A Study of the Role of Transcription Factors And

A STUDY OF THE ROLE OF TRANSCRIPTION FACTORS AND

CHROMATIN REMODELING IN THE

ACTIVATION/REPRESSION OF THE HUMAN GROWTH

HORMONE/CHORIONIC SOMATOMAMMOTROPIN GENES

XIAO YANG YANG

A Thesis Submitted to the Faculty of Graduate Studies of the University of

Manitoba in Partial Fulfillment of Requirements for The Degree of

DOCTOR OF PHILOSOPHY

Department of Physiology

University of Manitoba

Winnipeg, Manitoba

CANADA

395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada

Your file Votre reference ISBN: 978-0-494-64297-9 Our file Notre reference ISBN: 978-0-494-64297-9

NOTICE: AVIS:

The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduce, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.

The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.

In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.

While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.

••I Canada THE UNIVERSITY OF MANITOBA

FACULTY OF GRADUATE STUDIES

A Study of the Role of Transcription Factors and Chromatin

Remodeling in the Activation/Repression of the Human Growth

Hormone/Chorionic Somatomammotropin Genes

Xiaoyang Yang

A Thesis/Practicum submitted to the Faculty of Graduate Studies of The University of

Manitoba in partial fulfillment of the requirement of the degree

Doctor of Philosophy

Permission has been granted to the University of Manitoba Libraries to lend a copy of this thesis/practicum, to Library and Archives Canada (LAC) to lend a copy of this thesis/practicum, and to LAC's agent (UMI/ProQuest) to microfilm, sell copies and to publish an abstract of this thesis/practicum.

This reproduction or copy of this thesis has been made available by authority of the copyright owner solely for the purpose of private study and research, and may only be reproduced and copied as permitted by copyright laws or with express written authorization from the copyright owner. ABSTRACT

A multi-cellular organism is composed of many kinds of tissues/cell types. Each cell type performs distinct biological and/or physiological functions, but all carry identical genetic information. Cellular differentiation and organ development are the consequences of differential gene expression patterns, often termed tissue/cell type- specific gene expression. Understanding the molecular mechanisms that contribute to tissue-specific gene expression is a fundamental question in modern biology. The human growth hormone / chorionic somatomammotropin (hGH/CS) gene family consists of five structurally related genes coding for pituitary GH (GH-N), placental chorionic somatomammotropin (CS-A, CS-B and CS-L) and placental GH-variant (GH-V).

Despite sharing greater than 90 % sequence similarity between the GH/CS genes, GH-N is expressed specifically in pituitary somatotrophs, while CS genes and GH-V are expressed preferentially in placental trophoblasts. Elegant transgenic mouse studies have implicated a region 14.4 - 32 kilobases upstream of the GH-N gene, which contains five nuclease hypersensitive sites in pituitary and/or placenta chromatin. This region has been defined as the locus control region (LCR) and plays an essential role in hGH/CS expression. The preferential expression of hGH/CS family members in pituitary and placenta makes the hGH/CS gene locus an important model system to investigate mechanisms that regulate tissue-specific gene expression. The functional involvement of histone post-translational modifications in gene expression is well documented. As a major regulatory component, chromatin modification status along the hGH/CS locus was previously assessed in either human GH-secreting pituitary adenoma samples or transgenic mouse pituitaries with hyper-stimulation via GH releasing hormone. It was hypothesized that hyper-stimulation would affect the post- translational modification of histones along the GH/CS locus. In this thesis, histone modifications along the hGH/CS locus, including histone H4 hyperacetylation as well as

H3 lysine (K) 4 methylation, were assessed for the first time in human pituitary tissues taken post mortem. Using the chromatin immunoprecipitation (ChIP) assay to assess protein/DNA interactions in situ, the LCR appears to be widely modified by both histone

H4 hyperacetylation and H3K4 methylation, indicating their functional involvement in regulating pituitary gene expression. These modifications are also detected at the GH-N but not the CS promoter region, which is consistent with the distinct expression pattern for GH-N versus CS genes in the pituitary.

Pituitary-specific expression of GH-N is largely under the control of a remote LCR encompassing five hypersensitive sites (HS I/II-HS V). Binding of the pituitary-specific transcription factor Pit-1 to HS I/II is required for efficient pituitary-specific GH-N expression in vivo. However, the process by which Pit-1 gains access to HS I/II remains unclear. It was hypothesized that Pit-1 could induce chromatin remodeling in the LCR, resulting in activation of HS I/II and eventually, contribute to GH-N gene activation.

Using human embryonic kidney (HEK) 293 cells overexpressing wild type and mutant

Pit-1 proteins as a model system, the consequences after Pit-1 appearance in these cells

ii were assessed. Addition of Pit-1 resulted in increased DNA accessibility at HS III in a

POU-homeodomain dependent manner, as reflected by effects on histone H4 hyperacetylation and increased RNA polymerase II activity in the nearby region.

Assessment of protein/DNA interactions in vitro revealed that direct Pit-1 binding to HS

III is not supported by EMSA analysis. However, Pit-1 associates with HS III through indirect interaction via Elk-1, a member of the ETS family of transcription factors, as suggested through co-immunoprecipitation studies using human pituitary proteins.

Furthermore, Elk-1 was identified as a co-factor which partners with Pit-1 to stimulate endogenous GH-N RNA levels in the HEK293 cells. These observations are consistent with a role for a Pit-1/ETS protein interaction and the constitutively open HS III in chromatin remodelling and the activation of the GH LCR.

Despite the extensive sequence homology and the presence of Pit-1 DNA elements in the promoter regions, the placental CS/GH-V genes and GH-N are expressed in a mutually exclusive way in the pituitary, to the extent that not even a basal level of placental hormone expression is detected. An active mechanism of repression was hypothesized to explain the lack of placental CS/GH-V expression in the pituitary, based on the observations: (i) all five hGH/CS genes share a common structure in pituitary chromatin, and (ii) the CS-A promoter is active and responsive to Pit-1 binding in transfected rat pituitary GC cells. A conserved P sequence, located upstream of each placental expressed gene but absent from the GH-N gene, was considered an excellent candidate to be involved in pituitary repression of the placental CS/GH-V genes. The repressor activity of P sequences (263P) was suggested by the ability to repress CS-A gene

iii promoter activity in transfected rat pituitary GC cells. Two sub-fragments of263P, PSE-

A and PSE-B, were identified as protein-binding regions with repressor activity.

However, when a 103P fragment, containing complete PSE-A and PSE-B sequences, was assessed for repressor activity in transfected rat pituitary GC cells, it was unable to repress the CS-A promoter activity. Thus, it was hypothesized that sequence information outside of PSE-A and PSE-B but contained within the remaining 263P was required for pituitary repression. An additional P sequence element that contributes to the repressor activity of 263P in transfected rat pituitary GC cells, designated as PSE-C, was identified downstream of PSE-A. The hepatocyte nuclear factor (HNF)-3a was identified as the

PSE-C associated factor, and shown to participate in the repressor complex formed on

263P. In addition, the functional involvement of Pit-1 in the pituitary-repression activity of P sequences was also explored. A possible mechanism is proposed for pituitary repression with HNF-3 acting as a "bridge" stabilizing the repressor complex on 263P, and interfering with Pit-1 function. Alternatively, changes in chromatin structure during the activation process of GH-N promoter through Pit-1 binding to LCR, as a consequence, may also interfere with necessary modifications required for expression on the CS promoters, and eventually, resulting in the lack of gene expression.

Studies from this thesis reveal a functional involvement for both transcription factors and chromatin remodeling in the activation and/or repression of the human GH/CS genes in the pituitary. Indeed, the pituitary-specific transcription factor Pit-1, may have a dual role in both GH-N activation, as well as the placental CS/GH-V repression in the pituitary.

iv ACKNOWLEDGEMENT

I would first like to thank Dr. Peter A. Cattini, my supervisor and mentor. I am truly thankful for all that you have done for me for the whole process of my graduate studies.

Your passion and dedication on science clearly opened my mind in research. Thank you for your constant support, assist, encouragement, guidance, as well as patience for so many years. Thank you for having faith in me, and always inspiring me with your positive attitude. Thank you for holding my hands and leading me to this amazing field where I can always dream for impossible dreams. Things I learned from you will not only benefit me as a research scientist, but also affect my life in a positive way.

I would like to give special thanks to my advisory committee members, including Dr.

Janice G. Dodd, Dr. Mary Lynn Duckworth and Dr. Barbara Triggs-Raine. Thank you for providing me with your invaluable knowledge and experiences in my study. The continual guidance and support from you has been one of the major strength that leads me to the completion of my degree. I would also like to extend thanks to the external examiner, Dr. Robert J. Matusik, and members of my advisory committee for reviewing my doctoral thesis in an expedient manner. I would like to thank my colleagues in the "Cattini Lab", especially Marge (the "actual" lab manager), Yan (the technical "God"), and Lisa (my first "mentor" in Cattini lab).

You guys taught me hand by hand when I first started, and it will be impossible for me to finish my study without your help, support and encouragement. I would like to give special thanks to Dr. Mark Nachtigal, a former Cattini Lab member, for a lot of invaluable suggestions and discussions. As well as other members in Cattini Lab (past and present members), Karen, Shunyan, Farah, Pat, Aris, David (Sontag), Sarah, Kevin,

Jamit, Scott, David (Chan), Alina and Hana. Thank you all for your support throughout the years. I feel proud and honoured as a part of Cattini Lab, always.

I would like to thank my friends at the Molecular Endocrinology group, University of

Manitoba, Agnes, Arzu, Jun (Liu), Jacque, Eun Ran, Nicole, Peisun, Hugo, Yan (Hai) for their endless support. I would also like to thank Gail, Judy as well as other members of the Department of Physiology for their support and encouragement throughout the years.

Thanks are also extended to my family. My husband, Huaiyu, who is always there, supporting me, and also reminding me my obligation not only as a researcher, but also as a wife and a mother. My daughter, Tracy Joy, who is the best gift for me from the God, making me a "real" person. Nothing will be impossible for me as long as I have you two standing by my side, in past, present, and in future. Finally, I'd like to thank the Department of physiology, the Graduate Studies of the

University of Manitoba, Natural Sciences and Engineering Research Council of Canada,

Manitoba Institute of Children's Health, Canadian Institutes of Health Research (CIHR) for providing me with financial support during my studies.

Vll TABLE OF CONTENTS

CHAPTER 1: INTRODUCTION

1.1 Tissue-specific Gene Expression. 1

1.1.1 Chromatin Structure. 2

1.1.2 The Activation of Gene Expression. 4

i) Chromatin Remodeling. 4

ii) Assembly of Molecular Machinery at Appropriate 6

DNA Regulatory Elements,

iii) Locus Control Region (LCR). 7

1.1.3 The Human Growth Hormone (GH) /Chorionic 9

Somatomammotropin (CS) Gene Family Represents

a Unique Model to Investigate the Molecular Mechanisms

Involved in Tissue/Cell-specific Gene Expression.

1.1.4 Histone Post-translational Modification is one of the Major 12

Regulatory Components Involved in the hGH/CS Gene

Regulation.

1.2 Transcriptional Regulation of the GH-N Expression in the 14

viii Pituitary.

1.2.1 The Pituitary-specific Transcription Factor Pit-1. 13

1.2.2 The Upstream Locus Control Region (LCR). 17

1.3 Transcriptional Regulation of the Placental GH/CS Genes 21

in the Pituitary: a Case For Pituitary Repression.

1.3.1 A Possible Repression Mechanism for the Placental 22

Members of hGH/CS Genes in the Pituitary.

1.3.2 P Sequences and Associated Factors. 24

1.4 Research Objectives. 25

CHAPTER 2: MATERIALS AND METHODS

2.1 Materials. 28

2.1.1 Antibodies. 28

2.1.1a CCAAT/Enhancer Binding Protein (C/EBP) 28

2.1.1b C-Myc 29

2.1.1c ETS Family Members 29

2.1.Id Hepatocyte Nuclear Factor-3 (HNF-3) 29

IX 2.Lie Nuclear Factor-1 (NF-1) 30

2.1.If Pit-1 31

2.1.lg Regulatory Factor XI (RFX1) 31

2.1.1h Histone Covalent Modifications 31

i) Hyperacetylated Histone H4 31

ii) Di-Methyl-Histone H3 Lys (K) 4 32

iii) Tri-Methyl-Histone H3 Lys (K) 4 32

2.1.2 Cell Lines. 32

2.1.3 Human Pituitary Tissue Samples. 33

2.1.4 Other Nuclear Extract/Protein Samples. 33

i) LNCaP Nuclear Extract 33

ii) Recombinant Pit-1 Protein 34

2.1.5 Oligonucleotides. 34

2.2 Methods. 38

2.2.1 (3-Galactosidase Staining. 38

2.2.2 Chromatin Immunoprecipitation (ChIP) Assay. 38

i) Human Pituitary ChIP Assay. 38

ii) HEK293 ChIP Assay. 41

2.2.3 Electrophoresis Mobility Shift Assay (EMSA). 42

i) Preparation of Nuclear Extracts. 42 ii) DNA and Protein Interaction and Native Gel 43

Electrophoresis.

2.2.4 Gene Transfer and Reporter Gene (Luciferase) Assay. 44

i) Transient Transfection by Calcium Phosphate/DNA 44

Precipitation,

ii) "Mirus" Trans-IT293 Kit. 45

iii) Luciferase Assay. 46

2.2.5 Immunoprecipitation and Protein (Western) Blotting. 46

i) Immunoprecipitation (IP). 46

ii) Universal Magnetic Co-IP Kit. 47

iii) Protein (Western) Blotting. 48

iv) DNA Affinity Purification. 49

2.2.6 DNA Accessibility Assay. 49

2.2.7 Plasmid Constructs. 51

i) Hybrid Reporter Constructs. 51

ii) Expression Vectors. 53

2.2.8 Plasmid Transformation and Isolation. 53

i) Plasmid Transformation. 53

ii) Plasmid Isolation. 54

2.2.9 Quantitative Real-time PCR (qRT-PCR). 54

2.2.10 RNA. 55

XI i) RNA Isolation. 55

ii) RNA (Northern) Blotting. 55

2.2.11 Sequence Analysis. 56

2.2.12 Statistical Analysis. 57

CHAPTER 3: Analysis of Histone Covalent Modifications of the 58

Human Growth Hormone / Chorionic Somatomammotropin (hGH/CS)

Gene Locus in Human Pituitary Tissue.

3.1 Histone H4 Hyperacetylation of the hGH/CS Locus in Human 60

Pituitary.

3.2 Histone H3K4 Methylation of the hGH/CS Locus in Human 65

Pituitary.

CHAPTER 4: Transcription Factor Pit-1 and Elk-1 Participate 70 in a Common Complex that May Contribute to Human GH-N Gene

Activation.

Xll 1 Characterization of The HEK293/Pit-1 Model System. 72

4.1.1 Transient Transfection in HEK293 Cells Using "Trans-IT293" 72

Reagent Yields High Transfection Efficiency.

4.1.2 Assessment of Endogenous GH-N RNA Expression in 74

HEK293 Cells.

4.1.3 The cMyc-tag does not Affect the DNA-binding Capacity. 76

4.1.4 Pit-1 Expressed In HEK293 Cells is Capable of Associating 78

With Pit-1 Binding Sites In Vitro.

4.1.5 C-Myc-Pit-1 Expressed In HEK293 Cells Can Tram-activate 80

a Reporter Gene via Association with A HS I/II Fragment.

4.1.6 Pit-1 Expression in HEK293 Cells Induces Histone H4 82

Hyperacetylation around HS III within the Locus Control

Region.

4.1.7 The Chromatin Remodeling Induced by Pit-1 Expression in 85

HEK293 Cells Results in Local Increased Chromatin

Accessibility to RNA Polymerase II.

2 An Attempt to Address the Mechanism of Chromatin Remodelling 89

Induced by Pit-1 at HS III in HEK293 Cells.

4.2.1 Pit-1 Mutation Constructs and Expressions. 89

4.2.2 Both POU-Homeo and POU-Specific Domains are Required 92 for Appropriate DNA-binding Ability of Pit-1 In Vitro.

A.23 Assessment of the Ability of Pit-1 Mutants to Trans-activate 93

Promoter Activity in Transiently Transfected HEK293 Cells.

4.2.4 Chromatin Remodeling Induced by Pit-1 Expression in the 96

HEK293 Cells at HS III Requires Both the POU Homeo-

domain and Amino-terminal Tram-activation Domain.

4.2.5 Accessibility of DNA to RNA Polymerase II Induced by 99

Pit-1 Expression in the HEK293 Cells Depends on an Intact

POU Homeodomain.

4.3 Evidence does not Support a Direct Association Between Pit-1 103

and DNase-I Hypersensitive Sites III (HS III).

4.3.1 Sequence Analysis of HS III Reveals Four potential Oct-1 103

Binding Sites.

4.3.2 Recombinant Pit-1 Protein do not Associate with Possible 105

Oct-1 Sites in HS III.

4.3.3 HEK293 Cells Contain Endogenous Oct-1. 107

4.3.4 No Specific Protein-binding Complexes were Detected at 109

the HS III Oct-1-Like Elements in the Transfected HEK293

Cells.

4.3.5 Both the Endogenous Oct-1 and the Expressed Pit-1 113

XIV Proteins Associate with the Consensus Oct-1 DNA-Binding

Element.

4.3.6 The Oct-1 Sites from HS III do not Associate with the 117

Expressed Pit-1 in HEK293 Cells.

4 Evidence that the POU Homeodomain-Dependent Action in 119

HEK293 Cells is Mediated by Association with a Member of

the ETS Family of Transcription Factors, Elk-1.

4.4.1 Direct Protein-Protein Association Between Pit-1 and Elk-1 119

is Observed in the HEK293/Pit-1 Cell System.

4.4.2 Evidence that HS III Sequences with an Intact ETS Binding 122

Site is Required for the Association Between Pit-1 and Elk-1.

4.4.3 Evidence that the POU-Homeo domain Plays a Role in the 125

Association between Pit-1 and Elk-1.

4.4.4 Direct Association between Pit-1 and ETS Family Members 127

is Observed in Human Pituitary Tissues In Situ.

5 GH-N Gene Activation is Induced by Co-transfection of Pit-1 131

and Elk-1 in HEK293 Cells.

4.5.1 Pit-1 Specifically Increases Endogenous hGH-N Gene 131

Expression in Transfected HEK293 Cells. 4.5.2 Pit-1 Increases HS III Enhancer Activity in the Presence of 133

Intact Elk-1 Binding Site.

CHAPTER 5: Identification of the Hepatocyte Nuclear Factor-3a 139 as a Component in Pituitary Repressor Complexes Formed at the P

Sequences of the Human Growth Hormone /Chorionic

Somatomammotropin Locus.

5.1 Functional Assessment of an Additional Potential P Sequence 141

Element (PSE).

5.1.1 Sequence Outside of the PSE-A and PSE-B has the 141

Capacity to Further Repress CS-A Promoter Activity

In Vitro.

5.1.2 Sequences Downstream of 103P Contain Putative Binding 143

Sites for Transcription Factors HNF-3 and C/EBP.

5.1.3 PSE-C Contributes to 263P Repressor Activity in Transiently 145

Transfected Rat Pituitary GC Cells.

5.2 Identification of the PSE-C Associated Protein in Rat and 149

Human Systems.

xvi 5.2.1 C/EBP does not Associate with PSE-C in Rat Pituitary GC Cells. 149

5.2.2 PSE-C Contains a Low Affinity Binding Site for HNF-3/Jkh 151

Family Members.

5.2.3 Rat Pituitary GC Cells Contain Proteins that Bind to HNF-3 154

Site (TTR) as well as PSE-C (4IP).

5.2.4 Identification of HNF-3a in Rat Pituitary GC Cells. 156

5.2.5 Identification of HNF-3 a in the Human Pituitary. 161

5.2.6 HNF-3a Protein is Detected in both Rat Pituitary GC Cell 162

and Human Pituitary Nuclear Protein.

5.2.7 Human Pituitary HNF-3a is able to Associate with PSE-C 163

Fragment In Vitro.

5.2.8 HNF-3 a Associates with P Sequences in Human Pituitary 166

Chromatin In Situ.

HNF-3a Participates in the Repressor Complex Containing 169

NF-1.

5.3.1 HNF-3a Associates with NF-1, not RFX-1, in Human 169

Pituitary In Situ.

5.3.2 Association of HNF-3a and NF-1 was also Observed in Rat 170

Pituitary Cells. 5.4 Potential Involvement of the Transcription Factor Pit-1 in the 173

Pituitary Repression via P Sequences in Pituitary GC Cells.

5.4.1 The Pit-1 DNA Binding Site is Required for Repressor 173

Activity via P Sequences in Transfected Rat Pituitary GC

Cells.

5.4.2 Pit-1 Appears to Associate with PSE-C in the Pituitary GC 176

Cell System.

5.4.3 Pit-1 Associates Directly with TTR, a High Affinity HNF-3 180

Element.

5.4.4 Pit-1 cannot Directly Bind to PSE-C. 183

5.4.5 TTR, but not PSE-C (4IP), Contains a 'Pit-1 Like' Oct-1 184

Binding Site.

5.4.6 Pit-1 and HNF-3 Interaction was not Detected in the 186

Absence of DNA.

CHAPTER 6: DISCUSSION 190

6.1 The Histone Covalent Modifications Involved in the hGH/CS 190

Gene Expression. 6.1.1 Locus Control Region and other DNA Regulatory Elements. 192

6.1.2 Promoter Regions. 194

2 The Pituitary-specific Activation of GH-N Gene. 197

6.2.1 Pit-1 itself is not Sufficient for GH-N Gene Activation. 197

6.2.2 GH-N Activation is Much More Complicated than a 201

Simple 'Tracking' Process.

6.2.3 HS III and a Proposed "Window Hypothesis". 203

6.2.4 Functional Involvement of ETS Family Members in 206

GH-N Gene Activation.

6.2.5 Chromatin Conformation of the hGH/CS Locus. 208

6.2.6 Proposed Mechanism for the Pituitary-specific GH-N 211

Expression.

3 Pituitary-Specific Repression of the Placental GH/CS Genes. 214

6.3.1 P Sequences and the Associated Factors. 216

6.3.2 Lack of Chromatin Modifications at both CS Promoters and 219

263P in Pituitary.

6.3.3 Pit-1 is a Logical Target of a Mechanism underlying 221

Pituitary Repression. 6.4 Future Directions. 223

i) Applying the In Vitro Analysis of the Repressor 263P to 224

In Vivo Situation,

ii) Assessing Functional Involvement of Pit-1 in hGH/CS Gene 224

Activation and/or Repression in Pituitary In Vivo.

iii) Investigate Chromatin Conformation in the Pituitary where 225

hGH-N Transgene Expression is in a "Normal", or at

Least not Stimulated, Level.

6.5 Final Remarks. 226

CHAPTER 7: REFERENCES 229

xx LIST OF TABLES

CHAPTER 2: MATERIALS AND METHODS

2.1 Oligonucleotides. 34

2.2 PCR Primer Sets For Chromatin Immunoprecipitation. 35

2.3 PCR Primers for RT-PCR. 36

2.4 PCR Primers for Non-coding Bi-directional Transcripts Detection. 36

2.5 Sequence-specific Reverse Transcription (RT) primers. 37

2.6 Primer sets for Quantitative Real-Time PCR. 37

CHAPTER 6 DISCUSSION

6.1 Sequence alignments of Pit-1 /GHF1 sites in promoter regions 200

and the upstream locus control region.

xxi LIST OF FIGURES

CHAPTER 1: INTRODUCTION

1.1 Schematic of the human GH/CS gene locus and nearby genes 11

located on chromosome 17.

1.2 Nucleotide sequences (upper strand) of the 1.6 kb HS I/II fragment. 19

CHAPTER 2: MATERIALS AND METHODS

2.1 A schematic for sequence-specific RT-PCR. 50

CHAPTER 3: Analysis of Histone Covalent Modifications of the 58

Human Growth Hormone/Chorionic Somatomammotropin (hGH/CS)

Gene Locus in Human Pituitary Tissue

3.1 Histone H4 hyperacetylation of the hGH/CS locus in human 62

pituitary.

3.2 Histone H3K4 di- and tri-methylation status along the hGH/CS 67

locus in human pituitary chromatin.

CHAPER 4: Transcription Factor Pit-1 and Elk-1 Participate 70

XXll in a Common Complex that may Contribute to Human GH-N Gene

Activation.

4.1 Characterization of the transient transfected HEK293 cell system. 73

4.2 RNA blot analysis of endogenous GH expression. 75

4.3 The epitope cMyc tag does not affect DNA-binding capacity. 77

4.4 Pit-1 expressed in HEK293 cells binds DNA from the GH promoter 79

and locus control region (LCR).

4.5 Co-expression of cMyc-Pit-1 stimulates 1.6 TKp.Luc activity. 81

4.6 Effect of Pit-1 overexpression on histoneH4 hyperacetylation in 84

different regions of the hGH/CS locus.

4.7 Fold effect of Pit-1 expression in HEK293 cells on the level of 87

'random' non-coding transcripts along the hGH/CS locus.

4.8 Pit-1 mutation constructs and expressions. 91

4.9 DNA-binding of mutant Pit-1 proteins. 93

4.10 Traws-activation associated with modified Pit-1 proteins. 95

4.11 The histone modification change at HS III induced by Pit-1 98

depends on the presence of an intact POU-homeodomain.

4.12 Fold effect of Pit-1 deletions on the level of non-coding 101

transcripts along the hGH/CS locus in transfected HEK293 cells.

4.13 Sequence analysis of the DNase-I hypersensitive site III. 104

4.14 Recombinant Pit-1 proteins do not associate with HS III 106 Oct-1-like elements (OLEs).

4.15 HEK293 cells contain endogenous Oct-1 protein. 109

4.16 Oct-1 -like elements (OLEs) from HS III do not directly associate 112

with the expressed Pit-1 in the HEK293 cells.

4.17 Pit-1 expression in HEK293 cells does not interfere with binding 116

of endogenous Oct-1 to a consensus Oct-1 DNA binding element.

4.18 Oct-1-like elements from HS III do not affect Pit-1 and Oct-1 118

association with a consensus Oct-1 element.

4.19 Pit-1 expressed in HEK293 cells co-precipitates with Elk-1. 121

4.20 Exogenous Pit-1 participates in a common complex with the 124

endogenous Elk-1, not Ets-1 at HS III in HEK293 cells.

4.21 Evidence that association between Pit-1 and Elk-1 may depend 126

on the POU-homeodomain.

4.22 Pit-1 associates with ETS family members in human pituitary 130

in situ.

4.23 Expression of Pit-1 specifically stimulates endogenous GH-N 132

RNA expression in HEK293 cells.

4.24 Pit-1 increases HS III enhancer activity in the presence of an 135

intact ETS binding site.

CHAPTER 5: Identification of the Hepatocyte Nuclear Factor-3a 139 as a Component in Pituitary Repressor Complexes Formed at the P

Sequences of the Human Growth Hormone /Chorionic

Somatomammotropin Locus.

5.1 263P, not 103P, repressed the CS-A promoter activity in 142

transiently transfected rat pituitary GC cells.

5.2 Details of P sequence structure and analysis. 144

5.3 Functional analysis of PSE-C sequence in transiently transfected 147

pituitary cells.

5.4 C/EBP does not associate with PSE-C in rat pituitary GC nuclear 150

extracts.

5.5 PSE-C has the capacity to associate with HNF-3 family members. 153

5.6 Rat pituitary GC cells contain proteins that bind specifically to 155

HNF-3 (TTR) as well as PSE-C DNA fragments.

5.7 Identification of HNF-3 family members in rat pituitary GC cells. 157

5.8 Sequence analysis of the PCR products with specific primers to 159

the conserved HNF-3 DNA binding domain.

5.9 Identification of HNF-3 a in the human pituitary tissues. 161

5.10 Protein blotting for HNF-3ct. 163

5.11 Human pituitary HNF-3ct associates with PSE-C in vitro. 165

5.12 HNF-3 a associates with P sequences in human pituitary chromatin. 167

XXV 5.13 Protein interactions between HNF-3a and other protein 170

participants of the P repressor complexes.

5.14 HNF-3a and NF-1 participate in a common complex in rat 172

pituitary GC cells.

5.15 Functional analysis of 263P on CS-A promoter with and without 175

intact proximal Pit-1 site in transiently transfected GC cells.

5.16 Indirect association of Pit-1 to PSE-C, not either PSE-A or -B. 178

5.17 Possible associations between PSE-C and CS-A promoter 179

based on oligonucleotide competition.

5.18 Pit-1 binds to high affinity HNF-3 site. 182

5.19 Pit-1 cannot associate directly with PSE-C. 184

5.20 Sequence alignment for TTR and PSE-C (4IP). 186

5.21 Protein-protein interaction between HNF-3a and Pit-1 was not 188

detected in pituitary nuclear protein.

CHAPTER 6: DISCUSSION

6.1 A looping model of GH-N expression in pituitaries from transgenic 210

mice.

6.2 Schematic representation of the events prior to the human GH-N gene 212

activation in the pituitary.

6.3 Schematic representation of possible mechanisms that lead to the lack 216 of placental GH/CS gene expression in the pituitary.

6.4 Summary of the thesis work. 228

XXVH LIST OF COPYRIGHT MATERIALS

All figures from copyright items in this thesis are reprinted with permissions (mentioned in footnote after each figure legend).

1. RFX1 and NF-1 associate with P sequences of the human growth hormone locus in pituitary chromatin. Norquay LD, Yang X, Sheppard P, Gregoire S, Dodd JG, Reith W, Cattini PA. Molecular Endocrinology. 2003 Jun; 17(6): 1027-38.

Url: http://www.ncbi.nlm.nih.gov/pubmed/12624117

2. Binding of AP-2 and ETS-domain family members is associated with enhancer activity in the hypersensitive site III region of the human growth hormone/chorionic somatomammotropin locus. Jin Y, Norquay LD, Yang X, Gregoire S, Cattini PA. Molecular Endocrinology. 2004 Mar;18(3):574-87.

Url: http://www.ncbi.nlm.nih.gov/pubmed/14673137

3. Regulation of the human growth hormone gene family: possible role for Pit-1 in early stages of pituitary-specific expression and repression. Cattini PA, Yang X, Jin Y, Detillieux KA. Neuroendocrinology. 2006;83(3-4): 145-53.

Url: http://www.ncbi.nlm.nih.gov/pubmed/17047377

XXVlll 4. Hepatocyte nuclear factor-3cx binding at P sequences of the human growth hormone locus is associated with pituitary repressor function. Yang X and Norquay LD, Jin Y, Detillieux KA, Cattini PA. Molecular Endocrinology. 2006 Mar; 20(3):598-607. (Joint first author)

Url: http://www.ncbi.nlm.nih.gov/pubmed/16239259

Figures Reprinted with Permission from Co-workers:

Figure 5.21 Evidence that association between Pit-1 and Elk-1 may dependent on the POU-homeodomain.

Data provided by Ms. Yan Jin.

Reprint figure with permission from Ms. Yan Jin.

Figure 5.23 Expression of Pit-1 specifically stimulates endogenous GH-N RNA expression in HEK293 cells.

Data provided by Ms. Yan Jin.

Reprint figure with permission from Ms. Yan Jin.

xxix ABBREVIATIONS

103P 103 base pair P sequence fragment

263P 263 base pair P sequence fragment

3C chromatin conformation capture

41P 41 base pair P sequence fragment

A adenine

A260 absorbance at 260 nanometers

Ab antibody

ANOVA analysis of variance

AS anti-sense strand of DNA

ATP adenosine triphosphate

B/I bound/input bp base pair

BSA bovine serum albumin

C cytosine

CBP CREB-binding protein

C/EBP CCAAT/enhancer binding protein

CREB cAMP element binding protein

CS-A/-B/-L chorionic somatomammotropin-A/-B/-like

xxx CS-Ap chorionic somatomammotropin-A promoter

CSp chorionic somatomammotropin promoter

DNA deoxyribonucleic acid

DNase deoxyribonuclease

DNABD DNA binding domain

DMSO dimethyl sulfoxide

DMEM Dulbecco's modified Eagle's Medium

DTT dithiothreitol

ECL enhanced chemiLuminescence

EDTA ethylenediaminetetraacetic acid

EMSA electrophoresis mobility shift assay

ENH 241 base pair CS-B downstream enhancer region

FBS fetal bovine serum

FGF fibroblast growth factor

FM03 flavin containing monooxygenase 3

FP free probe

G guanine

GAPDH glyceraldehydes 3-phosphate dehydrogenase

GHF1 growth hormone factor 1

GH-N/-V growth hormone normal/-variant

GHp growth hormone promoter

xxxi ChIP chromatin immunoprecipitation

GHRH growth hormone releasing hormone

GST glutathione-S-transferase h human

HAT histone acetyl-transferase

HDAC histone de-acetylase

HEK293 human embryonic kidney 293

HFH HNF-3/fkh-related homologous

HMT histone methyl-transferase

HNF-3/fkh hepatocyte nuclear factor-3/forkhead

HS hypersensitive sites

IP immunoprecipitation

JmjC Jumonji (Japanese for "cruciform") C domain

K lysine kb kilobase kDa kiloDalton

KLH keyhole limpet hemocyanin

LCR locus control regions

LSD 1 lysine-specific demethylases 1

Luc luciferase mRNA messenger ribonucleic acid N-CoR nuclear co-repressor

NE nuclear extract

NF-1 nuclear factor-1

NGS normal goat serum nm nanometer

NMS normal mouse serum

NRS normal rabbit serum

NT non-transfected

OLE Oct-1 like element

PAGE polyacrylamide gel electrophoresis

PBS phosphate buffered saline

PBS-CMF calcium- and magnesium-free phosphate buffered saline

PCR polymerase chain reaction

PIC pre-initiation complex

PL placental lactogen

PMSF phenylmethylsulfonyl fluoride

Pol II RNA polymerase II poly dldC polydeoxyinosinic-polydeoxycytidylic acid

PRL prolactin

PSE P sequence element qRT-PCR quantitative real-time PCR RFX regulatory factor X

RNA ribonucleic acid

RNAi RNA interference

RT-PCR reverse transcriptase polymerase chain reaction rpm round per minute

S sense strand of DNA

SCN4A sodium channel a-subunit

SDS sodium dodecyl sulfate

SEM standard error of the mean.

T thymine

TBE Tris-borate-EDTA

TCAM testicular adhesion molecule

TK thymidine kinase

TNIB tissue nuclei isolation buffer

TNIB+ tissue nuclei isolation buffer with additives tRNA transfer ribonucleic acid

TSH thyroid stimulating hormone

TTR transthyretin wt wild type CHAPTER 1

INTRODUCTION

1.1 Tissue-specific Gene Expression

It is remarkable that every multi-cellular organism originates from a single cell and develops into a complex organism with many different cells types, all carrying identical

DNA. Each cell type may perform distinct biological and/or physiological functions, but permits the development of a multi-cellular organism to be fully functional. Cellular differentiation and organ development are the consequences of differential gene expression resulting from the temporal cascades of gene activation or repression [1, 2].

Clearly, even though from the same genome, expression of genes must be precisely regulated to ensure they are expressed in the right cells of the right tissues at the right time. This phenomenon, termed tissue/cell type - specific gene expression, is a key regulatory component during development. Without tissue-specific gene expression, the ability to produce different cell types from the same genome, and development of a fully functional organism, would not be possible. Therefore, understanding the molecular mechanisms that contribute to tissue-specific gene expression is a fundamental question in modern biology.

1 1.1.1 Chromatin Structure

In the eukaryotic cell nucleus, genes do not exist as naked DNA, but instead are compacted with basic histone proteins into a higher order structure called chromatin. The condensed DNA/protein complex is a necessary structure to ensure the DNA is packaged in an orderly fashion into the available space of the nucleus. The basic repeating structural unit of chromatin, the nucleosome, consists of 146 base pairs (bp) of DNA wrapped around a histone core (an octamer of core histone proteins, composed of two each of the histones H2A, H2B, H3 and H4) [3, 4]. Nucleosome units are separated by the "linker" DNA, which can vary in length from 7 to 94 bp between cell types [5].

Under low ionic conditions, an extended form of chromatin, represented by the repetitive nucleosome units, is visualized as "beads on a string" [3, 6]. This structure is termed the

10 nm fiber (diameter). The 10 nm fiber structure is accessible to the transcription machinery and thus has the potential to be transcriptionally active.

The core histone proteins have highly conserved globular COOH-terminal domains that are responsible for interaction with DNA, as well as intra-nucleosomal interactions [7].

Also, the NH2-terminal tails of each core histone protein project outward from the nucleosomal core [3]. Even though the exposed histone tails are not necessary for nucleosomal structure, they appear to be required for formation of the higher order structure of chromatin [3, 7]. Core histone tails are subject to several covalent modifications, and are involved in the regulation of DNA accessibility [8, 9].

2 The 10 nm fiber is further compacted into a 30 nm fiber (diameter) [6]. Stabilization of the 30 nm fiber occurs through the presence of linker histone HI, and the NH2-terminal tails of the core histone proteins [4, 8]. Beyond the 30 nm fiber, chromatin is further compacted through short and long-range fiber-fiber interactions [8, 10], attachment to the nuclear matrix [11, 12], and formation of loop structures [13], which can eventually result in the most compact state of chromatin: chromosomal fibers that can be visualized during mitosis [14].

Compaction of DNA into a chromatin structure permits it to fit within the limited space of the nucleus. However, a consequence resulting from this compaction is that the double-stranded DNA is no longer accessible for transcription initiation. In order for transcription initiation to occur, the gene locus must be present, essentially, in the form of a 10 nm fiber. Therefore, the reversible "opening up" process is called chromatin remodeling [15]. The transition from a 30 nm (transcription initiation-inactive) to a 10 nm (transcription initiation-active) fiber and back again is controlled in part by modifications to the basic histone structures that make up individual nucleosomes.

Specifically, posttranslational modifications (including acetylation, methylation and phosphorylation) of the amino-terminal tail of linker (HI) and core histones (H2A, H2B,

H3 and H4) can favor condensation or loosening of the chromatin structure and, therefore, transcription initiation and gene expression [9, 16].

3 1.1.2 The Activation of Gene Expression

In eukaryotes, gene expression is regulated principally at the transcriptional level. As the initial step for gene expression, transcription is achieved by the coordinate activity of trans-activating factors that recognize c/s-acting DNA sequences in promoters and regulatory DNA elements such as enhancers and repressors [17, 18]. Transcriptional activation of a gene involves the ordered recruitment of components of the transcription machinery in concert with alterations in chromatin structure [19]. In this thesis, molecular mechanisms responsible for tissue-specific gene expression are explored at the transcriptional level, specifically focusing on how transcription factors, DNA regulatory elements and chromatin structure contribute to tissue-specific gene expression.

i) Chromatin Remodeling

Based on the transcription status, the structure of chromatin can be placed broadly into two classes: compacted and transcriptionally inhibitory heterochromatin, and relatively less condensed euchromatin [20-22]. The remodeling of chromatin from heterochromatin to euchromatin is essential for transcription initiation, and can be accomplished through nucleosome remodeling and post-translational modifications of histone tails.

Modification of the nucleosomes through ATP-dependent remodeling complexes is one mechanism resulting in transition to euchromatin, and thus, transcriptional activation.

Most transcriptionally active or competent ("poised") DNA sequences are complexed in nucleosomes. However, nucleosomal structure itself is inhibitory to transcriptional

4 activation [23, 24]. In order for transcription to occur, the location and/or structure of nucleosomes need to be modified by the remodeling complexes with energy from ATP hydrolysis [25]. Remodeling of the nucleosomes will result in destabilized chromatin structure and increased accessibility for transcription factors and RNA polymerase, thereby facilitating transcription. Several mechanisms that rely on ATP-dependent complexes to modify the compact chromatin structure have been documented, including nucleosome displacement [25, 26] and movement (sliding) of nucleosomes [27, 28].

The post-translational modification of the core histone tails is another option for remodeling the chromatin structure. Even though the NH2-terminal tails of core histone proteins are not required for nucleosome integration, they are subject to several types of post-translational modifications that have been linked to gene expression. These post- translational modifications, including acetylation [20, 29], methylation [30, 31] and phosphorylation [32, 33] of the core histones, can favor condensation or loosening of the chromatin structure and, therefore, affect transcription initiation and gene expression [21,

32, 34]. A combination of distinct histone modifications, on one or more core histone tails, sequentially or in combination, is proposed to form a "histone code", which is

"read" by the transcription machinery and used to guide gene expression [34].

Among these modifications, histone acetylation is reported to be able to disrupt the condensed chromatin structure and facilitate transcription in most cases studied [35, 36].

This was perhaps best demonstrated by the ability of chromatin containing hyperacetylated histones to be digested much more rapidly by DNase-I than chromatin

5 with unacetylated histone [37]. Histone acetylation can occur on all the four types of core histone proteins. This modification neutralizes the positively charged lysines, thereby weakening interactions between nearby nucleosomes. This effect promotes the destabilization of higher order chromatin structure, thus facilitating the transcription process [4, 38]. Furthermore, acetylation of lysine 16 (K16) of histone H4 tails appears to be important in destabilizing the higher order chromatin structure [39-41]. By contrast, histone methylation is found to be more stable than the more dynamic histone acetylation states and has impact on long-term maintenance of stabilized gene expression

[42, 43]. Different from acetylation, methylation can be associated with both transcriptionally active and repressed chromatin [43, 44]. Methylation on histone H3 lysine 4 (K4) usually associates with transcriptionally active chromatin [45, 46]; while methylation of histone H3 lysine 9 (K9) or lysine 27 (K27) usually links with transcription silencing [47, 48]. In addition, the degree of methylation of a specific histone lysine residue (e.g. mono-, di- and tri-methylation) may vary and results in distinct biological consequences [43, 44, 49].

ii) Assembly of Molecular Machinery at Appropriate DNA Regulatory

Elements.

Despite being "poised" compared to condensed chromatin, genes do not activate transcription themselves. Assembly of regulatory machinery at the appropriate position in the chromatin is also required. Once chromatin is in an "open" conformation, critical interactions can occur, resulting in the recruitment of the pre-initiation complex (PIC), consisting of multiple proteins, including RNA polymerase II and the general

6 transcription factors, at the promoter, ultimately leading to gene expression. These trans acting factors associate with specific DNA sequences through non-covalent DNA-protein interactions with their DNA-binding domains, and might contain activation or repression domains that would affect transcription [50]. In addition, trans-acting factors may also be functional through recruitment of other factors that do not directly associate with

DNA, and thus are termed co-activators or co-repressors.

As for DNA elements, the core/basic promoter is not the only region determining whether a gene is transcribed or not. Several types of DNA elements, including enhancer, repressor, silencer, insulator, and locus control regions (LCR) are all important cis- regulatory components for transcription [51]. A major characteristic common to all these regulatory elements is their sensitivity to nuclease digestion is 2-3 times greater than the other regions. Hypersensitive sites (HSs) are used to described regions that are so sensitive to nuclease digestion that they appear to be "nucleosome free", and show at least a 100 times more sensitivity to DNase-I digestion than bulk chromatin [52]. The presence of hypersensitive sites is usually considered a "signature of regulatory elements", and usually contains binding sites for sequence-specific DNA binding proteins. Therefore, identification of activator and/or repressor protein components within the complex as well as their corresponding DNA elements can be a valuable approach to understanding the molecular mechanisms of transcription.

iii) Locus Control Region (LCR)

7 The locus control region (LCR) can be described as a set of DNA regulatory elements defined by an ability to fully activate gene expression over a distinct chromatin distance in a copy number-dependent and site of integration-independent manner defined by transgenic studies [19, 53, 54]. LCRs are distinct from typical enhancers in that are also capable of creating a domain for histone modifications, establishing replication timing and DNA demethylation [55].

Generally, the remote LCR may function in several ways. In a tracking or scanning model, it is hypothesized that the transcription-activating complex is recruited to an enhancer or enhancer-like region, resulting in formation of a localized histone modification domain/hub. The complex then tracks linearly along chromatin, until it encounters a competent promoter [56, 57]. In this model, the scanning process will not alter the proximity between enhancer and promoter [58]. Alternatively, chromatin looping between promoters and enhancers may occur [59-61]. In this model, the intervening chromatin between the enhancer and the promoter "reels out" and forms a loop; this is mediated by transcription factors. The third model type is termed as a facilitated tracking model, which incorporates both looping and tracking models together

[19, 62]. In this model, the looped out DNA sequence is the target for transcription- activation complex tracking.

The functional involvement of a LCR on gene expression has been based largely on the

P-globin locus. The P-globin genes are specifically expressed in erythroid cells in a way that different family members are expressed at different stages sequentially during

8 development. In early studies, functional involvement of the LCR in P-globin gene expression was best demonstrated by the observation that a "minilocus" construct containing the 5' and 3' flanking regions of the human (3-globin gene conferred tissue- specific, copy number-dependent and site of integration independent gene expression in transgenic mice [63]. Additionally, deletion of this region resulted in loss of nuclease sensitivity and core histone hyperacetylation [64], reduction of pre-initiation complex assembly, and eventually, a marked decrease in transgene expression [65, 66]. These observations led to the proposal that the (3-globin LCR was required for "opening", or at least "maintenance" of an open state of the (3-globin locus in the context of chromatin, which is a prerequisite for efficient transcription to occur. However, unexpectedly, deletion of the LCR did not have a major effect on either nuclease sensitivity along the entire locus [67] or histone modifications at gene promoters [68]. These studies indicated that the |3-globin LCR does not contain the domain-opening activity as was expected from the transgenic study. Thus, the establishment and maintenance of an 'open' chromatin structure for the P-globin locus during development were dependent on other elements besides the LCR [69]. The LCR appears to function as a contributory rather than dominant regulatory component in the regulation of the P-globin gene locus.

1.1.3 The Human Growth Hormone (GH) /Chorionic Somatomammotropin (CS)

Gene Family Represents a Unique Model to Investigate the Molecular

Mechanisms Involved in Tissue/Cell-specific Gene Expression.

9 The human growth hormone/chorionic somatomammotropin (GH/CS) family contains five genes, including growth hormone normal (GH-N), growth hormone variant (GH-V), and three chorionic somatomammotropins (CS-A, -B, and -like/-L). The gene products of this family play fundamental roles in fetal as well as adult growth and development.

Pituitary GH-N is required for post-natal growth, development and homeostatic regulation [70]. The primary role of placental GH-V as well as CS appears to help provide a continuous supply of metabolic substrates, especially glucose, to the fetus in an indirect manner by influencing maternal metabolism through their insulin antagonistic activity [71, 72]. Some evidence also supports a direct action on fetal growth and metabolism [71, 72].

The human (h) GH/CS gene cluster is located on chromosome 17q22-24, within a single

47 kilobase (kb) locus on chromosome 17 [73]. The cluster is flanked upstream by the lymphocyte-specific CD79b and skeletal muscle sodium channel a-subunit SCN4A genes

[74, 75] and downstream by the testicular adhesion molecule-1 (TCAM-1) gene [76]

(Figure 1.1). The five GH/CS genes are aligned in the same transcriptional orientation in the order 5'-GH-N/CS-L/CS-A/GH-V/CS-B-3', sharing 90-99% sequence similarity.

All five genes from the hGH/CS locus are believed to have evolved through processes of gene duplication [73, 77, 78], resulting in similar gene structures and flanking regulatory sequences [73]. In spite of the sequence homology between the GH/CS genes, GH-N is expressed specifically in pituitary somatotrophs, while CS genes and GH-V are expressed preferentially in placenta [73].

10 Appropriate expression of the hGH/CS genes in vivo is dependent on a remote locus control region (LCR) found 14.5 - 32 kilo bases (kb) upstream of GH-N gene [79]. The hGH/CS LCR contains regulatory sequences associated with five DNase-I hypersensitive sites (HS I/II-V), including those reported to be specific to the pituitary (HS I/II) and placenta (HS IV) as well as constitutive (HS III and HS V) in nature [80, 81]. In addition, there are other regulatory components data support in the regulation of hGH/CS gene expression, including conserved P sequences (located upstream of each placental

CS/GH-V genes) and downstream enhancer element (located downstream of each CS genes) (Figure 1.1) [73].

