Puntledge River Summer and Fall Chinook Spawning Behaviour Study
10.Pun.05
Prepared for:
Comox Valley Project Watershed Society PO Box 3007 Courtenay, BC V9N 5N3
Prepared by:
R. Withler 1, M. Wetklo1, and E. Guimond 2
Prepared with financial support of:
BC Hydro Fish and Wildlife Compensation Program
March 2012
1 Fisheries and Oceans Canada 2 473 Leighton Ave. Pacific Biological Station Courtenay, BC Molecular Genetics Section V9N 2Z5 Nanaimo, B.C. V9T 6N7
Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
EXECUTIVE SUMMARY
The Puntledge River supports both a summer and fall-run of Chinook salmon (Oncorhynchus tshawytscha). Puntledge summer Chinook are genetically distinct from the fall Chinook stock. It is surmised that the summer-run evolved from early migrants of an ancestral fall-run stock that were able to ascend Stotan and Nib falls during the natural spring freshet period between April and June/July, and hold in Comox Lake prior to spawning. The falls have been critical in maintaining the spatial segregation and racial integrity of the two stocks. Following hydroelectric expansion in the watershed, summer-run Chinook returns declined considerably, and resulted in the implementation of numerous mitigation, rehabilitation, and enhancement efforts. Fish ladders were constructed at the falls to facilitate summer Chinook migration due to reduced discharges. This has inadvertently benefited other species previously not capable of ascending the falls, including fall Chinook, and has increased the risk of summer and fall Chinook to co-mingle below the diversion dam, and potentially spawn together. This report summarizes results from a two year spawning behaviour study to investigate whether there is a propensity for both summer and fall Chinook to only mate with other fish in the same race. In 2009 and 2011, small numbers of male and female summer and fall Chinook were placed in an enclosed spawning channel where the pairing and spawning behaviour was observed. The progeny were DNA sampled after emergence. Mate choice was assessed by successful progeny production for each potential male-female parental pair in both replicates of the spawning trials conducted in each year. Results from the two trials indicated that Puntledge River Chinook salmon show no preference in choosing a mate of the same ecotype (summer or fall). In both years progeny production was positively correlated to male length (P < 0.05), indicating that some type of mate selection, typical of that observed in natural populations, occurred in the trials. Male type was not correlated with reproductive success in both years. Based on the current flow regimes and channel characteristics of the river, the likelihood of hybridization between the Puntledge summer and fall Chinook populations in the natural environment may be high.
ii
Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
TABLE OF CONTENTS
Executive Summary...... ii Table of Contents ...... iii List of Figures...... iv List of Tables ...... v
1 INTRODUCTION ...... 1
2 BACKGROUND...... 1
3 STUDY AREA ...... 3
4 MATERIALS AND METHODS...... 4 4.1 Spawning Study Design ...... 4 4.2 Microsatellite analysis...... 6 4.3 Analysis of Mate Choice and Spawning Success...... 8
5 RESULTS...... 8 5.1 2009 Trial ...... 8 5.2 2011 Trial ...... 12
6 DISCUSSION...... 16
7 RECOMMENDATIONS AND FUTURE STUDIES...... 21
8 LITERATURE CITED...... 22
APPENDICES
A 2009 summer and fall chinook spawning behaviour trial parent data B 2011 summer and fall chinook spawning behaviour trial parent data C Photos from the 2009 and 2011 spawning behaviour trials. D Confirmation of FWCP Recognition E FWCP Financial Statement
iii Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
LIST OF FIGURES
Figure 1. Puntledge River showing location of Upper and Lower Puntledge Hatchery sites, hydroelectric facilities and other major features ...... 2 Figure 2. Male-female family size (number of progeny) distribution for successful 2009 spawners by replicate (section)...... 9 Figure 3. Number of progeny produced by 2009 sires as a function of male size...... 11 Figure 4. Number of mates that spawned with 2009 sires for both replicates. Sires are ranked by descending NF length (mm)...... 12 Figure 5. Number of progeny produced by 2009 sires as a function of the number of mates with which sires produced progeny...... 12 Figure 6. Male-female family size (number of progeny) distribution for successful 2009 spawners by replicate (section)...... 13 Figure 7. Number of progeny produced by 2011 sires as a function of male size...... 15 Figure 8. Number of mates that spawned with 2011 sires for both replicates. Sires are ranked by descending NF length (mm)...... 16 Figure 9. Number of progeny produced by 2011 sires as a function the number of mates with which sires produced progeny...... 16 Figure 10. DNA association of summer Chinook (SCN), fall Chinook (FCN) and “Mixed” summer and fall Chinook by group arriving at the lower Puntledge Hatchery, for the 4 year BCRP Puntledge DNA Study time series (2006 and 2009). Comparisons were made with Puntledge summer (SCN) or fall (FCN) Chinook salmon reference data. A model result of a probability of >=0.85 was chosen as the minimum value required to assign a fish to one or the other stock - SCN or FCN. Fish with a probability value <0.85 are called “Mixed” fish and could indicate a fish is a summer x fall hybrid; is of some other stock (a stray); or is a Chinook carrying rare alleles...... 20
iv Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
LIST OF TABLES
Table 1. Size range of parents (Su-Summer, Fa-Fall) used in the 2009 and 2011 spawning trials...... 6 Table 2. Microsatellite loci, their annealing temperature (Tm) and the number of cycles used in polymerase chain reaction (PCR) amplifications; observed number of alleles (A), genetic diversity (He) and the source of primer sequences. Multiplexed loci are indicated with superscripts 1-6...... 7 Table 3. Number of potential and successful parents in 2009 by replicate (section)....9 Table 4. Number of progeny by family and parental ecotypes (Summer–Su, Fall–Fa). For each replicate (section), progeny are totalled by progeny type (same-type or cross- type)...... 10 Table 5. Number of potential and successful parents in 2011 by replicate (section)..13 Table 6. Number of progeny in 2011 by family and parental ecotypes (Summer–Su, Fall–Fa). For each replicate (section), progeny are totalled by progeny type (same-type or cross-type)...... 14
v Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
1 INTRODUCTION
The Puntledge River system is one of a few rivers on the east coast of Vancouver Island that supports both a summer and fall-run of Chinook salmon (Oncorhynchus tshawytscha). The two runs have discrete migration timings and spawning distribution in the river. Summer-run Chinook enter the river from May to August while fall-run Chinook enter from September to October. However both stocks spawn at the same time, from early October to early November. Puntledge summer Chinook are genetically distinct from the fall Chinook stock. From 2006 - 2009 a multi-year study was conducted at Fisheries and Oceans Canada (DFO) Puntledge River Hatchery to characterize the transitional change in genetic composition of Chinook salmon arriving at the facility between June and September (Guimond and Withler, 2007). Puntledge River Hatchery enhances both the summer- and fall-run Chinook stock, using an “August 1st ”and “September 1st ” cut-off date to spatially separate the summer-run and fall-run populations from a possible mixture of summer and fall Chinook that arrive throughout the month of August. One of the key findings from the four year DNA study indicated that some level of hybridization occurs between the summer and fall ecotypes, but the incidence of hybrids was lower than what would be expected, suggesting that hatchery procedures have been maintaining genetic separation and/or that the two ecotypes tended to spawn assortatively (within the same ecotype) in the wild (Guimond and Withler 2010). This latter theory was further investigated in a two year spawning behaviour study to determine the progeny production from summer and fall parents allowed to spawn together in an enclosed spawning area. This project, funded by BC Hydro’s Fish and Wildlife Compensation Program (FWCP) and Fisheries and Oceans Canada (DFO), will assist in the development of a long-term strategy to rebuild the Puntledge summer-run Chinook stock to historical production levels.
