fGENETIC V ARTATION AMONG GEOGRAPHTCALL Y ISOLATED POPULATIONS OF THE COMMERCIALLY IMPORT ANT SEA CUCUMBER. ISOSTICHOPUS FUSCUS. IN THE EASTERN PACIFI A thesis submitted to the faculty of San Francisco State University In partial fulfillment of The requirements for The degree Master of Science In Marine Science by Heather Renee Lohr San Francisco. California May.2003 Copyright by Heather Renee Lohr 2003 GENETIC VARIATION AMONG GEOGRAPHICALLY ISOLATED POPULATIONS OF THE COMMERCIALLY IMPORTANT SEA CUCUMBER ISOSTICHOPUS FUSCUS, IN THE EASTERN PACIFIC Heather Renee Lohr San Francisco State University 2003 Understanding population genetic structure of commercially exploited species can aid in the careful exploitation of animal resources while preserving sustainable genetic diversity in natural populations. The mitochondrial control region and cytochrome oxidase subunit I of the sea cucumber, Isostichopus foscus, were explored for intraspecific variation among different subpopulations from the Galapagos Archipelago, mainland Ecuador, and the Gulf of California, Mexico to estimate the level of gene flow among these populations. Pairwise Fst values revealed little genetic differentiation and high levels of gene flow between populations from Galapagos Islands and Ecuador (F,, = 0.026, Nm = 18.81). Comparisons of Mexico with Galapagos Islands and Ecuador indicate higher genetic differentiation and little migration (F51 = 0.550, Nm = 0.41; F,, = 0.475, Nm = 0.55 respectively). Phylogenies of control region sequences show Galapagos and Ecuadorian individuals interspersed throughout a single clade and most Mexican sequences grouping into a second clade. These results indicate gene flow between Galapagos Islands and Ecuador either currently or in recent evolutionary history. a correct representation of the content of this thesis. ~Joh DJr.~/ ACKNOWLEDGEMENTS I would like to thank Dr. Jon Geller for his guidance and support over the past few years. I am grateful to Jon for giving me the opportunity to complete a thesis that passes my own personal "so who cares" test. This project involved tons of troubleshooting and Jon was always supportive in letting me do what was necessary in order to get it completed. I am indebted to Dr. Bob Vrijenhoek for his time spent discussing my thesis and assistance in helping me to understand my results. I also thank Dr. Tom Niessen for his critical review of my manuscript. Thanks to Dr. Simona Bartl, Laurie Fitzgerald, Jason Cope, Laurie McConnico, Shannon Johnson, Christy Schnitzler, Chad King, Matt Levey, and Matt Forrest for help and support in all forms from lab to field. Thanks especially to Laurie Fitzgerald for holding my hand while I learned the ways of the lab and for always answering every single question. To Jason Cope for an endless number of discussions of statistical software as I would never have been able to run Arlequin without him. Thanks to MLML and everyone at the labs; I am grateful in more ways than I can ever say. Thanks to Toni Roberts, Dr. Kenneth Coale, and Donna Kline. for their endless support and to Joan Parker and her library staff for always getting in papers faster than I could read them. Finally, I want to thank my family for their unconditional love and support throughout. This project was funded in part by Earl H. and Ethel M. Meyers Oceanographic and Marine Biology Trust, PAD! Project A.W.A.R.E .• and PADI Foundation. v TABLE OF CONTENTS List of Tables ...... VII List of Figures ...... viii List of Appendices ...... IX Introduction ...... 1 Methods ...... 4 Data analysis ...... 6 Genetic diversity ...... 7 Population structure ...... 7 Results ...... 8 Sequence data and phylogenetic analysis ...... 8 Genetic diversity ...... 10 Genetic structure ...... 10 Discussion ...... 12 History of the Galapagos Islands fishery ...... 12 Clarification of taxonomic uncertainty using COl ...... : 14 Genetic structure and geographical connections ...... 15 Conclusions ...... 17 References ...... · · · · · · · · · · · · · · ·· 19 VI LIST OF TABLES Table Page 1. Sample ID, geographic location, and sequences obtained from I. fuscus individuals ...... 24 2. Genbank ID, sequence position, and references for COl sequence fragments from sea cucumber sequences ...... 26 3. Control region genetic diversity measures and Tajima's test of neutrality ...... 27 4. Control region pairwise F 51 values from L foscus populations ...... 28 5. Control region genetic distance measures within and among populations of L foscus from Galapagos Archipelago ...... 29 6. Control region genetic distance measures within and among populations of L fuscus from different regions ...... 30 7. COl genetic distance measures within and among populations of L fuscus from different regions ...... 31 8. Pairwise distance matrix for fragment of COl gene for groups of sea cucumber sequences...... 32 9. Analysis of variance (AMOVA) from control region sequences from three I. fuscus populations...... 33 10. Analysis of variance (AMOVA) from control region sequences from two I. .fitscus regions ...... ·...... 34 Vll LIST OF FIGURES Figure Page 1. Neighbor-joining phylogram of L fuscus control region sequences 35 2. Neighbor-joining bootstrap tree of L fuscus control region sequences...... 36 3. Maximum parsimony best tree of L fitscus control region sequences...... 3 7 4. Maximum likelihood phylogram of L fuscus control region sequences ...... ~...... 38 5. Neighbor-joining phylogram of sea cucumber COl sequences ...... 39 6. Neighbor-joining bootstrap tree of sea cucumber COl sequences ... 40 7. Maximum parsimony best tree of sea cucumber COl sequences .... 41 8. Maximum likelihood phylogram of sea cucumber COl sequences. 42 Vlll LIST OF APPENDICES Appendix Page ]. Mitochondrial control region sequence alignment for I. fuscus ..... 43 2. Mitochondrial COl sequence alignment for I. foscus and various other sea cucumbers...... 53 IX Introduction: Poor management of animal resources. lack of incentive for conservation, and lack of collaboration all affect sustainable exploitation of animal species (Rosser & Mainka 2002). Over-exploitation has been identified as the major threat to 1/3 of bird and mammal species currently in danger of extinction (Rosser & Mainka 2002). Habitat fragmentation or human disturbance resulting in species decline can lead to deleterious genetic changes, which may affect fitness and adaptive potential of individuals (Sherwin & Moritz 2000). A goal in conservation is to avert or remedy the decline of genetic variation; monitoring and understanding population genetic structure can aid in managing careful exploitation of resources and preserving sustainable genetic diversity in populations of commercially important species (Sherwin & Moritz 2000). Isostichopus fuscus (Ludwig 1875) is a commercially important shallow water species of sea cucumber in the eastern Pacific ranging from the northern Gulf of California, Mexico south to Ecuador (Herrero-Perezrul et al. 1998, 1999). Of the 1100 species of sea cucumbers in the world, only I 0- 20 are commercially harvested; fisheries off the coast of Ecuador and in the Galapagos Islands are comprised of only I. .fi1scus (Jenkins & Mulliken 1999). This sea cucumber is large, 19- 25 em in length, and abundant on. rocky coral bottoms (Herrero-Perezrul et al. 1999). Its shallow distribution and sedentary lifestyle make it an easy target for collection in large numbers by divers. Recent intense commercial fishing pressures on this animal resulting in an end of season decrease in CPUE (catch per unit effort), raised questions I of the stability and sustainability of the Galapagos Islands sea cucumber population (Conand & Byrne 1993, Conand 1997). Isostichopus foscus, like most other holothurians, reproduces by mass spawning of gametes and has a pelagic larval period (Herrero-Perezrul et al. 1999). It is often assumed that an animal with a long-lived pelagic larval stage must have high dispersal capabilities and a high level of gene flow among populations (Scheltema 1986, Scheltema et al. 1996); however, there are many barriers to gene flow or survival of colonizing larvae (Gartner-Kepkay et al. 1983, Hedgecock 1986, Scheltema 1986, Palumbi 1994, 1995, Edmands et al. 1996, Geller 1998). Barriers to dispersal may be physical, such as sharp temperature changes or current patterns (Hedgecock 1986, Scheltema 1986, Wares et al. 2001 ). Other barriers may be biological such as behavioral patterns favoring local recruitment (Hedgecock 1986, Morgan 1987, Edmands et al. 1996). Moreover, long-lived planktonic larvae may settle in an unfavorable location or use up their energy stores in transport and be too weak to metamorphose upon arrival (Scheltema 1986, Palumbi 1994). ·Some populations may be effectively homogenized genetically via larval dispersal, but for many marine invertebrates pelagic larval dispersal does not provide adaptive and evolutionarily significant gene flow over long distances . (Hedgecock 1986, Peck 1994). Directly measuring levels of planktonic larval dispersal is difficult. as conventional mark -recapture techniques cannot be conducted on such tiny animals. Genetic studies have shown that even populations separated by short distances can be 3 reproductively isolated (Gartner-Kepkay et al. 1983, Burton 1986). Even in populations where gene flow exists, it must exceed a certain level in order to prevent differentiation due to genetic drift and selection (Slatkin 1994). Analysis of mitochondrial DNA lmtDNA) provides information regarding both population structure and gene flow (A vise et al. 1987, Moritz et al. 1987, Simon 1991). Primers located within highly conserved, slowly evolving flanking regions can be used to amplify variable portions of the genome and may yield information regarding intraspecific variation. The mitochondrial control region and cytochrome oxidase subunit I (COl) were explored for intraspecific variation among different subpopulations of!. fuscus. The control region contains conserved blocks important for replication and transcription (Attardi 1985, Moritz et al. 1987, Simon 1991) interspersed with sections of non-coding DNA that are more free to vary (Brown et al. 1979, Simon 1991, Palumbi 1996). Being among the most variable regions in the mitochondrial genome, the control region has been successfully utilized to determine intraspecific differentiation for a number of taxa including sea stars (Hrincevich & Foltz 1996), sea cucumbers (Arndt & Smith 1998), and fish (Brown et al. 1993, Stepien et al. 2001 ). COl is more highly conserved and is typically used to identify distant divergence, or reconstruction of deeper branching phylogenies. The goal of this project was to estimate levels of gene flow between geographically isolated populations of I. .fuscus in the Galapagos Archipelago, mainland Ecuador, and the Gulf of California, Mexico. If gene flow is restricted between these 4 distinct populations of Isostichopusfuscus, this might imply demographic independence and more stringent enforcement of fishing. regulations may be needed to preserve the Gahipagos Archipelago sea cucumber population. Materials and Methods: Isostichopus fuscus tissues, including gonad, respiratory tree, and muscle were preserved in 70% ethanol (EtOH). Samples obtained from Ayangue, Ecuador, Espanola Island, San Cristobal Island, and Floreana Island from within the Galapagos Archipelago were collected by P. Martinez (Charles Darwin Research Station). Tissue samples were also collected by me from Bahia Concepcion, Baja California Sur, Mexico (Table I). After collection, 0.5 g of tissue was homogenized at room temperature in a microcentrifuge tube containing 0.75 ml DNAzol (Molecular Research Center, Inc.). Samples were centrifuged I 0 minutes at I 0,000 x g. The supernatant was transferred to a new microcentrifuge tube and DNA precipitated by the addition of 0.8 ml of I 00% EtOH. DNA was pel!eted by centrifugation for 5 minutes at 7,000 x g and the supernatant removed. The DNA pellet was washed twice with 0.5 ml 75% EtOH, then centrifuged for 5 minutes at 7,000 x g to again pellet the DNA. All remaining ethanol was removed, the DNA was resuspended in 0.2 ml TE (10 mM Tris, I mM EDTA, pH= 7.5) and stored at -20 °C. Conserved gene fragments on either side of the mitochondrial control region were targeted and amplified using the Polymerase Chain Reaction (PCR). PCR reactions 5 totaling 25 ~I consisted of 1 ~I genomic DNA as template, 10 rnM Tris (pH 8.3). 50 mM KCI, 1.5 to 2.5 rnM MgCiz, 0.01% Triton~X, 0.01% gelatin. 