DOCSLIB.ORG

Pathways for the Regulation of Body Iron Homeostasis in Response to Experimental Iron Overload

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pathways for the Regulation of Body Iron Homeostasis in Response to Experimental Iron Overload Journal of Hepatology 43 (2005) 711–719 www.elsevier.com/locate/jhep Pathways for the regulation of body iron homeostasis in response to experimental iron overload Igor Theurl1, Susanne Ludwiczek1, Philipp Eller1, Markus Seifert1, Erika Artner2, Peter Brunner3,Gu¨nter Weiss1,* 1Department of General Internal Medicine, Clinical Immunology and Infectious Diseases, Medical University, Anichstr. 35, A-6020 Innsbruck, Austria 2Institute for Medical Chemistry, Medical University of Innsbruck, A-6020 Innsbruck, Austria 3Institute of Analytical Chemistry and Radiochemistry, University of Innsbruck, Innsbruck, Austria Background/Aims: Secondary iron overload is a frequent clinical condition found in association with multiple blood transfusions. Methods: To gain insight into adaptive changes in the expression of iron genes in duodenum, liver and spleen upon experimental iron overload we studied C57BL/6 mice receiving repetitive daily injections of iron-dextran for up to 5 days. Results: Iron initially accumulated in spleen macrophages but with subsequent increase in macrophage ferroportin and ferritin expression its content in the spleen decreased while a progressive storage of iron occurred within hepatocytes which was paralleled by a significant increase in hepcidin and hemojuvelin expression. Under these conditions, iron was still absorbed from the duodenal lumen as divalent metal transporter-1 expressions were high, however, most of the absorbed iron was incorporated into duodenal ferritin, while ferroportin expression drastically decreased and iron transfer to the circulation was reduced. Conclusions: Experimental iron overload results in iron accumulation in macrophages and later in hepatocytes. In parallel, the transfer of iron from the gut to the circulation is diminished which may be referred to interference of hepcidin with ferroportin mediated iron export, thus preventing body iron accumulation. q 2005 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. Keywords: Iron; Hemochromatosis; Iron absorption; Hepcidin; IRP 1. Introduction Secondary iron overload leads to progressive iron accumulation in the reticulo-endothelial system [1] with Secondary iron overload is a frequent clinical condition subsequent negative effects on cell mediated immune which can arise from inborn errors of haemoglobin function, since iron inhibits interferon-g inducible pathways synthesis, myelodysplastic syndromes or chemotherapy in macrophages [4]. Accordingly, subjects with secondary induced anaemia, which all require multiple blood transfu- iron overload are at a higher risk for tuberculosis and cancer sions [1,2]. In addition, an inherited form of secondary iron [3]. In being a catalyst for the formation of highly toxic overload is found in Southern Africa which has been linked radicals, iron overload leads to tissue damage and organ to a defect in duodenal iron transport together with the failure [5], which is well known in primary iron overload, consumption of iron rich traditional beer [3]. hereditary hemochromatosis, although with this condition iron is primarily deposited within parenchymal cells [6–8]. However, information of adaptive changes of body iron Received 29 November 2004; received in revised form 9 March 2005; homeostasis upon secondary or experimental iron overload accepted 17 March 2005; available online 13 June 2005 is rare. * Corresponding author. Tel.: C43 512 504 23255; fax: C43 512 504 25607. Maintenance of body iron homeostasis is mainly E-mail address: [email protected] (G. Weiss). regulated by duodenal iron absorption. Thereby, ferric 0168-8278/$30.00 q 2005 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.jhep.2005.03.030 712 I. Theurl et al. / Journal of Hepatology 43 (2005) 711–719 iron is reduced at the luminal site by duodenal cytochrome b Animals used for experiments were all between 12 and 16 weeks of age, with an average weight of 