GH/CS LCR Hsvivm nj Placenta II 1 Pituitary w T -^- ~47kb 5kb * SCN4A | \CD79B — GH/CS locus — TCAM 4 • - n kb » 31 |-b

• fill• A AIHA am -JSiMA

Figure 1.1 Schematic of the human GH/CS gene locus and nearby genes located on chromosome 17. The human GH/CS gene family and the 5'-flanking CD79B and SCN4A genes, as well as 3'-flanking TCAM gene are shown. The relative position of hypersensitive sites (HS) within the locus control region (LCR), P and downstream enhancer (E) sequences are shown. Originally, HS I/II were reported to be pituitary-specific, HS IV was placenta- specific, and HS III and V were pituitary/placenta-specific [80].

11 The separate expression of hGH/CS family members in pituitary and placenta distinguishes the hGH/CS locus from the extensively studied P-globin locus. Studies from human [82], mouse [83] and chicken [64] P-globin loci revealed that the (3-globin locus represents a model where expression of gene family members are restricted to a single tissue type (erythroid tissues) with varied expression during developmental stages

[84]. In this regard, the |3-globin family represents a model to investigate how gene expression pattern is regulated temporally. However, the fact that the hGH/CS genes are expressed not only at varied developmental stages, but also in spatially distinct tissues makes it an excellent model to investigate the molecular mechanisms involved in tissue- specific gene regulation.

This thesis focuses mainly on the expression of the human GH/CS genes in a pituitary context using both in vitro and in situ techniques. Two specific aspects are addressed, including the pituitary-specific expression of the GH-N gene, and the lack of expression of the placental genes. The dynamic relationship between transcription factors and chromatin structure in regulating gene expression were further investigated.

1.1.4 Histone Post-translational Modification is one of the Major Regulatory

Components Involved in the hGH/CS Gene Regulation.

12 As mentioned previously in Introduction 1.1.2, certain types of histone post-translational modifications, such as histone H4 acetylation as well as methylation on histone H3 lysine

4, usually associate with transcription activation. Thus, these modifications are usually considered as markers of an active chromatin domain, also known as "euchromatin modifications" [21]. In terms of hGH/CS gene expression, status of histone covalent modifications along the locus, encompassing regions from the upstream locus control region (LCR) at the 5' end to the CS-B enhancer region at the 3' end, is one of the most important characteristics determining expression of the hGH/CS gene family members in transgenic mice in vivo [85, 86].

In earlier studies, covalent histone modifications along the hGH/CS locus were focused mainly on histone H3/H4 acetylation and histone H3K4 tri-methylation [85, 87]. By using a combination of antibodies specific for basal level of acetylated histones H3 and

H4 (first one and/or two lysines on histone tails), as well as a traditional approach for

DNA detection (Southern blotting), a broad range of histone acetylation along the hGH/CS locus was observed in tissues from (i) human GH-secreting pituitary adenoma samples [88] and (ii) pituitaries from human growth hormone releasing hormone

(hGHRH)/hGH double transgenic mice [85]. Using the pituitaries from the hGHRH/hGH double transgenic mice, a 32-kb domain containing the entire hGH LCR and GH-N promoter was observed, with the HS I/II to be the most pronounced and centered region

[85]. Note that GH-N expression was abnormally high in both of these tissues, which might be reflected in the histone modification status. Also, histone tri-methylated H3K4

13 was assessed in hGHRH/hGH double transgenic mouse pituitaries, where a similar modification pattern as the H3/H4 acetylation was observed [87].

As part of this thesis, histone modification status along the hGH/CS locus was analyzed using post mortem human pituitary tissues (Chapter 3). Compared to the GH-secreting pituitary adenoma and GHRH hyperstimulated transgenic mouse pituitaries, the use of

'normal' human pituitary tissue would be expected to reflect histone modification status in a tissue where the endogenous GH-N expression is, perhaps more 'normal', and certainly not hyper-stimulated. Also, the result is likely an underestimate for the peak of modifications due to the lack of somatotroph enrichment in these tissues. The first research objective of this thesis was to assess the chromatin modifications in the hGH/CS locus, more specifically, histone H4 hyper-acetylation and various levels of histone H3- lysine (K) 4 methylation, along the hGH/CS locus, using post-mortem human pituitary tissues and a more sensitive DNA-detection method (PCR) (Chapter 3). Results from the histone modification analyses will be discussed in combination with the data from transcription factor studies in the context of increasing the understanding of pituitary- specific gene expression.

1.2 Transcriptional Regulation of the GH-N Expression in the Pituitary.

Despite the fact that GH-N gene expression can be detected at a very low (or "basal") levels in other tissues like liver, brain [89], skin [90] and lymphoid tissues [91-94], the

14 primary cells that express the GH-N gene are the somatotrophs of the anterior pituitary

[73]. The expression of the GH-N gene accounts for greater than 3% of the total mRNA in these cells [73]. The pituitary-specific expression of the hGH-N gene is largely under the control of the transcription factor Pit-1 (or GHF1, growth hormone factor 1) and a remote locus control region (LCR).

1.2.1 The Pituitary-specific Transcription Factor Pit-1.

The POU-homeodomain transcription factor Pit-1 or GHF1 was identified and cloned as a pituitary-specific transcription factor in the late 1980's [95-98]. The acronym POU is derived from the name of three mammalian transcription factors, including the pituitary- specific Pit-1 [95], the octamer-binding proteins Oct-1 [99] and Oct-2 [100], and the neural Unc-86 from Caenorhabditis elegans [101]. The members of the POU gene family are characterized by a unique bipartite DNA-binding domain referred to as the

POU domain [102]. This domain is composed of a variant homeodomain and a conserved POU-specific domain, joined via a non-conserved linker DNA. Since both subdomains contain helix-turn-helix motifs that directly associate with the bipartite

DNA-binding sites, the POU domain factors exhibiting a surprising flexibility in DNA binding [103]. The consensus sequence for Pit-1 binding is T(A/T)TA(T/A)

TAAT(T/A)CAT [104]. On most sites, Pit-1 appears to bind as a homodimer [105, 106], however, on some sites Pit-1 can bind, as a heterodimer with the POU domain factor Oct-

1 [107, 108], to the consensus Oct-1 sites [103]. The transcription factor Oct-1, like Pit-

15 1, also belongs to the POU homeodomain family, but is ubiquitously expressed in adult tissues although it does display a specific temporal or spatial pattern of expression like other POU family members [109]. Examples of both activation and repression of transcription by Oct-1 have been described for several genes, including histone H2B

[110], vascular cell adhesion molecule [111] and gonadotrophin-releasing hormone

[112]. The specific binding motifs for Oct-1 (5'-ATGCAAAT-3') and Pit-1 share some nucleotide similarity (AT-rich sequences), so that Oct-1 sites also represent sites for Pit-1 binding [113, 114].

Pit-1 plays an important role in development of the anterior pituitary, as well as pituitary- specific expression of several genes. Among the five cell types of the anterior pituitary, three, including somatotrophs (secreting growth hormone/GH), lactotrophs (secreting prolactin/PRL) and thyrotrophs (secreting thyroid stimulating hormone/TSH) [115-119] are products of the Pit-1 lineage. Gene expression of not only GH-N in somatotrophs, but also PRL in lactotrophs [117, 120] and TSH in thyrotrophs [121], require Pit-1.

Functional involvement of Pit-1 in pituitary development and pituitary-specific gene expression is best demonstrated by the observation that disruption of the Pit-1 gene coding region resulted in hypoplasia of these three cell types, and thus, reduced expression of GH, PRL and TSH [115, 118]. However, even though expressed in all three cell types, the fact that each cell lineage expresses a highly specialized and distinct peptide hormone implicates the functional involvement of other factors in addition to Pit-

1 in the expression of these pituitary genes.

16 Pit-1, as a major transcription factor involved in regulation of the GH-N gene expression in the pituitary, is reported to bind to two pituitary-specific binding sites within the 5 '- flanking sequence of the GH-N promoter [98, 122]. The Pit-1 binding site, located within the first 496 base pairs upstream of the GH-N transcription initiation site, is highly conserved in nearly all species studied, and is required for GH-N promoter activity in vitro [123-126]. However, it is remarkable to observe that efforts to direct reporter gene expression using 500 or 5000 bp of upstream hGH-N sequence, including the GH-N promoter region, met with little success in transgenic mouse studies [80]. Thus, regardless of the presence of Pit-1 and/or Pit-1 binding sites in the promoter, this observation suggests that other regulatory elements are required for efficient pituitary- specific GH-N expression in vivo.

1.2.2 The upstream Locus Control Region (LCR).

The hGH/CS locus control region (LCR), located 14.5 kb to 32 kb upstream of the GH-N transcription initiation site, was identified based on its ability to direct high level, position-independent, somatotroph-specific expression of the hGH-N gene in transgenic mice [74, 80]. The hGH/CS LCR is characterized by five DNase-I hypersensitive sites

(HS I/II - V) [80], which suggest (i) relatively 'open' domains of chromatin within the

LCR and (ii) the presence of putative sites for multiple c/s-transcription factors [52]. The appearance of HS I/II is specific to pituitary somatotrophs, while HS IV is unique to placenta tissue. Hypersensitive site III and V appear in both tissues [80], and more

17 recently it was reported that HS III is in fact ubiquitous (Figure 1.1) [87]. In contrast to the 'contributory' function of the LCR in the |3-globin gene locus, the role of the LCR in the regulation of GH-N gene expression appears to be definitive. This was best

demonstrated by the observation that with the presence of the LCR, the naive GH-N promoter is fully capable of activating a hGH-N transgene in vivo [80, 127].

Among the five hypersensitive sites, HS I/II was documented as a pituitary-specific

enhancer. HS I/II is located in an ~ 1.6 kb region approximately -14.6 to -16.2 kb

upstream relative to the GH-N transcription initiation site in the 5'-flanking sequences,

and is sufficient to direct high-level GH-N expression to somatotrophs in vitro and in vivo

[74, 128]. Subsequent studies on the 1.6 kb region (HS I/II) revealed that enhancer

activity was localized to a 203-bp sub-fragment, which contained three A/T rich Pit-1-

like sequences [128] (Figure 1.2). Functional studies suggested that Pit-1 participates in

complexes formed on the 203-bp region through association with the three A/T rich sites

(A/T-l, -2 and -3), and activates the enhancer independently of the homologous GH-N

promoter and the presence of proximal Pit-1 sites [128]. Two out of the three A/T-rich

elements within this 203-bp sub-fragment (A/T-l and -3) were confirmed as Pit-1 sites by

another group and termed as Pit-IB and Pit-lC [129]. Furthermore, an additional Pit-1

site (Pit-1 A) in the nearby region (upstream of the 203-bp enhancer element) was also

identified (Figure 1.2) [129].

18 1 (-664,556) 70 AGATCTTGTC TCAGAAAAAC CCCAGAAAAC AACAACAAAA AAACGCGCTA TTGGGCTTAT TTCTATTTTA

..... 700 CAGTGAGGGA ACAGCACGGC TCAAAATGTG ACAAATAACC CTGCAGGCGG TGGGGCCCCC GCTGCCTCCG

...... 1050 CCGCTGAGCC CTAGGACCAG CTCCAGAGTA GGCCCCACAC CACAGGGTCC AGGCAACACA CCTGTGTGAG CATGCACATA CACACACACA CACACCCCCC ACAAACACGT GTGCCCCAAG CCTTTCCCAG TTATACCCCC CAACTTTGGG GAGACACTAG CCCCAAAGTT AATGAAGGAC TCTGTCGTTA GGGGCTCAGG AAGAGTATTT Pit-IA CCTAAACCAT GAGACTCCCA GATTTTGCCC CACTCCCCCC GGGTCAGTCT CTCTCCAGCC ACCCTCACCA GCATGCGGGC CCATGGGCCT CAAGCTGACC TCAGGTGATG TTTATATTTC TGAGCTGTTT ATTCCATGAA A/T-2 A/T-1/Pit-1B 1400 CTGAACATCT GACAGCTTTT CAGAGAAATG TTTTTTCATT TGGAACATCT GGAAACAAGA AAGAACATCT A/T-3/Pit-lC GGGGCTGCCC GGAACGGGCT GTTCCTCGGA TGAAACCTTA ACCCTCCTGC CCCTGACTTC CGTGGCTCAG GTCCTGGCCT GCACCCCTTG AGAGTGGCCC CCACCTTATC AGGTCCGAGG CCTAGGCCAA GATCT -3' 1605 (-662,952)

Figure 1.2 Nucleotide sequences (upper strand) of the 1.6 kb HS I/II fragment. Nucleotide sequences of HS I/II, located 14.6 to 16.2 kb upstream of the GH-N transcription initiation site are shown (NCBI reference sequence NT010783.15). The 203 bp enhancer sub-fragment of HS I/II is indicated by blue letters. The nucleotides that are unrelated to the enhancer activity are indicated by black dots. Three A/T rich Pit-1- like elements within the 203-bp sub-fragment are underlined (A/T-l, -2, and -3). A/T-l and A/T-3 were later confirmed as Pit-1 sites by another group [129], and recognized as Pit-IB and Pit-lC, respectively. An additional Pit-1 element in a nearby region is identified as Pit-1 binding site (Pit-1 A). Sequences for A/T-l, -2 and -3 are based on [128]. Sequence for Pit-IA, B, and C are from [129]. Numbers for the nucleotide sequences on chromosome 17 are also indicated.

Despite that all four Pit-1 sites showed the capacity to bind Pit-1 and were involved in the enhancer activity in vitro, further studies on the HS I/II were mainly focused on a 99-bp region containing the three A/T- rich Pit-1 sites. The binding of Pit-1 in this region is known to be an important step in pituitary GH-N expression. It was elegantly demonstrated using transgenic animals that disruption of the HS I/II region via a 99-bp

19 deletion created through homologous recombination resulted in (i) reduced Pit-1 occupancy at the GH-N promoter, (ii) loss of the histone H3/H4 acetylation throughout the hGH/CS locus, (iii) general loss of the RNA transcript level along the whole locus, as well as (iv) a dramatic decrease in the hGH-N transgene expression to approximately 1 %-

4% of the wild type levels [85, 130]. Thus, all these observations suggested that effective binding of Pit-1 to HS I/II is a fundamental step required for GH-N expression in the pituitary in vivo. Multiple sequential steps in GH-N transcription activation, including opening up of a chromatin domain, activation of the basal promoter, and sliding of the transcriptional machinery containing the RNA polymerase II (Pol II), all appear to be a consequence of effective Pit-1 binding to HS I/II.

However, the process by which Pit-1 gains access to the chromatin at HS I/II has not been determined. This is not unexpected since (i) the GH/CS locus is unique to primates and thus does not exist in rodents, a common animal model [131-133]; and (ii) there is inherent difficulty in obtaining human embryonic cells of the pre-somatotroph lineage for study. Thus, the second research objective of this thesis was to investigate the processes prior to Pit-1 binding to HS I/II by using a human non-pituitary/placenta cell system

(Chapter 4). In brief, the consequences of Pit-1 expression in human embryonic kidney

293 (HEK293) cells were explored, including effects on and/or association with DNA, protein and chromatin.

20 1.3 Transcriptional Regulation of the Placental GH/CS Genes in the Pituitary: A

Case for Pituitary Repression.

The placental members of the hGH/CS gene family include four genes that are expressed in the villus syncytiotrophoblast of the placenta [73]. Among them, the CS-A and CS-B genes are highly expressed and encode proteins whose amino acid sequences differ at one position in the single peptide, but the secreted protein products are identical [134-136].

Their product, designated chorionic somatomammotropin (CS) or placental lactogen

(PL), is produced in increasing amounts as pregnancy progresses [73]. During the third trimester, up to 1 g of hCS is secreted per day into the bloodstream, accounting for 10% of all placental protein production [137], and > 5% of total RNA in the placenta [134,

138]. The two other genes, CS-L and GH-V, are only expressed at trace levels during pregnancy, compared with the prominent expression of CS-A and CS-B. The CS-L gene, because of a mutation at one of the exon-intron boundaries, encodes a variant mRNA and is thought to be a pseudogene [73, 78, 139]. The protein product of GH-V shares some similarity with GH-N in terms of metabolic effects and intracellular signaling pathways

[140]. It was proposed that the GH-V gene was "accidentally" inserted between the CS-

A and CS-B genes during a gene duplication event, and that this position between two highly expressed placental genes leads to its expression in placenta [73, 141, 142].

Despite potent expression in placenta, the placental genes and GH-N are expressed in a mutually exclusive way in the pituitary, to the extent that not even basal levels of placental hormones expression is detected [73]. Given the extensive sequence similarity

21 between GH-N and CS/GH-V genes, this raises the question as to why the placental

CS/GH-V genes are not activated in the pituitary like GH-N. In regard to this question, a hypothesis was developed that all the four placental hGH/CS genes are repressed in the pituitary [143].

1.3.1 A Possible Repression Mechanism for the Placental Members of hGH/CS

Genes in the Pituitary.

The hypothesis that the placental hGH/CS genes are actively repressed in the pituitary was based mainly on the following observations:

First, one possible explanation for a lack of placental gene expression in the pituitary is that the placental GH/CS genes possess a different and more closed/compacted chromatin structure (e.g., 30 nm versus 10 nm fiber), and thus, are less accessible to transcription factors than the GH-N gene. However, an assessment of nuclease sensitivity (or relative accessibility) of the pituitary GH-N versus placental GH-V/CS genes suggested that all five genes showed similar chromatin condensation in the pituitary [144]. This observation suggests that although they are not expressed in pituitary, the placental genes appear to be similarly competent or at least "poised" for transcription. The placental

GH/CS genes appeared equally as "open" for transcription and the binding of transcription factors as the GH-N gene in human pituitary chromatin.

22 Secondly, the placental members of the human GH/CS family show high sequence similarity to GH-N in their flanking DNA. This includes the presence of binding sites for

Pit-1, the major transcription factor for GH-N gene activation in the pituitary, in their proximal promoter regions [73]. As discussed in Introduction 1.2.1, it is well established that Pit-1 is essential for GH-N expression in the pituitary, and functional Pit-1 binding sites are found in the promoter regions of all members of the hGH/CS family due to the sequence similarity [145, 146]. It was also observed that when a hybrid reporter gene driven by the CS-A promoter was transiently transfected into rat anterior pituitary GC cells, the promoter is active and the activity is reported to be Pit-1 element dependent

[147, 148]. As cloning and sequencing of the human Pit-1 cDNA indicate that the human and rat Pit-1 proteins share over 96% sequence identity [149], the observation from the transfection studies in the rat cell system raises the possibility that a similar response is possible in the human system. This in turn raises the expectation that the CS/GH-V genes should be active in human pituitary in vivo, like the GH-N gene.

The above observations of (i) the essential role that Pit-1 plays in pituitary-specific GH-N expression in vivo, (ii) the ability of Pit-1 to activate the CS-A promoter in vitro, and (iii) the apparent "open" chromatin conformation, raise the question of what is preventing Pit-

1 from activating the placental GH/CS gene expression in pituitary cells. Thus, an active repression mechanism was proposed for the lack of expression of placental hGH/CS genes in pituitary cells.

23 1.3.2 P sequences and Associated factors.

On the basis of alignment and comparison of sequences in the hGH/CS locus, highly conserved regions referred to as "P sequences" were identified upstream of each of the four placental genes, but not the pituitary-expressed GH-N gene [73]. Lack of the presence of P sequences upstream of the GH-N gene makes the P sequence a good candidate to be involved in the regulation of the placental hGH/CS genes, either positively in the placenta or perhaps as a repressor in the pituitary. There are data from transgenic mouse studies implicating P sequences in placenta-specific enhancer activity

[150]. However, there is also evidence supporting a role for P sequences in pituitary repression.

The capacity for P sequences to block pituitary expression of hGH/CS genes was suggested by the ability of a DNA fragment containing P sequences to repress human placental CS-A gene promoter activity in pituitary tumor GC cells after gene transfer

[143]. Repressor activity was further localized to a 263 bp fragment, termed as 263P.

Previous studies on the pituitary repressor complex identified two protein-binding regions within 263P, specifically P sequence element-A (PSE-A) and PSE-B. These findings were used to develop a model in which the presence of the 263P complex in pituitary cells negated formation of a functional enhancer complex involving Pit-1 and, as a result, contributed to the lack of placental gene expression in pituitary cells.

24 An analysis of protein binding events at PSE-B revealed that NF-1 was the associating factor [151]. When similar analysis was performed on PSE-A, multiple DNA-protein binding interactions were demonstrated, including NF-1 and RFX [152]. However, when a 103-bp fragment (103P) of 263P, containing PSE-A and PSE-B, was assessed for the repressor activity in vitro, it was unable to repress the CS-A promoter activity in transfected rat pituitary GC cells [153]. Thus, the lack of repressor activity seen with

103P versus 263P raises the possibility and hypothesis that sequence information outside of PSE-A and PSE-B but contained within the remaining 263P sequences is required for pituitary repression. The third research objective of this thesis was to explore the possibility that an additional regulatory element(s) outside of PSE-A and PSE-B in 263P is involved in the pituitary repressor activity on the CS-A promoter (Chapter 5). Using a combination of in vitro and in situ analyses, the potential function for an additional P sequence element, designated as PSE-C, was explored. The candidates for PSE-C associated factor(s) were also assessed as potential participant(s) of the repressor complex.

1.4 Research Objectives.

Regulation of the hGH/CS gene expression involves multiple regulatory components.

Studies in this thesis have been designed to gain insights into the molecular mechanisms responsible for expression and repression of the hGH/CS genes in the pituitary. The three specific research objectives were:

25 1. To assess histone covalent modifications, one of the prerequisites for pituitary

repression/activation of the hGH/CS genes, in human pituitary tissues

(including histone H4 hyperacetylation, histone H3K4 di-/tri-methylation).

2. Using the human embryonic kidney (HEK) 293 cell as a model system, to

further investigate (i) the process by which Pit-1 gains access to chromatin

prior to GH-N activation; and (ii) the mechanisms underlying the consequence

of Pit-1 introduction.

3. To assess the potential for an additional P sequence element and its associated

factor(s), to contribute to the pituitary-repression of the placental genes.

The results relating to these objectives are presented in three chapters. Chapter 3 focuses on assessment of the histone modifications in the hGH/CS locus using post mortem human pituitary tissues. Data from this chapter have contributed to three publications

[152, 154, 155]. In Chapter 4, an attempt has been made to investigate the functional involvement of Pit-1 in chromatin modification and DNA accessibility along the hGH/CS locus using the HEK293 model system has been investigated. This study also extends to the identification of associated factor(s) in this process and subsequent chromatin remodeling. A portion of the results presented in Chapter 4 has been reported in [154].

Identification of an additional P sequence element (PSE-C) and its associated factors is described in Chapter 5, and will be discussed in terms of a possible pituitary-specific repression role in the placental CS/GH-V gene expression in the pituitary. The majority of the data within this chapter have been reported in [153]. Each chapter starts with a

26 brief highlight of the rational, followed by a description of results, limited discussion, and a summary of the findings. A more detailed discussion can be found in Chapter 6.

27 CHAPTER 2

MATERIALS AND METHODS

2.1 Materials.

2.1.1 Antibodies.

2.1.1a CCAAT/Enhancer Binding Protein (C/EBP)

Two antibodies specific to the C/EBP family members were used during the process of identifying the PSE-C associated factors.

The antibody for C/EBPa is an affinity-purified rabbit antibody purchased from Geneka

Biotechnology, Inc. (Cat# 1600016). It is raised against the immunizing peptide

MESADFYEAEPRPP, which is derived from amino acid residues 1-14 of the human

C/EBPa protein sequence. It specifically recognizes C/EBPa.

The C/EBPp (C19) antibody is a rabbit affinity purified polyclonal antibody purchased from Santa Cruz Biotechnology, Inc. (sc-150). It is raised against a peptide mapping at the carboxy terminus of C/EBPP of rat origin, which differs from the corresponding human sequence by a single amino acid. It also reacts with C/EBP |3 of human origin, but does not cross-react with C/EBPa, C/EBP5 and C/EBPe.

28 2.1.1b c-Myc

The c-Myc antibody is a mouse monoclonal antibody that recognizes the c-myc epitope tag specifically. It was raised against a synthetic peptide that corresponds to residues

408-439 of the human p62-c-myc protein. Purchased from Clontech Laboratories, Inc.

(Cat# 3800-1).

2.1.1c ETS Family Members

Two antibodies specific to ETS family members were used.

The Ets-1 (N-276) antibody is an affinity purified rabbit polyclonal antibody purchased from Santa Cruz Biotechnology, Inc. (Cat# sc-111). It is raised against a peptide mapping within the highly divergent amino terminal domain of Ets-1 of human origin.

The Elk-1 (1-20) antibody is an affinity purified rabbit polyclonal antibody purchased from Santa Cruz Biotechnology, Inc. (Cat# sc-355). It is raised against a peptide mapping at the C-terminus of Elk-1 of human origin.

2.1.1d Hepatocyte Nuclear Factor-3 (HNF-3)

Several antibodies specific to the HNF-3 family members were used.

The HNF-3a/p (C-20) antibody is an affinity purified goat polyclonal antibody

purchased from Santa Cruz Biotechnology, Inc. (Cat# sc-6553). It is raised against a

peptide mapping at the carboxy terminus of HNF-3 a/fJ of human origin. Even though the

29 C-20 antibody is claimed to recognize both HNF-3a and HNF-3(3, to date, no report has indicated that it is used for HNF-3P identification.

Two other antibodies were used specifically to recognize HNF-3a, including HNF-3a

(H-120) and HNF-3a (T-20). The HNF-3a (H-120) is a rabbit polyclonal antibody purchased from Santa Cruz Biotechnology, Inc. (Cat# sc-22841). It is raised against a recombinant protein corresponding to amino acids 51-170 mapping near the amino terminus of HNF-3a of human origin.

The HNF-3a (T-20) antibody is an affinity purified goat polyclonal antibody also purchased from Santa Cruz Biotechnology, Inc. (Cat# sc-9186). It is raised against a peptide mapping near the carboxy terminus of HNF-3a of human origin.

An antibody specific to FTNF-3|3 was also used. The HNF-3J3 antibody is a sheep immuno-affinity purified immunoglobin (IgG) purchased from Upstate Biotechnology,

Inc. (Cat# 07-180). It is raised against a GST (glutathione-S-transferase) fusion-protein corresponding to the full length of rat FTNF-3p\ It also recognizes FTNF-3|3 of human and mouse origin. Cross reactivity with FTNF-3a and HNF-3y has never been tested.

2.1.1e Nuclear Factor-1 (NF-1)

The NF-1 (H-300) antibody is a rabbit polyclonal antibody purchased from Santa Cruz

Biotechnology, Inc. (Cat# sc-5567). It is raised against a recombinant protein corresponding to amino acids 1-300 mapping at the N-terminus of human NF-1.

30 2A.lt Pit-1

Three Pit-1 antibodies were used. The Pit-1 (X-7) is the Pit-1 antibody used in this thesis unless otherwise stated. The Pit-1 (X-7) is an affinity purified rabbit polyclonal antibody purchased from Santa Cruz Biotechnology, Inc. (Cat# sc-442). It is raised against a polyhistidine fusion protein construct containing sequences corresponding to the full length of rat Pit-1. It also cross-reacts with Pit-1 of mouse and human origin.

The Pit-1 (N-20) antibody is an affinity purified goat polyclonal antibody purchased from

Santa Cruz Biotechnology, Inc. (Cat# sc-16288). It is raised against a peptide mapping at the N-terminus of human Pit-1. It also cross-reacts with Pit-1 of rat and mouse origin.

It was used to recognize partial-deleted Pit-1 proteins expressed from different Pit-1 cDNAs. It was used to confirm the presence of Pit-1 dimer in the human pituitary samples after immuno-precipitation using the "Universal Magnetic Co-IP Kit".

The Pit-1 (2C11) antibody is a mouse monoclonal antibody purchased from Santa Cruz

Biotechnology, Inc. (Cat# sc-47761). It is raised against amino acids 30-146 of rat Pit-1.

It also cross-reacts with Pit-1 of human and mouse origin.

2.1.1g Regulatory Factor XI (RFX1)

The RFX1 (D-19) antibody is an affinity purified goat polyclonal antibody. It is raised against a peptide mapping within an internal region of RFX1 of human origin. Purchased from Santa Cruz Biotechnology, Inc. (Cat# sc-10650).

2.1.lh Histone Covalent Modifications

i) Hyperacetylated Histone H4

31 The anti-hyperacetylated histone H4 antibody is a polyclonal rabbit antibody. It is raised against a KLH (keyhole limpet hemocyanin)-conjugated synthetic peptide

(AGGACKGGACKGGACKGGACKGGC), corresponding to amino acids 2-19 of

Tetrahymena thermophila histone H4. It also recognizes hyperacetylated histone H4 of other origins like human. The Lysine residues from human histone H4 tails are modified by acetylation at position 5, 8, 12 and 16 sequentially. This antibody is reported to detect the tri- and tetra-acetylated forms, but not the mono- or di-acetyl forms, of histone H4.

Purchased from Upstate Biotechnology, Inc. (Cat# 06-946). ii) Di-methyl-Histone H3 Lys (K) 4

The anti-dimethyl-histone H3K4 antibody is a rabbit antiserum. It is raised against a

KLH conjugated synthetic peptide (ARTme2KQTAR-GGC) corresponding to amino acids

1-8 of human histone H3K4. Purchased from Upstate Biotechnology, Inc. (Cat# 07-

030). iii) Tri-methyl-Histone H3 Lys (K) 4

The anti-trimethyl-histone H3K4 antibody (ChIP grade) is a rabbit polyclonal antibody.

It is raised against a KLH conjugated synthetic peptide (ARTMe3KQTAR-GGC), corresponding to amino acids 1-8 of human H3K4. Purchased from Abeam, Inc. (Cat# ab8580).

2.1.2 Cell Lines

The cell lines used include GC (rat pituitary adenoma cell line), HEC-1 (human uterus adenocarcinoma cell line), HEK293 (human embryonic kidney 293 cell line), HeLa

32 (human cervical carcinoma cell line), and SK-Hep (human liver adenocarcinoma cell line).

Generally, cells were maintained at 37°C in a monolayer culture in Dulbecco's modified

Eagle's Medium (DMEM) (Invitrogen Corp., Cat# 12100-061) supplemented with 500 uM glutamine and antibiotics (50 U/mL penicillin, 50 ug/mL streptomycin), and fetal bovine serum (FBS) at an appropriate (v/v) percentage in a humidified air/C02 (19:1) atmosphere. GC, HEC-1, HeLa and SK-Hep cells require 8% FBS-DMEM (v/v), and

HEK293 cells usually need 5% FBS-DMEM (v/v) for maintenance. Cells were washed with calcium- and magnesium-free phosphate buffered saline (PBS-CMF). Trypsin-

EDTA was used to lift the cells after a single wash in PBS-CMF. Cell stocks were maintained at -80 °C in 90% FBS, 10% dimethyl sulfoxide (DMSO).

2.1.3 Human Pituitary Tissue Samples.

The post-mortem human pituitary tissue samples were kindly provided by Dr. Robert

Shiu (Human Pituitary Repository, Protein and Polypeptide Laboratory, University of

Manitoba).

2.1.4 Other Nuclear Extract/Protein Samples, i) LNCaP Nuclear Extract

The LNCaP (clone FGC) samples were generously provided by Dr. Robert J. Marusik

(Department of Cell and Developmental Biology, Vanderbilt University Medical Center), purchased from Geneka Biotechnology, Inc. (Cat# 1011373).

33 ii) Recombinant Pit-1 Protein

The recombinant Pit-1 protein, Pit-1 (FL), is purified from bacterial lysates (>98%) by

Ni"1^ affinity column chromatography. The recombinant Pit-1 protein was used in this thesis to assess (i) the potential binding to DNA elements, and (ii) possible heterodimer(s) formation with other transcription factors such as Oct-1. It is purchased from Santa Cruz Biotechnology, Inc. (Cat# sc-4014).

2.1.5 Oligonucleotides

Single-stranded oligonucleotides were purchased from Invitrogen Biotechnology, Inc, and resuspended in double-distilled H2O. Double-stranded oligonucleotides were generated by mixing equal masses of sense (S) and antisense (AS) oligonucleotides, and incubated for 10 minutes in a boiling water bath. After the heat source was removed, the oligonucleotides were left in the water bath overnight to anneal.

The sense strand for each oligonucleotide, from 5' to 3', is given in Table 2.1.

Primers sets for polymerase chain reaction (PCR) are listed in Table 2.2, 2.3, 2.4 and 2.6 according to the different sections of this thesis.

Sequence and strand-specific reverse transcription (RT) primers are listed in Table 2.5.

41 Pm5(PSE-Cm) GGAAGCGTTTGCCTGTTACTTTCATTGTGCTTCTACAGA GT C/EBP TGCAGATTGCGCAATCTGCA TTR TGACTAAGTCAATAATCAGAATCAG

34 RF-1 CTCATCAACTTGGTGTGGACGGC PSE-A3 TGTTGGTTGCCAACACCACTGCCAACCA PSE-B4 GATGGCAGGGCCCCAGCA CSp Pit-1 CACCTGTTTCTGTGTACATTTATGCATGGGGCCACTGAC G HSI/II AGCTTGGGCCTCAAGCTGACCTCAGGTGATGTTTATATT TCTGAGCTGTTTATTCCATGAACTGAACATCTGACAGCT TTTCAGAGCT Oct-1 consensus TGTCGAATGCAAATCACTAGAA Oct-1 mut TGTCGAATGCAAGCCACTAGAA Oct-1 a CCAACCACCACCAGAGGGAAGCAGA Oct-1 b GGTTTATGTGGTGTTTATGGGTGGT Oct-1 c TCAGTTTGGGGAAGATCCACTCAGG Oct-1 d CTGGAGAGCGGAAGTGGCAGGTAAACACAG HS III wt CCACTCAGGCCCTGGAGAGCGGAAGTGGCAGGTAAAC ACAG HS III m CCACTCAGGCCCTGGAGAGCTCGCTGAGCAGGTAAACA CAG mETS/HS III CCACTCAGGCCCTGGAGAGCAGAAGTGGCAGGTAAAC ACAG Mutated sequences are indicated by underlining.

Table 2.2 PCR Primi; r Sets For Chromatin Immunoprecipitation. ^^S^^^S ^^S^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^m HSV (F) CTAAACTCGAGTAGAGGATAAGTGTGAGGAC HSV (R) CCATCCTCGAGCGAGCTGGACCACCTTAACTT HSIV (F) TCCCAGGGATCCGGGAAGAAGTGGTGGAC HSIV (R) CAAAAGAAGCTTCCCACGTAATAAGGGAGGCAC HSIII (F) TGCGTCAAGCTTGGGCACTGTCCCGATTCGAG HSIII (R) AGGCTCGAGCTCGGGTGCAGGCACCTTGTTTC HSI/II (F) GATATCAAGCTTCCCGGGTCAGTCTCTCTCCAG HSI/II (R) TAAGGTGAGCTCCGAGGAACAGCCCGTTCC GHp (F) GCTATGCTCGGCGCCCATCGTCTGC GHp (R) GAAGGACCGCCCACCAAGGTCT CSp (F) CACAGAAACAGGTGGGGTCA CSp (R) GAAGGACCCCCCACCAAGAAGGAC 263P (F) ATGTCTGGATCCTCCTACTGGC 263P (R) AGCTCGGATCCCACTCTGTAGAAAC HNF-263P (F) ATGTCTGGATCCTCCTACAGGC HNF-263P (R) TCGGATCCCACTCTGTAGAAGCACAA Enh (F) GTCTACATTTCAGCTCATCAACTTGG Enh (R) GCTGTGAACACATGGGGTCTCATCTTTGCGG

35 Prlp (F) CCTCCAAACCAATCTAGTCTCAGATCTCACC Prlp (R) GGAAGTCTCACGGTTTTCTCTTTCCC hFGF-16ex3 (F) GAAGAAACTCACACGTGAATGTG hFGF-16ex3 (R) TTACCTATAGTGAAAGAGGTCTC

Table 2.3 PCR Primers for RT-PCR.

HNF-3 DNA BD IF1 CATCTCGCTCATCACCATGGCCATCC HNF-3 DNA BD IRL GTAGCAGCCGTTCTCGAACATG Rat/human HNF-3a (F) CAGGGTGGCTCCAGGATGTTAGG Rat/human HNF-3ct (R) GGTTCTGACGGTAATAGGGGAAG Rat HFH3BF (E) TGAAGCCGCCCTACAGCTACATAG Rat HFH3BF (R) CGCCGCCGCCGCCGCAGGAAGCTG

Table 2.4 PCR Primers for Non-coding Bi-directional Transcripts Detection. ^^^^^S^^^^^^^B^^K^^^ll^^li^^^^E^^^^^^^^^^^^^^^^^^^^^^^^^^^SI^^^^ S PO/GAPDH (F) GGTGTGAACCATGAGAAGT PO/GAPDH (R) AGGGATGATGTTCTGGAGA Pl/GH-N (F) AGGCTTTTTGACAACGCTAT Pl/GH-N (R) CACTCAGCGTGTGCTCATCT P2/GHp (F) CCTCTGGTCCATGGTTACCAC P2/GHp (R) GGGGCAGGGAGCCCCCATGAC P3/CD79 (F) CCTATGAGGACATAGTGACG P3/CD79 (R) CAGAGAACTCCCTCCAAGTT P4/HS I/II (F) GATATCAAGCTTCCCGGGTCAGTCTCTCTCCAG P4/HS I/II (R) TAAGGTGAGCTCCGAGGAACAGCCCGTTCCG P5 (F) CTGAGGATTGCCAAGCCCAAC P5 (R) CATTCTCGTGGCCATACATC P6 (F) CACTCCCCCACTTCAGGGTA P6 (R) GGGCAGGCAGCGACATCAT P7 (F) GCCGCAGTACGAGGTGAACC P7 (R) CCTGGCCCAGCAGTCTCATT P8 (F) CCTGGGTGGCGTAGAGATG P8 (R) GACCCACGTTGTCGTAGTTG P9/HS III (F) GCATGTCTATACTCCAACCACCAC P9/HS III (R) GGCACCTTGTTTCAAAGCCCTG P10 (F) GAGGAGTTTCTTACTTCATACA P10 (R) GGGGATCAGTGCGTGCAAGG Pll/HSIV (F) TCCCAGGGATCCGGGAAGAAGTGGTGGAC Pll/HSIV (R) CAAAAGAAGCTTCCCACGTAATAAGGGAGGCAC P12/HSV (F) CCATCCTCGAGCGAGCTGGACCACCTTAACTT P12/HSV (R) CTAAACTCGAGTAGAGGATAAGTGTGAGGAC PI 3 (F) TAGCCTCCTAAGTCTTTCCG PI 3 (R) GTCGCCGAGCTTCCAGGACT PI 4 (F) GAGACCCGCCGAGGAGACG P14 (R) GGTGGCGTGGCCTGCTCTA

RTP1 caccaaggtctacgc PI agtatcgccatgtaa RTP12 RTP2 ggtagtgtgatgctac P2 gctctgggaagatcta RTP13 RTP3 tccgagtccatttgc P3 gttccacttaatgtc RTP14 RTP4 caggacctgagccacggaag P4 gctcaggaagagtatt RTP15 RTP5 cagccccatagtgggtcc P5&P6 tggcatttgcaaacag RTP16 RTP6 gggcactgaggagcttcg P7 ccctatcccactatac RTP17 RTP7 ggggttgggtacaacg P8 gccctccctaattgac RTP18 RTP8 atggccccaaccgtga P9&P10 ccatccctgccaatag RTP19 RTP9 agcccaacaacagcaa Pll gatgtcatgtgaccct RTP20 RTP10 ggcactttggcccacact P12&P13 caggaaatgtctatcc RTP21 RTP11 ccagctcagcatttta P14 gagcgttttcagatag RTP22

Table 2.6 Primer sets for Quantitative Real-Time PCR. l^tw^^^^^^^^S^RSfl 'SmM^MM^^i^MW^^^^SM^m^MSS^MB': humanGH-N (F) CCTCTGACAGCAACGTCTATGA humanGH-N (R) GCAGCAGTGTTTCTCTAACACA humanCS-A (F) GGCTTCTAGGTGCCCGAGTA humanCS-A (R) GCACTGGAGTGGCACCTTCA humanCS-B (F) CCTCTGGTCCATGGTTACCAC humanCS-B (R) GGGGCAGGGAGCCCCCATGAC humanGH-V (F) CCTATGAGGACATAGTGACG humanGH-V (R) CAGAGAACTCCCTCCAAGTT

37 2.2 Methods.

2.2.1 p%Galactosidase Staining

The HEK293 cells were transiently transfected with a commercial plasmid pCHHO

(containing a functional LacZ gene) according to the manufacturer's instructions.

Seventy-two hours after gene transfer, in situ X-Gal staining was performed to monitor the successful transfection in these cells. In brief, cells were washed with PBS-CMF three times, followed by fixation for 5 minutes at room temperature in fixation buffer

[0.05M NaP04 pH 7.4, 2mM MgCl2, 0.2% glutaraldehyde, 0.02M formaldehyde]. Cells were then washed three times in wash buffer [0.05M NaPC^ pH 7.4, 2mM MgCb, ImM

NP-40 (v/v)]. After the addition of the X-Gal buffer [0.12M NaP04 pH 7.4, 5mM

MgCl2, 5mM K3Fe(CN)6, 5mM K4Fe(CN)6, 1.2mg/mL X-Gal], cells were incubated at

37°C overnight (-15 hours). Blue cells were observed and counted under the microscope the next day.

2.2.2 Chromatin Immunoprecipitation (ChIP) Assay

i) Human Pituitary ChIP Assay

ChIP assay using post-mortem human pituitary tissues was performed according to a published protocol [152] as previously described [156]. All steps, with the exception of filtering and cross-linking, were conducted at 4°C.

38 Approximately 2.5-3.5 grams (2-3 pooled) of human pituitary samples were scissor minced in 20 mL tissue nuclei isolation buffer (TNIB) [lOmM HEPES pH 7.9 at 4°C, lOmM KC1, 1.5mM MgCl2], with freshly added 9.1mM N-butyric acid sodium salt, ImM

PMSF, 0.1% NP-40 and protease inhibitors (1 Complete Mini protease inhibitor tablet per 50 mL of TNIB, Roche). TNIB containing these additives is referred to as TNIB+.

Samples were homogenized using a Brinkmann mechanical homogenizer in approximately 2.5 mL aliquots for 15 passes. The homogenates were pooled together and filtered through 2 layers of sterile cheesecloth. Filtered homogenate, as well as the cheesecloth (Gauze sponges) rinsed with additional TNIB+, were combined and centrifuged at 2,000 rpm for 10 minutes in a HNS centrifuge with swinging buckets at

4°C. The nuclear pellet was resuspended in TNIB+, and followed by a second homogenization, until free nuclei with very few clumps of cells were observed under the microscope.

The isolated nuclear pellet was then resuspended in HEPES buffer [lOmM HEPES pH

7.5, 3mM MgCl2, lOmM NaCl, ImM PMSF] to approximately 20 A26o units/mL, and equilibrated to room temperature for cross-linking. Cross-linking was performed by the addition of a 37% formaldehyde solution to a final concentration of 1% for exactly 5 minutes. The cross-linking reaction was quenched by the addition of glycine to a final concentration of 0.125 M.

Cross-linked nuclei were pelleted at 2,000 rpm in a HNS centrifuge with swinging

39 buckekts for 10 minutes at 4°C, followed by a rinse with RSB buffer [lOmM Tris-HCl pH 7.5, 3mM MgCl2, lOmM NaCl, ImM PMSF]. Pelleted nuclei were then resuspended in lysis buffer [50mM Tris-HCl pH 8.0, 1% SDS, lOmM EDTA, ImM PMSF] with the presence of protease inhibitors (40 \iL of a solution containing one Complete Mini protease inhibitor tablet dissolved in 2 mL sdH20) for 10 minutes on ice. A total time of

90 seconds (3x in 30 second bursts) of mechanical sonication was performed to shear the chromatin by using 40% output of the sonicator (Vibra Cell™, Sonics and Materials

Inc.). The insoluble materials from the sonication were then removed by centrifugation using the bench top MicroMax centrifuge {Thermo IEC) at 10,000 rpm for 10 minutes at

4°C. The supernatants were "chromatin input" for immunoprecipitation. The A260 of a sample in 2M NaCl/5M urea was used to assess the DNA content. Chromatin units were calculated by (200 x A260) unit/mL.

For the following immunoprecipitations, 5 mL samples, containing 2 units of chromatin input from the above calculation, were prepared in dilution buffer [16.7mM Tris-HCl pH

8, 167mM NaCl, 1.2mM EDTA, 1.1% Triton X-100, 0.01% SDS, ImM PMSF] with protease inhibitors [200 \iL of a solution containing one Roche Complete Mini™ protease inhibitor tablet dissolved in 2 mL of sdH20]. An extra 2 unit chromatin sample was put aside to represent the immunoprecipitation input. Samples were pre-cleared for 3 hours at 4°C using 80 uL protein A/G plus agarose {Santa Cruz Biotechnology, Inc.) and

25 [xg of sheared salmon sperm DNA on a rotating platform. Specific antibodies (25-50 uL as appropriate) were added to the pre-cleared samples and incubated at 4°C overnight.

The following day, 80 uL protein A/G plus agarose and 50 \ig of sheared salmon sperm

40 DNA was added into the samples for a 1 hour incubation on a rotating platform. Samples were washed for 10 minutes at 4 °C in 5 mL of each wash buffer as follows: low salt buffer [20mM Tris-HCl pH 8.0, 150mM NaCl, 2mM EDTA, 1% Triton X-100, 0.1%

SDS]; high salt buffer [20mM Tris-HCl pH 8.0, 500mM NaCl, 2mM EDTA, 1% Triton

X-100, 0.1% SDS], LiCl buffer [lOmM Tris-HCl pH 8.0, 0.25M LiCl, ImM EDTA, 1% deoxycholic acid sodium salt, 1% NP-40], and twice in lx TE buffer [lOmM Tris-HCl pH 8.0, ImM EDTA]. After the final wash, samples were eluted twice in 1.25 mL of freshly prepared elution buffer [1% SDS, 0.1M NaHCOs] for 15 minutes at room temperature, and cross-links were reversed by incubation at 68 °C for 6 hours. DNA was isolated using QIAquick PCR purification kit (Qiagen) according to manufacturers instructions. Each bound sample was eluted with 60 |xL of EB buffer.

For ChIP DNA analysis, 10 ng of input DNA or 5 ^L bound sample were used as a template. PCR primers used in ChIP PCR analysis are listed in Table 2.2. PCR reactions {Taq DNA polymerase, Qiagen) were performed at an annealing temperature of

55 °C for 27 cycles. Specific amplicons from PCR amplification were detected using 2% agarose gel electrophoresis. The results were expressed as bound/input ratios to correct for normal variation in primer pair efficiencies. Densitometry analysis of PCR products were read using the FluoChem 8900 program and pooled together.

ii) HEK293 ChIP Assay

ChIP experiments from cultured HEK293 cells were performed using a modified human tissue ChIP procedure as previously described [152, 156]. In brief, cells were harvested

41 48 hours after transfection in cold PBS buffer and cross-linked with formaldehyde before lysis. Sonication of chromatin was performed for a total time of 80 seconds in 10-second pulses. After sonication, insoluble material was removed by centrifugation and the DNA content was measured by spectrophotometry. Chromatin was pre-cleared for 3 hours and then immunoprecipitated overnight at 4°C, reverse cross-linked at 68°C, and DNA was isolated using QIAquick columns (Qiagen). Polymerase chain reaction (PCR) was performed using 10 ng of input DNA or 5 ul bound DNA samples per PCR reaction (Taq

DNA polymerase; Qiagen) at 55°C annealing temperature for 27 cycles.