0.01% Nonidet, 200 ~M dNTP, 25 pmol/~1 forward and reverse primers, and 0.5 U Taq polymerase (Life Technologies) and were overlain with a drop of mineral oil. Newly designed primer sequences were: CUCDL(32)S (5'-GAACG GTCAA TCTTG TAAAT-3') and CUCDL(928)A (5'- AAAGC ATAGG GAAAC TCCT-3'). Amplifications used a PTC- 100 thermocycler (MJ Research) and cycling parameters were as follows: 94 °C (3 min), 30 cycles of94 °C (1 min), 50 °C (1 min), and 72 °C (1 min), a fmal extension at 72 °C (5 min). A portion of the COl gene was amplified using PCR as described above. Primers utilized were 16Scuc (5'-TGACA ANNAG GATTG CGACC-3') (Arndt eta!. 1996) and COib (5'-GGGTA GATAG TTCAG CCAGT TCC-3') (Arndt eta!. 1996). PCR parameters were as follows: denaturing at 94 °C (3 min), 30 cycles of94 °C (I min), 56 °C (I min), 72 °C (1 min), and a final extension at 72 °C (5 min). PCR products were cloned with a pGEM T-Easy kit (Promega). Three to five recombinant. transformed E. coli colonies were cultured and grown overnight according to the kit protocol. PCR was used to screen for presence of the correct insert. Plasmids tram confirmed positive cultures were purified with Qiaprep Spin Mini prep kit (Qiagen). Plasmids were stored at -20 oc until sequencing. Plasmids were bi-directionally sequenced using SequiTherm EXCEL II Long-Read DNA sequencing kit-LC and 6 manufacturer's instructions (Epicenter Technologies) and electrophoresed overnight on a LI-COR 4200 automated DNA sequencer. For some samples, the amplified product was purified with PCR Product Pre-Sequencing kit (USB Corporation) according to the kit protocol and sent to Northwoods DNA, Inc. for direct sequencing with an ABI 377 sequencer from purified PCR product. Purified products were sequenced in both 5' and 3' directions. Data Analysis Sequences obtained from the LI-COR sequencer were edited with AligniR version 1.2 (Ll-COR). Those obtained from Northwoods DNA, Inc. were edited using Chromas version 1.45. All sequences were aligned using Clusta!X sofrware (Thompson eta!. 1997) using default gap opening and gap extension penalties (I 0 and 0.20 respectively). COl sequences from I. fuscus were aligned along with 11 other sea cucumber sequences (Table 2). Neighbor-joining and maximum likelihood full heuristic search phylogenetic analyses were performed in PAUP* ver. 4.0b10 (Swofford 2000) using the Tamura-Nei evolutionary model (gamma shape= 0.3658 for control region and 0.2398 for COl). This model of evolution was determined to be most appropriate by MODEL TEST program version 3.06 (Posada & Crandall 1998). Phylograms were constructed for each analysis and a 50% majority rule, neighbor-joining consensus tree was bootstrapped with 1000 replicates. A maximum parsimony analysis with a full heuristic search was also conducted using P AUP*. 7 Genetic Diversity Control region genetic diversity was measured as nucleotide diversity (1t, Nei 1987) with the computer program DNAsp (Rozas & Rozas 1999). Nucleotide divergence measured as mean number of pairwise differences between geographically separate populations was calculated in Arlequin, a software program used for population genetic analysis (Schneider et al. 2000). Sites with gaps or missing data were excluded from analyses. Expectations of neutrality were tested with Tajirna's test (Tajima 1989), which compares the relationship between the number of segregating sites in sequences and · average number of mutations expected under neutrality, using Arlequin. Population Structure The presence of genetic subdivisions among the geographically isolated populations was calculated by estimating control region Fs1 (Hudson et al. 1992). using DNAsp. This derivation on Wright's (1951) fixation index estimates a value for F., based on DNA sequence data and Fs 1 = I - Hw I Hb. where Hw is average nucleotide variation among individuals within a population, and Hb is average variation between populations. This estimation is a pairwise method where polymorphic sites are treated as separate loci and a value for Fs1 is calculated from frequency of alleles at each locus by geographic location. This method assumes Wright's model of island migration and the infinite sites model in which all mutations are assumed to occur for the first time. Low 8 Fs, values (0.0- 0.15) indicate little genetic differentiation (i.e. high levels of gene flow), while large F." (0.25 - 1.0) indicates a great degree of genetic separation (i.e. reproductive isolation) (Hudson eta!. 1992). Per generation migration rate, Nm, was estimated based upon the relationship: Nm = (112)[(1/ Fst )-1] (Hudson eta!. 1992) Estimates of genetic distances within and among different populations were assessed for both the control region and COl with the software program MEGA (Molecular Evolutionary Genetics Analysis) (Kumar eta!. 1993), using a corrected distance based on the Tamura-Nei model. A pairwise genetic distance matrix by genera was also constructed for COl in MEGA. Standard error (S.E.) was estimated by bootstrap method with 1000 replications. An analysis of molecular variance (AMOVA) for control region was performed in Arlequin. The AMOV A tests population subdivision using a squared pairwise distance matrix and the significance of p was estimated by 1023 permutations and represents the probability of obtaining an «<> statistic greater than the observed value. Population structure was analyzed with the data divided into three populations (Mexico, Ecuador, and Galapagos) and two regions (north (Mexico) and south (Galapagos and Ecuador)). Results: Sequence data and phylogenetic avalysis A portion of the mitochondrial control region was sequenced for 46 Isostichopus fi,scus individuals from the Galapagos Islands, Ayangue, Ecuador, and Gulf of 9 California, Mexico (n = 21, 16, and 9 respectively) (Table 1). Sequences were found to be variable in length ranging from 819 to 829 bp with a final alignment length of 864 bp (Appendix 1). Although all sequences possessed variable sites interspersed throughout, those from Gulf of California, Mexico had three separate insertion sites visible in the alignment, setting them apart from other sequences (4 bp insertion at 4 3 7 bp, 4 bp insertion at 580 bp, and 3 bp insertion around 713 bp) (Appendix 1). The variability within this region of the genome yielded all unique sequences with the exception of two identical sequences from Ayangue, Ecuador. All sequences had uneven base composition with the deficit being G (13.03%). Other nucleotides were nearly evenly distributed. A 785 bp region of the cytochrome oxidase subunit I (COl) gene was obtained from sequencing 18 I. fuscus individuals from the Galapagos Islands, Ayangue, Ecuador, and Gulf of CA, Mexico (n = 8, 6, and 4 respectively) (Table I). A total of 11 other holothurian COl sequences from 9 different species was also used in this analysis (Table 2). A 389 bp alignment of overlap in sequences was used in analyses (Appendix 2). A neighbor-joining phylogram of control region sequences constructed in PAUP* yields two distinct clades (Figure 1). All but one Mexican sequence formed one clade and all Ecuador (with one exception) and Galapagos sequences group together, interspersed in a second clade. Bootstrapping with I 000 replicates shows 100% support tor the Mexican grouping (Figure 2). Maximum parsimony analysis produced 32 best trees; topologies differed only at the tips and one tree is presented (Figure 3). The 10 maximum likelihood tree (Figure 4) was similar to parsimony trees and showed a similar topology, with Mexican sequences forming a distinct clade in both analyses. In all three analyses, Mexican sequences, with one exception from Ecuador, formed a monophyletic clade. A neighbor-joining tree of COl sequences shows all sequences group together strongly by genera (Figure 5). Bootstrapping with 1000 replicates shows I 00% support for a clade containing all Isostichopus sequences (Figure 6). Maximum parsimony (Figure 7) and maximum likelihood (Figure 8) trees both yield similar topologies, with all sequences grouping together strongly by genera. Genetic Diversity Within population nucleotide sequence diversity (1I) ranged from 2 to 4% (Table 3). Mean number of pairwise differences ranged from 19.15 to 29.42 within each population (SD 8.34-14.23, Table 3). In both cases, GulfofCA, Mexico sequences were the most variable. After calculation ofTajima's D statistic, selective neutrality could not be rejected (Table 3 ). Genetic Structure Pair\vise F." analysis on subpopulations wi.thin the Galapagos Archipelago (Espanola, Floreana, and San Cristobal Islands) revealed no genetic differentiation among the three sites and an infinite amount of migration. Pooling Galapagos subpopulations II into one population, pairwise F,, values of the three geographically isolated regions revealed little genetic differentiation and high levels of gene flow between Galapagos and Ecuador (F51 = 0.026, Nm = 18.81) (Table 4). Comparisons between Mexico and Galapagos (F,,= 0.550, Nm = 0.41) and between Mexico and Ecuador CFst = 0.475, Nm = 0.55) indicated a great amount of genetic differentiation and low levels of migration (approximately 1 migrant per 2 generations) based on Wright's (1978) interpretation of F51 values. Control region genetic distances within and among subpopulations from the Galapagos Islands (Espanola, Floreana, and San Cristobal Islands) were all between 2.5 and 2.7% (Table 5). The Galapagos populations were pooled as a single population and genetic distances calculated within each region were between 2.6 and 4.5%, with the Gulf of California being the highest (Table 6). Distance calculated between the Galapagos and Ayangue, Ecuador (3.6%) was comparable to within-population values, while distances calculated between Gulf of California, Mexico and the other two regions were much higher (8.6 and 9.1 %, Table 6). Genetic distances calculated within and among each geographic region for l ji1scus COI sequences revealed distances ranging from 0.3 to 0.4% (Table 7). A pairwise distance matrix of all sea cucumber species, with l fuse us divided into northern (Mexico) and southern (Galapagos and Ecuador) regions, shows higher genetic distances occurring at the between species level for all other genera. relative to l foscus (Table 8). Distances ranged from 3 to 19.8% between different species to 24.6 to 77.6% between different 12 genera. Differences between Mexican and Ecuadorian I. foscus are less than the average differences seen among species from other genera. An analysis of molecular variance (AMOVA) on subpopulations within Galapagos Archipelago revealed no genetic differentiation, and again the subpopulations were pooled into a single Galapagos population for further analyses. An analysis of the three geographically isolated populations with no defined hierarchical geographic subdivision (one group, three populations) yielded great differentiation («1>51 = 0.37, p ::':: 0.001, Table 9). A hierarchical analysis of variance could not be performed because grouping populations implies more than one population per group and the Mexican region consists of only one population. To determine the population responsible for genetic differentiation, the data were divided into two regions: north (Mexico) and south (Galapagos and Ecuador). This analysis showed significant genetic differentiation between northern and southern regions («1> 51 = 0.53, p ::':: 0.001, Table 10). Discussion: History ofthe Galapagos Islands fishery Sea cucumbers have been fished commercially world-wide for over 1000 years. Much attention has been given to this commercial exploitation due to an increase in public demand for the product (Conand & Byrne 1993, Merlen 1995, Jenkins & Mulliken 1999). Over-fishing and poor stock management in recent years have resulted in overall decreased CPUE in some areas (Conand & Byrne 1993). Commercial fishing of I. 13 fuscus began in the mid 1980's off the coast of Ecuador. By the early 1990's. Ecuadorian stocks were nearly depleted, prompting a shift in fishing industry focus to move 600 miles off the coast of South America to the rich waters of Galapagos Islands. Unregulated, indigenous subsistence fishing was originally allowed in the park; therefore no laws were in place to protect against commercial fishing within the Archipelago. Fishing in Galapagos continued unregulated until mid 1990's when the governrnent closed waters to commercial fishing (Jenkins & Mulliken 1999). In 1994, the government yielded to pressure from the pepineros (cucumber fishermen) and reopened the fishery in Galapagos for a 3 month time period, despite a lack of population abundance data The catch limit was set at 550,000 animals and within two months, 6- I 0 million sea cucumbers were estimated to have been collected (Camhi 1995). Although commercial fishing was banned. fishing and processing on the islands continued, the government being either unwilling or unable to enforce the ban (Camhi 1995, Powell & Gibbs 1995). The fishery was reopened again and even with a well monitored fishery, the CPUE for 1999- 2001 was reported to have dropped significantly toward the end of each fishing season (Lizana 1999,2000, 2001). Sea cucumbers, along with other exotic and expensive "texture foods" such as shark fins, sea urchin roe, and fish bladders. are harvested and exported as a delicacy to Asian markets (Stutz 1995). Once sea cucumbers are collected they undergo processing, which consists of boiling, gutting, and sun drying the body wall. This results in a marketable product referred to as beche-de-mer or trepang (Conand & Byrne 1993, 14 Camhi 1995, Stutz 1995). In Galapagos Islands, processing of large numbers of sea. cucumbers has been detrimental to the delicate environment of the islands. At processing sites, trees providing valuable habitat have been cut down for firewood, exotic animals and weeds introduced by foreign boats anchored close to shore, and increased numbers of immigrants leave human waste and trash when sites are abandoned (Powell & Gibbs 1995). C/arijication of taxonomic uncertainty using COl We did not have the opportunity to compare morphology of animals collected from all three regions. Samples from the Galapagos Islands and Ecuador were labeled Stichopus fitscus and Mexican samples were identified as Isostichopus fuscus. Although this sea cucumber is referred to by both names in the literature and is assumed to be the same species (Brusca 1973), without physical comparison it was unclear if animals from all three locations were the same species. A portion of the COl was targeted to compare these samples to published sequences from other holothurians. Both phylogenetic and statistical analyses of COl sequences show I fuse us from all three regions form a monophyletic clade, which is separate from other genera of sea cucumbers. This supports the assumption that samples from all three regions are at least congeners. A comparison of genetic distances between species in the genus Cucumaria average 14.83% and Arndt et al. (1996) found within species distance estimates for Cucumaria to be approximately S I%. Genetic distance measures among different populations of 15 Isostichopus were all less than 0.5% (Table 7). Therefore, even without morphological validation, we conclude that Isostichopus samples from all three locations were