25 g. For induction of iron overload animals were (Dcytb) [9], and ferrous iron is then transferred into the w daily intraperitoneally injected with 1 mg of iron dextran (venofer ) for up enterocyte by means of the transmembrane protein divalent to 5 days. metal transporter-1 (DMT-1) [10,11]. At the basolateral site Mice were anaesthetized, blood was collected by orbital puncture, and ferrous iron is exported from the enterocyte to the the animals were then sacrificed. Tissue samples were frozen in liquid nitrogen or fixed in formalin for immunohistochemistry. circulation via ferroportin [12–14], and after being oxidised by the membrane bound ferroxidase hephaestin [15] iron is incorporated into transferrin. In addition, up to 50% of 2.2. RNA extraction, northern blot analysis absorbed iron may be in the heme form, which is taken up and Real Time PCR by a yet not characterised duodenal heme receptor [16,17]. Total RNA was extracted from nitrogen frozen tissue samples using a The expression of these iron transport genes is strongly guanidinium–isothiocyanate–phenol–chloroform based procedure as pre- regulated by body iron homeostasis, since the duodenal viously described and subjected to northern blotting [43]. For hybridisation expression of DMT-1, Dcytb, ferroportin and to a lesser we generated radiolabelled cDNA probes applying the oligoprimer procedure using a 2.3 kb EcoRI insert of murine TfR1, a 1.8 kb EcoRI extent of hephaestin are increased with iron deficiency insert of murine DMT-1, a 650 bp EcoRI insert of murine ferroportin, a anaemia [9,11,15,18–22]. The presence of iron responsive 950 bp EcoRI insert of murine Dcytb,a 1.5 kb EcoRI insert of murine elements (IREs) within the untranslated regions of DMT-1 hephaestin, a 250 bp EcoRI insert of murine Hepcidin, a 900 bp EcoRI insert of murine HFE and a 1.9 kb HindIII insert of chicken beta actin of a and ferroportin mRNA suggested that the expression of PCR2.1 Vector. In parallel, quantitative PCR was carried out exactly as these proteins may be susceptible to posttranscriptional described [43]. The following primers (a, forward primer; b, reverse 0 regulation by iron regulatory proteins (IRP) [23]. However, primer) and TaqMan probes (c, TaqMan probe) were used: muTfR1: (a) 5 - CGCTTTGGGTGCTGGTG-30,(b)50-GGGCAAG TTTCAACAGAA transcriptional regulation of DMT-1 and ferroportin GACC-30, (c) 50-CCCACACTGGACTTCGCCGCA-30, muHFE: (a) 50- expression by iron has also been anticipated [24–26]. TCATGAGAGTCGCCGTGCT-30, (b) 50-GGCTTGAGGTTTG CTCCA- 0 0 0 In terms of regulation of duodenal iron absorption [27] 3 , (c) 5 -AGCCCAGGGCCCCGTGGAT-3 , muDMT-1(IRE-form): (a) 50-CCAGCCAGTAAGTTCAAGGATCC-30,(b)50-GCGTAGCAGCT transferrin receptor (TfR1) mediated uptake of circulating GATC TGGG-30, (c) 50-TGGCCTCGCGCCCCAACA-30, muFerropor- iron from the basolateral site of enterocytes and the tin:(a)50-CTACCATTAGAAGGATTGACCAGCT-30,(b)50- 0 0 subsequent modulation of IRP activity was believed to be CAAATGTCATA ATCTGGCCGA-3 , (c) 5 -CAACATCCTGGCCCC- CATGGC-30, muHepcidin: (a) 50-TGTCTCCTGCTTCTCCTCCTTG-30, the pivotal mechanism for sensing the body’s needs for iron (b) 50-AGCTCTGTA GTCTGTCTCATCTGTTGA-30, (c) 50-CAGCCT- to the enterocyte [16,17]. The membrane bound protein GAGCAGCACCACCTATCTCC-30. muDcytb:(a)50 -TCGCGG- 0 0 0 0 HFE which is mutated in approximately 80% of subjects TGACCGGCT-3 ,(b)5-TTCCAGGTCCATGGCAGTCT-3 ,(c)5- CGTCTTCATCCAGGGCATCGCC-30, muHephaestin:(a)50-TGG- with hereditary hemochromatosis [28], modulates the AACT ATGCTCCCAAAGGAA-30, (b) 50-CTGTTTTTGCCAGACTT affinity of transferrin for TfR1 but its role in iron absorption CAGGA-30, (c) 50-CAAATCAGACTCTCAACAATGACACAGTGGCT- 0 0 0 0 remains elusive [29]. Importantly, the recent identification 3 . muHemojuvelin: (a) 5 -GGT TTC GTC GGG AGC CA-3 , (b) 5 -TGG TAG ACT TTC TGG TCA ATG CA-30, (c) 50-CGC TAC CAC CAT CCG of the liver cationic peptide hepcidin has suggested that this GAA GAT CAC TAT CAT ATT-30, muTNFa: (a) 50-TTCTATGGCC- molecule may be the principal regulator of iron absorption. CAGACCCTCA-30, (b) 50-TTGCTACGACGTGGGCTACA-30, (c) 50- 0 [30–32]. The expression of hepcidin is increased when body