2 BACKGROUND
The two Puntledge Chinook stocks likely originated from the same population, but the summer Chinook are now genetically distinct from the fall population as well as from other Chinook stocks in the Georgia Basin. It is suspected that the summer-run stock evolved from early migrants of the fall-run stock that were able to ascend two major waterfalls (Stotan and Nib falls) at an appropriate freshet flow and hold in Comox Lake prior to spawning (Marshall 1973). These waterfalls were only passable at a narrow range of discharges and were a barrier to fall-run Chinook, and to other salmon species in the watershed except steelhead and possibly coho. Consequently, summer-run Chinook originally utilized spawning habitat above Stotan falls, and more predominantly, in a 4 kilometre section of river immediately below the outlet of Comox Lake which is currently bound by BC Hydro’s diversion dam and the Comox Lake impoundment dam. Fall-run Chinook normally spawned downstream of the Browns River confluence (Figure 1).
1 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
2 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
During the first half of the twentieth century, the annual return of the summer and fall Chinook populations combined was around 6000, making the Puntledge River one of the most significant producers of Chinook salmon in British Columbia. However, both runs experienced sharp declines in the 1950s following expansion of the hydroelectric facilities on the river. An increase in the diversion of streamflow to the penstock for power generation, from 300 m3/s to 1000 m3/s, caused several problems for summer chinook. The reduced flows in the mainstem and greater flows emanating from the powerhouse delayed adult migration at the tailrace pool where they were attracted to the higher discharge. Adults also encountered more difficulty migrating up the river, particularly at Stotan and Nib Falls, resulting in a significant increase in pre-spawn mortality as adults succumbed to injury, predation or stress from increasing river temperatures. In the 1960s and 1970s modifications (i.e. fish ladders) were made to the waterfalls to aid summer Chinook passage, to mitigate for the reduced flows. These modifications inadvertently benefited other species that were previously unable to ascend the falls, including fall-run Chinook. Furthermore, summer flow is now supplemented by artificial flow releases from the B.C. Hydro facility into August which facilitates both summer and fall Chinook access above the falls throughout the entire summer. These factors have increased the risk of the two stocks to co- mingle below the diversion dam and possibly, spawn together. This is further exacerbated by the continued potential for summer Chinook migration to be delayed at the various choke points in the river and at the Puntledge diversion dam (Guimond and Taylor 2010).
3 STUDY AREA
The Puntledge River watershed covers a 600 km2 area west of the city of Courtenay on the east coast of Vancouver Island. Approximately 75% of this watershed area is encompassed by Comox Lake and the influent drainages to the lake. Downstream of Comox Lake, the Puntledge River flows in a north-easterly direction for 14.3 km where it joins with the Tsolum River. These two rivers combined become the Courtenay River, which flows for another 2.7 km into the Strait of Georgia. BC Hydro’s Puntledge River hydroelectric facility operates an impoundment dam at the outlet of Comox Lake, a diversion dam 3.7 km downstream and an overland penstock which diverts water to a powerhouse located 5.5 km downstream. These features divide the Puntledge River into three distinct reaches (Bengeyfield and McLaren 1994). Reach B, the headpond reach, is located between the Comox impoundment dam at the outlet of Comox Lake, and the Puntledge diversion dam. This reach is low gradient with deep, slow moving water as a result of backflooding from the diversion dam. Reach C, the diversion reach, extends downstream of the diversion dam for 6.3 km to the BC Hydro Puntledge Generating Station This higher gradient reach is dominated by smooth bedrock, and punctuated by two major waterfalls - Nib Falls and Stotan Falls. Reach D encompasses the remaining 4 km of the Puntledge River from the Powerhouse to the Tsolum River confluence (Figure 1).
3 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
The spawning behaviour studies in 2009 and 2011 were conducted in Jack Creek, a small man-made side-channel beside the Lower Puntledge Hatchery (Figure 1). The side-channel is divided into two sections, each approximately 24 m long by 2.5 m wide (Appendix 1 Photo 1). Substrate consisted mainly of a ~0.5 m layer of coarse gravel (2-5 cm diameter). The channel is completely enclosed by a chain link fence with additional electric fencing near ground level to deter small predators, mainly otters and mink. Water depth in the channel was maintained at ~0.5 m during the spawning period.
4 MATERIALS AND METHODS
4.1 Spawning Study Design
In both years of spawning behaviour trials, the majority of adults used in the studies were selected from Chinook broodstock that had entered the Lower Puntledge Hatchery raceways mid August (2009 trial from Aug. 1-15; 2011 trial from Aug. 16-23) and had been holding together in similar conditions until the selection date. A few weeks prior to this date, broodstock were sorted for species and maturity. Chinook were PIT (Passive Integrated Transponder) tagged and tissue sampled for DNA analysis. Uniquely coded TX1411SSL PIT tags, (12.50mm X 2.07mm, 125 kHz) were injected subcutaneously into the post dorsal area using a 12-gauge hypodermic needle and syringe. PIT tag code numbers were recorded along with the vial number containing the DNA tissue sample for future tracking of results and to identify individuals before spawning. DNA results were provided within a week, allowing the hatchery to ensure that summer-fall crosses were not created at the hatchery. PIT tagged Chinook were sorted by maturity and ecotype based on previous DNA results, and were only selected for the study if the probability of being either summer or fall Chinook was >= 0.85 (Guimond and Wither 2010).
2009 Trial On Oct 8, 2009 summer and fall Chinook from the August arrival group that had been previously DNA analyzed were selected for the spawning behaviour study. Only sexually mature parents were used for the study (males fully ripe and milt running; good solid coloration; females fully ovulated). A shortage of mature fall Chinook females available from this group however, necessitated the selection of 6 additional Chinook from a later arrival group at the lower hatchery. These later fish had recently entered the hatchery raceway in early October, thereby increasing the likelihood that they were “true” fall Chinook and not summer Chinook. However, DNA analysis was conducted on these fish to confirm their origin. All fish were externally marked with a different coloured Peterson disc tag corresponding to their origin (summer/fall) and sex (male/female). All fish were measured for total length and photographed before being released into one of two sections of Jack Creek. Parents were selected to closely represent the range of sizes that exist naturally in each ecotype (Table 1). In total, each
4 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
section of Jack Creek (replicate) contained 5 pairs of summer Chinook and 5 pairs of fall chinook, or 20 fish in each section at a 1:1 ratio male/female. Jacks (2 year old adults) were not used for the study. From October 8 – 14, behavioural observations during the pairing and spawning period were conducted daily for approximately 15 minutes in each section. Mortalities were promptly removed from the channel, measured for length, and inspected for egg retention (females). The eggs were allowed to incubate in the gravel over winter. After emergence, all progeny were removed from each section using several passes with a 3 m wide pole seine, euthanized and weighed. Total production from each section was estimated from sample weights, and a sub- sample was preserved in 95% un-denatured ethanol or spread out on trays, frozen, and then placed in bags labelled with date and section number. The samples were sent to the PBS Genetics Lab in Nanaimo for DNA analysis.
2011 Trial On October 7, 2011 summer and fall Chinook from the August arrival group that had been previously DNA analyzed were selected for the spawning behaviour study. Summer and fall males were tagged with uniquely colored Peterson tags to allow observations during the spawning period; females were not externally tagged and only summer females were selected for the trial. Similar to the 2009 trial, parents were selected to closely represent the range of sizes that exist naturally in each ecotype (Table 1). However, unlike 2009, parents, particularly females, were at various stages of maturity rather than being all at a similar advanced stage. Each section in Jack Creek received 8 summer and 8 fall Chinook males, and 8 summer females (Section 2 received only 7 summer females due to a shortage, of which 1 was later re-analyzed as a fall female Chinook). A greater male to female ratio (2:1 males to females) was employed in the 2011 trial to incorporate equal choice for female mate selection. Between October 8 and November 1, 2011, spawning behaviour was observed and mortalities were sampled as in 2009 (measured, scale samples taken and females inspected for egg retention) throughout the spawning period. The eggs were allowed to incubate in the gravel over winter. After emergence, all progeny were removed from each section using several passes with a 3 m wide pole seine, euthanized and weighed. Total production from each section was estimated from sample weights, and a sub-sample was preserved in 95% un-denatured ethanol, and sent to PBS for DNA analysis.
