View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector See related commentary on pg 994 ORIGINAL ARTICLE

The Effects of Dickkopf 1 on Expression and Wnt Signaling by Melanocytes: Mechanisms Underlying Its Suppression of Melanocyte Function and Proliferation Yuji Yamaguchi1,2, Thierry Passeron1, Hidenori Watabe1, Ken-ichi Yasumoto1, Francois Rouzaud1, Toshihiko Hoashi1 and Vincent J. Hearing1

Dickkopf 1 (DKK1), which is expressed at high mRNA levels by fibroblasts in the dermis of human skin on the palms and soles, inhibits the function and proliferation of melanocytes in the epidermis of those areas via the suppression of b-catenin and microphthalmia-associated transcription factor (MITF). In this study, we investigated the expression levels of DKK1 between palmoplantar and non-palmoplantar areas and the effects of DKK1 on melanocyte gene expression profiles and on Wnt signaling pathways using DNA microarray technology, reverse transcriptase-PCR, Western blot, 3-dimensional reconstructed skin, immuno- cytochemistry, and immunohistochemistry. DKK1-responsive included those encoding involved in the regulation of melanocyte development, growth, differentiation, and apoptosis (including Kremen 1, G-coupled receptor 51, lipoprotein receptor-related protein 6, low-density lipoprotein receptor, tumor necrosis factor receptor super-family 10, growth arrest and DNA-damage-inducible gene 45b, and MITF). Of special interest was the rapid decrease in expression of MITF in melanocytes treated with DKK1, which is concurrent with the decreased activities of b-catenin and of glucose-synthase kinase 3b via phosphorylation at Ser9 and with the upregulated expression of protein kinase Ca. These results further clarify the mechanism by which DKK1 suppresses melanocyte density and differentiation, and help explain why DKK1-rich palmoplantar epidermis is paler than non-palmoplantar epidermis via mesenchymal-epithelial interactions. Journal of Investigative Dermatology (2007) 127, 1217–000. doi:10.1038/sj.jid.5700629; published online 7 December 2006

INTRODUCTION and produce significantly less melanin pigment than in non- Characterizing determinants of topographical/anatomical/ palmoplantar skin. We showed earlier that fibroblasts derived site-specific differentiation and regulation is a new and from palmoplantar skin induce the expression of keratin 9, a exciting research field. We recently reviewed topographical/ marker for palmoplantar epidermis, in non-palmoplantar anatomical/site-specific differences between human skin on keratinocytes via mesenchymal-epithelial interactions the sole and the palm (also called palmoplantaris) and on the (Yamaguchi et al., 1999). Further, non-palmoplantar epider- trunk (also called non-palmoplantaris) in terms of thickness mis (with no dermal components) adopts a palmoplantar and pigmentation (Yamaguchi et al., 2005). Not only is phenotype when grafted on palmoplantar wounds (Yamagu- palmoplantar skin much thicker than the skin in other regions chi et al., 2001a, b). Finally, we recently reported that mRNA of the body but also melanocytes in those areas are less dense encoding dickkopf 1 (DKK1), an inhibitor of the canonical Wnt signaling pathway, is expressed at high levels in palmoplantar fibroblasts (Yamaguchi et al., 2004). 1Laboratory of Cell Biology, National Cancer Institute, National Institutes Wnt signaling consists of a canonical pathway (that 2 of Health, Bethesda, Maryland, USA and Department of Dermatology, involves b-catenin and multiple protein complexes contain- Osaka University Graduate School of Medicine, Suita-shi, Osaka, Japan ing glycogen synthase kinase 3b (GSK3b), axin, adenomatous Correspondence: Dr Yuji Yamaguchi, Department of Dermatology, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita-shi, polyposis coli, and Akt) and several non-canonical pathways Osaka 565-0871 Japan. E-mail: [email protected] (that involve calcium, protein kinase Ca (PKCa), c-Jun Abbreviations: DKK1, dickkopf 1; Gadd, growth arrest and DNA-damage- N-terminal kinase, and focal adhesion kinase) (Zorn, 2001; inducible gene; GSK, glucose-synthase kinase; Krn, Kremen; LDLR, Kawano and Kypta, 2003). DKK1 is the secreted antagonist of low-density lipoprotein receptor; LRP, lipoprotein receptor-related protein; canonical Wnt signaling that interacts with Wnt receptor MITF, microphthalmia-associated transcription factor; PKC, protein kinase C; RT, reverse transcriptase lipoprotein receptor-related protein 6 (LRP6) (Mao et al., Received 27 April 2006; revised 16 August 2006; accepted 13 September 2001; Nusse, 2001). DKK1 also interacts with the trans- 2006; published online 7 December 2006 membrane proteins Kremen (Krn) 1 and 2 and blocks the

& 2007 The Society for Investigative Dermatology www.jidonline.org 1217 Y Yamaguchi et al. Effects of DKK1 on Melanocyte Function and Proliferation