CTCAGATCATCTTCTCAAAATTCGA GTGACAAGC-3 , muIL6: (a) 50-GAGGATACCACTCCCAACAGACC-30, (b) 50-AAGTGCATCATC iron stores are high [32–34]. Hepcidin over-expression GTTGTTCATACA-30, (c) 50-CAGAATTGCCATTGCACAA CTCTTT resulted in reduced duodenal iron uptake and the develop- TCTCA-30. ment of anaemia [33,35] while reduced hepcidin expression causes iron overload [36–39]. This, may be traced back to a 2.3. Iron regulatory protein activity direct interaction of hepcidin with ferroportin expression, thus affecting iron transfer from the duodenal enterocyte to Protein-extracts were prepared from nitrogen frozen tissue homogen- the circulation [40,41]. The liver derived protein hemoju- ized in cytoplasmic lysisbuffer (25 mM Tris–HCl pH 7.4, 40 mM KCl, 1% Triton X-100) containing 1 mg/ml of each aprotinin, leupeptin and velin may have additive effects to those of hepcidin [42]. phenylmethylsulfonyl flouride. For gel retardation assays a 32P-labelled In the study presented here, we used a mouse model of IRE probe was prepared [44], and the analysis of RNA/protein complexes experimental iron overload to study adaptive changes of was carried out by non-denaturing gel electrophoresis and subsequent auto- radiography as described [45]. iron transport molecules in duodenum, liver and spleen in order to get new insights into regulation of iron homeostasis upon secondary iron overload. 2.4. Western blotting For western blotting 20 mg of protein extracts, prepared as described for the gel retardation assay, were run either on a 10% (for TfR1) or a 15% (for ferritin and b-actin) SDS-polyacrylamide gel. Proteins were transferred 2. Material and methods onto a nylon membrane (Hybond-P, Amersham-Pharmacia, Vienna, Austria) and blocked in 1!TBS buffer containing 5% dry milk and 0.1% Tween (Merck, Vienna, Austria). The membrane was incubated either with 2.1. Animal care human anti-TfR1-antibody (0.5 mg/ml, Zymed, Vienna, Austria), human anti-ferritin-antibody (2 mg/ml, Dako, Vienna, Austria), murine anti-HFE- Male C57BL/6 mice were kept according to institutional and antibody (a generous gift by Dr M.
Load more

Recommended publications
  • Iron Regulation by Hepcidin
    Iron regulation by hepcidin Ningning Zhao, … , An-Sheng Zhang, Caroline A. Enns J Clin Invest. 2013;123(6):2337-2343. https://doi.org/10.1172/JCI67225. Science in Medicine Hepcidin is a key hormone that is involved in the control of iron homeostasis in the body. Physiologically, hepcidin is controlled by iron stores, inflammation, hypoxia, and erythropoiesis. The regulation of hepcidin expression by iron is a complex process that requires the coordination of multiple proteins, including hemojuvelin, bone morphogenetic protein 6 (BMP6), hereditary hemochromatosis protein, transferrin receptor 2, matriptase-2, neogenin, BMP receptors, and transferrin. Misregulation of hepcidin is found in many disease states, such as the anemia of chronic disease, iron refractory iron deficiency anemia, cancer, hereditary hemochromatosis, and ineffective erythropoiesis, such as β- thalassemia. Thus, the regulation of hepcidin is the subject of interest for the amelioration of the detrimental effects of either iron deficiency or overload. Find the latest version: https://jci.me/67225/pdf Science in medicine Iron regulation by hepcidin Ningning Zhao, An-Sheng Zhang, and Caroline A. Enns Department of Cell and Developmental Biology, Oregon Health and Science University, Portland, Oregon, USA. Hepcidin is a key hormone that is involved in the control of iron homeostasis in the body. Physi- ologically, hepcidin is controlled by iron stores, inflammation, hypoxia, and erythropoiesis. The regulation of hepcidin expression by iron is a complex process that requires the coordination of multiple proteins, including hemojuvelin, bone morphogenetic protein 6 (BMP6), hereditary hemochromatosis protein, transferrin receptor 2, matriptase-2, neogenin, BMP receptors, and transferrin. Misregulation of hepcidin is found in many disease states, such as the anemia of chronic disease, iron refractory iron deficiency anemia, cancer, hereditary hemochromatosis, and ineffective erythropoiesis, such as β-thalassemia.