5 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Table 1. Size range of parents (Su-Summer, Fa-Fall) used in the 2009 and 2011 spawning trials. Section 1 Section 2 Avg. NF Length (mm) Range Avg. NF Length (mm) Range 2009 Su-Female 885 823 - 960 849 824 - 908 Fa-Female 863 810 - 914 857 780 - 930 Su-Male 795 676 - 852 763 606 - 886 Fa-Male 732 685 - 845 744 610 - 834 2011 Su-Female 849 672 - 914 831 673 - 1000 Fa-Female - - 713 - Su-Male 716 628 - 965 705 618 - 876 Fa-Male 769 652 - 960 735 590 - 910
4.2 Microsatellite analysis
Parent and progeny samples were genotyped with eight polymorphic microsatellite loci. The locus name, primer annealing temperatures, PCR cycles and descriptive statistics of genetic variation for each year are given in Table 2. Published primers were employed except as noted. In general, polymerase chain reaction (PCR) DNA amplifications were conducted using a DNA Engine Tetrad2 thermal cycler (BioRad, Hercules, California) in 6-μL volumes consisting of 0.14 units of Platinum (Invitrogen) Taq DNA polymerase, 1 μL of 1:4 diluted Wizard SV (Promega) extracted DNA, 1x PCR buffer, 90 μM of each nucleotide, 0.4 μM of forward primer, 0.4 μM of reverse primer with 5’ GTTT consensus, and deionized H2O. For PCR multiplexes the final concentrations of each nucleotide (180 μM) and MgCl2 (2.4mM) were increased (Table 2). Select primer concentrations were also adjusted as follows: Omy325, Ogo2, Ots2, and Ots213 (0.25 μM); Ogo4 (0.45 μM), and Oki100 (1.05 μM). The thermal cycling profile involved one cycle of Taq activation for 5 min at 95◦C followed by cycles of denaturation for 30 s at 94◦C, annealing for 30 s, and extension for 30 s at 72◦C; and a final extension for 10 min at 72◦C. Microsatellites were size fractionated in an AB 3730 capillary DNA analyzer (Applied Biosystems, Foster City, California), and genotypes were scored with AB GeneMapper version 4.0 using an internal lane sizing standard. In each spawning trial (2009 and 2011), sampled progeny were assigned to the pair of parents most likely to have produced them by exclusion using the multilocus genotypes obtained for all potential parents and sampled progeny. The programs Colony 1.2 (Wang 2004) and Cervus 3.0 (Kalinowski et al. 2007) were used to assist in progeny assignment to parental pairs.
6 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Table 2. Microsatellite loci, their annealing temperature (Tm) and the number of cycles used in polymerase chain reaction (PCR) amplifications; observed number of alleles (A), genetic diversity (He) and the source of primer sequences. Multiplexed loci are indicated with superscripts 1-6.
Year Locus Tm Cycles A He Source Modified Primers (◦C) 2009 Ogo22 55 34 7 0.691 Olsen et al. 1998 2009 Ogo41 58 34 14 0.792 Olsen et al. 1998 2009 Oke42 55 34 5 0.692 Buchholz et al. 2001 2009 Oki100 53 38 20 0.893 Beacham et al. 2008 2009 Omy3251 58 34 8 0.767 O’Connell et al. 1997 2009 Ots23 62 32 13 0.872 Banks et al. 1999 GCCTTTTAAACACCTCACACTTAG GTTTTTATCTGCCCTCCGTCAAG 2009 Ots93 62 32 5 0.309 Banks et al. 1999 ATCAGGGAAAGCTTTGGAGA GTTTCCCTCTGTTCACAGCTAGCA 2009 Ssa197 55 37 17 0.904 O’Reilly et al. 1996 Mean 11 0.740 2011 Ogo44 58 34 11 0.6980 Olsen et al. 1998 2011 Oki1006 54 42 19 0.9012 Beacham et al. 2008 2011 Omm10805 50 35 24 0.8973 Rexroad et al. 2002 2011 Omy3254 58 34 7 0.7316 O’Connell et al. 1997 2011 Ots2 62 27 12 0.8237 Banks et al. 1999 2011 Ots201b5 50 35 20 0.8883 Not published. CAGGGCGTGACAATTATGC GTTTGGACATCTGTGCGTTGC 2011 Ots2136 54 42 21 0.9031 Greig et al. 2003 2011 Ots3m 54 42 9 0.7895 Banks et al. 1999 TGTCACTCACACTCTTTCAGGAG GTTTGAGAGTGCTGTCCAAAGGTGA Mean 15 0.8291
7 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
4.3 Analysis of Mate Choice and Spawning Success
Mate choice was assessed by successful progeny production for each potential male-female parental pair in both replicates of the spawning trials conducted in 2009 and 2011. Progeny success was scored both by total number of progeny sampled from each parental pair and by a binary score of progeny production for each parental pair in which ‘0’ represented no progeny sampled and ‘1’ represented the presence of one or more progeny among those sampled.
2009 Trial Progeny production was examined with a fixed effect Analysis of Variance (ANOVA) model in which male nose-fork (NF) length and progeny type (those from same-type parents and those from cross-type parents) and the interaction effect (length x progeny type) were tested for significance in the successful progeny production. Same-type progeny were those assigned to a summer male and summer female parent or to a fall male and fall female parent. Cross-type progeny were those assigned to either combination of a summer and a fall parent.
2011 Trial Progeny production was examined with a fixed effect Analysis of Variance (ANOVA) model in which male nose-fork (NF) length and progeny type (those from two summer parents and those from a summer female and a fall male) and the interaction effect (length x progeny type) were tested for significance in the successful progeny production.
5 RESULTS
Although observations of spawning behaviour were conducted on a daily basis during each trial, they were only to offer a snapshot of pairing and spawning behaviour. These monitoring events provided limited information about “who spawns with who” and were considered less important than the genetics of the progeny produced by the various parents. One key difference observed between the two trials however was the rapid spawning observed in the 2009 trial (within hours of being transported to Jack Creek) compared to 2011, due to the advanced state of maturity of the females.
5.1 2009 Trial
The number of progeny produced by individual male and female parents varied greatly, with only 1 adult fish in each replicate failing to produce any sampled progeny (Table 3, Figure 2). In replicate 1, same- and cross-type progeny were produced in similar numbers (Table 4). In replicate 2, more progeny with same-type parents (summer-summer or fall-fall) than with cross- type parents (summer-fall) were produced.
8 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Table 3. Number of potential and successful parents in 2009 by replicate (section).
Section Potential females Successful Progeny Potential males Successful Progeny Summer Fall females numbers Summer Fall males numbers 1 5 5 9 1-95 4 5 9 4-179 2 5 5 10 16-88 4 7 10 1-176
0.60
0.55 Section 1 0.50 Section 2 0.45 0.40 0.35 0.30 0.25 Frequency 0.20 0.15 0.10 0.05 0.00 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 Family size
Figure 2. Male-female family size (number of progeny) distribution for successful 2009 spawners by replicate (section).
