Originally Published As
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Succession and Persistence of Microbial Communities and Antimicrobial Resistance Genes Associated with International Space StatiSingh et al. Microbiome (2018) 6:204 https://doi.org/10.1186/s40168-018-0585-2 RESEARCH Open Access Succession and persistence of microbial communities and antimicrobial resistance genes associated with International Space Station environmental surfaces Nitin Kumar Singh1, Jason M. Wood1, Fathi Karouia2,3 and Kasthuri Venkateswaran1* Abstract Background: The International Space Station (ISS) is an ideal test bed for studying the effects of microbial persistence and succession on a closed system during long space flight. Culture-based analyses, targeted gene-based amplicon sequencing (bacteriome, mycobiome, and resistome), and shotgun metagenomics approaches have previously been performed on ISS environmental sample sets using whole genome amplification (WGA). However, this is the first study reporting on the metagenomes sampled from ISS environmental surfaces without the use of WGA. Metagenome sequences generated from eight defined ISS environmental locations in three consecutive flights were analyzed to assess the succession and persistence of microbial communities, their antimicrobial resistance (AMR) profiles, and virulence properties. Metagenomic sequences were produced from the samples treated with propidium monoazide (PMA) to measure intact microorganisms. Results: The intact microbial communities detected in Flight 1 and Flight 2 samples were significantly more similar to each other than to Flight 3 samples. Among 318 microbial species detected, 46 species constituting 18 genera were common in all flight samples. Risk group or biosafety level 2 microorganisms that persisted among all three flights were Acinetobacter baumannii, Haemophilus influenzae, Klebsiella pneumoniae, Salmonella enterica, Shigella sonnei, Staphylococcus aureus, Yersinia frederiksenii,andAspergillus lentulus.EventhoughRhodotorula and Pantoea dominated the ISS microbiome, Pantoea exhibited succession and persistence. K. pneumoniae persisted in one location (US Node 1) of all three flights and might have spread to six out of the eight locations sampled on Flight 3.
- 
												  1 Supplementary Information Ugly Ducklings – the Dark Side of PlasticSupplementary Information Ugly ducklings – The dark side of plastic materials in contact with potable water Lisa Neu1,2, Carola Bänziger1, Caitlin R. Proctor1,2, Ya Zhang3, Wen-Tso Liu3, Frederik Hammes1,* 1 Eawag, Swiss Federal Institute of Aquatic Science and Technology, Dübendorf, Switzerland 2 Department of Environmental Systems Science, Institute of Biogeochemistry and Pollutant Dynamics, ETH Zürich, Zürich, Switzerland 3 Department of Civil and Environmental Engineering, University of Illinois at Urbana-Champaign, USA Table of contents Table S1 Exemplary online blog entries on biofouling in bath toys Figure S1 Images of all examined bath toys Figure S2 Additional images of bath toy biofilms by OCT Figure S3 Additional images on biofilm composition by SEM Figure S4 Number of bacteria and proportion of intact cells in bath toy biofilms Table S2 Classification of shared OTUs between bath toys Table S3 Shared and ‘core’ communities in bath toys from single households Table S4 Richness and diversity Figure S5 Classification of abundant OTUs in real bath toy biofilms Table S5 Comparison of most abundant OTUs in control bath toy biofilms Figure S6 Fungal community composition in bath toy biofilms Table S6 Conventional plating results for indicator bacteria and groups Table S7 Bioavailability of migrating carbon from control bath toys’ material Water chemistry Method and results (Table S8) Table S9 Settings for Amplification PCR and Index PCR reactions 1 Table S1: Exemplary online blog entries on biofouling inside bath toys Issue - What is the slime? Link Rub-a-dub-dub, https://www.babble.com/baby/whats-in-the-tub/ what’s in the tub? What’s the black stuff http://blogs.babycenter.com/momstories/whats-the-black- in your squeeze toys? stuff-in-your-squeeze-toys/ Friday Find: NBC’s http://www.bebravekeepgoing.com/2010/03/friday-find-nbcs- Today Show segment: today-show-segment-do.html Do bath toys carry germs? Yuck.