2.2.3 Electrophoretic Mobility Shift Assay (EMSA).

i) Preparation of Nuclear Extracts.

Nuclear protein extracts from rat pituitary GC and HEK293 cells were harvested according to a published protocol, based on salt extraction [157, 158]. In brief, cells were harvested by PBS-CMF containing EDTA (ImM) and pelleted by centrifugation. The cell pellets were resuspended in 400 \xL cold hypotonic Buffer A [lOmM HEPES-KOH pH 7.9 at 4°C, 1.5mM MgCl2, 10mM KC1, 0.5 mM dithiothreitol, 0.2mM PMSF]. The cells were then allowed to swell on ice for 10 minutes, and followed by centrifugation for

10 seconds. For high-salt extraction, the cell pellets were resuspended in 20-100 U.L cold high salt Buffer C [20mM HEPES-KOH pH 7.9 at 4°C, 25% glycerol, 420mM NaCl,

1.5mM MgCl2, 0.2mM EDTA, 0.5mM dithiothreitol, 0.2mM PMSF], and incubated on ice for 20 minutes. Insoluble cellular debris was removed by centrifugation and the supernatant fraction was stored at -80°C.

42 The procedures for nuclear protein extracts from the human pituitary samples, were conducted at 4 °C. Up to 2 grams of post-mortem human pituitary tissues were diced into very small pieces using a clean razor blade. Five times the packed cell volume of cold

Buffer A was added to the tissue, and incubated on ice for 10 minutes. Cells were pelleted, resuspended in cold Buffer A with 2x packed cell volume, and homogenized in a 15 mL Dounce tissue grinder with the loose "B" pestle until free nuclei were observed under the microscope. Nuclei were then pelleted at 2,000 rpm in the HNS centrifuge with swinging buckets, followed by an additional centrifugation in the JA-20 rotor of the

Beckman J2-21 at 15,000 rpm for 20 minutes at 4°C. The nuclear pellet was resuspended in cold Buffer C and homogenized with the Dounce tissue grinder. The nuclei were then incubated on a rotating platform at 4°C for 30 minutes before centrifugation in the JA-20 rotor of the Beckman J2-21 at 15,000 rpm for 30 minutes at 4 °C. The supernatant was collected and dialysed in molecular porous membrane dialysis tubing (MWCO. 6-8,000,

Spectrapor/Por) against Buffer D [20mM HEPES-KOH pH 7.9, 20% glycerol, 0.1M

KC1, 0.2mM EDTA, 0.5mM DTT, ImM PMSF] at 4 °C for 3 hours. Insoluble material was removed by centrifugation in the JA-21 rotor of the Beckman J2-21 at 15,000 rpm for 30 minutes. The nuclear protein was aliquoted in 50-500 \xL volumes, frozen in a dry ice/ethanol bath, and stored at -80°C. Protein concentration was assessed using the Bio-

Rad Protein Assay (Bio-Rad) with lmg/mL bovine serum albumin as a standard.

ii) DNA and Protein Interactions and Native Gel Electrophoresis.

For EMSA, 2-5 [ig of nuclear protein was pre-incubated with 2 u.g polydeoxyinosinic-

43 polydeoxycytidylic acid (poly dl-dC) as well as competitor oligonucleotides in a reaction buffer [lOmM Tris-HCl pH 7.5, 50mM NaCl, ImM dithiothreitol, ImM EDTA, 5% glycerol] or Buffer D [20mM HEPES-KOH pH 7.9, 20% glycerol, 0.1M KC1, 0.2mM

EDTA, 0.5mM DTT, ImM PMSF] for 10 minutes at room temperature. Following pre incubation, 1 ng double-stranded competitor oligonucleotides were used in mass excess of the probe amount unless otherwise indicated. Radiolabeled oligonucleotide probes were added, and the reactions were incubated for a further 10 min at room temperature.

In order to detect the "supershift", 2 ^ig of specific antibodies were used. As a negative control for addition of antibodies, 2 \iL of normal rabbit serum was also added, and reactions were incubated for an additional 10 minutes at room temperature. DNA-protein complexes were resolved in non-denaturing 5% (w/v) polyacrylamide gels.

Electrophoresis was performed with 0.5x Tris-borate-EDTA (TBE) buffer [5mM Tris-

HCl pH 8.0, 5mM boric acid, O.lmM EDTA] at room temperature. DNA-protein complexes were visualized by autoradiography.

2.2.4 Gene Transfer and Reporter Gene (Luciferase) Assay

i) Transient Transfection by Calcium Phosphate/DNA Precipitation

For transient gene transfer experiments with rat pituitary GC cells described in Chapter

5, the calcium phosphate/DNA precipitation method was used, essentially as previously described [147].

44 Cells were plated at a density of lxlO6 cells per 100 mm plate 24 hours prior to transfection. For DNA precipitation, 750 mL of a 250mM CaC^ solution, containing 30 u.g of reporter gene plasmids, and 60 ng of pRL-TKp.Luc (Renilla luciferase) plasmid

(Promega Corp.) as an internal control for DNA uptake, was 'bubbled' drop by drop into

750 mL of 2x HEPES solution [280mM NaCl, 50mM HEPES, 1.5mM dibasic

Na2HP04]. The resulting solution was left to precipitate at room temperature for 30-45 minutes. A single precipitation was divided among three plates to obtain triplicates.

Cells were washed thoroughly twice with PBS-CMF (calcium- and magnesium-free phosphate buffered saline) 20-24 hours after gene transfer, and provided with fresh growth medium. Cells were harvested 48 hours after DNA removal using 4 mL of PBS-

CMF containing ImM EDTA. Cells were then pelleted by centrifugation and lyzed in

100-250 uE of lysis buffer [lOOmM Tris-HCl pH 7.8, 0.1% Triton X-100] for 10 minutes on ice, and centrifuged using the bench top MicroMax centrifuge (Thermo IEC) at

13,000 rpm for 15 minutes at 4 °C to remove insoluble material.

ii) "Minis" Trans-IT293 Kit

For transient transfection of HEK293 cells, a Mirus Trans-IT293 kit (MIR 2700, Mirus

Biol Corp.) was used according to the manufacturer's instructions. In brief, HEK293 cells were plated 24 hours prior to gene transfer. The "Trans-IT293 reagent" was diluted with serum-free DMEM. Expression vectors, or alternatively, hybrid reporter gene

(luciferase) and pRL-TKp.Luc (Renilla Luciferase) plasmid (Promega Corp.) as a control for DNA uptake were gently mixed into the diluted reagent. A single precipitation was

45 divided among three plates/wells to obtain triplicates. For vector expression, lxlO6 cells were plated per 100 mm plate. Up to 4 u.g of plasmid DNA (expressing vector) as well as

25 ng pRL-TKp.Luc plasmid were used in each 100 mm plate. For reporter genes,

2.5x105 cells were plated into each well of a 6-well plate. Up to 2 \x,g of reporter gene plasmid, as well as 10 ng pRL-TKp.Luc plasmid were used in each well. DNA/reagent mixture was then added onto each plate. Removal of DNA was not necessary according to the manufacturer's instructions. Cells were harvested 72 hours after gene transfer, protein extraction or luciferase assay was performed immediately after harvesting.

iii) Luciferase Assay.

For luciferase assays, cell pellets were lyzed in 50-200 \ih of lysis buffer [lOOmM Tris-

HC1 pH 7.8, 0.1% Triton X-100] for 10 minutes on ice, and centrifuged at 13,000 rpm for

15 minutes at 4 °C to remove insoluble material. Cell lysates were assessed for luciferase activity immediately following harvesting. The luciferase activity from 20 \xh of cell lysate was determined using the Dual-luciferase assay system (Promega Corp.), according to manufacturers instructions, using a photon counting luminometer (LUMAT

LB9507, EG&G Berthold). Values were normalized with either protein concentration, which was assessed using the Bradford Protein assay and BSA as a standard, or through co-transfection with pRL-TKp.Luc and assessment of Renilla luciferase in a dual assay.

2.2.5 Immunoprecipitation and Protein (Western) Blotting.

i) Immunoprecipitation (IP).

46 For immunoprecipitation experiments, all steps were conducted at 4°C. Two hundred \ig

of nuclear extract (from human pituitary tissues or HEK293 cells) was precleared for 1

hour with 20 \ih pre-treated protein A/G plus agarose (Santa Cruz Biotechnology, Inc.).

Precleared extracts were equally divided into control and experimental groups for

immunoprecipitation. Two u.g of specific antibodies were used in the experimental

group. The control group was immunoprecipitated with 2 jxL non-immune serum from the same species as the antibody used in the experimental group. Immunoprecipitation

was carried out overnight. The following day, extracts were incubated with prepared protein A/G plus agarose for 3 hours. Washes were done for 2 minutes as follows:

supplemented NET Buffer [50mM Tris-HCl, pH 7.5; 500mM NaCl; 0.1% NP-40; ImM

EDTA], followed by NET Buffer [50mM Tris-HCl, pH 7.5; 150mM NaCl; 0.1%NP-40;

ImM EDTA], and a final wash buffer [lOmM Tris-HCl; 0.1% NP-40]. Protein A/G

agarose was then pelleted by centrifugation, resuspended in 40 \iL Laemmli sample

buffer [2% sodium dodecyl sulfate, 10% glycerol, lOOmM dithiothreitol, 60mM Tris-HCl

pH 6.8, and 0.001% bromophenol blue], and boiled for 5 minutes. Twenty uL of the

supernatant was resolved by SDS-PAGE at an appropriate percentage. Gels were

transferred onto the polyvinylidene difluoride (PVDF) membranes (Millipore Corp.) and

immunoblotted using specific antibodies as appropriate.

ii) Universal Magnetic Co-IP Kit.

Immunoprecipitations using the 'Universal Magnetic Co-IP kit' (Active Motif) were

performed according to the manufacture's instructions. In brief, 1-2 grams of post

mortem human pituitary tissue samples were used to harvest nuclear proteins according to

47 kit instruction. Nuclear protein samples were quantified by a Bradford-based assay (Bio-

Rad) with bovine serum albumin (BSA) as a standard, and stored in aliquots at -80°C.

Three hundred [xg of nuclear proteins were used in each IP reaction.

iii) Protein (Western) Blotting

In order to assess whole cell proteins, cells with/without transfection were pelleted by centrifugation, and resuspended in 100-200 jxL of whole cell protein lysis buffer [0.4M

Tris-HCl pH 8.0, 0.15M NaCl, 1% NP-40 (v/v), 1% deoxycholate sodium salt (w/v),

0.01M Na3V04, 0.1M NaF, 0.01M PMSF, 1 complete Mini protease inhibitor cocktail tablet {Roche Diagnostics)]. Protein samples were quantified by a Bradford-based assay

(Bio-Rad) with BSA as a standard, and stored at -80°C until processed.

For protein blotting, 10-20 u.g protein samples (whole cell protein or nuclear extract) were boiled for 5 minutes in Laemmli sample buffer and resolved by SDS-PAGE. Gels were transferred and immobilized onto PVDF membranes and blocked with 5% milk-

TBS-T (Tris-buffered saline-Tween 20). Immunoblotting was performed for 1 hour at room temperature using 2 \ig specific antibodies as appropriate. Secondary antibodies for

ECL (Enhanced ChemiLuminescence) purposes were used at between 1:5,000 to

1:10,000 dilution as appropriate. Detection of antibody-antigen complexes was carried out using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific Corp.) according to the manufacturer's instructions. Complexes were visualized on High

Performance Chemiluminescence Film (GE Healthcare Limited).

48 iv) DNA affinity purification

Forty picomoles of double-stranded biotinylated oligonucleotides were coupled to 200 \ig streptavidin magnetic beads (Promega) and washed three times with binding buffer

[lOmM Tris-HCl pH 7.5, 50mM NaCl, 5% glycerol, ImM EDTA, ImM dithiothreitol, and ImM phenylmethylsulfonylfluoride]. A 5-minute pre-incubation of 50 jxg nuclear protein with 5 ^g polydeoxyinosinic-polydeoxycytidylic acid (poly dldC, Pharmacia) was carried out at room temperature. After pre-incubation, nuclear proteins were incubated with oligonucleotide-coupled beads for 25-30 minute at room temperature, with rotation every 3-5 minutes. Beads were then washed three times for 5 minutes each time using 500 uL binding buffer per wash. Bound protein complexes were removed from the beads by boiling for 5 minutes in Laemmli sample buffer, resolved by SDS-

PAGE and immunoblotted using antibodies as appropriate.

2.2.6 Detection of Non-coding Bi-directional Transcripts

In order to assess the non-coding transcript levels along the hGH/CS locus, a series of

PCR primers (Table 2.4) were designed along the hGH/CS locus beginning upstream of

HSV and downstream across HS I/II and to the GH-N promoter. Sequence-specific reverse transcriptase (RT) primers were generated upstream of each anticipated PCR amplicon in both sense and anti-sense directions (Table 2.5). A schematic of the design for sequence-specific RT-PCR is presented in Figure 2.1.

49 RT primer PCR primer • Sense PCR product _ Anti-sense PCR primer RT primer

Figure 2.1 A schematic for sequence-specific RT-PCR. Design for the sequence-specific RT-PCR is shown. The two strands of DNA template (sense and anti-sense) are indicated. PCR primers are indicated by black arrowheads. The sequence-specific RT primer, located upstream of the expected PCR amplicon in both sense and anti-sense directions, are also shown with blue arrowheads.

For reverse transcriptase-PCR (RT-PCR) analysis, 1 \ig of RNA was incubated first with

5 picomolar sequence-specific RT primers, and then reverse transcribed with MMLV transcriptase (Invitrogen). Minus RT reactions were also set up to confirm the absence of genomic DNA contamination. Ten percent (10%) of the RT reaction mixture was used for PCR. PCR was performed at an annealing temperature of 55 °C for 30 cycles using

Taq DNA polymerase (Qiagen). PCR products were resolved in 2% agarose by electrophoresis. Density of each amplicon at the expected size was analyzed using the

FluoChem 8900 program. RT-PCR for the GAPDH (glyceraldehyde 3-phosphate dehydrogenase) gene considered as constitutively active in each group was also performed as the internal control. All the experiments were performed at least three times, and fold effect on transcript levels from three individual experiments was determined.

50 2.2.7 Plasmid Constructs.

Restriction enzymes were purchased from either New England BioLabs (NEB) or

Promega. Restriction enzyme digested plasmids were purified from agarose gels with a

GFX PCR DNA and gel band purification kit (Amersham). Ligations were performed with T4 ligase (NEB) at room temperature from 4 hours to overnight.

i) Hybrid Reporter Constructs.

The plasmids pXPl and pT81Iuc (TKp.Luc) were obtained from Dr. Steve Nordeen

(Molecular Biology Program, Department of Pathology, University of Colorado Health

Sciences Center, Denver, Colorado, USA) [156, 159]. The plasmid Renilla Luciferase

(pRL-TKp.Luc) was purchased from Promega Corp.

CSp.Luc: The immediate 5'-flanking region of the CS-A gene (-492/+6) was isolated as an EcoR\/BamH\ fragment (blunted) and inserted into the Hindlll site (blunted) upstream of the firefly luciferase (Luc) gene in pXPl [151, 156]

263PCSp.Luc: The 263P fragment was released from 263P/TKp.Luc as a BamHl/Xhol fragment and subcloned into CSp.Luc [151, 156]

103PCSp.Luc: The 103P fragment containing PSE-A and PSE-B was generated by PCR

[153, 156]. The PCR product was ethanol precipitated, digested with BamHl, isolated and inserted into the same restriction enzyme site of CSp.Luc.

51 263PCmCSp.Luc: A two-step PCR approach (Taq DNA polymerase, Qiagen) with mutated oligonucleotides (PSE-Cm) and 263PCSp.Luc as an initial template was used to introduce the site-specific mutations into 263P. The PCR products were inserted as a

BarnHl restriction enzyme site upstream of the CSp.Luc.

263PCSpAPit-l.Luc: The 263PCSp.Luc plasmids were digested with Nsil, the 3' overhang were removed with Klenow fragment (NEB), and the plasmids were religated

[153].

1.6TKp.Luc: The 1.6-kb Bglil fragment containing hypersensitive sites I/II from the human GH/CS LCR was digested from a PI library containing human genomic DNA

[128]. The 1.6-kb fragment was introduced into the SmallSacl site of the pT81/wc to generate 1.6TK.Luc. The 1.6TK.Luc is described elsewhere as 1.6GTKp.Luc [128].

wtETS/HSIII TKp.Luc and mETS/HSIII TKp.Luc:

The 41-bp fragments from HS III were synthesized with and without mutations in an ETS binding site, and inserted into the Smal site of pT81/wc to create constructs containing the

41 bp wild type (wtETS/HS IIITKp.luc) and mutant (mETS/HS IIITKp.luc) Elk-1 binding sites within HS III upstream of the same reporter (TKp.luc) gene. These were previously described as FP4TKp.luc and m2FP4TKp.luc, respectively [155].

52 ii) Expression Vectors c-Myc Pit-1 (cMyc GHF1)

The cMyc-tagged Pit-1 expressed vector was generated using the epitope-tagged mammalian expression vector set (Clontech). Pit-1 (GHF1) cDNAs were released from pGADGHFl vectors and inserted into the BglU site of the pCMV-Myc (Clontech).

Pit-1 wild type and mutants

The cDNA for rat wild type and mutant Pit-1 proteins, including a complete deletion of the POU homeodomain (APOUHD), and POU-specific domain (APOUs), partial deletion of the N-terminal trans-activation domain (ANg^s), were kindly provided by Dr. H

Ingraham [160] and inserted into the HindllVBamHl sites of the expression vector pcDNA3.1.

RSV-Elk-1

The human Elk-1 cDNA was obtained from Dr. A. D. Sharrocks (University of

Newcastle upon Tyne, UK) [161]. Elk-1 cDNA was subcloned and inserted into pcDNA3.1 through Kpnl/BamHl sites.

2.2.8 Plasmid Transformation and Isolation.

i) Plasmid Transformation.

The DH5a strain of Escherichia coli was used for the propagation of all plasmids. The

ElectroMAX™ DH5a-E™ cells were purchased from Invitrogen. To introduce plasmid

53 DNA, the MicroPulser Electroporator {Bio-Rad) was used according to the manufacturer's instructions. Transformed DH5a cells were then plated onto LB-Agar plates containing antibiotics.

ii) Plasmid Isolation.

For small scale plasmid preparation, single bacterial colonies were incubated in 2 mL of

L Broth with antibiotics and grown at 37 °C with vigorous shaking overnight. Plasmid

DNA was isolated using the QIAprep® Spin Miniprep Kit (Qiagen) according to manufacturer's instructions. For large scale plasmid preparation, single bacterial colonies were incubated in 5 mL of L Broth with antibiotics and grown overnight at 37 °C . The starter culture (5 mL) was then transferred to a large culture of 250 mL L Broth with antibiotics, grown at 37 °C for 12-16 hours with vigorous shaking. Plasmid DNA was isolated using the Plasmid Maxi Kit (Qiagen) according to the manufacturer's instructions. Final DNA pellets from both techniques were resuspended in TE buffer

[0.1M Tris-HCl pH 8.0,lmM EDTA].

2.2.9 Quantitative Real-time PCR (qRT-PCR).

One \ig of RNA samples from cultured cells was used for reverse transcription by the

QuantiTect Reverse Transcription Kit (Qiagen), according to the manufacturer's instructions. Quantitative real time RT-PCR (qRT-PCR) analyses were performed in an iCycler system (Bio-Rad) with specific primers (Table 2.6), using 10% of the reverse transcription samples in each reaction. Reaction volumes of 30 \iL consisted of the

54 following components: 2.5mM MgCl2, 0.025% DMSO, 0.6 u.L (1:1000 dilution) SYBR green (Sigma), 0.3 [i,L (1:1000 dilution) fluorescein calibration dye (Bio-Rad) and 0.75 units platinum Taq DNA polymerase (Invitrogen). Thermal cycling was initiated with a

4-minute denaturation at 95°C, followed by 40 cycles of 95 °C for 30 seconds, annealing at 60 °C for 15 seconds and 72 °C for 30 seconds. Standard curves were generated using plasmids containing the amplicon sequences for GH-N, CS-A/B, GH-V and GAPDH.

Minus RT controls were performed using the same PCR primers and thermal cycle conditions to test for genomic DNA contamination. Specific amplifications were identified by a single peak in the melting curve and a single band in the final PCR product visualized on a 1.5-2% agarose gel. The gene expression level in each sample

(absolute quantification) was calculated from the standard curve and normalized to human GAPDH expression as appropriate. Tests were run in duplicate on independent samples. All amplicon sequences were confirmed by sequencing.

2.2.10 RNA.

i) RNA Isolation.

Total RNA was extracted from cultured cells using QIA shredder and RNeasy Plus Mini

Kits (Qiageri) according to the manufacturers' instructions. The concentration of RNA samples was assessed right after harvesting, and RNA samples were aliquoted in 25 pig,

50 jxg or 100 [xg as appropriate on ice and stored in -80°C until processed.

ii) RNA (Northern) Blotting

55 One hundred \xg of RNA per lane, harvested from cultured cells was run in a 1.5% formaldehyde-agarose gel and transferred onto nitrocellulose membrane. After an over night (16-18 hours) transfer, the nitrocellulose membrane was air dried and baked at

80°C for one hour. Blots were then kept at room temperature until processed. For hybridization, blots were incubated first with prehybridization buffer [50% formamide,

5X SSC, 5X Denhardts solution (50X - 1% (w/v) Ficoll, 1% polyvinyl pyrollidone, 1%

(w/v) BSA, 50mM NaP04 pH 6.5, 0.1% SDS, lOOjag/mL yeast tRNA, 25fxg/mL salmon sperm DNA] at 42°C for 16-24 hours. Radiolabeled probes were prepared in probe buffer [lmg/mL salmon sperm DNA, lmg/mL tRNA]. After boiling for 5 minutes and cooling on ice for another 5 minutes, the radiolabeled probe was incubated with the blot in 15 mL hybridization buffer [50% formamide, 5X SSC, 5X Denhardts solution, 50mM

NaPC>4 pH 6.5, lO^g/mL yeast tRNA, 25^g/mL salmon sperm DNA, 10% (w/v) dextran sulphate] for 24 hours. Blots were washed with washing solution [0.1X SSC, 0.1% SDS] at 65°C for 15 minutes 3 times, air dried, sealed in a plastic bag and then exposed to X- ray film (Kodak BioMax) for autoradiography.

2.2.11 Sequence Analysis

Sequence analysis for the HNF-3 identification in Chapter 5 was analyzed through the

University Core DNA Services, University of Calgary. All plasmid constructs were sequenced through the DNA Sequencing Facility, Robarts Research Institute, London,

Ontario.

56 2.2.12 Statistical Analysis

Statistical analysis was performed using GraphPad Instat® software. Non-parametric one-way analysis of variance (ANOVA) was done in most cases, unless stated otherwise.

For the multiple-group comparisions, Dunnet's posttest was used for comparison between testing groups versus a single control group. Tukey posttest was used for comparison among all testing groups. Differences with a p value <0.05 were considered statistically significant. In Figures, *,/?<0.05, **,/><0.01 and ***,/><0.001.

57 CHAPTER 3

Analysis of Histone Covalent Modifications of the Human Growth

Hormone / Chorionic Somatomammotropin (hGH/CS) Gene Locus in

Human Pituitary Tissue

Highlights of Rationale

• Histone epigenetic modifications in the context of chromatin have been widely

accepted as one of the most important aspects involved in the tissue-specific

expression of the hGH/CS genes, especially histone acetylation and methylation [81,

85, 86].

• To date studies on the covalent modification of histones along the hGH/CS locus

have used tissues from either GH-secreting pituitary adenoma samples or human

growth hormone releasing hormone (hGHRH) /hGH double transgenic mice that were

enriched in somatotrophs [80, 85]. Systematic assessment of histone modifications

using human pituitary tissue has never been reported.

• Previous analysis of specific histone acetylation in the hGH/CS locus has focused

mainly on histone H3 and H4 acetylation on the basic (one and/or two) lysine

58 residues [150]. Moreover, the technique used to detect DNA regions (DNA Southern

blotting) was not as sensitive as is currently available [86, 88, 150].

• The first part of this thesis describes an attempt to assess the histone modification

patterns along the hGH/CS locus using human pituitary tissue samples. Observations

made here are distinct from those previously reported [85, 88, 150] in three aspects,

including (i) increased sensitivity by using a highly sensitive method (PCR) to replace

the traditional DNA (Southern) blotting to detect the DNA regions; (ii) measurement

of histone acetylation at a more precise level using the antibodies specific to the

hyperacetylated histone H4 (hyperacetylation, defined as three or more acetylated

lysine residues getting acetylated on histone H4); and (iii) use of post-mortem human

pituitary tissue samples (obtained from the Human Pituitary Repository, Protein and

Polypeptide Laboratory, University of Manitoba).

59 3.1 Histone H4 Hyperacetylation of the hGH/CS Locus in Human Pituitary.

The chromatin immunoprecipitation (ChIP) assay was used to assess the histone covalent modifications through hyperacetylation along the hGH/CS locus in human pituitary chromatin obtained from whole human pituitaries taken post mortem. Specific antibodies against hyperacetylated histone H4 were used to immunoprecipitate cross-linked and mechanically sheared human pituitary chromatin. PCR was performed on both input and imrnunoprecipitated (bound) chromatin fractions with primer sets designed to detect specific regions of interest along the hGH/CS locus (Figure 1.1), including the upstream hypersensitive sites (HSs) I to V, promoter regions for growth hormone (GHp) and chorionic somatommamotropin genes (CSp) (primers recognize promoters for both CS-A and CS-B genes), as well as P (263P) and downstream enhancer sequences (Enh). The unrelated human fibroblast growth factor (FGF)-16 exon 3 was used as control for background [162]. The PCR product values for both input (I) and bound (B) samples were obtained by electrophoresis and densitometry from digital images. The results are expressed as bound/input (B/I) ratios to correct for possible PCR primer pair variation resulting from different PCR efficiencies.

Previously, histone acetylation of the hGH/CS locus was reported using an alternate technique including the use of pituitary samples from double transgenic mice, which were generated by crossing PI clone mice, containing an 87 kb human genomic insert including the hGH/CS gene locus minus the hCS-B gene, with a line carrying a human

60 growth hormone releasing factor (GRF) transgene [163]. In these pituitaries hGH-N expression was abnormally high [85, 88], a 32 kb acetylated domain encompassing the entire hGH/CS LCR and GH-N promoter was observed, with the peak and center of this

'acetylated domain' located at the pituitary specific HS I/II site [85, 88].

In an analysis of the human pituitary tissues using the optimized ChIP protocol reported previously [152, 156], several regions of the locus, including the upstream DNase-I hypersensitive sites within the locus control region (LCR) and GH-N promoter, appeared to be hyperacetylated (Figure 3.1). A similar modification pattern was observed when an alternative ChIP assay was used in human pituitary tissue samples [85, 150].

61 PQ as

-o 1 H 3 O

HS HS HS HS GHp CSp 263P Enh FGF-16 V IV III MI exon3

Figure 3.1 Histone H4 hyperacetylation of the hGH/CS locus in human pituitary. Chromatin immunoprecipitation (ChIP) assay was performed using anti-hyperacetylated histone H4 antibodies and human pituitary tissues. The mean Bound/Input ratios for each primer set are shown. Significant increase over the FGF-16 exon 3 background level indicates hyperacetylation of the region and is denoted by gray columns. The basal value for FGF-16 exon 3 is 0.35 + 0.12 (n=3). Bars represent standard error of the mean (SEM). Statistical analysis was performed by one-way ANOVA followed by Dunnet's posttest for multiple comparisons with a single control. *,p<0.05. **, p<0.005. HS, hypersensitive site. GHp, GH-N promoter. CSp, CS promoter. Enh, CS downstream enhancer. Data reported in [152]1 and [155]2.

1 Reprinted figure with permission from Molecular Endocrinology. RFX1 and NF-1 associate with P sequences of the human growth hormone locus in pituitary chromatin. Norquay LD, Yang X, Sheppard P, Gregoire S, Dodd JG, Reith W, Cattini PA. Molecular Endocrinology. 2003 Jun; 17(6): 1027-3 8. Url: http://www.ncbi.nlm.nih.gov/pubmed/12624117 Copyright © 2003 by the Endocrine Society. 2 Reprinted figure with permission from Molecular Endocrinology. Binding of AP-2 and ETS-domain family members is associated with enhancer activity in the hypersensitive site III region of the human growth hormone/chorionic somatomammotropin locus. Jin Y, Norquay LD, Yang X, Gregoire S, Cattini PA. Molecular Endocrinology. 2004 Mar;18(3):574-87. Url: http://www.ncbi.nlm.nih.gov/pubmed/14673137 Copyright © 2004 by the Endocrine Society.

62 Within the LCR, HS I/II, HS III, HS IV all showed significantly higher B/I ratios than the

FGF-16 exon 3 background control. FGF-16 is a member of the FGF family, which is preferentially expressed in embryonic brown adipose and postnatal cardiac tissues [162,

164]. Under normal biological and physiological circumstances, FGF-16 is not expressed in pituitary. Therefore, the level of histone modifications associated with the FGF-16 coding region is used to represent the basic modification level on an 'inactive' gene. The basal B/I value for FGF-16 exon 3 was 0.35 ± 0.12 (n=3) in this set of experiments.

Immunoprecipitation with hyperacetylated H4 antibody along the locus revealed a consistent and significant increase in the B/I ratio of HS I/II (1.25 ± 0.2, n=3, p<0.05),

HS III (2.23 ±0.17, n=3, /X0.005) and HS IV (1.27 ± 0.23, n=3,/?<0.05) compared to the basal FGF-16 B/I ratio. Although an increase in the B/I ratio was also seen overall for

HS V (1.44 ± 0.56), it was not significant when compared to the basal FGF-16 background due to the variability. In contrast to the previous studies that a 'peak' of histone acetylation was located in HS I/II [85, 88, 150], the 'peak' of histone H4 hyperacetylation appeared to be located at HS III under the conditions employed, although not significant when compared to HS I/II.

In the promoter region, the B/I ratio for GHp was 1.31 ± 0.12 (n=3), which was significantly higher than background, while the mean B/I ratio of the CSp was nearly equal to that of the background at 0.37 (0.37 ±0.15, n=3). Taken together with the fact that GH-N is expressed in the pituitary while CS-A and CS-B are not, the histone hyperacetylation pattern detected in these promoter regions correlates with the pattern of expression of the corresponding genes in human pituitary.

63 Two other regions implicated in the regulation of placental CS gene expression, including the conserved upstream P sequence [73] and the CS-B downstream enhancer region (Enh)

[165], were also assessed for hi stone hyperacetylation. However, neither the P sequence region, 263P, (0.62 ± 0.07, n=3) nor the Enh region (0.58 + 0.12, n=3) displayed significant hyperacetylation in pituitary samples.

Therefore, assessment ofhistone H4 hyperacetylation revealed a hyperacetylated domain ranging from HS V to the GH-N promoter, with the peak for modification located at HS

III. By contrast, CS promoters, which are not active in the pituitary, are not hyperacetylated. These observations are consistent with a correlation between histone hyperacetylation and hGH/CS gene expression patterns in the pituitary.

64 3.2 Histone H3K4 Methylation of the hGH/CS Locus in Human Pituitary.

Methylation of the core histone tails is another covalent modification that has been reported to be involved in the regulation of hGH/CS gene expression [81, 86]. Different from acetylation, histone methylation is known to be associated with both transcriptionally active and repressed chromatin [46-48]. An additional layer of complexity results from the fact that lysine residues, the major sites for methylation on histone tails, can be methylated in the form of mono-, di- or tri-methylation, and different levels of methylation provide further functional diversity in terms of gene regulation [44].

A higher level of methylation at the lysine 4 (K4) of histone H3 (di- / tri- methyl H3K4) in promoter regions is considered a mark for gene activation [31, 45]. In order to assess the histone H3K4 methylation status along the hGH/CS locus in the human pituitary tissue, the ChIP assay was performed initially using the antibody specific to di-methyl histone H3K4 (Upstate, Cat# 07-030). PCR was performed with primer sets designed to detect specific regions of interest along the hGH/CS locus (described in Section 3.1), including HS V to HS I/II, GHp, CSp, 263P and Enh. Again, detection of FGF16-exon 3 was used as a background control.

The assessment of the histone H3K4 di-methylation revealed a similar modification pattern in the LCR to histone H4 hyperacetylation (Figure 3.2A). The B/I ratio for HS V

(2.74 ± 0.11, n=3, p<0.00\), HS III (1.84 ±0.11, n=35jp<0.01) and HS I/II (1.86 ± 0.10, n=3, p<0.0\) revealed a consistent and significant increase compared to that for FGF-16

65 (1.13 ± 0.06, n=3). By contrast, H3K4 di-methylation at HS IV was not observed (1.06 ±

0.12, n=3). In contrast to the results obtained from histone hyperacetylation, the 'peak' of H3K4 di-methylation appeared to be located at HS V, instead of HS III.

With regards to promoter regions, the GHp also showed a high level of histone modification as reflected in a mean B/I ratio of 1.85 (1.85 + 0.07, n=3,/?<0.01), which was significantly higher than the background. This is similar to the hyperacetylation pattern. By contrast, promoter regions for CS genes (CS-A and CS-B), revealed a significantly low level of modification with a mean B/I ratio of 0.52 (0.52 + 0.03, n=3, p<0.05). As for the other two regions assessed, including 263P (1.58 + 0.10, n=3) and

Enh (1.10 + 0.14, n=3), H3K4 di-methylation was not observed.

The ChIP assay with specific antibodies to detect tri-methyl histone H3K4 was also performed. Data from two independent experiments were generated, which means a statistical analysis was not applied. However, the results from the two experiments yielded the same pattern as di-methylation (Figure 3.2B). The mean B/I ratio of HS IV

(0.99), HS III (1.28), HS I/II (1.08) and GHp (1.37) represent at least a two-fold increase compared to that for the basal FGF-16 exon 3 (0.45). By contrast, a clear increase of

H3K4 tri-methylation at HS V (0.38), CSp (0.23), 263P (0.79) and Enh (0.57) were not observed.

66 HS HS HS HS GHp CSp 263P EnhFGF-16 V IV III I/II exon3

Tri-Methyl H3K4

—s—i •

HS HS HS HS GHp CSp 263P EnhFGF-16 V IV III I/II exon3

Figure 3.2 Histone H3K4 di- and tri-methylation status along the hGH/CS locus in human pituitary chromatin. Chromatin immunoprecipitation (ChIP) assay was performed using anti di- and tri-methyl histone H3K4 antibodies and human pituitary tissues. (A) The mean Bound/Input ratios for each primer set are shown. Significant increase over FGF-16 exon 3 background indicates histone H3K4 di-methylation of the region and is denoted by gray columns. The basal value for FGF-16 exon 3 is 1.13 + 0.06 (n=3). Bars represent standard error of the mean (SEM). Statistical analysis was performed by one-way ANOVA followed by Dunnet's posttest for multiple comparisons with a single control. *,p<0.05. **,p

67 ***, pO.OOl. (B) The Bound/Input ratios for each experiment for each primer set are indicated by squares and dots. The mean values from two experiments are denoted by columns. HS, hypersensitive site. GHp, GH-N promoter. CSp, CS promoter. Enh, CS- B downstream enhancer. Data reported in [154]1.

Two conclusions can be drawn from the analysis of the histone H3K4 di- and tri- methylation status along the hGH/CS locus. First, the LCR, characterized by five DNase-

I hypersensitive sites (l/II to V), showed clear methylation of H3K4 to various extents.

Second, the H3K4 methylation patterns on the gene promoters showed exactly the same modification pattern as H4 hyperacetylation in human pituitary, which is a high level of histone modification at the GH-N promoter but not at the CS promoter. These

observations further support the idea that the chromatin regions from HS V to GH-N promoter is 'labeled' with active markers in pituitary, which may play a role in the

control of gene activation in that tissue.

1 Reprinted figure with permission from S. Karger AG, Neuroendocrinology. Regulation of the human growth hormone gene family: possible role for Pit-1 in early stages of pituitary-specific expression and repression. Cattini PA, Yang X, Jin Y, Detillieux KA. Neuroendocrinology. 2006;83(3-4):145-53. Url: http://www.ncbi.nlm.nih.gov/pubmed/17047377 Copyright © 2006 by S. Karger AG.

68 SUMMARY OF THE RESULTS IN CHAPTER 3

Data presented in Chapter 3 provide a systematic analysis of histone covalent modifications along the hGH/CS locus using human pituitary tissue. Three types of modifications, all considered as 'active markers' for transcription, were assessed, including histone H4 hyperacetylation, di- and tri-methylation of H3K4.

Among the regions assessed, the upstream locus control region (LCR), characterized by the five DNase-I hypersensitive sites (HS I/II-HS V), showed various levels of histone H4 hyperacetylation and H3K4 methylation. The observation that these regions are labeled with "active markers" strongly suggests their functional involvement in the regulation of GH-N gene expression in the pituitary.

The active markers were also detected in the promoter region for GH, suggesting a role in GH gene expression in the pituitary. By contrast, the promoter region for CS genes, which are expressed preferentially in the placenta and not the pituitary, did not show either histone H4 hyperacetylation or H3K4 methylation. These observations suggest that histone modification patterns detected in human pituitary tissues, including histone H4 hyperacetylation, and H3K4 methylation, reflect the pattern of hGH/CS gene expression.

69 CHAPTER 4

Transcription Factors Pit-1 and Elk-1 Participate in a Common

Complex that may Contribute to Human GH-N Gene Activation

Highlights of Rationale

• Functional involvements of the pituitary-specific transcription factor Pit-1 and histone

covalent modifications along the hGH/CS locus have been well described in vitro and

in vivo [85, 88, 150]. The idea that Pit-1 plays a key regulatory role in histone

modification along the hGH/CS locus was best supported by the observation that

deletion of Pit-1 binding sites in HS I/II leads to loss of histone acetylation

throughout the hGH/CS locus, and a remarkable decrease in hGH-N transgene

expression in mice [85]. However, the process by which Pit-1 gains access to the

chromatin prior to activation of the locus control region (LCR) has not been

determined. Thus, the second part of this thesis attempts to explore the events prior

to HS I/II activation and potentially gain insight into the mechanisms that support this

process.

• The basic experimental strategy was to overexpress Pit-1 in a human non-

pituitary/placenta cell line, which thus, contains but does not efficiently express the

70 hGH/CS genes, and assess effects on chromatin remodeling along the hGH/CS locus

in terms of histone modification.

• In the absence of human embryonic cells of the pre-somatotroph lineage, human

embryonic kidney 293 (HEK293) cells transiently transfected with wild type or

mutant Pit-1 cDNAs expression, were used as a model system to examine the

consequences of Pit-1 appearance on the hGH locus, and specifically in the LCR.

The HEK293 cell line was selected for three reasons: (i) it is a human cell line, which

contains an endogenous hGH/CS DNA locus; (ii) it does not express Pit-1, and thus,

does not express hGH/CS genes efficiently; and (iii) a transfection reagent that yields

high transfection efficiency is available commercially for the HEK293 cells, making

these studies technically feasible.

71 4.1 Characterization of the HEK293/Pit-1 Model System.

4.1.1 Transient Transfection in HEK293 Cells Using "Trans-IT293" Reagent

Yields High Transfection Efficiency.

In order to test the transfection efficiency of the "Minis Trans-IT293" reagent (Minis,

MIR 2700), a commercial plasmid pCHl 10 (containing a functional LacZ gene, of which the product can be detected with |3-galactosidase staining) was transfected into HEK293 cells according to the kit instructions. Transfection was monitored by fJ-galactosidase (fJ- gal) staining. Cells stain blue and can be viewed with a microscope after successful transfection. Assessment of non-transfected HEK293 cells was used as a negative control. After P-gal staining, blue cells were observed and counted under the microscope. It revealed that approximately 40% of total cells were transfected in each of three independent transfection experiments (Figure 4.1A).

The Pit-1 expression vector was also tested. The cMyc-Pit-1 expression vector was obtained by introducing the human Pit-1 cDNA into the commercial pCMV-Myc expression vector. To test the expression of this construct, cMyc-Pit-1 plasmid was transfected into the HEK293 cells using the 'TransIT-293' reagent. Whole cell proteins were then harvested and tested by immunoblotting, using antibodies specific to the cMyc tag (Clontech, Cat# 3800-1) and Pit-1 (Santa Cruz, X-7, sc-442), respectively. A protein band of approximately 33 kDa (the expected size for cMyc-Pit-1) was detected by

72 immunoblotting using both cMyc (Clontech, Cat# 3800-1) and Pit-1 antibodies (Santa

Cruz, X-7, sc-442). In addition, no Pit-1 band was detected in the non-transfected

HEK293 control group (Figure 4.1B).

A non-transfected HEK293 transfected HEK293

B non-transfected transfected

M 33 kDa

Figure 4.1 Characterization of the transient transfected HEK293 cell system. (A) Transfection efficiency of the 'Mirus Trans-IT293' reagent was tested using the plasmid pCHHO, and followed by |3-Gal staining. Non-transfected HEK293 cells were also stained as negative controls. Blue cells indicate transfected and expressing cells. (B) The expression vector cMyc-Pit-1 was transfected into HEK293 cells. Twenty |j,g of the whole cell protein was resolved by SDS-PAGE and immunoblotted using both cMyc (Clontech, Cat# 3800-1) antibodies. A band of the expected size of approximately 33 kDa for cMyc-Pit-1 was detected and is indicated by the arrowhead.

The above experiments suggested that at least 40% transient transfection of HEK293

cells could be obtained using the 'Mirus TransIT-293' reagent. In addition, the

73 expression vector for Pit-1 was also tested and shown to code for a 'tagged' (cMyc) Pit-1 protein. Thus, these observations suggest that through the use of a high efficiency transfection reagent and expression of cMyc-Pit-1 protein, the transient transfection system in HEK293 cells would be adequate for our proposed study.

4.1.2 Assessment of Endogenous GH-N RNA Expression in HEK293 Cells.

One of the main reasons that the HEK293 cell line was chosen for this study was that it is human in origin but would not be expected to express endogenous GH and/or CS effectively, or any pituitary or placenta specific transcription factors. To assess this assumption, total RNA from non-transfected HEK293 cells was harvested and assessed for endogenous GH-N expression using RNA (Northern) blotting. Total RNA samples from several other human cell lines, including HeLa (human cervical carcinoma cell line), SK-Hep (human liver adenocarcinoma cell line) and HEC-1 (human uterus adenocarcinoma cell line) were also tested. Due to the high sequence similarity between rat and human GH [73, 132, 166], cross-hybridization between human and rat GH recognition under the same hybridization conditions was expected. Thus, RNA from rat pituitary GC cells was also loaded as a positive control. The 800 bp Hindlll fragment containing the human growth hormone cDNA was radiolabeled and used as a probe to detect GH. No signal was detected in samples from any of the human cell lines assessed.

In contrast, under the same hybridization conditions, detection of rat GH transcripts was observed in the GC cell sample (Figure 4.2).

74 HeLa SK-Hep HEC-1 HEK293 rGC

Figure 4.2 RNA blot analysis of endogenous GH expression. Fifty \xg of total RNA from several human cell lines, including HeLa, SK-Hep, HEC-1, HEK293 cells were subjected to RNA (Northern) blotting. Twenty [xg of total RNA from rat GC cells was also loaded as a control. A 800-bp Hindlll fragment from the human growth hormone cDNA was isolated and radiolabeled as a specific probe. Detection of rat GH transcripts due to the cross reaction of the probe with GC RNA is indicated by an arrowhead. The mobility of 18S and 28S RNAs is also indicated.

These observations, taken together with the lack of endogenous Pit-1 expression (Section

5.1.1) support the idea that the endogenous hGH-N gene is not expressed, or not expressed efficiently in HEK293 cells, or other human non-pituitary cells.

75 4.1.3 The cMyc-tag does not Affect Pit-1 DNA-binding Capacity.

Efficient expression of cMyc-Pit-1 was demonstrated in the HEK293 cells by immunoblotting (Figure 4.1B). To assess whether the epitope cMyc-tag affects the DNA binding, EMSA was done first using nuclear extracts from non-transfected HEK293 cells and from HEK293 cells transfected with a cMyc-tag expression vector. In this experiment, the cMyc-tag vector was introduced into HEK293 cells using 'Mirus-

TransIT293' reagent, to ensure a similar transfection efficiency obtained with cMyc-Pit-

1. An oligonucleotide containing the Pit-1 binding sites from the GH promoter (GHp Pit-

1) was radiolabeled and used as an EMSA probe. Unlabeled GHp Pit-1 oligonucleotide and an unrelated RFT oligonucleotide from the CS-B enhancer region were used as competitors [143]. To detect the binding of Pit-1 via a 'supershift', cMyc antibodies were used in the reactions.

When the GHp Pit-1 probe was incubated with non-transfected HEK293 cell nuclear proteins, two non-specific binding complexes (complexes I and II) were seen, as defined by the observation that both could be competed by specific (unlabeled GHp Pit-1) and non-specific (unrelated RF1) oligonucleotides (Figure 4.3). When HEK293/cMyc nuclear proteins were incubated with GHp Pit-1 probe, an identical binding pattern was observed. Furthermore, adding of the cMyc antibodies did not result in either competition or 'supershift' when compared with normal rabbit serum. The above observation indicated that there was no specific DNA-protein association between the

76 HEK293 endogenous proteins and GH promoter Pit-1 elements. Expression of the cMyc- epitope tag did not reveal any specific DNA-protein association either.

non-transfected cVfyc HEK293 NE HEK293 NE

Figure 4.3 The epitope cMyc tag does not affect DNA-binding capacity. EMS A was performed using the Pit-1 binding sites from GH promoter (GHp Pit-1) as a specific probe. Two nuclear extracts, from non-transfected HEK293 and cMyc-tag transfected HEK293 cells, were used in EMSA. Antibodies against cMyc-tag (Clontech, Cat# 3800-1) were added to detect a potential 'supershift'. Non-specific DNA-protein association band was indicated by arrowhead. FP, free probe. NRS, normal rabbit serum.

The highly similar patterns between the HEK293 and HEK293/cMyc nuclear proteins when incubated with the same GHp Pit-1 probe suggested no difference in DNA-binding ability, specifically to the GHp Pit-1 fragment. No specific DNA-protein associations

11 were observed in either case. Therefore, it was concluded that the expression of the epitope cMyc-tag does not bind to the Pit-1 DNA element.

4.1.4 Pit-1 Expressed in HEK293 Cells is Capable of Associating with Pit-1

Binding Sites In Vitro.

The question of whether Pit-1 can bind to Pit-1 DNA elements from the GH-N promoter and HS I/II region, in the presence of a cMyc tag was assessed. Two fragments containing Pit-1 sites, the GH promoter and HS I/II of the upstream LCR, were radiolabeled and used as EMSA probes. Nuclear proteins from HEK293 cells transfected with cMyc tag vector and with cMyc-Pit-1 were used.

When GHp Pit-1 was radiolabeled and incubated with HEK293/cMyc nuclear proteins, no specific binding complexes were formed on the GHp Pit-1 probe. Addition of cMyc antibody did not result in any competition or supershift compared with normal rabbit serum (Figure 4.4A). However, when the GHp Pit-1 probe was incubated with

HEK293/cMyc-Pit-l nuclear proteins, two specific binding complexes were detected.