9 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Table 4. Number of progeny by family and parental ecotypes (Summer–Su, Fall–Fa). For each replicate (section), progeny are totalled by progeny type (same-type or cross-type). Section 1 Section 2 Family FemXMal Female Type Male Type Progeny Family FemXMal Female Type Male Type Progeny 218x26 Su Su 19 138x81 Su Su 15 214x54 Su Su 11 29x104 Su Su 5 112x155 Su Su 1 70x104 Su Su 5 214x155 Su Su 1 243x104 Su Su 17 218x155 Su Su 35 302x48 Fa Fa 4 214x185 Su Su 13 305x55 Fa Fa 2 218x185 Su Su 3 306x55 Fa Fa 37 97x150 Fa Fa 18 302x72 Fa Fa 26 196x150 Fa Fa 40 303x72 Fa Fa 23 204x150 Fa Fa 16 305x72 Fa Fa 85 63x191 Fa Fa 7 306x72 Fa Fa 15 97x191 Fa Fa 4 304x200 Fa Fa 4 204x191 Fa Fa 10 306x200 Fa Fa 5 204x195 Fa Fa 4 304x277 Fa Fa 1 63x238 Fa Fa 8 - - - - 204x238 Fa Fa 1 - - - - Same Type 191 244 63x54 Fa Su 11 305x81 Fa Su 1 97x54 Fa Su 11 303x104 Fa Su 1 196x54 Fa Su 4 304x104 Fa Su 38 63x155 Fa Su 7 302x114 Fa Su 3 196x155 Fa Su 24 29x48 Su Fa 12 112x124 Su Fa 5 164x48 Su Fa 2 198x124 Su Fa 3 29x55 Su Fa 6 214x124 Su Fa 3 164x55 Su Fa 3 78x150 Su Fa 1 29x72 Su Fa 9 198x150 Su Fa 40 138x72 Su Fa 6 214x150 Su Fa 64 164x72 Su Fa 9 112x191 Su Fa 19 243x72 Su Fa 3 214x238 Su Fa 3 70x91 Su Fa 11 218x238 Su Fa 8 138x91 Su Fa 6 - - - - 243x91 Su Fa 2 - - - - 164x276 Su Fa 2 - - - - 243x276 Su Fa 2 Cross Type 203 116 Total 394 360
10 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
ANOVA indicated that male parent length had a significant positive association with successful progeny production (both scored as a number and a binary trait) (both P < 0.05), but neither progeny type (parents same or different) nor the interaction between male length and progeny type were significant for either progeny success trait (all P > 0.05). Thus, the only indication of mate choice in these trials was that it might be based on larger (longer) males; there was no indication that males or females selected mates based on ecotype. There was considerable variation in number of progeny produced even after male length was accounted for (Figure 3). This variation, represented by the vertical distance of the data points from the expected values represented by the regression line in Figure 3, was caused both by males that produced many fewer and many more progeny than those expected based on male length.
180
160 # of progeny Linear (# of progeny) 140
120
100
80 R2 = 0.17 60 Number of progeny of Number
40
20
0 600 625 650 675 700 725 750 775 800 825 850 875 900 Sire NF Length (mm)
Figure 3. Number of progeny produced by 2009 sires as a function of male size.
One factor that may have influenced male success in progeny production that was not examined in the ANOVA models was number of female partners from which the male succeeded in fertilizing eggs (Figure 4). In fact, in 2009, the number of progeny produced was positively correlated with the number of mates for male fish. Both large males and small males that mated with more than one female tended to produce more progeny than would be expected based on male size alone. The correlation (r2 = 0.64) between progeny number and mate number was significant, and not entirely due to the fact that larger males tended to have both more progeny and more mates (Figure 5).
11 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
0.60 Proportion of progeny 8 0.55 8 # of mates
0.50 6 0.45 5 5 44 4 4 0.40 3 3 3 0.35 2 2 2 2 1 1 1 1 0.30 0 0.25 0.20 0.15 Number of mates Proportion of progeny of Proportion 0.10 0.05 0.00 -10 1 2 3 4 5 6 7 8 9 1011121314151617181920 Sire
Figure 4. Number of mates that spawned with 2009 sires for both replicates. Sires are ranked by descending NF length (mm).
200 # of Progeny by # of mates 180 Linear (# of Progeny by # of mates)
160
140 2 120 R = 0.64
100
80
Number of progeny 60
40
20
0 0123456789 Number of mate s
Figure 5. Number of progeny produced by 2009 sires as a function of the number of mates with which sires produced progeny.
5.2 2011 Trial
The number of progeny produced by individual parents was again highly variable, with only 3 adult fish producing no progeny in each replicate (Table 5, Figure 6). In this experiment, all females (except one) were summer type. The factors examined as possible influences on successful progeny production were male type (fall or summer), male length and replicate. In
12 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
both replicates, more progeny were sired by fall males than summer males, with the difference in progeny production between male types more pronounced in replicate 1 than 2 (Table 6).
Table 5. Number of potential and successful parents in 2011 by replicate (section).
Potential females Successful Progeny Potential males Successful Progeny Section Summer Fall females numbers Summer Fall males numbers 1 8 0 7 1-118 8 8 14 1-72 2 6 1 7 3-153 8 8 13 1-62
0.60
0.55 Section 1 0.50 Section 2 0.45 0.40 0.35 0.30 0.25 Frequency 0.20 0.15 0.10 0.05 0.00 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 Family size
Figure 6. Male-female family size (number of progeny) distribution for successful 2009 spawners by replicate (section).
13 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Table 6. Number of progeny in 2011 by family and parental ecotypes (Summer–Su, Fall–Fa). For each replicate (section), progeny are totalled by progeny type (same-type or cross-type).
Section 1 Section 2 Family FemXMal Female Type Male Type Progeny Family FemXMal Female Type Male Type Progeny 313x212 Su Su 13 333x271 Su Su 31 390x212 Su Su 1 333x274 Su Su 8 225x214 Su Su 1 296x280 Su Su 1 278x251 Su Su 4 333x280 Su Su 45 264x272 Su Su 36 333x288 Su Su 19 278x272 Su Su 3 289x350 Su Su 16 293x272 Su Su 4 260x363 Su Su 5 311x272 Su Su 2 296x363 Su Su 3 313x272 Su Su 8 302x363 Su Su 1 264x319 Su Su 2 333x363 Su Su 1 264x343 Su Su 2 397x316 Fa Fa 3 278x343 Su Su 1 - - - - 293x343 Su Su 1 - - - - 264x353 Su Su 15 - - - - 390x389 Su Su 1 - - - - Same Type 94 133 311x233 Su Fa 72 333x208 Su Fa 1 264x246 Su Fa 14 333x259 Su Fa 8 311x299 Su Fa 35 296x295 Su Fa 1 313x310 Su Fa 40 302x295 Su Fa 1 311x351 Su Fa 9 348x295 Su Fa 15 313x351 Su Fa 17 289x312 Su Fa 8 293x368 Su Fa 4 296x312 Su Fa 4 - - - - 333x312 Su Fa 29 - - - - 289x316 Su Fa 7 - - - - 333x316 Su Fa 10 - - - - 348x316 Su Fa 42 - - - - 333x357 Su Fa 1 - - - - 289x362 Su Fa 10 - - - - 296x362 Su Fa 8 - - - - 302x362 Su Fa 4 Cross Type 191 149 Total 285 282
14 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
ANOVA again indicated that the only significant determinant of number of progeny produced (or successful progeny production measured as a binary trait) was male length (P < 0.05), with progeny production increasing with male length (Figure 7). Neither progeny type nor replicate was significant, nor was there a significant interaction between male length and progeny type (all P > 0.10).