identified correctly as the same species. Genetic structure and geographical connections Population genetic and phylogenetic analyses of mtDNA control region sequences show little differentiation between Galapagos Islands and mainland Ecuador populations. The data also show the mitochondrial control region in L fuscus to be variable enough to detect a difference at the species level, if it exists, as shown in the high degree of divergence between northern and southern regions. It was clear from these data that Ecuador and Galapagos Islands appear to be connected genetically today or have been in recent evolutionary time. High F,, values show the Mexican population is highly divergent from Ecuadorian populations (Table 4). These results are consistent with isolation by distance as gene flow between Galapagos and Ecuador, separated by 600 miles of ocean, may be more likely than gene flow between either southern location and Mexico, separated by over 2500 miles. Perhaps more important than absolute distance, the Peru-Humboldt current flows north along South America toward Ecuador, then joins with the South Equatorial current and flows west to the Galapagos Archipelago (Cribb 1986, James 1991 ). Thorton (1971) estimates a travel time of 2 weeks for passive material from the mainland to the Islands, and this appears within the planktonic lifespan for holothurian larvae of 2 weeks 16 to 2 months (Strathmann 1978, Smiley et al. 1991 ). The westward equatorial flow appears to provide an effective larval conveyor between mainland and island populations. The Galapagos/Ecuador samples represent the classic island model where Ecuador is the mainland source population with a higher diversity of alleles, which contribute to viability of Galapagos populations. The presence of gene flow inferred from these data shows a historical genetic connection between Galapagos and Ecuador. The large number of alleles observed in each population, indicates large, robust populations through time in all locations. From the perspective of resource management, it is important to recognize that gene flow can occur as a slow trickle or in pulses and the same genetic results might be observed. Thus, high historical levels of gene flow may not predict stock replenishment over short time scales. According to the data, the populations appear to have been robust over time, but they have not been subjected to intense fishing pressure until recently. Ruttenberg (2001) provides evidence for community level changes resulting from only a brief history of exploitation in the Galapagos Islands. Shifts in community structure for both commercial fish species and noncommercial invertebrates are apparent in heavily fished areas of the Archipelago (Ruttenberg 2001). Although these initial effects were only observed in targeted areas, it is unclear how this community shift will affect future populations. Being isolated.geographically, the stability of populations inhabiting the Archipelago can be severely impacted by variables such as seasonal change in water temperatures (Houvenaghel 1984 ), current patterns (James 1991 ), or El 17 Nifio events (Mills & Vargas 1997), which can further reduce genetic variation when compared to mainland populations (Akst et al. 2002). The degree of connectivity of Galapagos Islands and mainland populations is thus important for the management of this fishery. The data show that gene flow exists between Galapagos and Ecuador as inferred levels of gene flow based upon sequence similarities. An analysis of geographic patterns of genetic variation and inferred gene flow can provide only an indirect assessment of larval dispersal. It is not clear if the level of migration shown in the data (Nm = 18.81, Table 4) is sufficient to sustain high levels of exploitation of this fishery in the Galapagos Islands. Conclusions The Galapagos Islands have been an international model for protecting biodiversity (Camhi 1995). Millions of years of geographical isolation along with the diversity of habitats created an extraordinarily rich and uriique assemblage of inhabitants within the Archipelago. Recent commercial fishing pressures and exploitation of marine fauna left the government faced with the problem of balancing economic growth with marine conservation in an area as valuable to the global community as the Galapagos Islands. This study has attempted to uncover the level of genetic connectivity present between the Galapagos Islands and other potential source populations of I. ji1scus. The data clearly show genetic similarities between both southern populations and high inferred levels of gene flow suggesting larval dispersal between mainland and islands. 18 Whether this larval connection is occurring continuously, sporadically, or only in recent evolutionary history is unknown. While this study does not provide evidence for a closed Galapagos Islands population of Isostichopus fuscus, which would have important implications for its management as a fishery, it also does not imply that heavy local exploitation will be compensated by immigration. Without direct observations of larval transport, it is not possible to make firm conclusions as to the stability of the current or future supply of larvae to the Galapagos Islands from other populations. 19 Literature cited: Akst E, Boersma P, Fleischer R (2002) A comparison of genetic diversity between the Gahipagos Penguin and the Magellanic Penguin. Conserv. Gen., 3, 375-383. Arndt A, Marquez C, Lambert P, Smith MJ ( 1996) Molecular phylogeny of eastern Pacific sea cucumbers (Echinodermata: Holothuroidea) based on mitochondrial DNA sequence. Mol. Phyl. Evol., 6, 425-437. Arndt A, Smith MJ ( 1998) Genetic diversity and population structure in two species of sea cucumber: differing patterns according to mode of development Mol. Ecol., 7, 1053-1064. Attardi G (1985) Animal mitochondrial DNA: An extreme example of genetic economy. Inti. Rev. Cyt., 93, 93-145. A vise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, Saunders NC (1987) Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Ann. Rev. Ecol. Syst., 18, 489-522. Brown JR, Beckenback AT, Smith MJ (1993) Intraspecific DNA sequence variation of the mitochondrial control region of white sturgeon (Acipenser transmontanus). Mol. Bioi. Eva/., 10,326-341. Brown WM, George Jr. M, Wilson AC (1979) Rapid evolution of animal mitochondrial DNA. Proc. Nat/. Acad. Sci. USA, 76, 1967-1971. Brusca R (1973) A Handbook to the Common Intertidal Invertebrates ofthe Gulfof California. The University of Arizona Press, Tucson, AZ. Burton RS ( 1986) Evolutionary consequences of restricted gene flow among natural populations of the copepod, Trigriopus cal!fornicus. Bull. Mar. Sci., 39, 526-535. Camhi M (1995) Industrial fisheries threaten ecological integrity of the Galapagos Islands. Conserv. Bioi., 9, 715-724. Conand C, Byrne M (1993) A review of recent developments in the world sea cucumber fisheries. Mar. Fish Rev., 55, 1-13. 20 Conand C (1997) Are holothurian fisheries for export sustainable? Proc. 8th Int. Coral ReefSym, 2, 2021-2026. Cribb J (1986) Subtidal Galapagos. Exploring the waters ofDarwin's Islands. Camden House Publishing Ltd., Ontario, Canada. Edmands S, Moberg PE, Burton RS (1996) Allozyme and mitochondrial DNA evidence of population subdivision in the purple sea urchin Strongylocentrotus purpuratus. Mar. Bioi., 126, 443-450. Gartner-Kepkay KE, Zouros E, Dickie LM, Freeman KR (1983) Genetic differentiation in the face of gene flow: A study of mussel populations from a single Nova Scotian embayment. Can. J. Fish. Aquat. Sci., 40,443-451. Geller JB ( 1998) Molecular studies of marine invertebrate biodiversity: status and prospects. In: Molecular Approaches to the Study ofthe Ocean (ed. Cooksey KE), pp. 18-376. Chapman & Hall, London. Hedgecock D ( 1986) Is gene flow from pelagic larval dispersal important in the adaptation and evolution of marine invertebrates? Bull. Mar. Sci., 39, 550-564. Herrero-Perezrul MD, Reyes-Bonilla H, Garcia-Dominguez F (1998) Casual hermaphroditism in gonochoric Isostichopusfuscus (Ludwig, 1875) (Echinodermata: Holothuroidea) of the southern Gulf of California, Mexico. Bull. Mar. Sci., 63, 611-615. Herrero~Perezrul MD, Reyes-Bonilla H, Garcia-Dominguez F, Cintra-Buenrostro CE (1999) Reproduction and growth of Isostichopus fuscus (Echinodermata: Holothuroidea) in the southern Gulf of California, Mexico. Mar. Bioi., 135, 521- 532. Houvenaghel G ( 1984) The oceanographic setting of the Gallipagos Islands. In: Key environment series: Galapagos Islands (eds. Treheme J, Perry R), pp. 43-54. Pergamon Press, Oxford, United Kingdom. Hrincevich A W, Foltz DW (1996) Mitochondrial DNA sequence variation in a sea star (Leplasterias spp.) species complex. Mol. Phyl. Evol., 6, 408-415. Hudson RR. Slatkin M, Maddison WP (1992) Estimation of levels of gene flow from DNA sequence data Genetics, 132, 583-589. 21 James MJ (ed.) (1991) Galapagos Marine Invertebrates: Taxonomy, biogeography, and evolution in Darwin's Islands. Plenum Press, New York. Jenkins M, Mulliken TA (1999) Evolution of exploitation in the Galapagos Islands: Ecuador's sea cucumber trade. Traffic Bul/.,17, 107-118. Kumar S, Tamura K, Nei M (1993) MEGA: Molecular Evolutionary Genetic Analysis. Lizana IR (ed.) (1999) Charles Darwin Foundation Annual Report, Projections. Lizana IR (ed.) (2000) Charles Darwin Foundation Annual Report, Projections. Lizana IR (ed.) (2001) Charles Darwin Foundation Annual Report, Projections. Merlen G (1995) Use and misuse of the seas around the Galapagos Archipelago. Oryx, 29, 99-106. Mills K. Vargas H (1997) Current status. analysis of census methodology, and conservation of the Galapagos Penguin, Spheniscus mendiculus. Noticias de Galapagos, 58, 8-15. Morgan SG (1987) Adaptive significance of hatching rhythms and dispersal patterns of estuarine crab larvae: avoidance of physiological stress by larval export? J. Exp. Mar. BioL Ecol., 113,71-78. Moritz C, Dowling TE, Brown WM (1987) Evolution of animal mitochondrial DNA: relevance for population biology and systematics. Ann. Rev. Ecol. Syst., 18, 269- 292. Nei M ( 1987) Molecular Evolutionary Genetics. Columbia University Press, New York. Palumbi SR (1994) Genetic divergence, reproductive isolation, and marine speciation. Ann. Rev. Ecol. Syst., 25, 547-572. Palumbi SR (1995) Using genetics as an indirect estimator of larval dispersal. In: Ecology ofMarine Invertebrate Larvae pp. 369-387. CRC Press, Inc. Palumbi SR (1996) Nucleic Acids II: The polymerase chain reaction. In: Molecular Systematics (eds. Hillis DM, Moritz C, Mable BK), pp. 205-247. Sinauer Associates. Inc., Sunderland. 22 Peck S ( 1994) Diversity and zoogeography of the non-oceanic Crustacea of the Galapagos Islands, Ecuador (excluding terrestrial Isopoda). Canadian Journal of Zoology, 72, 54-69. Posada D, Crandall KA (1998) Modeltest: testing the model of DNA substitution. Bioinformatics, 14, 817-818. Powell JR, Gibbs JP (1995) A report from Galapagos. Trends in Ecol. Evo/., 10, 351-354. Rosser AM, Mainka SA (2002) Overexploitation and species extinctions. Conserv. Bioi., 16, 584-586. Rozas J, Rozas R (1999) DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics, 15, 174- 175. . Ruttenberg BI (2001) Effects of artisanal fishing on marine communities in the Galapagos Islands. Conser.•. Bioi., 15, 169!-1699. Scheltema RS (1986) Long-distance dispersal by planktonic larvae of shoal-water benthic invertebrates among central Pacific islands. Bull. Mar. Sci., 39,241-256. Scheltema RS, Williams lP, Lobel PS (1996) Retention around and long-distance dispersal between oceanic islands by planktonic larvae of benthic gastropod Mollusca. Am. Malacol. Bull., 12, 67-75. SchneiderS, Kueffer J-M, Roessli D, Excoffier L (2000) Arlequin. Ver. 2.0: a software for population genetic data analysis. Sherwin WB. Moritz C (2000) Managing and monitoring genetic erosion. In: Genetics, Demography, and Viability ofFragmented Populations (eds. Young AG, Clarke GM), pp. 9-34. Cambridge University Press, Cambridge. Simon C (1991) Molecular systematics at the species boundary: Exploiting conserved and variable regions of the mitochondrial genome of animals via direct sequencing from amplified DNA. Techniques in Taxonomy, 57, 33-71. Slatkin M (1994) Gene flow and population structure. In: Ecological Genetics (ed. Real LA), pp. 3-17. Princeton University Press, Princeton. Smiley, S, McEuen, FS, Chaffee, C, Krishnan, S (1991) Echinodermata: Holothuroidea In: Reproduction ofMarine Invertebrates (eds. Giese, AC, Pearse, JS, Pearse, VB), pp. 663-750 Stepien CA, Rosenblatt RH, Bargmeyer BA (2001) Phylogeography of the spotted sand bass, Paralabrax maculatofasciatus: divergence of Gulf of California and Pacific coast populations. Evolution. 55, 1852-1862. Strathmann R (1978) The length of pelagic period in echinoderms with feeding larvae from the northeast Pacific. J. Exp. Mar. Bioi. Ecol., 34, 23-27. Stutz B (1995) The Sea Cucumber War. Audubon, 16-17. Swofford DL (2000) PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123, 585-595. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The Clusta!X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res., 24, 4876-4882. Thornton I (1971) Darwin's Islands, a natural history ofthe Galapagos. Natural History Press, New York. Wares JP, Gaines SD, Cunningham CW (2001) A comparative study of asymmetric migration events across a marine biogeographic boundary. Evolution, 55, 295- 306. WrightS (1951) The genetic structure of populations. Ann. Eugen., 15, 323-354. WrightS (1978) Evolution and genetics of populations. In: Variability Within and Among Natural Populations. University of Chicago Press, Chicago. 