- 
												  Supplementary Information for Microbial Electrochemical Systems Outperform Fixed-Bed Biofilters for Cleaning-Up Urban WastewaterElectronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is © The Royal Society of Chemistry 2016 Supplementary information for Microbial Electrochemical Systems outperform fixed-bed biofilters for cleaning-up urban wastewater AUTHORS: Arantxa Aguirre-Sierraa, Tristano Bacchetti De Gregorisb, Antonio Berná, Juan José Salasc, Carlos Aragónc, Abraham Esteve-Núñezab* Fig.1S Total nitrogen (A), ammonia (B) and nitrate (C) influent and effluent average values of the coke and the gravel biofilters. Error bars represent 95% confidence interval. Fig. 2S Influent and effluent COD (A) and BOD5 (B) average values of the hybrid biofilter and the hybrid polarized biofilter. Error bars represent 95% confidence interval. Fig. 3S Redox potential measured in the coke and the gravel biofilters Fig. 4S Rarefaction curves calculated for each sample based on the OTU computations. Fig. 5S Correspondence analysis biplot of classes’ distribution from pyrosequencing analysis. Fig. 6S. Relative abundance of classes of the category ‘other’ at class level. Table 1S Influent pre-treated wastewater and effluents characteristics. Averages ± SD HRT (d) 4.0 3.4 1.7 0.8 0.5 Influent COD (mg L-1) 246 ± 114 330 ± 107 457 ± 92 318 ± 143 393 ± 101 -1 BOD5 (mg L ) 136 ± 86 235 ± 36 268 ± 81 176 ± 127 213 ± 112 TN (mg L-1) 45.0 ± 17.4 60.6 ± 7.5 57.7 ± 3.9 43.7 ± 16.5 54.8 ± 10.1 -1 NH4-N (mg L ) 32.7 ± 18.7 51.6 ± 6.5 49.0 ± 2.3 36.6 ± 15.9 47.0 ± 8.8 -1 NO3-N (mg L ) 2.3 ± 3.6 1.0 ± 1.6 0.8 ± 0.6 1.5 ± 2.0 0.9 ± 0.6 TP (mg
- 
												  Characterization of Environmental and Cultivable Antibiotic- Resistant Microbial Communities Associated with Wastewater Treatmentantibiotics Article Characterization of Environmental and Cultivable Antibiotic- Resistant Microbial Communities Associated with Wastewater Treatment Alicia Sorgen 1, James Johnson 2, Kevin Lambirth 2, Sandra M. Clinton 3 , Molly Redmond 1 , Anthony Fodor 2 and Cynthia Gibas 2,* 1 Department of Biological Sciences, University of North Carolina at Charlotte, Charlotte, NC 28223, USA; [email protected] (A.S.); [email protected] (M.R.) 2 Department of Bioinformatics and Genomics, University of North Carolina at Charlotte, Charlotte, NC 28223, USA; [email protected] (J.J.); [email protected] (K.L.); [email protected] (A.F.) 3 Department of Geography & Earth Sciences, University of North Carolina at Charlotte, Charlotte, NC 28223, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-704-687-8378 Abstract: Bacterial resistance to antibiotics is a growing global concern, threatening human and environmental health, particularly among urban populations. Wastewater treatment plants (WWTPs) are thought to be “hotspots” for antibiotic resistance dissemination. The conditions of WWTPs, in conjunction with the persistence of commonly used antibiotics, may favor the selection and transfer of resistance genes among bacterial populations. WWTPs provide an important ecological niche to examine the spread of antibiotic resistance. We used heterotrophic plate count methods to identify Citation: Sorgen, A.; Johnson, J.; phenotypically resistant cultivable portions of these bacterial communities and characterized the Lambirth, K.; Clinton,
- 