80
70 # of progeny Linear (# of progeny) 60
50 R2 = 0.40 40
30 Number of progeny of Number
20
10
0 600 625 650 675 700 725 750 775 800 825 850 875 900 925 950 975 Sire NF Length (mm)
Figure 7. Number of progeny produced by 2011 sires as a function of male size.
There was again considerable residual variation in progeny production among males after male length was accounted for, especially among males of intermediate length (Figure 7). Number of female mates again tended to be higher for large males than small males (Figure 8). However, in contrast to 2009, increased mate number was poorly correlated with increased progeny number (r2 = 0.26) and did not explain higher-than-expected progeny production for either large or small males (Figure 9).
15 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
0.40 Proportion of Progeny 5 5 # of mates 0.35 4 4 3 3 3 3 0.30 2 2 2 1 1 1 1 1111111 1 1 1 1 11 0 0 0 0 0 0.25
0.20
0.15
0.10 mates of Number Proportion of progeny of Proportion 0.05
0.00 -14 1 2 3 4 5 6 7 8 9 1011121314151617181920212223242526272829303132 Sire
Figure 8. Number of mates that spawned with 2011 sires for both replicates. Sires are ranked by descending NF length (mm).
80 # of progeny by # of mates Linear (# of progeny by # of mates) 70
60
50 R2 = 0.26 40
30 Number of progeny of Number
20
10
0 0123456 Number of mates
Figure 9. Number of progeny produced by 2011 sires as a function the number of mates with which sires produced progeny.
6 DISCUSSION
The two spawning trials conducted with Puntledge River Chinook salmon in Jack Creek in 2009 and 2011 provided similar results with respect to the determinants of successful progeny production. The 2009 trial indicated that successful progeny production was highly variable and not random among parents. One replicate indicated that parental pair type (same or different types) might be an important influence on success but this was not supported by the results of the
16 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
second replicate. Taken together, the 2009 replicate results indicated that some other factor, possibly male size, was the strongest influence on success. The spawning trials in 2011 were therefore specifically designed to estimate the influences of male length and male type (summer or fall) on successful progeny production with summer females. Indeed, analysis of variance on two measures of successful progeny production (number of progeny produced and a binary success/fail score) in 2011 (and re-analysis of 2009) confirmed that, in both years, the only significant measured factor explaining variation in progeny production was male length. Increased male length was correlated with increased progeny production, indicating that some type of mate choice (by males and/or females) likely favoured the reproductive efforts of large male fish. Observations of size-based mate choice in salmonids have been made before (e.g. Foote 1988, Foote 1989, Berejikian et al. 2000). Both males and females can display an absolute preference for larger mates, or a relative preference in which the attractive mate is one that is as large, or larger, than the individual exercising selection. We found no evidence that Puntledge River Chinook salmon show a preference choosing a mate of the same ecotype (summer or fall). In 2009, the ability of many of the adults to ‘choose’ a mate may have been limited. The fish all tended to be in an advanced state of maturity upon initiation of the trial and perhaps disinclined to further delay reproduction by applying ‘choosiness.’ Moreover, there were equal numbers of males and females in the spawning enclosures, possibly resulting in limited choice for adults who did not ‘pair up’ quickly. In fact, there was likely little time for a normal ‘dominance hierarchy’ to become established through mate choice activity by either or both sexes. The strong positive correlation between ‘number of mates’ and ‘number of progeny’ for males in 2009 tends to support the idea that spawning took place in a rapid ‘free-for-all’ situation. Under these circumstances, male success may have been largely influenced by the number of spawning events a male participated in rather than by the prolonged female-male pairing and guarding that would enable a male to dominate the fertilization of eggs from an individual female. In contrast, the 2011 trial involved fish in varying states of maturity and an excess number of males relative to females. This provided the opportunity for females to exert more choice in mate selection and for males to establish dominance (dissuasion of competing males) with one or more females. One possible result of this more natural and ‘less pressured’ spawning trial was that males were less polygamous (spawned on average with fewer females in 2011). Moreover, progeny production in males was not closely tied to number of mates in 2011, indicating that successful reproduction could be achieved by males that likely paired up with a single female and expended time and energy in maintaining a dominant position with her. Male length was again significantly and positively associated with progeny production and male type (summer or fall) was again not correlated with reproductive success. In the spawning trials of both years, there was a great deal of residual variation in spawning success after the effect of male length was accounted for. Parental assortative mating by ecotype did not account for this variation. Foote and Larkin (1988) demonstrated that males of the two
17 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
ecotypes of sockeye salmon (migratory sockeye and freshwater resident kokanee) preferred spawning with females of their same type, even when same type females were smaller than the alternative (kokanee). However, the sockeye and kokanee may have evolved in sympatry, (not geographically isolated), whereas the two ecotypes of Puntledge River Chinook salmon likely evolved in allopatry (geographically isolated), and may not have developed pre-spawning isolating mechanisms. Other factors known to influence mate choice and spawning success in salmonids that may have been responsible for some of the observed residual variation observed in this study include mate choice on the basis of male and female genotypes at immune system genes such as those of the major histocompatibility complex (MHC) (Neff et al. 2008, Forsberg et al. 2007, Evans et al. 2012), duration of life post-spawning (van den Berghe and Gross 1986), interactions between male and female gametes to enhance or reduce fertility (Rosengrave et al. 2008) and hatchery versus wild origin of fish (Fleming and Gross 1993, Thériault et al. 2011). We do not know how well the mate choice and success in progeny production in the Jack Creek trials reflects the outcomes in natural spawning events in the Puntledge River. Studies in the natural environment indicate that factors such as predation that may be excluded from a spawning trial can influence reproductive success (Quinn et al. 2001). It should also be noted that the location for the trials (Jack Creek) does not represent ideal Chinook spawning habitat. Exposure to less than optimal environmental conditions during incubation may have had a disparate influence on the survival of progeny in some redds. However, the fact that progeny numbers were positively correlated with male parent size indicates that some mate selection typical of that observed in natural populations did occur in the trials. The fact that selection for a partner of the same ecotype was not observed in the experimental situation indicates that it may not occur in the wild or may be secondary to other characteristics influencing wild mate choice and spawning success. Thus, the experimental results strongly indicate that it is unfounded to assume that the Puntledge River Chinook salmon ecotypes will avoid ‘cross-breeding’ in the wild in situations if individuals of the other ecotype constitute a large proportion of available mates. Thus, the likelihood of hybridization between the two ecotypes in the natural environment may be high under the Puntledge River current flow regime. If the primary goal is to rebuild a self-sustaining summer-run Chinook population to historic escapement levels, the results of the two trials underscore the importance of developing and implementing strategies in the hatchery and in the wild that will increase the separation in the run-timings of the two ecotypes in order to reduce the introgression of summer Chinook genes into the fall Chinook population (and vice versa). Results from several years of research and assessment projects on Puntledge summer Chinook have yielded critical information on the migration timing and spawning survival of the summer-run population. It is clear from these studies that the key to success for Puntledge summer Chinook survival is to enter the river early prior to late-June, when temperatures are cool, recreational use is very low and spring freshet spills are most likely available to aid
18 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
upstream migration into Comox Lake. Migration success through this reach to the upper river (above the falls) is near 100% for the early arriving adults. Furthermore, once these fish reach the lake, almost all will successfully survive to spawn in mid-October. In contrast, later arriving adults must contend with warmer river temperatures, lower flows and a high level of disturbance from swimmers, particularly at Stotan and Nib falls, two areas that present some of the greatest challenges for migration. Less than half of these later migrants will reach the upper river, and of those that do not, only ~50% will survive to spawn. When full-scale hatchery operations commenced in 1979 in the Puntledge River, enhancement practices involved taking over 90% of the returning summer chinook adults for hatchery broodstock due to the low returns (B. Munro pers. comm.). These fish were held in raceways under ambient river temperatures and often experienced high pre-spawn mortality (50% on average). The earliest arriving fish would have been held the longest in warm water at the Lower or Upper Puntledge Hatchery facilities, and likely experienced poorer survival than fish that arrived later in the season (Jensen et al. 2006). As a consequence, the early timing component of the summer run has declined significantly more than the later timing component, possibly contributing to the overlap of the two ecotypes and creation of hybrids. More recently, this differentially higher mortality would have been experienced by the early returning adults in the river whose migration has been delayed at various locations (Stotan and Nib falls, powerhouse pool and the diversion dam). DFO will be focusing its hatchery broodstock strategy on the capture of a greater proportion (50%) of the earlier arriving summer Chinook. The progeny from earlier broodstock returns are expected to maintain the same migration time and return early as adults in the river. Early arrival into the river gives these fish the best opportunity and conditions to ascend Stotan and Nib falls and migrate into Comox Lake. Combined with other strategies to increase Puntledge broodstock holding survival, by cooling and transporting broodstock to sites with cooler water supplies, will ensure that all summer Chinook broodstock survive at a high rate (>95%) and that the early component of the run is rebuilt and enhanced by the hatchery. It has also been suspected that there is a strong tendency for hatchery fish to return to the site of release. In 2005, a video camera in the fishway at the Comox impoundment dam recorded the majority of summer Chinook that were present above the diversion dam successfully migrating into Comox Lake (Guimond 2006). This event corresponded to the last brood year return from a large hatchery smolt release above the Comox impoundment dam. At the time, DFO could not confirm that these fish were originally imprinted to the upper watershed but has sparked a more detailed investigation on the homing behaviour of summer Chinook in the river. Assessment of retuning adults over the next 3-4 years will determine whether lake releases of Chinook smolts result in more adults migrating to Comox Lake compared to standard hatchery river releases. The 2006-2009 DNA studies on Chinook salmon returning to Puntledge Hatchery from June to September, has shown that those fish returning before August 1st are predominantly (>95%) summer origin (Guimond and Withler 2010). More importantly, there is an increasing proportion
19 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
of fall Chinook and hybrids occurring in the later timing segments arriving throughout August (Figure 10).