24 Table 1. Sample ID, geographic location, and sequences obtained from each /sostichopus fuscus individual. Capitol G denotes samples collected in Galapagos Islands. Collection site abbreviations are as follows: eig = Espanola Island, Isla Gardner, Isla Gardner; epc = Espanola Island, Puerto Cevallos; fie = Floreana Island, Las Cuevas; ffc = Floreana Island, Frente a Champion; sci! =San Crist6ballsland, Isla Lobes; seep= San Crist6ballsland, El Pescador. Capitol E denotes samples from Ayangue, Ecuador. Capitol M denotes samples from Bahia Concepcion, Mexico. All tissue samples from Galapagos and Ecuador were collected by P. Martinez. Samples from Mexico were collected by H. Lohr. Sample Location Latitude;Longitude Collection Date Sequences G_eig34 Geig 90"40.59'W;0"36.89'N 12/11/99 control region, COl G_eig35 Geig 90"40.59'W;0"36.89'N 12/11/99 control region G_eig39 Geig 90"40.59'W;0"36.89'N 12/11/99 control region, COl G_eig41 Geig 90"40.59'W;0"36.89'N 12/11/99 control region, COl G_epc46 Gepc 90"40.59'W;0"36.89'N 12/12/99 control region, COl G_epc50 G epc 90"40.59'W;0"36.89'N 12/12/99 COl G_epc51 Gepc 90"40.59'W;0"36.89'N 12/12/99 control region, COl G_epc54 G epc 90"40.59'W;0"36.89'N 12/12/99 control region G_epc60 Gepc 90"40.59'W;0"36.89'N 12/12/99 control region G_fic85 G fie 90" 40.59'W;0"36.89'N 12/13/99 COl G_ffc89 G fie 90"40.59'W;0"36.89'N 12/13/99 control region G_ffc92 G fie 90"40.59'W;0"36.89'N 12/13/99 control reg ion G_ffc94 G fie 90"40.59'W;0"36.89'N 12/13/99 control region G_ffc100 G fie 90"40.59'W;0"36.89'N 12/13/99 control region G_scil2 G sci! 90"40.59'W;0"36.89'N 12/10/99 control region, COl G_scil10 G sci! 90"40.59'W;0"36.89'N 12/10/99 control region G_scil11 G sci! 90"40.59'W;0"36.89'N 12/10/99 control region . G_scil12 Gscil 90"40.59'W;0"36.89'N 12/10/99 control region G_scil13 G sci! 90"40.59'W;0"36.89'N 12/10/99 control region G_scil19 Gscil 90"40.59'W;0"36.89'N 12/10/99 control region G_scep5 G seep 90"40.59'W;0"36.89'N 12/09/99. control region G_scep6 Gscep 90"40.59'W;0"36.89'N 12/09/99 control region E_1 E 80"45.89'W;2"2.27'S control region E_4 E 80"45.89'W;2"2.27'S control region E_5 E 80"45.89'W;2"2.27'S control region, COl E_7 E 80" 45. 89'W;2"2.27'S control region, COl E_a E 80"45.89'W;2"2.27'S control region, COl E_g E 80" 45.89'W;2"2.27'S control region, COl E_10 E 80"45.89'W;2"2.27'S control region, COl E_11 E 80"45.89'W;2"2.27'S COl E_13 E 80"45.89'W;2"2.27'S control region E_17 E 80"45.89'W;2"2.27'S control region E_19 E 80"45.89'W;2"2.27'S control region 25 Sample Location Latitude;Longitude Collection Date Sequences E_20 E 80°45.89'W;2°2.27'S control region E_21 E 80°45.89'W;2°2.27'S control region E_22 E 80°45.89'W;2°2.27'S control region E_23 E 80°45.89'W;2°2.27'S control region E_26 E 80°45.89'W;2°2.27'S control region E_30 E 80°45.89'W;2°2.27'S control region M_1 M 111 °49.01'W;26°38.27'N 06/23/01 control region, COl M_3 M 111 o49.01'W;26°38.27'N 06/23/01 control region M_4 M 111 °49.01'W;26°38.27'N 06/23/01 control region, COl M_6 M 111 °49.01'W;26°38.27'N 06/23/01 control region M_7 M 111 o49.01 'W;26°38.27'N 06/23/01 control region M_B M 111 o49.01 'W;26°38.27'N 06/23/01 control region M_9 M 111 °49.01'W;26°38.27'N 06/23/01 control region M_10 M 111 °49.01'W;26°38.27'N 06/23/01 control region M_14 M 111 °49.01'W;26°38.27'N 06/23/01 control region, COl M_15 M 111°49.01 'W;26o38.27'N 06/23/01 COl Table 2. Genbank 10, sequence position, and reference for COl sequence fragments from sea cucumbers used in the alignment with lsoslichopus fuscus sequences. Species Genbank accession Sequence position Reference number in Genbank (bp) Cucumaria curata CCU31901 448-836 Arndt et al. 1996 Cucumaria /ubrica CLU32214 448-836 Arndt et al. 1996 Cucumaria /ubrica CLU32216 449-836 Arndt et al. 1996 Cucumaria miniata CMU32215 446-834 Arndt et al. 1996 Cucumaria miniata AF009350 1-389 Arndt & Smith 1998 Cucumaria pal/ida CPU32210 1-389 Arndt et al. 1996 Cucumaria piperata CPU32211 443-832 Arndt et al. 1996 Cucumaria vegae CVU32209 1-389 Arndt et al. 1996 Parastichopus ca/ifomicus PCU32198 594-986 Arndt et al. 1996 Parastichopus parvimensis PPU32199 595-983 Arndt et al. 1996 Pseudostichopus mol/is PMU32221 448-836 Arndt et al. 1996 Table 3. Control region genetic diversity measures (;!:SD) and Tajima's (1989) test of neutrality for/. fuscus populations. No. of Nucleotide 1t Mean pairwise Tajima's D statistic Po~ulation n ha~lot~~es (%) differences Galapagos Islands 21 21 2;!:1 19.15;!:8.34 -1.03 (p>0.05) Espanola Island 8 8 2:!: 0.3 18.82;!:9.35 -0.78 (p>0.05) Floreana Island 5 5 2;!:0.4 19.60;!:10.50 -0.21 (p>0.05) San Crist6ballsland 8 8 3:!: 0.3 20.96;!:1 0.38 -0.25 (p>0.05) Ayangue, Ecuador 16 15 3;!:1 27.36;!:12.65 -1.51 (p>0.05) Gulf of CA, Mexico 9 9 4+1 29.42+14.23 -0.91 (~>0.05) 28 Table 4. Control region pairwise F, values of/. fuscus populations as estimates of population differentiation. Corresponding estimates of gene flow Nm = ((1/Fst)-1)/2 listed in upper matrix. Population Galapagos Islands Ayangue, Ecuador Gulf of CA, Mexico Galapagos Islands 18.81 0.41 Ayangue, Ecuador 0.026 0.55 Gulf of CA, Mexico 0.550 0.475 29 Table 5. Control region genetic distance measures with Tamura-Nei correction among populations {below diagonal) and within populations (along diagonal::!: SE) of/. fuscus from Galapagos Archipelago. Above diagonal represents ::!: SE calculated by bootstrap analysis (1000 replicates). All values are percentages. Population Espaiiola Island Floreana Island San Crist6bal Island Espanola Island 2.6;!:0.4 0.3 0.3 Floreana Island 2.6 2.6;!:0.4 0.3 San Crist6ballsland 2. 7 2.5 2.9+0.4 30 Table 6. Control region genetic distance measures with Tamura-Nei correction among populations (below diagonal) and within populations (along diagonal:': SE) of I. fuscus. · Above diagonal represents:': SE calculated by bootstrap analysis (1 DOD replicates). All values are percentages. Population Galapagos Islands Ayangue, Ecuador Gulf of CA, Mexico Galapagos Islands 2.6:';0.3 0.3 1.1 Ayangue, Ecuador 3.6 4.4:';0.3 1.1 Gulf of CA, Mexico 8.6 9.1 4.5+0.5 31 Table 7. Genetic distance measures with Tamura-Nei correction among populations (below diagonal) and within populations (along diagonal± SE) from /. fuscus COl gene. Above diagonal represents± SE calculated by bootstrap analysis (1000 replicates). All values are percentages. Population Galapagos Islands Ayangue, Ecuador Gulf of CA, Mexico Galapagos Islands 0.3±0.2 0.2 0.2 Ayangue, Ecuador 0.4 0.4±0.2 0.1 Gulf of CA, Mexico 0.4 0.4 0.4+0.2 Table 8. Pairwise distance matrix for 389 bp fragment of COl gene for groups of sea cucumber sequences. Distance values are in lower half of matrix and standard error values calculated by bootstrap analysis (1000 replicates) are above the diagonal. All values are percentages. 1 2 3 4 5 6 7 8 9 10 11 P. parvimensis 1.0 6.6 6.6 21.0 21.1 13.1 14.6 13.2 15.3 13.0 P. californicus 3.0 6.4 6.4 16.4 16.4 1 "1.7 11.8 10.6 12.6 12.7 I. fuscus (north) 24.9 24.6 0.2 20.0 30.0 14.5 17.7 24.2 14.3 14.6 I. fuscus (south) 25.0 24.7 0.4 19.9 30.9 14.6 17.8 24.7 14.5 15.1 C. curata 63.3 53.6 59.2 59.1 1.3 3.2 5.2 4.6 4.2 14.7 C. lubrica 64.6 54.3 71.3 71.6 4.3 2.8 4.3 4.2 4.6 25.8 C. piperata 48.4 42.3 50.1 50.4 12.5 12.1 4.2 5.6 4.4 19.6 C. miniata 49.9 44.8 56.5 56.8 19.4 18.2 16.0 1.9 3.6 37.7 C. pal/ida 46.6 39.6 64.3 65.4 18.5 18.1 18.2 5.9 3.9 22.9 C. vegae 51.4 43.1 51.3 51.7 17.7 19.8 16.7 12.3 12.8 20.0 P. mol/is 50.3 49.1 56.1 56.1 46.5 62.9 59.5 77.6 58.4 58.6 33 Table 9. Analysis of variance from control region sequences of I. fuscus as 1 group with 3 populations. P values calculated from 1023 random permutations represent probability of obtaining a statistic greater than the observed. %of total Source of variation Variance variation statistic p Structure: 1 group, three populations (Galapagos, Ecuador, Mexico) Among populations 7.08 36.7 <1>,, = 0.37 :5. 0.001 Within populations 12.23 63.6 34 Table 10. Analysis of variance from control region sequences of I. fuscus as 1 group with 2 regions. P values calculated from 1023 random permutations represent probability of obtaining a <1> statistic greater than the observed. %of total Source of variation Variance variation <1> statistic p Structure: 1 group, 2 regions (north =Mexico, south =Galapagos/Ecuador) Among populations 13.79 52.72 <1>,, = 0.53 ::: 0.001 Within populations 12.36 47.28 35 G scep6 0 G epc46 0 Ge!g39 0 G ffc94 0 ES A G ffc100 0 E19 A G epc51 0 G scil19 0 Gelg34 0 '--- G seepS 0 E 13 A '---- G ffc89 0 E23 A E9 A E 10 A E7 A E30 A Gepc54 0 Gscil12 0 G scil13 0 G ffc92 0 G ffc105 0 ,----E26 A G scil10 0 G scil2 0 Geig35 0 '-----EB A E20 A E21 A '--'--- E 17 A MB * - 0.005 subsrimrions1site Figure I. Neighbor-joining phylogram of mitochondrial control region sequences from Jsostichopusfuscus. 0 denotes Galapagos Islands A denotes mainland Ecuador *: denotes Gulf of California, Mexico. 36 G scep6 0 G epc46 0 Geig39 0 Gffc94 0 98 E5 A 96 G ffc100 0 E 19 A G epc51 69 92 0 97 G scil19 54 0 Geig34 0 61 I Gscep5 0 61 I I E 13 A, I G ffc89 0 75 E 23 A 97 E9 A 55 E10 A 65 E7 A 61 I E30 A 88 I 61 Gscil12 0 G sci!13 89 I 0 I Gepc54 0 G ffc92 0 G ffc105 0 E 26 A B4 64 G eig41 0 E 4 A G sci111 0 Gepc60 0 99 G scil10 0 99 Gscil2 0 72 G eig35 0" E 8 A 100 E20 A 63 E21 A E17 A E22 A M6 M8 M4 t* M 1 100 55 100 M3 ~ M9 93 M7 t 1oo I M10 ~ M 14 H I E 1 A Figure 2. Neighbor-joining bootstrap tree (1000 replications) of mitochondrial control region sequences from Isostichopusfuscus. Nodes with _s:50% bootstrap support were collapsed. 0 denotes Galapagos Islands A denotes mainland Ecuador *denotes Gulf of California. Mexico. 37 G scep6 0 Gepc46 0 Geig39 0 G ffc94 0 G ffc100 0 E 19 JiA G epc51 0 G sci119 0 Geig34 0 Gscep5 0 E 13 JiA G ffc89 0 G sci110 0 Gsci!2 0 Geig35 0 L----E8 JiA E23 JiA M8 * E 9 JiA E 10 JiA E7 JiA G scil12 0 G scil13 -Q E 30 JiA G ffc92 0 Gepc54 0 G ffc105 0 E26 JiA -- 5changes Figure 3. Maximum parsimony best tree trom mitochondrial control" region sequences fromlsostichopusjitscus. 0 denotes Galapagos Islands lA denotes mainland Ecuador i:r denotes Gulf of California, Mexico. 38 G seepS 0 Gepc46 0 G eig39 0 G ffc94 0 E5 A ~-I- G ffc1 00 0 E 19 A G epc51 0 G scil19 0 G eig34 0 L__ Gscep5 0 '----- G ffc89 0 E 13 A G scil10 0 G scil2 0 Geig35 0 L-----EBA E23 A MB * ,----M4 * M1 * M10 * II---1M3* M9 '------M7 *'tf '----- M14 L______* E 1 A E9 A E 10 A E7 A G sci!12 0 G scil13 0 E30 A G epc54 0 G ffc92 0 G ffc105 0 .---E26 A '------E22 A Geig41 0 E4 A G scil11 0 - 0.005 substitutions/site Figure 4. Maximum likelihood phylogramof mitochondrial control region sequences from Isostichopusfitscus. 0 denotes Galapagos Islands A denotes mainland Ecuador * denotes Gulf of California, Mexico. 39 - p parv1mens1s} Parastichopus P califomicus E7 E9 G 50epc ·EB pG46ep M41 G 34eig G B50c · M 14 Isostichopus E5 G 41eig M1 M 15 G 51epc G 2scil E 11 E 10 G 39eig ...., C curata y- CJubrica2 Cl ubrica 1 r- rc miniata 1 >- Cue umaria y Cminiata2 '----- C pallida '-- C vegae - - C piperata ,.I P mollis Pseu do sticlwpus - 0.01 substitutions/site } Figure 5. Neighbor-joining phylogram of various sea cucumber mitochondrial COl sequences. 40 P paJVimensis 6. P califomicus A 60 E7 * E9 * E10 * G 50epc* 60 EB * G46epc * 64 M4 * G85ftc * M15 100 * G 41eig * E5 * G 34eig * G 51epc * M14 * E 11 * M1 * - 100 G2scil * G 39eig * 100 C curata Ill 95 C lubrica 2 Ill I 81 C lubrica 1 Ill c piperata 11 100 C miniata 1 Ill 100 97 C miniata 2 II 99 79 C pallida fiJ c vegae nm Pmollis 8 Figure 6. Neighbor-joining bootstrap tree of mitochondrial COl sequences from various sea cucumber sequences ( 1000 replications). Nodes with :550% bootstrap support were collapsed. A denqtes Parastichopus *denotes Jsostichopus 1!11 denotes Cucumaria 8 denotes Pseudostichopus 41 P parvimensis } Parasticlwpus P califomicus E7 E9 E 10 G 50epc EB G 46epc M4 G 85flc M 15 Isostichopus G 41eig E5 G 34eig G 51epc ,------j[ M 14 E 11 M 1 G 2scil G 39eig C lubrica 2 Cucumaria C miniata 1 C minlata 2 C pallida L---Cvegae L______P mollis} Pseudosticlwpus - 5 changes Figure 7. Maximum parsimony phylogram of various sea cucumber mitochondrial COl sequences. 42 r- p parvrmensrs Parastichopus f- P califomicus } E7 E9 ' E 10 G 50epc EB G 46epc M4 G BSftc M 15 Isostichopus G 41eig ES G 34eig G 51epc M 14 E 11 M1 G 2scil G 39eig Cc urata Cl ubrica 2 Club rica 1 - - Cpiperata C vegae y Cminiala 1 Ct Jcumaria C miniata 2 '-- C palllda ) P mollis -- 0.05 substitutions/site Pseudosticlwpus Figure 8. Maximum likelihood phylogram of various sea cucumber mitochondrial COl sequences. Appendix 1. Mitochondrial control region sequence alignment from lsostichopusfitscus samples. All sequences are aligned according to G_scep6 sequence. A"." indicates concurrence with G_scep6 and a"-" indicates a gap. Numbers above alignment indicate position in alignment. 10 20 30 40 50 60 70 80 90 100 G_scep6 ACTCT-TCCTTGTGGCT-CCAAGJI.ATCCCAAGCAATCCCCCATTCTGCTGCCACCCCC-----CTTACCGACCTGTCTCTCCCATAGAGTAAAAGTCCAA G_epc46 ..... -...... -...... G_eig39 ..... -...... -...... G_ffc94 ..... - ...... - ...... E_5 ..... -c ...... - ...... r ...... c ..... -----...... T •...••.....•...•...•..•...• G ffclOO . • . . • -C., .. , .•. ,.-..•..•...•.... T .•..•...•... , .••.•. C ....• ------.•. , ..•. T .•.•.• ,.,, .. , ...•...... , .•. E l9 ..... -c ...... - ...... T .•.•••••..•...... c ..... -----...... 'I' ••••.•••••••••••••••.•••.•• G_epc51 ••••• - .••••••.••• - •••••.•••.•••• 'I' •.•••••••••••••.•.• c .... ------...... c ...... G-·sciU9 ..... - ...... , .. , -. , ... , •..... , • T. , . T .....•...... •.• C ..... -----, ••.•.• , •. , ••..•.•.•.•.•..•...•..•• , • G_eig34 •• , .• -., ..•• , .••• - ••••.•• , , ••••• T •••.•• , , • , ••• , •• , .• C ••• ,.----- ••••••••• ,, ••••• , •• ,, •• , ••• ,.,.,,., •• G_scep5 • . , .A- .... - .C .• A.- ...... •...•. T ..•.•... C.,., ..•.•• C ....• ------•.....•• , •...•. , ...•• ,, .•.... , ...... E 13 •.••. - ••..•..•.•• - .••..•..••.••• T ••.•••.••.••.••..•. C ••.• ------..••.•••.••.•••.••.••.••..••...•.••• G-ffc89 ..••• - •..•.•••.•• - •• , •••.•• , •••• T ••••• , •• , •••• A ••••.••.••• -----., ••• ,.,., ••.•••.•• ,,., ••••••.••• ,.,. E 23 ...•. - ..•...... - •...•.•.•..•. AT •..•.•...•...•..••..•..•. -----..••..•...•..•..