Addition of both cMyc and Pit-1 antibodies resulted in competition of the two complexes and clear 'supershift' due to the reduced mobility of an enlarged protein complex (Figure

4.4A). Similar binding patterns were obtained in EMSA competitions when the HS I/II oligonucleotide was used as the radiolabeled DNA probe (HS I/II Pit-1) (Figure 4.4B).

When HEK293/cMyc nuclear proteins were incubated with HS I/II Pit-1 probe, no

78 specific binding complexes were formed. However, two complexes were formed when

HEK293/cMyc-Pit-l nuclear proteins were incubated with HS I/II Pit-1 DNA, but both of them were competed by the addition of Pit-1 and cMyc antibodies. Clear supershift bands were also detected in both cases (Figure 4.4B).

fe g - ft. m m w U-i ON « < 3 ft. % ft. 3 3 ft, 5 ft. in f—' o. o a. £ in 5 S-. wo _ a CO § W &. - . o s % o S + + t> + + + + + +o + 1 + i+ + N

» # '* 4 I i inPrn

cMyc 293 NE cMyc-Pit-1 293 NE cMyc 293 NE cMyc-Pit-1 293 NE

Figure 4.4 Pit-1 expressed in HEK293 cells binds DNA from the GH promoter and locus control region (LCR). EMSAs were performed using nuclear extracts from HEK293/cMyc and HEK293/cMyc- Pit-1 cells with different probes to assess DNA-binding. (A) The GHp Pit-1 sites were radiolabeled as a probe. Unlabeled GHp Pit-1 oligonucleotides were used as competitors. Specific antibodies to cMyc-tag (Clontech, Cat# 3800-1) and Pit-1 (Santa Cruz, X-7, sc- 442) were used to detected 'supershift'. (B) The HS I/II Pit-1 sites were radiolabeled as probe. Unlabeled HS I/II oligonucleotides were used as competitors. cMyc antibody and Pit-1 antibodies were used to detect a 'supershift'. Specific binding complexes are indicated by black arrowheads. 'Supershift' region is indicated by open arrowhead. FP, free probe. NE, nuclear extracts. NRS, normal rabbit serum.

79 Using EMSAs, the ability ofcMyc-Pit-1 to bind Pit-1 sites associated with both the GH-N promoter and LCR was demonstrated.

4.1.5 cMyc-Pit-1 Expressed in HEK293 Cells Can Trans-Activate a Reporter Gene

Via Association with a HS I/II Fragment.

Having established a relatively high transfection efficiency and confirming expression of

cMyc-Pit-1 in HEK293 cells, the ability of cMyc-Pit-1 to ^raw-activate a reporter gene

was assessed.

To assess the trans-activation capability of cMyc-Pit-1, a hybrid reporter construct was

generated by fusion of the 1.6 kb/5glll HS I/II fragment, containing multiple Pit-1

binding sites, and a heterologous TK (thymidine kinase) promoter to generate the

1.6TKp.Luc gene. The 1.6kb Bglll fragment was derived from the HS I/II region within

the hGH/CS upstream LCR [128]. This fragment has been shown to enhance GH-N gene

expression in transgenic mice [80, 128]. The ability of tagged Pit-1 to activate reporter

gene expression through the HS I/II sequence was assessed. The 1.6TKp.Luc plasmid

was co-transfected into HEK293 cells with the cMyc-Pit-1 expression vector. The

expression vector for the epitope cMyc-tag alone was also co-transfected with the

1.6TKp.Luc gene as a control. Co-expression of cMyc-Pit-1 stimulated 1.6TKp.Luc

activity significantly in HEK293 cells (Figure 4.5). When 1.6TKp.Luc activity was

arbitrarily set to 1.0, the luciferase activity increased 4.7 fold (4.71 +0.10, n=4,p<0.005)

80 when cMyc-Pit-1 was expressed. By contrast, no significant effect on luciferase activity was observed with cMyc-tag expression alone, when compared to 1.6TKp.Luc (1.04 +

0.15, n=4).

6.0 T ** 5.0 :',

> •-C 4.0 < 3 H 3.0 a. H "* 2,0 | 1.6TKp.Luc

-r ~r | | 1.6TKp.Luc + cMyc 1.0 I I I 1.6 TKp.Luc + cMyc-Pit-1

Figure 4.5 Co-expression of cMyc-Pit-1 stimulates 1.6TKp.Luc activity. A hybrid luciferase (Luc) gene (1.6TKp.Luc) was used to assess the trans-activation activity of co-expressed cMyc-Pit-1 in transfected HEK293 cells. Firefly luciferase counts were corrected by protein concentration as per ug protein lysate. Corrected values are expressed as a percentage of 1.6TKp.Luc activity, which is arbitrarily set to 1.0. The mean value after protein concentration correction for 1.6TKp.Luc is 4.10 + 0.3 (relative light units x 103). Statistical analysis was performed by one way ANOVA with Dunnet's posttest for multiple comparisons with a single contol. **, /?<0.005 (n=4). Bars represent standard error of the mean (SEM).

The results indicated that cMyc-Pit-1 is capable of trans-activating the 1.6TKp.Luc gene

in HEK293 cells.

81 4.1.6 Pit-1 Expression in HEK293 Cells Induces Histone H4 Hyperacetylation

Around HS III within the Locus Control Region.

The in vitro analysis suggested that expressed Pit-1 in HEK293 cells was capable of (i) binding to Pit-1 sites originating from both GH promoter and HS I/II; and (ii) trans- activating a reporter gene through association with the HS I/II sequence; functional

assessment of the exogenous Pit-1 was performed in the context of chromatin in situ.

The chromatin immunoprecipitation (ChIP) assay was performed first to detect the

chromatin modifications after Pit-1 expression.

HEK293 cells were transiently transfected with cMyc and cMyc-Pit-1 expression vectors using 'Mirus-TransIT293' reagent. ChIP assay was performed with anti-hyperacetylated

histone H4 antibodies (Upstate) in a modified ChIP protocol (described in Section 2.2.2).

In brief, cells were harvested 48 hours after transfection and directly crosslinked using

1% formaldehyde. Chromatin was then fragmented by sonication and

immunoprecipitated by specific anti-hyperacetylated histone H4 antibodies. PCR was performed on both input and immunoprecipitated (bound) chromatin fractions with primer sets designed to detect specific regions of interest along the hGH/CS locus,

including the upstream hypersensitive sites (HSs) I to V and the growth hormone promoter (GHp). PCR with primers for the unrelated human FGF-16 exon 3 was used as

control [162]. The PCR product values for both input (I) and bound (B) samples were

82 obtained by electrophoresis and densitometry from digital images. The results are expressed as bound/input (B/I) ratios to correct for possible PCR primer pair variation.

The B/I ratios from HEK293/cMyc-Pit-l expressing group were corrected by those from

HEK293/cMyc-vector expressing group. Variable and not significant results were obtained with all regions surveyed with the exception of HS III, for which the effect of

Pit-1 was significantly different from that of FGF-16 (p<0.05, n=5). The relative B/I ratio for HS III in HEK293/cMyc-Pit-l expressing group was 1.7 fold greater than observed with the HEK293/cMyc vector group (Figure 4.6). Note that the result is likely an underestimate since the ratio reflects only the fraction of cells transfected successfully with the overexpressing Pit-1 (approximately 40% of total) (Figure 4.1).

83 Regions Detected HSVHSIVHSIII HSI/II CD 79 GHp GH-N FGF-16

Fold Effect (Pit-1 vs. vector) 1.1 1.7 1.3 1.3 1.2

PValue(n=5) 0.84 <0.05 0.69 0.39 0.55

Experiment Control

Figure 4.6 Effect of Pit-1 overexpression on histone H4 hyperacetylation in different regions of the hGH/CS locus. Chromatin immunoprecipitation (ChIP) assay was used to detect the histone modification along the hGH/CS locus after cMyc-Pit-1 expression in the HEK293 cells. The cMyc- Pit-1 expression vector was introduced into HEK293 cells by transient transfection, and ChIP assay was performed using the anti-hyperacetylated histone H4 antibodies. The Bound/Input (B/I) ratios of histone H4 hyperacetylation between cells transfected with Pit-1 relative to the empty vector are shown. The fibroblast growth factor 16 exon 3 (FGF-16; inactive in kidney cells) were used as controls. Statistical analysis was performed by one-way ANOVA followed by Dunnet's posttest for multiple comparisons with a single control. GHp, growth hormone promoter. Data reported in [154]1.

Data from ChIP experiments using HEK293 cells demonstrated that introduction of cMyc-Pit-1 resulted in a modest (1.7-fold) but significant (p<0.05) increase in the histone H4 hyperacetylation at HS III of the hGH/CS LCR. This result is likely to be an underestimate due to the limited transfection efficiency (Figure 4.1). Thus, the above observation suggests a more 'loose' chromatin environment around HS III, which might, facilitate further modifications of the hGH/CS locus.

Reprinted figure with permission from S. Karger AG, Neuroendocrinology. Regulation of the human growth hormone gene family: possible role for Pit-1 in early stages of pituitary-specific expression and repression. Cattini PA, Yang X, Jin Y, Detillieux KA. Neuroendocrinology. 2006;83(3-4):145-53. Url: http://www.ncbi.nlm.nih.gov/pubmed/17047377 Copyright © 2006 by S. Karger AG.

84 4.1.7 The Chromatin Remodeling Induced by Pit-1 Expression in HEK293 Cells

Results in Local Increased Chromatin Accessibility to RNA Polymerase II.

An expected consequence for histone hyperacetylation would be the presence of a more open or further loosening of the local chromatin structure. In the case of the latter, this would be followed by increased accessibility to transcription factors, including RNA polymerase II (Pol II), which can be active randomly at regions where the chromatin fiber/structure is more relaxed [21, 32, 35]. Therefore, the level of non-coding RNA transcripts, detected by RT-PCR, can be used to reflect the RNA Pol II activity indirectly in this regard. Thus, it is reasonable to hypothesize that non-coding transcripts would be detected locally around the HS III based on further opening of the hGH/CS locus after

Pit-1 expression in HEK293 cells, based on the above ChIP assay data.

A series of RT-PCRs were performed to determine the level of non-coding transcripts along the hGH/CS locus after Pit-1 expression. PCR primer sets were designed for HS

I/II-V, the CD79 gene (located between HS I/II-V and the GH-N gene), the GH proximal promoter, the GH-N gene, as well as seven intervening regions (schematic map showed in Figure 4.7). Sequence specific RT primers, reflecting direction of sense and anti- sense transcripts for each region were also generated. RNAs were isolated from cells 48 hours after gene transfer and assessed using specific RT primers for each direction, and followed by PCR. Amplicons for each region were analyzed by gel electrophoresis and

85 densitometry analysis by the FluorChem 8900 program. The coding/sense region for

GAPDH, which is presumed to be constitutively active and not affected by Pit-1 expression, was used as a control for normalization.

Normalized results are presented as relative fold effect of transcripts in the Pit-1 transfected group over the non-transfected HEK293 cells at each region. Also, in this set of experiments, relative levels at each region from sense and anti-sense RT directions are pooled together and analyzed by ANOVA to eliminate the directional bias. All fourteen regions assessed revealed an increase in transcript levels, suggesting an increase in RNA

Pol II activity along the locus. Among them, three regions, including HS III, P8 and P7

(located next to HS III towards HS I/II), revealed a significant increase in non-coding transcripts (Figure 4.7). The region with the highest level of transcript detected was located at HS III, indicating more than an 11 -fold increase compared to non-transfected

HEK293 cells. In contrast to HS III and nearby regions, HS I/II, CD79, GH-N promoter and the GH-N gene itself, showed increases, but were not significant levels of transcripts.

86 HSV HSIV HSIII HS I/II CD79 GHp GH-N H-HHWKH—H-0 P14 P13 P12 P11 P10 P9P8 P7 P6 P5 P4 P3 P2 P1

> 14

12 o 10 X c o 8 -t—> o 6 i u D I > 4 i I 2-H

y/- P14 P13 P12 P11 P10 P9P8 P7 P6 P5 P4 P3 P2 P1

Non-coding transcripts along the hGH/CS locus (PI-14)

Figure 4.7 Fold effect of Pit-1 expression in HEK293 cells on the level of "random" non-coding transcripts along the hGH/CS locus. A Pit-1 expression vector was introduced into HEK293 cells by transient transfection. Random transcripts were detected using sequence-specific reverse transcription primers and followed by PCR reactions. The ratio of random transcripts between HEK293 cells with and without Pit-1 expression was analyzed by gel electrophoresis and densitometry of the final PCR products. All values are normalized to (sense/coding) GAPDH, presumed to be constitutively active. Statistical analysis was performed by one-way ANOVA followed by Dunnet's posttest for multiple comparisons with a single control. ** p<0.01. *, p<0.05. Bars represent standard error of mean (SEM). GHp, growth hormone promoter. GH-N, growth hormone gene. Data reported in [154]'.

87 The above observations indicate that Pit-1 overexpression results in an increased accessibility for chromatin to transcription factors, and specifically RNA Pol II, reflected by detection of increased non-coding transcripts along the hGH/CS locus. Among all the regions assessed, HS III showed the highest and most significant level of transcripts detections.

88 4.2 An Attempt to Address the Mechanism of Chromatin Remodeling Induced

by Pit-1 at HS III in HEK293 Cells.

4.2.1 Pit-1 Mutation Constructs and Expressions.

Results from studies using the HEK293/Pit-1 expression model system demonstrated that

expression of Pit-1 induced histone modification at HS III, consistent with the

observation that chromatin and DNA becomes more accessible or 'opens up', as reflected

by a significant increase in RNA polymerase II (RNA Pol II) activity/non-coding transcripts. However, the mechanism, including whether this involves Pit-1 binding to the DNA and/or whether Pit-1 exerts its effect through protein-protein interaction,

remained unclear.

As a POU homeodomain transcription factor, Pit-1 has two DNA-binding motifs, a

highly conserved POU-specific (POUs) domain and a more divergent homeodomain

(POUHD)- Analysis of mutant Pit-1 proteins indicated that, the POUHD is required and

sufficient for low affinity DNA binding, while POUs domain is necessary for high

affinity binding and accurate recognition of natural Pit-1 response elements [160, 167].

Interestingly, besides DNA-binding, the POU-homeodomain of Pit-1 also exerts protein-

binding capability. Association of Pit-1 with Ets family member(s) through the POU

homeodomain is reported to be able to activate synergistically the Ras signaling pathway

and reconstitute prolactin gene expression in HeLa cells [168, 169].

89 To further characterize the role of Pit-1 in promoting chromatin remodeling, expression vectors for wild type and modified Pit-1 lacking three significant regions of the Pit-1 protein were generated: complete deletion of the POU homeodomain (APOUHD) (deletion of amino acids 200-282), complete deletion of the POU-specific domain (APOUs)

(deletion of amino acids 128-202), and partial deletion of the N-terminal frvms-activation domain (ANg^s) [160]. Different rat Pit-1 cDNA fragments with different DNA-binding and trans-activating abilities were provided by Dr. H Ingraham (University of California,

San Francisco, USA) [97, 160]. These modified rat Pit-1 cDNAs (Figure 4.8A) were inserted into a commercially available expression vector CMV-pcDNA3.1 at

Hindlll/BamHl restriction enzyme sites.

To assess the expression of the modified Pit-1 cDNAs, the three constructs as well as the wild type Pit-1 were transiently transfected into HEK293 cells, nuclear proteins were harvested 48 hours after gene transfer. Two Pit-1 antibodies, including X-7 (Santa Cruz, sc-442, raised against full length Pit-1 of rat origin) and N-20 (Santa Cruz, sc-16288, raised against the first 50 amino acid at the N-terminus of human Pit-1, which cross- reacts with Pit-1 of rat origin) were used for immunoblotting to detect Pit-1 protein.

After immunoblotting with N-20 Pit-1 antibodies, multiple bands were detected. Major bands of smaller size for truncated Pit-1 were detected. The detection of multiple bands might be a result from either protein degradation and/or alternative initiation site for protein translation (Figure 4.8B).

90 DNA-Binding Domain POU-specific POU-homeo 0 8 128 198 ; 272 291 Wl 1 1 II

200 282 APOUHD I 1 It- -D

APOUs

AN8-128 I h

B H

O O £ i 1 5 5

• 37 kDa

9 , 25 kDa «G5 , ' 20 kDa • 15 kDa

Figure 4.8 Pit-1 mutation constructs and expressions. (A) Schematic representation showing the linear structure of wild type and modified Pit-1 cDNAs. Two DNA-binding domains (POU-homeo and POU specific domains) are shown. Particular sites for amino acids deletions are shown. (B) HEK293 cells transiently transfected with expression vectors for wild type and mutant Pit-1 proteins were analyzed for expression by protein blotting and probed with anti-Pit-1 antibodies (Santa Cruz, N-20, sc-16288). Protein sizes are indicated at right in kilodaltons (kDa). wt, wild type. APOUHD, POU-homeodomain deletion. APOUs, POU-specific domain deletion. ANg-m, N-terminal trans-activation domain deletion. NT, non-transfected HEK293 cells.

Major bands of smaller size for truncated Pit-1 were detected as appropriate reflecting deletion of specific regions [97, 160]. These Pit-1 mutants with different DNA-binding ability were assessed further for their effect on chromatin structure after transfection in

HEK293 cells.

91 4.2.2 Both POU-Homeo and POU-Specific Domains are Required for Appropriate

DNA-binding Ability of Pit-1 In Vitro.

To assess and confirm DNA-binding ability of the different Pit-1 proteins, EMS A was performed using Pit-1 binding sites from the GH-N promoter as a specific probe (GHp

Pit-1). One [xg of nuclear protein from HEK293 cells transfected with wild type or modified Pit-1 cDNAs were used in EMS A reactions. Unlabeled GHp Pit-1 oligonucleotides were used as specific competitors at 50- and 100- fold mass excess of probe. Two major binding complexes were detected with wild type Pit-1, defined by the observation that both were competed by unlabeled probe (Figure 4.9). One major specific binding complex was also observed with nuclear protein from HEK293 cells transfected with the N-terminal mutant Pit-1 (ANg-m), but with a higher mobility that is consistent with its expected smaller protein size (Figure 4.8B). By contrast, no major binding complexes were detected with nuclear extracts from HEK293 cells expressing

Pit-1 mutants with deletion of either the POU-specific or POU-homeo domain (Figure

4.9).

92 £< Pit-1 wtNE APOUHDNE APOUSNE AN8-128NE O 0 50x lOOx 0 50x lOOx 0 50x lOOx 0 50x lOOx

Figure 4.9 DNA-binding of mutant Pit-1 proteins. EMS A was performed using radiolabeled GH promoter Pit-1 sites (GHp Pit-1) with wild type and mutant Pit-1 proteins. Nuclear protein (lug) from HEK293 cells transfected with the indicated form of Pit-1 were assessed. Competitor oligonucleotides (unlabeled probe) were used at 50- and 100- fold mass excess of probe. Specific binding complexes are indicated by black arrowheads. FP, free probe. NE, nuclear extracts, wt, wild type. APOUHD, POU-homeodomain deletion. APOUs, POU-specific domain deletion. ANg-128, N-terminal #"am'-activation domain deletion.

The results from EMS A experiments confirm the importance of both POU-homeodomain and POU-specific domain for DNA-binding of Pit-1 to the GH-Npromoter in vitro.

4.2.3 Assessment of the Ability of Pit-1 Mutants to 7>a«s-Activate Promoter

Activity in Transiently Transfected HEK293 Cells.

93 Assessment of ^rarcs-activating ability for Pit-1 mutants was performed using the

1.6TKp.Luc reporter gene containing Pit-1 elements from HS I/II, as described in Section

4.1.3. HEK293 cells were transfected with 1.6TKp.Luc and co-transfected with

expression vectors for wild type and mutant Pit-1, including APOUHD, APOUS and ANg.

128 Pit-1 (Figure 4.8A). The reporter gene alone (1.6TKp.Luc) with no Pit-1 co- expression was also set up as a control. Luciferase activity was analyzed 48 hours after gene transfer and results are presented as fold increase relative to 1.6TKp.Luc activity.

When 1.6TKp.Luc activity is arbitrarily set to 1.0, expression of wild type Pit-1 significantly increases the activity of the reporter gene 3.6-fold (n=6, ;?<0.001).

However, none of the modified Pit-Is were associated with stimulation of reporter gene activity when compared to wild type Pit-1 (Figure 4.10). The POU-homeodomain and

POU-specific domain averaged about 75.6% (n=6,/*>0.05) and 59.4% (n=6, /?>0.05) of

1.6TKp.Luc activity, respectively. A slight but not significant increase of 1.6TKp.Luc activity of approximately 1.3 (n=6, /?>0.05) was observed with the N-terminal deleted

Pit-1. However, none of these effects (increase/decrease) of the modified Pit-Is on the reporter gene expression were statistically significant.

94 1

Figure 4.10 Trans-activation associated with modified Pit-1 proteins. A hybrid luciferase (Luc) gene (1.6TKp.Luc) was used to assess the effect of different Pit-1 mutant proteins in HEK293 cells. Wild type (wt) and modified Pit-1 cDNAs (APOUHD, APOUS and ANg.m) were transfected into HEK293 cells together with the reporter 1.6TKp.Luc gene. Firefly luciferase activity was corrected by protein concentration as per u.g protein lysate. Corrected values are expressed as a percentage of 1.6TKp.Luc activity, which is arbitrarily set to 1.0. The mean value for 1.6TKp.Luc was 9.12 + 0.51 (relative light units x 104) (n=6). Statistical analysis was performed by one way ANOVA followed by Tukey posttest for multiple comparisons. ***, /?<0.001. Bars represent standard error of the mean (SEM).

The functional analysis of wild type and modified Pit-1 cDNAs provides evidence that the

N-terminal trans-activation domain and both DNA binding domains (APOUHD and

APOUs) are essential for full trans-activation activity of Pit-1 in transiently transfected

HEK293 cells.

95 4.2.4 Chromatin Remodeling Induced by Pit-1 Expression in the HEK293 Cells at

HS III Requires Both the POU Homeo-domain and Amino-terminal Trans-

Activation Domain.

In vitro studies of wild type and modified Pit-1 proteins demonstrated that (i) both POU- homeo and POU-specific domains are required for DNA-binding; and (ii) the two DNA- binding domains and N-terminal ^raw-activation domains are essential for full trans- activation ability. In order to assess the functional involvement of these domains in chromatin remodeling and specifically at HS III, the chromatin immunoprecipitation

(ChIP) assay was used to assess hyperacetylated histone H4 (Upstate, Cat# 06-946) in transiently transfected HEK293 cells.

HEK293 cells were transfected using the 'Mirus-TransIT293' reagents and harvested 48 hours after gene transfer. ChIP assays were performed as described in Section 2.2.2.

Briefly, cells were directly crosslinked using 1% formaldehyde. Chromatin was mechanically fragmented and immunoprecipitated by specific anti-hyperacetylated histone H4 antibodies (Upstate, Cat# 06-946). PCR primers specific to HS III were used on both input and immunoprecipitated (bound) chromatin fractions. PCR primers for the unrelated human FGF-16 exon 3 were used as a control [162]. The PCR product values for both input (I) and bound (B) samples were obtained by electrophoresis and densitometry from digital images. The results are expressed as bound/input (B/I) ratios to correct for possible PCR primer pair variation.

96 In a series of five independent experiments, expression of wild type Pit-1 was again associated with increased histone H4 hyperacetylation at HS III with a mean B/I ratio at around 2.79 + 0.28 (n=5) (Figure 4.11). Among the three modified Pit-Is, only disruption of the POU-specific domain (APOUs) did not result in significant loss of histone H4 hyperacetylation. The mean B/I ratio at HS III for the POU-specific domain deletion was 2.22 + 0.28 (n=5, p>0.05). In contrast, this effect was lost with the deletion of either the POU homeodomain (APOUHD) or the N-terminal frYWs-activation domain

(AN8.128). The relative B/I ratio for APOUHD and AN8.i28 were 1.04 ± 0.36 (n=5, p<0.00\), and 1.31+0.51 (n=5,p<0.001), respectively.

97 3.5 i 3 ...i__. *• X -** 3 2.5 C * 3* #*# : e 2 • Exptl 1—4 *** e X ._ v • Expt2 os 1.5 • « X i A Expt3 a 1 .B; i x Expt4 "-^ 1 i "3 0.5 ... .-.. X Expt5 i 0 Pit-1 wt APOUHD APOUs AN8-128

Figure 4.11 The histone modification change at HS III induced by Pit-1 depends on the presence of an intact POU-homeodomain. HEK293 cells were transfected with wild type and mutant Pit-1 expression vectors. Nuclei from transfected HEK293 cells were analyzed by ChIP for hyperacetylated histone H4 at HS III. Bound/Input ratios for wild type Pit-1 and each mutant were determined by gel electrophoresis, densitometry analysis and normalized to that of FGF- 16. Corrected values are expressed as a fold-increase relative to non-transfected HEK293 cells. The values for five independent experiments are shown. Mean values are indicated by gray bars. Statistical analysis was performed by one-way ANOVA followed by Tukey posttest for multiple comparisons. ***, p<0.00\. wt, wild type Pit-1. APOUHD, POU-homeodomain deletion. APOUs, POU-specific domain deletion. ANg-ns, N-terminal domain deletion.

These observations suggest that regardless of DNA-binding, the histone H4 hyper acetylation at HS III of the hGH/CS LCR induced by Pit-1 in HEK293 cells depends on the presence of both POU-homeodomain and the N-terminal trans-activation domain.

Given the fact that the DNA-binding domain (POU-homeomain) of Pit-1 is also able to associate with other proteins, the chromatin remodeling observed in the HEK293 cells may result from either DNA-binding or protein-protein associations, or a combination of both.

98 4.2.5 Accessibility of DNA to RNA Polymerase II Induced by Pit-1 Expression in

the HEK293 Cells Depends on an Intact POU Homeodomain.

As described in Section 4.1.7, an expected consequence of histone hyperacetylation would be the loosening of local chromatin structure, and, as a consequence, increased accessibility to transcription factors, including RNA polymerase II (RNA Pol II) [21, 32,

35]. As such, detection of non-coding transcripts along the locus can be used to assess access to RNA Pol II indirectly. Thus, in order to confirm the functional involvement of the POU-homeodomain and the /raws-activation domain in the chromatin remodeling at

HS III observed in Section 4.2.4 (Figure 4.11), RNA transcripts for both sense and anti- sense direction along the hGH/CS locus were assessed as described previously in Section

4.1.7.

Briefly, HEK293 cells were transfected with wild type and mutated Pit-1 constructs, and total RNAs were harvested 48 hours after gene transfer. RT-PCRs were performed with sequence-specific RT primers for both the sense and anti-sense direction, followed by

PCR reactions with primer sets specific to HS I-V as well as ten intervening regions (Pl-

P10) along the hGH/CS locus including the CD70B gene, the GH-N promoter and gene, and finally GAPDH as a control. All densitometry values from wild type Pit-1 and each

Pit-1 mutant were normalized to GAPDH individually, and then corrected by values from non-transfected HEK293 cells. The results are expressed as a fold effect of Pit-1 (wild type and deletions) on RNA levels.

99 Normalized values for the sense RNA Pol II activity from wild type as well as two

modified Pit-1 cDNAs, including the POU-specific domain (APOUs) and N-terminal

domain (ANg-m) deletions, revealed a consistent increase in random non-coding

transcripts along the hGH/CS locus (Figure 4.12A). The region with the highest

apparent level of transcripts was associated with the HS III region, and averaged 15 to

17-fold more transcript than in non-transfected HEK293 cells. As for other regions, an

increased level of transcripts was also detected but with variation between groups. In the

group associated with the POU-homeodomain deleted Pit-1 (APOUHD), the RNA

transcripts were observed at a very low level, with maximum 5-fold increase compared to

the non-transfected HEK293 cells along the whole hGH/CS locus. This set of

experiments was repeated three times, and consistently showed a similar pattern.

However, variation at each site assessed was such that statistical significance was not

possible. In addition, non-coding RNA transcripts were also assessed for the anti-sense

direction (Figure 4.12B). A similar pattern of increased transcripts as detected in the

sense direction was also observed. Compared to the wild type Pit-1 as well as two Pit-1

deletions, including the POU-specific domain (APOUs) and N-terminal domain (ANg-m)

deletions, RNA transcripts in the group associated with the POU-homeodomain deleted

Pit-1 (APOUHD) did not generate a consistent increase (Figure 4.12B). In contrast to the

observations made in the sense direction, where HS III showed the highest apparent level

of transcript, a peak of RNA transcripts for the anti-sense direction was not observed.

Again, the experiments for anti-sense direction were also repeated three times, and each

showed a similar pattern.

100 CD 79 CHp GH-N GAPDH i 1 • 1 i „ ** # " '*"

Pit-1 Wt

APOUHD II 1K APOUs

1 II 1 i ^~~1 1 AN8-I28 "^N 4t—i •-i >—i \ i f J ^ ^ ! P14 PI3P12 Pill P6 P5 P4 P3 P2 PI PO CD79 GHp GH-N GAPDH

tr T3 1 —i—*— 1 jf— —//— PI4 P13P12 P11PI0P9P8 P7 P6 P5 P4 P3 P2 PI PO i CD79 GHp GH-N GAPDH Primer pairs used to assess non-coding transcripts along the hGH/CS locus (P1-P14)

Figure 4.12 Fold effect of Pit-1 deletions on the level of non-coding transcripts along the hGH/CS locus in transfected HEK293 cells. Pit-1 deletion expression vectors were each introduced into HEK293 cells by transient transfection. Random transcripts were detected using sequence-specific reverse transcription primers and followed by PCR reactions. The value for sense/coding GAPDH, which is presumed to be constitutively active, was used as control for normalization. All values are normalized to GAPDH in each group individually, and then corrected by non-transfected HEK293 group. The mean relative fold effects at each region along the hGH/CS locus from three independent experiments are shown for wild type (wt) and each Pit-1 mutants (APOUHD, APOUS and ANg.^s) in both sense (A) and anti-sense (B) direction. The peak level for RNA transcripts for the sense direction is shadowed. GHp, growth hormone promoter. GH-N, growth hormone gene.

101 The level ofRNA transcripts can be used as an indicator for RNA Pol II activity, which in turn reflects accessibility of DNA to transcription factors in a chromatin context. Thus, the above observations can be interpreted that deletion of either the POU-specific domain or N-terminal domain ofPit-1 did not affect accessibility of Pit-1 to chromatin.

Only disruption of the POU-homeodomain resulted in lack of accessibility of Pit-1 to

chromatin.

102 4.3 Evidence does not Support a Direct Association Between Pit-1 and DNase-I

Hypersensitive Site III (HS III).

4.3.1 Sequence Analysis on HS III Reveals Four Oct-1 Binding Sites.

Based on the HEK293 transfection study, there is evidence for a role for the Pit-1 homeodomain in increased DNA accessibility around HS III. However, the question remains about whether it is a DNA-binding dependent effect. The HS III region was originally identified approximately 28 kb upstream of the GH-N transcription initiation site (+1) [73, 80]. A core 574-bp fragment from HS III region (-676,432/-675,859 on chromosome 17) is reported to exert enhancer activity and associate with multiple transcription factors including activator protein 2 (AP-2) and Elk-1 [155].

In order to address the question as to whether Pit-1 binds to DNA to increase DNA accessibility, sequence analysis using the Matlnspector 2.2 binding site detection program based on the TRANSFAC 4.0 database [170, 171] was performed using the 574- bp fragment of HS III as a query sequence (Figure 4.13). The search resulted in four potential Oct-1-like sites but no Pit-1 sites. The binding motif for Oct-1 (5'-

ATGCAAAT-3') and Pit-1 (5'-T(A/T)TA(T/A)TAAT(T/A)CAT-3') share some nucleotide similarity [105, 172], and Oct-1 sites usually represent potential candidates for

Pit-1 binding sites [113, 114].

103 HS III - 676,432 5' - GATTCGAGGGCATGAGGGTGGGTGCTGAAGGGGCCTCTGGGGTGGGCTGGGGATGGGGG

ACCGGCCACCTTCACTGCAGGGTGGAGGGTGCATGTCTATACTCCAACCACCACCAGAGGGAA OLE a

GCAGAGAGCTTGGACCCACGGCCCTGCCTGAGGCCAGGTCTGGCCCCCACCTCCCCTAGCTGT

CCTCCCCGCAGGCCATCTTCTGCCTGCCCCATTCCCACTCTCAGCCCCCGATCCAGCCCGCCC

TTAGCTTACCTCTGCCACTACTTGAGGGGAGCAGAGACTGCAGAAGCACCCAGGAGGGCCCCA

CGGCCAGGGAAGAGGAGGAAGGAAGGCAGGTTTATGTGGTGTTTATGGGTGGTTTATGAGTGG OLEb GTTTATGGGTGGCCCTCCCCAGCCTCAGACTGAGCCACCCAGGGCTTTGAAACAAGGTGCCTG

CACCCTGGCTCTGAGCCTTCCCCTCACCCCCCACTGATGAGCTTGGCGTCACGGTTGGGGCCA ETS TGCCCTTGAGCTTGGGGTCAGTTTGGGGAAGATCCACTCAGGCCCTGGAGAGCggaagtGGCAG OLEc GTAAACACAG - 3' OLE d - 675,859

Figure 4.13 Sequence analysis of the DNase-I hypersensitive site III. The 5'-3' sequence of the 574 bp HS III fragment (nucleotides -676,432/-675,859 on chromosome 17) is shown (NCBI reference sequence NTO10783.15). Four Oct-1-like elements (OLE a-d) according to the Matlnspector search are highlighted. The corresponding sub-fragments that were used in further EMSA studies are underlined. The putative site for ETS family member(s) according to Matlnspector search is indicated by lowercase letters. Numbers for the nucleotide sequences are also indicated.

In order to assess the protein binding potential of these four Oct-1-like sites by EMSA, four HS III sub-fragments approximately 25-30 bp in length, containing each of the Oct-

1 -like sites, were obtained and designated as Oct-1-like elements (OLEs) a, b, c and d

(Figure 4.13).

According to the Matlnspector search, four putative Oct-1-like sites were detected within

HS III sequences. These Oct-1-like elements are considered potential binding sites for

Pit-1.

104 4.3.2 Recombinant Pit-1 Proteins do not Associate with Possible Oct-1 Sites in HS

III.

EMS A was performed to test for potential DNA-protein interactions between Pit-1 proteins and the four OLEs within HS III. Recombinant Pit-1 protein (Santa Cruz, sc-

4014) was used in EMS A reactions and incubated with the consensus Oct-1

oligonucleotide (5'-ACAGCTTACGTTTAGTGATCTT-3'), which was radiolabeled as a

specific probe (Santa Cruz, sc-2506). The four HS III sub-fragments, OLE a, b, c and d

(Figure 4.13), were used as oligonucleotide competitors. Pit-1 binding element from the

growth hormone promoter (GHp Pit-1) was also labeled and used as a control to detect the potentially positive binding complex(es) for the recombinant Pit-1 protein.

Incubation of the recombinant Pit-1 protein with the radiolabeled GHp Pit-1 probe resulted in one clear binding complex (Figure 4.14A), reflecting the unique binding

complex between the recombinant Pit-1 protein and the Pit-1 element at the GH promoter. When radiolabeled Oct-1 probe was incubated with recombinant Pit-1 proteins, one specific binding complex was detected, which was competed by addition of

25- and 50-fold mass excess of unlabeled probe (Figure 4.14B). Detection of the

specific binding complex confirmed that recombinant Pit-1 protein is capable of binding to the consensus Oct-1 DNA-binding element. However, no competition was observed in any of the reactions when OLE oligonucleotides from HS III (OLE a-d) were used as

105 competitors at 50-fold mass excess of probe, suggesting that the recombinant Pit-1 protein is unlikely to be able to associate with the OLEs from HS III at least with high affinity.

Figure 4.14 Recombinant Pit-1 proteins do not associate with HS III Oct-1-like elements (OLEs). EMS A assays were performed using recombinant Pit-1 proteins (Santa Cruz, sc-4014). (A) The Pit-1 binding element from the growth hormone promoter (GHp Pit-1) was radiolabeled and used as a specific probe. (B) The consensus Oct-1 oligonucleotide was radiolabeled and used as a specific probe. Seven hundred ng of recombinant Pit-1 protein was used in each reaction. Competitor oligonucleotides for unlabeled probe were used at 25- and 50-fold mass excesses of probe. Competitors for the HS III sub-fragments (OLE a, b, c and d) were used directly at 50-fold mass excesses of probe. The specific binding complex is indicated by an arrowhead. FP, free probe.

Data from the above EMSA indicate that the recombinant Pit-1 protein is able to associate with consensus Oct-1 DNA binding element, confirming the similarity between

Pit-1 and Oct-1 DNA-binding sites. However, it is unlikely that the recombinant Pit-1

106 protein associates with the four OLEsfrom HS III with high affinity through direct DNA- protein interaction since oligoes do not compete.

4.3.3 HEK293 Cells Contain Endogenous Oct-1.

The transcription factor Oct-1 is a 100 kDa protein that belongs to the same POU-

homeodomain family as the 33 kDa Pit-1. Distinct from the pituitary-specific expression

of Pit-1, Oct-1 appears to be expressed in a wide variety of tissues but this includes the

developing pituitary gland [173]. The coexpression of Pit-1 and Oct-1 in the developing

pituitary and the similarity of their DNA binding elements suggested these proteins might

interact with each other [105, 172]. The fact that Pit-1 is able to form a heteromeric

complex with Oct-1 [108] adds an additional layer of complexity to the mechanistic study

underlying how Pit-1 manages the chromatin remodeling and transcription activation in

the HEK293 cells. As such, the question of whether HEK293 cells contain endogenous

Oct-1 protein was assessed. If yes, then the possibility of heterodimer formation with the

expressed Pit-1 in transfected HEK293 cells must be considered.

To assess the level of endogenous Oct-1 in the HEK293 cell system, EMS A was

performed using the radiolabeled Oct-1 consensus DNA element as a free probe when

incubating with nuclear protein from (untransfected) HEK293 cells. The unlabeled Oct-1

consensus oligonucleotides, the mutant Oct-1 oligonucleotides (Oct-lm, 5'-

ACAGCTTACGTTCGGTGATCTT-3'), as well as the four OLEs from HS III region

107 (OLE a, b, c and d) were used as specific competitors at 25- and 50- fold mass excesses of probe, respectively. After incubation with HEK293 nuclear protein, one specific binding complex was formed on the radiolabeled Oct-1 probe, defined by the efficient competition with 25- and 50-fold mass excess of unlabeled probe, but not the mutant Oct-

1 oligonucleotides (Oct-lm). None of the HS Ill-related Oct-1-like elements were effective competitors when compared to the Oct-1 consensus element at either 25- or 50- fold mass excess. This suggests that even if Oct-1 can bind to the HS III region, it would likely be a low affinity interaction. Among the four HS Ill-related OLEs (and Oct-lm), slight competition with OLE c was detected at 50x mass excess (Figure 4.15).

108 ss z ° a oct-i 1 *2 consensus Oct- lm OLE a OLEb OLEc OLEd mS 25x 50x 25x 50x 25x 50x 25x 50x 25x 50x 25x 50x

Figure 4.15 HEK293 cells contain endogenous Oct-1 protein. EMS A assay was performed using radiolabeled consensus Oct-1 DNA binding element as a specific probe and nuclear extracts (NE) from the untransfected HEK293 cells. Unlabeled Oct-1 consensus element, mutant Oct-1 element (Oct-lm), as well as four HS III OLEs (OLE a, b, c and d) were used as competitor oligonucleotides. Competitor oligonucleotides for unlabeled probe were used at 25- and 50-fold mass excesses of probe. The specific binding complex is indicated by an arrowhead. FP, free probe.

Data from EMSA suggest endogenous Oct-1 in HEK293 cells can associate with a consensus Oct-1 DNA binding element. The HS Ill-related Oct-1-like elements (OLE a, b, c and d) do not represent high affinity Oct-1 binding sites.

4.3.4 No Specific Protein-binding Complexes were Detected at the HS III Oct-1-

Like Elements in the Transfected HEK293 Cells.

109 In order to further assess the possibility of nuclear protein binding at HS III (OLE a to d),

EMS As were performed using nuclear proteins from both untransfected and Pit-1 transfected HEK293 cells. The four HS III Oct-1-like elements (a-d) were radiolabeled and each used as a specific probe. No clear association between the endogenous Oct-1 proteins and radiolabeled probes (as described in Figure 4.15) was detected when any of the HS Ill-related OLE was used as a probe. When OLE a was radiolabeled as a specific probe and incubated with HEK293 and HEK293/Pit-1 nuclear proteins, no specific binding complex were observed, represented by the lack of competition by both the unlabeled OLEa and mutant Oct-1 element (Oct-lm) (Figure 4.16A). When OLE b was radiolabeled as a specific probe, no binding pattern was observed (Figure 4.16B). When

OLE c was radiolabeled as a specific probe, one minor binding complex with high mobility was detected compared to the mobility of the Oct-1 band shown in Figure 4.15.

However, the observation that the binding complex was also retained in the HEK293/Pit-

1 nuclear extracts suggests it is caused by proteins other than Pit-1 in the EMS A reactions

(Figure 4.16C).

When OLE d was radiolabeled as a specific probe, one binding complex, located at a much lower position compared to the Oct-1 band (Figure 4.15) was detected in both

HEK293 and HEK293/Pit-1 nuclear extracts. The observation that this binding complex was detected in both nuclear extracts suggested that it was not caused by the expressed

Pit-1 (Figure 4.16D). Of note, OLE d oligonucleotide also contains putative binding site for ETS family members as well as Oct-1 sites. In this regard, it is possible to hypothesize that this minor band is caused by association between the endogenous ETS

110 family member(s) and OLE d oligonucleotides. Furthermore, the association between the endogenous ETS family member(s) and the expressed Pit-1 protein was not detected under the conditions employed.

Thus, no specific binding related to Pit-1 expression was observed with OLE a-d as

suggested by the lack of novel and specific complexes seen with nuclear extracts from

HEK293/Pit-1 versus HEK293 cells.

Ill B

P- u. w OLEb Oct-lm g OLEb Oct-lm J 2 O 25x 50x 25x 50x ffi 25x 50x 25x 50x

HEK293 NE HEK293/Pit-1 NE HEK293 NE HEK293/Pit-1 NE

HEK293 NE HEK293/PH-1 NE HEK293NE HEK293/Pit-1NE

Figure 4.16 Oct-1-like elements (OLEs) from HS III do not directly associate with the expressed Pit-1 in the HEK293 cells EMSA assay was performed using nuclear extracts (NE) from non-tranfected and the Pit- 1 transfected HEK293 cells. The four Oct-1-like elements (OLEs) from HS III were radiolabeled and used as specific probes, respectively. The mutant Oct-1 elements, and unlabeled OLE a, b, c and d oligonucleotides were used as competitors at 25- and 50-fold mass excesses of probe. (A) OLE a was radiolabeled as a specific probe. (B) OLE b was radiolabeled as a specific probe. (C) OLE c was radiolabeled as a specific probe. (D) OLE d was radiolabeled as a specific probe. FP, free probe.

112 Data from EMSAs suggest that (i) none of the four putative HS III Oct-1 elements associates with the endogenous Oct-1 protein in HEK293 cells; and (ii) OLE a, b, c and d are not high affinity Oct-1 sites. Additionally, the presence of Pit-1 protein in HEK293 cells does not induce any specific DNA-protein binding complex at the OLEs (a to d) in the HS III region.

4.3.5 Both the Endogenous Oct-1 and the Expressed Pit-1 Proteins Associate with

the Consensus Oct-1 DNA-Binding Element.

Even though the above EMS A data indicate that it is unlikely for the endogenous Oct-1 protein to associate with HS III through direct DNA-protein interaction, the presence of endogenous Oct-1 in HEK293 cells raises the possibility that Oct-1 could interact with the expressed Pit-1 and form a heterodimer. To address this question, EMS A was performed using the radiolabeled Oct-1 consensus DNA element as a specific probe with nuclear proteins from the Pit-1 transfected HEK293 cells. Unlabeled consensus Oct-1 and Oct-lm oligonucleotides were used as specific competitors. Additionally, to further assess the possibility that expressed Pit-1 associates with both Oct-1 and Pit-1 binding motifs, the growth hormone promoter Pit-1 element (GHp Pit-1) was also used as a competitor. Specific antibodies to Pit-1 protein (Santa Cruz, X-7, sc-442) were used to detect the potential Pit-1 binding complex and possible 'supershift'.

113 Three binding complexes (complex I, II and III) were formed when the radiolabeled Oct-

1 probe was incubated with the HEK293/Pit-1 nuclear proteins (Figure 4.17). All three complexes were competed effectively by addition of the unlabeled Oct-1 element, but not the mutant Oct-1 oligonucleotide. Addition of GHp Pit-1 oligonucleotide also resulted in efficient competition of all three binding complexes, suggesting that these components can also associate with GHp Pit-1 oligonucleotide. Furthermore, addition of specific Pit-

1 antibodies only resulted in competition of complex II and the appearance of a

'supershift' region or a larger protein complex when compared to normal rabbit serum

(NRS). By contrast, the presumably bigger complex I with the low mobility was regained (Figure 4.17). The effective competition of complex II by GHp Pit-1 oligonucleotides and the 'supershift' with Pit-1 antibodies suggests that complex II is formed by association between the expressed Pit-1 protein in HEK293 cells and the Oct-1 consensus DNA-binding element. In contrast, complex I is likely formed through association of endogenous Oct-1 protein and the consensus Oct-1 element. Even though

GHp Pit-1 oligonucleotide was able to compete the binding complex I due presumably to nucleotide similarity between Pit-1 and Oct-1 binding elements, the fact that complex I was retained after the addition of Pit-1 antibodies, is not consistent with the involvement of Pit-1 in the formation of complex I. Furthermore, the relative molecular weights for

Oct-1 (100 kDa) versus Pit-1 (33 kDa) is also consistent with Pit-1 related complexes having a higher mobility in an EMS A gel compared to Oct-1.

114 Furthermore, the presumably smaller complex III also showed similar competition through addition of both Oct-1 oligo and GHp Pit-1 oligo, as detected with complexes I and II. However, the observation that addition of Pit-1 antibodies did not compete this complex implied that it was not recognized by the Pit-1 antibodies. Taken into the consideration that the size of this complexe was not consistent with either Pit-1 or Oct-1, it might be a result from the association between DNA fragments and other possible proteins. Previous studies on the expression of Pit-1 mutants revealed multiple bands from possible degration or alternative translation initiation (Figure 4.8B). It is possible to propose that Pit-1 antibodies have difficulty recognize the truncated form of Pit-1, which led to the failure of competition and "supershift" of complex III.

It is also important to note that Pit-1 and Oct-1 formed their own binding complex when incubated with the Oct-1 consensus element, indicating no evidence of heterodimer formation between the expressed Pit-1 and the endogenous Oct-1.

115 23 Z

f, UCI-1 — t/j 7 £3 consensus Oct-1 m GHpPit-1 £ * O X 25x 50x 25x 50x 25x 50x + +

Figure 4.17 Pit-1 expression in HEK293 cells does not interfere with binding of endogenous Oct-1 to a consensus Oct-1 DNA binding element. EMS A was performed using a radiolabeled consensus Oct-1 DNA binding element as a specific probe. Nuclear proteins from Pit-1 transfected HEK293 cells were used in the reaction. Unlabeled Oct-1 consensus element, mutant Oct-1 element (Oct-lm) as well as the Pit-1 element from the growth hormone promoter (GHp Pit-1) were used as specific competitors at 25- and 50-fold mass excess of probe. Specific Pit-1 antibodies (Santa Cruz, X-7, sc-442) were also used. The specific binding complexes are indicated by arrowheads. The 'supershift' region is indicated by open arrowhead. FP, free probe. NE, nuclear extracts. NRS, normal rabbit serum.