Average Proportions of Chinook DNA Samples by Run Timing Group 2006-2009
1.00 Proportion of SCN Proportion of FCN 0.80 Proportion of "Mixed" CN
0.60
0.40 Proportion ofchinook
0.20
0.00 1 (Before Aug 1) 2 (Aug 1-15) 3 (Aug 16-23) 4 (Aug 24-31) 5 (Sept 1-15)
Gr oup Figure 10. DNA association of summer Chinook (SCN), fall Chinook (FCN) and “Mixed” summer and fall Chinook by group arriving at the lower Puntledge Hatchery, for the 4 year BCRP Puntledge DNA Study time series (2006 and 2009). Comparisons were made with Puntledge summer (SCN) or fall (FCN) Chinook salmon reference data. A model result of a probability of >=0.85 was chosen as the minimum value required to assign a fish to one or the other stock - SCN or FCN. Fish with a probability value <0.85 are called “Mixed” fish and could indicate a fish is a summer x fall hybrid; is of some other stock (a stray); or is a Chinook carrying rare alleles.
As a general rule, Puntledge Hatchery has established August 1st as the cut-off date for the collection of summer Chinook broodstock. Overall, the August 1st cut-off date appears to be an effective hatchery strategy in maintaining the summer Chinook stock. However, in some years when returns were low, the cut-off date was delayed to August 15th or even later. Thus in former years of very low returns, the hatchery likely forced the creation of hybrids while selecting broodstock from later timing segments. Presently, adults selected for broodstock in later timing segments are pre-screened (i.e. DNA analysis prior to spawning to positively identify ‘True’ summer Chinook) to ensure that no summer-fall Chinook crosses are produced. While this practice reduces artificial crosses at the hatchery, the selection of later returning adults may prolong the overlap in the two run-timings since both the timing of migration and spawning have been shown to be under strong genetic control in salmonids (Quinn et al. 2000). Although summer Chinook escapement to the Puntledge River is still below the target levels, the hatchery will review the practice of collecting later arrivals (Aug 1-15) as a conservation strategy to maintain the genetic population in years of low returns. It is anticipated that in the long term, over the next 1-2 generations, these measures will have a positive affect on the survival and productivity of the summer Chinook population. Continued
20 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
assessment will be a fundamental process in this recovery strategy to determine whether separation of the two stocks can be achieved, and will minimize the occurrence of hybrids in the population.
7 RECOMMENDATIONS AND FUTURE STUDIES
A thorough understanding of the genetic mechanisms controlling run timing in the two Puntledge Chinook stocks will enable hatchery practices to maintain diversity and minimize the artificial introgression of summer and fall Chinook genes. Some additional investigations include: i). Continuation of DNA analysis on Puntledge summer Chinook returns to the lower Puntledge Hatchery will assist in tracking genetic responses to changes in hatchery practices and other strategies that enhance the early returning cohorts, and determine whether these and other measures to control migration and spawning distribution (ex. fence/fishway operations and river flow manipulation), are creating a greater separation in the run timing of the summer and fall ecotypes. ii). Determine the amount of hybridization that may be occurring naturally in the Puntledge River, by analyzing wild progeny collected at two to three locations in the river where there is a high propensity for summer and fall Chinook to co-mingle and spawn together. Samples of fry from broodyear 2011 parents from two spawning locations below the diversion dam have already been collected and preserved for analysis. iii). Assess the inheritance of run timing by tracking adult returns from different release groups (i.e. progeny from early arriving parents and late arriving parents).
8 ACKNOWLEDGEMENTS
We are grateful for the financial support for this study from the BC Hydro Fish and Wildlife Compensation Program (FWCP), and Fisheries and Oceans Canada (DFO). We also wish to acknowledge the technical and advisory support from DFO during the design and implementation of the studies, in particular R. Devlin, M. Sheng, G. Graf, G. Brown, B. Munro, D. Miller and L. Frisson. Special thanks go to Puntledge Hatchery staff for assistance with project logistics, acquisition and sampling of adults for the studies, fry sample collection and preservation, and to the PBS Molecular Genetics technicians for analyzing DNA samples and providing timely results.
21 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
9 LITERATURE CITED
Banks MA, Blouin MS, Baldwin BA, Rashbrook VK, Fitzgerald HA, Blankenship SM, and Hedgecock D. 1999. Isolation and inheritance of novel microsatellites in Chinook salmon (Oncorhynchus tshawytscha). Journal of Heredity 90: 281-287.
Beacham, TD, Varnavskaya NV, Le KD, and Wetklo M. 2008. Determination of population structure and stock identification of chum salmon (Oncorhynchus keta) in Russia determined with microsatellites. Fish. Bull. 106:245–256.
Bengeyfield, W. and W. A. McLaren. 1994. Puntledge River gravel placement feasibility study. Global Fisheries Consultants Ltd. White Rock, B.C. and McLaren Hydrotechnical Engineering, Coquitlam, B.C. for: Environmental Resources, B.C. Hydro, Burnaby.
Berejikian BA, Tezak EP, and LaRae AL. 2000. Female mate choice and spawning behaviour of Chinook salmon under experimental conditions. Journal of Fish Biology 57: 647–661.
Buchholz WG, Miller SJ, and Spearman WJ. 2001. Isolation and characterization of chum salmon microsatellite loci and use across species. Animal Genetics 32: 160-167.
