ADAMTS5 in Healthy Muscle and Muscular Dystrophy

Home , ADAMTS13, ADAMTS3, ADAMTS5, Collectin, Matrix gla protein

ADAMTS5 in healthy muscle and muscular dystrophy

Adam Thomas Piers ORCID ID – 0000-003-4914-3451

Doctor of Philosophy November 2016

Faculty of Veterinary Science The University of Melbourne

This thesis is submitted in total fulfillment of the requirements of the degree.

Abstract

A Disintegrin and Metalloproteinase with Thrombospondin motifs 5 (ADAMTS5) is an extracellular matrix (ECM) protease that has been shown to exacerbate cartilage destruction in a murine arthritis model. Its function in skeletal muscle remains relatively unknown, aside from in vitro work highlighting its importance in myoblast fusion (1), and embryonic neuromuscular development (2). Microarray analysis of adult muscle from the mdx mouse model of muscular dystrophy showed that Adamts5 gene expression was upregulated compared to wild type mice (3). Significantly, this finding was supported by work showing that ADAMTS5 protein levels were elevated in the serum of both mdx mice and Duchenne muscular dystrophy (DMD) patients (4). This study went further to demonstrate that ADAMTS5 serum levels were amenable to antisense oligonucleotide exon skipping treatment, thus demonstrating that ADAMTS5 may be a therapy-responsive biomarker for future pre-clinical DMD trials.

The first part of this thesis investigated the role of ADAMTS5 in adult skeletal muscle by comparing wild type (WT) and Adamts5-/- knockout (KO) mice. The proteolytic cleavage of a known ADAMTS5 proteoglycan target, versican, was utilised as a readout of ADAMTS activity. Versican cleavage was detected using a neo-epitope antibody specific for the newly created C- terminal DPEAAE sequence of the cleaved versican product. It was demonstrated that versican cleavage was significantly reduced in KO muscle compared to WT muscle. The lack of upregulation in the gene expression of other known ADAMTS versicanases in KO mice demonstrated that ADAMTS5 was the major versican processing ADAMTS member in skeletal muscle. However, despite these differences in proteolytic activity, no differences were observed in postnatal muscle growth or function between WT and KO mice. Thus demonstrating that ADAMTS5 is dispensable for postnatal muscle development and function.

Positive immuno-staining for ADAMTS-cleaved versican fragments at the neuromuscular junction and around endothelial cells suggested that ADAMTS proteinases may play a role in these tissues. Previous work has shown that the proteolytic processing of ECM proteins is important for angiogenesis (5), while Adamts5 has been detected in the developing murine neuromuscular junction (2). To investigate the role of ADAMTS5 in angiogenesis and neuromuscular changes, WT and KO mice were exercised. Endurance exercise induces skeletal muscle adaptations and remodelling of the ECM, including the upregulation of various ECM proteins and proteases (6-8). This thesis showed that exercise significantly upregulated the gene expression of ADAMTS5 in muscle, but not the activity as measured by DPEAAE immunoblotting. The most significant result was that the typical exercise-induced adaptations observed in WT muscle, namely oxidative fibre type switching and angiogenesis, were inhibited in KO iii muscle. No differences were observed in the gene expression of the known oxidative pathway regulators calcineurin, PGC-1a, or VEGF-α. These results suggest that ADAMTS5 is involved in how muscle adapts to the demands of endurance exercise, possibly via ECM remodelling at the neuromuscular junction and/or endothelial cells.

To investigate whether the genetic ablation of ADAMTS5 ameliorated the pathology of mdx mice, KO mice were crossed with mdx mice to create mdx wt and mdx ko littermates. The gene expression and activity of ADAMTS5 was shown to be increased in mdx wt mice compared to WT mice, which led to the hypothesis that elevated ADAMTS proteoglycan proteolysis may exacerbate the mdx pathology. Previous work has suggested that ECM cleavage products act as damage-associated molecular patterns (DAMPs) to induce pathological inflammatory responses (9, 10). The pathology of 12 week old mdx wt and mdx ko mice were compared based on measures of muscle damage and function. No differences were observed in the levels of tibialis anterior (TA) muscle necrosis, diaphragm fibrosis, or the gene expression of inflammatory factors in the TA muscles of mdx wt and mdx ko mice. No improvement was observed in the force producing capacity of mdx ko TA muscles compared to mdx wt. However, mdx ko mice did display a significant improvement in their resistance to fatigue compared to mdx wt mice. The oxidative profile of mdx wt and mdx ko mice were not different when assessed based on myosin heavy chain isoform expression and gene expression analysis of oxidative markers. Overall, these results demonstrate that the genetic ablation of ADAMTS5 is not a viable therapy for the treatment of DMD.

This thesis demonstrated that fibroblasts were responsible for producing ADAMTS5 in the ECM surrounding skeletal muscle. To investigate how the genetic ablation of ADAMTS5 affected the ECM proteome (matrisome), fibroblasts were isolated from WT and KO mice and grown in tissue culture. Gene expression analysis of key ECM proteins demonstrated that KO fibroblast cultures were capable of producing a normal matrix. Proteins were then extracted from WT and KO fibroblasts using a sequential extraction protocol to allow label-free quantitative proteomic analysis to be performed. ECM protein abundance differences were evident in the amount of fibromodulin and fibrillin-1 between the groups, but no major differences were observed in the overall matrisome composition. Principal component analysis revealed variability within the WT samples, while DPEAAE immuno-blotting showed no difference in the processing of versican between WT and KO fibroblasts. These results suggest that ADAMTS5 is less active in vitro in cultured fibroblasts than in skeletal muscle. Future proteomic analysis using skeletal muscle from WT and KO mice may provide more information regarding the role of ADAMTS5 in the matrisome.

Declaration

This is to certity that:

(i) the thesis comprises only my original work towards the PhD except where indicated;

(ii) due acknowledgement has been made in the text to all other material used; and

(iii) the thesis is fewer than 100,000 words in length, exclusive of tables, maps, bibliographies and appendices.

Adam Thomas Piers

Preface

All work presented in this thesis was completed during the PhD candidature of Adam Piers. The following work was performed in collaboration with others:

The initial fibroblast isolation steps were performed with the help of Christopher Kintakas. Dr Constanza Angelucci provided training in sequential protein extractions and mass spectrometry sample preparation. Protein samples were run on the Orbitrap mass analyser by Dr Nicholas Williamson and Dr Ching-Seng Ang at Bio21. Training for the physiological apparatus was provided by Professor Gordon Lynch and Tim Naim at The University of Melbourne. Dr Peter Houweling aided in the setup of the physiological equipment and during some experiments. Dr Jason White kindly helped during the setup of the exercise cages and during the initial computer analysis. Finally, I am grateful to Dr Chantal Coles for training me in the dark art of Western blotting.

Acknowledgements

This has been a hugely challenging and rewarding journey, and one that I could not have undertaken without the incredible people that have been by my side here in Melbourne and across the Nullarbor.

I would like to start by thanking my two supervisors Jason and Shireen. ADAMTS5 has been a hard beast for all of us to tame, but the two of you have always been there pushing me to finish. Thank you for affording me the freedom to explore my ideas, but also knowing when to reign me in when I’ve inevitably drifted off on a tangential line of enquiry. Your support has taken me across the world presenting my work and meeting some of the greatest minds in our field. I think I’m finally beginning to understand what a scientist is.

To the past and present members of our lab, I also thank you for your support. I want to single out Chantal and Chris as we have formed quite the TS5 team over the past couple of years. I have loved our deep Friday chats, epic lab sessions, conference trips and of course the onion farmer shenanigans. You are both very dear friends to me and I look forward to many more adventures together out of the lab. I also want to extend my thanks to Keryn in Lebron country, Liam in Memphis, Connie in Tassie, and Pete, Alex, and Marta here in Melbourne, who were all there for me as friends and as constant sources of inspiration. Finally, I want to acknowledge the support of Boris Struk at Muscular Dystrophy Australia, who has been a vital supporter of my research.

Living away from my family over the course of my PhD has been hard, but has also led to me forming the most incredible connection with my friends. In particular Willow, Tahlia, Glynn and Lauren. I have lived with all of you at different stages over the past 5 years, and I want to thank you for your immense support and warmth. Big thanks to Henrik, Akin and the TSML crew for your wise words and love. I am also deeply indebted to the Spiller family; Marisa, Bruno, Dan, and Caity, for taking me in and supporting me like a member of your family. I have always felt extremely loved and welcome in your home, and will never forget what you did for me.

To my amazing family, you have given so much from afar. My trips home to the West always filled me with such love and energy, especially at the end. I will never forget my time sitting in the front room of 105 writing my chapters as I looked out on the street listening to The Boss. Thank you Mum, Dad, Hannah, Holly, Kuks, Wallace, Kaia, Bess and Bonnie for always being on the end of the phone when I needed you and for telling me that you were proud of what I was trying to accomplish. Your love and support means the world to me.

vii

Finally, to my Emily. Where to begin..I have been thinking about how to write this for a long time, as I literally cannot think of words to express how I feel about you and what you’ve done for me. You met me when I was a somewhat normal person (second year’s easy..), and have been by my side every step of the way through some very difficult times. Your massive heart and love have picked me up so many times along this journey. I will never forget all the sacrifices you made as a partner, and am proud to be standing alongside you as we step over the finishing line.

viii

Table of contents

1. Introduction to skeletal muscle and the extracellular matrix 1

1.1. Skeletal muscle 1 1.1.1. Structure 1 1.1.2. Myogenesis 3 1.1.3. Fibre types 3 1.1.4. Function 4 1.2. The Extracellular Matrix 8 1.2.1. Linking muscle and the matrix 8 1.2.2. Basement membrane proteins 11 1.2.3. Interstitial matrix proteins 12 1.2.4. Proteoglycans 13 1.2.5. ECM proteases 18 1.3. Muscle adaptations and repair 23 1.3.1. Muscle growth 23 1.3.2. Exercise-induced muscle adaptations 23 1.3.3. Muscle injury and repair 26 1.4. Muscular dystrophy 29 1.4.1. Duchenne muscular dystrophy 30 1.4.2. Current DMD therapies 31 1.5. The mdx mouse model of DMD 34 1.5.1. Muscle damage in dystrophic muscle 35 1.6. The ECM and dystrophic muscle 38 1.6.1. Proteoglycans in dystrophic muscle 39 1.6.2. Metalloproteinases in dystrophic muscle 39 1.6.3. The ECM and muscle regeneration 40 1.6.4. ECM-targeted therapies 40 2. Materials and methods 45

2.1. Animal work 45 2.1.1. Adamts5 genotyping protocol 46 2.1.2. Endpoint protocol 46 2.1.3. Creatine Kinase assay 47 2.1.4. Hydroxyproline assay 48 2.1.5. Voluntary wheel exercise 48 2.1.6. In situ muscle function 49 2.2. Histology 52 2.2.1. Cryostat protocol 52 2.2.2. Measuring myofibre size 52 2.2.3. Haematoxylin & Eosin histochemistry 53 2.2.4. H & E damage quantification 53 2.2.5. NADH histochemistry 53 2.2.6. X-gal staining of muscle sections and fibroblasts 54 ix

2.3. Immuno-histochemistry 54 2.3.1. Immuno-histochemistry antibodies 54 2.3.2. Versican immunostaining 55 2.3.3. DPEAAE Immunostaining 55 2.3.4. MYHC fibre typing 56 2.3.5. CD31 capillary density 57 2.3.6. Mdx IgG immuno-histochemistry 58 2.4. RNA isolation and quantitative real-time PCR 59 2.4.1. RNA isolation 59 2.4.2. Reverse transcription quantitative real-time PCR 59 2.4.3. Primers 60 2.4.4. Quantitative RT-PCR Analysis 61 2.5. Muscle protein analysis 61 2.5.1. Protein extraction 61 2.5.2. Protein quantification 62 2.5.3. Chondroitinase treatment 62 2.5.4. SDS-PAGE 62 2.5.5. Silver and coomassie staining 63 2.5.6. Western blots 63 2.6. Statistics 64

3. ADAMTS5 expression and activity in postnatal skeletal muscle 65

3.1. Introduction 65

3.2. Results 67 3.2.1. Fibroblasts express Adamts5 in the muscle ECM 67 3.2.2. Adamts proteinase gene expression in WT and KO muscle 69 3.2.3. Proteoglycan gene expression in WT and KO muscle 70 3.2.4. ADAMTS5 is a major versicanase in skeletal muscle 71 3.2.5. Adamts5 ablation does not affect postnatal muscle growth 72 3.2.6. Adamts5 ablation does not affect muscle force production 73 3.2.7. Versican proteolysis and localisation in muscle 74 3.2.8. Spatial versican processing in muscle 75 3.3. Discussion 76 3.3.1. ADAMTS5 is not required for postnatal muscle growth 76 3.3.2. Other ADAMTS members do not compensate for the absence of ADAMTS5 76 3.3.3. ADAMTS5 is the major versicanase in muscle 76 3.3.4. Adamts5 ablation does not affect muscle force production 77 3.3.5. Spatial versican processing 77 3.4. Conclusion 78

4. ADAMTS5 is required for exercise-induced muscle adaptations 79

4.1. Introduction 79

4.2. Results 81 4.2.1. Voluntary wheel exercise in WT and KO mice 81 4.2.2. The effect of exercise on postnatal growth in WT and KO mice 82 x

4.2.3. The effect of exercise on Adamts gene expression 84 4.2.4. Exercise increases proteoglycan gene expression 86 4.2.5. Exercise does not increase versican processing in muscle 87 4.2.6. Exercise-induced MYHC adaptations in WT and KO muscle 88 4.2.7. Exercise-induced angiogenesis in WT and KO muscle 91 4.2.8. Gene expression of metabolic pathways in WT and KO muscle 92 4.3. Discussion 93 4.3.1. ADAMTS5 is involved in how muscle adapts to exercise 93 4.3.2. Exercise-induced hypertrophy is absent in KO muscle 94 4.3.3. The effect of exercise on gene expression of ECM proteins 95 4.3.4. Muscle adaptations and ECM cleavage 96 4.4. Conclusion 97

5. Does genetic ablation of Adamts5 ameliorate the dystrophic pathology of mdx mice? 98

5.1. Introduction 98

5.2. Results 100 5.2.1. Gene expression of Adamts5 and versican in mdx muscle 100 5.2.2. ADAMTS-versican processing in mdx muscle 101 5.2.3. The expression of other ADAMTS versicanases are not upregulated in mdx ko muscle 102 5.2.4. Proteoglycan expression in mdx muscle 103 5.2.5. Mdx muscle growth is not affected by Adamts5 ablation 104 5.2.6. Adamts5 ablation reduces serum creatine kinase in mdx mice 105 5.2.7. Adamts5 ablation does not reduce mdx muscle necrosis 106 5.2.8. Adamts5 ablation does not reduce mdx sarcolemmal damage 107 5.2.9. Adamts5 ablation reduces central nuclei in mdx muscle 108 5.2.10. Adamts5 ablation does not affect the gene expression of Pax7 in mdx muscle 109 5.2.11. Adamts5 ablation does not ameliorate mdx diaphragm fibrosis 110 5.2.12. Adamts5 ablation does not affect the expression of inflammatory cytokines in mdx muscle 111 5.2.13. Muscle function in mdx wt and mdx ko mice 113 5.2.14. The genetic ablation of Adamts5 improves the fatigue resistance of mdx mice 114 5.2.15. The oxidative properties of mdx wt and mdx ko muscle 116 5.3. Discussion 118 5.3.1. Elevated Adamts5 expression and activity in mdx muscle 118 5.3.2. Adamts5 ablation does not ameliorate muscle damage in 12 week old mdx mice 119 5.3.3. Adamts5 ablation does not reduce the gene expression of inflammatory factors in dystrophic muscle 120 5.3.4. Adamts5 ablation does not improve mdx muscle strength 121 5.3.5. Adamts5 ablation improves mdx fatigue resistance 121 5.4. Conclusion 122