••.....•...•.••...•.• E 9 ••... - .•...... - •...•.•.•.... AT .....•...•...•..••.....•. -----, •• , .•• , •...•• , ..•. , .•.•.•.• ,., ...•.• E 10 ••.•. - ...... •.. - ...•.•....•.• AT ..•.•....•.•...•...... •.• -----.•...•...•.••...•...•.•...•.....••... E 7 ..•.• C ...... - ...... •.•.• AT ....•...... •..••....• ----- .•.•••.•...••••...•...•.•.••.•.•...•. G scill2 ..... - •. , •. , .• , .• - ... , .•. , ...•. AT .•...... •.•. , .• , .•. , .•..• -----., •.• , •.• , ••. , .•.•. , ..• ,,., •.. ,., .•.• G-scillJ .••.• - ..... , .. , .. - •.. , .•... , .•. AT .....•...•.. , ...••. , ....• -----•.•...•. ,, .•.•.• , •. , .. , ••. ,., .•. , .••• E 30 ..... - ..•..••..•. - •...•...... •. AT ••.• , ....•...•..•...•..•. -----.,., ..•. , .•.•. , .•• ,, ...••.•••....•. ,. G=epc54 ..... - ....•..•..• - ...•...•.•... AT .....•...... , .••.•....•. -----.•••..• ,,., .•. , .•. , ..• , •.....••• , ••• , G f fc92 ..•.. - .•. , .. , .... - .•• , .•...... • AT .... ,., .•. , •• ,, .. , .• , ••.. ----- .•• ,, •. ,,.,, •••.•• , .•.•. ,, •••.. , .• ,,. G ffcl05 ..•. , - •.... , •. , .• - ••. , ... ,.,,, •. T .• , .• , ..•.•. ,, •• , •...••.• -----,.,, •. ,, .• ,, .• , ••. , ••. ,., .• , •.•.• ,, .• E 26 , .. TA-,, .•.• , .C.A-A, .•••.•.. , .•. T •• , .• ,, .•. ,., ••..•. , .• , •• -----, •. , ••. , .•.•.• , •. ,,.,.,., .•.•. , .• ,, .• G eig41 .•... - .... , ...... - •..•••.....•.. T ...•...•.•... A ..•....•.•. -----•.•.•.••...• , •.•. , ...•. ,, .• ,., .. C.,., G=scilll .•..• - •.•..•.••.. - •...... •.•.. T ..••...... •...••.....•• -----••.••..•...•.•...•.•.•...•.••.•.•.••. E 4 . . .. A- .... - ... C .. - ...... , ..... T ...... , .... , ... , .. -----...... , . , ...... (:epc60 . , .•. - •. , ....•.•. - ..•. , ...... , .• T ••. , .•. , .. , ... , .•..•• ,' •. -----•.•.•.• :,, .• ,, ...•...• , •...•. , •...•• , G scillO •.... - .. , ...... - .•...... •. , .•. T, .•... , •. , .•.•... A.C ..•. ------, ••.. ,.,.-,, ...•. , .•• ,.,, .•...• C •. ,. G scil2 •.. , . -., .. , ...••. - .•..•... , . , .•. T •.•••.... , .•. , •. . P.•• C, ••• ------•••.••. ,.- ••• ,, ••.•••. ,., ••.•• ,C ...• G_eig35 ..•.. - .•.... ,.,., -., .•....•. , .•. T •.•.•. , ..•.•. , .•. A. C •. , •• ------•. , .• ,, •• -, •. , .•.• , ..•• , •• , •.. ,.,.,. E_B • , • TA- ••.••• , • C .• -A •••.••••••• , • T •.•... , , .....•. , , A. C •• , •• TTACC .•••.. , , •. - .•. , . , , ...•.••••.. , .•• , .•. E_20 CTCTA-.AA •. TC.AA.- .•. , .•. ,, .•.•. T, •... T ..• C.,.,,, .• , ... , .. -----.,., ...•. , •• , .•. , .•.•.. , •.... , ... , ••. E_21 -- .TA- .A .•. TC .A-.- .•. , .• ,, •. , .•. T ••... T, .•• , .•. , •. , .•.. ,., -----., .•.•...•.•.•. , .. , ... , .•. , ...... , ••. E_l7 T_T.TA- .A.A. TC, .A.-•...•.. C .•.•.• T .•.•. T.,., ....•...• C,. TT. -----•••.•.•.. ,., ••. , .•. , ...•. , ••...... •.• E_22 , , • TA- .A .. GT, .CAA- •..••.•.••. , .• T ...•. - .•.•.•..•.• --..•... ----- •••. , .•.•. , ..• , .C,.,., .•.•. ,,.,., .••. M_6 •...• - ..••. ,,., .. -., ....•. , .•. , .T •. ,., ... , .• , .•. , .• ,, ..... -----, •...•. , •. , ... , ... , .•.•. , ....•...•. ,. N_8 ..... - ...... - ...... M_4 • • • • • - •• , •••••••• - •..••• C •••. G •• T ••.•••• , ••••• A •••.•• TA ..• ---CC •• , •• T.,., ... ,. T., ... , ...... •. , TT •• N 1 •.• , . -, ••. ,, .•••. - ..•.•.••.•. G., T •. ,, •.... , .• ,, .. , ... TA .•. ---CC •. , •• T •••.•.... T .. , .•.. , •.. , ..... TT .• N_J ..... - .••...••... - ..•...... G •. T ••.•..•••.•..•.•.••• TA .•• ---CC ..•.. T., .- ••••.. TC .....••.••.....• TT .• M_9 .. , .. - ...•.•..•.. - .•...•...•• G .• T .•...... •..•••.... TA ... ---CC ••••• T ••..•..•• TC ••....•..•..••• , TT .. 11 7 ...•. - ••..••.•••. T .....•..... G .• T ••..•• , .•.•.•.•••••. TA ••. ---CC ••••• T ••.••.•.• T •••.••••••••.•.•. TT •. N 14 ••••• - .•••..•.••. - ••••••••••• G •• T •••••••••••• , ••••••• TA •.• ---CC .•.•. T ••.•••..• T ..•.••....•...••. TT •. M 10 •••.. - •.....••... - ••.••...•.• G •. T •....•.•...... ••.•• TA ..• ---CC .••.• 'r ...... , .. T •••••.•...•.•.••. TT .• E 1 . . . . . - ...... • - .• , .•...... G •• T ..••••••....••• , ..•• TA ..• ---CC, --G. T •.•.••••. T •••...... C •••... TT •• 110 120 130 140 150 160 170 180 190 200 G_scep6 AACTGCGAA_l\ACGAACAAACTCCCTAACCGA'fTCTCTCCTCCCAACCCATCC--TCATTCACTTTTJ\AACCCAAAACAATAAAACTCCCCCATGAAACCC G epc46 G=eig39 G_ffc94 E_5 G ffclOO •••• A •••••.••••••••••••. ,,., •••••••••••••••••••.•••• --••••• ', •••• • ••• ' ••••••••••• , •• , ••••• , ••••• , ••• ()9 ...... --...... c ... . G epc51 , ••••• A •••.•••••• , ••• , ••. , ••.••••••••• , •• , •., •••••• , -- ••• , ••••••••••• ', •••••••• '. • •• •' ••••••••••• , •• G--scil19 •••••• A ••••••••••••• , ••••••.•• , ••••••••••••• , ••••••• -- •••• ' ••• ' ••••• •' •••••••• ' • ••••.••••••••••• ,. •, G_eig34 • , ••.. A., .•• , ••..•••.• , •••. • •• • •.•••• ,,. •., •• , •••••. --., •• ,, •• , •• , •••••••••• , •••.•• , •• ' .• , •• , .• , •,,. G_scep5 .•• , , .A •...... , .•.••• • •. , ..••••.•••••.••...•. , ••.• , .--••...••••..••.••. , .••••• ,, .• , .•••.•••....•..• • E 13 • , .. , .A •.•.• , ..•..••.•..•.•..•..•.••.••••..•..•.•••. --.•..• , .•..••••• , .•••••.. , .•..•. , ••..•.• A ...• ,. G-ffc89 •.•••• A ••••••••••••••• , ••••••••••••••••••••••••••••• CC •.••..•• , ••.••• , .•• , ••••••..••. - ••••.••... , •.. E_23 !!:_9 ...... -- ...... c ...... E_lO ...... ' ...... --.... '.'.' .. c ... ' ...... E 7 ...... ' ...... ' .. '' ...... ' ...... --.' .. ' ...... c ..... ' ...... ' ...... G=scill2 ...... ' ...... ' .... '.' ...... ' ... -- ...... c ...... - ...... ' ...... G_sci 1.13 ...... ' ...... --...... c ...... - .. . E_30 ...... - ...... --...... c ...... ' ...... ' .. . G_epc54 ... ' ...... ' ...... ' ...... --...... c ...... G_ffc92 .. ' ...... - .--...... c ...... G_ffcl05 E_26 ...... --...... --...... c ...... A.----. G_eig41 .••• , ••••.•• , ••••••• , •• , •••••• , • • ••••••••• A •••• , • ••• -- •••• ' •••• , ••• • •• , •••••••••••••• , •••••••••••••• G_scilll E_4 • , ••. , .•••••• • ••••••••••••••••••••.••••••• A •• , •••••• -- ••••••••••••• • •• ' •••••••• , ••• • ••••••• , ••••• , •• G_epc60 G scil10 •.•.. , •.••...•.••..••.••. -- •.. G. C ••••.••.•. , ...... • --•••.•. , ..••••..•....•.•.• , ••••..•..• , .• , •••. ,. d::=scil2 ..•...... -- ..• G.c •....••...... --...... G_eig35 ••...•••.••.•••••..•••.•. -- •.• G.C .•..•••..•...•..•• ,--.•••.••••• , .••.•• , ••••••••...... •..•• ,,, •.... E_B • , .•. , , •• , •... , .G ••.•.••. -- •. , •• C.C .•.••...... •••••• --•••...••. , .••••• ,, •.•.•• , •••••. C .•• ------E_20 E_21 E_17 E 22 M-6 • , •••• A ••• ,., •••••. , ••• , ••••• • ••••••••••••••••••••• , --•••• , .••••• ', ••••••••• ', •., •• , •••••••••••••• '. M 8 M 4 • , .•..•.••. TA ..•• , •.•.• : ...•.• C .. TC .•.. , .•.. , •.•• , •• --.T .•...•..•• , .••..•.... , .••..•..••• T ..• , •.••.• M-1 • , ••• , ••••. TJ'l•.•••••••• , ••••••• C •• TC •.• , .•..•. , ••.••. -- •..•..••.•...•• , •.••••••.•.•. , ....• T •• ,, ..•. , • M 3 . . • • . . • . . . • TA .•••.•.• , .•...•.. C .• TC, •• , •.••..•..•... -- •••••••.•..••• , •. , .••.•. , ••..•.. ,. ,T ..•..• , ... M 9 .•..•••.•.. TA ••..•••.••.• , •.•• C .. TC ••....•••...••.•. --.•.....• , .. , •.•...• , •.••••. , •. , ••.• T .•.• , .• , .. M-7 •..••...• , .TA •.• G ••.• , •.••..•• C •• TC •..•...•• , ••. , ••. -- ...... ••..• , ... , •• , ••.••..••.••.••• T., ....•.•. M 14 • , •••••. , •. T ••.••••••••••••••• c .. T ••.• , .•• A ••.••• C •• --.A •••..••••..•.••••••.•••.••.•••.•• T ..•••.••.• N 10 .••. , ••.• , .TA .• T ••• , •• , ..••••• C .• TC ...•.••.... , •.•.. -- •••.•..• , .•. , •• , ..• ,, ...••.••.. ,., .T ..• ,,.,.,. E 1 •.•••.•••.• T •.•••.••••••.••••• C •• T ••••.•..•••••.••.• -- .•••.••.••...•.•••••••••.•.•.••..•• T •..••.••.. 210 220 230 240 250 260 270 280 290 300 G scep6 CCCCCTATGAACACAAAA-CCTTCCTTCACTTTCCCTCTAAAACTAATCCTAATAAACACTAAAAAAA-TTTCTCGTGACAGCTC-CATATAACCAAAAG G-epc46 ...... - ...... - ...... -...... G=eig39 ...... - ...... - ...... - ...... G ffc94 ...... -...... - ...... -...... E 5 •. , .-•..•..••.•••. -T, ••.•..••.• , .... A ..•....••....•..••.• T ..•....•. -- ••.•..••••••• , •. - •..••... , .• , •. G ffclOO •••.•.•••.•...•..• -T ••...•.••••••••• A •••••••••.•.•••••••• T .•••••... -- ••••••••••••.••• - •••••.•••••••• E 19 ••...••..•.•... , .. -T.,, ... , ..••••... A .••.•...• , .••.••.••. T ••••.•... --•••••... , •••.•.• - ••. ,., •••••• ,, G epc51 • , ••.••• , .. , .....• - ••.••. ,.,, •••••.• A .••••••..•••• , •••••. T.,, ••..• , .A .••.•• , •••.• , ••• -.,., ••• , •• , •• , G-scill9 • , , •.•••....••• , •• - •••.••.• , ••••••.• A., •• , ••••••.•••••... T •••.•... , .-.••• , •.• , •••• , •• - •.• ,, •• ,.,.,,. G-eig34 •...... , .. , ..... -.,., ..•...... •..• A.....••...... T ....•.... TA ...... , .. - ... , ...... G=scep5 , ....•.••..• , •••.• - ..•.••.....•.•.•. A., .••••.•.•••.••.•.• T •.•.•.••• 'rA., ••.....• , ••••• - ••••••• ,, •.• , • E 13 • • • • • -., •••• ,, •• , .- ••••••• , ••••••••• A ••••••••• , ••• , •••••• T ••••••••• -A •••••••••••••••• - •• , ••.•• , .... ,. G=ffc89 •• , . -- •....••..•.• -T,, ...•. , •••••..• A .••.••.. ,., •• , ••.••. T., .•....• -A ••••••.• ,.,, ..•• -.,.,,., .••.•• , E 23 . , •..•.. , ••...•••. - •. , ••••.....•...• A., •••• , .• , .•.•.•.••••. , .....•.• A •••.••.•.••.••.• - •••••• ,., .•.. , E 9 •. , ...•. , •• , .. , , •. -.,, •..•.. , .•.. A •• A.,,., ••.•.•... , •• , ••...... •.•• -A .•.• ,, ....• ,, ••• -.,, .•••• ,,,.,. E 10 •..• , •.• , , •. , •• , •• - •••.•• ·: •• , ••• A •• A •••• , •••• , •• ,, ••••••• ,., •••••• -A •••••••••••• ,, •• -,., ••••• ,.,.,. E_7 ••.. - .. ,., .. , , •. , .-•••..• , , ••.•••••. A .• , •••••.• , •• , ••••••. , ••••.... -A ••••••••••.. ,, .• - •• ,, ••.••. , •• , G sclll2 •.....• , •..•.....• -.,., .•.. , ••••..•• A., •.••..••••..••.•.•...•....•• -A .•••..•.••.••.•• -.G ..••..•••••• <~scill3 , ••.••.... , ....••• - ...•.••...••.••.• A ..••••...•.•. , ••.• , .••.••..•.. -A •...••.•...••.•• -.G •.•••.•..••• E 30 •....• , ... , , , ..••. - •...•.•....•.•• , • A. , ...•..•..•...•. , • , ..•.....•. TA. , ...... - ... , ... , .... , . G epc54 •.••.• , •..•.•••.•• - ••..•....•...•• ,.A., ...... •....••.•.••. , •..••.•. -A ••••..••••••. , .• - ••••.•• ,, .•••• G=ffc92 ...... , •. , .•..• - ..•...... ••..•. A •. , •••.•.•••• , •.•••.•. , •....•• -A ••.••• , .•••..... - ••.•• , •• ,,., •• G ffcl05 •.• , •• , ••••••••••• -., •• , •• , ••• , •• , •• A ••• , •• , ••••• ,,., ••• ' •• , ••.••••• - •.' •• , •• , •••• , •• - • •• •.'.,, ••• • • E-26 , .... c ...... - .. ,., ... , .. , ..... A •••••••• ,., •• , •• C ••• , •.•••••••• - ••• , ••••••••• , •• - ••• , •••••••• ,. G-eig41 , .• ---...• , •.•..•• - ..••..•...•••••.• A., ••••...••.••.•••••.••••. G ••.• - •.•••••••••••• ,.-•••.••• , .••••• G=scllll ••••• C •••••••• , ••• - ••• , ••••••••• ,,, .A •••• , ••••••••••••••••••••• G •••• - •••••••••••• , ••• - •••••••••••••• E 4 . ... . - .... , ...... - ... , .. , ...... A., ...... , ...... G .... - .. , ..•...... ,, .. -., ....•. , .. ,,. G_epc60 .... --..••.. , ••••• T, .• , ... , ...•• , •• AA ••••••••••• ,,, •••••• ,, •••• G •••• - ••••• , •• ,,, ••••• -·•• , ••••• ,, •••• G scillO , ••.• C ••... ,, .••.• - .•.•.••.•••••••.• A •.••• , ••••.•. , •••••...•...••••. - •••.••.•.••.••.• - •• , .C •••. , •••. G-scil2 , • , •• C •••••••••••• - ••••••••••••••••• A ••••••••••••• ,, ••••••• , •••••••• -., •••••••••••••• - •••• C •.••• , •• , G=eig35 , • , •• - •••••• , ••••• -., ••••••.•••••••• A ••••••••••••••••••••••• , ••••••• AC ...... - .... , ...... E 8 ------.••. '.,, •••• -., •.• , •. , •.• •. • • .A •• •. • ••.•.•••• •. • ••• , ••..••• • •. - •• , •• ,,, •••••••• - •• ,. • .•.••• , •• E 20 ..... C ...... -.,,, ...... , .... A .. , ..•...... ,, ...... , .... G .... - ...... ,, ..... , •. - .. , ..... ,, ... . E 21 ..... C ..... , ...... - ...... ,,, •.. A ...•.•.•.. , ... , ...... G .... - ...... •... ,.-...... E_l7 ••.•. C., ••.• , .• , •• - ••. , •.••••••••••• A •••••••••••.•• , ••••• , •• , •.••••. - ••.• , •••. , ••.••• - •••••••••••••• E_22 , ••••••••••••••••• - ••••••••••••••••• A •••••••••••••••••••••••••••.••• - •••••••••• , ••••• - ••••••• , ••••• A M 6 •••••••• , ••• , • ~ ••• - ••••••••••••••••• A ••••••••••••••••••••• , •• , •••••• - •• , •••••• G •••••• -., •••••• , •• , •• M 8 ...... - ...... ·-· ...... - ...... - ...... M 4 A.A •.••..••..•••.• - ..•••• , .•..•••... A ..••••••••... , •.••••• ,, ...•.•. --••••••.. , •• , ••.• A.,., ••• G ..••.• M 1 .. A ••.••••••..••.• - .. , ••.••.•.••.•.. A., •.••••••••• , ••.••.•• , •••.•••• - ••••••.••••.. , •• A •••• , •. G .••••. M_3 , .A •.•..• , .T ..•••• - •. , .•. , .••.•• , .•. A ••. , .• , •..••••.••••.•.. , ••..•.. - ••••.••••••• , ••• A .• , •... G .•••• , M_9 •. A •••••••• T, .•••• -.,., ••••••••••••• A •••••••••••••• , ••••• , ••••••.••• -., •••• , ••••• T ••• A ••• , ••• G ••• , •• M 7 •• A ••••••••••••••• - ••••••••••••••••• A, •••••••••••••••••••••• A ••••••• - •••••••••• , ••••• A ••••••• G •••••• M 14 • • A •••• , •••••••••• - ••••••••••••••••• A, •••••••••••••••••••••••••••••• - •••••••••••••••• A ••••••• G •••••• M_lO , .A •••••• , •• ,,.,,.-., ••••. , •• , ••••.. A., •••••.•••••.•.•.•.•• , ••.•.... - .•••••.• , ••..... A ..••. , .G .•.•.• E_1 .. A ..••...... - ...... •...•... A. C ...... G .... , . , ..•...... •. --...••... A ...... A ...... G .. T .. A 310 320 330 340 350 360 370 380 390 400 G~scep6 CCCCTTCATACACATTTCAGCCCAAATTGAAAAACGAAAACTTTCCCCCTAGAAGGAACCCCCCCC-TCTTTGTCCGTCCTCTCTTCCGC'rCCTAACGCG G~epc46 ...... '.' .. ' ...... ' ...... ' ...... ' ...... c ...... G eig39 • , ••.••...... •...•. , ',, •.•.•...•....••.••• ,., .....•.••• A •..• ,,.' •• - ••• ' ••... , •. , .•• , ••••..••.••..• ,. G-ffc94 ...... ' ...... ' .... ' ... c ...... ' ...... E 5 • , , .C ..• , •.•. G •. , ••. , •• , ... , .•.•..• T ••••••.• , .••.•.•.••. G ••.•..•.• -., •.••• , .••.• , .•• , •..•• , •• , •••.• , G-ffclOO . , .. c ... ,., .. G .. , •• ,, •• , .•.• , •.•• , .T., •• , •.••..•.••••••. G ••. ,., ••• C ..• ,,.,, .•••• , ••••. ,, ••.••.•.• , .• E 19 •••• C •••••••• G ••••••••••••.