Evans ML, Dionne M, Miller KM, and Bernatchez L. 2012. Mate choice for major histocompatibility complex genetic divergence as a bet-hedging strategy in the Atlantic salmon (Salmo salar). Proceedings of the Royal. Society B 279: 379-386. (doi:10.1098/rspb.2011.0909)
Fleming, IA, and Gross MR. 1993. Breeding success of hatchery and wild coho salmon (Oncorhynchus kisutch) in competition. Ecological Applications 3:230-245. (doi: 10.2307/1941826)
Foote CJ. 1988. Male Mate Choice Dependent on Male Size in Salmon. Behaviour 106: 63-80.
Foote CJ. 1989 Female mate preference in Pacific salmon. Anim. Behav. 38, 721–723. (doi:10.1016/S0003-3472(89) 80022-3)
Foote CJ and Larkin PA. 1988. The role of male choice in the assortative mating of anadromous and non-anadromous sockeye salmon (Oncorhynchus nerka). Behaviour 106: 43-62.
Forsberg LA, Dannewitz J, Petersson E, and Grahn M. 2007 Influence of genetic dissimilarity in the reproductive success and mate choice of brown trout—females fishing for optimal MHC dissimilarity. J. Evol. Biol. 20, 1859–1869. (doi:10.1111/j.1420- 9101.2007.01380.x)
Greig C, Jacobson DP, and Banks MA. 2003. New tetranucleotide microsatellites for fine-scale discrimination among endangered Chinook salmon (Oncorhynchus tshawytscha). Molecular Ecology Notes 3: 376-379.
Guimond, E. 2006. Puntledge River impoundment and diversion dam fishway assessment 2005. Project # 05.Pu.02. Prepared for BC Hydro Bridge Coastal Fish and Wildlife Restoration Program, Burnaby, BC.
22 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Guimond, E. and J.A. Taylor. 2010. Puntledge River radio telemetry study on summer Chinook migration in the upper watershed 2009. Project #09.Pun.04. Prepared for Comox Valley Project Watershed Society and BC Hydro BCRP.
Guimond, E. and R. Withler. 2010. Puntledge River Summer Chinook DNA Analysis 2009. Project #09.Pun.02. Prepared for Comox Valley Project Watershed Society and BC Hydro BCRP.
Jensen, J.O.T., W.E. McLean, T. Sweeten, W. Damon, and C. Berg. 2006. Puntledge River high temperature study: Influence of high water temperature on adult summer chinook salmon (Oncorhynchus tshawytscha) in 2004 and 2005. Can. Tech. Rep. Fish. Aquat. Sci. 2662:vii+47p.
Kalinowski ST, Taper ML, and Marshall TC. 2007 Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16: 1099-1006. doi: 10.1111/j.1365-294x.2007.03089.x
Marshall, D.E. 1973. Progress report on the Puntledge River program 1971 and 1972. Technical Report 1973-8. Department of the Environment, Fisheries and Marine Service, Pacific Region.
Neff, BD, Garner SR, Heath JW, and Heath DD. 2008. The MHC and non-random mating in a captive population of Chinook salmon. Heredity 101:175–185. (doi:10.1038/hdy.2008.43)
O’Connell M, Danzmann RG, Cornuet J, Wright JM, and Ferguson MM. 1997. Differentiation of rainbow trout (Oncorhynchus mykiss) populations in Lake Ontario and the evaluation of the stepwise mutation and infinite allele mutation models using microsatellite variability. Canadian Journal of Fisheries and Aquatic Sciences 54: 1391-1399.
O’Reilly PT, Hamilton LC, Stewart K, McConnell SK, and Wright JM. 1996. Rapid analysis of genetic variation in Atlantic salmon (Salmo salar) by PCR multiplexing of dinucleotide and tetranucleotide microsatellites. Canadian Journal of Fisheries and Aquatic Sciences 53: 2292-2298.
Olsen JB, Bentzen P, and Seeb JE. 1998. Characterization of seven microsatellite loci derived from pink salmon. Molecular Ecology 7: 1087-1089.
Quinn TP, Unwin MJ, Kinnison MT. 2000. Evolution of temporal isolation in the wild: genetic divergence in timing of migration and breeding in introduced populations of Chinook salmon. Evolution, 54, 1372–1385.
Quinn, TP, Hendry AP, and Buck GB. 2001. Balancing natural and sexual selection in sockeye salmon: interactions between body size, reproductive opportunity and vulnerability to predation by bears. Evolutionary Ecology Research 3: 917–937.
23 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Rexroad CE, 3rd, Coleman RL, Hershberger WK, and Killefer J. 2002. Rapid communication: Thirty-eight polymorphic microsatellite markers for mapping in rainbow trout. Journal of Animal Science 80: 541-542.
Rosengrave P, Gemmel NJ, Metcalf V, McBride K, and Montgomerie R. 2008. A mechanism for cryptic female choice in Chinook salmon. Behavioral Ecology 19: 1179-1185. doi: 10.1093/beheco/arn089
Thériault V, Moyer GR, Jackson LS, Blouin MS and Banks MA. 2011. Reduced reproductive success of hatchery coho salmon in the wild: insights into most likely mechanisms. Molecular Ecology 20: 1860-1869. (doi: 10.1111/j.1365-294X.2011.05058.x.) van den Berghe EP and Gross MR. 1986. Length of breeding life of coho salmon (Oncorhynchus kisutch). Canadian Journal of Zoology 64: 1482-1486.
Wang J. 2004. Sibship reconstruction from genetic data with typing errors. Genetics 166: 1963- 1979.
24 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Appendix A. 2009 summer and fall Chinook spawning behaviour trial parent data.
POH NF DNA Vial PIT Tag Sex Jack Ck. Tag Length Length Mort Egg # # Stock Su/Fa M/F Sec# Colour1 (mm) (mm) date Retention Comments 196 133218 Fa F 1 Y/O 711 898 17-Oct 0% Group 2; Oct 8, 2009 97 135473 Fa F 1 Y/O 725 914 14-Oct 40% Group 2; Oct 8, 2009 204 144141 Fa F 1 Y/O 667 832 17-Oct 0% Group 2; Oct 8, 2009 63 153909 Fa F 1 Y/O 706 860 13-Oct 0% Group 2; Oct 8, 2009 301 161868 Fa F 1 Y/O 559 810 11-Oct 100% Oct swim-ins; Oct 9 112 128633 Su F 1 P 698 867 14-Oct 0% Group 2; Oct 8, 2009 214 132854 Su F 1 P 644 855 16-Oct 0% Group 2; Oct 8, 2009 78 144012 Su F 1 P 724 918 13-Oct ~50% Group 2; Oct 8, 2009 198 148747 Su F 1 P 703 960 15-Oct 0% Group 2; Oct 8, 2009 218 157291 Su F 1 P 634 823 13-Oct 0% Group 2; Oct 8, 2009 238 131293 Fa M 1 W 559 716 6-Nov Group 2; Oct 8, 2009 124 134005 Fa M 1 W 546 698 21-Oct Group 2; Oct 8, 2009 150 143281 Fa M 1 W 646 845 18-Oct Group 2; Oct 8, 2009 195 146072 Fa M 1 W 557 718 21-Oct Group 2; Oct 8, 2009 191 162547 Fa M 1 W 553 685 20-Oct Group 2; Oct 8, 2009 54 145300 Su M 1 G 610 798 18-Oct Group 2; Oct 8, 2009 155 156782 Su M 1 G 628 841 27-Oct Group 2; Oct 8, 2009 185 175403 Su M 1 G 669 852 14-Oct Group 2; Oct 8, 2009 26 176173 Su M 1 G 618 808 14-Oct Group 2; Oct 8, 2009 114 131684 Su M 1 G 454 620 23-Oct Group 2; Oct 8, 2009 302 145714 Fa F 2 Y/O 732 930 17-Oct 0% Oct swim-ins; Oct 9 303 147072 Fa F 2 Y/O 683 885 15-Oct 0% Oct swim-ins; Oct 9 304 153582 Fa F 2 Y/O 635 802 15-Oct 0% Oct swim-ins; Oct 9 305 155113 Fa F 2 Y/O 611 780 18-Oct 0% Oct swim-ins; Oct 9 306 163555 Fa F 2 Y/O 721 889 14-Oct <10% Oct swim-ins; Oct 9 138 138272 Su F 2 P 665 830 14-Oct <10% Group 2; Oct 8, 2009 29 139837 Su F 2 P - 824 13-Oct 0% Group 2; Oct 8, 2009 164 140983 Su F 2 P 738 908 13-Oct 0% Group 2; Oct 8, 2009 70 144457 Su F 2 P 685 853 13-Oct 0% Group 2; Oct 8, 2009 243 151114 Su F 2 P 682 828 13-Oct 0% Group 2; Oct 8, 2009 91 143391 Fa M 2 W 455 610 24-Oct Group 2; Oct 8, 2009 276 145432 Fa M 2 W 638 830 25-Oct Group 2; Oct 8, 2009 55 145940 Fa M 2 W 560 740 15-Oct Group 2; Oct 8, 2009 277 148051 Fa M 2 W 520 708 25-Oct Group 2; Oct 8, 2009 72 149028 Fa M 2 W 609 834 18-Oct Group 2; Oct 8, 2009 239 140710 Su M 2 G 494 676 22-Oct Group 2; Oct 8, 2009 48 147596 Su M 2 G 631 844 21-Oct Group 2; Oct 8, 2009 200 148280 Su M 2 G 660 886 17-Oct Group 2; Oct 8, 2009 104 149655 Su M 2 G 661 860 20-Oct Group 2; Oct 8, 2009 81 159005 Su M 2 G 510 606 22-Oct Group 2; Oct 8, 2009
25 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Appendix B. 2011 summer and fall Chinook spawning behaviour trial parent data.