6. Proteomic analysis of ADAMTS5 in the fibroblast matrisome 123

6.1. Introduction 123

6.2. Methods 125 xi

6.2.1. Isolating primary fibroblasts from muscle 125 6.2.2. Tissue culture 126 6.2.3. RNA extraction 126 6.2.4. Sequential protein extraction 126 6.2.5. SDS-page and silver staining 129 6.2.6. Proteomics 130 6.3. Results and discussion 134 6.3.1. Adamts and proteoglycan gene expression 134 6.3.2. Silver staining of WT and KO proteins in sequential extracts 136 6.3.3. Principal Component Analysis of WT and KO combined data 139 6.3.4. Comparing the protein abundance of WT and KO samples from a combined analysis of all three extracts 140 6.3.5. Principal Component Analysis of sequential extracts from WT and KO samples 143 6.3.6. WT and KO matrisomes from sequential extracts 145 6.3.7. Comparing the protein abundance and solubility of WT and KO samples between fractions 147 6.3.8. Versican proteolysis and abundance 150 6.4. Conclusions and future directions 152

7. General Discussion 153

8. References 156

xii

List of Figures

Figure 1.1 A cross sectional view of the skeletal muscle structure ...... 2 Figure 1.2 Excitation-contraction coupling ...... 5 Figure 1.3 Length-tension relationship ...... 6 Figure 1.4 Principal components of a muscle contraction ...... 7 Figure 1.5 The DGC links the ECM to the myofibre cytoskeleton ...... 10 Figure 1.6 ECM proteins of the basement membrane and interstitial matrix ...... 12 Figure 1.7 The hyalectan family of aggrecan, versican, neurocan, and brevican ...... 14 Figure 1.8 The ADAMTS family ...... 20 Figure 1.9 Biglycan activation of macrophage inflammasomes ...... 28 Figure 1.10 Distribution of muscle weakness in muscular dystrophy...... 30 Figure 1.11 Haematoxylin & Eosin staining of control and DMD muscle sections ...... 31 Figure 2.1 The hind-limb muscles of a mouse ...... 47 Figure 2.2 The in situ muscle function setup ...... 51 Figure 2.3 A representative mask of transverse muscle sections used for calculating minimal Feret’s diameter ...... 52 Figure 2.4 Representative immunohistochemical images of solei and EDL muscles using MYHC antibodies ...... 57 Figure 2.5 CD31 grid analysis from the soleus muscles ...... 58 Figure 3.1 Adamts5 is expressed by fibroblasts in the endomysium and perimysium of skeletal muscle ...... 68 Figure 3.2 Gene expression of Adamts proteinases in WT and KO muscle from 12 week old male mice ...... 69 Figure 3.3 Gene expression of proteoglycans in WT and KO muscle from 12 week old male mice ...... 70 Figure 3.4 Proteolytic processing of versican in WT and KO skeletal muscle ...... 71 Figure 3.5 Adamts5 ablation does not affect postnatal muscle growth ...... 72 Figure 3.6 Adamts5 ablation does not affect muscle function...... 73 Figure 3.7 Localisation of full length and cleaved versican (DPEAAE) around myofibres ...... 74 Figure 3.8 Spatial processing of versican in muscle from 12 week old male mice...... 75 Figure 4.1 Analysis of voluntary wheel exercise in WT and KO mice from 12 week old male mice ...... 81 Figure 4.2 The effect of voluntary exercise on postnatal growth in 12 week old male WT and KO mice ...... 83 Figure 4.3 The effect of exercise on Adamts expression in WT and KO muscle from 12 week old male mice ...... 85 Figure 4.4 Exercise increases the gene expression of proteoglycans in WT and KO muscle from 12 week old male mice ...... 86 Figure 4.5 The effect of exercise on versican processing in WT and KO soleus muscles from 12 week old male mice ...... 87 Figure 4.6 Exercise-induced fibre type transitions in WT and KO muscle from 12 week old male mice ...... 89 Figure 4.7 Gene expression of MYHC isoforms in the EDL muscle of 12 week old male WT and KO mice ...... 90 Figure 4.8 Exercise-induced angiogenesis in WT and KO muscle from 12 week old male mice ...... 91 Figure 4.9 The effect of exercise on the gene expression of metabolic genes in WT and KO muscle from 12 week old male mice ...... 92 Figure 5.1 Adamts5 and versican mRNAs are upregulated in 12 week old mdx muscle ...... 100 Figure 5.2 Increased ADAMTS-processing of versican in mdx muscle ...... 101

xiii

Figure 5.3 Gene expression of Adamts proteinases in the TA muscles of 12 week old male mdx mice ...... 102 Figure 5.4 Gene expression of proteoglycans in the TA muscle of 12 week old male mdx mice ...... 103 Figure 5.5 Body mass, muscle mass and muscle size of mdx wt and mdx ko mice ...... 104 Figure 5.6 Genetic ablation of Adamts5 reduces serum creatine kinase (CK) levels in 12 week old male mdx mice ...... 105 Figure 5.7 Genetic ablation of Adamts5 does not reduce muscle necrosis in 12 week old male mdx mice ...... 106 Figure 5.8 Genetic ablation of Adamts5 does not reduce the number of IgG-positive fibres in 12 week old male mdx mice ...... 107 Figure 5.9 The proportion of previous muscle damage from 12 and 3 week old mdx wt and mdx ko mice ...... 108 Figure 5.10 Genetic ablation of Adamts5 does not alter the gene expression of Pax7 in the TA muscles of 12 week old male mdx mice ...... 109 Figure 5.11 Genetic ablation of Adamts5 does not ameliorate diaphragm fibrosis in male mdx mice ...... 110 Figure 5.12 Genetic ablation of Adamts5 does not alter the gene expression of inflammatory factors in the TA muscles of 12 week male mdx mice ...... 112 Figure 5.13 Genetic ablation of Adamts5 does not improve force production in the TA muscle of 12 week old mdx mice ...... 113 Figure 5.14 Genetic ablation of Adamts5 improves the fatigue resistance of TA muscles in 12 week old male mdx mice ...... 115 Figure 5.15 Genetic ablation of Adamts5 does not alter the oxidative profile of the TA muscle of 12 week old male mdx mice ...... 117 Figure 6.1 The isolation of muscle-derived fibroblasts for tissue culture, RNA extraction, sequential protein extraction, and proteomics ...... 128 Figure 6.2 The gene expression of Adamts proteinases, ECM proteins, and MyoD in WT and KO fibroblasts ...... 135 Figure 6.3 Silver stained WT and KO protein extracts from sequential extracts ...... 136 Figure 6.4 Identification of protein bands from MS analysis of WT and KO GuHCl in gel digests ...... 138 Figure 6.5 Principal component analysis of combined WT and KO replicates ...... 139 Figure 6.6 Comparison of WT vs KO protein abundances ...... 142 Figure 6.7 Principal component analysis of WT and KO replicates in NaCl, SDS and GuHCl extraction fractions ...... 144 Figure 6.8 The Matrisomes of WT and KO fibroblasts across NaCl, SDS and GuHCl fractions ...... 146 Figure 6.9 Comparing the abundance of proteins from WT and KO samples in NaCl, SDS, and GuHCl extractions ...... 149 Figure 6.10 WT and KO versican proteolysis in fibroblasts and muscle ...... 151

List of Tables

Table 1.1 Muscle fibre types ...... 4 Table 2.1 Animal ethics application numbers ...... 45 Table 2.2 Adamts5 primers...... 46 Table 2.3 Primary antibodies used for immuno-histochemistry ...... 54 Table 2.4 Secondary and conjugated antibodies used for immuno-histochemistry ...... 55 Table 2.5 Primers designed for qRT-PCR ...... 60 Table 2.6 Antibodies used for Western blotting...... 64 xiv

List of Abbreviations

ADAMTS A Disintegrin and Metalloproteinase with Thrombospondin motifs

AIM2 Absence in melanoma 2

ANOVA Analysis of variance

ATP Adenosine triphosphate

BCP 1-Bromo-3-chloropropane

BMD Becker muscular dystrophy

BMP Bone morphogenetic protein

Bp Base pair

BSA Bovine serum albumin

CD31 Platelet endothelial cell adhesion molecule cDNA Complimentary deoxyribonucleic acid

CK Creatine kinase

CID Collision induced dissociation

CSPG Chondroitin sulphate proteoglycan

Ct Cycle threshold

DAMPs Damage-associated molecular patterns

DAPI 4’,6-diamidino-2-phenylindole

DGC Dystroglycan complex

DMA-HT Dynamic Muscle Analysis High Throughput

DMC Dynamic Muscle Control system

DMD Duchenne muscular dystrophy

DMEM Dulbecco’s modified eagle medium

DNA Deoxyribonucleic acid dNTP Deoxyribonucleotide triphosphate

DTT Dithiothreitol

EBD Evans blue dye

ECM Extracellular matrix xv

EDL Extensor digitorum longus

EDTA Ethylenediaminetetraacetic acid

ER Endoplasmic reticulum

F4/80 EGF-like module-containing mucin-like hormone receptor-like 1

FBS Foetal bovine serum

FGF Fibroblast growth factor

GAG Glycosaminoglycan

GuHCl Guanidine-hydrochloride

HA Hyaluronic acid

HCl Hydrochloric acid

HPLC High Performance Liquid Chromatography

HPRT Hypoxanthine-guanine phosphoribosyltransferase

IFN-γ Interferon gamma

IGF-1 Insulin-like growth factor 1

IgG Immunoglobulin

IL Interluekin iBAQ Intensity based absolute quantification kD Kilodalton

LFQ Label free quantification intensity

LC-MS/MS Liquid chromatography-tandem mass spectrometry

Lo Optimal muscle length

LTBP Latent binding protein

MCRI Murdoch Childrens Research Institute

MMP Matrix metalloproteinase

MNE Mean normalised expression

MOPS 3-(N-morpholino) propanesulfonic acid

Mrf Myogenic regulatory factors

MYHC Myosin heavy chain

NaCl Sodium chloride

NADH Nicotinamide adenine dinucleotide tetrazolium

NBT Nitro blue tetrazolium xvi

NFAT Nuclear factor of activated T-cells

NF-kB Nuclear factor kappa-light-chain-enhancer of activated B cells

NLRP3 Cytoplasmic NOD-like receptor proteins

OCT Optimal cutting temperature compound

PAMPs Pathogen-associated molecular patterns

PBS Phosphate-buffered saline

PFA Paraformaldehyde

PGC-1a Peroxisome proliferator-activated receptor gamma coactivator 1-alpha

Po Maximal tetanic force

PRRs Pathogen recognition receptors

PVA Polyvinyl alcohol

PVDF Polyvinylidene fluoride qRT-PCR Real-Time Quantitative Reverse Transcription

ROS Reactive oxygen species

SDS Sodium dodecyl sulphate

SEM Standard error of the mean

SLRP Small leucine-rich proteoglycan sPo Maximal specific tetanic force

SR Sarcoplasmic reticulum

TA Tibialis anterior

TBS Tris-buffered saline

TGFβ Transforming growth factor β

Th-1 T-helper cell

TIMP Tissue inhibitor of metalloproteinase

TLR Toll-like receptor

TRP Transient receptor potential

VEGF Vascular endothelial growth factor

WT Wild type

xvii

1. Introduction to skeletal muscle and the extracellular matrix 1.1. Skeletal muscle Skeletal muscle is essential for life. Man has studied and documented it throughout history. Leonardo Da Vinci sketched shoulder muscles in the early 16th century, and the ‘father of modern anatomy’ Andreas Vesalius, detailed the appearance and location of dead muscle in his seminal work Fabrica (1555). In 1791, Luigi Galvani stimulated frog legs to demonstrate the relationship between muscle and electricity. Guillaume-Benjamin-Amand Duchenne built on Galvani’s work to develop his own line of investigation into neurological disorders, with his contributions reflected in the naming of Duchenne muscular dystrophy after him. During the early 19th century Carlo Matteucci became the first person to prove that electrical signals originate in muscles. The field exploded in the 20th century with the advent of advanced microscopic techniques, x-ray diffraction, and biochemical techniques, all of which paved the way for what we today consider muscle biology (11-14).

Skeletal muscle is essential for movement, breathing, posture, heat regulation, reflexes and metabolism (15). It is a highly adaptable tissue, with unique abilities for self-repair and regeneration. However, when compromised, as occurs in muscular dystrophy, the effects are severe and even lethal. This chapter will introduce the general physiology of skeletal muscle and the surrounding extracellular matrix (ECM). In addition, the role of the ECM in muscle adaptations and muscular dystrophy will also be discussed.

1.1.1. Structure Skeletal muscle tissue is comprised of bundles of muscle cells (myofibres), the surrounding connective tissue of the ECM, motor nerves, and blood vessels. Myofibres are syncytial cells, which means that they contain multiple nuclei. In healthy muscle, the nuclei are located on the periphery of the cell, in close proximity to the muscle membrane (sarcolemma). The structure of skeletal muscle is best described in concert with the ECM. From the gross level it consists of: the epimysium surrounding the entire muscle, the perimysium that encompasses muscle bundles and the associated blood vessels and nerves, and lastly the endomysium that ensheaths individual myofibres (Figure 1.1) (16). At the most basic level the myofibre is made up of sarcomeres, the functional units of muscle.

Figure 1.1 A cross sectional view of the skeletal muscle structure

Depicted is the relationship between the motor neuron, muscle, blood vessels, and the surrounding connective tissue of the ECM. The motor nerve provides the initial stimulus for a muscle contraction, with the t-tubular system also playing a vital signalling role. The epimysium is the connective tissue matrix which separates individual muscles. The perimysium is the matrix which separates groups of myofibres (fascicles) within an individual muscle. Endomysium is the extracellular matrix found between individual myotubes within an individual fascicle. Adjacent to the endomysium is the sarcolemma, which houses the myofibrillar components. These myofibrillar components make up the sarcomere, the functional unit of muscle that is responsible for muscular contractions, and thus movement. Fiorotto ML. 2012.

Force is generated within the sarcomere through the interaction of groups of myofibrillar proteins known as the thick and thin filaments (13). The series arrangement of the filaments gives muscle its characteristic striated appearance. The major components of the thin filament are actin, troponin-C, troponin-T, troponin-I, and the thin filament associated protein nebulin. The thick filament consists of myosin, myosin binding proteins, and the thick filament associated protein titin (17). The boundary of one sarcomere is demarcated from the next by the Z-lines. Actin, nebulin, myosin and titin all insert into the Z-line. Associated with the Z-line is α-actinin, which

2 is an actin-linking protein found at the end of the thin filament (18). Later in this chapter, the peri- myofibrillar cytoskeleton that links the myofilament to the ECM will be discussed.