canonical Wnt signaling by inducing endocytosis of the LRP6 RESULTS complex (Mao et al., 2002) without affecting the Wnt We previously reported that expression levels of DKK1 receptor Frizzled. DKK1 induces the formation of ectopic mRNA are upregulated in human palmoplantar fibroblasts heads in Xenopus laevis in the presence of bone morpho- compared with non-palmoplantar fibroblasts (Yamaguchi genetic protein inhibitors (Glinka et al., 1998) and plays et al., 2004). In this study, we initially confirmed those critical roles in modulating apoptosis during vertebrate limb DKK1 expression levels in cultured fibroblasts derived from development (especially inter-digit space formation) by palm or trunk skin at the protein level, using immunoblotting interacting with bone morphogenic protein (Grotewald and (Figure 1a) and immunocytochemistry (Figure 1b). Indeed, Ruther, 2002). DKK genes (including DKK1, DKK2, and the expression of DKK1 in three independent populations of DKK3) are coordinately expressed in mesodermal lineages; palmoplantar-derived fibroblasts (Palm1, Palm2, and Palm3) that is, the transcripts of DKK1 are found in defined lineages, was dramatically higher than in three independent popula- including limb buds, heart, urogenital ridge, tailbud, palate, tions of non-palmoplantar-derived fibroblasts (Trunk1, and craniofacial regions, whereas transcripts of DKK3 are Trunk2, and Trunk3). restricted to the trunk mesenchyme (Monaghan et al., 1999). We then treated normal human melanocytes with 50 ng/ Keratin 14-DKK1 transgenic mice lack hair follicle develop- ml of recombinant human DKK1 for 2 hours, harvested total ment and have no pigmentation on the trunk because RNA and analyzed that using oligonucleotide-cDNA micro- melanocytes are not present in the inner-follicular epidermis arrays. That concentration of DKK1 used was determined in of those mice (Andl et al., 2002), which suggests that non- previous studies (Tian et al., 2003; Yamaguchi et al., 2004). pigmented (glabrous) palms and soles (even in mice) are due The complete database of gene expression patterns are to the high expression of DKK1. reported on a public database (http://www.ncbi.nlm.nih. HOX gene family members are transcription factors gov/geo/) with a Series no. of ‘‘GSE5515’’. The 30 genes known to regulate patterning in the primary and secondary with the largest increases or decreases in expression are listed axes of developing embryos. HOX genes play critical roles in limb development (Dolle et al., 1989) and their collinear regulation is similar to that seen in the trunk: genes located in a DKK1 b the middle of the HoxD complex are expressed in proximal areas of the limb bud, whereas genes located in a more 50 direction have a more distal expression. HOX genes are also known to direct topographical/anatomical/site-specific differ- entiation of embryonic neurons in response to levels of fibroblast growth factors (Liu et al., 2001; Dasen et al., 2003), bone morphogenetic protein (Dasen et al., 2003), and retinoic acid (Schubert et al., 2004). Notably, adult human fibroblasts obtained from different sites of the body maintain key features of HOX gene expression patterns established during embryogenesis, which suggests that HOX genes may direct topographical/anatomical/site-specific differentiation Palm3 and underlie the detailed positional memory in adult fibroblasts (Chang et al., 2002). We reported earlier that DKK1, which is expressed at high mRNA levels by fibroblasts in the dermis of human skin on the palms and soles, inhibits the function and proliferation of melanocytes in the epidermis of those areas via the Palm1 Trunk1 Palm2 Trunk2 suppression of b-catenin and microphthalmia-associated transcription factor (MITF) (Yamaguchi et al., 2004). In this -Actin study, we first confirmed the expression patterns of DKK1 at protein levels using immunocytochemistry and immunoblot- ting. We further evaluated the effects of DKK1 on gene expression profiles using DNA microarray technology and Trunk3 validated the results using reverse transcriptase (RT)-PCR, DKK1(green) DAP(blue) Palm1 Trunk1Palm2 Trunk2 Western blot, immunocytochemistry, and immunohisto- chemistry. We finally evaluated the effects of DKK1 on Wnt Figure 1. DKK1 expression by palmoplantar and by non-palmoplantar signaling pathways of melanocytes, focusing on GSK3b and fibroblasts. (a) Immunoblotting analysis; the intensity of the 35 kDa DKK1 PKCa as critical intermediates of the canonical and non- band is higher by 2.8-fold (P ¼ 0.00003) in palmoplantar fibroblasts (Palm1, Palm2) than in non-palmoplantar fibroblasts (Trunk1, Trunk2). canonical Wnt signaling pathways. Not only did we use (b) Immunocytochemical analysis; high levels of DKK1 (green melanocyte cultures but we also used 3-dimensional skin fluorescence) are seen in palmoplantar fibroblasts (Palm3) compared with reconstructs and in vivo skin obtained from the same non-palmoplantar fibroblasts (Trunk3). Nuclei are stained blue by subjects. 40,6-diamidino-2-phenylindole. Bar ¼ 64 mm.

1218 Journal of Investigative Dermatology (2007), Volume 127 Y Yamaguchi et al. Effects of DKK1 on Melanocyte Function and Proliferation