EMSA data suggest that even though the expressed Pit-1 protein in the HEK293 cells also binds to the consensus Oct-1 element as does the endogenous Oct-1 protein, it

appears to form a different complex rather than forming a Pit-l-Oct-1 heterodimer in the

HEK293 cells.

116 4.3.6 The Oct-1 Sites from HS III do not Associate with the Expressed Pit-1 in

HEK293 Cells.

To further assess the possibility that the expressed Pit-1 associates with any of the four

Oct-1-like elements from HS III, EMS A competitions using OLE a, b, c and d oligonucleotides were performed. Again, the consensus Oct-1 DNA binding element was radiolabeled as a specific probe and nuclear proteins from Pit-1 transfected HEK293 cells were used in the EMSA reactions. Two binding complexes were formed on the consensus Oct-1 probe, both of which were competed with unlabeled Oct-1 consensus elements at 25- and 50-fold mass excess of probe. As described in the previous Section

4.3.4, the two complexes formed are consistent with the binding of endogenous Oct-1

(complex I) and the expressed Pit-1 (complex II), respectively. When oligonucleotides

OLE a, b, c and d were used as competitors, both complex I and II were retained and no competition was observed (Figure 4.18), suggested the low or no affinity of these Oct-1- like elements (OLE a, b, c and d) for either endogenous Oct-1 or the expressed Pit-1 proteins in HEK293 cells.

117 Oot-1 consensus OLE a OLEb OLEc OLEd 25x 50x 25x 50x 25x 50x 25x 50x 25x 50x

Figure 4.18 Oct-1-like elements from HS III do not affect Pit-1 and Oct-1 association with a consensus Oct-1 element. EMS A was performed using a radiolabeled consensus Oct-1 DNA binding element as a specific probe. Nuclear proteins from the Pit-1 transfected HEK293 cells were used in the reaction. Unlabeled Oct-1 consensus element and HS III OLEs (OLE a, b, c and d) were used as specific competitors at 25- and 50-fold mass excess of probe. The specific binding complexes are indicated with arrowheads. FP, free probe. NE, nuclear extracts.

EMSA data suggest that none of the four Oct-1 like elements from HS III is capable of interfering with Pit-1 and Oct-1 protein binding to a consensus Oct-1 element. Taken together with the lack of evidence for heterodimer formation between Pit-1 and Oct-1, these observations are consistent with the four Oct-1-like elements in HS III possessing no or a very low affinity for both Oct-1 and Pit-1.

118 4.4 Evidence that the POU Homeodomain-Dependent Action in HEK293 Cells is

Mediated by Association with a Member of the ETS Family of Transcription

Factors, Elk-1.

4.4.1 Direct Protein-protein Association Between Pit-1 and Elk-1 is Observed in

the HEK293/Pit-1 Cell System.

Given that the data do not support induction of chromatin modification through direct binding of Pit-1 to DNA at HS III, the potential for protein-protein interaction between

Pit-1 and other transcription factor(s) was assessed. The presence of a binding site for an

ETS family member as identified in a Matlnspector search using the core 574bp HS III fragment as a query sequence [170, 171] (Figure 4.13) suggests the involvement of ETS family member(s) in the process of chromatin modification and/or increased DNA accessibility induced by Pit-1. There are two pieces of experimental evidence in the literature about ETS family members that would support this hypothesis that they might relate to the function of Pit-1 or DNase-I hypersensitive site III (HS III) along the hGH/CS locus, or a combination of both. First, it was reported that association of Ets-1 and Pit-1 through the POU-homeodomain reconstitutes pituitary-specific prolactin expression in HeLa cells synergistically, indicating the possibility for potential protein- protein interaction [168, 169]. Second, another ETS family member, Elk-1, has been linked to the enhancer activity of HS III. Additionally, association of Elk-1 and HS III was confirmed in human pituitary chromatin in situ [155]. Therefore, a potential

119 interaction between Pit-1 and an ETS family member, in particular Ets-1 and/or Elk-1 to be more specific, was pursued in the HEK293 cell system.

A possible interaction between exogenous Pit-1 and ETS family members in HEK293 cells was assessed using a co-immunoprecipitation (IP) assay. HEK293 cells were transiently transfected with cMyc-Pit-1 expression vector, and nuclear proteins were harvested 48 hours after gene transfer. IP was performed using specific antibodies against the cMyc-epitope tag (Clontech, Cat# 3800-1) or non-immune mouse serum

(NMS) (Santa Cruz, sc-2025). The immuno-precipitates were then analyzed by SDS-

PAGE and immuno-blotting using Ets-1 (Santa Cruz, N-276, sc-111) or Elk-1 (Santa

Cruz, 1-20, sc-355) antibodies.

When the nuclear protein (input) sample was immuno-detected with Ets-1 antibodies, a major band for Ets-1 at the expected size (55 kDa) was detected. In contrast, when Elk-1 antibodies were used, only a faint band at the size of 62 kDa was detected (Figure 4.19).

Assessed in this manner, Ets-1 appeared to be present at a higher level than Elk-1 in

HEK293 cells. However, the possibility that this apparent difference in levels is due to the specificity/affinity of antibodies used in immuno-blotting could not be ruled out from this assessment.

Following IP with the cMyc-tag antibodies, a minor band of 62 kDa was detected with

Elk-1 antibodies, although detection was made difficult because of co-localization of other bands. By contrast, no band of about 55 kDa was detected with Ets-1 antibodies.

120 Furthermore, in the non-immune normal mouse serum (NMS) IP group (negative control), no specific bands for either Ets-1 or Elk-1 were detected (Figure 4.19).

IP: IP: Input cMyc NMS

55 kDa • mmmm m. Ets-1 Ab $4 |*4

62 ^ ^ IB: Elk-1 Ab

Figure 4.19 Pit-1 expressed in HEK293 cells co-precipitates with Elk-1. HEK293 cells were transfected with cMyc-tagged Pit-1 and nuclear protein (Input) was immunoprecipitated with cMyc antibodies (Clontech, Cat# 3800-1) or normal mouse serum (NMS) (Santa Cruz, sc-2025). The resulting fractions were analyzed by protein blotting and probed with antibodies for the presence of Ets-1 (Santa Cruz, N-276, sc-111) and Elk-1 (Santa Cruz, 1-20, sc-355). Migration positions of molecular weight markers (in kDa) are shown. IP, Immuno-precipitation. IB, Immuno-blotting.

Based on an analysis of co-immunoprecipitation data, Pit-1 may be associated with an endogenous ETS family member, Elk-1, but not Ets-1, in HEK293 cells.

121 4.4.2 Evidence that HS III Sequences with an Intact ETS Binding Site is Required

for the Association Between Pit-1 and Elk-1.

To assess whether HS III DNA element is involved in the protein-protein interaction between Elk-1 and Pit-1, the ability of the Elk-1 and Pit-1 complexes reflected in the immuno-precipitation to bind HS III sequences was explored. Immuno-precipitation experiments were performed again as described in Section 4.4.1. Instead of assessing the protein content with protein blotting, the proteins from the precipitate were recovered by eluting with potassium chloride (KC1) solution at different concentrations (0.4, 0.6 and

1.0 M). Proteins eluted in this manner were used in an EMS A to assess their ability to bind to the previously identified Elk-l/Ets-1 DNA element in HS III (ETS/HS III) [155].

The wild type ETS/HS III oligonucleotide (HS III wt) was radiolabeled and used as a specific EMSA probe. When the radiolabeled ETS/HS III oligonucleotide was incubated with different elution fractions from cMyc immuno-precipitation, a single shifted product was seen in the 0.4 M KC1 fraction, but not in the other elution fractions. By contrast, in the control IP group using normal mouse serum (NMS), no shifted product was detected

(Figure 4.20A). The specificity of this interaction was assessed with a subsequent

EMSA experiment with 0.4 M KC1 cMyc-immunoprecipitated fraction in the presence of

Elk-1 or Ets-1 antibodies. As a result, competition of the shifted band was only detected with the addition of Elk-1 but not Ets-1 antibodies (Figure 4.20B).

To further clarify the involvement of the HS III/ETS site, a seven base pair disruption of the ETS site was introduced into the wild type ETS/HS III fragment to generate a mutant

122 ETS/HS III fragment (HS III m7) (Figure 4.20C). The mutant ETS/HS III oligonucleotides were radiolabeled and used as an EMSA probe. The equivalent protein content after 0.4 M KC1 recovery was used again in EMSA reactions. Interestingly, no specific binding complex was detected. Addition of cMyc antibodies did not result in any specific change compared to adding normal mouse serum (NMS) (Figure 4.20D).

123 A B D

& o.4M 0.6M I.OM £: £ % 2: % KCI KC1 KC1 % + + a a I s | s | s g|sss a I s •B Z o Z o Z o 3-, Z o u u BC Z o

mHiMn dtli id C ETS HS III wt CCACTCAGGCCCTGGAGAGCGGAAGTGGCAGGTAAACACAG HS III m7 CCACTCAGGCCCTGGAGAGCtcgctgaGCAGGTAAACACAG

Figure 4.20 Exogenous Pit-1 participates in a common complex with the endogenous Elk-1, not Ets-1 at HS III in HEK293 cells. EMSAs were performed using radiolabeled wild type and mutant ETS DNA elements from HS III as probes. (A) The wild type ETS/HS III (HS III wt) was radiolabeled as an EMS A probe. Nuclear protein from cMyc-Pit-1 transfected HEK293 cells was immunoprecipitated with cMyc antibodies and eluted at increasing salt concentrations. A shifted product that appears specifically in the cMyc-precipitation with 0.4 M KCI elution is indicated by arrowhead. (B) The 0.4 M KCI elution fraction from (A) was used in a further EMS A experiment in combination with antibodies against Elk-1 (Santa Cruz, I- 20, sc-355) and Ets-1 (Santa Cruz, N-276, sc-111), respectively. (C) The nucleotide sequence for HS III wt and HS III m7 are shown. The ETS binding site is underlined. The 7-bp mutation is indicated by lowercase letters. (D) The mutant ETS/HS III oligonucleotide with 7 bp mutation within the ETS binding motif was radiolabeled as a probe. The 0.4 M KCI elution fraction from (A) was used again, wt, wild type. FP, free probe. NMS, normal mouse serum. IP, immuno-precipitation.

124 The above observations suggested that exogenous Pit-1 associates with endogenous Elk-

1, but not Ets-1 in the HEK293 cell system. The intact ETS binding site within HS III was required for the Elk-l/Pit-1 interaction.

4.4.3 Evidence that the POU-Homeo domain Plays a Role in the Association

between Pit-1 and Elk-1.

The results from previous studies with Pit-1 deletions suggested a role for the homeodomain of Pit-1 in modifying the chromatin or affecting DNA accessibility at HS

III {Section 4.2.7). However, data from the subsequent EMSA experiments did not support a direct association between Pit-1 and HS III {Section 4.3). Even though the

POU-homeodomain of Pit-1 is required for low affinity DNA binding, it is also reported that Pit-1 associates with other transcription factors through the POU-homeodomain

[168, 169]. This raised the possibility that the POU-homeodomain might be involved in protein-protein interactions of Pit-1 and other transcription factor(s) that are required for chromatin remodeling in the hGH/CS LCR.

Based on the hypothesis that the ETS site in the HS III DNA fragment is required for protein-protein interaction between the endogenous ETS family members and other associated protein components in the HEK293 cells, the ETS/HS III oligonucleotide was conjugated to magnetic beads and used to extract nuclear proteins from HEK293 cells transfected with wild type and APOUHD Pit-1 cDNAs. After a series of wash and elution

125 steps, the bound fractions as well as input samples were analyzed by SDS-PAGE and immunoblotting using specific Pit-1 antibodies (Santa Cruz, X-7, sc-442).

Both wild type and APOUHD Pit-1 were detected in the input fraction at appropriate sizes.

However, after magnetic bead exaction, only wild type Pit-1 (33 kDa), but not Pit-1 with the POU homeodomain deletion was detected (Figure 4.21).

Input Bound

NT Pit-1 wt APOUHD Pit-1 wt APOUHD

Figure 4.21 Evidence that association between Pit-1 and Elk-1 may depend on the POU-homeodomain. The ETS/HS III oligonucleotide was conjugated to magnetic beads and mixed with nuclear protein from untransfected HEK293 cells and from HEK293 cells transfected with wild type (wt) as well as POU-homeodomain deleted (APOUHD) Pit-1 cDNAs. After mixing with the conjugated oligonucleotides, the bound fractions as well as input fractions were analyzed by protein blotting and probed with Pit-1 antibodies (Santa Cruz, X-7, sc-442). NT, non-transfected HEK293 cells. Data provided by Ms. Yan Jin1.

1 Reprinted figure with permission from Ms. Yan Jin.

126 The above observations provide additional support for interactions between Pit-1 and

ETS family member(s) in the HEK293 cells, and also support a role for the POU- homeodomain in the protein-protein interaction between Pit-1 and ETS family member(s).

AAA Direct Association between Pit-1 and ETS Family Members is Observed in

Human Pituitary Tissues In Situ.

The results from Section 4.4.3 support direct association between exogenous Pit-1 and endogenous Elk-1 in the transfected HEK293 cell model system. To further validate this observation in situ, immuno-precipitation (IP) studies were performed using nuclear proteins from the human pituitary samples. A commercial 'Universal Magnetic Co-IP' kit (Active Motif), was purchased and used in this experiment to make use of a higher sensitivity and specificity due to the optimized procedure for nuclear protein harvesting combined with co-IP {Section 2.2.5).

Nuclear proteins from human pituitary samples were harvested according to kit instructions. Three hundred u.g of nuclear extract was used for each IP reaction. Two u,g of antibodies against Ets-1 and Elk-1, as well as non-immune normal rabbit serum were incubated individually with human pituitary nuclear proteins. Magnetic protein G beads were then added to pull down the associated proteins. The protein components were eluted from the beads, resolved by SDS-PAGE, immuno-blotted and assessed using Pit-1

127 antibodies (Santa Cruz, X-7, sc-442, raised against full length rat Pit-1 which cross-reacts with human Pit-1).

In the control group where normal rabbit serum was used for IP, no Pit-1 band was detected, suggesting the specificity of the precipitation (Figure 4.22). In the experimental group where Ets-1 or Elk-1 antibodies were used for IP, a band of approximately 66 kDa, about double the molecular weight for a Pit-1 monomer, was detected in both IP reactions when immuno-blotted with Pit-1 antibodies. A crude GC nuclear protein sample was used as a positive control for Pit-1, and, revealed a band at the expected size of around 33 kDa. However, when crude human pituitary nuclear extracts (same sample for each IP reactions) was assessed as an additional positive control, a major band at 66 kDa, exactly the same size as detected in the IP reactions, was observed. Another faint band, at 33 kDa consistent with Pit-1 monomer, was also detected (Figure 4.22). Thus, these observations suggest that human Pit-1 can run and be detected as a dimer under the isolation and/or blotting conditions employed.

In order to confirm that the bands detected in the IP experiment were Pit-1 dimers, the IP experiment was repeated under similar conditions, but immuno-blotted with a second polyclonal Pit-1 antibody (Santa Cruz, N-20, sc-16288, raised against the first 50 amino acid at the N-terminus of human Pit-1). The same pattern was observed after IP with detection of a 66 kDa band consistent with a Pit-1 dimer.

128 The observation that Pit-1 functions as a dimer has been reported previously [174-176].

Detection of the Pit-1 dimer under the conditions employed might be a consequence of the use of the "Universal Magnetic Co-IP Kit". Traditionally, nuclear proteins are harvested based on salt extraction. By contrast, nuclear protein harvesting in the

"Universal Magnetic Co-IP" kit depends on a chemical cocktail (containing unknown components). Thus, it is possible that this modifies Pit-1 such that it either favors dimerization and/or resistance to denaturation to monomers under conditions of SDS-

PAGE. However, the observation that the same band was recognized by two separate

Pit-1 antibodies, which recognize different regions of Pit-1, provides strong evidence that the 66 kDa band represents a Pit-1 dimer.

A potential interaction between Pit-1 and Elk-1 in human pituitary samples was indicated by detection of Pit-1 in the Elk-1 IP group (Figure 4.22). Additionally, it should be noted that Pit-l/Ets-1 interaction was also detected in human pituitary samples. Ets-1 has been shown to be an important regulator involved in the rat prolactin promoter activity in lactotrophs [168, 169, 177]. Thus, the detection of Pit-l/Ets-1 likely reflects the composition of the human pituitary tissues used for the IP experiment. Specifically, that the tissue represents a mixture of cell types including prolactin-secreting lactotrophs.

129 IP IP NE Ets-1 NRS Elk-1 NRS HPit GC 75KDal •< Pit-1 dimer 66kDa

50KDal

Pit-1 monomer 33kDa

Figure 4.22 Pit-1 associates with ETS family members in human pituitary in situ. Immunoprecipitation (IP) was performed using nuclear extracts from human pituitary tissue samples to detect the Pit-1/Elk-1 interaction. The antibodies against Ets-1 and Elk- 1, as well as non-immune normal rabbit serum (NRS) were used to precipitate the associated proteins according to manufacturer's (Universal Magnetic Co-IP Kit) instructions. Purified proteins and 20 \xg human pituitary/GC nuclear extracts were then resolved by SDS-PAGE, immunoblotted and detected with Pit-1 antibodies (Santa Cruz, N-20, sc-16288). The bands for monomer and dimer forms of Pit-1 at approximately 33 kDa and 66 kDa respectively, are indicated by arrowheads. Migration positions of molecular weight markers (in kDa) are shown. IP, immuno-precipitation. NE, nuclear extracts. NRS, normal rabbit serum.

The data support the association of Pit-1 and Ets family members in human pituitary cells in situ.

130 4.5 GH-N Gene Activation is Induced by Co-transfection of Pit-1 and Elk-1 in

HEK293 Cells.

4.5.1 Pit-1 Specifically Increases Endogenous hGH-N Gene Expression in

Transfected HEK293 Cells.

To assess the potential for an effect of Pit-1 and/or Elk-1 on endogenous gene expression, the endogenous non-coding hGH/CS RNA was assessed in transfected HEK293 cells by quantitative real-time PCR (qPCR). Wild type Pit-1 and Elk-1 expression vectors were transiently transfected into HEK293 cells alone or in combination, total RNA was harvested 48 hours after gene transfer and assessed by quantitative real-time PCR (qRT-

PCR). Quantitative RT-PCR (qRT-PCR) analyses were performed in an iCycler (Bio-

Rad) system with specific primers designed for GH-N (GeneBank access number

NW_001838450.2), CS-A/B (GeneBank access number NM_022640.2) and GH-V

(GeneBank access number NM022557.2), respectively. The non-coding transcript level in each sample was calculated from the standard curve and normalized to human GAPDH expression as appropriate.

Expression of hGH-N RNA transcript was increased significantly about 6.23-fold (6.23 +

0.62, pO.OOl, n=3) in the presence of wild type Pit-1. In contrast, neither hCS-A/B nor hGH-V RNA levels were increased significantly. Human GH/CS RNA levels were also assessed in HEK293 cells overexpressing the Elk-1 cDNA. A 13.4-fold (13.4 + 0.60,

131 j9<0.001, n=3) increase in GH-N RNA levels was observed, however, significant 3-4-fold increases in CS RNA levels were also detected. When Pit-1 and Elk-1 were co- expressed, GH-N levels were increased 23-fold (22.76 + 0.9 (pO.OOl, n=3), relative to non-transfected cells but, perhaps more importantly, Pit-1 again was associated with a significant and specific (10-fold) increase in GH-N but not (placental) CS or GH-V RNA levels relative to Elk-1 overexpression alone (Figure 4.23).

HEK293 HEK293 • Pit-1

GH-N CS-A CS-B GH-V

Figure 4.23 Expression of Pit-1 specifically stimulates endogenous GH-N RNA transcript in HEK293 cells. Human GH/CS RNA transcripts were assessed by quantitative real-time PCR (qRT-PCR) after expression of Pit-1 and Elk-1 alone or in combination in HEK293 cells. The RNA level in each sample was calculated from the standard curve and normalized to human GAPDH expression as appropriate. RNA levels after transfection are presented as fold increase above basal levels in non-transfected HEK293 cells, which are arbitrarily set to 1.0. Statistical analysis was performed by one-way ANOVA with Tukey post test for multiple comparisons (n=3-5). **, /?<0.01; ***, /?<0.001. Data provided by Ms. Yan Jin1.

1 Reprinted figure with permission from Ms. Yan Jin.

132 The observation from quantitative RT-PCR demonstrated that Pit-1 expression can stimulate a specific increase in endogenous (human) GH-Nbut not CS/GH-VRNA levels in HEK293 cells. The relative response was linked to Elk-1, as co-expression of Pit-1 and Elk-1 revealed an additive effect on GH-N RNA levels.

4.5.2 Pit-1 Increases HS III Enhancer Activity in the Presence of Intact Elk-1

Binding Site.

Evidence for both function and interaction between Pit-1 and Elk-1 in HEK293 cells has been presented. Furthermore, the functional consequence of an association between Pit-1 and Elk-1 at HS III was also investigated in HEK293 cells by testing the potential for Pit-

1 to fraws-activate a reporter gene via ETS/HS III.

A hybrid luciferase gene directed by a 41 base pair fragment of HS III containing an ETS binding site and a minimal thymidine kinase promoter (wtETS/HS III TKp.Luc) was used in the functional assessment; wtETS/HS III TKp.Luc was described previously in [155].

In order to confirm the functional involvement of ETS in this enhancer region in HEK293 cells, the reporter genes containing wild type 41 bp HS III element or a mutant 41 bp HS

III element (single base pair mutation of the ETS site) (Figure 4.24 A) were transfected in to HEK293 cells, and luciferase activity was measured. The wild type reporter gene itself

(wtETS/HS III TKp.Luc) revealed higher relative basal luciferase activity which was 8-

133 fold greater than detected in mETS/HS III TKp.Luc, reflecting the enhancer-stimulating activity induced by the endogenous Elk-1 in HEK293 cells. When luciferase activity for wtETS/HS III TKp.Luc was arbitrarily set to 100%, activity of mETS/HS III TKp.Luc was reduced significantly to only 12.9% (pO.OOl, n=3) (Figure 4.24B).

In order to address the question as to whether Pit-1 expression affects the enhancer activity mediated by Elk-1, wild type Pit-1 expression vector was transiently transfected into HEK293 cells for comparison. Expression of wild type Pit-1 induced a modest but highly significant increase in luciferase activity. When luciferase activity of wtETS/HS

III TKp.Luc was arbitrarily set to 100%, introduction of wild type Pit-1 resulted in 136% activity compared to the reporter gene itself (p<0.00\, n=3). Furthermore, in the mETS/HS III TKp.Luc group, expression of wild type Pit-1 did not result in a significant increase in luciferase activity (Figure 4.24B), indicating a contribution of the ETS-DNA element to the enhancer activity of HS III seen in the presence of Pit-1.

134 ETS site wtETS/HS III CCACTCAGGCCCTGGAGAGCGGAAGTGGCAGGTAAACACAG mETS/HS IH CCACTCAGGCCCTGGAGAGCaGAAGTGGCAGGTAAACACAG

• wtETS/HS III TKp.Luc | | wtETS/HS III TKp.Luc + Pit-1 wt

H| mETS/HS III TKp.Luc

mETS/HS III TKp.Luc + Pit-1 wt

Figure 4.24 Pit-1 increases HS III enhancer activity in the presence of an intact ETS binding site.

(A) Nucleotide sequences for the wild type 41 base pair (bp) fragment within HS III containing an ETS binding site is shown (wtETS/HS III). A single base pair mutation of the wtETS/HS III is also shown by lowercase letter. The ETS putative site is boxed. (B) The wild type as well as mutant ETS/HS III fragment was inserted upstream of a luciferase reporter gene driven by a minimal promoter to generate two hybrid reporter genes, including wtETS/HS III TKp.Luc and mETS/HS III TKp.Luc. These constructs were transfected into HEK293 cells alone or in combination with wild type Pit-1 cDNA (Pit-1 wt). Firefly luciferase counts were corrected by protein concentration as per u,g protein lysate. The mean value for wtElk/HS III TK.Luc is 1.35 + 0.06 (relative light units x 105). Corrected values are expressed as a percentage of wtETS/HS III TKp.Luc activity, which is arbitrarily set to 100%. Statistical analysis was performed by one-way ANOVA followed by Tukey posttest for multiple comparisons. ***, /?<0.001. Bars represent standard error of the mean (SEM).

Thus, the functional analysis confirmed that the enhancer activity ofHS III was mediated via an ETS DNA element, in HEK293 cells. Furthermore, the increase in activity observed with Pit-1 is mediated through the ETS site and thus likely Elk-1, as the

135 enhancer activity was only detected in the presence of an intact but not disrupted ETS binding site.

136 SUMMARY OF THE RESULTS IN CHAPTER 4

• Functional involvement of the pituitary-specific transcription factor Pit-1 and its

association with upstream HS I/II have been well described using transgenic animals

[85, 128]. However, the process by which Pit-1 gains access to the chromatin prior to

LCR activation has not been determined. In the absence of human embryonic cells of

the pre-somatotroph lineage, the HEK293 cell line was used as a model system to

assess the consequence of Pit-1 appearance on the hGH/CS locus and potentially gain

some insight into this process.

• Using a high-efficiency transient transfection system, data reveal that addition of

functional Pit-1 to the HEK293 cells resulted in modest but significant change in

chromatin remodeling at HS III specifically, reflected by a significant increase of

histone H4 hyperacetylation, and increased access of DNA to RNA Pol II activity as

reflected in the detection of non-coding RNA transcript around HS III.

• Mechanistic studies using modified Pit-1 cDNAs suggest that histone H4

hyperacetylation at HS III region requires both the POU-homeodomain and the

amino-terminal trans-activation domain of Pit-1. However, increased DNA

accessibility, reflected by activation of the RNA Pol II appears to depend only on the

presence of the POU-homeodomain.

• The POU homeodomain dependent action of Pit-1 in HEK293 cells appears to be

mediated by association with the transcription factor Elk-1, an ETS family member.

137 Interaction between Pit-1 and ETS family members, including Elk-1, was observed in

human pituitary tissue.

• Using the high-efficiency transient transfection and HEK293 cells, expression of Pit-

1 stimulated a specific increase in endogenous GH-N RNA level. Furthermore, co-

expression of Pit-1 and Elk-1 appear to combine in an additive manner to increase

GH-N RNA levels in HEK293 cells greater than 20-fold.

138 CHAPTER 5

Identification of the Hepatocyte Nuclear Factor-3a as a Component in

Pituitary Repressor Complexes Formed at the P Sequences of the

Human Growth Hormone/Chorionic Somatomammotropin Locus

Highlights of Rationale

• Five members of the hGH/CS gene family share extensive nucleotide similarity and

are believed to have evolved by gene duplication [73, 133]. Despite the sequence

similarity within genes and the immediate flanking regions, GH-N is the only one

expressed efficiently in the pituitary, while the others are expressed preferentially in

the placenta [73].

• The hypothesis that all the placental GH/CS genes are negatively regulated in

pituitary was based mainly on two observations. First, all four placental genes

showed similar sensitivity to nuclear digestion in the pituitary as the GH-N gene,

indicating that although they are not expressed, the placental genes appear 'poised' or

'competent', and thus, might be expected to have similar accessibility to transcription

factors as the 'active' GH-N gene [144]. Second, due to the sequence homology, all

placental gene promoters contain binding sites for the pituitary-specific transcription

factor Pit-1 (GHF-1) [145, 146], which is essential for pituitary development [115,

139 160] and pituitary-specific GH-N expression [117, 118, 178]. The fact that rat Pit-1

can bind to and activate the CS-A promoter in vitro raises the possibility that the CS

promoter can be activated in pituitary somatotrophs in vivo [147]. However, the role

that Pit-1 plays in pituitary-specific GH-N expression in vivo and the capability of

activating CS-A promoter in vitro also raise the question of what is preventing Pit-1

from activating the placental GH/CS gene expression in vivo under similar levels of

chromatin condensation and nuclease sensitivity.

• A sequence analysis of the hGH/CS locus reveals conserved DNA elements located

about 2 kb upstream of each placental GH/CS gene but not the GH-N gene. These

regions, referred to as P sequences, has been implicated in the specific regulation of

the placental GH/CS genes [73]. The capacity for these sequences to block pituitary

expression of hGH/CS genes was suggested by the ability of a DNA fragment

containing P sequence to repress human placental CS-A gene promoter activity in

pituitary tumor GC cells after gene transfer [143]. Repressor activity was further

localized to a 263 bp fragment (263P). Previous studies on the pituitary repressor

complex identified two protein-binding regions within 263P, including P sequence

element-A (PSE-A) and PSE-B. The sequence downstream of the previously

characterized PSE-A and PSE-B is explored for activity in the third part of this thesis.

Data reported here provide new evidence for an additional DNA regulatory element

and associated protein involved in the proposed pituitary repressor activity, providing

additional support for a pituitary complex.

140 5.1 Functional Assessment of an Additional Potential P Sequence Element (PSE).

5.1.1 Sequence Outside of the PSE-A and PSE-B regions has the Capacity of

Further Repressing CS-A Promoter Activity In Vitro.

The repressor function of 263P sequences has been well documented using anterior rat pituitary tumor GC cells by transient gene transfer [143]. Two protein-binding regions were characterized on the DNA and named as PSE-A and PSE-B. Two functionally and structurally independent pituitary complexes including nuclear factor-1 (NF-1) or regulatory factor XI (RFX1) have been reported to associate with a 103-bp fragment

(103P) containing the entire PSE-A and PSE-B regions [151, 152].

To determine if 103P is responsible for the full repressor activity associated with 263P, plasmids were constructed with -4-92/+6 of CS-A gene 5'-flanking DNA (CS-Ap) driving expression of a luciferase reporter gene (CSp.Luc). Both 263P and 103P fragments were inserted upstream in the hybrid luciferase reporter gene CSp.Luc to generate

263PCSp.Luc and 103PCSp.Luc respectively, and luciferase activity was assessed in transiently transfected GC cells. The CSp.Luc and 263PCSp.Luc genes were also used in the experiments as non-repressed and repressed controls, respectively. The 103P element did not repress the activity of the CS-A promoter significantly in pituitary GC cells.

When CSp.Luc activity is arbitrarily set to 100%, the luciferase activity of 103PCSp.Luc averaged 88% of CSp.Luc activity, but this decrease is not significant (n=12). However,

141 the presence of 263P upstream of the CS-A promoter resulted in significant repression of luciferase activity to 36% (n=12,/K0.001) (Figure 5.1).

C« 40- CSp.Luc • •{HE

263PCSp.Luc • 263P -Tcs^" 103PCSp.Luc • 103P -CcE

Figure 5.1 263P, not 103P, repressed the CS-A promoter activity in transiently transfected rat pituitary GC cells. Hybrid luciferase (Luc) genes were used to assess the effect of 103P and 263P sequences on CS-A promoter activity in transfected GC cells. Schematic constructs are shown. To control for DNA uptake, cells were co-transfected with pRL-TKp.Luc . Corrected values are expressed as a percentage of CSp.Luc activity, which is arbitrarily set to 100%. The mean value of CSp.Luc is 1.33 + 0.10 (n=6). Statistical analysis was performed by one way ANOVA followed by Dunnet's posttest for multiple comparisons with a single control. ***,/?< 0.001. Bars represent standard error of the mean (SEM). Data reported In [153]1.

Reprinted figure with permission from Molecular Endocrinology. Hepatocyte nuclear factor-3a binding at P sequences of the human growth hormone locus is associated with pituitary repressor function. Yang X and Norquay LD, Jin Y, Detillieux KA, Cattini PA. Molecular Endocrinology. 2006 Mar; 20(3):598-607. (Joint first author) Url: http://www.ncbi.nlm.nih.gov/pubmed/16239259 Copyright © 2006 by the Endocrine Society.

142 Therefore, these experiments raised the possibility that sequences outside the 103P, and specifically PSE-A and PSE-B, contribute to 263P repressor activity in rat pituitary GC cells.

5.1.2 Sequences Downstream of 103P Contain Putative Binding Sites for

Transcription Factors HNF-3 and C/EBP.

To investigate the putative binding sites upstream and downstream of 103P, sequence analysis using the Matlnspector 2.2 binding site detection program based on the

TRANSFAC 4.0 database [170, 171] was performed. No binding sites upstream of 103P were detected according to the search. However, two putative binding sites were detected downstream of 103P, including CCAAT enhancer binding protein (C/EBP) and

HNF-3/fkh family transcription factor DNA elements (Figure 5.2). This 41 base pair

(bp) region, downstream of PSE-A, is referred to as PSE-C (41P).

143 263P

TCCTACAGGCCTGCCTGGAGAACAGCTCACAGCACAGTGCCCTCCCAGCAGAT

GATGAGTCTGGGGTGCTAGTCCAGTAATGCTTCAGGAATGACGGCAGAAAAAG PSE-B GAGCTCTGTTTTCTGCTCTGAAAGTGGGGAGATGGCAGGGCCCCAGCATTCAC PSE-A ATCCTAGGCCACAGGGGTGTGGGTGTTCAATGTTGGTTGCCAACACCACTGCC PSE-C AACCACTTCTGGAAGCGTTTGCCTGTTTGTTTGCTTGTGTTTCTACAGAGT HNF-3 C/EBP

Figure 5.2 Details of P sequence structure and analysis. The 5'-3' sequence of the CS-A 263P fragment (-2245A2283 in relation to the CS-A gene) is shown. Corresponding repeats for the remaining three placental genes are also detected: CS-L (-2593A2327), GH-V (-2451/-2189) and CS-B (-2860/-2598). 103P, generated by PCR, is indicated in blue. PSE-A and PSE-B nuclease protection regions are highlighted in gray. The 41-bp PSE-C fragment is highlighted in yellow. Putative binding sites for HNF-3 and C/EBP are underlined. Data reported in [153]1.

The CCAAT enhancer binding protein (C/EBP) family contains six known proteins, including C/EBPa (C/EBP), C/EBPp (NF-IL6, LAP), C/EBPy (Ig-EBP), C/EBP8 (NF-

IL6P), C/EBPe (CRP-1) and C/EBP£ (CHOP, GADD153) [179]. The family members recognize the DNA binding site through a basic leucine zipper DNA binding domain via dimerization [180, 181]. The consensus sequence DNA element for C/EBP family members is 5'-gatcAGATTGTGCAATGT-3' [182]. These proteins are reported to be involved in the regulation of many genes, including those coding for the human hepatic

1 Reprinted figure with permission from Molecular Endocrinology. Hepatocyte nuclear factor-3a binding at P sequences of the human growth hormone locus is associated with pituitary repressor function. Yang X and Norquay LD, Jin Y, Detillieux KA, Cattini PA. Molecular Endocrinology. 2006 Mar; 20(3):598-607. (Joint first author) Url: http://www.ncbi.nlm.nih.gov/pubmed/16239259 Copyright © 2006 by the Endocrine Society.

144 flavin containing monooxygenase 3 (FM03) [183], the human insulin receptor promoter

[184], the mouse fatty acid translocase/CD36 and the rat alpha-fetoprotein promoter

[185].

The hepatocyte nuclear factor-3/forkhead (HNF-3/fkh) family of transcription factors is a large family of regulatory proteins characterized by the distinct forkhead DNA-binding domain. It has been reported that the family members (HNF-3a, |3 and y) mediate the coordinated expression of a number of hepatocyte-specific genes in humans [186]. The

HNF-3a and HNF-3|3 proteins share 93% amino acid similarity in the winged helix DNA binding domain, bind to the same DNA consensus sequences, and both are potent transcriptional activators [187-189]. The additional FfNF-3/fkh-related homologues

(HFH) are required for determination of events during embryogenesis in Drosophila and

Xenopus [190, 191]. HFH gene expression in rodent exhibits restricted tissue-specific expression in tissues other than liver [186].

A Matlnspector search identified two putative binding sites for C/EBP and HNF-3/fkh downstream of 103P, suggesting that C/EBP and HNF-3/fkh are candidates for PSE-C associated protein. Both C/EBP and HNF-3/fkh have the potential to be involved in the regulation of the human placental GH/CS gene expression in the human pituitary in vivo.

5.1.3 PSE-C Contributes to 263P Repressor Activity in Transiently Transfected

Rat Pituitary GC Cells.

145 To assess the possible contribution of PSE-C to 263P repressor activity, specific mutations in this region were introduced into 263P by site-directed mutagenesis (PSE-

Cm/41Pm5). The mutations effectively eliminated both the C/EBP and HNF-3/fkh binding sites, without the creation of additional binding sites (as assessed by

Matlnspector 2.2 and TRANSFAC 4.0 database) (Figure 5.3A). The mutated 263P fragment was then placed upstream of the CS-A promoter to generate 263PCmCSp.Luc.

The luciferase activity of 263PCmCSp.Luc was assessed in transiently transfected GC pituitary cells. The 263PCSp.Luc and CSp.Luc genes were used as controls. When

CSp.Luc activity is arbitrarily set to 100%, introduction of PSE-C mutation

(263PCmCSpLuc) resulted in a 39% loss of CSp.Luc activity in pituitary GC cells

(Figure 5.3B). This represents a significant reduction in repressor capacity compared with that of 263PCSp.Luc (n=15, p< 0.005). The mean value for CSp.Luc was 1.79 ±

0.25 (n=15).

146 PSE-C(41P): GGAAGCGTTTGCCT 3TTTGTTTGCTT 3TG TTTCTACA 3AGT

PSE-Cm(41 Pm5): GGAAGCGTTTGCCT 3TTACTTTCATT GTG CTTCTACA GAGT HNF-3 C/EBP

1ZU 100- I 80- 1 T s bU- • - • d. 40" CSp.Luc • 1 263PCSp.Luc • 20- 1 263PCmCSp.Luc •

Figure 5.3 Functional analysis of PSE-C sequence in transiently transfected pituitary cells. (A) PCR-based, site-directed mutagenesis of PSE-Cm fragment containing the 5 bp mutation was generated. The oligonucleotides for PSE-C (4IP) and PSE-Cm (41Pm5) are shown. The mutated nucleotides are underlined. Putative binding sites for HNF-3 and C/EBP are boxed. (B) Both PSE-C and PCE-Cm were introduced upstream of the CSp.Luc to generate 263PCSp.Luc and 263PCmCSp.Luc. Schematic constructs are shown. The hybrid Luc genes were used to assess the PSE-C activity in transiently transfected pituitary GC cells. Cells were co-transfected with pRL-TKp.Luc to control for DNA uptake. Corrected values are expressed as a percentage of CSp.Luc activity, which is arbitrarily set to 100%. The mean value for CSp.Luc is 1.79 + 0.25 (n=15). Statistical analysis was performed by one-way ANOVA followed by Dunnet's posttest for multiple comparisons with a single control. *,p< 0.05. Bars represent standard error of the mean (SEM). Data reported in [153]1.

1 Reprinted figure with permission from Molecular Endocrinology. Hepatocyte nuclear factor-3ct binding at P sequences of the human growth hormone locus is associated with pituitary repressor function. Yang X and Norquay LD, Jin Y, Detillieux KA, Cattini PA. Molecular Endocrinology. 2006 Mar; 20(3):598-607. (Joint first author) Url: http://www.ncbi.nlm.nih.gov/pubmed/16239259 Copyright © 2006 by the Endocrine Society.

147 These observations confirmed the prediction that PSE-C contributes to the repressor activity of 263P. Additionally, the presence of intact binding sites for C/EBP and HNF-

3/fkh is required for the repressor activity of PSE-C. Thus, C/EBP and/or HNF-3/fkh are candidates to bind PSE-C and participate in a common complex involved in the repression of the placental hGH/CS genes in pituitary cells.

148 5.2 Identification of the PSE-C Associated Protein in Rat and Human Systems.

5.2.1 C/EBP does not Associate with PSE-C in Rat Pituitary GC Cells.

Radiolabeled PSE-C (4 IP) was used as probe in the EMS A to detect the binding

complexes when incubated with rat pituitary GC nuclear extracts. The consensus C/EBP

DNA-binding element was used as competitor. Specific antibodies to C/EBPa (Active

Motif, Cat# 39306) and C/EBP(3 (C-19, Santa Cruz, sc-150) were also used to detect

either competition or a possible 'supershift'. The complexes observed when unlabeled

41P was used as 'cold' competitor with GC nuclear proteins were defined as specific

complexes. As a result, two specific complexes were formed on the PSE-C probe when

incubated with GC nuclear extracts due to the observation that they were efficiently

competed by unlabelled 41P oligonucleotide at 50- and 100-fold mass excess of probe.

When C/EBP oligonucleotide was used, no evidence of competition was observed. After the addition of the C/EBPa and C/EBP(3 antibodies, no further complexes were formed

compared to the normal rabbit serum (NRS), which is used as negative control for the presence of other proteins (Figure 5.4).

149 Figure 5.4 C/EBP does not associate with PSE-C in rat pituitary GC nuclear extracts. The 41P (PSE-C) fragment was radiolabeled and incubated with nuclear extracts from rat pituitary GC cells. Two specific complexes, defined by competition through unlabeled probe, are indicated by arrowheads. Competitor oligonucleotides were used at 50- and 100-fold mass excesses of probe. C/EBPa and C/EBP(3 antibodies were also used. FP, free probe. NE, nuclear extracts. NRS, normal rabbit serum. Data reported in [153]1.

The observations from EMSA are not supportive of C/EBP as a PSE-C associated proteins.

150 5.2.2 PSE-C Contains a Low Affinity Binding Site for HNF-3//M Family

Members.

Based on the lack of evidence to support C/EBP binding, studies focused on the potential participation of HNF-3 in the 263P pituitary repressor complex, through binding to PSE-

C. As a potential binding site for HNF-3, PSE-C (41P) was first used to assess the binding of HNF-3 using a characterized source of HNF-3. The nuclear extracts from a human prostate adenocarcinoma LNCaP cell line that are rich in HNF-3 family member proteins, and predominantly HNF-3a, were used as a 'positive' source of HNF-3 complexes for EMS A (kindly provided by Dr. RJ Matusik) [192]. The liver transthyretin gene promoter (TTR) containing a characterized HNF-3 binding element was used as a control [193].

EMSA was performed using a TTR probe first when incubating with the LNCaP nuclear extracts. Specific oligonucleotides (unlabeled TTR), HNF-3cx and HNF-3 (3 antibodies were used as competitors. As a result, the TTR probe revealed two specific binding complexes with LNCaP nuclear protein, defined by the effective competition after adding the unlabeled TTR oligonucleotides. Addition of the HNF-3a antibody resulted in a

'supershift' due to the enlarged protein complex. By contrast, the addition of HNF-3(3 antibody only resulted in modest competition compared to the normal rabbit serum

(NRS) (Figure 5.5A).

151 To further investigate the potential for HNF-3 binding to PSE-C (4 IP), similar EMS A reactions were carried out under the same conditions but with radiolabeled 4IP instead of

TTR as the probe (Figure 5.5B). Unlabeled 4IP oligonucleotides and a mutant form of

41P (41Pm5), in which the HNF-3 site was disrupted (Figure 5.3A), were used as specific competitors, as well as HNF-3a and FfNF-3(3 antibodies. The pattern seen with

4IP was similar to the binding pattern when TTR was used as probe. Two specific complexes were formed which could not be competed by the mutated 41P with a modification of the HNF-3 site (41Pm5). Again, addition of the HNF-3a antibody resulted in a larger protein complex that is consistent with a 'supershift'.

Of note, addition of the HNF-3 p antibody led to slight but detectable competition when compared to the normal rabbit serum (NRS). This result might be related to (i) cross- reaction among the HNF-3 family members due to the lack of specificity for the HNF-3 (3 antibodies used in the EMS A reaction; and (ii) minor presence of HNF-3 (3 in the protein content for both LNCaP and GC cells.

152 Figure 5.5 PSE-C has the capacity to associate with HNF-3 family members. EMSAs were done using the LNCaP nuclear protein with radiolabeled TTR (consensus HNF-3 binding element) and PSE-C (4IP) as probe, respectively. Competitor oligonucleotides were used at 50- and 100-fold mass excesses of probe. (A) TTR was labeled as probe. Two specific complexes formed after addition of LNCaP nuclear extract, defined by competition through unlabeled probe, are indicated with arrowheads. Supershift region is indicated with open arrowhead. (B) Evidence for direct binding of HNF-3 to PSE-C. When labeled 41P was used as probe, a similar binding pattern was observed after the addition of LNCaP nuclear extract. FP, free probe. NE, nuclear extracts. Ab, antibody. NRS, normal rabbit serum.

The above observations support the ability of 41P to associate with HNF-3 family members. The 41Pm5 oligonucleotides, with the specific mutation of the HNF-3 binding site, interfered with binding of HNF-3 family members. These data suggest (i) the capacity for PSE-C to associate with HNF-3 family members; and (ii) the specificity of

PSE-C (41P) binding to HNF-3 family members via sequences identified by the 5 bp mutation in 41Pm5.

153 5.2.3 Rat Pituitary GC Cells Contain Proteins that Bind to HNF-3 Site (TTR) as

well as PSE-C (41P).

Having established the capacity for 4IP to associate with HNF-3 family members, nuclear extracts from the rat pituitary GC cells were used in EMSA assay to assess the presence of HNF-3-like proteins in pituitary cells. Again, the 41P element was used as the probe. Specific oligonucleotides, including 4IP, 41Pm5 and the high affinity HNF-3 binding site (TTR) were used as specific competitors. The HNF-3a and HNF-3(3 antibodies were also used to detect a potential 'supershift'. As a result, two binding complexes were formed on the 41P probe after incubation with the GC nuclear proteins, and similar to the binding pattern observed with the LNCaP nuclear extract (Figure 5.6).

Both complexes were competed by unlabeled probe oligonucleotide itself (4IP). When the TTR DNA element was used as a competitor, the competition was more efficient, reflecting the higher binding affinity between TTR and HNF-3 family members than 4IP.

In contrast, when the mutated 41P oligo, 41Pm5, was used, no evidence of competition was observed. Addition of the HNF-3 a antibody did not show the 'supershift', but some competition. The specificity of this interaction was further suggested by the lack of competition (or supershift) with HNF-3(3 antibody.

154 Figure 5.6 Rat pituitary GC cells contain proteins that bind specifically to an HNF-3 sequence (TTR) as well as PSE-C DNA fragments. EMS A was performed using radiolabeled 41P as probe with rat GC nuclear extract. Competitor oligonucleotides, including 4IP, 41Pm5 and TTR, were incubated with nuclear extracts at 50- and 100-fold mass excess of probe. The HNF-3a and HNF-3p antibodies were also used. Two specific binding complexes, defined by competition through unlabeled probe, are indicated with arrowheads. FP, free probe. NE, nuclear extracts. NRS, normal rabbit serum. Data reported in [153]1.

These observations suggest that rat pituitary GC cells contain proteins that can bind to

HNF-3 site (TTR) as well as PSE-C specifically, indicating the presence of the HNF-3 family members in GC nuclear protein.

155 5.2.4 Identification of HNF-3a in Rat Pituitary GC Cells.

The HNF-3/fkh family is comprised of multiple members as mentioned earlier [186, 190,

191]. To identify the specific candidate family members within GC nuclear extracts that associates with PSE-C, an RT-PCR-based screening approach was devised. Specific

PCR primers were designed initially for the conserved DNA-binding domain of rat HNF-

3a, -p\ and -y. The expected 250-bp amplicon (Figure 5.7) was isolated, purified, and then sequenced commercially by Applied Biosystems from both forward and reverse directions.