1.1.2. Myogenesis Myogenesis is a highly organised sequence of cellular events involved in the development and repair of muscle tissue. It occurs in successive waves; beginning with the embryonic phase (E10.5-12.5 in mouse), that transitions into foetal and neonatal phase (P0 and P0-21 respectively), before finally entering adult myogenesis, where postnatal growth and muscle repair occur (19). Postnatal growth is attributed to the activity of myogenic satellite cells located between layers of the basement membrane, a component of the ECM (20).

The first phase of myogenesis involves commitment of progenitors to a myoblast fate, followed by differentiation and fusion to form multi-nucleated myofibres. The entire process is controlled by positive and negative regulators, who direct the mesodermal precursor cells down the myogenic lineage. Myod and Myf5 are basic helix-loop-helix transcriptional activators of the myogenic regulatory factor family expressed by proliferating myoblasts (21). Proliferating myoblasts withdraw from the cell cycle to become terminally differentiated myocytes that express the late MRFs Myog and Mrf4. This is followed by expression of muscle specific genes, such as myosin heavy chain (MYHC) and muscle creatine kinase (21).

Embryonic development is characterised by the differentiation of myoblasts into primary myofibres, while later in foetal development myoblasts fuse with primary fibres and one another to create secondary myofibres (17). These different fibre generations express different MYHC isoforms, resulting in fibre type diversity. Early in development, all fibres express embryonic MYHC, but the primary fibres express only slow MYHC-1 and neonatal MYHC. The secondary fibres that appear after birth express MYHC-1 (Myh7) as well as three fast isoforms, MYHC-2a (Myh2), MYHC-2x (Myh1), and MYHC-2b (Myh4) (22).

1.1.3. Fibre types Skeletal muscle is a heterogeneous tissue comprised of fibres with different properties and functions. The MYHC isoform expression of a muscle ultimately determines the rate of cross- bridge cycling and thus the speed at which a muscle contracts (23). Slow fibres express slow MYHC-1 and therefore contract more slowly in comparison to fast fibres that express more MYHC-2x and MYHC-2b. The rapid rate of cross-bridge adenosine triphosphate (ATP) consumption in fast fibres contributes to their reduced fatigue resistance, while the slower isoforms are characterised by increased fatigue resistance. Mitochondrial density and oxidative capacity also contribute to the fatigue resistance of a muscle (Table 1.1). The largely oxidative slow fibres contain a high density of mitochondria and capillaries, which are characteristic of

aerobic metabolism (24). In contrast, the predominantly glycolytic fast fibres have a lower density of mitochondria and capillaries. MYHC-2a fibres are a fascinating hybrid of both slow and fast fibres in that they incorporate both aerobic and glycolytic properties.

Table 1.1 Muscle fibre types

Mammalian muscle is categorised into 4 fibre types: MYHC-1, MYHC-2a, MYHC-2x, and MYHC-2b. Each fibre type has distinct properties that reflect their metabolic and functional roles. The properties discussed here are: speed of contraction, resistance to fatigue, power production, mitochondrial density, capillary density, myosin heavy chain gene expression, as well as metabolic parameters related to aerobic, oxidative and glycolytic capacity.

Slow Twitch Fast Twitch Fast Twitch Fast Twitch (Type 1) (Type 2a) (Type 2x) (Type 2b) Contraction time Slow Moderately fast Fast Very fast Resistance to fatigue High Fairly high Intermediate Low

Activity Aerobic Long-term aerobic Short-term aerobic Short-term aerobic

Power produced Low Medium High Very high Mitochondrial Very high High Medium Low density Capillary density High Intermediate Low Low Oxidative capacity High High Intermediate Low Glycolytic capacity Low High High High

Myosin heavy chain Myh7 Myh2 Myh1 Myh4 gene

Pioneering work demonstrated that motor-neuron innervation is the primary determinant of muscle fibre type (25). Subsequent experiments supported this by showing that muscle adapts rapidly to changes in neural activity (26). Muscle fibre type adaptations can be measured by studying MYHC switching along the continuum: MYHC-1/MYHC-2a/MYHC-2x/MYHC-2b (22). The elongated half-relaxation time and fatigue resistant properties of the soleus muscle can be attributed to a high proportion of MYHC-1 and MYHC-2a fibres. In contrast, the extensor digitorum longus (EDL) contracts and fatigues more rapidly due to a preponderance of fast twitch MYHC-2x and MYHC-2b fibres (27).

1.1.4. Function

Excitation-contraction coupling Excitation-contraction coupling describes the series of events that occur when a motor nerve delivers an action potential to elicit a muscle contraction (28). The motor nerve body, axon, terminal branches, and the innervated myofibre all constitute the motor unit. An increase in force is made possible by recruiting more motor units to perform a contraction.

Propagated action potentials initiate acetylcholine release at the neuromuscular junction, leading to depolarisation of the sarcolemma. The transverse-tubular-ryanodine system form a series of invaginations along the sarcolemma (Figure 1.1). Depolarisation of the sarcolemma and connected t-tubular-ryanodine system causes calcium release from the sarcoplasmic reticulum, the calcium store of the myofibre. Increased intracellular calcium enables the binding of troponin- C, which lifts the steric hindrance of tropomyosin to permit myosin and actin filament interactions. The sarcomere generates force when myosin and actin are able to form a cross-bridge and perform the power stroke upon hydrolysis of ATP (Figure 1.2). The force generated within the sarcomere is transferred through the sarcolemma via focal adhesion points to the surrounding ECM (29, 30). From the ECM, the force is propagated through the tendons to move the desired bone (31).

Figure 1.2 Excitation-contraction coupling

The pathway begins at the neuromuscular junction with acetylcholine (ACh) being released from the axon terminal of the motor neuron. ACh binds to receptors on the opposing motor end plate to elicit an action potential (AP) within the myofibre. The AP then propagates along the sarcolemma and down the transverse-tubular system to trigger calcium release from the sarcoplasmic reticulum (SR). The liberated calcium binds to troponin-C and shifts tropomyosin away, thus allowing myosin and actin to a form cross-bridge. In this cross-bridge formation the power stroke is performed, allowing the muscle to develop force against an opposing load. Following a contraction, the myofibre relaxes upon breakup of the cross-bridge, movement of tropomyosin into the inhibitory position, and the pumping of calcium back into the SR. Cummings 2008 (Pearson Education Inc.).

Length-tension relationship One of the basic principles of muscle physiology dictates that the force developed by a muscle is directly proportional to its length. This theory is aptly referred to as the length-tension relationship. The relationship is based on the sliding filament hypothesis, which states that the force produced by a sarcomere depends on the overlap between myosin and actin filaments (13). When a muscle is stimulated at increasing lengths, the force increases up to a maximal point, which corresponds to a sarcomere length where the filament overlap is optimal (Figure 1.3). Muscle contractions can be categorised based on their muscle length during movement; isometric contractions occur at a fixed length, eccentric contractions lengthen with movement, while the muscle shortens during a concentric contraction.

Figure 1.3 Length-tension relationship

The force (y-axis) produced by a muscle is directly proportional to its length (x-axis). The green plateau highlights the muscle length where the overlap between the actin and myosin filaments is optimal for cross-bridge formation and thus maximal muscle force production. Cummings 2008 (Pearson Education Inc.).

Force-frequency relationship A twitch contraction is a single stimulus–contraction–relaxation sequence within a myofibre. This sequence consists of excitation-contraction coupling, sarcoplasmic reticulum calcium release and the formation of cross-bridges. A twitch is characterized by latent, contraction and relaxation phases, which differ in terms of calcium release and cross bridge recruitment (32). During muscle relaxation, calcium is sequestered back to the sarcoplasmic reticulum, myosin heads release their binding to actin, and the filaments move passively back to their resting positions.

However, if a second stimulus is applied at a rate faster than the calcium recycling, twitches summate to produce a more powerful tetanic contraction (Figure 1.4). The summation of individual twitches to form a tetanus demonstrates that the force produced by a muscle is

6 proportional to the frequency of stimulation. The force frequency relationship is determined by the rate of force development and relaxation, which in turn are dependent the gene expression of myosin heavy chain isoforms, as well as the calcium handling properties of the muscle (33).

Figure 1.4 Principal components of a muscle contraction

The twitch arises from a single stimulus (action potential). Multiple twitches from multiple stimuli summate to transition into the incomplete tetanus, and finally into a complete tetanus. The tetanic contraction represents the maximal force that a muscle is able to produce.

Muscle fatigue Muscle fatigue is the reversible decline in the ability of a muscle to sustain the strength of a contraction, or a decrease in force production per cross bridge (34). The majority of what we know about fatigue at the cellular level comes from work using single muscle fibres, which forms the basis of an excellent review by Allen et al (24). The reduced force production in fatigued muscle can be divided into: a reduction in maximum isometric force; a reduction in myofibrillar calcium sensitivity; and a reduction in sarcoplasmic reticulum release, leading to a decline in the myoplasmic free calcium concentration during tetanus (35).

The classic explanation for fatigue is an intracellular accumulation of lactate, inorganic phosphate, and hydrogen ions. This accumulation creates a competition for calcium binding sites on troponin C, leading to reduced myofibrillar calcium sensitivity (35). However, the metabolite accumulation theory has been superseded by recent work attributing fatigue to a combination of: ionic changes in the action potential, impaired sarcoplasmic reticulum calcium release, reduced neurotransmitter release at synapses, as well as the damaging effects of reactive oxygen species (ROS) (24). When discussing fatigue, it is important to distinguish between peripheral and central fatigue. Processes occurring in the spinal cord and above are defined as central, while those located in the peripheral nerve, neuromuscular junction and muscles are referred to as peripheral fatigue (24). This thesis will discuss peripheral fatigue originating from within the muscle.

As mentioned, the exact cause of muscle fatigue is not known. One possible explanation is a disruption to the excitation-contraction coupling pathway (36). The conduction of the action potential down the transverse tubule into the myofibre is a crucial early event in excitation- contraction coupling. Due to its small volume, small ionic changes across the t-tubular system can disrupt excitation-contraction coupling (24). Examples of ionic changes are decreases in the Na+ electrochemical gradient or shifts in K+ and Cl- permeability (37). Interestingly, it has been shown that chondroitin sulphate proteoglycans, which form part of the ECM, are structural

7 components of the t-tubular system (38). This raises the question as to whether changes in the ECM composition of the t-tubular system might affect excitation-contraction coupling.

An accumulation of inorganic phosphate from the breakdown of creatine phosphate decreases force production, calcium sensitivity and calcium release, all of which contribute to muscle fatigue (39). The correlation between fatigue and increased intracellular levels of lactate and hydrogen ions is not as convincing as once thought (39). In a study using isolated myofibres, lowering the pH from 7.18 to 6.77 did not decrease tetanic force production, or the rate of fatigue following repeated stimulation (40). Finally, it has been shown that minimising ROS levels using exogenous ROS scavengers reduces fatigue in isolated and intact muscles (24). From the literature it is evident that no single theory explains why muscle fatigues, but rather that a combination of different factors are responsible.

1.2. The Extracellular Matrix The ECM is the non-cellular component that surrounds all tissues and organs (41). Traditionally the ECM was viewed solely as a structural support for cells. However, it is now increasingly recognised as having a variety of roles in physiological functions and tissue morphogenesis. The ECM influences signal transduction and gene transcription through the binding of growth factors and the sequestration of cytokines to interact with cell-surface receptors (41). The significance of the ECM is highlighted by the wide range of disorders that arise from genetic abnormalities in ECM proteins (42).

At its most basic form the ECM is composed of water, polysaccharides and proteins. The total complement of matrix proteins is referred to as the matrisome, which includes over 300 core ECM proteins, ECM-modifying enzymes, ECM-binding growth factors, and other ECM-associated proteins (43). Although typically discussed in isolation, the majority of ECM proteins exist as supramolecular aggregates in nature. Together these aggregates are regulated by proteolytic remodelling. Proteolysis represents a form of post-translational modification of ECM proteins, while remodelling refers to the breakdown and clearance of ECM, such as occurs during digit web regression (44). Unlike turnover, where degraded tissue is replaced, remodelling typically does not lead to replacement. In this thesis processing will be used to describe the proteolysis of proteins during maturation, such as occurs in procollagens (44). Finally, cleavage is a form of proteolysis at one or more sites along a protein that generates distinct protein fragments.

1.2.1. Linking muscle and the matrix The force generated within sarcomeres is transferred through the sarcolemma to the connective tissue attached to bones. (31). The ECM components of this connective tissue layer are referred to as the basement membrane and the interstitial matrix. A series of proteins link the basement

8 membrane and adjacent sarcolemma to the inside of the myofibre and the sarcomere. Before reviewing the ECM proteins of the interstitial matrix and the basement membrane, this link between the ECM and the inside of the myofibre will be discussed by way of the dystrophin- associated glycoprotein complex (DGC), utrophin, and the basement membrane proteins laminin and integrin.

At its core, the DGC consists of dystroglycan, as well as the transmembrane proteins sarcospan and sarcoglycan, dystrobrevin and syntrophins, which interact with the C-terminus of dystrophin (Figure 1.5). In skeletal muscle, α- and β-dystroglycans exist in a glycosylated complex (45). The position of the dystroglycan complex within the sarcolemma allows it to interact with ligands in the surrounding ECM through α-dystroglycan, as well as with dystrophin inside the myofibre through β-dystroglycan (46). Extracellularly, α-dystroglycan acts as a laminin-2 receptor, in addition to binding agrin at the neuromuscular junction (47). At the cell surface, α-dystroglycan is involved in the assembly of the ECM through polymerisation of laminin (48).

The sarcoglycans are a family of four glycosylated transmembrane proteins (α, β, γ, and δ). The precise binding partners of the various sarcoglycans are still unconfirmed, with different groups reporting β-dystroglycan and dystrophin interactions (49). The current theory more generally hypothesises that sarcoglycans help stabilise the DGC within the sarcolemma (50). Biglycan has also been shown to bind α- and γ- sarcoglycan, where it helps to regulate their expression during development (51).The sarcoglycan complex is the only known binding partner of sarcospan (52), which is a protein involved in recruiting proteins to the sarcolemma, where it forms stable signalling complexes (53). It has also been postulated that syntrophins are involved in membrane signalling, as syntrophin deficient mice have reduced expression of utrophin, acetylcholine receptor, and acetylcholinesterase at the neuromuscular junction (54). Finally, dystrobrevin also plays a role in signal transduction by linking the sarcoglycan/sarcospan and syntrophin complexes (55).

Figure 1.5 The DGC links the ECM to the myofibre cytoskeleton

The ECM is depicted at the top as collagen fibrils connected to laminin, with myofibrillar actin filaments bound to dystrophin at the bottom. The DGC is a complex of transmembrane proteins consisting of sarcospan, sarcoglycans (α, β, γ, δ), dystrobrevin, syntrophins, and dystrophin. Guiraud et al 2015 (56). Dystrophin The dystrophin family consists of dystrophin, utrophin, and dystrophin-related protein 2 (49). Dystrophin is encoded by the 2 Mb DMD gene, which spans 85 exons (57). It is a 427 kDa protein expressed in skeletal muscle, cardiac muscle, and the brain (58). Dystrophin is composed of four major domains that all interact with various proteins: the N-terminal domain binds actin, the large central rod domain also shares actin-binding capabilities, the cysteine-rich region binds β- dystroglycan, and the C-terminal domain interacts with dystrobrevins and the syntrophins (59).