in Table S1. Highly regulated genes also included some DKK1 Ctrl DKK1 Ctrl DKK1 Ctrl receptor-related genes (Table S2), Wnt-related genes (Table S3), melanocyte marker genes (Table S4), and HOX-related genes (Table S5). DKK1 had various immediate effects on melanocytes, considering that affected genes are related to such diverse processes as mitochondrial function (e.g. MRPL38 and MRPS27), melanosome trafficking (e.g. HPS4, SV2B, and STX5A) and transport (e.g. MLPH), apoptosis (e.g. growth arrest and DNA-damage-inducible gene (Gadd)45b and TNFRSF10A), Wnt signaling (e.g. b-catenin and PKC), as well as melanocyte development (e.g. HOX) and differentia- tion (e.g. MITF).  We validated the mRNA expression levels of B40 of those PKC 1 Krn1 GPR51 genes using RT-PCR (some are shown in Figure 2), and confirmed that the levels of several genes related to Wnt signa- ling were significantly upregulated in response to rhDKK1 (e.g. b-catenin and PKCb1 (Po0.0001)), as were receptors (e.g. Krn1 (Po0.0001), low-density lipoprotein receptor (LDLR) (Po0.001), GPR51 (Po0.01), and TNFRSF10A (Po0.0001)) and markers of apoptosis (e.g. Gadd45b, P ¼ 0.0016), where- as MITF was significantly downregulated (Po0.001) by rhDKK1. Interestingly, the level of b-catenin mRNA did not correlate with the protein level, as reported previously (Yamaguchi et al., 2004). LRP6 LDLR TNFR10 We next investigated the expression patterns of proteins related to Wnt signaling pathways in more detail. We harvested cell extracts after 2 hours (Figure 3a) and after 5 days (Figure 3b) of treatment with DKK1 and analyzed them by Western blotting. Overall, GSK3b expression was unchanged at 2 hours but was slightly downregulated after 5 days of treatment with DKK1. However, GSK3b phos- phorylated at Ser9 was dramatically upregulated in response to DKK1 within 2 hours and that was also seen after 5 days of treatment. PKCa expression was also increased at both time points examined. As reported previously, b-catenin expression was downregulated after 2 hours or 5 days of Gadd45 MITF GAPDH DKK1 treatment. Consistent results were confirmed by immunocytochemistry of DKK1- or mock-treated melano- Figure 2. Validation of gene expression levels using RT-PCR. Shown are normal human melanocytes treated with 50 ng/ml DKK1 for 2 hours or cytes (Figure 4). untreated (ctrl). The expression of PKCb1 (Po0.0001), Krn1 (Po0.0001), To further examine whether the secretion of DKK1 by GPR51 (Po0.01), LRP6 (P ¼ 0.065), LDLR (Po0.001), TNFR10 (Po0.0001), fibroblasts was responsible for the physiological differences and Gadd45 (Po0.002) is upregulated in melanocytes when treated with observed between palmoplantar skin and non-palmoplantar DKK1, but MITF (Po0.001) is downregulated. glyceraldehyde-3-phosphate skin, we used 3-dimensional skin reconstructs (termed dehydrogenase expression served as control (P ¼ 0.41) (n4 ¼ 3). MelanoDerm). These model skins consist of normal human keratinocytes and melanocytes grown at the air/liquid inter- face of the maintenance medium either in the presence or b-catenin expression were decreased in melanocytes in absence of 100 ng/ml of rhDKK1 for 4–14 days (Figure 5, only palmoplantar epidermis. 10 days treatment is shown). The immunostaining of these skin reconstructs was consistent with the findings of DISCUSSION melanocyte cultures, as shown above, and revealed de- In this study, we used Western blotting and immunohisto- creased expression of b-catenin and GSK3b and increased chemistry to confirm that DKK1 expression is significantly expression of PKCa and Ser9-phosphorylated GSK3b. higher in human fibroblasts derived from palmoplantar skin We also confirmed these in vitro results using immuno- compared with those derived from non-palmoplantar skin. histochemistry of human skin in situ. Melanocytes in We then investigated the effects of DKK1 on human palmoplantar skin, which are adjacent to dermal fibroblasts melanocytes using a multidisciplinary approach that included with high expression levels of DKK1, showed relatively low gene profile analysis and the investigation of signal transduc- expression of GSK3b (Figure 6) but high expression of GSK3b tion protein expression patterns. We found that the expres- phosphorylated at Ser9 and of PKCa. In contrast, levels of sion of a large number of Wnt-related genes (including

www.jidonline.org 1219 Y Yamaguchi et al. Effects of DKK1 on Melanocyte Function and Proliferation

abDKK1 Ctrl DKK1 Ctrl DKK1 Ctrl

102 100 57 100 GSK3 GSK3

pGSK3(green) DAPI(blue)

350 100 160 100 pGSK3 pGSK3

PKC(green) DAPI(blue)

163 100 144 100 PKC PKC

86 100 81 100 -Catenin(green) DAPI(blue) -Catenin -Catenin Figure 4. Expression of pGSK3b,PKCa,andb-catenin by normal human melanocytes. Shown are normal human melanocytes treated with 50 ng/ml DKK1 for 2 hours or untreated (ctrl) by immunocytochemistry. The expression of Ser9-phosphorylated GSK3b and PKCa is upregulated in response to DKK1, but b-catenin expression is downregulated. Green fluorescence marks antibody staining, and nuclei are stained blue by 40,6-diamidino-2-phenylindole. Bar ¼ 128 mm for outer panels and 64 mm for insets. -Actin -Actin

Figure 3. Validation of expression levels of proteins related to Wnt signaling pathways in normal human melanocytes treated with DKK1 for (a) 2 hours critical receptor expressed specifically by melanocytes or (b) 5 days or untreated (ctrl) by immunoblotting. GSK3b expression (Rouzaud et al., 2006), as both of them are G-coupled is unchanged at 2 hours, but is downregulated at 5 days. The expression protein receptors with an alignment score of 6365 by of Ser9-phosphorylated GSK3b and PKCa is upregulated, but b-catenin ClustalW at the basic pair level. TNFRSF10A is known as a expression is downregulated. Numbers under the gels indicate levels death receptor that leads to p53-independent apoptosis via of intensity compared with control. caspase cleavage (Xu and El-Deiry, 2000), and its upregula- tion suggests that DKK1 may induce melanocyte apoptosis via this receptor, although further analysis will be necessary PKCb1, Krn1, and LRP6) is quickly upregulated in melano- to prove that point. Our speculation that DKK1 induces cytes in response to DKK1. Genes encoding receptors other apoptosis in melanocytes also derives from the finding that than the known DKK1 receptors (Krn1 and LRP6) also show the expression of Gadd45b, which induces apoptosis via the upregulated expression within 2 hours after treatment with p38 mitogen-activated protein kinase pathway (Sarkar et al., DKK1, suggesting that LDLR, GPR51, and TNFRSF10A (also 2002), is also upregulated in melanocytes treated with DKK1. known as tumor necrosis factor-related apoptosis-inducing In other words, the inhibition of melanocyte growth by DKK1 ligand-receptor 1) are responsive to DKK1. LDLR is related to (as we previously reported (Yamaguchi et al., 2004)) may LRP6, which has a DKK1 binding site (Mao et al., 2001), with involve the upregulated expression of TNFRSF10A and/or an alignment score of 706 by ClustalW at the amino-acid Gadd45b. level and with a score of 230 bits by BlastP. GPR51 (also Our microarray analyses also suggest numerous other known as GABABR2 (Li et al., 2003)) is related to MC1R, a candidate genes that might be responsible for the suppression

