Journal of Hepatology 43 (2005) 711–719 www.elsevier.com/locate/jhep Pathways for the regulation of body iron homeostasis in response to experimental iron overload Igor Theurl1, Susanne Ludwiczek1, Philipp Eller1, Markus Seifert1, Erika Artner2, Peter Brunner3,Gu¨nter Weiss1,* 1Department of General Internal Medicine, Clinical Immunology and Infectious Diseases, Medical University, Anichstr. 35, A-6020 Innsbruck, Austria 2Institute for Medical Chemistry, Medical University of Innsbruck, A-6020 Innsbruck, Austria 3Institute of Analytical Chemistry and Radiochemistry, University of Innsbruck, Innsbruck, Austria Background/Aims: Secondary iron overload is a frequent clinical condition found in association with multiple blood transfusions. Methods: To gain insight into adaptive changes in the expression of iron genes in duodenum, liver and spleen upon experimental iron overload we studied C57BL/6 mice receiving repetitive daily injections of iron-dextran for up to 5 days. Results: Iron initially accumulated in spleen macrophages but with subsequent increase in macrophage ferroportin and ferritin expression its content in the spleen decreased while a progressive storage of iron occurred within hepatocytes which was paralleled by a significant increase in hepcidin and hemojuvelin expression. Under these conditions, iron was still absorbed from the duodenal lumen as divalent metal transporter-1 expressions were high, however, most of the absorbed iron was incorporated into duodenal ferritin, while ferroportin expression drastically decreased and iron transfer to the circulation was reduced. Conclusions: Experimental iron overload results in iron accumulation in macrophages and later in hepatocytes. In parallel, the transfer of iron from the gut to the circulation is diminished which may be referred to interference of hepcidin with ferroportin mediated iron export, thus preventing body iron accumulation. q 2005 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. Keywords: Iron; Hemochromatosis; Iron absorption; Hepcidin; IRP 1. Introduction Secondary iron overload leads to progressive iron accumulation in the reticulo-endothelial system [1] with Secondary iron overload is a frequent clinical condition subsequent negative effects on cell mediated immune which can arise from inborn errors of haemoglobin function, since iron inhibits interferon-g inducible pathways synthesis, myelodysplastic syndromes or chemotherapy in macrophages [4]. Accordingly, subjects with secondary induced anaemia, which all require multiple blood transfu- iron overload are at a higher risk for tuberculosis and cancer sions [1,2]. In addition, an inherited form of secondary iron [3]. In being a catalyst for the formation of highly toxic overload is found in Southern Africa which has been linked radicals, iron overload leads to tissue damage and organ to a defect in duodenal iron transport together with the failure [5], which is well known in primary iron overload, consumption of iron rich traditional beer [3]. hereditary hemochromatosis, although with this condition iron is primarily deposited within parenchymal cells [6–8]. However, information of adaptive changes of body iron Received 29 November 2004; received in revised form 9 March 2005; homeostasis upon secondary or experimental iron overload accepted 17 March 2005; available online 13 June 2005 is rare. * Corresponding author. Tel.: C43 512 504 23255; fax: C43 512 504 25607. Maintenance of body iron homeostasis is mainly E-mail address: [email protected] (G. Weiss). regulated by duodenal iron absorption. Thereby, ferric 0168-8278/$30.00 q 2005 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jhep.2005.03.030 712 I. Theurl et al. / Journal of Hepatology 43 (2005) 711–719 iron is reduced at the luminal site by duodenal cytochrome b Animals used for experiments were all between 12 and 16 weeks of age, with an average weight of 25 g. For induction of iron overload animals were (Dcytb) [9], and ferrous iron is then transferred into the w daily intraperitoneally injected with 1 mg of iron dextran (venofer ) for up enterocyte by means of the transmembrane protein divalent to 5 days. metal transporter-1 (DMT-1) [10,11]. At the basolateral site Mice were anaesthetized, blood was collected by orbital puncture, and ferrous iron is exported from the enterocyte to the the animals were then sacrificed. Tissue samples were frozen in liquid nitrogen or fixed in formalin for immunohistochemistry. circulation via ferroportin [12–14], and after being oxidised by the membrane bound ferroxidase hephaestin [15] iron is incorporated into transferrin. In addition, up to 50% of 2.2. RNA extraction, northern blot analysis absorbed iron may be in the heme form, which is taken up and Real Time PCR by a yet not characterised duodenal heme receptor [16,17]. Total RNA was extracted from nitrogen frozen tissue samples using a The expression of these iron transport genes is strongly guanidinium–isothiocyanate–phenol–chloroform based procedure as pre- regulated by body iron homeostasis, since the duodenal viously