Dystrophin is a key component of the DGC, where it links F-actin to the ECM (Figure 1.5) (46). This connection between dystrophin and the underlying cytoskeleton provides mechanical protection for the sarcolemma (60). In addition, dystrophin also acts as a scaffolding protein for ion channels and various signalling pathways (61). Duchenne muscular dystrophy arises from genetic mutations in the dystrophin gene, which cause dystrophin to be absent from muscle (57). It is important to highlight that the absence of dystrophin results in the loss of the entire DGC (62). The contraction-induced sarcolemmal damage that characterises dystrophin-deficient muscle will be discussed later.

Utrophin Utrophin is a homologue of dystrophin that was first identified in human foetal muscle (63). Both proteins are cytoskeletal members of the spectrin and α-actinin superfamily who share homology

10 along their entire amino acid sequences (63). Utrophin (UTRN) is expressed fairly ubiquitously in an array of tissues, including vascular smooth muscle, endothelium, nerves, and at the neuromuscular junction (64). UTRN is not expressed in mature myofibres, but is present in the sarcolemma of developing, regenerating, and dystrophin-deficient fibres (64). Based on these observations, the therapeutic potential of utrophin was conceived and it is currently being trialled as a therapy for DMD (65-67).

1.2.2. Basement membrane proteins The basement membrane is the transition zone between the sarcolemma and the ECM (Figure 1.6) (68). It is composed of two layers; an internal basal lamina and an external fibrillar reticular lamina (69). The basal lamina is a 50-100 nm macromolecular network composed of collagenous glycoproteins, non-collagenous glycoproteins and proteoglycans (16). The basement membrane is primarily made up of laminin and collagen IV, which form networks with other basement membrane proteins, such as nidogen and perlecan, as well as integrins and the DGC (31). Fibroblasts, the main ECM-producing cell in muscle, are involved in the formation of the basement membrane early in myogenesis (70), while laminin is secreted by myofibres (71). The main roles of the basement membrane in muscle are the transfer of sarcomeric forces, myogenesis, and synaptogenesis (69).

Laminin and integrin The myogenic laminins are comprised of laminin -211, -4, -8, -9, and -10 (72). Laminin-211 is the most abundant form around the sarcolemma, while laminin-4 is found at myotendinous and neuromuscular junctions (31). Laminins are heterotrimers made up of α, β and γ chains, with the α2 chain being the most abundant in the basement membrane of mature skeletal muscle (Figure 1.5) (72). The importance of the α2 chain is evidenced by the congenital muscular dystrophies that arise in its absence (69).

Closely associated with laminins in the basement membrane are integrins, which are cell surface adhesion molecules that link the inside of the cell to the ECM. Aside from laminins, integrins also bind other ECM proteins, such as collagen, fibronectin, and tenascin (73). Integrins help regulate a plethora of cellular events by translating mechanical and structural cues into intracellular molecular signals (73). They consist of α and β subunits arranged into heterodimers (72), such as the β1 subunit which dimerises with laminin-α7. Integrin-α7β1 is a laminin receptor that has been localised to the surface of myoblasts and myofibres, where it is involved in myoblast migration and proliferation, and the development of neuromuscular and myotendinous junctions (74, 75). Interestingly, integrin-α7β1 is upregulated in the sarcolemma of DMD patients (76). Furthermore, delivery of an adeno-associated virus containing the human integrin-α7β1 gene ameliorates the pathology of the mdx mouse model of DMD (77).

Microfibrils Collagen, elastin fibres, and microfibrils exist as macromolecular aggregates within the ECM (78). Fibrillin-1 and fibrillin-2 are the basic components of the microfibril, with mutations in them leading to connective tissue diseases such as Marfan syndrome (79). Interestingly, it has been proposed that ECM proteases may modulate microfibril formation and function by interacting with fibrillin-1 (80). Electron microscopic immuno-localisation in tissue and extracted microfibrils has shown that fibrillin microfibrils covalently bind to the C-terminus of the proteoglycan versican (81). More recently, fibrillin-1 was shown to co-localise with versican, perlecan and latent transforming growth factor β binding protein-2 (LTBP2) in the spinal pericellular matrix (82). LTBP2 and -4 help stabilise microfibril bundles and regulate elastic fibre assembly (83)

1.2.3. Interstitial matrix proteins The interstitial matrix is composed mainly of collagens, elastin, fibronectin, tenascin and proteoglycans (41). It provides structural support for nerves and blood vessels, as well as helping to transfer force from the myofibre to the skeleton during movement (73).

Figure 1.6 ECM proteins of the basement membrane and interstitial matrix

ECM proteins can be broadly divided into basement membrane and interstitial matrix proteins. Three myofibres in cross section are depicted showing the sarcolemma in black, basement membrane in green, and interstitial matrix in red. Proteins of the basement membrane include laminin, integrin and collagen (IV and VI). The interstitial matrix consists of collagens (I, III, V, XI, XII, XIV), elastin, fibronectin, and proteoglycans. Collagen The collagens are a large superfamily consisting of 27 different types. They are grouped based on their structure and supramolecular organisation into: fibril-forming, fibril-associated, network- forming, anchoring, basement-membrane, and transmembrane collagens (84). Collagens are comprised of polypeptide α chains coiled into triple helix rope structures (84). Collagen synthesis involves post-translational modifications, and proteolytic cleavage of pro-peptides at the N-

12 terminus by A disintegrin and metalloproteinase with thrombospondin motifs 2 (ADAMTS2), and by bone morphometric protein (BMP) at the C-terminus (73). Collagens types I, III, V, XI, XII, and XIV have been localised to the interstitial matrix of skeletal muscle, with type I being the most abundant (30). Fibroblasts synthesise the majority of interstitial collagens, as well as organising collagen fibrils into sheets and cables that provide tensile strength (41). The myofibre itself is also capable of making collagen type I and XV (72).

Collagen VI forms a supramolecular complex by binding the following proteins: the fibrillar collagens I and II, the basement membrane collagen IV, perlecan, integrin, tenascin, fibronectin and the membrane associated proteoglycans (16). Fibronectin is a large fibril-forming adhesive glycoprotein found at the cell surface, in blood plasma, and in the ECM (72). Tenascin is another adhesive glycoprotein found in the muscle ECM. Tenascin-C localises with fibronectin around skeletal muscle, where it is upregulated following muscle damage and inflammation (85).

1.2.4. Proteoglycans The majority of the interstitial matrix is made up of proteoglycans, which are macromolecules composed of a core protein with covalently attached glycosaminoglycan (GAG) side chains (86). GAGs are unbranched chains of repeating disaccharide units that can be divided into sulphated (chondroitin-sulphate, heparan-sulphate and keratan-sulphate) and non-sulphated (hyaluronic acid) forms (87). The main functions of proteoglycans are in buffering, hydration, binding, and resistance to compressive forces (41). The hydrophilic nature of proteoglycans makes them highly hydrated molecules capable of generating osmotic pressure within the matrix. It is this osmotic pressure that provides the structural support to resist compressive forces, which is particularly vital in cartilage (68). In muscle, proteoglycans are localised to the neuromuscular junction and sarcolemma, where they are responsible for cell adhesion, cell migration, and the binding of growth factors, cytokines, and proteinases (88).

The nomenclature used to classify proteoglycans includes: cellular/subcellular location, gene/protein homology, and the presence/absence of specific core protein modules (89). Based on their location, four classes of proteoglycans exist; intracellular, cell surface, pericellular and extracellular. This section will focus on the extracellular proteoglycans, in particular the hyaluronan and lectin binding proteoglycans (hyalectans), and the small leucine-rich proteoglycans (SLRPs). The hyalectans consist of versican, aggrecan, neurocan, and brevican. They are defined by their tri-domain structure: an N-terminus that binds to hyaluronan, a central domain with GAG side chains, and a lectin binding C-terminus (90).

Versican Versican is a chondroitin-sulphate proteoglycan that was initially discovered in cultured fibroblasts (91). The versican gene (Cspg2) is found on chromosome 13 in mice and encompasses 15 exons that encode a full length protein core of 3396 amino acid residues (92). The protein is localised to the ECM and interstitial space surrounding most tissues, where its roles include: tissue morphogenesis, angiogenesis, and ovulation (93).

Versican exists as four distinct isoforms, with each isoform generated by alternative splicing of the mRNA encoding the chondroitin sulphate containing domains. The two domains present in the various versican isoforms are GAGα and GAGβ (94). In versican V1 only the GAGβ domain is present, V2 contains only GAGα, while the V0 isoform includes both domains (Figure 1.7) (95). The most abundant isoforms in skeletal muscle are V0 and V1 (1, 89), whose molecular weights are 370 and 263 kDa respectively (92). V1 plays a role in repair and remodelling after tissue damage, while the V0 isoform is involved predominantly in embryonic development (96). Interestingly, V3 can operate in a dominant negative fashion by reducing the accumulation of V0/V1 (96, 97).

Figure 1.7 The hyalectan family of aggrecan, versican, neurocan, and brevican

The hyalectans are comprised of immunoglobulin-like-folds at the N-terminus, proteoglycan tandem repeats, chondroitin sulphate chains, epidermal growth factor-like domains, lectin-like domains, and complement regulatory protein-like domains at the C-terminus. The versican isoforms with their differing GAG side chains are displayed; V0 contains GAG-α and GAG-β, V1 has GAG-β only, V2 has GAG-α only, while V3 contains no GAG chains. Iozzo et al 2015 (89).

In addition to the chondroitin sulphate attachment regions, versican also contains N-terminal globular (G1), and C-terminal globular (G3) domains (92) (Figure 1.7). The G1 domain consists of an immunoglobulin fold and a link module that bind hyaluronan, while the G3 domain has two epidermal growth factor-like repeats, a carbohydrate recognition domain, and a complement regulatory protein-like motif (92). The G3 domain of versican can form complexes with fibronectin and vascular endothelial growth factor (VEGF) (92), while the cleaved form of versican plays a role in tumour angiogenesis (5).

Versican interacts with growth factors, cytokines, and chemokines via the negative charge of the sulphate residues in its GAG chains (92). Inflammatory cytokines, transforming growth factor β (TGF-β), basic fibroblast growth factor, and interleukin-1β (IL-1β) help regulate versican synthesis in a variety of different tissues (98). In the ECM, versican interacts with collagen I, tenascin, fibronectin, fibulin, and fibrillin (69, 92). Aside from full length versican, cleaved fragments can also co-localise with fibrillin-1 fibrils (99). Versican also interacts with cell surface molecules, where it may play a role in stabilising the supra-molecular versican-hyaluronan-CD44 aggregate at the plasma membrane (90). Versican is proteolytically cleaved at its N-terminus by the ADAMTS versicanases (100-103).

Versican is highly expressed by proliferating cells and mesenchyme during embryonic morphogenesis and tissue remodelling (104). Versican is synthesised early in myogenesis and localised in pericellular regions around myotubes (105, 106), where it is involved in proliferation and differentiation of avian myoblasts (107). Related work has suggested that versican plays a role in the spacing of individual muscles during development (105). According to microarray analysis of turkey skeletal muscle, versican is differentially expressed at E18, 1 day post-hatch, and 16 weeks of age (107, 108). Subsequent in vitro experiments using small interfering RNA demonstrated that knockdown of versican altered proliferation and differentiation of two satellite cell lines (107). Versican is also important for cardiac development (109), with abnormalities in its proteolytic processing leading to valve disease (110).

Aggrecan Aggrecan is aptly named based on its ability to form large supramolecular aggregates with hyaluronan. It is comprised of multiple globular domains termed G1 to G3, with keratan- and chondroitin-sulphate GAG chains located between them (Figure 1.7). The G1 domain

15 immobilises aggrecan into aggregates with hyaluronan, while the region between G1 and G2 is a protease-sensitive site involved in degradation. Protease degradation of aggrecan is associated with arthritis and other inflammatory disorders (89). The G3 domain interacts with tenascins, fibulins, and sulphated glycolipids (111). Aggrecan is expressed in cartilage, the intervertebral disc, brain and aorta (112).

Neurocan and brevican Neurocan is a hyalectan that was discovered in the rat brain, where it has been shown to inhibit neurite growth (113). The N-terminus interacts with hyaluronan in vitro, while the C-terminus shares homology with the G3 domain of versican and aggrecan (89). Neurocan and brevican exist as either full length proteoglycans or as proteolytically cleaved forms that lack the GAG-binding region and N-terminus. The G3 domain of brevican interacts with tenascin-R and fibulin-2 (114). Brevican is also vital to the central nervous system, where it has been implicated in glioma tumorigenesis, neural tissue injury and repair, and in Alzheimer’s disease (114).

Hyaluronan and the pericellular matrix Hyaluronan, or hyaluronic acid (HA) is a GAG that lacks a protein core. Its hygroscopic nature provides mechanical support within connective tissue, especially in synovial joints (115). Hyaluronan is found predominantly in interstitial connective tissue, but has also been implicated in intracellular processes. In smooth muscle hyaluronan responds to endoplasmic reticulum (ER) stress by forming cable-like structures that bind leukocytes as part of the early inflammatory response (116). Postnatally, hyaluronan is found in the skin, the skeleton, and the endomysium, perimysium, and epimysium of skeletal muscle (117). In the C2C12 myoblast cell line, endogenous hyaluronan synthesis is required for myogenic differentiation (118). Aggrecan, versican, and hyaluronan constitute the pericellular matrix that surrounds most adult and embryonic cells (92). The pericellular matrix is a transitional matrix that undergoes constant remodelling by ECM proteases. Recently, ADAMTS activity in the pericellular matrix has been shown to play a role in myoblast fusion (1).

The SLRP family Small leucine-rich proteoglycans (SLRPs) confer structural support, and participate in signalling pathways that mediate cell growth, morphogenesis and immunity (119). They consist of a central core protein of leucine-rich repeat sequences, N and C terminal cysteine containing domains, and either chondroitin-sulphate, dermatan-sulphate, or keratan-sulphate chains (86). SLRPs are divided into five classes based on their degree of evolutionary conservation, protein/genomic homology, and chromosomal organisation (120). Class I SLRPs contain chondroitin- sulphate/dermatan-sulphate side chains, as well as an N-termini cluster of cysteine residues (120).

The side chains of class II SLRPs are primarily keratan-sulphate residues, with clusters of tyrosine-sulphate residues located at their N-termini (120).

Biglycan Biglycan is a class I SLRP. The BGN gene is found on the X-chromosome, where it encodes a 42 kDa protein core containing leucine-rich repeats and one or two GAG side chains (121). Biglycan is synthesised as a precursor, from which the N-terminal pro-peptide is cleaved off by bone morphogenetic protein to yield the mature protein (122). Historically, biglycan was considered purely as a structural ECM protein, but recent work has shown that it acts as a danger signalling molecule in tissue stress or injury (123). This danger response is based on the interaction of secreted biglycan core protein and its GAG chains with innate immunity receptors, namely Toll- like receptors (TLRs) 2 and 4 (123). In skeletal muscle, biglycan associates with the DGC where it contributes to its stability by binding to α-dystroglycan, α-sarcoglycan, and γ-sarcoglycan (124). It is also localised to the neuromuscular junction and the endomysium (125).