												  The Gut Microbiome of the Sea Urchin, Lytechinus Variegatus, from Its Natural Habitat Demonstrates Selective Attributes of MicroFEMS Microbiology Ecology, 92, 2016, fiw146 doi: 10.1093/femsec/fiw146 Advance Access Publication Date: 1 July 2016 Research Article RESEARCH ARTICLE The gut microbiome of the sea urchin, Lytechinus variegatus, from its natural habitat demonstrates selective attributes of microbial taxa and predictive metabolic profiles Joseph A. Hakim1,†, Hyunmin Koo1,†, Ranjit Kumar2, Elliot J. Lefkowitz2,3, Casey D. Morrow4, Mickie L. Powell1, Stephen A. Watts1,∗ and Asim K. Bej1,∗ 1Department of Biology, University of Alabama at Birmingham, 1300 University Blvd, Birmingham, AL 35294, USA, 2Center for Clinical and Translational Sciences, University of Alabama at Birmingham, Birmingham, AL 35294, USA, 3Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294, USA and 4Department of Cell, Developmental and Integrative Biology, University of Alabama at Birmingham, 1918 University Blvd., Birmingham, AL 35294, USA ∗Corresponding authors: Department of Biology, University of Alabama at Birmingham, 1300 University Blvd, CH464, Birmingham, AL 35294-1170, USA. Tel: +1-(205)-934-8308; Fax: +1-(205)-975-6097; E-mail: [email protected]; [email protected] †These authors contributed equally to this work. One sentence summary: This study describes the distribution of microbiota, and their predicted functional attributes, in the gut ecosystem of sea urchin, Lytechinus variegatus, from its natural habitat of Gulf of Mexico. Editor: Julian Marchesi ABSTRACT In this paper, we describe the microbial composition and their predictive metabolic profile in the sea urchin Lytechinus variegatus gut ecosystem along with samples from its habitat by using NextGen amplicon sequencing and downstream bioinformatics analyses. The microbial communities of the gut tissue revealed a near-exclusive abundance of Campylobacteraceae, whereas the pharynx tissue consisted of Tenericutes, followed by Gamma-, Alpha- and Epsilonproteobacteria at approximately equal capacities.
- 
												  Brevundimonas Diminuta BacteremiaS Pediatric Research and Child Health O p s e s n Acce CASE REPORT Brevundimonas Diminuta Bacteremia: A rare case report in a Male Middle Aged Childhood Sandeep Mude1*, Ramakanth1, Uday S Patil2, Sanjay Kulkarni3 1Residents, Masai childrens Hospital, Kolhapur, Maharastra, India 2MD, D.C.H (Professor and Dean) Department of Pediatrics, Masai Childrens Hospital, Kolhapur, India. 3MD, Department of Microbiology, Ambika Pathology Lab, NABL accredited (NBR-MC3332), Kolhapur, India. Abstract Brevundimonas diminuta has rarely been isolated from clinical specimens. We report here a case of B. diminuta bacteremia in a male middle aged childhood who presented with fever, jaundice and abdomen distention. USG abdomen showed moderate hepatomegaly, partially distended gall bladder, mild splenomegaly very minimal ascites with bilateral mild basal pleural effusion. Blood culture was processed by BACT/ALERT 3D 60 (BioMériux). Isolate was identified as B. diminuta. Identification and sensitivity was done by VITEK® 2 COMPACT (BioMériux). We have come across only one report of middle aged childhood sepsis caused by B. diminuta from India [1]. To the best of our knowledge, this is the first case report of B. vesicularis bacteremia in a male middle aged childhood. Keywords: Bacteremia, B. diminuta, immunocompetent middle aged childhood Introduction fever of 15 days. Jaundice and abdomen distension for 9 days. History of clay coloured stools for 2-3 days, decreased Brevundimonas diminuta, formerly grouped with oral intake since 4 day and altered sensorium since 2 days. Pseudomonas, and has been reclassified as under the genus of There is no history of seizures. On examination, the child was Proteobacteria, is an aerobic nonsporing and nonfermenting, drowsy and irritable, afebrile, with pulse rate of 113/min and slowly growing gram‑negative bacillus.