    [Show full text]
  • Iron Transport Proteins: Gateways of Cellular and Systemic Iron Homeostasis
    Iron transport proteins: Gateways of cellular and systemic iron homeostasis Mitchell D. Knutson, PhD University of Florida Essential Vocabulary Fe Heme Membrane Transport DMT1 FLVCR Ferroportin HRG1 Mitoferrin Nramp1 ZIP14 Serum Transport Transferrin Transferrin receptor 1 Cytosolic Transport PCBP1, PCBP2 Timeline of identification in mammalian iron transport Year Protein Original Publications 1947 Transferrin Laurell and Ingelman, Acta Chem Scand 1959 Transferrin receptor 1 Jandl et al., J Clin Invest 1997 DMT1 Gunshin et al., Nature; Fleming et al. Nature Genet. 1999 Nramp1 Barton et al., J Leukocyt Biol 2000 Ferroportin Donovan et al., Nature; McKie et al., Cell; Abboud et al. J. Biol Chem 2004 FLVCR Quigley et al., Cell 2006 Mitoferrin Shaw et al., Nature 2006 ZIP14 Liuzzi et al., Proc Natl Acad Sci USA 2008 PCBP1, PCBP2 Shi et al., Science 2013 HRG1 White et al., Cell Metab DMT1 (SLC11A2) • Divalent metal-ion transporter-1 • Former names: Nramp2, DCT1 Fleming et al. Nat Genet, 1997; Gunshin et al., Nature 1997 • Mediates uptake of Fe2+, Mn2+, Cd2+ • H+ coupled transporter (cotransporter, symporter) • Main roles: • intestinal iron absorption Illing et al. JBC, 2012 • iron assimilation by erythroid cells DMT1 (SLC11A2) Yanatori et al. BMC Cell Biology 2010 • 4 different isoforms: 557 – 590 a.a. (hDMT1) Hubert & Hentze, PNAS, 2002 • Function similarly in iron transport • Differ in tissue/subcellular distribution and regulation • Regulated by iron: transcriptionally (via HIF2α) post-transcriptionally (via IRE) IRE = Iron-Responsive Element Enterocyte Lumen DMT1 Fe2+ Fe2+ Portal blood Enterocyte Lumen DMT1 Fe2+ Fe2+ Fe2+ Fe2+ Ferroportin Portal blood Ferroportin (SLC40A1) • Only known mammalian iron exporter Donovan et al., Nature 2000; McKie et al., Cell 2000; Abboud et al.
    [Show full text]
  • Non-Commercial Use Only
    Veins and Lymphatics 2012; volume 1:e6 Ulcerated hemosiderinic three months previous to this therapy. Significant improvement in these injuries, Correspondence: Eugenio Brizzio and Alberto dyschromia and iron deposits with a reduction in the dimensions of the Lazarowski, San Martín 965, 1st floor (Zip code within lower limbs treated brown spot (9 of 9) at Day 90, and complete 1004) Buenos Aires, Argentina. with a topical application scarring with a closure time ranging from 15 Tel. +54.11.4311.5559. to 180 days (7 of 9) were observed. The use of E-mail: [email protected]; of biological chelator [email protected]; topical lactoferrin is a non-invasive therapeu- [email protected]; tic tool that favors clearance of hemosiderinic 1 2 [email protected] Eugenio Brizzio, Marcelo Castro, dyschromia and scarring of the ulcer. The 3 2 Marina Narbaitz, Natalia Borda, success of this study was not influenced Key words: ulcerated haemosiderinic dyschro- Claudio Carbia,2 Laura Correa,4 either by the hemochromatosis genetics or mia, liposomal Lactoferrin, scarring, hemo- Roberto Mengarelli,5 Amalia Merelli,2 the iron metabolism profile observed. siderin-ferritin. Valeria Brizzio,2 Maria Sosa,6 Acknowledgments: the authors would like to Biagio Biancardi,7 Alberto Lazarowski2 thank P. Girimonte for her assistance with the statistical analysis of the results. We also wish to Introduction thank the patients who made this study possible. 1International Group of Compression and Conference presentation: part of the present Argentina Medical Association, Buenos Chronic venous insufficiency (CVI) is one of study has been presented at the following con- 2 Aires, Argentina; Department of Clinical the most significant health problems in devel- gresses: i) XX Argentine Congress of Hematology, Biochemistry, Institute of oped countries.