Decorin Decorin is the most abundant proteoglycan in adult skeletal muscle (126). It is a class I SLRP that was named based on its ability to decorate collagen fibrils (127). The core protein of decorin binds near the C-terminus of collagen type I, where it plays a role in collagen fibrillogenesis and structural formation (128). Decorin is involved in a plethora of biological functions, which has led some to anoint it as a ‘guardian of the matrix’ (129). A recent review listed the multiple processes and diseases in which decorin is implicated, they were: Lyme disease, lung mechanics and asthma, diabetic nephropathy and tubulo-interstitial fibrosis, myocardial infarction, corneal transparency and tendon biomechanical properties, dentin mineralization and periodontal homeostasis, hepatic fibrosis and hepatocellular carcinoma, collagen fibrillogenesis, foetal membrane biology, wound healing and angiogenesis, innate immunity and inflammation, adhesion and migration, and mesenchymal stem cell biology (89).

Lumican Lumican is a class II SLRP involved in corneal development and dermal wound healing (130). Lumican is expressed in skin, artery, lung, kidney, bone, aorta, articular cartilage (131), diaphragm (132)m and skeletal muscle (133). The main function of lumican is in regulating collagen fibril assembly. Electron microscopic analysis of lumican knockout mice revealed changes in the structure of collagen fibrils, with thicker fibrils and non-uniform interfibrillar spacing (134). Lumican is also involved in cell proliferation, migration and adhesion (131). Recent work has shown that secreted proteoglycans, including lumican, can bind receptors to influence growth, motility, and immune responses (135).

1.2.5. ECM proteases Proteases are key modulators of ECM formation and remodelling. The majority are secreted into the extracellular space of skeletal muscle, where they form part of the secretome (136). The trypsin domain that characterises secreted serine proteases was the second most represented domain in the muscle secretome. The metalloproteinases are a group of zinc-dependent ECM endopeptidases that function in either a secreted or membrane-bound form. Three subfamilies of metalloproteinases exist; matrix metalloproteinases (MMPs), matrixins, ADAMTSs, and astracins. The proteolytic activities of metalloproteinases represent essential post-translational modifications of ECM proteins. They are also involved in ECM assembly through molecular activation or maturation of ECM precursor proteins (44). For example, ADAMTS2 cleavage of the amino-propeptide of type I and II pro-collagens is required for the generation of collagen monomers capable of fibril assembly (137). The focus of this section will be MMPs and ADAMTS proteinases.

Matrix metalloproteinases The matrix metalloproteinases form part of the metzincin clan, which are synthesised as pre-pro- polypeptide zymogens that require propeptide cleavage for their proteolytic activation. The majority contain a furin-recognition sequence between the pro- and catalytic domains (44). MMPs operate extracellularly to degrade the ECM during embryonic development, cell migration, and tissue morphogenesis (138). MMP-2 is constitutively expressed by myoblasts, where it degrades collagens I, II, III, IV, V, elastin, proteoglycans, and fibronectin (139). The genetic ablation of MMP-9 induces a glycolytic fibre type shift, whereby the percentage of MYHC-2b fibres increase relative to wild type in the tibialis anterior and gastrocnemius muscles (140). This finding suggests that MMP-9 activity plays a role in the remodelling that accompanies muscle fibre type transitions. The activity of MMPs are regulated by enzyme tissue inhibitors of metalloproteinases (TIMPs).

TIMPs TIMPs are endogenous inhibitors of metalloproteinases that help regulate ECM turnover during normal development, angiogenesis, and pathogenesis. The TIMP family has four members: TIMP-1, -2, -3, and -4. TIMP-2 is expressed constitutively throughout the body, while the expression of TIMPs -1, -3, and -4 are inducible and more tissue specific (141). TIMP-1 is found in the reproductive organs, TIMP-3 in the heart, while TIMP-4 is expressed in the brain, heart, and skeletal muscle (141). All TIMPs are comprised of a two domain structure of N- and C- terminal regions (142, 143). The C-terminus is responsible for protein-protein interactions, and the binding of pro-MMPs to regulate MMP activation (144). The N-termini of TIMPs bind the

18 zinc binding pocket of metalloproteinases to inhibit their activity (145). TIMP-3 is a truncated inhibitor that inhibits some ADAMTS members, including ADAMTS4 and ADAMTS5 (146).

Aside from their role in MMP inhibition, TIMPs are also involved in cell signalling. TIMP-2 is a binding partner of α3β1integrin, TIMP-3 interacts with VEGF, and TIMP-1 signals through CD63 (147-149). Deregulation of these enzymatic processes leads to the progression of many diseases, with TIMP-1 associated with negative prognosis in many human cancers (141). TIMPs have also been implicated in cell growth, cell death, and angiogenesis (141).

ADAMTS proteinases The ADAMTS proteinases have recently emerged as key participants in ECM proteolysis. Following the initial sequencing of ADAMTS1, 19 family members have been discovered (150). ADAMTS members can be divided into evolutionary clades based on their structure, protein sequence, gene structure and substrate preferences (Figure 1.8A) (151). ADAMTS2, ADAMTS3, and ADAMTS14 are pro-collagen N-peptidases responsible for removing the amino-propeptides of procollagens I, II and III (151). ADAMTS7 and ADAMTS12 are cartilage oligomeric matrix protein-cleaving enzymes, and ADAMTS13 is a von-Willebrand Factor proteinase. ADAMTS6, ADAMTS10, ADAMTS16, ADAMTS17, ADAMTS18 and ADAMTS19 are orphan enzymes, whose physiological substrates have yet to be identified (152). ADAMTS4 and ADAMTS5 are aggrecanases who cleave aggrecan in arthritis (153-155), ADAMTS4 cleaves brevican during the formation of brain tumours (156), while ADAMTS1, ADAMTS4, ADAMTS5, ADAMTS9, and ADAMTS20 are all versicanases that cleave versican (100-103).

ADAMTS members share a compound domain organisation, comprising of a signal peptide for access to the secretory pathway, a protease domain consisting of pro-peptide and catalytic modules, and an ancillary domain with a disintegrin-like module and thrombospondin repeats (102) (Figure 1.8B). All ADAMTS members build upon the basic organisation of ADAMTS4, with differences occurring in their number of C-terminal thrombospondin repeats (152). The catalytic domain possesses a ‘Met-turn’ created by a methionine and three histidines (157). A hydrophobic pocket forms between the Met-turn and the catalytic zinc ion, which then acts as an active site for substrate binding (152). Crystal structure analysis has revealed that the disintegrin- like domain is found close to the metalloproteinase active site, which suggests that it may be involved in substrate recognition (158). ADAMTS proteinases share proteolytic activity toward the hyalectan group of chondroitin sulphate proteoglycans (159), with their ancillary domain determining their particular substrate specificity, location, and binding partners (151).

ADAMTSs are synthesised as zymogens that require post-translational cleavage of their pro- peptide domain for proteolytic activation (151). Pro-protein convertases remove the pro-peptide

19 domain to allow target substrates access to the catalytic pocket of the enzyme. ADAMTS1, ADAMTS4 and ADAMTS7 are processed in the trans-Golgi network and then secreted (160- 163), while inactive ADAMTS9 binds to the cell surface for pro-protein convertase activation (164). The pro-peptide domain is believed to act as a chaperone that directs proper folding and secretion of the proteinase (152). Additional processing in the ancillary domain can have a ‘super- activating’ effect on their aggrecanase activity, as was demonstrated in ADAMTS4 by MMP cleavage of the C-terminal spacer region (165). This type of proteinase activation has led some to speculate that individual ADAMTS fragments may possess independent biological roles (151).

Figure 1.8 The ADAMTS family

(A) Evolutionary tree of ADAMTS family members based on their amino acid sequences. The tree is divided into clades, with the right hand branch representing ADAMTS proteinases capable of cleaving the large aggregating proteoglycans. Apte et al 2004. (B) From the N-terminus ADAMTS proteinases are comprised of: a signal peptide, a pro-peptide domain, a catalytic domain, a disintegrin-like domain and a central thrombospondin domain. Stanton et al 2011 (93).

Knockout mouse models have highlighted the specialised roles of ADAMTS proteinases in the turnover of the provisional matrix and in ECM assembly (1, 166). During embryonic development, versican-hyaluronan aggregates form a loose and hydrated provisional matrix. ADAMTS proteolysis maintains the composition of the provisional matrix by cleaving and clearing proteins, ultimately creating a more compact matrix over time (166). The combined ablation of ADAMTS5 and ADAMTS20 results in a loose, amorphous matrix, with a high proteoglycan content (104). Fibroblasts isolated from the dermis of Adamts5 knock-out mice display reduced versican proteolysis, and alterations in their provisional matrix composition (95).

ADAMTS5 ADAMTS5, or aggrecanase-2, has been a major arthritis drug target since its discovery in 1999 (167). The majority of work in this field has been in mouse cartilage, where ADAMTS5 is the main aggrecanase responsible for aggrecan degradation (155). Genetic ablation of the catalytic domain of Adamts5 protects mice from experimentally-induced arthritis (168). ADAMTS5 is also critical during development, and in pathologies such as cancer (169). During embryonic development ADAMTS5 is expressed in the brain, nerves, skeletal muscle and tendons (2). In adult tissue it is largely expressed during neuromuscular development and in smooth muscle (2).

In the developing mouse ADAMTS5 is expressed early in myogenesis, but not in mature myotubes (2). This was demonstrated using β-galactosidase histochemistry in knockout mice in which a LacZ cassette was inserted in place of the Adamts5 locus (2). Adamts5 expression was detected in limb skeletal muscle from E13.5, but was also observed at putative neuromuscular junction sites. A functional role for ADAMTS5 in muscle development was hypothesised based on in vitro work showing that proteolysis of the hyaluronan and versican-rich matrix by ADAMTS proteinases occurred during morphogenesis (1). Indeed, Stupka et al demonstrated that ADAMTS5 clearance of the versican-rich pericellular matrix aided in myoblast contact and fusion (1). In this experiment myoblast fusion was impaired by Adamts5 siRNA knockdown, but was rescued by the addition of recombinant ADAMTS5, thus suggesting that ADAMTS5 is involved in myoblast fusion during muscle development and regeneration (1). Finally, another study analysed the coding sequence of Adamts5 in C2C12 myoblasts to show that it was capable of acting as a myogenic enhancer through its binding of the myogenic transcription factors MyoD and Myog (170). This data further implicates ADAMTS5 in myogenesis, but postnatal in vivo evidence is required.

ADAMTS5 is comprised of the typical ADAMTS domain structure: signal peptide, pro-peptide domain, catalytic domain, and a disintegrin-like domain and a central thrombospondin domain (167). As with other family members, ADAMTS5 is secreted as an inactive zymogen requiring activation through processing of its pro-protein domain. ADAMTS5 diverges from other members in that it is activated extracellularly by furin, PACE-4, and PACE-7 (102). However, contrary to this data, ADAMTS5 has been shown to process the ECM adaptor protein, matrilin- 4, intracellularly (171). It was shown that genetic knockout of Adamts5 resulted in a loss of intracellular matrilin-4 processing in growth plate chondrocytes (171). Despite this, further work is needed to rule out the internalisation of active extracellular ADAMTS5, or the extracellular processing of matrilin-4.

ADAMTS5 is a proteoglycanase with proteolytic activity towards the hyalectan group of CSPGs, namely aggrecan, versican, brevican, and neurocan (87). Other reported substrates include: biglycan, reelin, matrilin-4 and α2-macroglobulin (102, 152, 155, 156). Proteoglycanases cleave hyalectans at Glu-Xaa recognition motifs along the core protein. Examples of such cleavages include ADAMTS5 processing of aggrecan and versican to generate the G1-EGE and G1- DPEAAE fragments respectively (102, 104, 172). G1-DPEAAE, or versikine, is produced by N- terminal versican cleavage at Glu441-Ala442 (103, 166). Cleavage is initiated by versican binding to the hydrophobic pocket of the ADAMTS metalloprotease domain, with the ancillary domain also playing a role. It has been demonstrated that the ancillary domain of ADAMTS5 must bind with the N-terminal GAG chains of versican to facilitate cleavage (173). Interestingly, co- transfection of ADAMTS5 with fibulin-1 increases its versicanase activity, which suggests that it may be a cofactor for ADAMTS5 mediated versican proteolysis (104).

The general consensus from the literature is that ADAMTS5 cleavage of proteoglycans, such as versican, helps maintain an optimal matrix proteoglycan content. In the absence of ADAMTS5, a higher amount of full length versican was detected in fibroblasts extracted from Adamts5 knockout mice (95). In line with this notion, the cleaved form of versican (DPEAAE fragment) was significantly reduced in Adamts5 knockout mouse models of atherosclerosis, aortic valve disease, interdigital web regression, and myoblast differentiation (95, 104, 110, 174, 175).

The hearts of Adamts5 knockout mice are enlarged compared to controls (110). Alterations in versican processing was hypothesised as the mechanism responsible, and then confirmed by inter- crossing Adamts5 knockout mice with versican heterozygous mice. The resulting progeny displayed reduced levels of versican and a rescue of the phenotype (110). This work demonstrates that ADAMTS5 processing of versican is required for normal heart development, and that versican accumulation affects morphogenesis. However, a recent paper has refuted this previously held theory by suggesting that genetic ablation of Adamts5 does not affect versican cleavage

(176). Gorski et al instead propose that ADAMTS5 regulates versican levels via a glucose-related synthesis pathway, and that degradation is mediated intracellularly by another ADAMTS proteinase (176). Despite the plethora of data suggesting the contrary, this paper argues that a reduction in versican proteolysis does not produce versican accumulations.

Two important concepts to consider when investigating the function of proteinases are that factors bound in the matrix can be released by ECM cleavage, and similarly that cleaved ECM fragments themselves can act as soluble ligands (177). It has been hypothesised that the ADAMTS- generated DPEAAE fragment can operate as a ligand with biological functions (103, 166). The bioactivity of DPEAAE has been illustrated during morphogenic development, where recombinant administration promoted interdigital web regression (104). It has also been hypothesised that the DPEAAE fragment can influence cell proliferation and apoptosis, but the manner in which it interacts with cells remains to be elucidated (166). In addition to acting as a reservoir for soluble growth factors, it has also been speculated that the matrix may be capable of liberating solid-phase ligands, but this is yet to be conclusively demonstrated (177).

1.3. Muscle adaptations and repair

1.3.1. Muscle growth Skeletal muscle is in a perpetual state of turnover. When protein synthesis exceeds protein degradation, the size of individual myofibres and hence the overall muscle mass increases (178). Postnatal growth occurs partially through an increase in the myofibre number (hyperplasia), but more critically through an increase in myofibre size (hypertrophy) (179). The insulin growth factor 1 (IGF1) pathway is the main positive regulator of protein synthesis, while the myostatin- Smad2/3 pathway acts as the negative regulator in skeletal muscle (178). Inactivation of the IGF1 receptor reduces myofibre size and number (180), while overexpression of IGF-1 leads to muscle hypertrophy (181). IGF-1 activates downstream pathways such as the mitogen-activated protein kinase/extracellular signal regulated kinase, and the PI3-Akt pathway (178). Akt stimulates protein synthesis by activating the kinase mammalian target of rapamycin (mTOR) and its downstream effectors. In addition to maintaining its mass, skeletal muscle must also adapt to metabolic and regenerative demands.