1220 Journal of Investigative Dermatology (2007), Volume 127 Y Yamaguchi et al. Effects of DKK1 on Melanocyte Function and Proliferation

DKK1 Ctrl Plam skin Trunk skin

GSK3(green) MART-1(red) GSK3(green) MART-1(red)

pGSK3(green) MART-1(red)

pGSK3(green) MART-1(red)

PKC(green) MART-1(red) DAPI(blue)

PCK(green) MART-1(red)

-Catenin(green) MART-1(red) DAPI(blue)

Figure 5. Immunostaining of GSKb, Ser9-phosphorylated GSKb, PKCa, and b-catenin in the reconstructed epidermis. Immunostaining shown after 10 days of treatment with or without 100 ng/ml rhDKK1. Note the decreased expression of GSK3b (0.63) and b-catenin (DKK1/ctrl ratio ¼ 0.76) and the -Catenin(green) MART-1(red) increased expression of Ser9-phosphorylated GSK3b (2.00) and PKCa (1.11). Figure 6. Immunohistochemistry of GSKb,PKCa,andb-catenin in palmoplantar and non-palmoplantar skin in situ. Melanocytes in the skin are identified by MART-1 staining (red fluorescence). Palm skin (left) shows low of melanocyte growth and/or function by DKK1. As example, expression of GSK3b (Palm/Trunk ratio ¼ 0.59) but high expression of GSK3b vitiligo is an acquired pigmentary disorder characterized by phosphorylated at Ser9 (1.24) and of PKCa (2.73). In contrast, levels of b progressive areas of depigmenting skin, which result from the -catenin (0.02) expression are lower in palmoplantar melanocytes in situ compared with melanocytes in trunk skin (right). Bar ¼ 100 mm for upper loss of melanocytes in those hypopigmented regions. Vitiligo six panels and 24 mm for lower two panels. has been associated with thyroid disorders including Hashi- moto thyroiditis and Graves disease (Grimes, 2005), and has also been associated with oxidative stress, in particular with distribution of melanin in melanosomes (Hoashi et al., 2005; increased levels of intracellular reactive oxygen species Valencia et al., 2006). DKK1 upregulates the expression of regulated by mitochondria (Dell’Anna et al., 2001). Expres- 3, SVG2B, melanophilin, and syntaxin 5A, which sion levels of thyrotrophic embryonic factor and mitochon- suggests that DKK1 regulates the subcellular trafficking of drial ribosomal proteins are increased 42.3-fold by treatment proteins either directly or indirectly. DKK1 also upregulates with DKK1, which suggests that these genes may be involved the expression of myoactive tetradeca peptide (MATP), a with increased melanocyte toxicity in DKK1-rich tissue. protein critical to the correct processing of tyrosinase (Costin Trafficking of melanosomal proteins within melanocytes et al., 2003); thus, the differentiation of melanocytes may be plays critical roles in regulating the synthesis, deposition, and influenced by DKK1 at many levels.

www.jidonline.org 1221 Y Yamaguchi et al. Effects of DKK1 on Melanocyte Function and Proliferation