    [Show full text]
  • Ferroportin Mutation in Autosomal Dominant Hemochromatosis: Loss of Function, Gain in Understanding
    Ferroportin mutation in autosomal dominant hemochromatosis: loss of function, gain in understanding Robert E. Fleming, William S. Sly J Clin Invest. 2001;108(4):521-522. https://doi.org/10.1172/JCI13739. Commentary Normal iron homeostasis requires close matching of dietary iron absorption with body iron needs (1). Hereditary hemochromatosis (HH), a common abnormality of iron metabolism, is characterized by excess absorption of dietary iron despite elevated stores, and secondary damage to the liver, pancreas, and other organs (2). Classic HH is caused by mutation of the HFE gene and is inherited as an autosomal recessive trait. However, a substantial percentage of individuals with hemochromatosis, especially in non–Northern European populations, have no mutations in HFE (3). Many such cases differ from classic HH in the relative distribution of iron between the plasma, hepatocytes, and reticuloendothelial (RE) cells (4). Pietrangelo et al. recently reported a pedigree with atypical hemochromatosis inherited as an autosomal dominant trait (5). In this issue of the JCI, Montosi et al. report the surprising finding that the gene mutated in these patients (SLC11A3) encodes the iron export protein ferroportin1 (also known as IREG1, or MTP1) (6). They conclude that the identified mutation (A77D) probably results in loss of ferroportin1 function, suggesting that the affected individuals are haploinsufficient for this gene product. In a nearly simultaneous report, Njajou et al. (7) describe a similar pedigree with autosomal dominant hemochromatosis and a different missense mutation (N144H) in the same gene. Njajou et al., however, conclude that the iron overload phenotype was likely […] Find the latest version: https://jci.me/13739/pdf Ferroportin mutation in autosomal Commentary dominant hemochromatosis: loss See related article, pages 619–623.
    [Show full text]
  • Simple Technique to Identify Haemosiderin in Immunoperoxidase Stained Sections
    J Clin Pathol: first published as 10.1136/jcp.37.10.1190 on 1 October 1984. Downloaded from 1190 Technical methods Phosphate buffer at pH 8*0 gave the sharpest 2 Rozenszajn L, Leibovich M, Shoham D, Epstein J. The esterase staining reactions, although there was little differ- activity in megaloblasts, leukaemic and normal haemopoietic cells. Br J Haematol 1968; 14:605-19. ence at pH 7-0 or pH 7-5. As the buffer pH was 3Hayhoe FGJ, Quaglino D. Haematological cytochemistry. Edin- increased above pH 8-0 staining with both substrates burgh: Churchill Livingstone, 1980. became progressively weaker, especially above pH 4Li CY, Lam KW, Yam LT. Esterases in human leucocytes. J 9.0. Below pH 7-0 staining with a-naphthyl butyrate Histochem Cytochem 1973;21:1-12. Yam LT, Li CY, Crosby WH. Cytochemical identification of became weaker, and below pH 5*0 staining with monocytes and granulocytes. Am J Clin Pathol 1971;55:283- naphthol AS-D chloroacetate began to disappear. 90. 6 Armitage RJ, Linch DC, Worman CP, Cawley JC. The morphol- This work was supported by a Medical Research ogy and cytochemistry of human T-cell subpopulations defined by monoclonal antibodies and Fc receptors. Br J Haematol Council project grant. I thank Professor FGJ 1983;51:605-13. Hayhoe for valuable advice. References Requests for reprints to: Dr DM Swirsky, Department of Gomori G. Chloroacyl esters as histochemical substrates. J His- Haematological Medicine, University Clinical School, Hills tochem Cytochem 1953;1:469-70. Road, Cambridge CB2 2QL, England. Simple technique to identify identification of the two compounds on the same haemosiderin in slide.