1.3.2. Exercise-induced muscle adaptations Exercise-induced skeletal muscle adaptations are regulated according to the pattern of nerve impulses delivered to the muscle, which in turn affect gene regulation of angiogenic, contractile, and fibre type specific pathways. The pioneering experiment in this area was by Buller et al in 1960, where fast and slow motor nerves were cut and cross-anastomosed such that the fast muscle was stimulated by the nerve that had previously innervated the slow muscle and vice versa (25).

This cross-innervation altered the contractile properties of the muscles, with the fast muscle becoming slower and the slow muscle faster (25). It must be stressed that although critical to our understanding of exercise-induced remodelling, the adaptations induced by chronic nerve stimulation my not fully recapitulate those induced by endurance exercise (182).

Gene regulation Chin et al identified which gene expression programs were controlled by variations in motor nerve activity (183). This work showed that neuronal stimulation uses calcium as a secondary messenger to reprogram gene expression according to the stimulation received. In this way calcium signals through the calcineurin/nuclear factor of activated T-cells (NFAT) pathway to regulate skeletal muscle fibre types. Slow fibres receive more frequent neural stimulation, which serves to elevate intracellular calcium concentrations to a level sufficient for calcineurin activation; a calcium-regulated serine/threonine phosphatase that upregulates slow fibre specific gene promoters (183). Inhibiting the calcineurin/NFAT pathway with cyclosporine-A results in the converse switch from slow to fast fibres. A plethora of factors have been implicated in the pathway, including calcium/calmodulin-dependent protein kinases, myocycte enhancer factor 2, AMP-activated protein kinase, peroxisome proliferator-activated receptor gamma coactivator 1- alpha (PGC-1α), and peroxisome proliferator-activated receptors (184). PGC-1α has been highlighted as the master regulator of exercise-induced remodelling (185-188), but knockout mouse experiments have shown it not to be mandatory for the adaptive gene responses observed following exercise (189). Estrogen receptor-related is a PGC-1α-independent regulator of muscle vascularity and oxidative metabolism (187).

MYHC adaptations Skeletal muscle adapts to endurance exercise through a fast to slow fibre type transformation and enhanced angiogenesis (182). These adaptations reflect the metabolic demands and innervation patterns typical of this exercise type. Endurance exercise induces a muscle fibre type transformation according to the continuum of MYHC-2b/MYHC-2x/MYHC-2a/MYHC-1. Following four weeks of voluntary wheel exercise, the murine plantaris muscle undergoes an oxidative shift from the more glycolytic type MYHC-2b and MYHC-2x fibres to the more capillary-rich oxidative MYHC-2a fibres (182). The extent of the exercise-induced changes are dependent on the muscle type, with fast-twitch adapting more readily than slow-twitch, as well as the type, intensity, and duration of the exercise performed (190, 191).

Angiogenesis Capillaries are the critical site for nutrient and gas exchange, and waste removal (192). The formation of new capillaries from existing ones, as occurs following changes in muscle activity, is termed angiogenesis (193). Two forms of angiogenesis exist; sprouting and intussusception.

Sprouting involves proliferation of endothelial cells, controlled proteolytic degradation of the capillary basement membrane, and migration of sprouting tips to generate new vessels (194). Intussusception comprises minimal proliferation and does not require proteolytic degradation of the basement membrane. Instead, it is based on adaptation to elevated shear stress in the microvascular network (195). Previous work has shown that aerobic activity induces both sprouting and intussusception angiogenesis (196).

In active muscle, the pro-angiogenic factor vascular endothelial growth factor (VEGF) is stimulated by hypoxic and metabolic stress (195). Treadmill exercise increases the mRNA expression of Vegf in rat type MYHC-2b myofibres, but it is not known to what extent that changes in gene expression are responsible for fibre type specific increases in capillary density (197). Interestingly, angiogenic changes precede the shift in muscle fibre type that occur with endurance exercise (182). This work went on to speculate that exercise-induced angiogenesis may act in a permissive capacity to promote the later events of mitochondrial biogenesis and the switching of MYHC isoform expression.

ECM processing and angiogenesis ECM proteolysis has the capacity to both promote and inhibit angiogenesis. MMP proteolytic cleavage at the collagen XVIII C-terminus releases an anti-angiogenic fragment known as endostatin. Endostatin disrupts endothelial cell migration and survival by competing with collagen for integrin binding (198). ADAMTS5 is capable of exerting angiogenic effects independent of its proteolytic activity. The first thrombospondin type 1 repeat of ADAMTS5 inhibits in vitro endothelial cell formation, proliferation, and attachment (199). Conversely, MMP proteolysis can promote angiogenesis by liberating factors from the matrix, such as VEGF (200). Interestingly, VEGF has also been shown to upregulate ADAMTS1 expression and versican cleavage at the basement membrane, where cleaved DPEAAE fragments were found associated with endothelial cells (5).

The ECM and exercise-induced muscle adaptations

Exercise upregulates the expression of ECM proteins The gene expression of numerous ECM proteins are upregulated in human vastus lateralis muscles following 12 weeks of long term exercise (201). Of the upregulated proteins, a variety of collagens were detected, as well as elastin, five ADAMTS members, and the proteoglycans biglycan and lumican (201). In rats, the mRNA and protein levels of MMP-2 increased after two weeks of high intensity treadmill exercise (8). The changes in MMP-2 levels were only observed in skeletal muscles containing a high proportion of fast type II myofibres. Another study showed that 10 days of endurance exercise increased the gene expression of Mmp2, Mmp14 and Timp1 in skeletal

25 muscle (6). An interesting aspect of this work was the immuno-localisation of MMP-2 protein within myofibres, a finding that was supported by mRNA expression of Mmp2 from micro- dissected myofibres (6). This result was interpreted as skeletal muscles contributing to the expression and activity of MMP-2 in exercised myofibres. The observed changes in ECM proteins following exercise most likely reflect a reorganisation of the basement membrane, with the degree of remodelling proportional to the severity of the exercise (7).

ECM processing and exercise-induced adaptations There is limited literature concerned with how the ECM itself can impact on exercise-induced muscle adaptations. The role of MMPs in exercise-induced muscle adaptations was investigated by electrically stimulating rat EDL muscles (202). Following three days of stimulation, the protein and mRNA levels of MMP-2 increased, but the most significant result was observed following MMP inhibition. Intra-peritoneal injection of an MMP inhibitor to the rats prevented the growth of new capillaries following stimulation (202). Electron microscopy also showed that the number of capillaries with degraded basement membrane were reduced by MMP inhibition (202). This suggests that basement membrane MMP degradation is required for exercise-induced angiogenesis.

1.3.3. Muscle injury and repair Following injury, healthy muscle maintains mass by initiating a rapid repair process. This process consists of inflammation, necrosis, and regeneration of the damaged tissue. In this section, the repair process of normal muscle is reviewed. Damage and repair in diseased muscle will be discussed subsequently in the context of muscular dystrophy.

Inflammation Inflammation is the body’s immune response to harmful stimuli, such as pathogens, infection and tissue damage. It is a component of innate or non-specific immunity, as opposed to adaptive or acquired immunity. Inflammation is caused by the release of chemical factors from damaged tissue that attract immune cells to initiate the regenerative healing process. The response is defined by release of inflammatory mediators including tumour necrosis factor α (TNF-α) and interferon (IFN) (203), as well as an accumulation of neutrophils, macrophages, T-cells, eosinophils, and mast cells (204).

The normal repair process consists of cytokine release, inflammatory phagocytosis of necrotic debris and the formation of new muscle through the activation of muscle stem cells, which are termed satellite cells (205). The process begins with a T-helper 1 (Th-1) cell inflammatory response, in which neutrophils, macrophages and cytokines are recruited to the site of injury (206). Neutrophils are at peak density approximately two hours after increased muscle use, where

26 their functions include phagocytosis, and the release of proteases to degrade cellular debris (207). By 24 hours, phagocytic M1 macrophages dominate the scene, followed by the Th-2 derived M2 macrophages that attenuate the inflammatory response and promote muscle repair (206). M1 macrophages express high levels of TNF-α, interleukin-1β (IL-1β), and interleukin-6 (IL-6), while M2 macrophages produce interleukin-10 (IL-10) to inhibit IL-1β (206). Anti-inflammatory (M2c) macrophages have a deactivating effect on M1 macrophages and are associated with the later stages of muscle regeneration through secretion of IL-10 and TGF-β (205).

The inflammasome Microbial invasions arrive in the form of pathogen-associated molecular patterns (PAMPs) and are detected by neutrophils, macrophages and dendritic cells as part of the inflammatory response. Inflammation can also be activated in these cell types by physical and chemical stimuli released upon tissue injury. These stimuli are known as danger-associated molecular pattern (DAMPs) (10). Both PAMPs and DAMPs are identified by pathogen recognition receptors (PRRs). Five different PRRs exist: cell surface Toll-like receptors (TLRs), cytoplasmic NOD-like receptor proteins (NLRPs), intracellular RIG-I-like receptors, transmembrane C-type lectin receptors, and absence in melanoma 2 (AIM2) receptors (10).

The inflammasome is a multi-protein complex involved in caspase-1 activation and caspase-1- dependent secretion of IL-1β, IL-18 and IL-33 (208). The essential components of the inflammasome are the sensor protein, the ASC adaptor protein, and caspase-1. PAMPs and DAMPs activate inflammasomes via four different PRRs: NLRP1, NLRP3, NLRPC4 and AIM2 (208). NLRP3 is the most extensively investigated inflammasome. PRRs on the inflammasome signal through myeloid differentiation factor 88 (MYD88) and nuclear factor (NF)-kβ to activate caspase-1 (135). Other stimuli capable of activating caspase-1 more directly include ATP, K+ ions and ROS.

Proteoglycans and inflammation Under normal physiological conditions proteoglycans are bound in the matrix and are therefore not capable of binding to PRRs. Proteolytic processing liberates proteoglycans from the matrix, thereby affording them solubility and the ability to act as DAMPs (10). DAMP binding of TLRs induces dimerisation of toll/interleukin-1 receptors, which elicit downstream adaptor molecules to initiate activation of inflammatory cytokines. Biglycan was the first proteoglycan in which DAMP activation of TLRs was demonstrated (Figure 1.9) (209). In its soluble form, biglycan binds to TLR2, TLR4, and the purinergic P2X7 and P2X4 receptors on the surface of macrophages. Ligand binding of these receptors initiates synthesis of pro-IL1β and NLRP3 inflammasomes (10). In addition, decorin, hyaluranon, versican, tenascin-C, fibrinogen, and heparan-sulphate

27 fragments are all capable of interacting with PRRs (10). Decorin operates through TLR2 and TLR4 to trigger inflammation by way of NF-kβ and the synthesis of TNFα and IL12 (210).

Figure 1.9 Biglycan activation of macrophage inflammasomes

Soluble biglycan interacts with TLR2 and TLR4 to promote synthesis of pro-inflammatory cytokines, such as IL1β and TNFα. Biglycan binding clusters the TLR2/4 and P2X7 purinergic receptors to induce the NLRP3/ASC inflammasome, leading to activation of caspase-1, cleavage of pro-IL1β, and secretion of mature IL1β. Nastase et al. 2012 (123).

Versican and the other ECM components represent a store for cytokines, which influence ECM remodelling via autocrine or paracrine mechanisms (98). It has been suggested that cytokines modulate ECM remodelling to help create a more amenable inflammatory environment for the recruitment of additional inflammatory cells, such as macrophages and neutrophils (98). The cycle is then perpetuated when macrophages and leukocytes themselves produce versican during inflammatory storms (98, 211). In pathological inflammatory conditions, such as cancer, a correlation exists between the elevated expression of versican and inflammatory cytokines (212). Versican expression is influenced by a plethora of inflammatory cytokines, including TGF-β, IL1β, IL11, TNFα and IFN-γ (98). In return, versican can stimulate production of cytokines such as TNFα through its ability to bind TLR2 and TLR6 in Lewis lung carcinoma cells (213).

Muscle regeneration Injury to muscle tissue results in necrosis of the damaged myofibres, followed by a period of regeneration whereby muscle satellite cells are activated (21). Satellite cells are a population of quiescent, undifferentiated, mononuclear, myogenic cells located beneath the basement

28 membrane of myofibres (20). Activation is achieved through stretching, exercise, injury and electrical stimulation (214). Following activation, satellite cells proliferate, and then differentiate from myoblasts into myotubes (215). Typically, in healthy tissue, the cycles of muscle degeneration and regeneration help to maintain normal muscle function. However, as will be discussed later, in muscular dystrophy the balance between degeneration and regeneration is lost, resulting in the loss of muscle function.

Adult satellite cells express the paired homeobox transcription factor Pax7 while in a quiescent state, and then express Myf5 when committed to the myogenic lineage (214). The term satellite cell encompasses a heterogeneous population consisting of satellite stem cells (Pax7+/Myf5-) and satellite progenitor cells (Pax7+/Myf5+) (216). Transcription factors orchestrate regeneration across multiple phases of differentiation, maturation, and satellite cell replenishment (206). The proliferative phase is characterised by satellite cell activation and the expression of MyoD and Myf5 to produce a pool of muscle precursor cells (217). The muscle precursor cells either then exit the cell cycle to replenish the Pax7+ satellite cell pool, or alternatively express Myog, Mef2, and Mrf4, to differentiate further. Differentiated cells can fuse to existing damaged fibres or form new myotubes, which express sarcomeric proteins such as MYHC (216).

1.4. Muscular dystrophy The muscular dystrophies are a clinically, genetically, and biochemically heterogeneous group of inherited disorders (218). In the past, they were grouped based on their clinical presentation and age of onset, but current approaches have supplemented these old classifications with information about the primary protein defect and its localisation or function (219). The primary protein defect in the muscular dystrophies causes the loss of basement membrane-cytoskeleton components, such as: laminin-α2 (congenital muscular dystrophy), dystrophin (Duchenne muscular dystrophy), sarcoglycans (limb-girdle muscular dystrophy), and the α chains of collagen VI (Bethlem myopathy) (69). A common feature amongst the muscular dystrophies is skeletal muscle weakness, which can be used to distinguish between different forms (Figure 1.10) (218). A primary cause of the muscle weakness is often muscle atrophy, as is the case in several of the limb girdle muscular dystrophies and Duchenne muscular dystrophy (DMD).

Figure 1.10 Distribution of muscle weakness in muscular dystrophy

(A) Duchenne and Becker muscular dystrophy (BMD); (B) Emery-Dreiffus muscular dystrophy; (C) Limb girdle muscular dystrophy. Mercuri et al 2013 (219).

Aside from the devastating impact on the patient and their family, muscular dystrophy also has large economic ramifications. A study by Access Economics in 2012 estimated the total economic cost of muscular dystrophy on Australian society at $1.8 billion. This figure was divided into $1.2 billion for the loss of wellbeing borne by individuals, and $0.6 billion by individuals, families, governments, and the rest of society.

1.4.1. Duchenne muscular dystrophy DMD is the most common of the muscular dystrophies. The latest reports have the prevalence at 8.29 per 100,000 boys (219). It is caused by mutations in the X-linked DMD gene, which results in the absence of dystrophin from the skeletal muscle of affected individuals (57). Based on reports from the literature, 4770 pathogenic DMD mutations have been catalogued in the Leiden Duchenne muscular dystrophy mutation database (220). The vast majority of mutations were deletions (3091), of which 2448 were out of frame and 1287 were point mutations. Two-thirds of patients have deletions in one or more exons, with 70% clustering between exons 45 and 55 (220). Throughout this thesis the word dystrophic will be used to signify skeletal muscle in which dystrophin is absent, but the term can also be used to describe the ensuing muscle weakness and damage pathology common to all muscular dystrophies.