DKK1 also affects the expression of numerous genes further analyses will be necessary to resolve this point. We related with Wnt and HOX functions in melanocytes (cf also found that DKK1 enhances the expression of PKCa, Tables S3 and S5, respectively). Although further analyses will which inactivates GSK3b (Chen et al., 2000; Fang et al., be necessary to elucidate the effects on melanocyte growth 2002) and induces apoptosis via p38 mitogen-activated and/or differentiation, DKK1 could be an important regulator protein kinase (Tanaka et al., 2003) (similar to Gadd45 as of those pathways considering their importance to melanocyte described above (Sarkar et al., 2002)), which suggests that function (Takeda et al., 2000b; Knight et al., 2004; Bachmann DKK1 may take its own pathway and/or the non-canonical et al., 2005; Dunn et al., 2005). Further, DKK1 enhances the Wnt signaling pathway to inhibit GSK3b. Taken together, the expression of acid fibroblast growth factor-like protein, which decreased activities of b-catenin and GSK3b via phosphor- may function similar to fibroblast growth factor in terms of ylation at Ser9 and the upregulated expression of PKCa may regulating HOX genes (Liu et al., 2001; Dasen et al., 2003) account for the decreased expression levels of MITF in and melanocyte growth (Halaban et al., 1988; Dotto et al., melanocytes responding to DKK1, and thus their decreased 1989; Hirobe, 1992; Berking et al., 2001). growth and differentiation. To further elucidate the mechanism(s) by which DKK1 In conclusion, DKK1, a secretory protein expressed at decreases melanocyte function (Yamaguchi et al., 2004), key relatively high levels by fibroblasts in palmoplantar skin, has proteins in Wnt signaling pathways were investigated. We various effects on melanocytes. Microarray analyses revealed focused on those genes, as DKK1 is an inhibitor of the a large number of upregulated or downregulated genes in canonical Wnt signaling pathway (Kawano and Kypta, 2003), melanocytes that respond quickly to treatment with DKK1. which is actively involved in regulating MITF function DKK1-responsive genes include those encoding receptors (Shibahara et al., 2000; Yasumoto et al., 2002). MITF is (such as LDLR, GPR51, and TNFSF10A), for apoptosis (such considered the master regulator of melanocyte function, and as Gadd45b), for melanosome trafficking and transport (such regulates not only melanocyte proliferation but also their as HPS4, SV2B, STX5A, and MLPH), and for Wnt and HOX production of melanin (McGill et al., 2002; Kim et al., 2003). signaling. The decreased expression levels of MITF in We previously reported that DKK1 suppresses the expression melanocytes treated with DKK1 may result from the of b-catenin and MITF (Yamaguchi et al., 2004), and we now decreased activity of b-catenin and of GSK3b via phosphor- show that the overall expression of GSK3b decreases in ylation at Ser9 and from the upregulated expression of PKCa. response to DKK1, whereas the overall expression of GSK3b The sum of those activities results in the decreased density of phosphorylated at Ser9 increases. GSK3b is a unique protein melanocytes in palmoplantar skin and the hypopigmentation in that it is inactivated by phosphorylation (Cohen and Frame, of that tissue. Future investigation will attempt to further 2001). The finding that DKK1 inhibits b-catenin and GSK3b clarify the mechanisms by which palmoplantar epidermis is expression might be sufficient to explain the inhibitory effects paler than non-palmoplantar epidermis through DKK1 and/or of DKK1 on MITF expression, as b-catenin and GSK3b other factors. enhance MITF activity at the promoter level (through the activation of lymphoid-enhancing factor/T-cell factor (Arias MATERIALS AND METHODS et al., 1999)) and at the post-transcriptional level (by the Melanocyte culture phosphorylation at Ser298 (Takeda et al., 2000a)). However, Neonatal human foreskin melanocytes were obtained from Cascade multiple protein complexes, which not only contain Axin, Biologics Inc. (Portland, OR). Melanocyte cultures were grown in adenomatous polyposis coli, and Akt, but also GSK3b (http:// melanocyte growth medium consisting of Medium 154 (Cascade www.stanford.edu/^rnusse), suppress the expression of b-cate- Biologics Inc.) and HMGS (Cascade Biologics Inc.). Melanocytes nin by inhibiting its accumulation through the canonical Wnt from the third to fifth passage were used in these experiments. signaling pathway (Cohen and Frame, 2001; Zorn, 2001; Kawano and Kypta, 2003). As GSK3b is inactivated via Microarray procedures several signaling pathways (Ding et al., 2000; Cohen and Modified oligo-cDNA microarray analysis was performed as Frame, 2001) and as Wnt-5a inhibits the canonical Wnt previously described with slight modifications (Yamaguchi et al., pathway by promoting the GSK3b-independent degradation 2004). Briefly, total RNA was prepared from cultured human of b-catenin (Topol et al., 2003), we hypothesize that the melanocytes treated with or without 50 ng/ml recombinant human canonical Wnt signaling pathway does not require the DKK1 (R&D Systems Inc., Minneapolis, MN) for 2 hours, using an phosphorylation of GSK3b at Ser9, but that the non-canonical RNeasy mini kit (Qiagen, Valencia, CA). The quality (purity and Wnt signaling pathway does involve that phosphorylated integrity) of extracted total RNA was confirmed using an Agilent form of GSK3b. 2100 Bioanalyzer with an RNA 6000 Nano Assay (Agilent Interestingly, we found an increase in b-catenin mRNA Technology, Palo Alto, CA). Paired cDNA samples, labeled by expression only after 2 hours of DKK1 treatment, but a cyanine 3- and cyanine 5-deoxyuridine triphosphate incorporation decrease in b-catenin protein, which was followed by the (Qiagen) during RT (Qiagen), were hybridized simultaneously with decreased expression of b-catenin mRNA after 5 days of one oligo-DNA chip (Hs-Operon V2-vB2.2p13) as per National DKK1 treatment (data not shown). The rapid decrease in Cancer Institute in-house protocol (available at http://mach1.nci. expression of b-catenin protein after 2 hours of DKK1 nih.gov/). Two fluorescent intensities of the oligo-DNA chip treatment (Yamaguchi et al., 2004) might have transiently were scanned using a microarray scanner (GenePix 4000A; enhanced the mRNA expression level of b-catenin, although Axon Instruments Inc., Molecular Devices Corp., Sunnyvale, CA).

1222 Journal of Investigative Dermatology (2007), Volume 127 Y Yamaguchi et al. Effects of DKK1 on Melanocyte Function and Proliferation