Jack POH NF Age (yrs, DNA PIT Stock Sex Ck. Tag Length Length Mort Egg from Vial # Tag # Su/Fa M/F Sec# Colour1 (mm) (mm) date Retention scale) Comments 264 127715 Su F 1 n/t 730 874 17-Oct 0% 4 mature 278 150115 Su F 1 n/t 758 913 17-Oct 0% ? mature 293 144498 Su F 1 n/t 713 858 17-Oct 0% 4 semi mature 238 131293 Su F 1 n/t 730 914 20-Oct 0% 4 green (firm) 311 97526 Su F 1 n/t 718 861 20-Oct 0% 4 mature 390 79405 Su F 1 n/t 682 852 22-Oct 0% 4 green (firm) 313 128923 Su F 1 n/t 702 850 23-Oct 0% 4 green (firm) 225 165921 Su F 1 n/t 542 672 3-Nov 0% ? green (firm) 368 102449 Fa M 1 W 532 652 17-Oct 3 376 124823 Fa M 1 W 605 760 19-Oct 3 246 154365 Fa M 1 W 645 819 19-Oct 4 310 124726 Fa M 1 W 563 720 20-Oct 3 239 140710 Fa M 1 W 582 731 25-Oct 3 mature 299 124126 Fa M 1 W 555 710 25-Oct 3 mature 233 149198 Fa M 1 W 740 960 30-Oct 4 351 86162 Fa M 1 W 615 800 1-Nov 4 mature 353 111044 Su M 1 Y/O 538 661 15-Oct 3 mature 343 105634 Su M 1 Y/O 505 628 19-Oct 3 212 159705 Su M 1 Y/O 536 670 20-Oct 3 mature 319 79494 Su M 1 Y/O 498 630 21-Oct 3 mature 389 68658 Su M 1 Y/O 570 726 22-Oct 3 mature 251 161525 Su M 1 Y/O 589 738 26-Oct 3 272 144036 Su M 1 Y/O 753 965 30-Oct 4 mature 214 132854 Su M 1 Y/O 553 712 1-Nov 3 296 142372 Su F 2 n/t 710 860 15-Oct 0% 4 semi mature 289 170543 Su F 2 n/t 810 1000 19-Oct 0% 4 semi mature 302 79598 Su F 2 n/t 572 714 21-Oct 0% ? green (firm) 333 109394 Su F 2 n/t 770 963 25-Oct 0% 4 green (firm) Initial DNA result- Su; re-sampled DNA 386/397 56266 Fa F 2 n/t 592 713 25-Oct >75% 3 result-Fa 348 112719 Su F 2 n/t 635 776 25-Oct 0% 3 green (firm) 260 162678 Su F 2 n/t 562 673 30-Oct 0% 3 semi mature 320 72813 Fa M 2 P 520 641 19-Oct 3 mature 295 145748 Fa M 2 P 607 798 19-Oct 3 mature 362 95945 Fa M 2 P 590 735 19-Oct 3 259 146316 Fa M 2 P 614 770 20-Oct 3 mature 208 130074 Fa M 2 P 482 590 21-Oct 3 mature 312 107367 Fa M 2 P 710 910 21-Oct 4 357 97837 Fa M 2 P 565 674 22-Oct 3 316 59140 Fa M 2 P 590 764 24-Oct 3 350 86584 Su M 2 G 590 708 15-Oct 3 mature 394 92959 Su M 2 G 535 655 18-Oct 3 mature 274 156902 Su M 2 G 488 618 19-Oct 3 271 152053 Su M 2 G 536 668 19-Oct ? mature 288 132846 Su M 2 G 551 705 19-Oct 3 mature 340 95196 Su M 2 G 520 665 21-Oct 3 mature 280 165588 Su M 2 G 585 746 22-Oct 3 363 58902 Su M 2 G 670 876 28-Oct 4
26 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Appendix C. Photos from the 2009 and 2011 spawning behaviour trials.
Photo 1. Section 1 in Jack Creek, an artificial spawning channel at the Lower Puntledge Hatchery used for the 2009 and 2011 spawning trials.
Photo 2. Active spawning of summer and fall Chinook observed during the 2009 spawning trial.
27 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Photo 3. Chinook fry collected from Jack Creek and prepared for DNA analysis (caudal fins preserved in 95% un-denatured ethanol).
28 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Appendix D. Confirmation of FWCP Recognition – Comox Valley Echo May 4, 2012.
29 Puntledge River Summer and Fall Chinook Spawning Behaviour Study 10.Pun.05
Appendix E. FWCP Financial Statement. Project #: 10.Pun.05
BUDGET ACTUAL Other Other Other Other INCOME FWCP (Cash) (in-kind) FWCP (cash) (in-kind)
Total by Source $26,598 $20,240 $26,598 $20,240 Grand Total Income (BCRP + Other) $46,838 $46,838 EXPENSES Project Personnel Biologist (contractor) $8,400 $8,937.60 Technician (contractor) $2,450 $2,565.30 Communications Technician $1,125 $1,109.26 DFO Biologist $5,000 $5,000 DFO Technicians $8,400 $8,400 Material and Equipment Small Tools/supplies & equipment rental $200 $5,000 $244.35 $5,000.00 DNA Analysis $11,000 $11,000.00 Travel $330 $268.40 Newsletter $675 $49.26 Adiministration
Admin Fees (10%) $2,418 $1,840 $2,417.42 $1,840.00
Total Expenses $26,598 $20,240 $26,591.59 $20,240.00 Grand Total Expenses (FWCP + others) $46,838 $46,831.59
Balance (Grand Total Income - Grand Total Expenses $0.00 $6.41
30