- 
												  The Microbiota Continuum Along the Female Reproductive Tract and Its Relation to Uterine-Related DiseasesARTICLE DOI: 10.1038/s41467-017-00901-0 OPEN The microbiota continuum along the female reproductive tract and its relation to uterine-related diseases Chen Chen1,2, Xiaolei Song1,3, Weixia Wei4,5, Huanzi Zhong 1,2,6, Juanjuan Dai4,5, Zhou Lan1, Fei Li1,2,3, Xinlei Yu1,2, Qiang Feng1,7, Zirong Wang1, Hailiang Xie1, Xiaomin Chen1, Chunwei Zeng1, Bo Wen1,2, Liping Zeng4,5, Hui Du4,5, Huiru Tang4,5, Changlu Xu1,8, Yan Xia1,3, Huihua Xia1,2,9, Huanming Yang1,10, Jian Wang1,10, Jun Wang1,11, Lise Madsen 1,6,12, Susanne Brix 13, Karsten Kristiansen1,6, Xun Xu1,2, Junhua Li 1,2,9,14, Ruifang Wu4,5 & Huijue Jia 1,2,9,11 Reports on bacteria detected in maternal fluids during pregnancy are typically associated with adverse consequences, and whether the female reproductive tract harbours distinct microbial communities beyond the vagina has been a matter of debate. Here we systematically sample the microbiota within the female reproductive tract in 110 women of reproductive age, and examine the nature of colonisation by 16S rRNA gene amplicon sequencing and cultivation. We find distinct microbial communities in cervical canal, uterus, fallopian tubes and perito- neal fluid, differing from that of the vagina. The results reflect a microbiota continuum along the female reproductive tract, indicative of a non-sterile environment. We also identify microbial taxa and potential functions that correlate with the menstrual cycle or are over- represented in subjects with adenomyosis or infertility due to endometriosis. The study provides insight into the nature of the vagino-uterine microbiome, and suggests that sur- veying the vaginal or cervical microbiota might be useful for detection of common diseases in the upper reproductive tract.
- 
												  Research CollectionResearch Collection Doctoral Thesis Development and application of molecular tools to investigate microbial alkaline phosphatase genes in soil Author(s): Ragot, Sabine A. Publication Date: 2016 Permanent Link: https://doi.org/10.3929/ethz-a-010630685 Rights / License: In Copyright - Non-Commercial Use Permitted This page was generated automatically upon download from the ETH Zurich Research Collection. For more information please consult the Terms of use. ETH Library DISS. ETH NO.23284 DEVELOPMENT AND APPLICATION OF MOLECULAR TOOLS TO INVESTIGATE MICROBIAL ALKALINE PHOSPHATASE GENES IN SOIL A thesis submitted to attain the degree of DOCTOR OF SCIENCES of ETH ZURICH (Dr. sc. ETH Zurich) presented by SABINE ANNE RAGOT Master of Science UZH in Biology born on 25.02.1987 citizen of Fribourg, FR accepted on the recommendation of Prof. Dr. Emmanuel Frossard, examiner PD Dr. Else Katrin Bünemann-König, co-examiner Prof. Dr. Michael Kertesz, co-examiner Dr. Claude Plassard, co-examiner 2016 Sabine Anne Ragot: Development and application of molecular tools to investigate microbial alkaline phosphatase genes in soil, c 2016 ⃝ ABSTRACT Phosphatase enzymes play an important role in soil phosphorus cycling by hydrolyzing organic phosphorus to orthophosphate, which can be taken up by plants and microorgan- isms. PhoD and PhoX alkaline phosphatases and AcpA acid phosphatase are produced by microorganisms in response to phosphorus limitation in the environment. In this thesis, the current knowledge of the prevalence of phoD and phoX in the environment and of their taxonomic distribution was assessed, and new molecular tools were developed to target the phoD and phoX alkaline phosphatase genes in soil microorganisms.