Differential gene expression was profiled with Genepix 3.0 software immunofluorescence to detect the expression of signal transduction and was analyzed by National Cancer Institute Center for Informa- proteins using primary antibodies to GSK3b (1:50, Cell Signaling tion Technology programs and databases. Experiments were Technology), phospho-GSK3b, which is specific for GSK3b phos- performed in triplicate independently. phorylated at Ser9 (at 1:100, Cell Signaling Technology), b-catenin (at 1:50, Cell Signaling Technology), and PKCa (at 1:1,000, Sigma). RT-PCR Bound antibodies were visualized with appropriate secondary To confirm the accuracy of oligo-cDNA microarrays, RT-PCR was antibodies, Alexa Fluors 488 goat anti-rabbit IgG (H þ L) (Molecular performed. Oligonucleotide primers used for PCR were based on Probes Inc., Eugene, OR) at 371C for 30 minutes at 1:500 dilution published mRNA sequences as follows: human PKCb1 sense primer with 5% goat serum. 40,6-diamidino-2-phenylindole (Vector Labora- 50-agtgccaagtttgctgcttt-30; PKCb1 antisense primer 50-acaatgag tories Inc., Burlingame, CA) was used as a counter stain. The gacgtccctgtc-30; human Krn1 sense primer 50- caagtttgctgggatggagt fluorescence of green produced by Alexa 488s and of blue by 40,6- -30; Krn1 antisense primer 50-tgtcaaatagggggaagctg-30; human LRP6 diamidino-2-phenylindole was observed and captured using a Leica sense primer 50-gctcagagtcccagttccag-30; LRP6 antisense primer DMR B/D MLD fluorescence microscope (Leica, Wetzlar, Germany) 50-tcccttcatacgtggacaca-30; human LDLR sense primer 50-aagtg and a Dage-MTI 3CCD 3-chip color video camera (Dage-MTI, catctctcggcagtt-30; LDLR antisense primer 50-tgcagtttccatcagagcac- Michigan City, IN). We also observed the fluorescence using 30; human GPR51 sense primer 50-gctgctgatcgacctgtgta-30; GPR51 confocal laser scanning microscopy as described previously (Hoashi antisense primer 50-gatggtgctgcagaagatga-30; human TNFRSF10A et al., 2005). sense primer 50-agagagaagtccctgcacca-30; TNFSF10A antisense primer 50-ttgtgagcattgtcctcagc-30; human Gadd45b sense primer 50- 3-Dimensional skin reconstructs acagtgggggtgtacgagtc-30; Gadd45b antisense primer 50-gagatgtaggg The epidermal equivalent MelanoDerms was obtained from MatTek gacccactg-30; MITF sense primer 50-agagagcgagtgcccaggcatgaac-30; Corp. (Ashland, MA). Normal human keratinocytes and melanocytes MITF antisense primer 50-tctttggccagtgctcttgcttcag-30; glyceralde used in those reconstructs were obtained from Asian neonatal hyde-3-phosphate dehydrogenase sense primer 50-accacagtccatgc foreskin tissues. MelanoDerms were grown at the air/liquid interface catcac-30; glyceraldehyde-3-phosphate dehydrogenase antisense of the maintenance medium MEL-NHM-113 (MatTek Corp.), and the primer 50-tccaccaccctgttgctgta-30. After denaturation at 941C for culture medium was renewed every 2 days. Where noted, the 2 minutes, PCR was performed for 30 cycles (30 seconds at 941C, epidermis samples were supplemented with 100 ng/ml rhDKK1 1 minute at 561C, and 1 minute at 721C). All amplified products were every 2 days for 4–14 days (only results for 10 days are shown). sequence verified (Yamaguchi et al., 2004). Control reactions were DKK1 was dissolved in phosphate-buffered saline with 0.1% bovine performed in the absence of RT and were negative. Each experiment serum albumin and the same concentrations of phosphate-buffered was repeated in triplicate independently. saline and bovine serum albumin were employed for mock-treated controls. Immunoblotting s Cultures from 100 mm dishes were solubilized in 500 ml M-PER Immunohistochemistry mammalian protein extraction reagent (Pierce Biotechnology, Rock- Skin specimens obtained from matched palmoplantar areas (i.e. ford, IL) or extraction buffer containing 1% Nonidet P 40 palms, n ¼ 1 and soles, n ¼ 4) and from non-palmoplantar areas (Calbiochem, San Diego, CA), 0.01% SDS, 0.1 M Tris:HCl, pH 7.2, (trunk, n ¼ 5) taken from five adult Asian subjects (ages ranged from and Protease Inhibitor cocktail (Roche, Mannheim, Germany). 31 to 47) during cutaneous surgery. Participants gave their written Protein concentrations of extracts were measured using the BCA informed consent and the study was conducted according to protein assay kit (Pierce, Rockford, IL). Cell extracts (1 mg) were Declaration of Helsinki Principles. We received approval by Osaka separated on 8–16% gradient SDS polyacrylamide gels (Invitrogen University for all experiments. The expression of proteins related to Corp., Carlsbad, CA). After electrophoresis, proteins were transferred signal transduction was detected by indirect immunofluorescence electrophoretically from the gels to Immobilon-P transfer membranes using the primary rabbit polyclonal antibodies described above. (Millipore, Bedford, MA). The filters were incubated in the presence Mouse mAb named Ab-3 (1:100 dilution, NeoMarkers, Fremont, of antibodies to GSK3b (at 1:1,000, Cell Signaling Technology, CA), which is specific for MART1, was additionally used as a primary Beverly, MA), pGSK3b (at 1:1,000, Cell Signaling Technology), antibody. Secondary antibodies used were Alexa Fluors 594 goat PKCa (at 1:10,000, Sigma, St Louis, MO), b-catenin (at 1:1,000, Cell anti-mouse IgG (H þ L) and Alexa Fluors 488 goat anti-rabbit IgG Signaling Technology), extracellular signal-regulated kinase 1/2 (H þ L) (Molecular Probes Inc.). The green fluorescence produced by (p44/42 MAP Kinase antibody) (at 1:1,000, Cell Signaling Techno- Alexa 488s was superimposed over the red fluorescence produced logy), or b-actin (at 1:3,000, AC-15, Abcam, Cambridge, MA) at by Alexa 594s to show colocalization. room temperature for 1 hour and were then incubated with horse- radish peroxidase-linked anti-rabbit or anti-mouse whole antibodies CONFLICT OF INTEREST (at 1:1,000, Amersham Bioscience, Pittsburgh, PA) at room The authors declare no conflict of interest. temperature for 1 hour. Antigens were detected using an ECL-plus Western Blotting Detection System (Amersham). ACKNOWLEDGMENTS This research was supported in part by the Intramural Research Program of the Immunocytochemical staining NIH, National Cancer Institute, by The Osaka Medical Research Foundation for Incurable Diseases, by Lydia O’leary Memorial Foundation, by SHISEIDO Melanocyte cultures in two well Lab-Tek chamber slides (Nalge Grant for Science Research, and by a grant-in-aid from the Ministry of Nunc International Corp., Naperville, IL) were processed for indirect Education, Culture, Sports, Science, and Technology.

www.jidonline.org 1223 Y Yamaguchi et al. Effects of DKK1 on Melanocyte Function and Proliferation