    [Show full text]
  • Curriculum Vitae
    CURRICULUM VITAE PART I: General Information DATE PREPARED: 1/2018 Name: KARL TIMOTHY KELSEY 70 Ship Street, G-E3, Department of Epidemiology and Pathology and Lab. Office Address: Medicine, Providence, RI 02912 Home Address: 57 Toxteth Street, Brookline, MA 02446 Work E-mail: [email protected] Work FAX: (401) 863-5132 Place of Birth: Minneapolis, Minnesota Education: 1976 B.A., Physics University of Minnesota, Minneapolis, MN 1981 M.D., Medicine University of Minnesota, Minneapolis, MN 1984 M.O.H, Occupational Health Harvard University, Boston, MA Postdoctoral Training: 1981–1982 Resident Diagnostic Radiology Mt. Zion Hospital and Medical Center, San Francisco, CA 1982–1983 Postdoctoral Fellow Environmental Pathology Laboratory of Environmental Pathology University of Minnesota Medical School Minneapolis, Minnesota 1983–1985 Resident Occupational Medicine Harvard School of Public Health, Boston, MA 1985–1987 Postdoctoral Fellow Environmental Carcinogenesis Laboratory of Radiobiology Harvard School of Public Health Boston, Massachusetts Licensure and Certification: 1982 Minnesota Medical License (inactive by choice) 1984 Massachusetts Medical License (inactive by choice) 1986 Board Certification, American Board of Preventive Medicine – Occupational Medicine Academic Appointments: 1986–1987 Lecturer of Community Medicine Tufts University School of Medicine 1987–1991 Assistant Professor of Occupational Medicine Harvard School of Public Health 1988–1991 Assistant Professor of Radiobiology Harvard School of Public Health 1991–1998 Associate Professor of Occupational Medicine Harvard School of Public Health 1991–1998 Associate Professor of Radiobiology Harvard School of Public Health 1995–2007 Associate Physician of Channing Laboratory Brigham and Women’s Hospital 1995–2007 Associate Professor of Medicine Harvard Medical School 1998–2007 Professor of Cancer Biology & Environmental Health Harvard School of Public Health 2007-pres.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Duodenal Mrna Expression of Iron Related Genes in Response To
    648 SMALL INTESTINE Duodenal mRNA expression of iron related genes in Gut: first published as 10.1136/gut.51.5.648 on 1 November 2002. Downloaded from response to iron loading and iron deficiency in four strains of mice F Dupic, S Fruchon, M Bensaid, O Loreal, P Brissot, N Borot, M P Roth, H Coppin ............................................................................................................................. Gut 2002;51:648–653 Background: Although much progress has been made recently in characterising the proteins involved in duodenal iron trafficking, regulation of intestinal iron transport remains poorly understood. It is not known whether the level of mRNA expression of these recently described molecules is genetically regu- lated. This is of particular interest however as genetic factors are likely to determine differences in iron status among mouse strains and probably also contribute to the phenotypic variability seen with disrup- tion of the haemochromatosis gene. Aims: To investigate this issue, we examined concomitant variations in duodenal cytochrome b (Dcytb), divalent metal transporter 1 (DMT1), ferroportin 1 (FPN1), hephaestin, stimulator of Fe trans- port (SFT), HFE, and transferrin receptor 1 (TfR1) transcripts in response to different dietary iron contents in the four mouse strains C57BL/6, DBA/2, CBA, and 129/Sv. See end of article for authors’ affiliations Subjects: Six mice of each strain were fed normal levels of dietary iron, six were subjected to the same ....................... diet supplemented with
    [Show full text]
  • Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened.
    [Show full text]
  • Essential Trace Elements in Human Health: a Physician's View
    Margarita G. Skalnaya, Anatoly V. Skalny ESSENTIAL TRACE ELEMENTS IN HUMAN HEALTH: A PHYSICIAN'S VIEW Reviewers: Philippe Collery, M.D., Ph.D. Ivan V. Radysh, M.D., Ph.D., D.Sc. Tomsk Publishing House of Tomsk State University 2018 2 Essential trace elements in human health UDK 612:577.1 LBC 52.57 S66 Skalnaya Margarita G., Skalny Anatoly V. S66 Essential trace elements in human health: a physician's view. – Tomsk : Publishing House of Tomsk State University, 2018. – 224 p. ISBN 978-5-94621-683-8 Disturbances in trace element homeostasis may result in the development of pathologic states and diseases. The most characteristic patterns of a modern human being are deficiency of essential and excess of toxic trace elements. Such a deficiency frequently occurs due to insufficient trace element content in diets or increased requirements of an organism. All these changes of trace element homeostasis form an individual trace element portrait of a person. Consequently, impaired balance of every trace element should be analyzed in the view of other patterns of trace element portrait. Only personalized approach to diagnosis can meet these requirements and result in successful treatment. Effective management and timely diagnosis of trace element deficiency and toxicity may occur only in the case of adequate assessment of trace element status of every individual based on recent data on trace element metabolism. Therefore, the most recent basic data on participation of essential trace elements in physiological processes, metabolism, routes and volumes of entering to the body, relation to various diseases, medical applications with a special focus on iron (Fe), copper (Cu), manganese (Mn), zinc (Zn), selenium (Se), iodine (I), cobalt (Co), chromium, and molybdenum (Mo) are reviewed.