- 
												  Plant-Derived Benzoxazinoids Act As Antibiotics and Shape Bacterial CommunitiesSupplemental Material for: Plant-derived benzoxazinoids act as antibiotics and shape bacterial communities Niklas Schandry, Katharina Jandrasits, Ruben Garrido-Oter, Claude Becker Contents Supplemental Tables 2 Supplemental Table 1. Phylogenetic signal lambda . .2 Supplemental Table 2. Syncom strains . .3 Supplemental Table 3. PERMANOVA . .6 Supplemental Table 4. PERMANOVA comparing only two treatments . .7 Supplemental Table 5. ANOVA: Observed taxa . .8 Supplemental Table 6. Observed diversity means and pairwise comparisons . .9 Supplemental Table 7. ANOVA: Shannon Diversity . 11 Supplemental Table 8. Shannon diversity means and pairwise comparisons . 12 Supplemental Table 9. Correlation between change in relative abundance and change in growth . 14 Figures 15 Supplemental Figure 1 . 15 Supplemental Figure 2 . 16 Supplemental Figure 3 . 17 Supplemental Figure 4 . 18 1 Supplemental Tables Supplemental Table 1. Phylogenetic signal lambda Class Order Family lambda p.value All - All All All All 0.763 0.0004 * * Gram Negative - Proteobacteria All All All 0.817 0.0017 * * Alpha All All 0 0.9998 Alpha Rhizobiales All 0 1.0000 Alpha Rhizobiales Phyllobacteriacae 0 1.0000 Alpha Rhizobiales Rhizobiacaea 0.275 0.8837 Beta All All 1.034 0.0036 * * Beta Burkholderiales All 0.147 0.6171 Beta Burkholderiales Comamonadaceae 0 1.0000 Gamma All All 1 0.0000 * * Gamma Xanthomonadales All 1 0.0001 * * Gram Positive - Actinobacteria Actinomycetia Actinomycetales All 0 1.0000 Actinomycetia Actinomycetales Intrasporangiaceae 0.98 0.2730 Actinomycetia Actinomycetales Microbacteriaceae 1.054 0.3751 Actinomycetia Actinomycetales Nocardioidaceae 0 1.0000 Actinomycetia All All 0 1.0000 Gram Positive - All All All All 0.421 0.0325 * Gram Positive - Firmicutes Bacilli All All 0 1.0000 2 Supplemental Table 2.
- 
												  Ecological Strategies and Metabolic Trade-Offs of Complex Environmental Biofilmswww.nature.com/npjbiofilms ARTICLE OPEN Ecological strategies and metabolic trade-offs of complex environmental biofilms Robert Niederdorfer1,2, Katharina Besemer3, Tom J. Battin1 and Hannes Peter1 Microorganisms aggregated into matrix-enclosed biofilms dominate microbial life in most natural, engineered, and medical systems. Despite this, the ecological adaptations and metabolic trade-offs of the formation of complex biofilms are currently poorly understood. Here, exploring the dynamics of bacterial ribosomal RNA operon (rrn) copy numbers, we unravel the genomic underpinning of the formation and success of stream biofilms that contain hundreds of bacterial taxa. Experimenting with stream biofilms, we found that nascent biofilms in eutrophic systems had reduced lag phases and higher growth rates, and more taxa with higher rrn copy number than biofilms from oligotrophic systems. Based on these growth-related traits, our findings suggest that biofilm succession was dominated by slow-but-efficient bacteria likely with leaky functions, such as the production of extracellular polymeric substances at the cost of rapid growth. Expanding our experimental findings to biofilms from 140 streams, we found that rrn copy number distribution reflects functional trait allocation and ecological strategies of biofilms to be able to thrive in fluctuating environments. These findings suggest that alternative trade-offs dominating over rate-yield trade-offs contribute to the evolutionary success of stream biofilms. npj Biofilms and Microbiomes (2017) 3:21 ; doi:10.1038/s41522-017-0029-y