The clinical signs of DMD typically manifest by approximately three years of age, after which diagnosis is confirmed by a combination of muscle biopsies to identify the underlying protein defect, and a serum creatinine kinase concentration assay (221). Muscle biopsies allow for histopathological analysis of muscle breakdown and regeneration (Figure 1.11), as well as immuno-histochemical confirmation of the absence of dystrophin. However, identification of the genetic defect remains the gold standard diagnostic method. DMD boys are commonly

30 wheelchair-bound by 12, with many succumbing to cardiac and/or respiratory failure in their mid- twenties. DMD is characterised by progressive and severe muscle wasting, necrosis, inflammation and fibrosis (219).

Figure 1.11 Haematoxylin & Eosin staining of control and DMD muscle sections

Healthy control muscle on the left and DMD muscle on the right. Control myofibres have peripheral nuclei, intact sarcolemmas, and non-fragmented sarcoplasms. DMD muscle is characterised by myofibre necrosis, damaged sarcolemmas, fragmented sarcoplasms, and the infiltration of adipose and fibrotic tissue.

The absence of dystrophin from the DGC also causes a cardiac phenotype, which results in muscle necrosis, and replacement of the myocardium with connective tissue and fat (222). Cardiomyopathies account for approximately 10-20% of DMD deaths (223), with a further 75% attributed to respiratory failure (224). At 18, approximately 98% of DMD boys have a cardiomyopathy, with 72% presenting with dilated and 26% with hypertrophic cardiomyopathies (225). Current clinical guidelines recommend an echocardiography every two years for the first decade of life, and annually from the age of 10 (219). The guidelines also stipulate that cardio- protective treatment with angiotensin-converting-enzyme (ACE) inhibitors and β-blockers be initiated immediately after diagnostic confirmation of a cardiac phenotype.

1.4.2. Current DMD therapies Currently there is no cure or effective therapy to prevent DMD from progressing to premature death. Frontline treatments include glucocorticoids, such as prednisolone, prednisone, and deflazacort, as well as ACE inhibitors and β-blockers to treat cardiac symptoms. Steroids are believed to function in an anti-inflammatory and immunosuppressive manner to improve muscle strength and prolong ambulation by two to four years, but are also associated with severe side effects, such as weight gain and pathological bone fracture (226).

Preclinical DMD treatments can be categorised into the following: repair or replacement of the mutated dystrophin gene, dystrophin substitution by its surrogate utrophin, rescue of dystrophin translation using stop codon read-through compounds, and finally the amelioration of downstream pathological mechanisms (227). The principal outcome measure for assessing the efficacy of therapeutic interventions is the 6-minute walk test (6MWT). Performance in the 6MWT has been shown to correlate with wheelchair status and knee extensor strength (228).

Genetic modifiers Genetic modifiers help predict prognosis and treatment efficacy. A genetic modifier is a locus that positively or negatively changes the phenotype of a primary disease causing mutation (229). In DMD, genetic modifiers may affect the age of onset, the time to loss of ambulation, disease progression, and disease severity. Proteomics, transcriptomics, and genome profiling have discovered the following genetic modifiers in DMD and the mdx mouse model: osteopontin, MMP-9, latent TGF-β binding protein 4 (LTPB4), and annexin A6 (229, 230). LTBP4 was initially identified as a modifier in mice and then as an outcome predictor in DMD patients, while annexin A6 was implicated in sarcolemma resealing and as a modifier of the disease (229). Interestingly, many of the genetic modifiers identified for DMD are ECM or ECM-associated proteins, which suggests that targeting the ECM may be of interest in future DMD therapies.

Gene and pharmacological therapies Gene replacement therapies can in theory treat all DMD patients. Approximately 20% of the wild type level of dystrophin is required achieve a significant improvement in the muscle pathology of DMD patients (231). Current therapies include: delivery of truncated dystrophin transgenes packaged inside adeno-associated viruses, agents to read-through stop codon mutations, compounds aimed at upregulating surrogate proteins at the dystrophin-deficient sarcolemma of dystrophic muscle, as well as the promising use of antisense oligonucleotides to induce exon skipping (221). Antisense-mediated exon skipping restores the dystrophin reading frame using modified complementary RNA or DNA oligonucleotides (232). This treatment generates a truncated, but functional BMD-like dystrophin protein. Currently, Drisapersen and Ataluren are the only two drugs that have reached phase 3 clinical trials for DMD. Drisapersen is an exon skipping compound made by BioMarin Pharmaceutical, and Ataluren is a stop codon read- through drug created by PTC Therapeutics.

Read-through technology arose from a small molecule screen looking for drugs to modulate ribosomal read through of the premature stop codon in mutated dystrophin. Effective compounds, such as Ataluren allow the ribosome to ignore the mutation and continue to translate dystrophin. A news release from PTC in October 2015 reported that Ataluren ‘slowed disease progression for patients with nonsense mutation Duchenne muscular dystrophy’. A 47 metre benefit was observed

32 in 6MWT from a pre-specified subgroup, which supported results from the phase 2b study. However, in the overall study population a non-significant 15 metre benefit was observed in 6MWT. The read-through efficacy of Ataluren has been questioned previously (233), as has the lack of dystrophin measurement from the muscle biopsies taken during the phase 2a and 2b trials (234). At the end of 2015, PTC Therapeutics submitted a new drug application for Ataluren to the US Food and Drug Administration (FDA).

Drisapersen is a 2'-O-methyl phosphorothioate (2OMePS) oligonucleotide exon skipping drug that restores the reading frame of mutated dystrophin at exon 51 (235). The drug was designed to target exon 51 as 13% of DMD patients have mutations in this region that can be corrected through skipping (236). An early phase 2 clinical trial showed a low level of de novo dystrophin production in 60-100% of myofibres in 10 of the 12 patients (237). In the latest phase 2 trial, patients were dosed with Drisapersen for 48 weeks, with significant gains observed in the 6MWT after 25 weeks in the group given continuous treatment. Unfortunately this gain was not maintained out to 48 weeks (235). In January 2016 the FDA declined an application lodged by BioMarin Pharmaceutical Inc. for Drisapersen, which it was marketing as Kyndrisa. A letter written by the FDA highlighted concerns regarding the drug’s effectiveness, and its risk-benefit profile. Etiplersen is another exon skipping drug that targets exon 51, but it differs from Drisapersen in its morpholino chemical composition. Phase 2 trials met the primary endpoint requirement of increased dystrophin production (238). Sarepta published a news release in January 2015 stating that following 168 weeks of continuous treatment, patients showed continued ambulation in the 6MWT. However, all patients showed a decline in 6MWT from the 144 week time point onwards. Encouragingly though, respiratory muscle function appeared stable based on pulmonary function tests. In September 2016 the FDA granted Sarepta an accelerated approval for clinical testing of Etiplersen, making it the first drug approved to treat patients with DMD.

Two new exon skipping therapies with improved potency and delivery are currently undergoing preclinical trials. The first is a cell penetrating peptide conjugated to an oligonucleotide known as Pip. Single, low dose intravenous delivery of Pip restores high levels of dystrophin protein in mdx skeletal and cardiac muscle (239). The second treatment is a new class of tricyclo-DNA oligonucleotides, which have been shown to increase the expression of dystrophin, improve muscle function, improve respiratory and cardiac function, and even some rescue of cognitive function (240).

The bacterial Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology was recently used to correct the dystrophin mutation in mdx mice (241, 242). In vivo CRISPR editing of postnatal somatic mdx cells produced genetically mosaic animals with 2 to 100%

33 correction of the DMD gene mutation. Interestingly, a 17% correction of the mutant DMD allele produced dystrophin levels comparable to wild type mice, with functional improvements observed in grip strength performance and reduced serum creatine kinase levels. Finally, satellite cells from edited myoblasts were micro-dissected and PCR sequenced to show that the dystrophin gene was also rescued in these cells (241). In February 2016 a licence was granted allowing CRISPR-gene editing in human embryos. It is hoped that this ruling will pave the way for DMD CRISPR trials in the near future.

Utrophin Transgenic overexpression of the dystrophin surrogate, utrophin, rescues the pathology of the mdx mouse (65). Building on this work, Summit Therapeutics created SMTC1100, a small molecule utrophin modulator. Initial screening of the drug in healthy male volunteers showed that it was safe and well tolerated (243). In August 2015 Summit issued a press release stating that its Phase 1b clinical trial of SMTC1100 had met its primary objective with half of the treated patients achieving the desired utrophin plasma levels. An open label Phase 2 clinical trial is currently underway.

More recently, a second generation drug called SMT022357 was tested on mdx mice, where it was shown to upregulate utrophin expression in skeletal, respiratory, and cardiac muscle. The drug also ameliorated the mdx pathology in skeletal muscle. A 47% decrease of serum creatine kinase was observed, along with increased expression of the DGC proteins β-dystroglycan and dystrobrevin. Taken together, these results were reported as a sign of improved sarcolemmal stability (244). Reductions in fibrosis and centrally located nuclei, a marker of previous muscle damage, were also observed in hind-limb muscles and the diaphragm. Finally, an improvement in the physiological function of the EDL of treated mdx mice was observed using an ex vivo eccentric contraction protocol (244).

It must be noted that gene and cell therapies face major obstacles before they can become a clinical reality. The large size of the transgene, the challenge of targeting skeletal muscle with viral vectors, and identification of an effective stem cell that targets muscle all represent major hurdles (219). To this end, future strategies should combine current therapies with compounds aimed at ameliorating the downstream mechanisms. These include compounds that help maintain muscle mass and function, as well as others that target muscle inflammation, necrosis and fibrosis.

1.5. The mdx mouse model of DMD The mdx mouse originated from a mutation in a colony of inbred C57:BL10 mice. The mutation was later identified as a premature stop codon in exon 23 of the DMD gene (245, 246). Despite being a homolog animal model for the human disease, the mdx mouse has a relatively mild

34 phenotype (247). Mdx muscle undergoes a wave of inflammation and necrosis between three and five weeks of age (246, 248). The muscles stabilise following this initial damage, making 12 weeks of age a recommended time point for tissue analysis (249). Despite not being completely analogous to DMD, an international consensus has established the mdx mouse as the model of choice for preclinical and proof of concept studies (250).

The mdx mouse is characterised by a cardiac phenotype later in life. Young mdx hearts function relatively normally under basal conditions, but display a phenotype under stress (251). The susceptibility of mdx cardiomyocytes to stress-induced damage has been implicated in the development of cardiomyopathies in dystrophic hearts (252). Indeed, mdx cardiomyocytes from ex-vivo perfused hearts show increased susceptibility to stress-induced damage at eight (253), and 12 weeks of age (252). ECG experiments have shown that mdx hearts display a tachycardia reminiscent of DMD patients (254). While some claim that standard measures of cardiac function in the mdx mouse fail to detect abnormalities until 10 months of age (251), recent MRI analysis has revealed fibrosis in six month old mdx hearts (255).

1.5.1. Muscle damage in dystrophic muscle

Initial muscle damage The most common explanation for the dystrophic pathology is the ‘mechanical defect hypothesis’, which dictates that the absence of dystrophin compromises the mechanical stability of the myofibre and/or its sarcolemma, leading to muscle damage and degeneration (50). Indeed, the absence of dystrophin renders the sarcolemma more susceptible to damage during contractions (256-258), but it is unknown how much of the subsequent damage is due to the cycles of muscle degeneration and incomplete regeneration. Thus, a key aspect to treating the pathology is limiting the secondary inflammation and necrosis that occur after the initial mechanical damage. The two- tiered hypotheses by Miranda Grounds propose that a balance of cell and molecular factors differentiate between acute and chronic damage in dystrophic muscle (249).

Mdx mice display an exacerbated influx of calcium through the sarcolemma, but the mechanism responsible is still contentious (248). A commonly accepted theory is that contraction of dystrophin-deficient muscle leads to sarcolemma tearing and calcium influx (256-259). An alternative hypothesis proposes that the lack of dystrophin disorganises the cytoskeleton, leading to a dysregulation of calcium-permeable ion channels (260). Unregulated channel activity increases the cytosolic calcium concentration to activate calcium-sensitive proteases (calpains), phospholipase A2, and ROS (261, 262). Elevated production of ROS and inflammatory cytokines, such as NF-kβ, perpetuates the ongoing cycle of muscle degeneration (263). Administration of streptomycin to mdx mice blocks the transient receptor potential (TRP) calcium channels, leading

35 to a reduction in fibrosis and an improvement in muscle regeneration (61). Perfusion of dystrophic muscle fibres with protease inhibitors protects the muscle from the excitation contraction coupling impairments that occur following repeated contractions (264).

Secondary muscle damage

Necrosis The secondary, chronic, stage of the dystrophic pathology is characterised by necrosis, inflammation, fibrosis, and incomplete regeneration. The mdx mouse displays little evidence of the dystrophic phenotype until an acute period of limb muscle necrosis and regeneration at around three weeks of age (265-267). Necrosis peaks during this phase, whereby 30-60% of the total area of the tibialis anterior is necrotic (268). From this point it decreases to approximately 5% by eight weeks of age, with the cycles of necrosis and regeneration persisting for up to one year. The mechanism responsible for the acute onset of the pathology at three weeks is unknown. Some groups have speculated that it may be due to adult locomotor activity, or developmental changes in the expression of utrophin, and proteins involved in excitation contraction coupling (17, 269). Interestingly, in a comparison of muscle damage amongst different fibre types in mdx mice, fast- twitch fibres displayed greater damage than slow-twitch (270).

Chronic inflammation The inflammatory process is designed to protect the body from harmful external stimuli. However, if left unchecked it can have more deleterious effects on the host than the original stimuli (271). Chronic inflammation is defined as an immune response that persists for several months, whereby the processes of inflammation, tissue remodelling and repair occur concordantly (272). A chronic inflammatory response dominates the dystrophic pathology (273-275), where inflammatory cells exacerbate muscle damage through the release of free radicals, growth factors, chemokines, and inflammatory mediators (207). Glucocorticoids inhibit inflammation in DMD patients to delay the progression of the disease and prolong ambulation (276). As mentioned previously, glucocorticoid treatment produces side effects, which only increases the demand for new anti-inflammatory agents to treat the disease.

The contribution of inflammation to the dystrophic pathology has been demonstrated in experiments where antibody depletion of macrophages from four week old mdx mice resulted in an 80% reduction in the number of injured fibres (277). This work suggests that the mechanical stress caused by the absence of dystrophin accounts for less than half of the muscle fibre damage measured in mdx mice, with the majority of the initial muscle damage caused by inflammatory cells (204). The severity of muscle damage has been strongly linked to the balance of M1 and M2c macrophage recruitment (204). M1 macrophages dominate the early, acute period of

36 inflammation in dystrophic muscle, after which M2c macrophages appear to promote tissue repair and variable levels of fibrosis (204). IL-10 helps regulate the macrophage balance in mdx muscle, by inhibiting the activation of M1 macrophages and increasing that of M2c macrophages (204).