SUPPLEMENTARY MATERIAL Halaban R, Langdon R, Birchall N, Cuono C, Baird A, Scott GA (1988) Basic fibroblast growth factor from human keratinocytes is a natural mitogen Table S1. Top 30 genes upregulated in melanocytes by DKK1. for melanocytes. J Cell Biol 107:1611–9 Table S2. Receptor-related genes upregulated in melanocytes by DKK1. Hirobe T (1992) Basic fibroblast growth factor stimulates the sustained Table S3. Wnt-related genes upregulated in melanocytes by DKK1. proliferation of mouse epidermal melanoblasts in a serum-free medium Table S4. Melanogenic markers upregulated in melanocytes by DKK1. in the presence of dibutyryl cyclic AMP and keratinocytes. Development 114:435–45 Table S5. HOX-related genes upregulated in melanocytes by DKK1. Hoashi T, Watabe H, Muller J, Yamaguchi Y, Vieira WD, Hearing VJ (2005) MART-1 is required for the function of the melanosomal matrix protein REFERENCES Pmel17/gp100 and the maturation of melanosomes. J Biol Chem Andl T, Reddy S, Gaddapara T, Millar SE (2002) WNT signals are required for 280:14006–16 the initiation of hair follicle development. Dev Cell 2:643–53 Kawano Y, Kypta R (2003) Secreted antagonists of the Wnt signalling Arias AM, Brown AM, Brennan K (1999) Wnt signalling: pathway or network? pathway. J Cell Sci 116:2627–34 Curr Opin Genet Dev 9:447–54 Kim D-S, Hwang E-S, Lee J-E, Kim S-Y, Kwon S-B (2003) Sphingosine-1- Bachmann JM, Straume O, Puntervoll HE, Kalvenes MB, Akslen LA (2005) phosphate decreases melanin synthesis via sustained ERK activation and Importance of P-cadherin, b-catenin and Wnt5a/frizzled for progression subsequent MITF degradation. J Cell Sci 116:1699–706 of melanocytic tumors and prognosis in cutaneous melanoma. Clin Knight RD, Javidan Y, Nelson S, Zhang T, Schilling T (2004) Skeletal Cancer Res 11:8606–14 and pigment cell defects in the lockjaw mutant reveal multiple roles Berking C, Takemoto R, Satyamoorthy K, Elenitsas R, Herlyn M (2001) Basic for zebrafish tfap2a in neural crest development. Dev Dynam 229: fibroblast growth factor and ultraviolet B transform melanocytes in 87–98 human skin. Am J Pathol 158:943–53 Li SP, Park MS, Yoon H, Rhee KH, Bahk JY, Lee JH et al. (2003) Differential Chang HY, Chi JT, Dudoit S, Bondre C, van de Rijn M, Botstein D et al. (2002) distribution of GABA(B1) and GABA(B2) receptor mRNAS in the rath Diversity, topographic differentiation, and positional memory in human brain. Mol Cell 16:40–7 fibroblasts. Proc Natl Acad Sci USA 99:12877–82 Liu JP, Laufer E, Jessell TM (2001) Assigning the positional identity of spinal Chen RH, Ding VW, McCormick FRH (2000) Wnt signaling to motor neurons: rostrocaudal patterning of Hox-c expression by FGFs, b-catenin involves two interactive components. Glycogen synthase Gdf11, and retinoids. Neuron 32:997–1012 kinase-3b inhibition and activation of protein kinase C. J Biol Chem Mao B, Wu W, Davidson G, Marhold J, Li M, Mechler BM et al. (2002) 275:17894–9 Kremen proteins are Dickkopf receptors that regulate Wnt/beta-catenin Cohen P, Frame S (2001) The renaissance of GSK3. Nat Rev Mol Cell Biol signalling. Nature 417:664–7 2:769–76 Mao B, Wu W, Li Y, Hoppe D, Stannek P, Glinka A et al. (2001) LDL- Costin GE, Valencia JC, Vieira WD, Lamoreux ML, Hearing VJ (2003) receptor-related protein 6 is a receptor for Dickkopf protein. Nature Tyrosinase processing and intracellular trafficking is disrupted in mouse 411:321–5 primary melanocytes carrying the uw mutation: a model for oculocu- McGill GG, Horstmann MA, Widlund HR, Du J, Motyckova G, Nishimura E taneous albinism (OCA) type 4. J Cell Sci 116:3203–12 et al. (2002) Bcl2 regulation by the melanocyte master regulator Mitf Dasen JS, Liu JP, Jessell TM (2003) Motor neuron columnar fate imposed by modulates lineage survival and melanoma cell viability. Cell 109:707–18 sequential phases of Hox-c activity. Nature 425:926–33 Monaghan AP, Kioschis P, Wu W, Zuniga A, Bock D, Poustka A et al. (1999) Dell’Anna ML, Maresca V, Briganti S, Camera E, Falchi M, Picardo M (2001) Dickkopf genes are co-ordinately expressed in mesodermal lineages. Mitochondrial impairment in peripheral blood mononuclear cells during Mech Dev 87:45–56 the active phase of vitiligo. J Invest Dermatol 117:908–13 Nusse R (2001) Developmental biology. Making head or tail of Dickkopf. Ding VW, Chen RH, McCormick F (2000) Differential regulation of glycogen Nature 411:255–6 synthase kinase 3 beta by insulin and Wnt signalling. J Biol Chem Rouzaud F, Costin GE, Yamaguchi Y, Valencia JC, Berens WF, Chen KG et al. 275:32475–81 (2006) Regulation of constitutive and UVR-induced skin pigmentation by Dolle P, Izpisua-Belmonte JC, Falkenstein H, Renuxxi A, Duboule DC melanocortin 1 receptor isoforms. FASEB J 20:1927–9 (1989) Coordinate expression of the murine Hox-5 complex Sarkar D, Su ZZ, Lebedeva IV, Sauane M, Gopalkrishnan RV, Valerie K et al. homeobox-containing genes during limb pattern formation. Nature 342: (2002) mda-7 (IL-24) Mediates selective apoptosis in human melanoma 767–72 cells by inducing the coordinated overexpression of the GADD family of Dotto GP, Moellmann GE, Ghosh S, Edwards M, Halaban R (1989) genes by means of p38 MAPK. Proc Natl Acad Sci USA 99:10054–9 Transformation of murine melanocytes by basic fibroblast growth factor Schubert M, Holland ND, Escriva H, Holland LZ, Laudet V (2004) Retinoic cDNA and oncogenes and selective suppression of the transformed acid influences anteroposterior positioning of epidermal sensory neurons phenotype in a reconstituted cutaneous environment. J Cell Biol and their gene expression in a developing chordate (amphioxus). Proc 109:3115–28 Natl Acad Sci USA 101:10320–5 Dunn KJ, Brady M, Ochsenbauer-Jambor C, Snyder S, Incao A, Pavan WJ Shibahara S, Yasumoto K, Amae S, Udono T, Watanabe K, Saito H et al. (2005) WNT1 and WNT3a promote expansion of melanocytes through (2000) Regulation of pigment cell specific gene expression by MITF. distinct modes of action. Pigm Cell Res 18:167–80 Pigm Cell Res 13:98–102 Fang X, Yu S, Tanyi JL, Lu Y, Woodgett JR, Mills GB (2002) Convergence of Takeda K, Takemoto C, Kobayashi I, Watanabe A, Nobukuni Y, Fisher DE multiple signaling cascades at glycogen synthase kinase 3: Edg receptor- et al. (2000a) Ser298 of MITF, a mutation site in Waardenburg syndrome mediated phosphorylation and inactivation by lysophosphatidic acid type 2, is a phosphorylation site with functional significance. Hum Mol through a protein kinase C-dependent intracellular pathway. Mol Cell Genet 9:125–32 Biol 22:2099–100 Takeda K, Yasumoto K, Takada R, Takada S, Watanabe K, Udono T et al. Glinka A, Wu W, Delius H, Monaghan AP, Blumenstock C, Niehrs C (1998) (2000b) Induction of melanocyte-specific microphthalmia-associated Dickkopf-1 is a member of a new family of secreted proteins and transcription factor by Wnt-3a. J Biol Chem 275:14013–6 functions in head induction. Nature 391:357–62 Tanaka Y, Gavrielides MV, Mitsuuchi Y, Fujii T, Kazanietz MG (2003) Protein Grimes PE (2005) New insights and new therapies in vitiligo. J Am Med Assoc kinase C promotes apoptosis in LNCaP prostate cancer cells through 293:730–5 activation of p38 MAPK and inhibition of the Akt survival pathway. J Biol Grotewald L, Ruther U (2002) The Wnt antagonist Dickkopf-1 is regulated by Chem 278:33753–62 Bmp signaling and c-Jun and modulates programmed cell death. EMBO J Tian E, Zhan F, Walker R, Rasmussen E, Ma Y, Barlogie B et al. (2003) 21:966–75 The role of the Wnt-signaling antagonist DKK1 in the development