- 
												  Kinetics of Mercury Accumulation by Freshwater BiofilmsEnviron. Chem. 2018, 14, 458–467 © CSIRO 2017 doi:10.1071/EN17073_AC Supplementary material Kinetics of mercury accumulation by freshwater biofilms Perrine DranguetA,B Vera I. SlaveykovaA and Séverine Le FaucheurA,C AUniversity of Geneva, Faculty of Sciences, Earth and Environment Sciences, Department F.-A. Forel for Environmental and Aquatic Sciences, Environmental Biogeochemistry and Ecotoxicology, Uni Carl Vogt, 66 Bvd Carl-Vogt, CH 1211, Geneva, Switzerland. BPresent address: Département de sciences biologiques, Université de Montréal, Pavillon Marie- Victorin CP6128, Succ. Centre-Ville, Montréal, Québec H3C 3J7, Canada CCorresponding author. Email: [email protected] Table S1. Targets and sequences of the primers used to characterise the bacterial communities in biofilms using qPCR and amplicon sequencing Molecular tool Primers Target Sequence (5’-3’) References P338f GCATGGCYGYCGTCAG All bacteria [1] P518r CGACGCCATCTTCATTCACAT merAF ATTCCAGCTCCAATAGCG qPCR Hg resistance [2] merAR GACTACGATGGTATCTAATC hgcAR Hg TCCGTAGGTGAACCTGCGG [3] hgcAR methylation TCCTCCGCTTATTGATATGC Universal 1053F small subunit GCATGGCYGYCGTCAG [4] ribosomal 1319R rRNA gene CGACGCCATCTTCATTCACAT Amplicon sequencing D512F ATTCCAGCTCCAATAGCG Nuclear small ribosomal [5] subunit 18S D978R GACTACGATGGTATCTAATC Table S2. Taxonomic ranks of the major microorganisms living in both biofilms (B1 and B2), as well as the number of sequences and their abundance (%) calculated with OTUs assigned to (a) bacteria and (b) microalgae prior (T0) and after 24h (T24)
- 
												  Competitive Exclusion and Metabolic Dependency Among Microorganisms Structure the Cellulose Economy of Agricultural SoilCompetitive exclusion and metabolic dependency among microorganisms structure the cellulose economy of agricultural soil Roland C Wilhelm ( [email protected] ) https://orcid.org/0000-0003-1170-1753 Charles Pepe-Ranney Cornell University Pamela Weisenhorn Argonne National Laboratory Mary Lipton Pacic Northwest National Laboratory Daniel H. Buckley Cornell University Research Keywords: decomposition, metagenomics, stable isotope probing, metaproteomics, metabolic dependency, competitive exclusion, surface ecology, soil carbon cycling Posted Date: February 14th, 2020 DOI: https://doi.org/10.21203/rs.2.23522/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at mBio on February 23rd, 2021. See the published version at https://doi.org/10.1128/mBio.03099-20. Page 1/33 Abstract Many cellulolytic microorganisms degrade cellulose through extracellular processes that yield free intermediates which promote interactions with non-cellulolytic organisms. We hypothesize that these interactions determine the ecological and physiological traits that govern the fate of cellulosic carbon (C) in soil. We evaluated the genomic potential of soil microorganisms that access C from 13 C-labeled cellulose. We used metagenomic-SIP and metaproteomics to evaluate whether cellulolytic and non- cellulolytic microbes that access 13 C from cellulose encode traits indicative of metabolic dependency or competitive exclusion. The most highly 13 C-enriched taxa were cellulolytic Cellvibrio ( Gammaproteobacteria ) and Chaetomium ( Ascomycota ), which exhibited a strategy of self-suciency (prototrophy), rapid growth, and competitive exclusion via antibiotic production. These ruderal taxa were common indicators of soil disturbance in agroecosystems, such as tillage and fertilization.