•••••••• T •••••••••••••••••••• G ••••••••• c ...... ,, .. , ...... G=epc51 •••• C ••• , ••.• G ••••••••••••.•••••••• T •••• , ••••••••••••••• G ••••••••• - •••• , •••••• , •••••••• , •••••• ,, •• ,. G scil19 .•.. C •...••.• G., ••• , ..•. ,.,, ... , •.. T •.•.•.•.• , . , • , ••••.. G .•..••••• -.,,, .•..••• , •. , •••.• , ••.• ,., ..••• G=eig34 .•.. C •• , •.• , .G ...•...••..•• ,, •• , ••• T., .•. , •.••. , ..•••..• G •• , ..•••• -.,, ••• , •••• , •..••.•. , ••••....•• ,. G._ seepS •••• C •••••••• G •••••••••••••••••• , •• T •••••••• , ••••••••••• G •••••• , •• - •••••••• , •••••••••••••••••• ,,.,,. E_13 , ••• C ••.. , •.. G •.•••••..••••. , .••••. T •••••••••••..••••.•• G., ..•• , •• C ••..••.•• , •••••.•••••••••••• , .•. , G_ffc89 ...• C ....•... G., ••..•. , ..••.•.•.••. T ..•.•.•..•• , .••.•.•• G., ..••.•. - •••••••...•• , .•.•••.• , .••. , ...••. £_23 , ... , , .. , , , ...... •.,,, ...... , ...... , ...... G., ...... - ...... ,.,, .. , ...... E 9 ...... •....• , •...... , ...... •..•...... ••••.•..••..• , •••. G ..•..••.• - ••..••. , •.•••••.••.••.•.• T,, ..••• E 10 , •.•••• , • , ••.••••••.• , •.••.•••••••••••• , ••.•••• , ••••••••• G •••• , •••• - ••••••••••••••••••• ,., ••• T .•••••• E 7 ••••••••••••••..• , •• , ...••.•••••••••••••.••••••••••••••• G ••••••••• C ••••••••••••••••••••••••• T .••• , •• G_sci112 . , • , • , , , ••... , ...•. , , .. , .•. , , •..•. , •••.•. , ..•. , •••.•...• G.' ••• , ••• - .•. •. • •.• , ••••••.• , •• ,.' .. , ••• ' •• G scill3 •••••••••••••••.••••••.•.••..•••••••••••• , •.•••••••••••• G ••••••••• C •• , ••••••••••••••••••••.•••••• , •• E=30 , ••••••. , •• , •• , , •••••.••..•.• , ••• , •• , • , •• , • • ••• , ••••• , •• G •• , •••••• - •• , •• •., ••••• , •• , ••••••••• ,,, •••• G_epc54 ..... ' ...... ' ...... ' ...... c ...... ' ...... G ffc92 .•••.•• , •. , •.•••.• , • '., •• , .••• ,., ••• , ••••••• ,.,, •••••••• G ••• , ••••• - •••••• ' ••••••••••••• ,, ••••••••• •. G-ffcl05 ...•...... •.....•.•.•..•.....•• , ••..•..•..•.•...•.•...• G., •.••••• CC •.... , •••••.• ,.,., •...•••.••...• E-26 •. , .•.•• , , ••••••.••• , .•••••••••••••• , •••••••••• , ••••• , •• G ••••••••• C ••••••••••••••••••••••••••••.•••• G-eig41 ...... G ...... ,., ..... , .... G .. , ...... - .•.... , ...•...... ,., ...... G ... ,. G-scilll , , •••.••.•••••••••••••• G •••••••••••••.•• ,, ••• ,••• , •• , •••• G •••••.•••• -,, •••••••• ,, •••••••• , •••••• G., ••• E 4 •••••••••••••.• , ••• , ••• G •• ,, ••••• ,, ••••• , •••• , •• ,., ••••• G ••••••• ,.- ••• , ••• ,.,., •• , ••••• , •••••• G., ••• G epc60 • , •••••••••.• , ••••••.••••••••••••••••••• , ••••••••••••••• G ••••••••• c ...... ,., ... , .. , ...... G-sci!lO .••. C •...••.••. ,., ••..•.•••..•• , .. , ••••••• , ... ,,, •...••• G., ..• ,.,,-•••• ,., •• , ••.••. ,., .. , •••. ,., •.• , G-scil2 , ••• C ••••••• ,., •••••••••••••••••••••••.••••••••••••• , ••• G ••.•• , •• ,-,.,., ••••• , ••••• , ••••••••• , •••• ,. G_eig35 •••• C •••• , •••• , ••••••••••••••••••••••••••••••.•••••••••• G ••••••••• c ...... , ..... , .... , .. ,., .... ,. E 8 , , .. , .•. , , , . , .• , , • , ••..•..••..•• , •.•.•.••.••.•• , •••.• , .A., •..•• , •• C ••• , •..•.••.• , ••.••..••.•. , •••••• E-20 ...•••••.•.•.••..•..•.. G •••••.••.•••••••••••. , •..•.••• , .G .•..•• , •• C .•.••.••••.••.••••• , .•••••.•••• ,. E_21 •••••.••••.•••••••••••• G ••• , ••••••••••••••••••••••• , •••• G ••••••••• C ••••• , ••••••••••••••••••••.•••••• E_l7 •••••••••••••••••••••••••••••••••••••••••••••••••••••••• G ••••••• , .c ... , ...... G ••••• E_22 .. , ... , . , ..... , ..... , .. , ... , , ..... , ...... , .. , •. , .. , .... G.,.,.,.'.-... ,. • .. , .. , ...... •,,, ..... ,,.,' N_6 •.••••.••••.••.•••••..•..••.••.•• , .• G, ••.••.•.•• , •. , .••. G ..••••••• -., ••• , .••••• , •.••• , ••..••••. , ••.• H_B ...... c ...... M 4 .•••.•....•.•.....•...•...•.•.•.•...•.•• , , ..•.••.••.. C.AG ..•.. , •.. C., ••.•. ,, .••.• ,,., •.• ,, •••• ,,, ••• M_1 ..••.•..•.••.•...•.•.....••..••..•••••.•....• , ..••••. C.AG ••.•. , ••. C .••• ,., .•..• ,., .• , •.. , ••• , •. , ..•• H_3 ' ...... : ...... c ...... c ...... H_9 ...... c ...... c ...... M_7 , •• T •••• , :T .. ••.... , •. A •••••••••• , •• , ••••••• T •••••••• C •••••••••• T.C •. , .• ,., ••..•••• , •. , .•• , .• , •.•• ,. M_14 •.•.•.••..••...•••.•...•.•..••••••••.•.•••.••..••..•. C.A •...... •• C ••.•...••.•.•..• , ••..••. , ••.•.•.• M 10 • • • . . • • . • . • • . • • . • • • • • . . • . • • . • . • . • • • • • • • • • . • . • • • , ••••. C •• G •• , .••.•• C .•••••. T •••.•.•••••. , •••• ,., .•••• E 1 ...... c .. G •••.••• -.c ...... 410 420 430 440 450 460 480 490 500 G~scep6 CAACTATAGGACTTCCAAACTCGGTAA'l'AAACTTT----TTTATP..ATCTGGGTGCTTCGCACATCACTATACAATGCTTGATCCATTCGCAGGGCCTCAT G__ epc4 6 G_eig39 G ffc94 E_5 G_ffclOO E 19 •• • ...... ' •...• , •• ,., •.•.•.•• , .. , •• ---- •. , ••• ,,, ...... ••••• , ••.• ' •... , •• , ••. , .....• , •• , .•• , .•. 'T .• G epc51 G-scill9 G_eig34 G_scep5 E 13 G_ffc89 ..•• , •. , ..•.....•....••....••.•.... ----•..••.....••••• , •..•.•..•.•.••.•...•••••• , •. T .•.•...•.•..•... E 23 ..•••...•••.•....•...... , .••.•••... ----•...•.•....• TC.- .••...•...••••.•.•.•...•.••.••..•....•• , •.... E 9 ...... ----...... c ...... E~lO ...... ----...... c ...... E 7 ...... ----...... - .... c ...... G scil12 ...... ····· ... ----...... ' ...... c ...... G scil13 ...... ' ...... ----...... c ...... E 30 ...... ' .... c ...... ' ...... ---- ...... ' ...... c ...... ' ...... G_epc54 ••. , • , •••. , ••••••••••••••.•..•••••• ---- .••••• G •.•••••••• C •.• , .••••••••• , •• , ••••••••. , •• , •• ,, ••••••• , G ffc92 ...... ' ...... ----...... ' ...... c.' ...... G-ffcl05 ••.•••••••.•..••••••.•••••••. G •.••• ----, .••••••••••••••••••••••••••••• G ••••••••••••••••••..••.••••• , E 26 G- eig41 G=:scilll ...... c ...... ---- ...... E 4 , , , •••..• , • , ..••..•••••. , , . , .• , ...• ---- .. -., .• , .•. A., .•.• ,., •• , ..•. •· .•.•••• , •• , •. '., ••••..•• , •• , •.. G epc60 G-scilla , , .• , •••..•..• , , .. , .•. , .•••.. , ..••• ----...• , •••• , •. TC.- ••• , •••. , ••.••. ,, •• ,., .•••• ,,, •.... , .A.A., .•• G-scil2 , , • , ••..•.....•.••.•...••••.•• , ••.• ----••••.•....•.•...••..•••.. , •.••.. , .• , •..••.••..•.••• ,.A.A., •• , G=eig35 •.•...... , ... , . , , • , •. , .•.• , ••• , •• , .----,, •• , •• , •.• ,.,, ••..•.•• , ••• , •• ,' ... , ..• , •• ,,,. • .•.• , .A .••.••• E 8 E 20 ...... c ...... ----...... E 21 ' ...... c ...... ' .... ----...... ' .. . E=l7 E 22 ...... - ...... -...... H 6 H 8 ...... c--- ...... T ...•.•.•..•.. T •• M 4 , • , .•...... •• , •• , , ...•. ACCTT.,. TCTT •.•• AT .ATC.,., .. , ••• , •. ,, •• , •• ,., .• C .• , ••••. T •.•.. , •• ,,.,, T •• 11_1 , •••••••• , , •• , , ••.••.... , •• ACCTT •.• TCTT ••.• AT .ATC .. - ..•.•.•... , .•••••.• , .•.. , ••.••. 1' .•.•• , •.. , •.. T •• 11_3 , ... , • , •.. , • , , .•••• , ... , , .. ACCTT .•. TCTT •..• A'l'.ATC •. - .••...... •..•.• ,., ••..•.. T .• ,.,, ••.•• , .T •. N 9 .••. , , ••.... , , , ••••• , .•• , , .ACCTT .•. TCTT .... AT .ATC .• - .•..••..•• ,,, •.•.. ,,., •• ,, •• , •. T •• ,.,, ••• ,.,, T .. M 7 , , ••••. , ••.....• , ••• , , • , ••. ACCTT, •• TCTT ••.. AT .JI.TC •• -.,.,, ••. ,.,,,.,.,, •••. , •. , ••••. T,., ••..••• ,,. T .• N 14 ..•..•• , , , ••.••• , , •.•••...• ACCTT ••. T-TT •... AT .ATC .• -- .•••.••.•. , ..•..•.•... C ....•.•. T ..•.•. , ..•... T .• !<1-10 • , .•.. , • , •. , , • , • , • , .•. , •.•. ACCTT .. ,TCTT •.•. AT.ATC .• - .••. , ••... , .•••••••...••.•.•... T •...... •.•. '1'.'1' •. E 1 T ••.••••.••••. , . , , •••. , • , •• ACCTT ••• CTTT. CC. , .••. , •• -, •• , •••••.. , ••.• , .•••. C ••• C. G ••••• , •. , , , , .... T, . 510 520 530 540 550 560 570 580 590 600 G_scep6 CGCTTGGTCACCTCGCTCTCCTGATCTTATAGACTGTTCTCATTCTCCCT-CCC-AACATATTTTAGGGGACTA------GCAAATCCTCC'fTACCGCC G_epc46 ...... -... - ...... ------...... G_eig39 ...... - ... - ...... ------...... G ffc94 ...... -... - ...... ------...... E_5 ..•. , .•...•...... •. , ...••.•...•.•• , ..•.••..•.•• , , • - .•• - ..••..••..•••..•••• ------A .• G. C •.•..••..•.•• G_ffclOO .... , ...... ••...... •.. - ... - ....•. , ...... , .• ------A .• G ...... E 19 ...... , ...... , . , .. - •.. - ...... ------A .. G ...... , ...• G_epc51 , . , .. , .. , ...... , , . , , ...... , ....•..... ,.,, .•.. T.-... - .. T ...... •...... •. ------A .... ,., .. ,., ...... G_scil19 ...... , ... , . , , ...... , ...... , ...... , .. , . , , .... , .. T.- •.. - ..... , ....•...... ------A .... , .• ,.,., .. , ..• G_eig34 ...... , ...... , , , .• , .. , ...... , .. , .• , .. A .. ,. T.- ... -., ...... , ..... ------A., .. ,., ..... ,., ..• G_scep5 , .. , . :, . , . , ...... , ...•...... , ...... , .T.- ... - ... ,., ...... G ... ------A ...... , .... . ED . , .... , , ... , .. , .. , . , , , .. , ...... , T., ... , .. , ... T .-.. ,-.,, .. ,.,, ..... ,, .. ,------A .. ,, .. , .. , .. ,, ... . G ffc89 ...... , .-... - ...... , •.• ------A ....•.....•..... T. E 23 ...... - .•. - ...... •....•••..• ------A, .G ..•...... •... , . E_9 . , , .. , • , , ••.....•.....•••.....••.••..••.•. C ••••• , • - ••• -, ••• , •••••••••••••• ------A .•••••.• , ••••..•.• E_lO ...... , ...... ', ...... C ...... - ... -, ...... , ...... , .. ------A, ... , ...... , , . , . E 7 . , ...... , , , . , .. , , •. , ... , ...... , ' ...... , . , , - ... -. , ..... , ...... , , ... ------A, , .. , . , , , .. , ...... G-scill2 , , , , .. , ', ...... , ... ' .... ,.,, ...... ' .. , .. , ... ,., ... - ... - .. , ..... , ...... ------A .... , .. ' ... ' ...... G scill3 . , .... , ... , .. , ... , .. , ...... , , . •, .. , ..... ,, .. , .. , .. -, .. - ... , ...... '. •. ------A ...... , ... ,,., .. . E 30 , , . , , . , ...... , ...... ' ...... ,, .. , .. ,,,.,,., ..... ,, .-., .-...... • .. • .. ------A .. ' ...... , .. , .. , •. G_epc54 ...... ••••••••••••..••..•..•••••.•••....•..• , .. - ••• - .••. , •• , .•••••.••.• ------A .••.••.•• T •••..••• G_ffc92 ...... - ... -...... ------...... G f£cl05 • , •• , , •. , , •• , •..•• , ••.•••.•••• , •• , ',., •• ,, •••• ,., .- ••• -., ••• G •• ,, ••••• , ••• ------., ••••• •' •••••••• • • E 26 ...... -... - ...... ------...... G eig41 •••••••••••• • ••••••• , ••••••••••••••••••••••••••••• - ••• - ••••••••••••••• G •• ,------•• , •••• T ••••••• ,.,. G=scilll , •• , •••••••••••••••••••••••••••• G ••••••••• , •••• , , • - ••• - •••••••• , •• , ••• G ••• ------••••••••• , •• , •• , , •• E 4 ...... •...... , . - .•. - .•..••.•...•... G ... ------A .....•. , ...... , . , • G epc60 •• , , •• , ••• , •..•••••• , ••• , •• ' •• • •••• , •• • •• ,. • ••• •' .-.' .- •••• , •• , ••••••• G ••• ------.'. • •• •' •• , •• , •••• • G-scillO 1' ••••.•..•...... ••••. C ...••• , ••••.• , ••• , . , , .•.••.. -T •• - .. , •• , •.•••.• , ••••. ------A,. G. , • , ••• , ••.•••• G scil2 T ••• , •• , ..•.. , .•••.•. C •••..•.•.••••.•..••• ,, •• , ••. -T .• - ••••• , ••••••.• ,,, •• ------A .• G.,,., •.•••• ,.,. G=eig35 T •••.••.... ,., ..•. ,, .c ...... ,., .. ,,, ... , ...... -T •. - ••.••.•• , •••••• , ••• ------A •• G •••••• ,., •• , •• , E B T •••.••.. , •.••.•••.•..•....•••.••..•.•.••.••.•..• C- .•• C., •.•••• , ••• , •••••• ------A •• G •••••• , •• , •..•• E 20 ...••.•...•..•...••...•.....•••• G ..••..••.••..•..• - ••• - ••••••.. , •.•••• G. , . ------•.••••• , •••.•.•..•• E_21 • , •••••. , •••••.••••••••••••••••• G ••••••••• , ••••••• - ••• -, •••••••••••••• G ••• ------•••••••••••.••.•••• E_l7 . , , •..•.. ,., .• ,,, •• , .•••••• , •.•• G.,,, •• , •• , •• , •• '.-••• -., •.•.• ', •• ' •• ••••• ------•••.• ,.,, ••• , •. , .• • E 22 • , ••• , •• , • , •••• , ••• , .••••••••••••• C •••••• ,, .• , •••• - ••• - ••••••••••••••••••• CTGACTAA •• , •••••••••• ,, ••• M 6 ...... ; ...... - ... - ...... ------...... M B • . , , ••••...•. , •.. , •.. , ....•• , , ••••• , ...... , , •.••. - .• T- •..•• , ••.•••••.•.•• ---GCTAA ••• G ••• , ••..•• , • , • M 4 • , ..•.••••..•.. , • , ••. , , •..••••••••. , • , ..•••• , •••• --T •• T •••.•.••.•••••• G .•• ---GCTAA ••• G .•.••.. , •. , , •• M 1 .•••••.•••.••.•••.• , .....••.••.•...••....•••.••.• --T •• T •.•••••.••.•.•. G .• , ---GC'l'AA .•• G., ••. , • , •• , , • , M_3 •••••••••••••••••••••••••••••••••••••••• T •••••••• --T •• 'f •••.• T ••••••••• G •• G---GCTAA •• , G ••••• T •••••••• M 9 •.••••• , •••.•.. , .• , ••..•••.•••••.•..•• , • T, , •.•. , . --T .. T •.• , . T .••• , •••• G. , G---GCTAA. , • G, •.•. T .•. , .••• M 7 •.••••• , .•••.•. , •••..••.•.. , •••. , •• , .•...... •. --T •• T., •• ,., .••.•••. G ••• ---GCTAA., .G •••.••••.•.•.• M 14 •.....•. , ..•.•..•••.••...... •••••••.•.•.•.. - ••••. --T •• T .••••••.. , ••••. G •.• ---GCTAA .•• G ••••• T •••••• ,, r-(10 • , •••••• , , ••••••••••• , •••••••••••••••••••• C •••••• CCT •• T ••••• , ••••••••• G ••• ---GCTAA .•• G .••.....••• ,,. E 1 •••.••••.••...• , , , , . , .••• T .• , •.••• ,, .•• , •. ,,, •••• --T .. T.,, •••••.•.• , •• G .• ------AA •.• G ...• , ••. ,,., •• 610 620 630 640 650 660 670 680 690 700 G_scep6 CCCTAAAAATGCTTGTTCTGGAGTTCGA--ACAGTCTATAGAGA--TACP.GTAGTTAAGAAAGGTTCGTTCTTT--ATCTTATGG-TTTCTATAATTAGA G epc46 G=eig39 ...... --...... --...... -- ...... - .. c ...... G_ffc94 ...... --...... -- ...... -- ...... - .. c ...... 8_5 , , , ••••.•.. , •. , •• , •• , , ••.•.• --•.• , ..•..••..• --•..••••.•.•..•.•.••• , •. , •••• TT .. , .•. , .• - .• C •.• C •.•..•• G_ffclOO , , •. , • , , •• , .. , .••.•• , ...••. , --, , • , ..• , •.•••• --..••.•.••• , •• , • , . , •. , • , .•••• TT .••.• , •. , -. , C •.. C ... , ••• E_)9 , . , • , •.•. , , •. , .••.•• , • , .•.. , -- •.• , •• , •• , •. , . --...•.•.• , .•• ·, •• , , .•.•••••••• TT. , .•••••• - •• C. , , ••..•••• G_epc51 ...... --...... --...... -- ...... - .. c ... c ...... G_scill9 ...... --...... --...... --...... - .. c ... c ...... G eig34 , •••••• , , •• , , • , , • , ••• , •• AT •. GA •.•• , ••.•• ,, .• -- •. , •••••. , ...•...•.•.•. ,., •• --•.•... , .. - .• C ••• C ••• , ••• G=scep5 ...... --...... --...... --...... - .. c ... c ...... E: 13 ...... -- ...... --...... --...... - .. c ... c ...... G-ffc89 T •.