156 648 bp •

291 bp* 250 bp • M 8Q m re I

Figure 5.7 Identification of HNF-3 family members in rat pituitary GC cells. RT-PCR was used to identify HNF-3 family members in rat pituitary GC system. Total RNA from rat pituitary GC cells was used. Primers that amplify the conserved DNA- binding domain of rat HNF-3 family members (rHNF-3 DNA BD), HNF-3a (rat HNF- 3a), and HFH-B3 (rat HFH-B3) are listed in Table 2. Amplicons are indicated with arrowheads. M, 100-bp DNA marker. Data reported in [153]\

The commercial sequencing file is presented using color lines indicating different nucleotides (Figure 5.8A), eg. green represents A (adenine), red represents T (thymine), blue represents C (cytosine) and black represents G (guanine). The sequence is read according to the color of the peak line at each location. Positions where the peak line is not clear or doubled by two colors, the nucleotide is read manually to cover all the possibilities. The final sequence was converted into nucleotides in this way, and then

157 aligned with published sequences for HNF-3 family members (Figure 5.8B), including rat HNF-3a (GeneBank access#: X55955), rat HNF-3|3 (GeneBank access#: L09647), rat

HNF-3y (GeneBank access#: L09648), rat HFH3BF (GeneBank access#: LI3193).

Despite the fact that mismatches do exist among the published sequences for the rat

HNF-3 family members, specific locations from the commercial sequence analysis where the peak line showed highly definitive were used as diagnostic locations (red letters in

Figure 5.8B).

158 Applied Biosystems X\'HN=*i=

f.-N C *zCA3jJT-*e'M1V=" Pl.s2"5.0 !£"*{} r^ Luffi25tv. K* ' 1 1 V*fcC'l -SGV&MCS* 'u* 1 , i-kllfeiJL ..hill* ill Jlmtf ll ihl NW If !K* KM -1' J» H

rv. ' /'

Ilililllllil. .ii II.JI .ilii i iMhiL.Liimklliiilii. • JII :: ;cc: cc.' {• " " - *sa- ,•-•••• •; G R >;• •« •*• *JU a ;_-„••:,• c - a i u»*dtie; jv.yL)iL3y I - i i I 1 i i ' » 1 '. l 1 ' '-1"- i I ll 11:11:1 -1 i 1 - : i - i i I 1 '-1"- S R K

'ViJV •>w_A .GtiJr*

Applied Biosystems

K?o:p 4.££0 1£>'£ '•• £ i'=»;-a*!*-V'.' KMI! .1 1 IJ - •illhLlalj •- - ii^jrilli*rilMlhij.

l.hnil i J.U.JIIIIIIIIII1 Jlft ,.•.*•!•..Hill. Jllllfck 1

" -' - -•* -^ -•' • ' Y B » (1 . 'i A N JL-fi /-A'-iA * <.f'. AA Ji >|j Av , ly ./L'l'V J&1& •i't.JLL-A^i.J.d-iLJii J.

Note: S=C+G R=A+G K=T+G Y=C+T B=T+C+G

B rHNF-3 DNA seq: CTWCTAYCGG GACAACAAGC AGGGCTGGCA GAAOKCTAT rHNF-3alpha (X55955] CTATTACCGT GAGAACAAGC AGGGCTGGCA GAACTCCTAT rHNF-3beta CL096471 TTTCTACCGG CAGAACCAGC AGCGCTGGCA GAACTCCATC rrlNF-3gamia 0.09648; GTACTACCGG GAGAACCAGC AACGTTGGCA GAACTCCATC rHFH3BF (LB193] araACCGc GAGAACAAGC AGGGCTGGCA GAACAGCTAT rHNF-3 DNA seq: CGSCACWRCC TCTCCTTYAA YGAGTGYTTC GTCAAGGTGS rHNF-3alpha OGS955" CGCCACTGAC TCTCTTTCAA CGCTTGTTTC GTCAAGGTGG rHNF-3beta (L09647^ CGTCAirac TCTCCTTCAA CGAC--TTTC -TCAAGGTGC rHNF-Sgarnna CL09648: CGGCACTCGC TGTCCTTCAA TGACTGCTTC GTCAAGGTGG rHFH3BF (L13193* CGCCACAACC TGTCGCTCAA CGAGTGCTTC GTGAAGGTGC rHNF-3 DNA seq: CBCGCT-CSC CACASAAGCC VGGCAAGGGC TCCTACTGGA rHNF-3alpha (X559S5; CGCGAT-CCC CGGACAAGCC GGGCAAGGGC TCCTACTGGA rHNF-3beta CL09647* CCCGCG-CGC CGGACAAGCC GGGCAAGGGC TCCTACTGGA rHNF-3gamna CL0964C CACGCT-CCC CAGACAAACC GGGCAAAGGC TCCTACTGGG rHFKBBF CL13193: CGCGCGATGA CA-AGAAGCC AGGCAAAGGC AGCTACTGGA

Figure 5.8 Sequence analysis of the PCR products with specific primers to the conserved HNF-3 DNA binding domain. (A) The crude data from commercial sequences analysis for both forward and reverse directions are shown. The diagnostic locations where the peak line is definitive are boxed. The corresponding nucleotides are also indicated. (B) The nucleotides from (A)

159 are converted into DNA sequence and aligned with sequences for HNF-3 family members. The alignment from the forward direction is shown. The GeneBank access numbers are rHNF-3a (X55955), rHNF-3(3 (L09647), rHNF-3y (L09648) and rHFFDBF (LI3193). Diagnostic locations from commercial sequence analysis are indicated in red letters. Mismatched nucleotides are shown in blue letters.

According to sequence analysis, a predominance of FINF-3a transcripts were detected in rat pituitary GC RNA. In addition to HNF-3a, the family member hepatocyte nuclear factor-3 homolog (HFH-B3), a family member previously reported to be expressed in rat brain [186], was also detected (Figure 5.8B).

In order to confirm the presence of these HNF-3/fkh family members, RT-PCR was performed again using primers specific to divergent regions of HNF-3a and HFH-B3 with total GC RNAs. According to the RT-PCR results, diagnostic amplicons of 648 bp for HNF-3a and 291 bp for HFH-B3 were both observed in pituitary GC cell RNA

(Figure 5.7).

These observations provide support for the presence of HNF-3a and the family member hepatocyte nuclear factor-3 homolog (HFH-B3) in the rat pituitary GC system.

160 5.2.5 Identification of HNF-3a in the Human Pituitary.

RT-PCR reactions were also performed, using total RNA samples isolated from human pituitary tissues to detect the HNF-3a. PCR primers specific to the conserved DNA- binding domain of HNF-3 were used. The amplicons with the same size as in GC cells were detected in two individual pituitary samples, suggesting the presence of HNF-3 a in the human pituitary tissues (Figure 5.9).

651 bp

M hHNF-3a M

Figure 5.9 Identification of HNF-3a in the human pituitary tissues. Total RNAs from two separate human pituitary tissue samples were assessed by RT- PCR. PCR primers specific to FTNF-3a were used. Amplicons are indicated with arrowheads. M, 100-bp DNA marker. Data reported in [153]'.

161 The presence of HNF-3 a in human pituitary RNA was also confirmed by RT-PCR.

5.2.6 HNF-3a Protein is Detected in both Rat Pituitary GC Cell and Human

Pituitary Nuclear Protein.

In addition to RT-PCR, protein immunoblotting was also used to detect the presence of the HNF-3 family members in both GC cells and human pituitary samples. Nuclear proteins from GC cell pellets and human pituitary samples were harvested and resolved by SDS-PAGE. Nuclear proteins from HeLa cells and LNCaP cells (rich in HNF-3 family members, thus, used as a positive control for FTNF-3a proteins [192]) were used for controls. Using protein blotting with HNF-3a antibodies (Santa Cruz, C-20, sc-

6553), a band of the expected 52 kDa size was detected in both rat pituitary GC cells and human pituitary nuclear proteins, but not in HeLa cells (Figure 5.10). As for HFH-B3, further study was not pursued due to a lack of commercial antibodies or complete DNA sequence.

162 HeLa GC LNCaP hPit

Figure 5.10 Protein blotting for HNF-3a. Twenty [j,g of nuclear proteins from human cervical cancer HeLa cells, rat pituitary GC cells, LNCaP cells and human pituitary tissues (hPit) were immuno-blotted with HNF-3a antibodies (Santa Cruz, C-20, sc-6553). The expected size of HNF-3a (52 kDa) is indicated by arrowhead. Data reported in [153]1.

These observations provide evidence of HNFSa in both rat and human pituitary cell samples.

5.2.7 Human Pituitary HNF-3a is able to Associate with PSE-C Fragment In

Vitro.

After detecting the presence of HNF-3a protein in the human pituitary tissue, the capacity of its association with the 263P fragment, and specifically PSE-C, was assessed

163 in the context of pituitary chromatin in situ. Two experiments were designed to address this question. EMSA was performed first in order to examine their association in vitro, and, second, a chromatin immunoprecipitation (ChIP) assay was done to assess participation of HNF-3a with PSE-C DNA in the pituitary in situ.

For EMSA, the 41P element was used as a probe and incubated with human pituitary nuclear extract. Three HNF-3a antibodies, raised against different regions of the human

FINF-3a peptide were used as specific competitors to ensure specificity, including HNF-

3a C-20 (Santa Cruz, sc-6553, against peptides mapping the carboxy terminus), H-120

(Santa Cruz, sc-22841, against recombinant protein to amino acids 51-170 near the carboxy terminus) and T-20 (Santa Cruz, sc-9186, against peptides mapping near the carboxy terminus). Incubation of the PSE-C probe with the human pituitary nuclear extract resulted in two specific binding complexes, both of which could be competed by the addition of the specific FfNF-3a antibodies in all three cases (Figure 5.11).

164 HNF-3a Abs

Figure 5.11 Human pituitary HNF-3a associates with PSE-C in vitro. PSE-C (4 IP) was radiolabeled and used as an EMS A probe with human pituitary nuclear extracts. Two specific complexes, defined by the positive competition after addition of the specific antibodies, are indicated by arrowheads. Three different HNF-3a antibodies, including C-20 (Santa Cruz, sc-6553), H-120 (Santa Cruz, sc-22841) and T-20 (Santa Cruz, sc-9186) were used in this assay. NE, nuclear extracts. NRS, normal rabbit serum.

These observations are consistent with the participation of HNFSa in human pituitary and strengthen the rationale for investigating an interaction in situ using the ChIP assay.

165 5.2.8 HNF-3a Associates with P Sequences in Human Pituitary Chromatin In Situ.

A chromatin immunoprecipitation (ChIP) assay was performed in order to assess the association of HNF-3a with P sequences in the context of human pituitary chromatin.

The same procedure was performed as described in Section 3.1 for the preparation of pituitary chromatin. However, specific antibodies to the transcription factor HNF-3a as opposed to specific histone modifications were used to detect the associated DNA regions along the locus.

Two HNF-3a antibodies were used in the ChIP assay, including C-20 (Santa Cruz, sc-

6553) and H-120 (Santa Cruz, sc-22841). PCRs were performed on both input and immunoprecipitated (bound) chromatin fractions with primer sets to specific regions along the hGH/CS locus, including P sequences (263P), CS promoter (CSp), and GH-N promoter (GHp). Again, unrelated FGF-16 exon 3 was assessed as a control for background. The B/I ratios were then calculated and used to indicate the relative level of association between DNA fragment and transcription factors.

Among the regions assessed, only the B/I ratio for the 263P region resulted in a 6- to 7- fold increase relative to the FGF-16 exon 3 (Figure 5.12B). This result was seen in ChIP assays with both antibodies. The mean values for B/I ratio in each set of ChIP assays were 1.93 and 2.06. In contrast, B/I ratios for CS-A and GH-N promoter regions, were in

166 a range similar to or less than that of the FGF-16 exon 3, which were 0.33 and 0.30, respectively (Figure 5.1A).

HNF-3a C-20 Ab HNF-3a H-120 Ab I B mean B/I ratio I B mean B/I ratio FGF-16 0.33 0.31

i -™_ 263P ••' j 1.93 | 2.06 0.16 0.06 CSp P ' ** • '•

GHp J flHflfc *-*«* ' 0.22 mm'^> 0.21

B 8.0-.

gC-20 | | H-120

FGF-16

Figure 5.12 HNF-3a associates with P sequences in human pituitary chromatin. Chromatin immunoprecipitation (ChIP) assay was performed using nuclei isolated from three pooled postmortem human pituitary samples. (A) Representative PCR results from ChIP assays using two separate HNF-3a antibodies (C-20 and H-120). DNA from both input (I) and the bound (B) fractions were amplified by PCR with primer pairs for 263P, the CS-A promoter, the GH-N promoter, and exon 3 of FGF-16. The mean B/I ratios for each antibody are listed. (B) The B/I ratio for FGF-16 exon 3 was arbitrarily set at 1.0, and the relative ratios for GH-N, CS-A and 263P PCRs are shown. Data reported in [153]1.

Reprinted figure with permission from Molecular Endocrinology.

167 The result from ChIP assays using human pituitary tissue was consistent with the association between HNF-3a and 263P in situ, which provides further evidence linking

HNF-3a with P sequence repressor function.

Hepatocyte nuclear factor-3a binding at P sequences of the human growth hormone locus is associated with pituitary repressor function. Yang X and Norquay LD, Jin Y, Detillieux KA, Cattini PA. Molecular Endocrinology. 2006 Mar; 20(3):598-607. (Joint first author) Url: http://www.ncbi.nlm.nih.gov/pubmed/16239259 Copyright © 2006 by the Endocrine Society.

168 5.3 HNF-3a Participates in the Repressor Complex Containing NF-1.

5.3.1 HNF-3a Associates with NF-1, not RFX-1, in Human Pituitary In Situ.

Our previous characterizations of the human pituitary repressor complex identified two protein-associated regions within 263P, including PSE-A and PSE-B. An analysis of protein binding events at PSE-A revealed multiple DNA-protein interactions, namely, the mutually exclusive binding of RFX1 and NF-1 [152], whereas an analysis of PSE-B provided evidence that NF-1 was the associating factor [151]. It has been demonstrated that two functionally and structurally independent pituitary complexes can form at P sequences, including a functional NF-1 repressor complex and a non-functional complex containing RFX1 [156]. As an additional protein factor associated with P sequences and that contributes to repressor activity, HNF-3a has the potential to associate with other P sequences and perhaps repressor components through protein-protein interaction. The structural linkage between HNF-3a and NF-1 and/or RFX1 was explored using co- immunoprecipitation.

Human pituitary nuclear proteins were immunoprecipitated with either FfNF-3a antibodies (Santa Cruz, C-20, sc-6553) (experimental) or nonimmune goat serum

(control). Proteins purified by HNF-3a antibodies were then subjected to SDS-PAGE, immunoblotted and assessed using NF-1 and RFX1 antibodies, respectively. The presence of NF-1 family members in the HNF-3cx immunoprecipitate was detected with

NF-1 specific antibodies (Santa Cruz, H-300, sc-5567) at the expected 52 kDa size

169 (Figure 5.13A). By contrast, an attempt to detect the RFX1 band at approximately 130 kDa was unsuccessful (Santa Cruz, D-19, sc-10650) (Figure 5.13B).

IP: IP: Human NGS HNF-3cc Pituitary

^^M IB RF'Xl Ab

Figure 5.13 Protein interactions between HNF-3a and other protein participants of the P repressor complexes. Co-immunoprecipitation was performed using human pituitary nuclear extract with non immune goat serum (NGS) or HNF-3a antibodies (Santa Cruz, C-20, sc-6553). Purified proteins from immuno-precipitations as well as 20[xg human pituitary nuclear extract were resolved by SDS-PAGE, immuno-blotted and assessed with NF-1 (Santa Cruz, H- 300, sc-5567) and RFX1 (Santa Cruz, D-19, sc-10650) antibodies, respectively. (A) The arrowhead indicates the NF-1 band of approximately 52 kDa. (B) The arrowhead indicates the RFX1 band of approximately 130 kDa. IP, Immuno-precipitation. IB: Immuno-blotting. Data reported in [153]1.

These observations provide evidence to support the participation ofHNFSa and NF-1 in a common complex.

170 5.3.2 Association of HNF-3a and NF-1 was also Observed in Rat Pituitary Cells.

To confirm the interaction between NF-1 and HNF-3a in the context of P sequence binding events in the rat GC cell system, a DNA pull-down assay involving the use of magnetic DNA affinity columns was performed. Double-stranded PSE-C oligonucleotide was labeled first with biotin and coupled to streptavidin magnetic beads to generate an

"affinity column". After incubation with rat pituitary GC nuclear extract, protein components associating with PSE-C DNA were purified and then, resolved by SDS-

PAGE. Specific antibodies, including HNF-3a (Santa Cruz, C-20, sc-6553) and NF-1

(Santa Cruz, H-300, sc-5567) were used for immunoblotting. As a control, an unrelated oligonucleotide, RF-1 from the CS-B enhancer region, was also coupled with beads and the identical experiment was performed [165]. When PSE-C was used in the affinity column, both HNF-3a and NF-1 were detected in the eluate from the purification, with an approximate size of 54 kDa and 52 kDa, respectively. In contrast, when the unrelated

RF-1 oligo was used in the column, neither the FTNF-3a nor the NF-1 band was observed

(Figure 5.14). This experiment provided evidence that FTNF-3a and NF-1 could be pulled down together by the PSE-C DNA element, which indirectly suggested that FTNF-

3a and NF-1 interact with each other as protein components of the repressor complex formed at P sequences in the GC cell system.

171 RatGC PSE-C RF-1 Pituitary column column 75kDa • EB:HNF-3a 50kDa •

75kDa IB:NF-1 50kDa

Figure 5.14 HNF-3a and NF-1 participates in a common complex in rat pituitary GC cells. Affinity purification of P sequence-binding proteins uses PSE-C and RF-1 (negative control) DNA elements. Double-stranded oligonucleotides (PSE-C and RF1, respectively) were labeled with biotin and coupled to streptavidin magnetic beads to generate affinity purification columns. After incubation with rat pituitary GC nuclear proteins, binding complexes were eluted, resolved by SDS-PAGE, and immunoblotted for HNF-3a (Santa Cruz, C-20, sc-6553) (A) and the NF-1 (Santa Cruz, H-300, sc-5567) family (B) using corresponding antibodies. Protein size markers are indicated with arrowheads. Data reported in [ 15 3 ]l.

Taken together with the observations made using human pituitary tissue samples, both rat and human systems support participation of HNF-3a and NF-1 in a common complex.

172 5.4 Potential Involvement of the Transcription Factor Pit-1 in Pituitary

Repression via P Sequences in Pituitary GC Cells.

5.4.1 The Pit-1 DNA Binding Site is Required for Repressor Activity via P

Sequences in Transfected Rat Pituitary GC Cells.

It has been well documented that efficient CS-A promoter activity in transfected rat pituitary GC cells is driven predominately by the transcription factor Pit-1 [148].

Disruption of the proximal Pit-1 DNA element in the CS-A promoter not only eliminates

Pit-1 binding, but also reduces promoter activity [98]. As the major activator of the CS-

A promoter activity in vitro, functional involvement of Pit-1 in the P sequence repression was assessed. A hybrid luciferase gene, containing -492/+6 of the CS-A gene 5'- flanking DNA (CSp.Luc) was used for transient transfection. A CSp.Luc construct with deletion of the Pit-1 binding site (CSpAPit-l.Luc) was created by Nsil digestion of

CSp.Luc, removal of the 3' overhang nucleotides with Klenow fragment, and religation of the construct. This is the same mutation that was shown previously to eliminate binding of Pit-1 to the proximal site, and reduce promoter activity in pituitary GC cells

[98, 143]. The 263P fragment was then placed upstream of CSpAPit-l.Luc to generate

263P CSpAPit-l.Luc, and luciferase activities of these two constructs were assessed in transiently transfected GC cells. For comparison, CSp.Luc and 263PCSp.Luc were also included in this experiment as non-repressed and repressed controls, respectively (Figure

5.15).

173 When activity for CSp.Luc was arbitrarily set to 100%, the 263PCSp.Luc construct resulted in 49% of the luciferase activity of CSp.Luc (n=12, /K0.001). The significant loss of activity indicated P sequence repression on the CS-A promoter in the presence of an intact Pit-1 site. When the Pit-1 site was deleted, the CSpAPit-l.Luc retained only

25% of CSp.Luc activity, consistent with the previous observation that Pit-1 is a major, but not the only activator of the CS-A promoter in GC cells [98, 143, 194]. The remaining 25% of activity, thus, represents CS-A promoter activity mediated by protein complexes other than Pit-1. However, when 263P was placed upstream of CSpAPit- l.Luc, the ability of 263P to function as a transcription repressor was reduced. The

263PCSpAPit-l.Luc construct only averaged 24% of the full CSp.Luc activity in transfected GC cells. Compared with the CSpAPit-l.Luc, which retained 25% of full

CSp.Luc activity, no significant difference was observed (n=T2) (Figure 5.15).

174 CSp.Luc •

263PCSp.Luc H

AM deleted Pit-1 site

CSpAPit-l.Luc •

263PCSpAPit-l.Luc Q

100-

>» M 80- .£ *•*w* < y 60- 3 h-t ^^M *%* fi" ,^ t» 40- U £ ^^^^^H^^^^^H 20-

Figure 5.15 Functional analysis of 263P on CS-A promoter with and without intact proximal Pit-1 site in transiently transfected GC cells. Hybrid luciferase (Luc) genes were used to assess the effect a mutation in the Pit-1 binding site of the CS-A promoter (-496/+6) on 263P repressor activity in pituitary GC cells. A Nsil deletion was introduced into the Pit-1 binding site of CS-A promoter to generate CSpAPit-l.Luc. 263P fragment was placed upstream of CSp.Luc and CSpAPit- l.Luc, luciferase activities for these constructs were assessed. Schematic constructs are shown. The intact Pit-1 binding sites are indicated by gray ovals. Nsil Deletion of Pit-1 sites are indicated by black ovals. Cells were co-transfected with pRL-TKp.Luc to control for DNA uptake. Corrected values are expressed as a percentage of CSp.Luc activity, which is arbitrarily set at 100%. The mean value for CSp.Luc was 3.22 + 0.15 (n=12). Statistical analysis was performed by one-way ANOVA followed by Tukey

175 posttest for multiple comparisons. ***,/? < 0.001, comparing 263PCSp.Luc to CSp.Luc. Bars represent SEM. Data reported in [153]1.

These results indicate that deletion of the Pit-1 DNA binding site in the CS-A promoter containing -496Z+6 nucleotides of 5'-flanking sequences eliminates the ability of263P as a transcriptional repressor element in transfected rat pituitary GC cells. Thus, repressor activity of 263P appears to be dependent on the intact Pit-1 binding sites, thus implicating Pit-1 protein in the complex.

5.4.2 Pit-1 Appears to Associate with PSE-C in the Pituitary GC Cell System.

Given the functional data suggesting that 263P repressor activity might be mediated by

Pit-1, an effort was made to assess the DNA-protein interactions between Pit-1 and P sequence elements, including PSE-A, -B and -C. EMS As were performed using GC nuclear proteins and the proximal Pit-1 binding site from CS-A promoter as probe (CSp

Pit-1). Sub-fragments from different P sequence elements, including PSE-A3 (containing half sites for both NF-1 and RFX-1), PSE-B4 (containing a complete NF-1 site) and PSE-

C (containing the HNF-3 site), were used as specific oligonucleotide competitors (Figure

176 5.16A). The oligonucleotides were added into the reactions according to their order

within 263P, as B4, A3 and 41P (PSE-C).

When incubated with Pit-1-containing GC nuclear proteins, three major specific

complexes were formed on the CSp Pit-1 probe. These specific complexes are defined by the effective competition with the unlabeled CSp Pit-1 oligo (at 100-, 250-fold mass

excess of probe). Similar competition was observed only when 41P (PSE-C) was used as

a specific competitor, however, the competition was much less efficient when the same

amount of oligonucleotides were used. When DNA fragments from PSE-A (A3) and -B

(B4) were used as competitors, no evidence of competition was observed (Figure 5.16B).

These observations suggest that protein(s) binding to the CS-A promoter sequence can

also associate with PSE-C.

177 A

B4 GATGGCAGGGCCCCAGCA III I III NF-1 consensus TGGNNNGNNGCCAA

NF-1 half site GCCAA GCCAA NF-1 half site Mill Mill A3 TGTTGGTTGCCAACACCACTGCCAACCMill A RFX1 half site GTTGC Mill

GTTGCCTAGCAAC EF-C/MDBP RFX site

41P GGAAGCGTTTGCCTGTTTGTTTGCTTGTGTTTCTACAGAGT i mi n HNF-3 consensus AATATTTGTTT

Figure 5.16 Indirect association of Pit-1 to PSE-C, not either PSE-A or -B. (A) Schematic for sub-fragments of 263P. Relative locations for PSE-A, B and C are shown. Nucleotide sequence for the oligonucleotide competitors, including B4, A3 and 41P are listed. Consensus sequences for NF-1 [195, 196], RFX-1 [197, 198] and HNF-3 [189, 199] are also indicated. (B) Radiolabeled proximal Pit-1 binding site from the CS- A promoter was used as free probe (CSp Pit-1 FP), and EMS A was performed using GC nuclear proteins. The three binding complexes formed on the CSp Pit-1 probe are indicated by arrowheads. Competitor oligonucleotides were pre-incubated with nuclear proteins at increasing amount (100- and 250-fold mass excesses of probe). FP, free probe. NE, nuclear extracts.

178 Based on the EMSA competitions, there are at least two interpretations of the association between CSp Pit-1 and PSE-C (Figure 5.17). The first possibility assumes that CSp Pit-1 associated protein is also able to associate with PSE-C, but with lower binding affinity.

This is supported by the observation that binding complexes formed on the CSp Pit-1 probe were competed by the addition of PSE-C oligonucleotides. Pit-1 is the best candidate as the major protein in GC cells that binds to CSp Pit-1 site (Figure 5.17A).

Alternatively, it is also possible that different proteins bind to the CSp Pit-1 probe and

PSE-C DNA but these proteins can interact. This assumption raises the possibility that

HNF-3a, as the PSE-C associating protein, associates with Pit-1 through protein-protein interaction (Figure 5.17B).

PSE-C HNF-3a PSE-C ptt-1 :> CpitO CSp Pit-1 -==- «=^- CSp Pitit--1 —^= =^—

Figure 5.17 Possible associations between PSE-C and CS-A promoter based on oligonucleotide competition. Possible associations between PSE-C and CS-A promoter are shown. (A) Pit-1 associates with both CSp Pit-1 and PSE-C. (B) Pit-1 and PSE-C associating protein, HNF-3a, interact with each other through protein-protein interaction.

The results of EMSA and specific competition with oligonucleotides suggest low-affinity association between Pit-1 protein and PSE-C. The two possibilities, (i) Pit-1 directly

179 associates with PSE-C and (ii) protein-protein interaction between Pit-1 and HNFSa are consistent with these observations.

5.4.3 Pit-1 Associates Directly with TTR, a High Affinity HNF-3 Element.

A series of EMSA experiments were designed and performed to detect the DNA protein interactions between Pit-1 and PSE-C. This includes the use of LNCaP (a human prostate adenocarcinoma cell line) nuclear extract, which is reported to contain HNF-3 protein [192], and TTR, a high affinity HNF-3 binding site [193], as well as full length

Pit-1 recombinant protein (Santa Cruz, sc-4014).

The first EMSA was performed using recombinant Pit-1 protein and radiolabeled CSp

Pit-1 oligonucleotide as a specific probe, to detect the binding capacity for Pit-1 protein to the CSp Pit-1 binding site (Figure 5.18A). Recombinant Pit-1 protein formed a clear binding complex on the CSp Pit-1 probe, confirming the DNA-binding capacity of recombinant Pit-1 protein.

The second EMSA experiment was done using radiolabeled TTR as a specific probe.

LNCaP nuclear extracts and recombinant Pit-1 proteins were used in the EMSA reactions independently or together (Figure 5.18B). Incubation of recombinant Pit-1 protein with the TTR probe resulted in one single band (complex I). When LNCaP nuclear extracts were incubated with TTR probe, a much larger complex was detected (complex II),

180 suggesting a distinct binding pattern. When Pit-1 protein and LNCaP nuclear extracts were added into the reactions together and incubated with TTR probe, both complexes (I and II) were detected. Interestingly, the intensity of complex I (Pit-1 binding complex formed on the TTR probe) was enhanced compared to that when Pit-1 protein was added alone. A possible explanation for the above observation is presumably an increased available Pit-1 protein results in LNCaP nuclear proteins saturating non-specific binding sites on the probe. In addition, when Pit-1 antibodies were added into the reaction with both proteins, complex I was slightly shifted up, confirming that complex I was formed by the recombinant Pit-1 protein on the TTR probe.

181 B •s S + eu OH

s •*- H '53 5o< "CL, !z •§ + + % &< % % ^J CJ oJ? — J e-*-u* J^ Jz

Complex II

Complex I

Figure 5.18 Pit-1 binds to high affinity HNF-3 site.

EMS A assays were performed to detect the association between recombinant Pit-1 proteins (Santa Cruz, sc-4014) and HNF-3 binding site. (A) The proximal Pit-1 binding site on CS-A promoter was radiolabeled as an EMSA probe. The binding complex after adding of Pit-1 proteins is indicated by arrowhead. (B) TTR, a high affinity HNF-3 binding site, was radiolabeled and used as an EMSA probe. LNCaP nuclear extracts and recombinant Pit-1 proteins were added into the reaction independently or together. The Pit-1 antibodies (Santa Cruz, X-7, sc-442) were also added to detect a 'supershift'. The specific binding complexes are indicated by arrowheads. The 'supershift' region is indicated by an open arrowhead. FP, free probe. Pit-1 P, recombinant Pit-1 proteins. Ab, antibody.

Therefore, the above EMSA experiments provide evidence that Pit-1 is capable of associating with the high affinity HNF-3 binding site, which increases the possibility that it can directly bind to PSE-C and mediate the repressor activity of263P.

182 5.4.4 Pit-1 cannot Directly Bind to PSE-C.

The third EMS A experiment was done using radiolabeled PSE-C (4 IP) as a specific probe. Again, both LNCaP nuclear proteins and recombinant Pit-1 protein were used to detect specific binding. Addition of the LNCaP nuclear extract resulted in similar binding complexes as when TTR was used as the probe (Figure 5.19). However, no evidence for Pit-1 binding to the specific probe (4IP) was observed when recombinant

Pit-1 protein was used in the reaction. Furthermore, when LNCaP nuclear proteins and recombinant Pit-1 proteins were added together, the LNCaP binding pattern remained unchanged with no clear evidence for competition after addition of Pit-1 protein. In addition, no evidence for either competition or supershift after adding of Pit-1 antibodies

(Santa Cruz, X-7, sc-442) was observed.

183 Figure 5.19 Pit-1 cannot associate directly with PSE-C. EMS A assay was performed using radiolabeled PSE-C (4 IP) as the probe. LNCaP nuclear extracts and recombinant Pit-1 proteins were added to the reactions independently or together. Pit-1 antibodies (Santa Cruz, X-7, sc-442) were also added to detect a possible 'supershift'. The binding complexes are indicated by arrowhead. FP, free probe. Pit-1 P, recombinant Pit-1 protein. Ab, antibody.

Even though Pit-1 was capable of binding to a high affinity HNF-3 binding site (TTR), it was not able to associate with PSE-C directly through DNA-protein interaction. Thus, the repressor activity of 263P mediated by Pit-1 does not appear to be dependent on its direct interaction with PSE-C.

184 5.4.5 TTR, but not PSE-C (41P), Contains a 'Pit-1 like' Oct-1 Binding Site.

The previously described observations from EMSA raised the question about what was the difference between TTR and PSE-C (4IP) in terms of protein binding, specifically to

Pit-1 protein. In order to address this question, sequence analysis was performed using the Matlnspector 2.2 binding site detection program based on the TRANSFAC 4.0

database using TTR and PSE-C (4IP) as query sequences, respectively.

This analysis revealed a potential binding site for Oct-1, but not Pit-1, in the TTR

sequence. As implicated by a literature review, the specific binding motifs for Oct-1 and

Pit-1 share some nucleotide similarities (AT-rich sequence) and thus, Oct-1 sites are usually candidates for Pit-1 binding [113, 114], as illustrated by the results presented by

EMSA in Section 4.3.2 (Figure 4.14B). When PSE-C (41P) was searched using

Matlnspector 2.2 program, three potential Oct-1-like sites were suggested (Figure 5.20).

However, when nucleotide alignments were performed on these three Oct-1-like sites, none of them showed a 'Pit-1 like' character as found in the TTR. Thus, distinct Oct-1-

like sites in TTR versus PSE-C (4IP) likely explain the different binding capacity of these oligonucleotides for Pit-1 protein.

185 Pit-1 consensus T |TA|TAAT| CAT

TTR TGACTAAGTCAATAATCAGAATCAG

Oct-1 consensus ACAGCTTACGTTTAGTGATCAA MM I 41P GGAAGCGTTTGCCTGTTTGTTTGCTTGTGTTTCTACAGAG Mill Ml! CGTTT GTTT

Figure 5.20 Sequence alignment for TTR and PSE-C (41P). Nucleotide sequences for TTR and PSE-C (4IP) oligonucleotides are listed. Consensus sequences for Pit-1 and Oct-1 binding sites are indicated. Sequence alignments with Pit- 1 [104, 200] and Oct-1 consensus (Santa Cruz, sc-4014) are also indicated. Sequence alignments through complimentary nucleotides are indicated by dash lines.

Sequence analysis suggests that TTR, but not PSE-C, contains a 'Pit-1' like Oct-1 site that allows Pit-1 binding. This observation provides an explanation for the different binding capacity of these oligonucleotides for Pit-1. In addition, this observation is consistent with a lack of association of Pit-1 with PSE-C through direct protein-DNA interaction.

5.4.6 Pit-1 and HNF-3 Interaction was not Detected in the Absence of DNA.

Given that the direct association of Pit-1 with PSE-C was not supported by previous observations (Figure 5.19), the potential for protein-protein interaction between Pit-1 and

186 PSE-C associated protein, HNF-3a, was pursued using co-immunoprecipitation (IP).

Nuclear proteins from both rat pituitary GC cells and human pituitary tissue were used in this study.

Nuclear proteins from both GC cells and human pituitary samples were immunoprecipitated with both non-immune normal goat serum (control) and HNF-3a antibodies (Santa Cruz, C-20, sc-6553). The purified proteins were then separated by

SDS-PAGE, immunoblotted and assessed with Pit-1 antibodies (Santa Cruz, X-7, sc-

442). The crude nuclear proteins from GC cells and human pituitary samples were also fractionated by SDS-PAGE and immunoblotted as 'positive' controls for Pit-1 (Figure

5.21). The presence of Pit-1 (expected size of 33 kDa) in protein precipitated with HNF-

3 a antibodies was not detected in either GC or human pituitary immunoprecipitated samples. The immunoprecipitation with the Pit-1 antibodies was not pursued due to the fact that none of the commercially available Pit-1 antibodies were effective for immunoprecipitation ([156] and personal communication between Dr. Harry Elsholz from University of Toronto).

187 IP: IP: NGS HNF-3 GC 33kDa •^•H ^H I^MI IB Pit-1 Ab g Human Pituitary

33kDa +^m ^m ^« IB: Pit-1 Ab

Figure 5.21 Protein-protein interaction between HNF-3a and Pit-1 was not detected in pituitary nuclear protein. Immunoprecipitation was performed using nuclear extracts from both GC (A) and human pituitary tissues (B). Non-immune normal goat serum (NGS) and HNF-3a antibody (Santa Cruz, C-20, sc-6553) were used to precipitate (IP) the associated proteins. Purified proteins and 20 ^g GC/ human pituitary nuclear extracts were then resolved by SDS-PAGE, immunoblotted (IB) and assessed with Pit-1 antibodies (Santa Cruz, X-7, sc- 442). The arrowhead indicates the Pit-1 band of approximately 33 kDa. IP, immuno precipitation. IB, immunoblotting. NGS, normal goat serum.

Thus, under the regular conditions for immunoprecipitation, direct protein-protein interaction between Pit-1 and HNF-3a was not detected in HNF-3a immunoprecipitation experiments using either rat GC pituitary cell or human pituitary nuclear proteins. The experiments using Pit-1 antibodies for immunoprecipitation were not pursued due to the limitation of effective antibodies.

188 SUMMARY OF THE RESULTS IN CHAPTER 5

The data presented in this section support the presence of an additional regulatory element (PSE-C) involved in the repressor activity of P sequences in rat pituitary GC cells, and identify HNF-3a as a novel member of the pituitary P sequence repressor complex in the rat GC cell system and potentially human pituitary tissue.

Using in vitro and in situ techniques, the association between HNF-3a and P sequences and another component of the pituitary repressor complexes, specifically

NF-1, was identified. Previously, two independent pituitary complexes were reported to associate with P sequences in a mutually exclusive way [152, 153, 156]. The identification of HNF-3a as an additional member of P complexes supports a model that HNF-3a, through binding to PSE-C, favors the association of NF-1 over REX1 with PSE-A, and that this interaction is a key component in regulating the ability of

263P to function as a transcriptional repressor.

Additionally, the functional involvement for the pituitary-specific transcription factor

Pit-1 in the pituitary-repression activity of P sequences was also explored. Data suggest that Pit-1 mediates P sequence repression activity through protein-protein interaction with the PSE-C region. However, a direct interaction between Pit-1 and

HNF-3a was not detected by immunoprecipitation of human pituitary nuclear protein under the regular conditions for immunoprecipitation.

189 CHAPTER 6

DISCUSSION

6.1 The Histone Covalent Modifications Involved in the hGH/CS Gene

Expression.

Histone post-translational modification has been demonstrated as one of the most important characteristics determining expression of the hGH/CS genes in transgenic mice in vivo [85, 86]. In the first part of this thesis, histone modification status along the hGH/CS locus was analyzed using post mortem human pituitary tissue (Chapter 3).

Compared to the GH-secreting pituitary adenoma and GHRH-hyperstimulated transgenic mouse pituitaries, the use of human pituitary tissues would result in the histone modifications reflecting the epigenetic status in tissues where the endogenous GH-N gene was expressed at a more 'normal' level, but certainly not hyper-stimulated.

Two major histone modifications, including acetylation and methylation, were assessed in a slightly different manner from previous studies [85, 150]. For acetylation, a more precise and higher level of acetylation on histone H4, termed hyperacetylation (not only on lysines at positions K5 and K8 of histone H4 tails, but also including K12 and K16),

190 termed hyperacetylation, was assessed using an antibody specific to the hyperacetylated histone H4. There are two reasons for this choice of analysis. First, even though both acetylation and hyperacetylation associate with competent, or at least, "poised" chromatin, hyperacetylation is more likely to be the definitive result from a preference of acetylation over deacetylation [201, 202]. Second, the acetylation status of H4K16, which is specifically required for association with other transcription regulators, can only be detected when hyperacetylated H4 is assessed [39-41]. Thus, by using the antibodies specific to hyperacetylated histone H4, it is not only possible to map the histone modification status along the locus, but also to recognize specific region(s) with the potential to associate with other transcription factors. A histone methylation analysis was also performed using the human pituitary tissue samples in Chapter 3. Both di- and tri-methylation of histone H3 Lys-4 (H3K4) were assessed along the hGH/CS locus.

Studies from S. cerevisiae revealed that di-methylation of histone H3K4 is a mark of transcriptional permissiveness that functions to demarcate euchromatic and heterochromatic regions, whereas the tri-methylation at the same residue, a modification which is restricted primarily to the 5' end of genes, plays a direct transcription-activating role [30, 203]. Interestingly, in metazoans, H3K4 di-methylation is found to track similarly with tri-methylation on the same residue, predominately in the promoter region

[45, 204]. Once a promoter is labeled with "active transcription markers" such as di- or tri-H3K4 methylation, steady transcriptional activation is expected in the related gene

[46]. Thus, assessment of chromatin modifications along specific regions of the hGH/CS locus, including the regulatory DNA elements (upstream locus control region, P sequences and downstream enhancer elements), and promoter regions (GH-N and CSs)

191 provide key information about the stqate of activity of the genes in the locus.

6.1.1 Locus Control Region and Other DNA Regulatory Elements.

In Chapter 3, analysis of the human pituitary tissues using the optimized ChIP protocol

(described in Section 2.2.2) on the DNA regulatory elements revealed a different distribution of H4 hyperacetylation along the hGH/CS locus. Within the upstream locus control region (LCR), all hypersensitive sites displayed a high level of histone H4 hyperacetylation (Figure 3.1). Among them, HS I/II, HS III, and HS IV all showed significant levels of hyperacetylation compared to the FGF-16 background level. As for

HS V, although not significant, an increase was still suggested when compared to the control FGF-16 gene (Figure 3.1). Slightly different from the pattern previously reported by others [85], the peak of H4 hyperacetylation appears to be located at HS III instead of

HS I/II. By contrast, two other regulatory elements implicated in the regulation of placental CS gene expression, including the conserved upstream P sequences (P) and the

CS-B downstream enhancer region (Enh), did not show any level of H4 hyperacetylation compared to the FGF-16 background.

The above data suggest that histone hyperacetylation co-maps with the hypersensitive sites along the hGH/CS locus. Support for this observation can be found in studies involving the P-globin locus [64]. An analogous situation has been described, where core histone hyperacetylation co-maps with generalized DNase I sensitivity in the chicken {$-

192 globin chromosomal domain [64]. This observation is consistent with the view that one of the roles the modification plays is to render a gene locus transcriptionally competent.

Once a chromosomal domain has been rendered transcriptionally competent, the regulated expression of the individual genes in the domain or locus can then be controlled by specific cis elements and their trans-acting factors.

Analysis of histone methylation on the hGH/CS LCR revealed various levels of di- and tri-methylation on H3K4 (Figure 3.2). The pituitary-specific HS I/II showed a high level of both di- and tri-methylation. HS III, which is common to both pituitary and placenta, showed an increased level of H3K4 methylation as well. The other hypersensitive site that is common to both pituitary and placenta, HS V, showed a significant level of di- methylation, but no tri-methylated H3K4 was detected at the same region. As for P sequences and Enh element, as well as the placenta-specific HS IV, neither di- or tri- methylated H3K4 was detected. As mentioned previously, tri-methylation of H3K4 is a euchromatin marker while di-methylation at the same position indicates transcriptional permissiveness [30, 203], HS V, was characterized by high di- but not tri-methylation, suggests (i) less chance for active transcription to occur at HS V, and (ii) a boundary between transcriptionally active euchromatin and transcriptionally inactive heterochromatin. As HS V appears to be at the 5' end of the 32-kb acetylated domain when assessed using pituitaries from the hGHRH/hGH double transgenic mice, it has the spatial and structural potential to function as insulator to prevent the hGH/CS genes from being influenced by other regulatory regions related to other nearby genes. However, the function of HS V in the regulation of hGH/CS gene expression has not been addressed,

193 and the HS V associated factors have not been identified.

6.1.2 Promoter Regions.

Analysis of the promoter regions in human pituitary samples revealed a difference in histone modifications between the GH-N and the CS promoters. Compared to the FGF-

16 exon 3 background, the GH-N promoter showed a high level of histone modification, including histone H4 hyperacetylation (Figure 3.1), as well as di- and tri methylation on histone H3K4 (Figure 3.2), all of which are believed to be "active markers" of transcription. By contrast, the promoter region for CS genes did not show either H4 hyperacetylation or H3K4 methylation. The correlation between the promoter histone modifications and activity is consistent with GH-N but not CS expression in the pituitary

[73], and also agrees with the chromatin status of these genes determined with other pituitary samples [85, 87, 88].

Whether a gene is expressed or not often depends on the structure of chromatin both locally (at the promoter) and in the surrounding domains. Given the considerable condensation of chromatin in the eukaryotic nucleus, making the promoter region available by "opening-up" the compact chromatin at this location for a particular gene controls whether transcription can occur. This structural change in the chromatin is usually initiated by modifying the N-terminal tails of the histones, especially H3 and H4

[205]. The histone modifications may directly affect nucleosome structure and/or create binding sites for other proteins, and thus, change the properties of chromatin to allow

194 RNA Pol II recruitment and/or transcription initiation [42, 206, 207]. Certain types of histone modifications associated with transcription activation, like histone H4 hyperacetylation and various levels of H3K4 methylation, therefore become an intrinsic step in transcription control.

Enzymes mediating the histone modifications, such as histone acetyl-transferases

(HATs), histone de-acetylases (HDACs), and histone methyl-transferases (HMTs), are essential components of the transcriptional machinery [201]. It is well established that histone acetylation is a dynamic process that is mediated by the activities of HATs and

HDAC [202, 206]. Both enzymes are needed to catalyze dynamic acetylation of histones associated with transcribed chromatin domains [207]. Furthermore, there is arising evidence suggesting that HATs and HDACs might be housed in large multi-protein complexes [202, 208]. This adds an additional layer of complexity to the identification of the enzymes catalyzing the GH-N promoter. By contrast, studies on the enzymes catalyzing histone methylation are limited. It was believed for quite a long time that histone methylation is an irreversible process due to lack of histone demethylases [43].

Successful identification of the lysine-specific demethylases 1 (LSD-1) [209] and

Jumonji C (JmjC) domain proteins [210] revealed that histone methylation is also a dynamic process. It is speculated that both histone methyl-transferases and demethylases play a role in balancing methylation dynamics, but how it is achieved at the molecular level is still incompletely understood [209]. In the case of GH-N gene expression in pituitary, identification of the specific HMT(s)/demethylases on promoter has not been pursued either.

195 Promoter activation usually involves an ordered series of events [205]. The initiating event might be binding of a sequence-specific component (that is able to find its target

DNA sequence in the context of chromatin), which then allows a localized chromatin structure change. This change is followed by recruitment of remodeling complexes including enzymes for histone acetylation (HATs and HDACs). Once the target histones are acetylated, the chromatin domain has been activated for transcription to occur [205,

211]. In the case of GH-N gene activation, particular enzymes catalyzing H3K4 methylation have never been identified. As for acetylation, it is hypothesized that it might be induced by the pituitary transcription factor Pit-1. There is evidence from the literature demonstrating that Pit-1, the major protein that activates the GH-N promoter, has the capacity to recruit HATs as well as HDAC complexes [212, 213]. If true, the hyperacetylation at the GH-N promoter in the pituitary might result from an imbalance in the dynamic process of acetylation over deacetylation.

Despite the extensive sequence homology and the presence of Pit-1 binding elements, promoter regions for placental CS/GH-V genes are neither acetylated nor methylated based on an analysis of human pituitary tissue samples. Lack of histone modifications on

CS promoters implies absence of effects on CS promoter versus the GH-N promoter. It was demonstrated using transgenic mice that association of Pit-1 with the upstream hypersensitive site I/II within the LCR is a fundamental step required for GH-N expression in the pituitary in vivo [85, 87, 130]. Multiple sequential steps in GH-N transcription activation including Pit-1 occupancy at the GH-N promoter can be affected

196 by effective Pit-1 binding to HS I/II [85]. Thus, it is possible that Pit-1 may initiate chromatin changes (e.g. histone modifications) after binding to HS I/II and as a consequence, allow Pit-1 to make further interactions with the GH-N promoter.

However, this chromatin change may, as a consequence, interfere with similar structural changes at downstream CS promoter regions, through an, as yet, unknown mechanism.

The result could be interference with the recruitment of remodeling complexes required for histone modifications on the CS promoter.

6.2 The Pituitary-specific Activation of GH-N Gene.

6.2.1 Pit-1 itself is not Sufficient for GH-N Gene Activation.

The POU-homeodomain transcription factor Pit-1 has been documented to be involved in the regulation of pituitary-specific hGH-N gene expression in two main ways: (i) the development of somatotrophs, the cell type that produces growth hormone (GH) in the anterior pituitary; and (ii) associating with the upstream locus control region (LCR) and the GH-N promoter.

During pituitary development, three out of five cell types of the anterior pituitary, including somatotrophs, lactotrophs and thyrotrophs, all require Pit-1 for terminal differentiation, as established by genetic analysis of Snell and Jackson dwarf mice [118].

If Pit-1 alone is sufficient for directing GH-N gene expression in the pituitary, the

197 expression of GH-N might also be expected in pituitary lactotrophs and thyrotrophs.