1224 Journal of Investigative Dermatology (2007), Volume 127 Y Yamaguchi et al. Effects of DKK1 on Melanocyte Function and Proliferation

of osteolytic lesions in multiple myoloma. N Engl J Med 349: palmoplantar fibroblasts through epithelial-mesenchymal interactions. 2483–94 J Invest Dermatol 112:483–8 Topol L, Jiang X, Choi H, Garrett-Beal L, Carolan PJ, Yang Y (2003) Wnt-5a Yamaguchi Y, Itami S, Watabe H, Yasumoto K, Abdel-Malek ZA, Kubo T et al. inhibits the canonical Wnt pathway by promoting GSK-3-independent (2004) Mesenchymal-epithelial interactions in the skin: increased b-catenin degradation. J Cell Biol 162:899–908 expression of dickkopf1 by palmoplantar fibroblasts inhibits melanocyte Valencia JC, Watabe H, Chi A, Rouzaud F, Chen KG, Vieira WD et al. (2006) growth and differentiation. J Cell Biol 165:275–85 Sorting of Pmel17 to melanosomes through the plasma membrane by Yamaguchi Y, Kubo T, Tarutani M, Sano S, Asada H, Kakibuchi M et al. AP1 and AP2; evidence for the polarized nature of melanocytes. J Cell (2001a) Epithelial-mesenchymal interactions in wounds: treatment of Sci 119:1080–91 palmoplantar wounds by nonpalmoplantar pure epidermal sheet grafts. Xu SQ, El-Deiry WS (2000) p21(WAF1/CIP1) inhibits initiator caspase Arch Dermatol 137:621–8 cleavage by TRAIL death receptor DR4. Biochem Biophys Res Commun Yamaguchi Y, Yoshikawa K (2001b) Cutaneous wound healing; an update. 269:179–90 J Dermatol 28:521–34 Yamaguchi Y, Hearing VJ, Itami S, Yoshikawa K, Katayama I (2005) Yasumoto K, Takeda K, Saito H, Watanabe K, Takahashi K, Shibahara S Mesenchymal-epithelial interactions in the skin: aiming for site-specific (2002) Microphthalmia-associated transcription factor interacts with tissue regeneration. J Dermatol Sci 40:1–9 LEF-1, a mediator of Wnt signaling. EMBO J 21:2703–14 Yamaguchi Y, Itami S, Tarutani M, Hosokawa K, Miura H, Yoshikawa K Zorn AM (2001) Wnt signalling: antagonistic Dickkopfs. Curr Biol 11: (1999) Regulation of keratin 9 in nonpalmoplantar keratinocytes by R592–5

www.jidonline.org 1225