•••.•.....••.•••.••...... -- ••..••...••••• -- •.•••..•..•••.••..••••.••••• -- ...••..•. - •• c ... c ...... E 23 . , .•..•• , • , . , .• , .•. , ...•.... -- ••. , .••.. , ..•. GA ..• ,, ••.• , ••• , •.. , .•.• ,, .• ,.--•.•. , •••. -. ,C •.•.•.•..•• E-9 ...••• , , , .• , •....• , •..••.•.• -- ••. , ...... -- •. GA .•....•.• , .•.•. , .•.••• ,, .•.• --••••. G ••• - •• C •• , ••••.••• E 10 , .....•. , •. , •.. , • , .•. , .• , ... -- •. , •.. , ••• -- .. GA •....•.••.••.•..•••.••.•••.• --••••. G ••• - •• C ••••••• , ••• E-7 •.•• , •••••••• , ••••• , ...•.••• --•••• , ••••• T ••• GA ...•••.•.••.•....•••••.••••• --••••• , ••• G •• C ••••••••••• G scill2 . , , . , • , .•• , •. , . , •.•..•..... , --•.• ,, •••.• --,.GA ...•.•.•.••••• , ••. ,., .•..••• --.•.••..•. - •. C ..••••.••.• G-scill3 , .•.•• , .• , , • , •. , , •.• , •..... , --..•. ,, •. ,.--,.GA •..•..••.••.•.•• , ..•.•• , ••.. --, .••.•••. - •• C., ... , ..... E 30 , ...•..•. , , . , •. , ..•.•...• , . , --, .. ,, •.••• -- •. GA., •.•.•••.•..• , ... C., •. ,, •.• T- •••.•.• ,. -.,C., ••• , •..• , G epc54 , ...•.•...•.•....•••••..•... -- .••..•...• --.,GA •...•.•.••••.••..•.• , •.••••. -- .••.•.••• - •• C ...••••..•• G-ffc92 •..•..•.•.. A •.••••.••..•...• -- ••.•.. , ••. --.. GA ••.••.• , • , •• , ••.•.•••• , ..•.• --.•. , .•.•• - •• C •. , C .•••••• G ffc105 ...... --...... --...... --...... - .. c ...... E 26 ...... --...... --...... --...... - .. c ...... G_eig41 ...... --...... --...... --...... - .. c ...... G scilll ...... c ...... --.... c ...... --...... --...... - .. c ...... E 4 ...... --...... --...... --...... - .. c ...... G-epc60 ...... --...... --...... --...... - .. c ...... G-scillO ...... --...... --...... -- ...... - .. c ...... G-scil2 ...... --...... -- ...... -- ...... - .. c ...... G=eig35 , .. , .. , ... , ...... , .A.,.,.--., ...... ,,.--...... , ...... --...... , .. - .. C ...... E_B • • • • • • , •• , •• , •• , , ••••• A •••.• -- •• , ••••••••.•• --••••• C ••••••••••••• , •••••••• --•••••• , •• - •• C •••••• C •••• E_20 ...... --.... c ...... --...... --...... - .. c ...... E_21 ...... --.... c ...... --...... --...... - .. c ...... E 17 ...... --.... c ...... --...... --...... - .. c ...... E_22 , , .• , . , , ••• , •.••.. , •..••.••. --.,G •••.•.. - •.. -- .• ,., .. , ••••.••..••• , •• , •••• --.••••.••. - .• C ..••.••.••• M_6 .....•.•••.••.•...••...•.•.. --•.•..••• G.-- .• --.••.•.•.•.••.••..••••••.••• c-- ...... - .. c ...... M_B , •••••••••••.•••••••••••• A .• -- •••••••••••••• -- ••••••••••••••• , ••••••.••••• -- ••••••••• -, ••••••••.• GA. M_4 , , , , • , ... , .• , •.. , .• , .• , , .• --GA, •. , ••••••• , •• -- •...• C .•.•. , •• , .•.•.•.•.• ,,.-- ••... , .•• - .• C., ••.• , .GA. M_1 ..••.•• , ....•. , .•• , .•.••. A--GA .••••.•.•...•. --., .•• C •••••••• , ••••••.•••.•• --••••••••• - ••••••••••• GA. N 3 , •• , •••• , •••• , ••••• , ••••• , A .GA. , .••• , ....••• -- .•••• C ••••••.••••••••••• , •••• -- •• , • , ••• --. , • , .G •• , •• GA. M_9 •..• , . , •• , .••.•••••.•.•... A. GA ••• , ••••• , . , • , --, ..• , C •.•••••.•...••.•...••. --..•..•• , --.••.• G •.•• , GA. M_7 , , , •.•• , . , •. , .•....•.••• e---GA •••.•.•.•.• , •• -- ••..• C .•• ,, ••••.•.•.•••.••• ,--..••••. ,--..•.•••.••. GA. M_14 , •••.•.• , .. , .. , ..••...... • --GA .•..•.•.• , •..• -- •.•.• C .•• , C •.•..••...•..•••• -- ••••••. , --••.. --•.•.. GA. r.l 10 , .•••• , •.•..•. , ••••••...•• --GA •••••••••. , ••• --•.... C ••. , •••.•.•••.•.. , •• ,.--••.. CG .• -- ••• -- ••••.. GA. E 1 , , ••• , .••.••. , . , •.•. , •.... --GA ••..••.••.••. , --•.••• C. , ••• , ••.••• , •.••••..• --G. , , C. , • -- •. , ••...•. , GA. 710 720 730 740 750 760 770 780 790 BOO G_scep6 A-TGGT-AAGCC---TGCCCTGGCTAGT'l'TCAGCAAAGTCACAAGTGGTTTCT-CGGGCCTCACCTTTCTTAATTCGCTTGGTGAGACAGAAAATAATTC G epc46 .-.. , .- •• , .. ---.,.,'.A •...•.• ,.,, .. , ... ,,., •.. , •.•••. - •. ,., ••.••••.• ,,., ..•••.• , •••.•..•. ,., ..... , •• G-eig39 . - .... -...... - ...... ' ...... G-ffc94 . -, •.• -., .. ,---.A •. ,., .• , ••••...• ,, .•.••••••.•.. , .C .• -.,,, T, ..•...•.•• , ••.••.. , •••..••.• , .• , •....••• • -s .- •••• - •• A •• ---, ••• , ••• 'I' •••• , ••• A, •.•• , •• A •••• A ••••• C- •••••••••• , ••••••••••••• , ••••••• , •••.• , .••• , •• G ffclOO • - •••• - •• A •• --- ••• T •••• T •••••••• A ••• , .C •• A •••• A ••••• C- •• , ••• , •••• ,., ••••• , •••••••••••• ,,,,., ••• , •• ,. E-19 . - •... - .. A .. --- •••..••. T ••... C •• A ..••.••• A ...• A .•••. C-T •• , .••••.•. , •••.•. , ..•• , •.••.••..•.••...•. , •. G epc51 • - •••• - •• A •• ---•••••• ,. T .G •• , ••••• , •••.•• A •••• A ••••• C- ••••• , •••••••••••••••••••••••• , ••.•••••• , ••• ,. G-scil19 • -, ••• - •• A •• ---••••• , •. T .G •• , •••••••••. , .A •••• A ••••• C- ••• , •••••••••••••• , •• , ••• , .••• , •••••••.••••••• G-eig34 . - •.•• - .• A .. --- ••••.••. T .G .•••• G., •.•••.. A ••• -- .••••• - .•••. , •• , .•• , •. , ••...••.•.••••.. ,., ... , .•...•• G-sr:ep5 • - ••.. - •• A.,--- .•...•.• T .G., •••••..•.•• , .A •..• A .•••• C- •... ,, ..••••..•• ,, •.••••.••••.•• ,.,, .•••.•..• , E:-13 .- •••• - •• A •• --- ,A •••••• T ••••••••••••••••• A •••• A ••••. C- ••• , ••••••••••••• , •••• ,., •••••••••••• , •• ,, •••• G ffc89 . - ..•• -.GA •• ---.A ••••.• T. G .•...•..•..•..• A •••• A .•... C- ••.••• , ••.•• , ••... , , ••.•••..•..••• , .••...•.••• • 23 . - •••• - •• A .• --- .P..••• , .T ...• ,, ••••. , •.••••••••• A •..• TC- •.. ,, ••.••••.••• ,, •• ,, •.•• , •••. , .• , .•. ,, .. ,, •• • -9 .-.•.. -.GA .. ---•.•..•....•. ·: •••.•• , •••••..•.•....•. C- .. ,,, ...... , ...... , ...... , .•...... E--10 . - •.•• -.GA .• ---•.•..••...... ••.. , .••.•..•••.•..••... C-, •.••• , ••..• , .••.•• , .. , ••••.•. ,.,., .•.....••.• E-"7 . - ••.. -.GA .. ---••..•.•..••..•.•••..•.•..•...•• ,, ••.. C-G ••..••.•. , •• , ••••. , .•••.•..•.. A ••••• , •• , .•••• G scill2 .-.•.. -.GA •. ---..•..•.••••.•...••• , ••.•.•. ,, •..•.... C-., ••. , •• , •••••.•.•••• , •• , .•• , ••• ,,, .••.••..••• G-scU13 .- ..•. -.GA •• --- ••••.••.••.....••..•••....•.•...••... C- ••••.••••••.••..••.••••.•••••••••••.....•...•• • 30 .-•••• -.GA •• --- ••.••.•...... •.•• , •..•.•.••.. , •.••.• C-T .. , •••.•••.•.•••••..•••••.••••• ,., .. , ••.....• G=epc54 ,-,, .. -.GA •• ---.,,, .••••....•• T .. , , ..•...... , ...... C- .•.•. , .• , .•...•...... , .. ,, ..... ,,., ... , .A .... . G ffc92 .-... ,-,GA .• --- •••..••...... •• ,, ..••••.•• , •••. ,, •••.. -., .•. , •••.•••••••.•.•••••. , ..••• , .••.•...•.••• G ffc105 • -.,,.-.GA .. --- .. ,, .. , ...... , ..... , .... ,, .... ,., ... ·.c-, ... , ...... ,., .. ,,., .. ,, ..... ,,, ..... , .... . E-26 .- ••.. -.GA •. ---, .• , .••••...•••••.•••..•••.••..••.••• C- ....••..•...... •...... ••...... G eig41 • - •••• - •• A •• ---••••••••••.••••••••• , •••• G ••••••••• C •• - ••••••••••• , ••••••• , ••••• , •••••• , ••••••.••• , •• G=scilll .A ..•• -, .A .• ---.A ••• , ••.•..•••.••• , . , •.. G •.••.. , •.•• , - .••. T •••• , •• , , ••.•• , ••••••..•••• , .•. , ••. , • , , •• • 4 .- ••.• - •• A .. --- •••.••. ~· .• , •.• ,, •••••. , .G ••••.•.•..•• - ••••. , •..•.•••.•. ,, •••••••.••••••..•• , .•...• ,, G-epc60 • - •••• - •• A .. ---•••• , •• , ••. , •••••.•••••.• G., •..••••• T. - •.•• ,, •••• ,, •••.•• , •.•••• ,, ••••• , •••...••..• ,. G-scillO .-•••• - ••••• ---•••••••••••.••••••••••••••••••• A ••••• c-...... G_scil2 .- •••• - .•••• --- •••••••.•••.•••••••••.••••••••• A ••••• c- ...... G_eig35 .- •••• - ••••• --- •••••••••.••••••••••••••••••••• A ••••• c-...... E 8 .-,, · .-••... ---. • • • .••.••.••••••. ,., ••••.•.•.• A .•••• ,-, •• ,T, .•• , .. ,, .• ,., .••••.• ,,., .• , .•. , ,., , . , , ••• E-20 .-., •• - •• A •• --- .A ••• ,, •••• ,, •••• ,, •••••. G ••••••••• ,.,-, •• ,, ••••• , ••• ,., •••••• ,., ••••• ,,., ••.•• ,, .••• E-21 • -. , .• - •• A .• ---.A •.. , , •...••••...• , , •• , .G ••••••.••• , . -. , .• , , .• , •. , ••• , •• , , ••••• , ••••• , , • , , ••..•.••• , E 17 • - •••• - •• A •• ---•••••••••••••••••••••••••••••• - •••••• C- •••••••••••••••• , ••••••••••••••••• G .•••••• , ••• E 22 • - ••• C- •. A •• --- •• , • , ••.••••••••. , • , •••• , •.••••.••• , .• -A •••• , ••••.••••.••.•.•••••• , , ••• , • , ••.•• , ..• , • M_6 .-.... - ..... ---...... c-...... M_B G- ..•• -G.A. TCAT .ATT •. A ••••••••••••• G •. , , ••..•• AA.A, • CA •..• T •..•••• , , .•.• , , .• , •.•••• , •• , ....•..•... , • M 4 G-, .•. -G ••. TCAT. --- .. A •... , •••• T.,, .. ,, .•••.•• AA.G .. C- ••. ,T, ..• ,, •. , .• , .•.•• , •• ,, •.• ,., .....•. ,.,, •• H 1 G- •... -G.A.TCAT.ATT •• A ••..•• , ••••.• G.,, •••••.. AA.A •. CA .•.• T ....•....•••.•..•...• ,., .•.•.... , •...• , •• M 3 G- ••.• -G---TTAT. --- • • P..T •• .•••••••••••• , T ••.•.. AA .A •• C-. , •• T, •• , •...•• , .•..•. , .• , •• , •.. , ••.• , ... , •• , . ., 9 G- .•.. -G---TTAT. --- .. AT •..••••.•.. , •••• T ••..•• AA.A •. C- .••. T .•••.... , •..•. , •...• , , ...••.••••..••... , • 11 7 G- •.•• -G ••. TTAT. --- •• A. T •• , ..••••••••.••••••.• AA .A, .C-TA •• T •• , .• , •.•.•.••..••••..•••.•• , ••.. , .... , •• N-14 G- •••• -G .•• TTATC--- •• A ••...•.•••.••.•.• , •••••• AA. A •. C-T •••..••••• , .••..• , •..•••.• , , ••••. , .. , •...•••• >1:::10 G- •• , .AG. , • TTAT. ---, .A •.• , ..•••• , .••••. , • , • , •. AA.A •• C-., •• T .••••.• , .•• , • , , •• , •• , •••.•• , •• , ...••••• , . E_1 G- •••. -G ••• TTATC--- •. AC •••.•• - •.• ••••.••.•••••• AA.A •• C-, ••••••••.•. , •••••. , .•.••.••••••••••••..•...•• 810 820 830 840 850 860 G_scep6 CTGTCATTTATATAJ1.ATGGTGTTTTGATTACACCAAAAGCTAGTTTAT-TAAAl1.TAGCTACTTT G_epc46 ...... - ...... G_eig39 ...... -...... G ffc9'1 ...... -...... E 5 ...... c ...... - ...... G ffclOO ...... c ...... - ...... E_l9 ...... c ...... - ...... G epc51 ...... c ...... - ...... G:=scill9 ...... c ...... - ...... G_eig34 ...... c ...... - ...... G_scep5 •••.•.•....• , •• , ••. , •... A. C .• , •..••.•....•••.... G ••••••. --.••. C. E_l3 ...... c ...... - ...... G_ffc89 ...... c .. : ...... - ...... E 23 ...... c ...... - ...... E 9 ...... c ...... - ...... E 10 ...... c ...... - ...... E 7 ...... ; ...... c ...... - ...... G_scill2 ...... c ...... - ...... G_scill3 ...... c ...... - ...... E 30 ...... c ...... : .. - ...... G_epc54 ...... c ...... - ...... G_ffc92 ······················ .... c ...... - ...... G_ffcl05 ...... - ...... E 26 , •• , • , •• , •••••• , ••••••• J1•••• ,,,., ••• , •••••• , •••• G-- •.•.•.•••••• ,. G=eig41 ...... - ...... G sc.ill1 ...... - ...... E 4 ...... -...... G_epc60 ...... -..•...... G scillO ...... c ...... - ...... G-scil2 ...... c ...... - ...... G_eig35 ...... c ...... - ...... E 8 ...... , ..... , ...... c., .. , ... ,., ...... , .. G--., .. ,, .... , .. . E 20 ...... ·...... - ...... c. E 21 ..••..•.. , ••.•. ' ••• , .. , .•• , •• '.,,, ••••.•••• , .. , .-.••••.•••. G.,.- E_l7 ...... - ...... E_22 ....•..•...•....•.• , •..•.• C .. T ••.•.• , ••.•.•.... G-- .•.•••••..•... H 6 ...... - ...... t1 8 .•.••••... , .• , , .•••. , , .. , .C .A. T •• ,, ...•.. , •.... , - •..... , ...... •. f-.1 .4 , ...... •...•....••....•..• C.A.T •.•.••..... , •. , •. -., •. ,,,,,,., •. , M 1 .....•...•.•••..••.•..•... C .A. T .•••.. ,,., ..•.• ,.-.. ,.,, .• , •• , •.• M 3 ...... ••.•... , ••.•.. , ••• C.A.T ..•• , .. ,., •.•••.. - •• , .• , ••.••... , t-l:_9 • , •••••.•••.•...•.••...••• C.A,T ..•.• , ••••••.•..• - .. ,, ••••••• , •.• M 7 •.••.••..... , ••.•• , ••••.•. C.A.T., ••• , .•.•.••...• - ••••..••• , , •. , , M 14 ...... C.C .T.,, ...... ,.,-, ...... ,. M_lO ••...••...••.•. , ••••••.••• C.A.T •..• , •••••.••••.. - .•• , •••••••••.. E 1 •••••.••..••... , •. - •••.••• C.C,T •..•••••• ,, .•••.• -.G ••••• , •• G ••• - Appendix 2. Mitochondrial COl sequence alignment from Isostichopus fuscus and various other sea cucumbers. All sequences are aligned according to P_parvimensis sequence. A"." indicates concurrence with P_parvimensis and a"-" indicates a gap. Numbers above alignment indicate position in alignment. 10 20 30 10 50 60 70 80 90 100 P~parvirnensis ATGAJI.ACTAAGACGCTGJ'l.CT'i'TTTTCTACTAAACACAAGGP..CA'l'TGGTACACTTTACTTATI.TTTTTGGAGCATGAGCAGGAATGGCTGGAACAGCCATGA P~californicus E 7 ••••• CT •.•• , •• T, •.••• , ••••••.•..•••••••••••••••••• C •• A ••••.••• A ••••.•••••.••••••••••• T .••..•••• A •••• E 9 ••..• CT. , •• , •. T .• , •• , •• , .•••.••.••..•..••..•.•.••. C •• A •.•..••• A .••••••••..•••.•••.••• '1' ••••••••• A •.•. E 10 , , , • ,CT •.•.••• T •..•..•• ,, •• ,, •• , ••.•••..•..••..••. C •• A ....•.•. l\ ...•..•.•...... •.• T ..•••..•• A ••.. G~50epc • , , •• CT.,., ••• T •.....•• , .••• .' •• , ••••••••••.••.•••. C •• A ..••..•. A ••••.•••..• N •..•••...• T .•••••.•• A .••. E 8 ..••. CT ..• , ••• T ••••..••..••.••..•••••••••••••••••• C •• A •••••••• A •••••••••.••.••••••••• T •..•.•••• A •.•• G_46epc ..... CT,.,, ••. T., •...... •..•...•...•.•••. C .. A .••..•.. A •...•.•...••...•.•.... 'I' ..••••••• A ..•. M 4 . . • . . CT ••••• , .T.,,.,, ••••••.•••.••.•••••••••••.••• C •• A •••••••• A •••••••••••••••••••••• T ••••••••• A •••• G 85 Elc ..•.. CT ••...•• T •••••••••••••••..••.••••••.•••••••• C •• A •••••••• A •••••••••••••••••••••• T ••••••••• A •••. 1'1_15 . , • , .CT •..•..• T ..••..•• ,, •• , •• , ••••••.•••.••..•••. C •• A ••.••••• A •.••••••.••••••••••.•• T ••.••••. . l\ .•.. G_41eig , •• , .CT .• , •..• T ..•.. ,.,,, •••••••••..••.••..•••••.• C •• A •••••••• A •••••••••••••••••••••• T ••••••••• A ••.. E_5 .•. , .CT •• , ••.• T., •...••.•••..• , .•• , •••••• , •••.•••. C •. A •.•••••• A ••.••••••••..••..•••.• '1' ••••••••• A .••. G_34eig . , . , .CT.,, •..• T., •...... ,, •..•••.••..•... C .. A ...... A ...... T ...... • A ... . G_Slepc .•.•. CT •.•• N .• T, .• , , ••••••••••••••.••••••.•••••••• C •• A •••••••• A •••••••••••••••••.•••. 'I' •••.••••. A ••• , t·l 14 ••... CT •..• ,,. T., •. , ••..••..••..••.•••••.•••..••.• C .• A •.•••••. A ••.•••••..••.••.•••.•• T ...••.••• A •.•• E 11 ••••• CT •.••..• T ..•..•• ,, •• ,,, •••••••.•••.••••••••• C •• A •••••••• A •••••••••••••••••••••• T ••••••••• A •••• H 1 • • . • . CT •.