However, the fact that each cell lineage expresses a highly specialized and distinct peptide hormone implicates the functional involvement of factors other than Pit-1 in the regulation of pituitary gene expression [214]. Thus, although Pit-1 is required for the development and differentiation of the anterior pituitary cell lineages, it is reasonable to suggest that expression of GH and PRL, as well as TSH results from combinatorial interaction between Pit-1 and other frww-activating factors [168]. Taking into consideration the high structural similarity between prolactin and the hGH/CS genes

[215, 216], regulation of GH-N expression appears to be a precise process governed by involvement of other specific transcription co-factors besides Pit-1.

Binding of Pit-1 to sites in both the GH-N promoter region and the upstream LCR, specifically HS I/II, has been demonstrated [98, 122, 128]. However, although association of Pit-1 to the GH-N promoter region is capable of activating promoter activity in vitro [123], the intact LCR is still required for tissue-specific GH-N transgene expression in transgenic mice in vivo [80]. These observations raise the possibility that

Pit-1 associates with the GH-N promoter and HS I/II differently, and each has its own functional implications in regulating GH-N gene expression.

The ability of Pit-1 to be allosterically controlled by the associated DNA sequences is supported by crystallographic analysis of the DNA-binding domain [175, 212, 217]. As a

POU domain transcription factor, Pit-1 can bind to a range of DNA sequences with variable conformations/flexibility dictated by the underlying nucleotide sequence and

198 display a distinct capacity of recruiting other cofactors [218]. In a study of the proximal

Pit-1 site from the rat GH promoter and rat PRL promoter regions, the presence of an additional two base pair spacing within rat PRL Pit-1 site was demonstrated to alter the structure of the DNA-protein binding complex, resulting in preventing nuclear receptor co-repressor N-CoR recruitment to the complex, unlike the Pit-1 sites from the rat GH promoter region [212]. In addition, the fact that Pit-1 typically binds to DNA as a cooperative dimer adds an additional layer of complexity in terms of DNA binding and recruitment of other cofactors [175, 176]. It was proposed that a single base difference between Pit-1 binding sites at the GH-N promoter and HS I/II specifies distinct Pit-1 functions in activating GH-N transgene activation in vivo, which means the presence of an adenine (A) in place of a thymine (T) within HS I/II Pit-1 binding sites is responsible for the distinct Pit-1 functions [200]. However, nucleotide alignment of all four Pit-1 sites from HS I/II regions suggests this might not be the case (Table 6.1).

199 Pit-1/GHFl consensus W WTAW NCAT

hGHp GH-1 TACAT TTAT GCAT G GH-2 CTAAA TTAT CCAT T Promoter regions hPrlp Prl-lP TATAT ATAT TCAT G Prl-3P TTTTC TTAT TCAT A hCSp CS-1 TACAT TTAT GCAT G

Pit-lA AAATA TAAA CCAT C Locus control A/T- 1/Pit-1B GAAAT ATAA ACAT C regions (LCR) A/T-2 ATGTT CAGT TCAT G A/T- 3/Pit-lC AATGA AAAA ACAT T

Table 6.1 Sequence alignments of Pit-1/GHFl sites in promoter regions and the upstream locus control region. Nucleotide alignment of previously identified Pit-1 binding sites from human growth hormone (GH), prolactin (Prl) and chorionic somatomammotropin (CS) promoters. The sequences of three Pit-1 binding sites within the upstream locus control region (LCR) are also aligned. The consensus recognition sequence is also shown [128]. Promoter sequence information obtained from [98, 145]. Sequence information for A/T-l, -2 and - 3 obtained from [128]. Pit-lA, -B, and -C obtained from [127]. Note: W=A+T. N=A+T+C+G.

Pit-1 sites in the promoter regions for GH, PRL and CS genes are highly homologous, and all contain a conserved thymine (T). By contrast, Pit-1 sites from HS I/II show some variety at this particular position. Among the four Pit-1 sites, three of them were initially identified first as A/T-rich Pit-1-like sites [128]. Two of them have an adenine (A) in the place of thymine (T) as observed in other promoter regions. These two A/T rich Pit-1- like sites, together with an additional site located more than 100-bp upstream, were later reported as Pit-IB, C and A, respectively [129]. Interestingly, when HS I/II was inactivated by deletion of a 99-bp element, three Pit-1 sites were removed, including

200 A/T-1/Pit-1B, A/T-2 and A/T-2/Pit-lC (Figure 1.2). Since the three Pit-1 sites deleted do not consistently have A at the promoter T position (Table 6.1), loss of Pit-1 function on HS I/II might not be considered a consequence of a single nucleotide difference associated with Pit-1 binding sites.

6.2.2 GH-N Activation is Much More Complicated than a Simple 'Tracking'

Process.

Histone covalent modifications in the context of chromatin have been widely accepted as one of the most important aspects of gene regulation, and by extension, involved in the regulation of GH-N gene expression in pituitary cells. An 87-kb human genomic DNA encompassing the entire LCR and majority of the hGH/CS gene cluster (GH-N, CS-L,

CS-A and GH-V, but not CS-B) was inserted into the mouse genome to generate a PI transgenic mice line (PI clone) (Figure 6.1) [79]. By crossing the PI clone mice with a line carrying a human growth hormone releasing factor (GHRF) transgene [163], it was possible to map the histone modification status throughout the hGH/CS locus as well as the upstream LCR in the somatotroph-enriched hyperplastic transgenic pituitaries [150].

A 32-kb domain containing the entire hGH LCR and GH-N promoter was reported to be acetylated, with the HS I/II to be the most pronounced and centered region. The acetylation extended, tracking upstream and downstream in an "unbrella-like" manner to include HS V at one end and the GH-N promoter at the other [150].

201 The pituitary "tracking model" is hypothesized to describe the process by which GH-N becomes active in vivo, based on the histone acetylation data determined from hyperplastic mouse pituitaries. In this model, as the most modified region along the hGH/CS locus, HS I/II is hypothesized to be the original site for recruitment of HATs.

Following this, HAT activity spreads bi-directionally to modify the chromatin encompassing the region from HS V to the hGH-N promoter, thereby forming an activated chromatin domain. This domain facilitates access to the hGH-N promoter by selective frvms-factors and as a result, activates transcription [86]. The detection of ectopic lymphocyte-specific CD79b transcripts in transgenic pituitaries provides further evidence to support the influence of this 'activation domain' [219]. Nonetheless, several other findings from the literature are not consistent with a simple "tracking model".

First, the occupancy of HAT co-activators is inconsistent with the location of the modified region. Among the several HAT candidates modifying the hGH/CS chromatin including CREB (cAMP element binding protein)-binding proteins (CBP) and TATA- binding protein associated factor (TAF)-250, CBP is the only one to be associated with

Pit-1 [213, 220]. Interestingly, the robust occupancy of CBP along the hGH/CS was only detected in the GH-N promoter region, not the HS I/II, which is supposed to be the original and most pronounced site for histone modification [200]. Even though the possibility of involvement of other co-activator(s) cannot be ruled out, the selective recruitment of CBP to the GH-N promoter cannot be seen as proof that the starting site for "spreading/tracking" of histone acetylation occurs elsewhere, that is, at HS I/II.

202 Second, the pituitary "tracking model" is premised on the assumption that histone acetylation is coupled to transcriptional activation. Generally, acetylation of histones may be the event that maintains the local chromatin in an "open" or transcriptionally active state [32, 40]. However, there is increasing evidence to couple histone H3K4 methylation, instead of histone H3 and H4 acetylation, with transcription, reflected by the fact that this modification is associated with recruitment of an active form of RNA Pol II

[30, 206, 221, 222]. In the case of GH-N expression in pituitary, insertion of an exogenous Pol II determination element within the "32-kb activated acetylation domain"

(between HS I/II and GH-N to be more specific) in a transgenic mouse study, directly led to a loss of transcription, but had no impact on the histone acetylation status along the hGH/CS locus [130]. Thus, histone acetylation along the hGH/CS locus appears to be more a "marker" of an activated chromatin domain than required for active transcription.

The 32 kb acetylated domain is further divided into two pituitary-specific sub-domains

(encompassing the LCR and the GH-N gene, respectively) defined by histone H3K4 tri- methylation, which also correlated with regions where non-coding transcripts along the locus were detected [130].

Taken together, all these observations suggest that a more complex model than a simple

"tracking model" is required to describe the process by which GH-N becomes active in the pituitary in vivo.

6.2.3 HS III and a Proposed "Window Hypothesis".

203 As mentioned above, Pit-1 binding to HS I/II is a fundamental step required for GH-N expression in the pituitary in vivo. However, the process by which Pit-1 gains access to

HS I/II prior to GH-N gene activation has not been determined. The ability to identify and dissect the events resulting from the de novo appearance of Pit-1 in terms of GH-N expression, have been hampered by the inherent difficulty in obtaining human embryonic cells of the pre-somatotroph lineage, and the difference between the GH(CS) locus in primates and non-primates. Using the human embryonic kidney (HEK) 293 cells as a model system, the consequences of the appearance of Pit-1 were assessed in Chapter 4.

An increased DNA accessibility particularly in the region of HS III, but not HS I/II, was detected in these HEK293 cells after Pit-1 expression, supported by detection of increased levels of both histone H4 hyperacetylation and RNA polymerase II (Pol II) activity.

HS III is one of the DNase-I hypersensitive sites located approximately 28 kb upstream of the GH-N transcription initiation site within the LCR that is common to both pituitary and placenta chromatin [80], and is now believed to be "constitutive" [87]. Studies using the mouse pre-somatotropic progenitor (GHFT1) cell line demonstrated that HS III was the only hypersensitive site within the hGH/CS LCR that showed a high level of histone

H3 and H4 acetylation after stable gene transfer, suggesting an enrichment of HS III in the acetylated chromatin fraction in the Pit-1 containing pituitary-derived cell line [88].

Thus, it was reasonable to propose the hypothesis that HS III serves as an initial "entry" point or a "window" for recruitment of specific factors such as Pit-1, which can then trigger chromatin remodeling and subsequent assembly of additional activator proteins

204 [154]. In Chapter 3 of this thesis, when the human pituitary chromatin was assessed for histone modification status, a peak for H4 hyperacetylation along the hGH/CS locus appeared to be located at HS III (Figure 3.1). It is therefore reasonable to suggest that this H4 hyperacetylation may indicate a site within the locus with a higher potential for association with other transcription factors [39-41]. This is consistent with the observation that a non pituitary/placenta-specific DNA element for the ETS family of transcription factors was identified in HS III and is associated with its enhancer activity

[155].

As a POU-homeodomain transcription factor, Pit-1 has a unique DNA-binding motif consisting of the POU homeo (POUHD) and POU-specific (POUs) domains [175, 223].

In vitro analysis of mutant Pit-1 proteins revealed that both POUHD and POUs domains contribute to DNA binding. More specifically, the POUHD is required and sufficient for low affinity DNA binding, while the POUs is necessary for high affinity binding and accurate recognition of natural Pit-1 response elements [160, 167]. Pit-1 also associates with other transcriptional co-factors to affect transcription, including co-activators CBP

[223, 224] and p/CAF [225], as well as the nuclear receptor co-repressor (N-CoR)/SMRT

[226, 227]. Association of Pit-1 and N-CoR/SMRT can form a transcriptional repressor complex with other proteins like mSin3A [228, 229] and histone deacetylases [229, 230], and block transcription from occurring. Studies using Xenopus oocytes as an in vivo reconstitution system revealed that Pit-1 is capable of remodeling chromatin and activating the PRL promoter by directly binding to DNA [231]. In this regard, it is very likely that the functional involvement of Pit-1 in the GH-N gene activation contains

205 multiple steps. Not only protein-DNA interaction, but also protein-protein interaction(s) are involved in this process.

6.2.4 Functional Involvement of ETS family Members in GH-N Gene Activation.

As presented in Chapter 4, expression of exogenous Pit-1 in HEK293 cells resulted in significant chromatin remodeling at the endogenous HS III region. Mechanistic studies using modified Pit-1 cDNAs suggest that histone H4 hyperacetylation at this region requires both the POU-homeodomain and /ra«s-activation domain. The increased DNA accessibility at the nearby regions, reflected by activation of the RNA Pol II, appears to depend on the POU-homeodomain. However, data from EMSA analysis indicate that

Pit-1 does not associate directly with DNA in the HS III region. Potential candidate binding sites were identified based on similarity to related Oct-1-like elements (OLEs), but no Oct-1 or Pit-1 (direct or indirect) binding was detected. Data presented in Chapter

4 provide evidence that Pit-1 may interact via an ETS DNA element in the HS III region through association with Elk-1, an ETS family member that was previously demonstrated to have enhancer-like activity and was shown to associate with DNA sequences in the HS

III region of the GH LCR in human pituitary chromatin in situ [155].

It was reported that Pit-1 and another ETS family member, Ets-1, interact and work synergistically to activate the rat PRL promoter [168, 169]. The ETS binding motif in the

Pit-1 POU homeodomain was both necessary and sufficient for direct binding of Pit-1 to

Ets-1 in a DNA-independent manner [169]. This is consistent with data in Chapter 4 that

206 suggest the importance of the Pit-1 POU homeodomain in the Pit-1/Elk-1 interaction, and

Pit-1 function associated with chromatin remodeling, including increases in hyperacetylation and DNA accessibility, observed at HS III.

In addition to the observation that Pit-1 is able to participate in a common complex with

Ets-1 or Elk-1 using human pituitary tissue samples, Pit-1 and Elk-1 also interact with each other and appear to be able to increase endogenous GH-N gene expression, at least at the transcriptional level, following co-expression in HEK293 cells. When Pit-1 is introduced into HEK293 cells independently or in combination with an Elk-1 expression vector, a specific increase in the endogenous (human) GH-N but not CS/GH-V RNA levels was detected. The relative response was linked to the expression level of Elk-1, as

GH-N RNA levels increased from 6-fold to 23-fold in the presence of basal versus overexpressd Elk-1. Even though overexpression of Elk-1 alone in HEK293 cells also resulted in a significant increase in endogenous GH as well as CS transcripts, this effect tends to reflect as an apparent "general" stimulation of transcriptional activity, suggesting a role for ETS factors in activation of the hGH/CS LCR in both the pituitary and placenta

[232]. To date, the above observation is the first report indicating an interaction between

Elk-1 or any ETS family member and Pit-1 in the regulation of pituitary GH-N gene expression.

Finally, the capacity for Pit-1 to exert this effect was demonstrated by its ability to stimulate significant enhancer activity associated with the Elk-1 site within a 41 bp HS III fragment of the hGH/CS LCR. Thus, these data implicate participation of Elk-1 and Pit-1

207 in a common complex and support a functional role for Elk-1/Pit-1 interaction in the human hGH/CS LCR.

6.2.5 Chromatin Conformation of the hGH/CS Locus.

It is now well established that chromatin forms complex and dynamic structures that allow for close proximity of regions that are spaced far apart along the linear length of

DNA [59]. The long-range control sequences have a crucial and often predominant role in metazoan gene activation [19, 87]. Defining how a complex gene locus achieves robust and tissue-specific expression of its corresponding genes should help to determine crucial relationships between chromatin conformation and other gene regulatory elements. The chromatin conformation capture (3C) assay has emerged as a powerful

PCR-based technique for the elucidation of the three-dimensional structure chromatin

[233-235]. The 3C technique was used successfully to demonstrate the association of distal hypersensitive sites within the LCR and active genes in the P-globin locus [235].

In addition, the formation and maintenance of the three-dimensional conformation is believed to be mediated by specific transcription factors [236, 237].

In the case of hGH/CS gene expression, the distinctive gene expression patterns in pituitary and placenta, combined with distinctive chromatin modifications suggests a corresponding distinction between the three-dimensional conformation of the locus in each tissue and the proteins that mediate interactions between regions within the locus.

The three-dimensional conformation of chromatin has been explored using the pituitaries

208 from PI transgenic mice (Figure 6.1A). A close positioning between the HS III-V and the HS I/II (Loop I; Figure 6.1B), as well as HS I/II to hGH-N promoter (Loop II;

Figure 6.1B) were detected with looping out of the intervening sequence [87]. The presence of Loop I can be linked with appropriate (site of integration independent and pituitary-specific) expression of GH-N in transgenic mice [85]; while a second loop

(Loop II) is associated with efficient promoter activity in vivo [85, 87]. These observations, from the structural point of view, provide direct evidence for 'looping' instead of'tracking' in the hGH/CS locus.

Interestingly, formation of the three-dimensional structure of the hGH/CS locus also appears to depend on the intact Pit-1 site at HS I/II. Inactivation of HS I/II by deletion of the 99-bp fragment not only results in loss of histone acetylation, decrease of transgene

GH-N expression, but also loss of a specific loop-formation. Using pituitaries from the

Pl/AHS I/II (Figure 6.1A) transgenic mice revealed that Loop II (formed by association between HS I/II and hGH-N promoter) was lost (Figure 6.1B) [87].

209 HSVIVIII 11,1 WJ t PI GH/CSLCR | \GH-N\-{C&Z~\ \CS-A \GH-V

Pl/AHS MI "¥] Igg-jVhf^FI 1CS-A | [\GH--V\

99-bp

A/T-1/Pit-1B A/T-2 A/T-3/Pit-lC

Loop II

pi Hsi/n-^Jt JUGH-NHCST]—[aCTI \ci£v\-

Loop I

\CD79S\ \GH-N\-{CS-L~\ \CS-A \ \GH-V\- Pl/AHS I/II »v-ra^:!

Loop I

Figure 6.1 A looping model of GH-N expression in pituitaries from transgenic mice. (A) Schematic of the PI and Pl/AHS I/II genes used for transgenic studies. The 99-bp region encompassing three A/T-rich Pit-1 sites is indicated. The deletion of the 99-bp is indicated by a black oval. Information about the PI and Pl/AHS I/II transgenes is based on [79, 85]. Information about the three A/T-rich Pit-1 sites is based on [128]. (B) Chromatin conformation capture (3C) assay analysis revealed that inactivation of HS I/II by deletion of the 99-bp element resulted in loss of the specific association between HS I/II and GH-N promoter (Loop II). Specific loops are boxed. Information about 3C assay studies is based on [87].

Given that hGH-N transgene expression in Pl/AHS I/II transgenic mice still remains 14% of that from the wild type PI transgenic line [85], this observation, from a structural point of view, provided evidence that a closer positioning between the HS I/II and GH-N

210 promoter may not be absolutely required for GH-N promoter activation, but is required for efficient GH-N transgene expression in vivo.

6.2.6 Proposed Mechanism for the Pituitary-specific GH-N Expression.

The second research objective of this thesis was to investigate the process by which Pit-1 gains access to HS I/1I prior to GH-N gene activation. Through a series of studies, several aspects, including the role of pituitary-specific transcription factor Pit-1 and its binding to GH-N promoter, the pituitary-specific hypersensitive site HS I/II, the

"constitutive" HS III, histone modifications, transcription co-factors, as well as the chromatin conformation all appear to be important regulatory components involved in the

GH-N gene activation in vitro and/or in vivo. Although all the above components contribute to GH-N expression in one way or another, the processes and timelines along which changes occur and how control is achieved during pituitary cell development remains to be fully determined. However, based on data reported in this thesis and from others, two possible mechanisms are proposed for the earlier events required for GH-N activation in vivo (Figure 6.2).

211 Pituitary LCR V nin ii i 11 W ETS -rI -CD79BI IwJvMoSn—[e£T1 IGTATT- I L

CZ>79B I \CH-N\ACS-C\- CP79B 1 ICH^vl-fC^n i

CD7<>B I IcawUo^n i V III II I it CP7»fl [ S-1M)

Loop II

HS I/II ; I CD79B I

HS V-III

Loop f

Figure 6.2 Schematic representation of the events prior to the human GH-N gene activation in the pituitary. The proposed mechanism for pituitary-specific GH-N gene activation is shown. Two possible pathways are shown. One in which ETS at HS III contributes to recruitment of Pit-1 (left), and the other where ETS/Pit-1 contributes to stabilization/generation of Loop I (between HS I/II and HS III-V). The human GH/CS gene family, the 5'- flanking CD79B and SCN4A genes, as well as the hypersensitive sites I/II to V (HS I/II to V) within the upstream locus control region (LCR) are shown. The "constitutive" HS III is

212 indicated by the pink oval. The potential binding sites for Pit-1 and ETS family member(s) are indicated. The regions of local chromatin remodeling are indicated by the green ovals. The "tissue-specificity" loop (Loop 1, between HS I/II and HS III-V) and "activation" loop (Loop II, between HS I/II and GH-N promoter) are shown. Transcription is indicated by a green arrow.

Hypersensitive site III was originally reported to be present in both pituitary and placenta chromatin, but has now been described as "poised" or "constitutive" [87]. It is possible though, to speculate that before binding to HS I/II, Pit-1 is recruited to HS III by Elk-1, resulting in the localized chromatin remodeling as well as recruitment of additional proteins, including RNA Pol II. The "cascade" of chromatin remodeling and/or sliding of the active form of RNA Pol II along the hGH/CS locus may happen, resulting in the opening up of HS I/II and its direct DNA-protein association with Pit-1. Association of

Pit-1 at HS I/II leads to (i) further recruitment of transcription factors, and (ii) formation of "Loop II" (formed by association between HS I/II and the hGH-N promoter), and eventually, activation of the hGH-N promoter in the pituitary (Figure 6.2, left panel).

Alternatively, Pit-1 and Elk-1 may be recruited to HS I/II and HS III separately first, and then interact with each other through protein-protein interaction, looping out the intervening sequences in between and forming the "Loop I" (formed by association between HS III-V and HS I/II) (Figure 6.2, right panel). Maintaining this chromatin conformation can be achieved through either protein-protein interaction and/or histone modifications. It is therefore noteworthy that Elk-1 and Pit-1 have been shown to associate with HS III and HS I/II regions, respectively, in human pituitary chromatin in situ [127, 128, 155]. Thus, Elk-1 and Pit-1 could participate in a common complex that

213 supports generation and/or maintenance of Loop I. Once Loop I is stabilized by the protein complex containing Elk-1/Pit-1, association of Pit-1 to HS I/II could occur, and result in the establishment of a functional GH-N promoter in the pituitary. The role for

ETS factor/Pit-1 interaction in the recruitment of Pit-1 or formation and/or maintenance of a looped chromatin configuration in the GH/CS LCR are, of course, not mutually exclusive.

6.3 Pituitary Repression of the Placental GH/CS Genes.

While studies from the first two research objectives provide some insight into pituitary- specific activation of the GH-N gene, they have provided few insights into the lack of placental gene expression in the pituitary in vivo. As described in Introduction 1.3, the placental genes and GH-N are expressed in a mutually exclusive manner in pituitary somatotrophs, and to the extent that not even basal level of placental hormones are detected in pituitary [73]. Taken together the observations that (i) the similar chromatin structure for all five GH/CS genes in the pituitary, and (ii) the CS-A promoter can also be driven by Pit-1 in vitro, the question therefore arises as to why the highly homologous placental CS/GH-V promoters are not activated in the pituitary by the same mechanism that activates GH-N.

In Chapter 3, analysis of histone modification status along the hGH/CS locus revealed

"active" modifications in the LCR and the GH-N promoter in human pituitary chromatin.

214 The modification pattern does not appear to extend to the promoters of placental CS/GH-

V genes, and thus correlates with inactivation of the placental gene promoters in the pituitary (Figure 6.3). As proposed in Section 6.1.2, one possible explanation for lack of placental gene expression is that changes in chromatin structure during activation of the

GH-N promoter via Pit-1 binding in the LCR may interfere with the necessary chromatin modifications required for CS promoter activation, thus resulting in a "passive" repression of the placental gene promoters and lack of expression in the pituitary.

Alternatively, there is still the possibility that the placental GH/CS genes are "actively repressed" in the pituitary somatotrophs. Studies from Chapter 4 suggest that Pit-1 at HS

I/II partners with ETS family members through the association with HS III to activate the

GH-N promoter. Co-expression of Pit-1 and Elk-1 appears to be able to increase endogenous GH-N gene expression at the transcriptional level in HEK293 cells (Figure

4.23). Overexpression of Elk-1 vector alone in HEK293 cells resulted in a significant increase in both endogenous GH-N as well as the placental CS RNAs, which is consistent with the apparent "general" transcription stimulation induced by the ETS family members. Surprisingly, when Pit-1 is introduced into HEK293 cells independently or in combination with an Elk-1 expression vector, only a specific increase in the endogenous

GH-N PvNA level was detected, but not CS/GH-V RNAs. In contrast to the observation that Pit-1 is capable of activating a hybrid reporter gene driven by an approximately 500 bp CS-A promoter region in transfected rat pituitary GC cells [143, 146], lack of an increase in CS RNA levels in HEK293 cells after Pit-1 expression, implies a mechanism whereby Pit-1 may actively block CS promoters specifically. By extension, this would

215 result in the "active" repression of the CS genes and lack of expression in the pituitary

(Figure 6.3).

Pituitary LCR V III II I \jt-——H SCN4A CD79B I -JGgJv]—{^IcsTT-f Jc£Jl £ 15J£FT—[f-ICS-BI-

Figure 6.3 Schematic representation of possible mechanisms that lead to the lack of placental GH/CS gene expression in the pituitary. The proposed mechanism for lack of placental gene expression in the pituitary is shown. The human GH/CS gene family, the 5'-flanking CD79B and SCN4A, as well as the hypersensitive sites I/II to V (HS I/II to V) within the upstream locus control region (LCR) are shown. Three P sequence elements (PSEs), A, B and C are also shown. The local chromatin modification (characterized by histone hyperacetylation) in the LCR is indicated by the green oval. The 3' end of the "acetylation domain" is indicated by a stop sign. Potential binding sites for NF-1, HNF as well as Pit-1 are also shown.

6.3.1 P Sequences and Associated Factors.

P sequences are conserved DNA elements located approximately 2 kb upstream of each of the placentally expressed genes of the hGH/CS family. Lack of presence of the P sequence upstream of the GH-N makes it a good candidate for involvement in the

216 regulation of the placental members of the hGH/CS locus in pituitary and/or in placenta.

Despite the core sequence of P elements, 263P, was demonstrated to confer placental expression enhancement in transgenic mice [150], the fact that 263P was able to repress the activity of the CS-A promoter in pituitary but not placental cells, suggesting its potential as a pituitary-specific repressor [143]. Previous studies demonstrate that both the two sub-fragments of 263P, PSE-A and PSE-B, could repress CS-A promoter activity in transient transfected pituitary GC but not in placental JEG-3 cells [143].

Subsequently, the nuclear factor-1 (NF-1), a family of transcription factors known to be involved in both activation and repression of genes [238-241], was identified as a PSE-B associated factor [151]. When similar analysis was performed on PSE-A, both NF-1 and members from the regulatory factor X (RFX) winged-helix family were shown to be able to associate with PSE-A, but in a mutually exclusive manner [152, 156].

However, when 103P, a sub-fragment of 263P containing both PSE-A and PSE-B, was assessed for the repressor activity in vitro, it was unable to repress CS-A promoter activity in pituitary GC cells (Figure 5.1). When protein binding on 103P was assessed, direct association of RFX 1 at PSE-A, but not NF-1, was detected with pituitary GC cell nuclear extract. In contrast, NF-1 binding to 263P was observed through competition of

EMS A and nuclease protection patterns [152, 156]. These results linked NF-1 with the repressor function of 263P, suggesting that at least two structurally and functionally independent complexes would have the capacity to associated with 263P: a repressor complex that contains NF-1 and a nonfunctional complex containing RFX1.

217 The lack of repressor activity seen with 103P versus 263P raised the possibility that sequence information outside PSE-A and PSE-B regions is required for pituitary repression. An additional binding factor(s) was proposed to favor NF-1 versus RFX1 binding to PSE-B and thus, determine the pituitary repressor function of 263P. Analysis downstream of PSE-A revealed the presence of binding sites for both C/EBP and HNF-3

(Figure 5.2). Both of which have previously been demonstrated to be involved in regulatory complexes that include NF-1 [185, 242-245]. However, data from EMSA suggested that the HNF-3 family member, but not C/EBP proteins, binding to PSE-C.

Through the use of RT-PCR and immunoblotting, a predominance of HNF-3 a was detected in rat pituitary GC cells as well as in human pituitaries. Association of HNF-3a to P sequences in human pituitaries in situ was demonstrated using the ChIP assay.

Although potential involvement of other HNF-3//&/2 family members at PSE-C cannot be ruled out in the human pituitaries, the relative abundance of HNF-3a as well as its association with P sequences in human pituitary chromatin as demonstrated by ChIP collectively link HNF-3a with P sequence repressor function in the human pituitary.

The proteins containing the distinct forkhead DNA-binding domain comprise a large family of regulatory factors involved in the regulation of cell type-specific gene expression [186, 246-248]. The HNF-3 proteins possess a conserved NH2-terminal transcription activation domain that is critical for mediating protein-protein interactions

[249]. The COOH-terminal domain of HNF-3 has roles in both transcription activation and repression. It is capable of binding to compact chromatin through its high affinity

DNA binding site, acting as a "pioneer factor" and opening the local nucleosomal region

218 [250]. It can also associate with transcription repressor proteins to inhibit transcription

[251, 252]. Data from Chapter 5 suggests that in human pituitary chromatin, HNF-3 associates with NF1 (functional repressor), but not RFX1 (non-functional repressor).

This selective protein-protein interaction suggests a possible mechanism in which binding of HNF-3 protein acts as a "bridge" stabilizing NF-1 binding at P sequences to ensure that the repressor complex to be functional.

As P sequence associating factors, NF-1 [239, 240], RFX1 [253], as well as HNF-3 [250,

252] are all reported to be involved in both the activation and repression of genes. This flexibility is intriguing in relation to P sequences, which have the potential for a dual role in regulating expression of the hGH/CS genes in distinct tissues [143, 150, 251, 252].

Even though P sequences are repressors of promoter activity in pituitary cells, the 263P fragment is also shown to enhance gene expression in the placenta in vivo [150]. For all the P sequence associating factors, the capacity exists to both repress and enhance gene transcription. Therefore, the identification of HNF-3 as a component of the P sequence complex in the pituitary expands the list of candidate factors in placental enhancement.

The repertoire of HNF-3, NF-1, and even RFX1 in the placenta is likely to be distinct from that in the pituitary. These factors may therefore underlie the tissue-specific function of the P sequences in the two distinct tissues.

6.3.2 Lack of Chromatin Modifications at Both CS Promoters and 263P in

Pituitary.

219 Another aspect that might contribute to absence of placental gene expression in the pituitary is the lack of chromatin modifications at both CS promoters and 263P in pituitary in situ. When chromatin modifications along the hGH/CS locus were assessed using the human pituitaries, neither CS promoters nor P sequences were labeled with

"transcription active makers" such as histone H4 hyperacetylation and H3K4 methylation

(Chapter 3). However, an analogous study using the human term placenta tissues revealed a significantly increased level of histone H4 hyperacetylation on both CS promoters and 263P [86, 152]. When histone H3K4 methylation was assessed at these sites using placental chromatin, a significant level of H3K4 methylation on CS promoters but not on P sequences was observed [86]. It is well-established that histone modification at the promoter region is essential for transcription activation [32].

Therefore, the detection of H4 hyperacetylation and H3K4 methylation on the CS promoter in placental tissues is consistent with the robust expression of the placental CS genes. For P sequences, distinct histone H4 hyperacetylation levels in pituitary and placenta tissues imply a functional association in these two tissues between chromatin modifications and the regulation of placental hGH/CS gene expression.

Similar to HNF-3, both NF-1 and PvFXl are associated with both transcription activation and repression activity [240, 241, 250, 252, 253]. In the case of NF-1, down-regulation of Id-1 promoter activity in non-aggressive breast cancer cells was linked to a complex containing both NF-1 and histone deacetylase 1 (HDAC-1) [254]. Thus, lack of histone acetylation at 263P in the pituitary might be the result of an imbalance of deacetylation over acetylation. The NF-1 containing complex, stabilized by HNF-3, may contribute to

220 a mechanism preventing histone hyperacetylation of 263P, and thus, repressing the expression of the placental GH/CS genes in the pituitary.

6.3.3 Pit-1 is a Logical Target for a Mechanism Underlying Pituitary Repression of

hGH/CS genes.

In Chapter 5, the functional involvement of Pit-1 in a pituitary-specific repression mechanism of hGH/CS genes was investigated. It has been well documented that efficient CS-A promoter activity in transfected pituitary GC cells is driven by the transcription factor Pit-1. When the proximal Pit-1 DNA element of the CS-A promoter was disrupted, both DNA binding and CS-A promoter activity were decreased significantly [98, 148]. In contrast to the observations detected in rat pituitary GC cells, expression of Pit-1 in HEK293 cells is not capable of activating the endogenous CS gene promoters (Chapter 4, Figure 4.23). These observations raise the possibility that pituitary-specific Pit-1 might be involved in the active repression of the placental CS/GH-

V genes. Thus, a mechanism by which P sequences might repress placental CS-A activity in pituitary cells could include interference with Pit-1 action [156]. This hypothesis was supported by the observation that P sequences (263P) significantly repress the wild-type CS-A promoter activity in transfected pituitary cells, but they do not repress when the Pit-1 site in the CS-A proximal promoter region has been mutated

(Figure 5.15). Thus, repressor activity of 263P in pituitary GC cells at least appears to be dependent on the intact Pit-1 binding sites and/or Pit-1.

221 When possible interaction between Pit-1 and P sequence elements was assessed in rat GC cell system, data from EMSA analysis suggested an indirect association between Pit-1 and PSE-C through protein-protein interaction, but not with PSE-A3 or PSE-B4 oligonucleotides. However, when complete PSE-A and PSE-B oligonucleotides were assessed, interaction between Pit-1 and PSE-A and/or PSE-B was detected in both EMSA and nuclease protection assays [143]. Although PSE-A3 and PSE-B4 both contain the binding sites for their own associated factors, the nearby nucleotide sequences still appear to be required for detection of either possible DNA-protein, or protein-protein interactions. If true, the interaction(s) (through either DNA elements or associated protein) with Pit-1 might be responsible for pituitary-specific repression of placental members of the hGH/CS gene family. In this case, although P sequence elements (-A, -B and -C) all exert pituitary repression, they do not need bind a pituitary-specific factor or factor(s) directly. The specificity might be related to an interaction with Pit-1. By contrast, in the placenta tissues where Pit-1 is absent, even with the presence of NF-1 and

RFX1 [156], promoters for CS/GH-V genes would still be expected to be fully functional. Thus, taken together with the observation that the Pit-1 binding site is required for repressor activity of P sequence in transfected pituitary GC cells, Pit-1 is a logical component or target target for a mechanism of pituitary repression of placental hGH/CS genes.

Although direct protein-protein interaction between Pit-1 and HNF-3a met with little success under the regular immunoprecipitation conditions, possible interaction between

Pit-1 and P sequence associated factors, not only HNF-3ct, but also NF-1 and/or RFX1,

222 still remains possible. NF-1 meanwhile, as the only transcription factor that can directly associate with PSE-A and PSE-B through DNA-protein interaction, also associates with

HNF-3, an identified PSE-C associated factor. As such a possible interaction between

Pit-1 and NF-1 is expected.

6.4 Future Directions.

Although the five genes of the hGH/CS family are believed to have evolved through gene duplication and share high sequence similarity, GH-N and the other placental CS/GH-V genes are expressed in a mutually exclusive way in pituitary and placenta. As a result of the apparent structural similarity versus distinct sites of expression, the hGH/CS gene family has provided an intriguing and informative model for studying gene regulation through both in vitro and in vivo approaches. However, studies of external factors that regulate gene expression have been somewhat limited by (i) a lack of human cell lines expressing endogenous GH and/or CS appropriately; and (ii) a lack of good animal models, given that the GH/CS locus is unique to human and other primates and does not exist in rodents. The generation of a transgenic mice line (171hGH/CS-TG), containing the intact human GH/CS cluster and the upstream locus region (LCR), now provides an in vivo system similar to human tissues where the hGH-N and CS genes are expressed in appropriate tissues [255]. In the combination with successful primary pituitary cell culture from these animals [256, 257], isolation of GH-N but not CS secreting pituitary cells containing "endogenous" hGH/CS locus would become possible. Studies based on

223 data reported in this thesis can now be applied to in vivo conditions using the primary pituitary cells from transgenic mice as following:

i) Applying the In Vitro Analysis of the Repressor 263P to an In Vivo Situation.

The studies described in Chapter 5 of this thesis were focused on the pituitary-specific repressor 263P. Although the active repression activity of these elements has been well documented using a pituitary cell model system in vitro, whether P sequences contribute to a lack of placental gene expression in the pituitary in vivo has never been assessed.

Data presented in Chapter 4, where expression of Pit-1 in HEK293 cells did not result in a increased level in placental CS/GH-V genes (Figure 4.23) suggest the function of Pit-1 is actively blocked by a repressor mechanism. Furthermore, as detection of GH-N, but not CS gene expression, was observed in the transgenic pituitaries, the 171hGH/CS- transgenic mice line provides an in vivo environment that is a better model than the transfected rat pituitary GC cell, with great potential to test whether 263P is actively functional as a pituitary-specific repressor. Targeted knockdown of components of the repressor complex (including NF-1, RFX1 and HNF-3) formed on the 263P by RNA interference (RNAi), followed by assessment of CS RNA level would become a possible approach to evaluate the possibility of pituitary repression of CS-A in vivo.

ii) Assessing Functional Involvement of Pit-1 in hGH/CS Gene Activation

and/or Repression in Pituitary In Vivo.

Although function of Pit-1 in pituitary development in vivo is reported to be definitive, its functional involvement in regulating the GH-N gene expression was largely based on (i)

224 in vitro approaches; and (ii) transgenic pituitaries where coding regions of Pit-1 have already been disrupted. Whether Pit-1 is continuously required for hGH/CS gene expression after a normal pituitary development has never been assessed. As presented in

Chapter 4 and Chapter 5, Pit-1 has potential to be involved in both GH-N gene activation and CS gene repression. Targeted knock down of Pit-1 in primary pituitary cells might be a valuable approach to address this question. Expression of CS genes and/or decrease in GH-N expression after Pit-1 knockdown might be expected.

iii) Investigate Chromatin Conformation in the Pituitary where hGH-N

Transgene Expression is at a "Normal" Level.

The three-dimensional chromatin conformation on the hGH/CS locus as well as the upstream LCR was previously demonstrated in PI and Pl/AHS I/II transgenic mice

(described in Section 6.2.5) [87]. Although formation of two loops was demonstrated through 3C analysis (Figure 6.1), the protein components that maintain the loops remain unclear. Based on the mechanism proposed in Chapter 6, both Pit-1 and Elk-1 might be involved in this process. This could be addressed by investigating the presence of the two loops by analyzing the pituitaries from the 171hGH/CS-transgenic mice using the 3C assay, as well as identification of the protein components through 3C-CMP [258]. These studies would provide more information about the formation of the active three- dimensional structure, and thus, how it could contribute to GH-N expression.

225 6.5 Final Remarks.

Figure 6.4 gives a schematic overview of the ideas and mechanisms proposed in this thesis. In the first objective of this thesis, histone modifications along the hGH/CS locus, including histone H4 hyperacetylation as well as H3K4 methylation, were assessed for the first time in human pituitary tissues (Chapter 3). All three modifications are considered as "active markers" for transcription, and were detected at the GH-N but not the CS promoter regions, which is consistent with the distinct expression pattern for GH-

N versus CS genes in the pituitary, and thus, contribute to their expression/repression in pituitary. The second research objective of this thesis made an effort to explore the earlier events after the appearance of Pit-1 but prior to GH-N gene activation. Using the

HEK293 cells with Pit-1 overexpression as a model system, data presented in Chapter 4 suggest a potential "window hypothesis" of HS III within LCR, allowing recruitment of

Pit-1 to HS III via interaction with ETS family member(s), leading to local chromatin modification around HS III, and resulting in extensive modification of the locus, and eventually, GH-N gene activation. The third research objective was to identify an additional element of repressor P sequences (Chapter 5). An additional P sequence element, termed PSE-C, was characterized and confirmed to be involved in the P sequence repression in the rat pituitary GC cells. In addition, HNF-3a was identified as the PSE-C associated factor, and shown to participate in the repressor complex formed on

263P. It was hypothesized that HNF-3 acts as a "bridge" stabilizing the repressor complex on 263 P, and interferes with Pit-1 function, leading to transcription repression of placental GH/CS genes.

226 Studies from this thesis reveal a functional involement of cross-talk between transcription factors and chromatin remodeling in the activation and/or repression of the human

GH/CS genes in the pituitary. Two possible mechanisms at the molecular level were proposed for potential gene activation and/or repression, which may provide insight into the regulation of tissue-specific gene expression.

227 GH-Np CSs/GH-Vp

Objective 1 + H4 Hyper-Ac Chromatin + Di-H3K4-Me Modifications + Tri-H3K4-Me

Recruitment Stabilization

HS III i (piM^-1

Objective 2 Objective 3

Figure 6.4 Summary of the thesis work. The promoter regions for GH-N as well as CSs/GH-V genes are shown. The chromatin modification analysis from Objective 1 is listed, including histone H4 hyperacetylation (H4 Hyper-Ac) and histone H3 di- / tri-methylation on lysine (K) residue position 4 (Di- /Tri-H3K4-Me). The relative remodeling levels on the promoter regions in human pituitary tissues are indicated. The proposed mechanism of events prior to GH-N gene activation from Objective 2 are indicated. The events occuring at HS III might lead to recruitment of more transcription factors, resulting in chromatin modification on GH-N promoter, and facilitating transcription initiation. The characterization of an additional element with the P sequence and its associated factors from Objective 3 is also shown. The relative binding locations for Pit-1, HNF-3 as well as repressor NF-1 are indicated. The "active repression" mechanism on P sequences and lack of chromatin remodeling on the promoter regions might work independently or in combination (through stabilization of each other), leading to inactivation of the placental CS/GH gene transcription.

228 CHAPTER 7

REFERENCES

1. Levine M, Manley JL 1989 Transcriptional repression of eukaryotic promoters.

Cell 59:405-408

2. McGinnis W, Krumlauf R 1992 Homeobox genes and axial patterning. Cell

68:283-302

3. Luger K, Mader AW, Richmond RK, Sargent DF, Richmond TJ 1997 Crystal

structure of the nucleosome core particle at 2.8 A resolution. Nature 389:251-260

4. Rhodes D 1997 Chromatin structure. The nucleosome core all wrapped up.

Nature 389:231, 233

5. Spadafora C, Bellard M, Compton JL, Chambon P 1976 The DNA repeat

lengths in chromatins from sea urchin sperm and gastrule cells are markedly

different. FEBS Lett 69:281-285

6. Martin LD, Vesenka JP, Henderson E, Dobbs DL 1995 Visualization of

nucleosomal substructure in native chromatin by atomic force microscopy.

Biochemistry 34:4610-4616

7. Arents G, Burlingame RW, Wang BC, Love WE, Moudrianakis EN 1991 The

nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein

229 assembly and a left-handed superhelix. Proc Natl Acad Sci U S A 88:10148-

10152

8. Chakravarthy S, Park YJ, Chodaparambil J, Edayathumangalam RS, Luger

K 2005 Structure and dynamic properties of nucleosome core particles. FEBS

Lett 579:895-898

9. Cosgrove MS, Boeke JD, Wolberger C 2004 Regulated nucleosome mobility

and the histone code. Nat Struct Mol Biol 11:1037-1043

10. Dorigo B, Schalch T, Kulangara A, Duda S, Schroeder RR, Richmond TJ

2004 Nucleosome arrays reveal the two-start organization of the chromatin fiber.

Science 306:1571-1573

11. Cook PR, Brazell IA 1975 Supercoils in human DNA. J Cell Sci 19:261 -279

12. Cook PR, Brazell IA 1976 Detection and repair of single-strand breaks in

nuclear DNA. Nature 263:679-682

13. Marsden MP, Laemmli UK 1979 Metaphase chromosome structure: evidence

for a radial loop model. Cell 17:849-858

14. Paulson JR, Laemmli UK 1977 The structure of histone-depleted metaphase

chromosomes. Cell 12:817-828

15. Felsenfeld G 1992 Chromatin as an essential part of the transcriptional

mechanism. Nature 355:219-224

16. Fischle W, Wang Y, Allis CD 2003 Histone and chromatin cross-talk. Curr Opin

Cell Biol 15:172-183

17. Johnson PF, McKnight SL 1989 Eukaryotic transcriptional regulatory proteins.

Annu Rev Biochem 58:799-839

230 18. Mitchell PJ, Tjian R 1989 Transcriptional regulation in mammalian cells by

sequence-specific DNA binding proteins. Science 245:371-378

19. Dean A 2006 On a chromosome far, far away: LCRs and gene expression. Trends

Genet 22:38-45

20. Grunstein M 1997 Histone acetylation in chromatin structure and transcription.

Nature 389:349-352

21. LaVoie HA 2005 Epigenetic control of ovarian function: the emerging role of

histone modifications. Mol Cell Endocrinol 243:12-18

22. O'Neill LP, Turner BM 1995 Histone H4 acetylation distinguishes coding

regions of the human genome from heterochromatin in a differentiation-

dependent but transcription-independent manner. Embo J 14:3946-3957

23. Smith CL, Hager GL 1997 Transcriptional regulation of mammalian genes in

vivo. A tale of two templates. J Biol Chem 272:27493-27496

24. van Holde KE, Lohr DE, Robert C 1992 What happens to nucleosomes during

transcription? J Biol Chem 267:2837-2840

25. Bazett-Jones DP, Mendez E, Czarnota GJ, Ottensmeyer FP, Allfrey VG 1996

Visualization and analysis of unfolded nucleosomes associated with transcribing

chromatin. Nucleic Acids Res 24:321-329

26. Ito T, Bulger M, Pazin MJ, Kobayashi R, Kadonaga JT 1997 ACF, an ISWI-

containing and ATP-utilizing chromatin assembly and remodeling factor. Cell

90:145-155

231 27. Lorch Y, Cairns BR, Zhang M, Kornberg RD 1998 Activated RSC-

nucleosome complex and persistently altered form of the nucleosome. Cell 94:29-

28. Schnitzler GR, Sif S, Kingston RE 1998 A model for chromatin remodeling by

the SWI/SNF family. Cold Spring Harb Symp Quant Biol 63:535-543

29. Eberharter A, Becker PB 2002 Histone acetylation: a switch between repressive

and permissive chromatin. Second in review series on chromatin dynamics.