    [Show full text]
  • The Soluble Form of HFE Protein Regulates Hephaestin Mrna Expression in the Duodenum Through an Endocytosis-Dependent Mechanism
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1842 (2014) 2298–2305 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis The soluble form of HFE protein regulates hephaestin mRNA expression in the duodenum through an endocytosis-dependent mechanism Bruno Silva a, Joana Ferreira a,VeraSantosa, Cilénia Baldaia b, Fátima Serejo b, Paula Faustino a,⁎ a Departamento de Genética Humana, Instituto Nacional de Saúde Dr. Ricardo Jorge, Lisboa, Portugal b Departamento de Gastroenterologia e Hepatologia, Hospital de Santa Maria, Centro Hospitalar Lisboa Norte, Lisboa, Portugal article info abstract Article history: Dietary iron absorption regulation is one of the key steps for the maintenance of the body iron homeostasis. Received 6 December 2013 HFE gene expression undergoes a complex post-transcriptional alternative splicing mechanism through which Received in revised form 25 June 2014 two alternative transcripts are originated and translated to a soluble HFE protein isoform (sHFE). The first pur- Accepted 15 July 2014 pose of this study was to determine if sHFE transcript levels respond to different iron conditions in duodenal Available online 27 July 2014 and macrophage cell models. In addition, we aimed to determine the functional effect of the sHFE protein on Keywords: the expression of iron metabolism-related genes in a duodenal cell model as well as, in vivo, in duodenum biopsy Alternative splicing samples. Iron metabolism Levels of sHFE transcripts were measured in HuTu-80, Caco-2, HT-29 and activated THP1 cells, after holo-Tf Enterocyte stimulus, and in total RNA from duodenum biopsies of functional dyspepsia patients.
    [Show full text]
  • Publications 2002 Agarwal, R., Peters, T.J., Coombes, R.C., Vigushin, D.M
    Publications 2002 Agarwal, R., Peters, T.J., Coombes, R.C., Vigushin, D.M. Tamoaxifen-related porphyria cutanea tarda. Medical Oncology. 19, 121-124 (2002) Anderson GJ, Frazer DM, McKie AT, Vulpe CD. The ceruloplasmin homolog hephaestin and the control of intestinal iron absorption. Blood Cells Mol Dis. 2002 Nov-Dec;29(3):367-75. Anderson GJ, Frazer DM, Wilkins SJ, Becker EM, Millard KN, Murphy TL, McKie AT, Vulpe CD. Relationship between intestinal iron-transporter expression, hepatic hepcidin levels and the control of iron absorption. Biochem Soc Trans. 2002 Aug;30(4):724-6. Anderson GJ, Frazer DM, McKie AT, Wilkins SJ, Vulpe CD. The expression and regulation of the iron transport molecules hephaestin and IREG1: implications for the control of iron export from the small intestine. Cell Biochem Biophys. 2002;36(2- 3):137-46. Review. Cremonesi, P., Acebron, A., Raja, K.B., & Simpson, R.J. Iron absorption: Biochemical and molecular insights into the importance of iron species for intestinal uptake. Pharmacol Toxicol, 91, 97-102 (2002) Desouky M, Jugdaohsingh R, McCrohan CR, White KN, Powell JJ. Aluminium- Dependent Regulation of Intracellular Silicon in the Aquatic Invertebrate Lymnaea stagnalis Proc. Natl. Acad. Sci. 2002;99:3394-3399. Evans RW, Hider RC & Wrigglesworth JM. (2002). Biometals 2002: Third International Biometals Symposium, Biochemical Society Transactions 30, 669-783. Evans, R.W.& Oakhill, J.S. (2002) Transferrin-mediated iron acquisition by pathogenic Neisseria. Biochemical Society, 30, 705-707. Frazer DM, Wilkins SJ, Becker EM, Vulpe CD, McKie AT, Trinder D, Anderson GJ. Hepcidin expression inversely correlates with the expression of duodenal iron transporters and iron absorption in rats.
    [Show full text]