••.•• 1' .••..•.. , •• , ••••• , •••••••.••.•••••• C •••r.. •••••••• A •••••••••••••••••••••• T ••••••••• A •••• G 2scil , • , , .CT ..•• ,, .T .••. , •...••.••.••. , •• ,.,., ••.•••••• C •• A •••.•••• A •.••.•••••..••••..••.• T ...•..••. A •..• G=39eig • , , •• CT •.•• , •• T .••..••.••..•• , ••..•• , ••••••.•••••• C •• A •••.•••• A .••••••.•••.•.•••••••• T ••••••••• A •••• C curata ...... T. , . AC .. , ... T, A ..••• A ..... C ...... • T ..••.••.••••.•. C. TC. A ..•.•••. C •..•...•.•... TC .. G ..... A ... . C-lubrica-- .... , .... , T. , . AC, . , , •. T. A ..•. , A ..... C ...... , • T ••••.••..•.•••. C. TC. A •••..... C .•...... TC .. G •.... A ... . C-- lubrica 1 , , .. , ..... AC .• , , .. T, A, •••. A •...• C ...... ••.... C •• C .•• C. TC. A .••••••. C •.•••.•..••.• TC .. G ....• A ..• , C_piperata , , . , , ••. , .AC ...... T.A ..... A.,,, .C ..•••...•..... A ...... •. C.TT.A ....• T .. C •.••.•••.••.. TC .. G ....• A .••• C miniata 1 . , , • , ••. , .AC. , . , •. T. A. , .. , A •..•• C ••...•...... A •.••• C ... C •• C .A .. C .• T •. C •.••.•••.•.. ATC .• G .•••. A •.•. C_miniata_1 , .•..•• , •• AC •• , .•. T .A, •••. A •. , •• C, •• , •.•••..... A ••••• C ••. C •• C .A .• C •. T •• C •••••••••••• Jl..TC .• G ••••• A •••. C_pallida .... , .• , •. AC ••.•.• T. A ..... A ..... C •• , •• , .....•.. A ..... C ... C .. T .A ..... T •. C •.•...... •.. ATC .. G .•..• A ... . C_vegae • • • , •• T ••• AC •• , ••• T .A ••• , .A ••••• C •• , , •.•••••••• A •.•....•. C •. C .A ..... T •• C ••••••••.••• ATC •• G •••.• A ... . P mollis ..•...... A •.. A· ••..• A .•• , .A .. A ..... T .•.•. T .• A •. A •. T •.•••.••. T .A .•.•.... C ...... T .•. ATA ..... T .. A ... . 110 120 130 140 150 160 170 180 190 200 P_parvimensis GTGTTATTATTCGGACAGAGCTGGCCCAACCAGGCTCCCTTCTTCAAGACGACCAAGTTTATAAAGTTGTGGTAACAGCCCACGCTTTAGTTATGATATT P_californicus '., •• , .• , •...• , .••. A., •• , ••.. , ••••• , •• , .. , .• , •••••••••••••• , ••. , ••• , •••• , •• , •• ,.,,, • ••••• ,, •• •., •••• E_7 .A ... , .. , .... A ..... A.. A.. T.,., .. , .A .. T .• A... , .... T ...... A.C ... , .C .. A.. T., ...... T .. E_9 • A .••••• ,, .N.A ..•.. A •. A •• T.,, .••.• A .• T .• A ..•.••.• T .•• , •. A.C .•... C .• A .• T ••.••..••••.•• , ••• , ..• ,., .T .. E_lO .A •...•• ,,., .A ...•. A .. A .. T •.. , ••.• A .. T .. A .••.•••• T., •••. A.C ..... C •• A .. T ••.••••••• , •.••.••••.. , ••. T •• G_50epc .A •••.••..••• A., •.. A .• A •. T •..•••.• T .• T .• A .•••.... T •••.•. A.C ••••• C •. A .• T ••• , •••.•....•••.•• , .•••.• T .• E 8 .A .••.••. , •.• A .•••. A •. A •. T •• , •.•.• T .. T .• A .•• , ••.• T .••••. A.C .••_ •. C •. A •• T ••..•••.••. , ....•.•... ,., .T .. G_46epc .A ••.•...•••• A .•... A .. A •. T ••.•.• , •• ,. T •• A .•••••.. T •.• , .• A.C ••... C •• A •. T.,., ••..••...••••••••.•••. T., M_4 • A •••••• , •• , .A ••••. A .. A •• T ••••• , , ••.• T •• A •••••••• T •••••• A.C ••••. C •• A •• T •••••••••••••••••• , .• , •••• T •• G 85flc .A ••• , •• , • , , .A ..••• A •• A. , T •.• , • , •••.• T, .A, •• , • , .•. T ••••• , A.C ••... C •. A •. T. , , ••..•. , ..•••.•. , •••.•.. T •• M 15 .A •• , .• ,, •• , .A ••••• A .• A •. T •• ,, •••••.• T •• A ••• , •••• T ••• , •• A.C .•.•. C •. A •• T •.•••• , •• ,, .•••••••.•••••• T •• G_4leig .A •...... •• , .A., ••. A •• A •• T •..••...... T .• A •••••... T •.•••. A.C •.... C .. A •• T ...... , ... T .• E_5 .A ••••••••••• A, •••• A .. A •• T •••••••• , •• T .. A ••• , •••• T ...... A.C ..... C .. A .. T ...... T •• G_34eig .A •• , •• , ••••• A .•••. A .. A •• T •• ,, ••.•• ,. T •• A ••• , •• ,. T .N., •• A. C .•••. C •• A •. T ••••.•• , ••• ,,, ••. ,, ••••.•• 'I', • G_Slepc . A ••.••• ,., •. A ..••• A •. A •. T.,,, •• , ••.• T •• A ••• , •. ,, T ••• , •• A. C., ••• C •• A .• T ••••.••.. ,, .••.• , .••••.••• T,. M 14 .A •• A •••••••• A., ••• A •• A •• T ••••••••••• T •• A ••• , ••.• T •••••• A. C ••••• C •• A •• T ••••••••••••••• , •••••••••• T •• E 11 .A •• , •• ,, ••.• A., ••. A .• A •• T.,, .• , •.. ,. T •• A ..•..• ,. T., •• , .A.C., ••. C •• A .• T ••••.• , •••• , •. , •. ,., ..•. , .T .. M 1 .A ...... •. , .A ..... A. ,A •. T ....•. , •..• T .. A ..•.••.• T •. ,,, .A. C., .•• C •• A •• C ... , •..••...• ,, •• ,,, ••.•.• T .. G=2scil • A •• , ••. , •• , .A, •••. A •. A •• T ••••••••• , , T •• A. , • , •••. T •••••• A. C ••••• C •• A •• T ••••••••••••• , •••• , ••••••• 'I' .• G_39eig .A •••••• ,, ..• A., ••• A •• A •• T •• ,., •••• , .T •• A., ••••.. T., •• , .A. C •• , •• C •• A .. T, •• ,, ••• ,,, •• , ••...•• , •... T .• C curata . A •• A •. A •• A •• A, , C •• AT, A •• A ••.•• T •• A, , T ••• , .• A •.• , T •••••• A.A., , ••• ACCA. A •• T, . , •• T, .•• , AC ..•• C, ••••• , . C lubrica 2 • A •• A.. A, .A •• A, , C •• AT .A •• A ••..• T .. A .• T .••..• A .•• , T •••.•. A.A •••••• ACCA.A •• T. , ••• T •.•.. AC, ... C. , •.•.•• C lubdca 1 • A .. A .. A .• A •• A, . C .. AT, A •• A ••••• T, • T, • T, •.••• A, ••. , •. T ••• A.A •• C ••• ACCA.A .. T .•••••• , ••• AC ••• , C •.••..• , C=piperata: , A .. C .. A .• A, .A, . C,. A •. C •• A •. , .. C .• T, . T •. A •.• A .•• , T •• , ••• A.A •• , .•• AC .A. A ... , .••.• , , •• , AC, . , , C •••..••. C miniata 1 .A •• A. , , , . C •• A, , C. , A •. C •• A. , ..• T, .A, , • , .A •.• A, .. , ••• , • , GA.A .. C ••• AC .A .A •• G, , •••• , .••• C •.. , • C .•• , • T, • C=miniata=2 . A •• A •• , , .C, .A, , C. , A. , C •• A., • , . T •• A, , • , .A. , .A, . , , , • , ••• GA.A .. C ••• AC .A.A •. G., ••••• , •• , C .•••• C .•••. T, • C_pallida • A ••.•• , , .C, .A, .••. A •• T •• A ••..• T .. A .•••• A •.• A •.. , , ••• , •. A.A •. C ••• ACCA, A •. T. , ••.••.••. C. , .A. C ••• , .C .. C_vegae .A .• G •..'A. •• C, • A, .C •. A •. T •• A ••.•• T. , A. , , , .A ••• A ••• , T, ••.•• A.A •• C ••• AC .A. A •• T ..••• T •.••• CC. C •• A ••••. C, • P mollis .••.••••.• A, .A, T •. , A,. TT .A .••••••• AA. T •.. T .A •••• , T., •••. A.A •...... A.A. A. , T, ...... C, . , .•...... , . 210 220 230 240 250 260 270 280 290 300 P_parvimensi5 CTTTATGGTAATGCCAATk~TGATCGGGGGATTTGGAAAATGACTGATTCCTCTAATGATAGGTGCCCCGGACATGGCTTTTCCCCGAATGAAAAAk~TG P californicus ...... A .. G ..... T ...... A ...... A ...... C .... , •. , ...... () T ..••.••.••.••. C •.••..•. A •. A •• C ••..•.•• C .•••• C •. C •.• T .••.••. T ••••. T .• T •.••.•.•.•• C .•••• , ••.•• c. ,c .. , T .•.•••• , •• , ••. CN .••.••• A •. A .• C ••....•• C ..••• C •. C •.• T •••.••. T •.••• T .• T., •••••••.. C •.••••..•.• C .• C .•. " 9 E:_10 T ...•....••.. , .C ••....•• A .• A •. C .••... , ,C, .••• C .. C ••. T ••••.•• T ••••• T .. T •••••••.•.. C •••• ,,., .. ·.C .• C ••• G_50epc T ...••.• , .••.•• C., ...... A •• A .• C •• , , .•.• C .•••• C. CC •• , T ••••••• T ••.•• T, . T •••• , •••.•• C .•• , •••.• , • C •• C ••• E 8 T •. , ••.••.••••• C ••.••.•• A •• A .• C .•• ,, •.. C •.••• C •. C .•• T, •••••• T .•••• T •. T ••••.••..•• C ••••••. , ••. C •• T .• , G_46epc T •• , .. , •. , •••.• C ...•.... A .• A •• C •••. , •.. C •..•. C •• C ••• T •••..•. T, .••. T .• T.G,, •.•. ,, .C., ••.•.. , •• C •• C, •• M 4 T.,, •.... , •• , •• C., .• , ..• A .. A •• C ••.••••. C •..•• C •• C .•• T •.••..• T., .. , T •• T ....•..••.. C .....•• ,N, .C .• C .. , G B5flc T ••.••••••••••• C ••.••..• A •• A •• C •..••••• C ••.•• C •• C ••• T .••.•.• T .••.. T •• T ••••••••..• C ••••••.•• , .C •. C .•• H 15 T •..• , ••• , •. , .. C ••.•••.• A .. A .• C •..• , • , , C ••••• C., C ••• T .••••.• T ••••. T •• T, •• , ••••... C. , ••.•.••.. C .. C .•. G_4leig T •• , •• , •• ,., ..• C ...... •• A •. A •. C., .• , .•• C .••.• C •. C ••• T .••••. , T ••••• T,. T .•• , •.••••• C., ••• , ..•.• C .• C .•. E 5 T •• , .• , .•.••••. C ..•..•.• A .• A •• C.,., •.•• C .•..• C .. C ••• T .••.••. T ..• ,. T .• T .•. , •.••. , .C., •.•• , •... C •• C, •. G_34eig T •..•...•.•..•• c ...... A •. A •• C ...••.•. C •••.• C, ,C ••• T ••••••• T ••••• T .• T •••••.••••• C .•••.•••••. C .. C .•• G_51epc T •...••••...•.• C.·.••.•.. A .. A •. C ...•...• C .••.• C, .C ••• T ••••••• T .•••• T .• T., •••..•..• C •.••.•••... C .. C .•• M 1 1l T ••.••• , •••••.• C •.••.••. A •. A •• C ••••••.• C .•••• C •. C ••• T •••••.• T .••.• T •• T •.••..••••• C ••• , ••.. ,, .C •• C •• , E 11 T •...••.••.••.• C •....••. A •. A •• c ...... ,, C, •.•. C •. C ..• T ••.••.• T .•••• T •• T ••••••••..• C •••. , •..... c .. C ••. M_l T .••..• , .•••• , .C .... , ... A .. A •• C ..• , ••.• C .•••• C •. C .•• T, •...•• T, •• , ,T •• T •.•••• , •• , .C .•• , •. ,,, •• C .. C.,. G 2scil T .••..•••••.... C ...•.... A .• A •• C ••. , ••.. C., ••• C •.•••• T, •••..• T., ••. T •• T •.•..•.•• , .C ••• , .. ,, ..• C .. C, .. G_39eig T. , .. , •. , •• , ••• , : • ..••.• A •• A •. C. , . , , ... C, •.•• C •• C ••• T, .••••• T ••.•. T •. T., •••••• , .• C., ••••• , , •• C •• C .•• c_curata •.. C ..•. , .•.••. T ••.••.•• A .• A. , •..... T •• C ••. T .A •• C •• C ..••••••••• A ••.•. C •• T ••••• C •. C •• A .•••• , , . C .. C ... C lubrica 2 •. , C. , .••.. , ..• T ••..••.• A .• A •. G ••..• T •• C ••. T .A. ,C .• C. , •••••• , •• A •. , , .C •• T ••••• C, , C •• A ••. , , ... C •• C ..• C lubrica 1 . • , C •. , ••.•••.•.....•••• A •• A •.•• , , ••••• C, •• T .A, .C •• C ••• , ..•• , •• A., , .• A. , • , .••• C. , C .• A. , ••. , , • T, • C, . , c=piperatii' •.. C. , , • , •••..•....••... A •• A •• G .. , •• C •• C •• GT .A, . C •. C •.•••.••• , .A, •.•• A ••••. , .• C. , C •.••• C •.••• C, .C .•• c miniata 1 • • . C ..... G •••.••.•..•••• A •• A •••.•.••.•. C ••• T .A, .C •• C ••••••••• , .A •••.• T .••••.•• C •. C •• T •..•• , ..••• T .• , C=rnini~ta=2 ••. C ....• G ••..•..••...•• A .• A ••••• , ••••• C, •• T .A, . C •• C ••• , ••.• , .• A .••. , T, •• , , ••• C •• C •• T •• , , •...•.• T .•• C_pallida • . • C •..••.•••.•••••..••. A •• A •• G •. C •••.• C ... T .A. , C •• C,, ••••••.•• A ••• , , C •• T .••.. C •. C .• T,. , ••. , •..• T, .• c_vegae ••..••.••.• , , ..••.•••••• A •• A •• G ••..• G •• C .•. , . A .. C •• A •• G ••.••••• A. , ••• T., T •••.•••. C.,, •••••. , ••• , T ..• P_mollis T •• , •••• , T ••••• T ••••• , •• A •• A •• , , • , , • T •• C ••••• T ••••• AT •••••••••• A ••••• A •• T ••••• C •• C •• A ••• , ••••••.• , •• 310 320 330 340 350 360 370 380 P pa.rvimensis AGATTC'I'GGTTAATACCTCCCTCCTTTATTCTTCTTCT'fGCTTCTGCAGGAGTTGAJl.AGAGGAGCCGGAACTGGTTGAACAATCTACCC P-californicus ...... c ...... G •••••••• A •••.••••••••.•••• .• T .• T ..•.•• G ..•. A .. T •. T .•••• , T .A .• , .. A .. C .• A., T ••. , •..•...•••••. , •••.• , •• C .•.•• T ••••.•.. " 7 •• T •• T •....• G .•• ,.t>,,. T •. T •. , ••. T .A., .•• A .• C .. A •. T,, ••..•...... ••..•..•• , ••. C ..•• , T •.••• , •. " 9 " 10 • , T. , T •••••• G. , •• A •• T. NT •• , , •• T. A ••••• A •. C .• A •• T •••••••••••••••••••••.•• , • N ••• , • T ••••• , , . G 50epc •• T .. T, •.••• G •... A .• T .• T ..• , •. T .A ....• A .. C •• A •. T ••••• , •.•.•...•.•..•.•. , .• C .•.. , T, ••..... • -a .• T •. T •..••. G .•.. A .. T •. T .•••• , T .A.,, .• A .. C .. A •. T., ••..•• , .• , ••• , ••.•.•.••• C ••... T •• , ••. ,. G~)6epc .. T .. T •. , ••. G •••• A .. T. TT ••. ,., T .A.,, •• A •. C •• A •• T .••..•••.••.••...... •..•.. C •.••. T .•.• , .•• M 4 .. T .• T ..•.•• G .•.• A., T. TT ••. , .. T.A .•... A .. C .• A .• T ...•••.••.• , .•• , .•••••• ,, .C .•. ,. T ••...•.. G 85flc .• T •• T •••.•. G ••.. A .. T .. T •.••.. T .A .••.• A •• c .. A •. T •.••. , ••..••. , ••.•.•..•••• C •••.. T .••.•..• M 15 .. T .• T,, .• , .G •.•. A •. T,. 'I', ••••• 'I' .A •••.• A •. C •• A •. T .•. , ..••••.•..••••.•.•••.• C ••••. T •••. ,, •• G~4leig •• T .• T •.•.•• G .••. A •. T .. T ••..•. T.A .••.• A .. C •• A .• T .•.•••.. , ••.••.•..•••.•... C .••.. T .•.• , •.. • -5 •• 'I' •• T,.,., .G .••• A .. T •• T •••... T .A •..•• A •• C •. A .. T ..•....•.•••.•••.•..••••.. C •..•• T •• ,, ...• G 34elg , .T •• T, .•••. G •.•• A .. T .• T ...•.• 'I' .A •.••. A •. C .• A .. T •.••..••.••••••..•••.• ,., .C ••••. T •.•... ,. G_5lepc •• 'I' •• T ..••.• G .••. A •. T •• T ••• , •• T .A .••.• A .• C •• A •• T ••• , •••• , •••.•••. ,, •••••.• C ••... T •• , •• , .• r-1 14 .. T .. T ...... G.... A.. T .. T ...... T.A ..... A .. C .. A.. T ...... , ...... C .. , .. T .... , .. . E-ll .. T •. T ...•.. G ••.• A .• T •• T •••••• T .A •.••. A •. C, .A .• T .•••.•.•••..•.•. NN ..••••.. C ••..• T •••• , •.. H-1 , • 'I' •• T ..••.• G ...• A .• T .• T .••.•. T.A ..... A .. C •• A .• T .••.••• , .•• , •• , ••.•..•. ,, .C •. , .. T ..•••. ,. G-2scil .. T •. T •...•• G ••.. A .. T .. T ....•• T.A .•. , .A •• C •• A •. T ..•• , .••• , ••..••..•••.• , •. C ...•. T ••.• , •• , G_39eig .. T., T ..•. , .G .• , .A., T., 'I' ••••.• T .A ...•• A •• C •. ANNT •••••••••••.••..••..••.... C •.••. T •.••.•• , c curata . , .... , .AC., .. T .. C .. A...... , .A .. C .. A.. A.. C .. A~.C .. C .. A., .. A ... , .. A...•. A .. A.. ,, .T .. T ... ,, C lub.rica 2 ..••..•. AC .•.. T •. C •. A •••.•..• A .• C .. C •• A •• C •• A •. C •• C •• A., •• A •.•••• A ••••• A .• A •• , •• T •• T ••.•• C=lubrica=l , ... , ... AC., .. C .. C .. A..... C .. C .. C .. AT.A .. , .. A.. C .• C .. A.... A ...... A..... A.. A.,., ...• T .. T., C_piperata ...... , .... , .. c .. A .. A.. A...... C .. C .. A•. C•.... C ..... A.... A...... A ... , .A .. A ...... • T .. T .. C miniata 1 ••••• , •• AC .••• C .. C •• T •• A ••..•• , . C .•• , . G .. C •• C •• , ••••• A. , •• A •••••• A •• G •• C, .A ••.• , ••• , • , , . , C-miniata-2 .•••.• , .AC ••.• C •• C. , T •• A •••••.•• C ••••• G •• C •. C •••••••. A •••• A, .•••. A •. G •• C •• A. , ••. , • , ••••• , C=pallida ••..•. , .AC •••• C •• C ..••• A •• , •.••..•.••• G •• C .• C ••• , •••• A .••• A, .•• , .A, .G •• A, .A •••••..•• , •••• C_vegae •.••• , .. AC •••. C •• C •• T •• A •••.•• , • C, .• , •••. C •• C ••. , •••• A .••• A •.• G •• A •••••..• C ••••••.• T., T •• P_mollis .. C ..••• AC. TC. T. , . , . T •. T •.•.• A ••... A •• AAT .••• T. T ••• A.A, • , GC •..•• TA •••..• , . A ••••.••• A. , , •.
Fgenetic V ARTATION AMONG GEOGRAPHTCALL Y ISOLATED POPULATIONS of the COMMERCIALLY IMPORT ANT SEA CUCUMBER