EMBO Rep 3:224-229

30. Santos-Rosa H, Schneider R, Bannister AJ, Sherriff J, Bernstein BE, Emre

NC, Schreiber SL, Mellor J, Kouzarides T 2002 Active genes are tri-

methylated at K4 of histone H3. Nature 419:407-411

31. Rougeulle C, Navarro P, Avner P 2003 Promoter-restricted H3 Lys 4 di-

methylation is an epigenetic mark for monoallelic expression. Hum Mol Genet

12:3343-3348

32. Iizuka M, Smith MM 2003 Functional consequences of histone modifications.

Curr Opin Genet Dev 13:154-160

33. Chadee DN, Hendzel MJ, Tylipski CP, Allis CD, Bazett-Jones DP, Wright

JA, Davie JR 1999 Increased Ser-10 phosphorylation of histone H3 in mitogen-

stimulated and oncogene-transformed mouse fibroblasts. J Biol Chem 274:24914-

24920

34. Strahl BD, Allis CD 2000 The language of covalent histone modifications.

Nature 403:41-45

232 35. Verdone L, Caserta M, Di Mauro E 2005 Role of histone acetylation in the

control of gene expression. Biochem Cell Biol 83:344-353

36. Roh TY, Cuddapah S, Zhao K 2005 Active chromatin domains are defined by

acetylation islands revealed by genome-wide mapping. Genes Dev 19:542-552

37. Lee DY, Hayes JJ, Pruss D, Wolffe AP 1993 A positive role for histone

acetylation in transcription factor access to nucleosomal DNA. Cell 72:73-84

38. Luger K, Richmond TJ 1998 The histone tails of the nucleosome. Curr Opin

Genet Dev 8:140-146

39. Corona DF, Clapier CR, Becker PB, Tamkun JW 2002 Modulation of ISWI

function by site-specific histone acetylation. EMBO Rep 3:242-247

40. Kurdistani SK, Tavazoie S, Grunstein M 2004 Mapping global histone

acetylation patterns to gene expression. Cell 117:721-733

41. Suka N, Luo K, Grunstein M 2002 Sir2p and Sas2p opposingly regulate

acetylation of yeast histone H4 lysine 16 and spreading of heterochromatin. Nat

Genet 32:378-383

42. Cheung P, Allis CD, Sassone-Corsi P 2000 Signaling to chromatin through

histone modifications. Cell 103:263-271

43. Lee DY, Teyssier C, Strahl BD, Stallcup MR 2005 Role of protein methylation

in regulation of transcription. Endocr Rev 26:147-170

44. Stallcup MR 2001 Role of protein methylation in chromatin remodeling and

transcriptional regulation. Oncogene 20:3014-3020

233 45. Schneider R, Bannister A J, Myers FA, Thorne AW, Crane-Robinson C,

Kouzarides T 2004 Histone H3 lysine 4 methylation patterns in higher

eukaryotic genes. Nat Cell Biol 6:73-77

46. Strahl BD, Ohba R, Cook RG, Allis CD 1999 Methylation of histone H3 at

lysine 4 is highly conserved and correlates with transcriptionally active nuclei in

Tetrahymena. Proc Natl Acad Sci U S A 96:14967-14972

47. Cao R, Wang L, Wang H, Xia L, Erdjument-Bromage H, Tempst P, Jones

RS, Zhang Y 2002 Role of histone H3 lysine 27 methylation in Polycomb-group

silencing. Science 298:1039-1043

48. Schotta G, Ebert A, Krauss V, Fischer A, Hoffmann J, Rea S, Jenuwein T,

Dorn R, Reuter G 2002 Central role of Drosophila SU(VAR)3-9 in histone H3-

K9 methylation and heterochromatic gene silencing. Embo J 21:1121-1131

49. Aletta JM, Cimato TR, Ettinger MJ 1998 Protein methylation: a signal event in

post-translational modification. Trends Biochem Sci 23:89-91

50. Alberts B. JA, Lewis J., Raff M., Roberts K., Walter P. 2002 Molecular

Biology of the Cell.

51. Bell AC, Felsenfeld G 1999 Stopped at the border: boundaries and insulators.

Curr Opin Genet Dev 9:191-198

52. Elgin SC 1988 The formation and function of DNase I hypersensitive sites in the

process of gene activation. J Biol Chem 263:19259-19262

53. Fraser P, Grosveld F 1998 Locus control regions, chromatin activation and

transcription. Curr Opin Cell Biol 10:361-365

234 54. Li Q, Peterson KR, Fang X, Stamatoyannopoulos G 2002 Locus control

regions. Blood 100:3077-3086

55. Simon I, Tenzen T, Mostoslavsky R, Fibach E, Lande L, Milot E, Gribnau J,

Grosveld F, Fraser P, Cedar H 2001 Developmental regulation of DNA

replication timing at the human beta globin locus. Embo J 20:6150-6157

56. Ptashne M, Gann A 1997 Transcriptional activation by recruitment. Nature

386:569-577

57. Tuan D, Kong S, Hu K 1992 Transcription of the hypersensitive site HS2

enhancer in erythroid cells. Proc Natl Acad Sci U S A 89:11219-11223

58. Li Q, Barkess G, Qian H 2006 Chromatin looping and the probability of

transcription. Trends Genet 22:197-202

59. Carter D, Chakalova L, Osborne CS, Dai YF, Fraser P 2002 Long-range

chromatin regulatory interactions in vivo. Nat Genet 32:623-626

60. Rippe K, von Hippel PH, Langowski J 1995 Action at a distance: DNA-looping

and initiation of transcription. Trends Biochem Sci 20:500-506

61. Wang JC, Giaever GN 1988 Action at a distance along a DNA. Science

240:300-304

62. Blackwood EM, Kadonaga JT 1998 Going the distance: a current view of

enhancer action. Science 281:60-63

63. Grosveld F, van Assendelft GB, Greaves DR, Kollias G 1987 Position-

independent, high-level expression of the human beta-globin gene in transgenic

mice. Cell 51:975-985

235 64. Hebbes TR, Clayton AL, Thorne AW, Crane-Robinson C 1994 Core histone

hyperacetylation co-maps with generalized DNase I sensitivity in the chicken

beta-globin chromosomal domain. Embo J 13:1823-1830

65. Forrester WC, Epner E, Driscoll MC, Enver T, Brice M, Papayannopoulou

T, Groudine M 1990 A deletion of the human beta-globin locus activation region

causes a major alteration in chromatin structure and replication across the entire

beta-globin locus. Genes Dev 4:1637-1649

66. Sawado T, Halow J, Bender MA, Groudine M 2003 The beta -globin locus

control region (LCR) functions primarily by enhancing the transition from

transcription initiation to elongation. Genes Dev 17:1009-1018

67. Bender MA, Bulger M, Close J, Groudine M 2000 Beta-globin gene switching

and DNase I sensitivity of the endogenous beta-globin locus in mice do not

require the locus control region. Mol Cell 5:387-393

68. Schubeler D, Groudine M, Bender MA 2001 The murine beta-globin locus

control region regulates the rate of transcription but not the hyperacetylation of

histones at the active genes. Proc Natl Acad Sci U S A 98:11432-11437

69. Reik A, Telling A, Zitnik G, Cimbora D, Epner E, Groudine M 1998 The

locus control region is necessary for gene expression in the human beta-globin

locus but not the maintenance of an open chromatin structure in erythroid cells.

Mol Cell Biol 18:5992-6000

70. Martin JB 1973 Neural regulation of growth hormone secretion. N Engl J Med

288:1384-1393

236 71. Handwerger S, Freemark M 2000 The roles of placental growth hormone and

placental lactogen in the regulation of human fetal growth and development. J

Pediatr Endocrinol Metab 13:343-356

72. Walker PD, Riley LA, Hart RP, Jonakait GM 1991 Serotonin regulation of

neostriatal tachykinins following neonatal 6-hydroxydopamine lesions. Brain Res

557:31-36

73. Chen EY, Liao YC, Smith DH, Barrera-Saldana HA, Gelinas RE, Seeburg

PH 1989 The human growth hormone locus: nucleotide sequence, biology, and

evolution. Genomics 4:479-497

74. Bennani-Baiti IM, Asa SL, Song D, Iratni R, Liebhaber SA, Cooke NE 1998

DNase I-hypersensitive sites I and II of the human growth hormone locus control

region are a major developmental activator of somatotrope gene expression. Proc

Natl Acad Sci U S A 95:10655-10660

75. Bennani-Baiti IM, Cooke NE, Liebhaber SA 1998 Physical linkage of the

human growth hormone gene cluster and the CD79b (Ig beta/B29) gene.

Genomics 48:258-264

76. Ono M, Nomoto K, Nakazato S 1999 Gene structure of rat testicular cell

adhesion molecule 1 (TCAM-1), and its physical linkage to genes coding for the

growth hormone and BAF60b, a component of SWI/SNF complexes. Gene

226:95-102

77. Barsh GS, Seeburg PH, Gelinas RE 1983 The human growth hormone gene

family: structure and evolution of the chromosomal locus. Nucleic Acids Res

11:3939-3958

237 78. Hirt H, Kimelman J, Birnbaum MJ, Chen EY, Seeburg PH, Eberhardt NL,

Barta A 1987 The human growth hormone gene locus: structure, evolution, and

allelic variations. DNA 6:59-70

79. Su Y, Liebhaber SA, Cooke NE 2000 The human growth hormone gene cluster

locus control region supports position-independent pituitary- and placenta-

specific expression in the transgenic mouse. J Biol Chem 275:7902-7909

80. Jones BK, Monks BR, Liebhaber SA, Cooke NE 1995 The human growth

hormone gene is regulated by a multicomponent locus control region. Mol Cell

Biol 15:7010-7021

81. Kimura AP, Sizova D, Handwerger S, Cooke NE, Liebhaber SA 2007

Epigenetic activation of the human growth hormone gene cluster during placental

cytotrophoblast differentiation. Mol Cell Biol 27:6555-6568

82. Schubeler D, Francastel C, Cimbora DM, Reik A, Martin DI, Groudine M

2000 Nuclear localization and histone acetylation: a pathway for chromatin

opening and transcriptional activation of the human beta-globin locus. Genes Dev

14:940-950

83. Forsberg EC, Downs KM, Christensen HM, Im H, Nuzzi PA, Bresnick EH

2000 Developmentally dynamic histone acetylation pattern of a tissue-specific

chromatin domain. Proc Natl Acad Sci U S A 97:14494-14499

84. Bulger M, van Doorninck JH, Saitoh N, Telling A, Farrell C, Bender MA,

Felsenfeld G, Axel R, Groudine M 1999 Conservation of sequence and structure

flanking the mouse and human beta-globin loci: the beta-globin genes are

238 embedded within an array of odorant receptor genes. Proc Natl Acad Sci U S A

96:5129-5134

85. Ho Y, Elefant F, Cooke N, Liebhaber S 2002 A defined locus control region

determinant links chromatin domain acetylation with long-range gene activation.

Mol Cell 9:291-302

86. Kimura AP, Liebhaber SA, Cooke NE 2004 Epigenetic modifications at the

human growth hormone locus predict distinct roles for histone acetylation and

methylation in placental gene activation. Mol Endocrinol 18:1018-1032

87. Ho Y, Tadevosyan A, Liebhaber SA, Cooke NE 2008 The juxtaposition of a

promoter with a locus control region transcriptional domain activates gene

expression. EMBO Rep 9:891-898

88. Elefant F, Cooke NE, Liebhaber SA 2000 Targeted recruitment of histone

acetyltransferase activity to a locus control region. J Biol Chem 275:13827-13834

89. Kyle CV, Evans MC, Odell WD 1981 Growth hormone-like material in normal

human tissues. J Clin Endocrinol Metab 53:1138-1144

90. Palmetshofer A, Zechner D, Luger TA, Barta A 1995 Splicing variants of the

human growth hormone mRNA: detection in pituitary, mononuclear cells and

dermal fibroblasts. Mol Cell Endocrinol 113:225-234

91. Hattori N, Ikekubo K, Ishihara T, Moridera K, Hino M, Kurahachi H 1994

Spontaneous growth hormone (GH) secretion by unstimulated human

lymphocytes and the effects of GH-releasing hormone and somatostatin. J Clin

Endocrinol Metab 79:1678-1680

239 92. Kooijman R, Berus D, Malur A, Delhase M, Hooghe-Peters EL 1997 Human

neutrophils express GH-N gene transcripts and the pituitary transcription factor

Pit-lb. Endocrinology 138:4481-4484

93. Kooijman R, Malur A, Van Buul-Offers SC, Hooghe-Peters EL 1997 Growth

hormone expression in murine bone marrow cells is independent of the pituitary

transcription factor Pit-1. Endocrinology 138:3949-3955

94. Wu H, Devi R, Malarkey WB 1996 Localization of growth hormone messenger

ribonucleic acid in the human immune system—a Clinical Research Center study.

J Clin Endocrinol Metab 81:1278-1282

95. Bodner M, Castrillo JL, Theill LE, Deerinck T, Ellisman M, Karin M 1988

The pituitary-specific transcription factor GHF-1 is a homeobox-containing

protein. Cell 55:505-518

96. Castrillo JL, Bodner M, Karin M 1989 Purification of growth hormone-specific

transcription factor GHF-1 containing homeobox. Science 243:814-817

97. Ingraham HA, Chen RP, Mangalam HJ, Elsholtz HP, Flynn SE, Lin CR,

Simmons DM, Swanson L, Rosenfeld MG 1988 A tissue-specific transcription

factor containing a homeodomain specifies a pituitary phenotype. Cell 55:519-529

98. Lefevre C, Imagawa M, Dana S, Grindlay J, Bodner M, Karin M 1987

Tissue-specific expression of the human growth hormone gene is conferred in part

by the binding of a specific trans-acting factor. Embo J 6:971-981

99. Sturm RA, Das G, Herr W 1988 The ubiquitous octamer-binding protein Oct-1

contains a POU domain with a homeo box subdomain. Genes Dev 2:1582-1599

240 100. Muller MM, Ruppert S, Schaffner W, Matthias P 1988 A cloned octamer

transcription factor stimulates transcription from lymphoid-specific promoters in

non-B cells. Nature 336:544-551

101. Finney M, Ruvkun G 1990 The unc-86 gene product couples cell lineage and

cell identity in C. elegans. Cell 63:895-905

102. Herr W, Sturm RA, Clerc RG, Corcoran LM, Baltimore D, Sharp PA,

Ingraham HA, Rosenfeld MG, Finney M, Ruvkun G, et al. 1988 The POU

domain: a large conserved region in the mammalian pit-1, oct-1, oct-2, and

Caenorhabditis elegans unc-86 gene products. Genes Dev 2:1513-1516

103. Andersen B, Rosenfeld MG 2001 POU domain factors in the neuroendocrine

system: lessons from developmental biology provide insights into human disease.

Endocr Rev 22:2-35

104. Yan GZ, Pan WT, Bancroft C 1991 Thyrotropin-releasing hormone action on

the prolactin promoter is mediated by the POU protein pit-1. Mol Endocrinol

5:535-541

105. Elsholtz HP, Albert VR, Treacy MN, Rosenfeld MG 1990 A two-base change

in a POU factor-binding site switches pituitary-specific to lymphoid-specific gene

expression. Genes Dev 4:43-51

106. Voss JW, Wilson L, Rhodes SJ, Rosenfeld MG 1993 An alternative Pit-1 RNA

splicing product reveals modular binding and nonmodular transcriptional

activities of the POU-specific domain. Mol Endocrinol 7:1551-1560

241 107. Scheidereit C, Cromlish JA, Gerster T, Kawakami K, Balmaceda CG, Currie

RA, Roeder RG 1988 A human lymphoid-specific transcription factor that

activates immunoglobulin genes is a homoeobox protein. Nature 336:551-557

108. Voss JW, Wilson L, Rosenfeld MG 1991 POU-domain proteins Pit-1 and Oct-1

interact to form a heteromeric complex and can cooperate to induce expression of

the prolactin promoter. Genes Dev 5:1309-1320

109. Zhou C, Tong Y, Wawrowsky K, Bannykh S, Donangelo I, Melmed S 2008

Oct-1 induces pituitary tumor transforming gene expression in endocrine tumors.

Endocr Relat Cancer 15:817-831

110. Fletcher C, Heintz N, Roeder RG 1987 Purification and characterization of

OTF-1, a transcription factor regulating cell cycle expression of a human histone

H2b gene. Cell 51:773-781

111. Iademarco MF, McQuillan JJ, Rosen GD, Dean DC 1992 Characterization of

the promoter for vascular cell adhesion molecule-1 (VCAM-1). J Biol Chem

267:16323-16329

112. Eraly SA, Nelson SB, Huang KM, Mellon PL 1998 Oct-1 binds promoter

elements required for transcription of the GnRH gene. Mol Endocrinol 12:469-

481

113. Li P, He X, Gerrero MR, Mok M, Aggarwal A, Rosenfeld MG 1993 Spacing

and orientation of bipartite DNA-binding motifs as potential functional

determinants for POU domain factors. Genes Dev 7:2483-2496

242 114. Remenyi A, Tomilin A, Scholer HR, Wilmanns M 2002 Differential activity by

DNA-induced quarternary structures of POU transcription factors. Biochem

Pharmacol 64:979-984

115. Andersen B, Rosenfeld MG 1994 Pit-1 determines cell types during

development of the anterior pituitary gland. A model for transcriptional regulation

of cell phenotypes in mammalian organogenesis. J Biol Chem 269:29335-29338

116. Cohen LE, Wondisford FE, Radovick S 1996 Role of Pit-1 in the gene

expression of growth hormone, prolactin, and thyrotropin. Endocrinol Metab Clin

North Am 25:523-540

117. Fox SR, Jong MT, Casanova J, Ye ZS, Stanley F, Samuels HH 1990 The

homeodomain protein, Pit-l/GHF-1, is capable of binding to and activating cell-

specific elements of both the growth hormone and prolactin gene promoters. Mol

Endocrinol 4:1069-1080

118. Li S, Crenshaw EB, 3rd, Rawson EJ, Simmons DM, Swanson LW, Rosenfeld

MG 1990 Dwarf locus mutants lacking three pituitary cell types result from

mutations in the POU-domain gene pit-1. Nature 347:528-533

119. Radovick S, Nations M, Du Y, Berg LA, Weintraub BD, Wondisford FE 1992

A mutation in the POU-homeodomain of Pit-1 responsible for combined pituitary

hormone deficiency. Science 257:1115-1118

120. Peers B, Voz ML, Monget P, Mathy-Hartert M, Berwaer M, Belayew A,

Martial JA 1990 Regulatory elements controlling pituitary-specific expression of

the human prolactin gene. Mol Cell Biol 10:4690-4700

243 121. Steinfelder HJ, Hauser P, Nakayama Y, Radovick S, McClaskey JH, Taylor

T, Weintraub BD, Wondisford FE 1991 Thyrotropin-releasing hormone

regulation of human TSHB expression: role of a pituitary-specific transcription

factor (Pit-l/GHF-1) and potential interaction with a thyroid hormone-inhibitory

element. Proc Natl Acad Sci U S A 88:3130-3134

122. Cattini PA, Peritz LN, Anderson TR, Baxter JD, Eberhardt NL 1986 The 5-

flanking sequences of the human growth hormone gene contain a cell-specific

control element. DNA 5:503-509

123. Bodner M, Karin M 1987 A pituitary-specific trans-acting factor can stimulate

transcription from the growth hormone promoter in extracts of nonexpressing

cells. Cell 50:267-275

124. Castrillo JL, Theill LE, Karin M 1991 Function of the homeodomain protein

GHF1 in pituitary cell proliferation. Science 253:197-199

125. West BL, Catanzaro DF, Mellon SH, Cattini PA, Baxter JD, Reudelhuber TL

1987 Interaction of a tissue-specific factor with an essential rat growth hormone

gene promoter element. Mol Cell Biol 7:1193-1197

126. Ye ZS, Samuels HH 1987 Cell- and sequence-specific binding of nuclear

proteins to 5'-flanking DNA of the rat growth hormone gene. J Biol Chem

262:6313-6317

127. Shewchuk BM, Asa SL, Cooke NE, Liebhaber SA 1999 Pit-1 binding sites at

the somatotrope-specific DNase I hypersensitive sites I, II of the human growth

hormone locus control region are essential for in vivo hGH-N gene activation. J

Biol Chem 274:35725-35733

244 128. Jin Y, Surabhi RM, Fresnoza A, Lytras A, Cattini PA 1999 A role for A/T-

rich sequences and Pit-l/GHF-1 in a distal enhancer located in the human growth

hormone locus control region with preferential pituitary activity in culture and

transgenic mice. Mol Endocrinol 13:1249-1266

129. Shewchuk BM, Liebhaber SA, Cooke NE 2002 Specification of unique Pit-1

activity in the hGH locus control region. Proc Natl Acad Sci U S A 99:11784-

11789

130. Ho Y, Elefant F, Liebhaber SA, Cooke NE 2006 Locus control region

transcription plays an active role in long-range gene activation. Mol Cell 23:365-

375

131. Jackson-Grusby LL, Pravtcheva D, Ruddle FH, Linzer DI 1988

Chromosomal mapping of the prolactin/growth hormone gene family in the

mouse. Endocrinology 122:2462-2466

132. Krawczak M, Chuzhanova NA, Cooper DN 1999 Evolution of the proximal

promoter region of the mammalian growth hormone gene. Gene 237:143-151

133. Miller WL, Eberhardt NL 1983 Structure and evolution of the growth hormone

gene family. Endocr Rev 4:97-130

134. Barrera-Saldana HA, Robberson DL, Saunders GF 1982 Transcriptional

products of the human placental lactogen gene. J Biol Chem 257:12399-12404

135. Barrera-Saldana HA, Seeburg PH, Saunders GF 1983 Two structurally

different genes produce the same secreted human placental lactogen hormone. J

Biol Chem 258:3787-3793

245 136. Hoshina M, Boothby M, Boime I 1982 Cytological localization of chorionic

gonadotropin alpha and placental lactogen mRNAs during development of the

human placenta. J Cell Biol 93:190-198

137. Kaplan SL, Gurpide E, Sciarra JJ, Grumbach MM 1968 Metabolic clearance

rate and production rate of chorionic growth hormone-prolactin in late pregnancy.

J Clin Endocrinol Metab 28:1450-1460

138. Seeburg PH, Shine J, Martial JA, Ullrich A, Baxter JD, Goodman HM 1977

Nucleotide sequence of part of the gene for human chorionic

somatomammotropin: purification of DNA complementary to predominant

mRNA species. Cell 12:157-165

139. Jacquemin P, Alsat E, Oury C, Belayew A, Muller M, Evain-Brion D,

Martial JA 1996 The enhancers of the human placental lactogen B, A, and L

genes: progressive activation during in vitro trophoblast differentiation and

importance of the DF-3 element in determining their respective activities. DNA

Cell Biol 15:845-854

140. Silva CM, Kloth MT, Lyons CE, Dunn CR, Kirk SE 2002 Intracellular

signaling by growth hormone variant (GH-V). Growth Horm IGF Res 12:374-380

141. Frankenne F, Rentier-Delrue F, Scippo ML, Martial J, Hennen G 1987

Expression of the growth hormone variant gene in human placenta. J Clin

Endocrinol Metab 64:635-637

142. Selby MJ, Barta A, Baxter JD, Bell GI, Eberhardt NL 1984 Analysis of a

major human chorionic somatomammotropin gene. Evidence for two functional

promoter elements. J Biol Chem 259:13131-13138

246 143. Nachtigal MW, Nickel BE, Cattini PA 1993 Pituitary-specific repression of

placental members of the human growth hormone gene family. A possible

mechanism for locus regulation. J Biol Chem 268:8473-8479

144. Nickel BE, Cattini PA 1996 Nuclease sensitivity of the human growth hormone-

chorionic somatomammotropin locus in pituitary and placenta suggest different

mechanisms for tissue-specific regulation. Mol Cell Endocrinol 118:155-162

145. Lemaigre FP, Peers B, Lafontaine DA, Mathy-Hartert M, Rousseau GG,

Belayew A, Martial JA 1989 Pituitary-specific factor binding to the human

prolactin, growth hormone, and placental lactogen genes. DNA 8:149-159

146. Nickel BE, Nachtigal MW, Bock ME, Cattini PA 1991 Differential binding of

rat pituitary-specific nuclear factors to the 5'-flanking region of pituitary and

placental members of the human growth hormone gene family. Mol Cell Biochem

106:181-187

147. Cattini PA, Eberhardt NL 1987 Regulated expression of chimaeric genes

containing the 5'-flanking regions of human growth hormone-related genes in

transiently transfected rat anterior pituitary tumor cells. Nucleic Acids Res

15:1297-1309

148. Nachtigal MW, Nickel BE, Klassen ME, Zhang WG, Eberhardt NL, Cattini

PA 1989 Human chorionic somatomammotropin and growth hormone gene

expression in rat pituitary tumour cells is dependent on proximal promoter

sequences. Nucleic Acids Res 17:4327-4337

149. Lew AM, Elsholtz HP 1991 Cloning of the human cDNA for transcription factor

Pit-1. Nucleic Acids Res 19:6329

247 150. Elefant F, Su Y, Liebhaber SA, Cooke NE 2000 Patterns of histone acetylation

suggest dual pathways for gene activation by a bifunctional locus control region.

Embo J 19:6814-6822

151. Norquay LD, Jin Y, Surabhi RM, Gietz RD, Tanese N, Cattini PA 2001 A

member of the nuclear factor-1 family is involved in the pituitary repression of

the human placental growth hormone genes. Biochem J 354:387-395

152. Norquay LD, Yang X, Sheppard P, Gregoire S, Dodd JG, Reith W, Cattini

PA 2003 RJFX1 and NF-1 associate with P sequences of the human growth

hormone locus in pituitary chromatin. Mol Endocrinol 17:1027-1038

153. Norquay LD, Yang X, Jin Y, Detillieux KA, Cattini PA 2006 Hepatocyte

nuclear factor-3 alpha binding at P sequences of the human growth hormone locus

is associated with pituitary repressor function. Mol Endocrinol 20:598-607

154. Cattini PA, Yang X, Jin Y, Detillieux KA 2006 Regulation of the human growth

hormone gene family: possible role for Pit-1 in early stages of pituitary-specific

expression and repression. Neuroendocrinology 83:145-153

155. Jin Y, Norquay LD, Yang X, Gregoire S, Cattini PA 2004 Binding of AP-2

and ETS-domain family members is associated with enhancer activity in the

hypersensitive site III region of the human growth hormone/chorionic

somatomammotropin locus. Mol Endocrinol 18:574-587

156. Norquay LD 2004 Characterization of regulatory P seqeunces with the capacity

for dual roles in directing expression of the human growth hormone chroionic

somatomammotropin gene family.

248 157. Andrews NC, Faller DV 1991 A rapid micropreparation technique for extraction

of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic

Acids Res 19:2499

158. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by

RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic

Acids Res 11:1475-1489

159. Nordeen SK 1988 Luciferase reporter gene vectors for analysis of promoters and

enhancers. Biotechniques 6:454-458

160. Ingraham HA, Flynn SE, Voss JW, Albert VR, Kapiloff MS, Wilson L,

Rosenfeld MG 1990 The POU-specific domain of Pit-1 is essential for sequence-

specific, high affinity DNA binding and DNA-dependent Pit-l-Pit-1 interactions.

Cell 61:1021-1033

161. Yang SH, Yates PR, Whitmarsh AJ, Davis RJ, Sharrocks AD 1998 The Elk-1

ETS-domain transcription factor contains a mitogen-activated protein kinase

targeting motif. Mol Cell Biol 18:710-720

162. Miyake A, Konishi M, Martin FH, Hernday NA, Ozaki K, Yamamoto S,

Mikami T, Arakawa T, Itoh N 1998 Structure and expression of a novel

member, FGF-16, on the fibroblast growth factor family. Biochem Biophys Res

Commun 243:148-152

163. Mayo KE, Hammer RE, Swanson LW, Brinster RL, Rosenfeld MG, Evans

RM 1988 Dramatic pituitary hyperplasia in transgenic mice expressing a human

growth hormone-releasing factor gene. Mol Endocrinol 2:606-612

249 164. Lu SY, Sontag DP, Detillieux KA, Cattini PA 2008 FGF-16 is released from

neonatal cardiac myocytes and alters growth-related signaling: a possible role in

postnatal development. Am J Physiol Cell Physiol 294:C 1242-1249

165. Lytras A, Cattini PA 1994 Human chorionic somatomammotropin gene

enhancer activity is dependent on the blockade of a repressor mechanism. Mol

Endocrinol 8:478-489

166. Wallis OC, Zhang YP, Wallis M 2001 Molecular evolution of GH in primates:

characterisation of the GH genes from slow loris and marmoset defines an episode

of rapid evolutionary change. J Mol Endocrinol 26:249-258

167. Sturm RA, Herr W 1988 The POU domain is a bipartite DNA-binding structure.

Nature 336:601-604

168. Bradford AP, Brodsky KS, Diamond SE, Kuhn LC, Liu Y, Gutierrez-

Hartmann A 2000 The Pit-1 homeodomain and beta-domain interact with Ets-1

and modulate synergistic activation of the rat prolactin promoter. J Biol Chem

275:3100-3106

169. Bradford AP, Wasylyk C, Wasylyk B, Gutierrez-Hartmann A 1997

Interaction of Ets-1 and the POU-homeodomain protein GHF-1 /Pit-1 reconstitutes

pituitary-specific gene expression. Mol Cell Biol 17:1065-1074

170. Quandt K, Freeh K, Karas H, Wingender E, Werner T 1995 Matlnd and

Matlnspector: new fast and versatile tools for detection of consensus matches in

nucleotide sequence data. Nucleic Acids Res 23:4878-4884

250 171. Wingender E, Chen X, Hehl R, Karas H, Liebich I, Matys V, Meinhardt T,

Pruss M, Reuter I, Schacherer F 2000 TRANSFAC: an integrated system for

gene expression regulation. Nucleic Acids Res 28:316-319

172. Chen RP, Ingraham HA, Treacy MN, Albert VR, Wilson L, Rosenfeld MG

1990 Autoregulation of pit-1 gene expression mediated by two cis-active

promoter elements. Nature 346:583-586

173. He X, Treacy MN, Simmons DM, Ingraham HA, Swanson LW, Rosenfeld

MG 1989 Expression of a large family of POU-domain regulatory genes in

mammalian brain development. Nature 340:35-41

174. Holloway JM, Szeto DP, Scully KM, Glass CK, Rosenfeld MG 1995 Pit-1

binding to specific DNA sites as a monomer or dimer determines gene-specific

use of a tyrosine-dependent synergy domain. Genes Dev 9:1992-2006

175. Jacobson EM, Li P, Leon-del-Rio A, Rosenfeld MG, Aggarwal AK 1997

Structure of Pit-1 POU domain bound to DNA as a dimer: unexpected

arrangement and flexibility. Genes Dev 11:198-212

176. Tomilin A, Remenyi A, Lins K, Bak H, Leidel S, Vriend G, Wilmanns M,

Scholer HR 2000 Synergism with the coactivator OBF-1 (OCA-B, BOB-1) is

mediated by a specific POU dimer configuration. Cell 103:853-864

177. Bradford AP, Conrad KE, Tran PH, Ostrowski MC, Gutierrez-Hartmann A

1996 GHF-1/Pit-1 functions as a cell-specific integrator of Ras signaling by

targeting the Ras pathway to a composite Ets-1/GHF-1 response element. J Biol

Chem 271:24639-24648

251 178. Mangalam HJ, Albert VR, Ingraham HA, Kapiloff M, Wilson L, Nelson C,

Elsholtz H, Rosenfeld MG 1989 A pituitary POU domain protein, Pit-1,

activates both growth hormone and prolactin promoters transcriptionally. Genes

Dev 3:946-958

179. Vinson CR, Hai T, Boyd SM 1993 Dimerization specificity of the leucine

zipper-containing bZIP motif on DNA binding: prediction and rational design.

Genes Dev 7:1047-1058

180. Haas NB, Cantwell CA, Johnson PF, Burch JB 1995 DNA-binding specificity

of the PAR basic leucine zipper protein VBP partially overlaps those of the

C/EBP and CREB/ATF families and is influenced by domains that flank the core

basic region. Mol Cell Biol 15:1923-1932

181. Johnson PF 1993 Identification of C/EBP basic region residues involved in DNA

sequence recognition and half-site spacing preference. Mol Cell Biol 13:6919-

6930

182. Wu GD, Lai EJ, Huang N, Wen X 1997 Oct-1 and CCAAT/enhancer-binding

protein (C/EBP) bind to overlapping elements within the interleukin-8 promoter.

The role of Oct-1 as a transcriptional repressor. J Biol Chem 272:2396-2403

183. Klick DE, Shadley JD, Hines RN 2008 Differential regulation of human hepatic

flavin containing monooxygenase 3 (FM03) by CCAAT/enhancer-binding

protein beta (C/EBPbeta) liver inhibitory and liver activating proteins. Biochem

Pharmacol 76:268-278

252 184. Webster NJ, Kong Y, Cameron KE, Resnik JL 1994 An upstream element

from the human insulin receptor gene promoter contains binding sites for C/EBP

beta and NF-1. Diabetes 43:305-312

185. Bois-Joyeux B, Danan JL 1994 Members of the CAAT/enhancer-binding

protein, hepatocyte nuclear factor-1 and nuclear factor-1 families can

differentially modulate the activities of the rat alpha-fetoprotein promoter and

enhancer. Biochem J 301 ( Pt l):49-55

186. Clevidence DE, Overdier DG, Tao W, Qian X, Pani L, Lai E, Costa RH 1993

Identification of nine tissue-specific transcription factors of the hepatocyte

nuclear factor 3/forkhead DNA-binding-domain family. Proc Natl Acad Sci U S

A 90:3948-3952

187. Lai E, Prezioso VR, Smith E, Litvin O, Costa RH, Darnell JE, Jr. 1990 HNF-

3A, a hepatocyte-enriched transcription factor of novel structure is regulated

transcriptionally. Genes Dev 4:1427-1436

188. Lai E, Prezioso VR, Tao WF, Chen WS, Darnell JE, Jr. 1991 Hepatocyte

nuclear factor 3 alpha belongs to a gene family in mammals that is homologous to

the Drosophila homeotic gene fork head. Genes Dev 5:416-427

189. Overdier DG, Porcella A, Costa RH 1994 The DNA-binding specificity of the

hepatocyte nuclear factor 3/forkhead domain is influenced by amino-acid residues

adjacent to the recognition helix. Mol Cell Biol 14:2755-2766

190. Dirksen ML, Jamrich M 1992 A novel, activin-inducible, blastopore lip-specific

gene of Xenopus laevis contains a fork head DNA-binding domain. Genes Dev

6:599-608

253 191. Weigel D, Jurgens G, Kuttner F, Seifert E, Jackie H 1989 The homeotic gene

fork head encodes a nuclear protein and is expressed in the terminal regions of the

Drosophila embryo. Cell 57:645-658

192. Gao N, Zhang J, Rao MA, Case TC, Mirosevich J, Wang Y, Jin R, Gupta A,

Rennie PS, Matusik RJ 2003 The role of hepatocyte nuclear factor-3 alpha

(Forkhead Box Al) and androgen receptor in transcriptional regulation of

prostatic genes. Mol Endocrinol 17:1484-1507

193. Costa RH, Grayson DR, Darnell JE, Jr. 1989 Multiple hepatocyte-enriched

nuclear factors function in the regulation of transthyretin and alpha 1-antitrypsin

genes. Mol Cell Biol 9:1415-1425

194. Tansey WP, Catanzaro DF 1991 Spl and thyroid hormone receptor

differentially activate expression of human growth hormone and chorionic

somatomammotropin genes. J Biol Chem 266:9805-9813

195. Gronostajski RM 1986 Analysis of nuclear factor I binding to DNA using

degenerate oligonucleotides. Nucleic Acids Res 14:9117-9132

196. Gronostajski RM 1987 Site-specific DNA binding of nuclear factor I: effect of

the spacer region. Nucleic Acids Res 15:5545-5559

197. Cornille F, Emery P, Schuler W, Lenoir C, Mach B, Roques BP, Reith W

1998 DNA binding properties of a chemically synthesized DNA binding domain

of hRFXl. Nucleic Acids Res 26:2143-2149

198. Emery P, Strubin M, Hofmann K, Bucher P, Mach B, Reith W 1996 A

consensus motif in the RFX DNA binding domain and binding domain mutants

with altered specificity. Mol Cell Biol 16:4486-4494

254 199. Cha JY, Kim HI, Im SS, Li TZ, Ahn YH 2001 HNF1 and/or HNF3 may

contribute to the tissue specific expression of glucokinase gene. Exp Mol Med

33:59-63

200. Shewchuk BM, Ho Y, Liebhaber SA, Cooke NE 2006 A single base difference

between Pit-1 binding sites at the hGH promoter and locus control region

specifies distinct Pit-1 conformations and functions. Mol Cell Biol 26:6535-6546

201. Forsberg EC, Bresnick EH 2001 Histone acetylation beyond promoters: long-

range acetylation patterns in the chromatin world. Bioessays 23:820-830

202. Kuo MH, Allis CD 1998 Roles of histone acetyltransferases and deacetylases in

gene regulation. Bioessays 20:615-626

203. Bernstein BE, Humphrey EL, Erlich RL, Schneider R, Bouman P, Liu JS,

Kouzarides T, Schreiber SL 2002 Methylation of histone H3 Lys 4 in coding

regions of active genes. Proc Natl Acad Sci U S A 99:8695-8700

204. Liang G, Lin JC, Wei V, Yoo C, Cheng JC, Nguyen CT, Weisenberger DJ,

Egger G, Takai D, Gonzales FA, Jones PA 2004 Distinct localization of histone

H3 acetylation and H3-K4 methylation to the transcription start sites in the human

genome. Proc Natl Acad Sci U S A 101:7357-7362

205. Cosma MP, Tanaka T, Nasmyth K 1999 Ordered recruitment of transcription

and chromatin remodeling factors to a cell cycle- and developmentally regulated

promoter. Cell 97:299-311

206. Berger SL 2002 Histone modifications in transcriptional regulation. Curr Opin

Genet Dev 12:142-148

255 207. Davie JR 1998 Covalent modifications of histones: expression from chromatin

templates. Curr Opin Genet Dev 8:173-178

208. Davie JR 1997 Nuclear matrix, dynamic histone acetylation and transcriptionally

active chromatin. Mol Biol Rep 24:197-207

209. Shi Y, Whetstine JR 2007 Dynamic regulation of histone lysine methylation by

demethylases. Mol Cell 25:1-14

210. Trewick SC, McLaughlin PJ, Allshire RC 2005 Methylation: lost in

hydroxylation? EMBO Rep 6:315-320

211. Orphanides G, Reinberg D 2000 RNA polymerase II elongation through

chromatin. Nature 407:471-475

212. Scully KM, Jacobson EM, Jepsen K, Lunyak V, Viadiu H, Carriere C, Rose

DW, Hooshmand F, Aggarwal AK, Rosenfeld MG 2000 Allosteric effects of

Pit-1 DNA sites on long-term repression in cell type specification. Science

290:1127-1131

213. Xu L, Lavinsky RM, Dasen JS, Flynn SE, Mclnerney EM, Mullen TM,

Heinzel T, Szeto D, Korzus E, Kurokawa R, Aggarwal AK, Rose DW, Glass

CK, Rosenfeld MG 1998 Signal-specific co-activator domain requirements for

Pit-1 activation. Nature 395:301-306

214. Simmons DM, Voss JW, Ingraham HA, Holloway JM, Broide RS, Rosenfeld

MG, Swanson LW 1990 Pituitary cell phenotypes involve cell-specific Pit-1

mRNA translation and synergistic interactions with other classes of transcription

factors. Genes Dev 4:695-711

215. Fryxell KJ 1996 The coevolution of gene family trees. Trends Genet 12:364-369

256 216. Soares MJ 2004 The prolactin and growth hormone families: pregnancy-specific

hormones/cytokines at the maternal-fetal interface. Reprod Biol Endocrinol 2:51

217. Klemm JD, Rould MA, Aurora R, Herr W, Pabo CO 1994 Crystal structure of

the Oct-1 POU domain bound to an octamer site: DNA recognition with tethered

DNA-binding modules. Cell 77:21-32

218. Phillips K, Luisi B 2000 The virtuoso of versatility: POU proteins that flex to fit.

J Mol Biol 302:1023-1039

219. Cajiao I, Zhang A, Yoo EJ, Cooke NE, Liebhaber SA 2004 Bystander gene

activation by a locus control region. Embo J 23:3854-3863

220. Cohen LE, Hashimoto Y, Zanger K, Wondisford F, Radovick S 1999 CREB-

independent regulation by CBP is a novel mechanism of human growth hormone

gene expression. J Clin Invest 104:1123-1130

221. Flanagan JF, Mi LZ, Chruszcz M, Cymborowski M, Clines KL, Kim Y,

Minor W, Rastinejad F, Khorasanizadeh S 2005 Double chromodomains

cooperate to recognize the methylated histone H3 tail. Nature 438:1181-1185

222. Ng HH, Robert F, Young RA, Struhl K 2003 Targeted recruitment of Setl

histone methylase by elongating Pol II provides a localized mark and memory of

recent transcriptional activity. Mol Cell 11:709-719

223. Bannister AJ, Kouzarides T 1996 The CBP co-activator is a histone

acetyltransferase. Nature 384:641-643

224. Ogryzko W, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The

transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell

87:953-959

257 225. Yang XJ, Ogryzko W, Nishikawa J, Howard BH, Nakatani Y 1996 A

p300/CBP-associated factor that competes with the adenoviral oncoprotein El A.

Nature 382:319-324

226. Chen JT>, Evans RM 1995 A transcriptional co-repressor that interacts with

nuclear hormone receptors. Nature 377:454-457

227. Horlein AJ, Naar AM, Heinzel T, Torchia J, Gloss B, Kurokawa R, Ryan A,

Kamei Y, Soderstrom M, Glass CK, et al. 1995 Ligand-independent repression

by the thyroid hormone receptor mediated by a nuclear receptor co-repressor.

Nature 377:397-404

228. AI land L, Muhle R, Hou H, Jr., Potes J, Chin L, Schreiber-Agus N, DePinho

RA 1997 Role for N-CoR and histone deacetylase in Sin3-mediated

transcriptional repression. Nature 387:49-55

229. Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia

J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW,

Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and

histone deacetylase mediates transcriptional repression. Nature 387:43-48

230. Laherty CD, Yang WM, Sun JM, Davie JR, Seto E, Eisenman RN 1997

Histone deacetylases associated with the mSin3 corepressor mediate mad

transcriptional repression. Cell 89:349-356

231. Kievit P, Maurer RA 2005 The pituitary-specific transcription factor, Pit-1, can

direct changes in the chromatin structure of the prolactin promoter. Mol

Endocrinol 19:138-147

258 232. Gutierrez-Hartmann A, Duval DL, Bradford AP 2007 ETS transcription

factors in endocrine systems. Trends Endocrinol Metab 18:150-158

233. Cullen KE, Kladde MP, Seyfred MA 1993 Interaction between transcription

regulatory regions of prolactin chromatin. Science 261:203-206

234. Dekker J, Rippe K, Dekker M, Kleckner N 2002 Capturing chromosome

conformation. Science 295:1306-1311

235. Tolhuis B, Palstra RJ, Splinter E, Grosveld F, de Laat W 2002 Looping and

interaction between hypersensitive sites in the active beta-globin locus. Mol Cell

10:1453-1465

236. Drissen R, Palstra RJ, Gillemans N, Splinter E, Grosveld F, Philipsen S, de

Laat W 2004 The active spatial organization of the beta-globin locus requires the

transcription factor EKLF. Genes Dev 18:2485-2490

237. Vakoc CR, Letting DL, Gheldof N, Sawado T, Bender MA, Groudine M,

Weiss MJ, Dekker J, Blobel GA 2005 Proximity among distant regulatory

elements at the beta-globin locus requires GATA-1 and FOG-1. Mol Cell 17:453-

462

238. Jones KA, Kadonaga JT, Rosenfeld PJ, Kelly TJ, Tjian R 1987 A cellular

DNA-binding protein that activates eukaryotic transcription and DNA replication.

Cell 48:79-89

239. Liu Y, Bernard HU, Apt D 1997 NFI-B3, a novel transcriptional repressor of the

nuclear factor I family, is generated by alternative RNA processing. J Biol Chem

272:10739-10745

259 240. Nebl G, Cato AC 1995 NFI/X proteins: a class of NFI family of transcription

factors with positive and negative regulatory domains. Cell Mol Biol Res 41:85-

241. Osada S, Ikeda T, Xu M, Nishihara T, Imagawa M 1997 Identification of the

transcriptional repression domain of nuclear factor 1-A. Biochem Biophys Res

Commun 238:744-747

242. Aigueperse C, Val P, Pacot C, Darne C, Lalli E, Sassone-Corsi P, Veyssiere

G, Jean C, Martinez A 2001 SF-1 (steroidogenic factor-1), C/EBPbeta

(CCAAT/enhancer binding protein), and ubiquitous transcription factors NFI

(nuclear factor 1) and Spl (selective promoter factor 1) are required for regulation

of the mouse aldose reductase-like gene (AKR1B7) expression in adrenocortical

cells. Mol Endocrinol 15:93-111

243. Auge-Gouillou C, Petropoulos I, Zakin MM 1993 Liver-enriched HNF-3 alpha

and ubiquitous factors interact with the human transferrin gene enhancer. FEBS

Lett 323:4-10

244. Ji C, Chen Y, Centrella M, McCarthy TL 1999 Activation of the insulin-like

growth factor-binding protein-5 promoter in osteoblasts by cooperative E box,

CCAAT enhancer-binding protein, and nuclear factor-1 deoxyribonucleic acid-

binding sequences. Endocrinology 140:4564-4572

245. Tsay W, Lee YM, Lee SC, Shen MC, Chen PJ 1997 Synergistic transactivation

of HNF-1 alpha, HNF-3, and NF-I contributes to the activation of the liver-

specific protein C gene. DNA Cell Biol 16:569-577

260 246. Clevidence DE, Overdier DG, Peterson RS, Porcella A, Ye H, Paulson KE,

Costa RH 1994 Members of the HNF-3/forkhead family of transcription factors

exhibit distinct cellular expression patterns in lung and regulate the surfactant

protein B promoter. Dev Biol 166:195-209

247. Ikeda K, Shaw-White JR, Wert SE, Whitsett JA 1996 Hepatocyte nuclear

factor 3 activates transcription of thyroid transcription factor 1 in respiratory

epithelial cells. Mol Cell Biol 16:3626-3636

248. Overdier DG, Ye H, Peterson RS, Clevidence DE, Costa RH 1997 The winged

helix transcriptional activator HFH-3 is expressed in the distal tubules of

embryonic and adult mouse kidney. J Biol Chem 272:13725-13730

249. Harnish DC, Malik S, Kilbourne E, Costa R, Karathanasis SK 1996 Control

of apolipoprotein AI gene expression through synergistic interactions between

hepatocyte nuclear factors 3 and 4. J Biol Chem 271:13621-13628

250. Cirillo LA, Lin FR, Cuesta I, Friedman D, Jarnik M, Zaret KS 2002 Opening

of compacted chromatin by early developmental transcription factors HNF3

(FoxA) and GATA-4. Mol Cell 9:279-289

251. Costa RH, Kalinichenko W, Lim L 2001 Transcription factors in mouse lung

development and function. Am J Physiol Lung Cell Mol Physiol 280:L823-838

252. Wang JC, Waltner-Law M, Yamada K, Osawa H, Stifani S, Granner DK

2000 Transducin-like enhancer of split proteins, the human homologs of

Drosophila groucho, interact with hepatic nuclear factor 3beta. J Biol Chem

275:18418-18423

261 253. Katan Y, Agami R, Shaul Y 1997 The transcriptional activation and repression

domains of RFX1, a context-dependent regulator, can mutually neutralize their

activities. Nucleic Acids Res 25:3621-3628

254. Singh J, Murata K, Itahana Y, Desprez PY 2002 Constitutive expression of the

Id-1 promoter in human metastatic breast cancer cells is linked with the loss of

NF-l/Rb/HDAC-1 transcription repressor complex. Oncogene 21:1812-1822

255. Jin Y, Lu SY, Fresnoza A, Detillieux KA, Duckworth ML, Cattini PA 2009

Differential placental hormone gene expression during pregnancy in a transgenic

mouse containing the human growth hormone/chorionic somatomammotropin

locus. Placenta 30:226-235

256. Kirschner LS 2009 Use of mouse models to understand the molecular basis of

tissue-specific tumorigenesis in the Carney complex. J Intern Med 266:60-68

257. Oomizu S, Honda J, Takeuchi S, Kakeya T, Masui T, Takahashi S 2000

Transforming growth factor-alpha stimulates proliferation of mammotrophs and

corticotrophs in the mouse pituitary. J Endocrinol 165:493-501

258. Simonis M, Klous P, Splinter E, Moshkin Y, Willemsen R, de Wit E, van

Steensel B, de Laat W 2006 Nuclear organization of active and inactive

chromatin domains uncovered by chromosome conformation capture-on-chip

(4C). Nat Genet 38:1348-1354

262