described and subjected to northern blotting [43]. For hybridisation expression of DMT-1, Dcytb, ferroportin and to a lesser we generated radiolabelled cDNA probes applying the oligoprimer procedure using a 2.3 kb EcoRI insert of murine TfR1, a 1.8 kb EcoRI extent of hephaestin are increased with iron deficiency insert of murine DMT-1, a 650 bp EcoRI insert of murine ferroportin, a anaemia [9,11,15,18–22]. The presence of iron responsive 950 bp EcoRI insert of murine Dcytb,a 1.5 kb EcoRI insert of murine elements (IREs) within the untranslated regions of DMT-1 hephaestin, a 250 bp EcoRI insert of murine Hepcidin, a 900 bp EcoRI insert of murine HFE and a 1.9 kb HindIII insert of chicken beta actin of a and ferroportin mRNA suggested that the expression of PCR2.1 Vector. In parallel, quantitative PCR was carried out exactly as these proteins may be susceptible to posttranscriptional described [43]. The following primers (a, forward primer; b, reverse 0 regulation by iron regulatory proteins (IRP) [23]. However, primer) and TaqMan probes (c, TaqMan probe) were used: muTfR1: (a) 5 - CGCTTTGGGTGCTGGTG-30,(b)50-GGGCAAG TTTCAACAGAA transcriptional regulation of DMT-1 and ferroportin GACC-30, (c) 50-CCCACACTGGACTTCGCCGCA-30, muHFE: (a) 50- expression by iron has also been anticipated [24–26]. TCATGAGAGTCGCCGTGCT-30, (b) 50-GGCTTGAGGTTTG CTCCA- 0 0 0 In terms of regulation of duodenal iron absorption [27] 3 , (c) 5 -AGCCCAGGGCCCCGTGGAT-3 , muDMT-1(IRE-form): (a) 50-CCAGCCAGTAAGTTCAAGGATCC-30,(b)50-GCGTAGCAGCT transferrin receptor (TfR1) mediated uptake of circulating GATC TGGG-30, (c) 50-TGGCCTCGCGCCCCAACA-30, muFerropor- iron from the basolateral site of enterocytes and the tin:(a)50-CTACCATTAGAAGGATTGACCAGCT-30,(b)50- 0 0 subsequent modulation of IRP activity was believed to be CAAATGTCATA ATCTGGCCGA-3 , (c) 5 -CAACATCCTGGCCCC- CATGGC-30, muHepcidin: (a) 50-TGTCTCCTGCTTCTCCTCCTTG-30, the pivotal mechanism for sensing the body’s needs for iron (b) 50-AGCTCTGTA GTCTGTCTCATCTGTTGA-30, (c) 50-CAGCCT- to the enterocyte [16,17]. The membrane bound protein GAGCAGCACCACCTATCTCC-30. muDcytb:(a)50 -TCGCGG- 0 0 0 0 HFE which is mutated in approximately 80% of subjects TGACCGGCT-3 ,(b)5-TTCCAGGTCCATGGCAGTCT-3 ,(c)5- CGTCTTCATCCAGGGCATCGCC-30, muHephaestin:(a)50-TGG- with hereditary hemochromatosis [28], modulates the AACT ATGCTCCCAAAGGAA-30, (b) 50-CTGTTTTTGCCAGACTT affinity of transferrin for TfR1 but its role in iron absorption CAGGA-30, (c) 50-CAAATCAGACTCTCAACAATGACACAGTGGCT- 0 0 0 0 remains elusive [29]. Importantly, the recent identification 3 . muHemojuvelin: (a) 5 -GGT TTC GTC GGG AGC CA-3 , (b) 5 -TGG TAG ACT TTC TGG TCA ATG CA-30, (c) 50-CGC TAC CAC CAT CCG of the liver cationic peptide hepcidin has suggested that this GAA GAT CAC TAT CAT ATT-30, muTNFa: (a) 50-TTCTATGGCC- molecule may be the principal regulator of iron absorption. CAGACCCTCA-30, (b) 50-TTGCTACGACGTGGGCTACA-30, (c) 50- 0 [30–32]. The expression of hepcidin is increased when body CTCAGATCATCTTCTCAAAATTCGA GTGACAAGC-3 , muIL6: (a) 50-GAGGATACCACTCCCAACAGACC-30, (b) 50-AAGTGCATCATC iron stores are high [32–34]. Hepcidin over-expression GTTGTTCATACA-30, (c) 50-CAGAATTGCCATTGCACAA CTCTTT resulted in reduced duodenal iron uptake and the develop- TCTCA-30. ment of anaemia [33,35] while reduced hepcidin expression causes iron overload [36–39]. This, may be traced back to a 2.3. Iron regulatory protein activity direct interaction of hepcidin with ferroportin expression, thus affecting iron transfer from the duodenal enterocyte to Protein-extracts were prepared from nitrogen frozen tissue homogen- the circulation [40,41]. The liver derived protein hemoju- ized in cytoplasmic lysisbuffer (25 mM Tris–HCl pH 7.4, 40 mM KCl, 1% Triton X-100) containing 1 mg/ml of each aprotinin, leupeptin and velin may have additive effects to those of hepcidin [42]. phenylmethylsulfonyl flouride. For gel retardation assays a 32P-labelled In the study presented here, we used a mouse model of IRE probe was prepared [44], and the analysis of RNA/protein complexes experimental iron overload to study adaptive changes of was carried out by non-denaturing gel electrophoresis and subsequent auto- radiography as described [45]. iron transport molecules in duodenum, liver and spleen in order to get new insights into regulation of iron homeostasis upon secondary iron overload. 2.4. Western blotting For western blotting 20 mg of protein extracts, prepared as described for the gel retardation assay, were run either on a 10% (for TfR1) or a 15% (for ferritin and b-actin) SDS-polyacrylamide gel. Proteins were transferred 2. Material and methods onto a nylon membrane (Hybond-P, Amersham-Pharmacia, Vienna, Austria) and blocked in 1!TBS buffer containing 5% dry milk and 0.1% Tween (Merck, Vienna, Austria). The membrane was incubated either with 2.1. Animal care human anti-TfR1-antibody (0.5 mg/ml, Zymed, Vienna, Austria), human anti-ferritin-antibody (2 mg/ml, Dako, Vienna, Austria), murine anti-HFE- Male C57BL/6 mice were kept according to institutional and antibody (a generous gift by Dr M.