The gene expression of various pro-inflammatory factors are elevated in dystrophic muscle. DNA microarray analysis comparing the leg muscles of mdx mice and controls showed that of the 242 differentially expressed genes, 30% were inflammatory (273). In the diaphragm, quantitative RT- PCR was used to demonstrate that TNF-α and IL-1β are up-regulated 2.5-fold and 6.3-fold respectively in mdx mice compared to controls (278). Chronic activation of NF-κβ has also been detected in DMD patients and in mdx mice, where it is believed to perpetuate muscle damage by prohibiting regeneration following damage (279).

Fibrosis Chronic inflammation and persistent cycles of degeneration lead to excess ECM around the endomysium and perimysium in a process termed fibrosis (272). The excess ECM in fibrotic tissue arises due to an imbalance in synthesis vs degradation of ECM proteins (272). Transforming growth factor-beta (TGF-β) is a cytokine that has been heavily implicated in fibrosis. In mammals, it is generated as one of three different latent precursor isotypes: TGF- β1, 2, and 3. TGF-β levels are regulated by secretion and activation of the latent precursors, rather than through TGF-β mRNA expression (272). Active TGF-β signals through Smad proteins to control transcription of procollagen I and III. Collagen is mainly produced by myofibroblasts, which are activated by a plethora of factors, including: TGF-β1 from macrophages, paracrine signals released by lymphocytes, PAMPs, caspases and VEGF (272). Besides collagen production, elevated TGF-β levels can also stimulate the production of fibronectin and connective tissue growth factor (30).

The dystrophic pathology in mdx mice is cumulative, with fibrosis becoming more pronounced in limb muscles by 15 months (280). Fibrosis is observed at approximately six months and one year in the diaphragm and hearts of mdx mice respectively (281). Fibrosis in dystrophic muscle results from a combination of increased collagen synthesis and aberrant expression of MMPs and TIMPs (230). TGF-β is strongly implicated in the process, where its expression is significantly elevated in mdx mice (281). MMP-9 has been shown to activate TGF-β through cleavage of its inhibitory domain, and that the active form of TGF-β is reduced in the diaphragm of mdx mice by MMP-9 inhibition (282). Subsequent work has demonstrated that MMP-9 is involved in the fibrotic response that characterises the later stages of the dystrophic pathology (283).

Regeneration Dystrophic muscle is characterised by chronic tissue damage, inflammation and fibroblast proliferation. These factors inhibit the ability of satellite cells to proliferate and differentiate,

37 leading to incomplete regeneration (284). Incomplete regeneration leads to the replacement of muscle by adipose and fibrous tissues (285, 286). In contrast to human DMD patients who undergo continuous degeneration throughout their life, the muscles of mdx mice experience necrosis, inflammation and degeneration early in life, after which they regenerate more efficiently to stabilise by approximately 12 weeks of age (287). The stabilisation of the mdx phenotype has been associated with limb muscle hypertrophy, but the precise compensatory mechanism responsible remains to be elucidated (288). The most differentially expressed genes over this age are involved in muscle development, function, immune responses and proteolysis (288). The stability of the pathology at 12 weeks makes it a suitable time point for studying the regenerative efficacy of therapeutic interventions in the mdx mouse. Dystrophic muscle is characterised by muscle fibres with centrally located nuclei, a histological feature that reflects the continuous degeneration and regeneration underlying the pathology (289).

Amelioration of dystrophic inflammation Following the discovery of the mdx mouse (246), multiple therapeutic approaches aimed at improving or ameliorating the pathology have been trialled. As mentioned previously, given the current state of gene and cell therapies in the DMD field, interventions that improve the quality of life by reducing secondary damage are paramount. Anabolic corticosteroids and growth hormone inhibitor studies were trialled early in the 1990s with mixed results (276). Subsequent research areas of interest included: insulin-like growth factor-1 (IGF-1), calcium influx and calpain activation, oxidative stress, and muscle necrosis (276). It wasn’t until 2001 that the idea of immune cell involvement was raised (290), with much of the subsequent work focusing on inflammatory cells.

Anti-inflammatory treatments for dystrophic muscle have focused on: cytokine inhibition by targeting TNF-α (266, 278, 291, 292) and interleukin-1β (IL-1β) (278); prevention of mast cell degranulation (287); cyclosporine treatment (293); CD4+ or CD8+ T-cell reduction (290); neutrophil reduction (292) and macrophage reduction (277). A key inflammasome component, ASC-1, has been implicated in the inflammatory response of mdx muscle (294). Endogenous danger/alarm signals originating from the ECM or damaged membranes, such as ATP or biglycan, are capable of activating inflammasomes (135, 209, 295). This raises the intriguing possibility that ECM proteolysis contributes towards mdx muscle inflammation.

1.6. The ECM and dystrophic muscle A common feature of the muscular dystrophies is the accumulation of ECM around the myofibres and interstitial space (296). In DMD, the persistent reorganisation of the ECM within an already inflamed muscle environment exacerbates muscle damage and dysfunction (297). Therefore,

38 therapeutic targeting of ECM remodelling may represent an alternative approach or adjunct for ameliorating the dystrophic pathology.

1.6.1. Proteoglycans in dystrophic muscle The dystrophic pathology is characterized by elevated proteoglycan expression (298). The expression of versican, lumican, and biglycan are upregulated 10.5-fold, 3.5-fold, and 3.5-fold respectively in mdx muscle (273). Decorin protein and mRNA levels are increased at four weeks of age in mdx TA muscles, a time point where the muscle has weathered the inflammatory storm that occurs at three weeks, and entered the regenerative phase (126). Co-immuno-precipitation and immuno-histochemistry experiments have demonstrated that biglycan binds α-dystroglycan in the DGC, and that its protein expression is elevated in mdx muscle (124). The reason for proteoglycan accumulations in mdx muscle is not known, but may occur as a result of fibrosis, or as a response to factors released during inflammation and regeneration.

In DMD muscle biopsies, biglycan and decorin are both elevated at the perimysium. Follow up experiments have demonstrated that muscle-derived fibroblasts from DMD patients are capable of synthesising biglycan and decorin (299). These findings were further validated by microarray data showing increased expression of biglycan and decorin mRNA in DMD muscle (300). In addition to chondroitin-sulphate proteoglycans, the synthesis of heparan-sulphate proteoglycans is also elevated in mdx muscle (301). This work identified decorin accumulations in the endomysium surrounding myofibres, while a higher molecular weight proteoglycan with a size and charge fitting that of versican was also detected. In a microarray analysis of DMD muscle versican gene expression was found to be upregulated 8-fold compared to controls (302). Chen et al also used immunohistochemistry to identify increased versican protein levels in the endomysium of DMD muscle compared to control muscle (302). The functional impact of elevated chondroitin-sulphate proteoglycan levels has been demonstrated in mdx mice using chondroitinase-ABC (298). Intramuscular administration helped break down the chondroitin- sulphate proteoglycans and ameliorate the dystrophic pathology (298).

1.6.2. Metalloproteinases in dystrophic muscle The majority of our knowledge regarding ECM proteases and the dystrophic pathology comes from MMP work. Microarray analysis has demonstrated differential expression of proteinases and proteinase inhibitors in regenerating mdx hind-limb muscle (288). PCR analysis of mdx muscle revealed that the expression of MMP-3, -8, -9, -10, -12, -14, and -15 were all upregulated (303). The increased production of MMP-9 has been shown to exacerbate the mdx phenotype (282, 304) and contribute towards dystrophic cardiomyopathies (305). However, the role of MMP-9 in mdx muscle is multi-faceted. Mdx mice in which MMP-9 has been knocked out exhibit

39 decreased necrosis and inflammation early in life, and then show inhibited muscle growth and increased fibrosis at later stages of the disease (283). Adamts5 gene expression is consistently elevated in mdx muscle from three weeks to nine months of age (3). Enzyme-Linked Immunosorbent Assay (ELISA) and proteomic analysis has also showed that ADAMTS5 protein is increased 2.8-fold in mdx mice compared to wild type (4).

1.6.3. The ECM and muscle regeneration The ECM and its associated proteins play important roles in skeletal muscle regeneration following trauma (71). It has been hypothesised that satellite cells require basement membrane degradation to aid in their migration to injury sites (306). Satellite cells cultured from human biceps muscle constitutively synthesise and secrete MMP-2 (307). This work also showed that treating the satellite cells with phorbol ester induced MMP-9 activity (307). These observations were interpreted as a mechanism by which satellite cells degrade the ECM to facilitate migration.

The regenerative roles of MMP-2 and MMP-9 were investigated in both the mdx mouse and in a cardiotoxin injury model. Zymography, Western blot, and Northern blot techniques all demonstrated that MMP-9 expression and activity was upregulated during the acute inflammatory response to injury, a period in which active proliferation of satellite cells is known to occur (139). MMP-2 mRNA and protein levels were upregulated later in the regenerative phase, which led the investigators to speculate about its involvement in the degradation of the basement membrane that occurs prior to myoblast fusion.

Enhanced expression of the metalloprotease ADAM12 in C2C12 myoblasts induces a quiescence- like phenotype not permissible for in vitro differentiation. (308). This function is mediated independently of the metalloprotease domain, which suggests that ADAM12 binding or signalling may be important in deciding the fate of satellite cells. Versican has also been implicated in satellite cell proliferation and differentiation. This was demonstrated using small interfering RNA to knockdown versican expression in myoblasts, with the resulting proliferation and differentiation affected (107). ADAMTS-cleaved fragments of versican have been shown to co- localize with satellite cells in mature myofibres (1). This observation was made from immuno- histochemical staining, thus it remains to be seen if ADAMTS5 is indeed involved in muscle regeneration.

1.6.4. ECM-targeted therapies Owing to their dynamic range of functions, ECM molecules are important targets for therapeutic interventions in an array of diseases. It is vital to delineate ECM changes that cause diseases, from those that arise because of disease. In the case of DMD, both are true. The primary cause of the disease is a mutation in the ECM-associated protein, dystrophin, but much of the resulting

40 pathological symptoms are due to changes in other ECM proteins. Therefore, ECM-targeted therapies aimed at ameliorating the dystrophic pathology are needed. In particular, growth factor signalling and ECM turnover by proteases. Agents have been designed to reduce the accumulation of ECM molecules, while others aim to inhibit ECM degradation (42).

Anti-fibrotic ECM agents The positive effects of reducing fibrosis in dystrophic muscle are two-fold; the first being an improvement in the quality of life of patients, and the second being an improvement in the amount of tissue available for repair by new cell and gene therapies (309). Two of the compounds routinely administered to DMD patients, glucocorticosteroids and ACE-inhibitors, operate by modulating ECM synthesis and remodelling. In addition to decreasing TGF-β signalling, glucocorticosteroids also target type I collagen, elastin, fibronectin, laminin, tenascin, MMPs and TIMPs (42). The primary mechanism of action of ACE-inhibitors is in blocking angiotensin converting enzyme. This serves to reduce fibrosis in muscle by modulating collagen and proteoglycan synthesis (42).

The diaphragm is the most severely affected muscle in the mdx mouse, with its pathology most closely recapitulating the fibrosis observed in DMD boys (310). As a result, reducing diaphragm fibrosis is paramount to treating the disease. The targeting of several ECM components have been successful in reducing mdx muscle fibrosis, including TGF-β, the angiotensin receptors and the MMPs. TGF-β is modulated by a number of factors, including decorin, which has been shown to reduce TGF-β levels and fibrosis (311). In mdx mice, diaphragm and cardiac fibrosis was treated by lowering TGF-β through inhibition of osteopontin (281). Pharmacological inhibition of TGF- β using the drug Suramin also ameliorated fibrosis in mdx hind-limb and diaphragm muscles, but not in the heart (312).

Fibrosis was reduced in the diaphragm, heart and limb muscles of nine month old mdx mice through administration of the angiotensin receptor antagonist Losartan (313, 314). Similarly, the targeting of MMP-2 and MMP-9 using Pirfenidone was shown to ameliorate mdx fibrosis (315). More recently, the anti-allergic drug Tranilast was given to mdx mice, where it was shown to suppress the release of pro-fibrotic cytokines to reduce diaphragm fibrosis (316). This study also measured the function of the diaphragm muscle using an in vitro force setup. Significant functional benefits were observed in the mdx mice treated with Tranilast, with their diaphragms showing improved resistance to muscle fatigue compared to untreated mdx mice (316).

MMP inhibition in dystrophic muscle Attenuation of MMP activity has been shown to reduce muscle damage and improve muscle regeneration (317). Batimastat is a broad spectrum MMP inhibitor that operates by mimicking the

41 collagen site recognised by MMPs. When administered to mdx mice it reduces several markers of muscle damage, including: necrosis, fibrosis, macrophage infiltration, and centrally nucleated fibres, as well as improving diaphragm function (303). Intraperitoneal injections of the anti- parasitic drug Suramin produces a wide range of therapeutic benefits in six month old mdx mice. These include: decreased limb and diaphragm fibrosis (312), protection against contraction induced fatigue in the diaphragm (318), and amelioration of the dystrophic cardiomyopathy at eight months of age (319). The proposed mechanism of action involves reduced MMP-9 activity and increased levels of β-dystroglycan. As β-dystroglycan is a known proteolytic target of MMP- 9, this raises the possibility that its levels were elevated due to a reduction in cleavage. Although a number of MMP inhibitors have been shown to improve the pathology of the mdx mouse, their suitability for DMD patients is still controversial. The majority of these compounds have been trialled in cancer patients, but to date none have proved successful due to their deleterious side effects (317).

Targeting ADAMTS5 to ameliorate the dystrophic pathology The role of ADAMTS5 in dystrophic muscle was originally flagged by microarray analysis of mdx muscle, where it was reported that Adamts5 mRNA was significantly upregulated at three, six, and 12 weeks of age compared to wild type mice (3). Quantitative RT-PCR validation of the microarray data showed that Adamts5 was significantly upregulated throughout the mdx lifespan, from three weeks to nine months of age (3). The ECM remodelling protease cathepsin S was also upregulated, along with components of the elastic system involved in elastin production and deposition. The authors postulated that the upregulation of these ECM genes may represent a compensatory mechanism for protecting the mdx muscle against contraction-induced damage (3).

More recently, ADAMTS5 was identified as a serum biomarker in a proteomic screen of over 1000 proteins in wild type and mdx mice. Proteomics showed the expression of ADAMTS5 was elevated 2.8-fold in mdx mice compared to wild type, a result which was then supported by ELISA, where it was reported to be up 7.6-fold (4). ELISA was then performed on human serum to find that ADAMTS5 was also significantly elevated 3.4-fold in DMD patients compared to healthy controls. The most exciting aspect of this work was the discovery that mdx mice displayed reduced protein levels of ADAMTS5 following treatment with an exon skipping drug. ELISA analysis showed that the drug intervention reduced the levels of ADAMTS5 from 7.6-fold above controls to only 2-fold after treatment (4). This result strongly suggests that ADAMTS5 is a responsive biomarker with potential applications for tracking the efficacy of therapeutic interventions over time.

As mentioned previously, full length and cleaved forms of biglycan, decorin and versican have been implicated in pathological inflammation (98). Cleaved biglycan is able to activate inflammasomes through the binding of TLRs (10), and an inflammatory role for the cleaved form of versican during apoptosis has been demonstrated (320). Importantly, ADAMTS5 has been shown to cleave all of these proteoglycans (87), which raises the possibility that it may be involved in the liberation of soluble DAMPs from the matrix. It was hypothesised that the genetic ablation of Adamts5 would reduce the liberation of DAMPs from the inflammatory milieu of mdx muscle. It was also hypothesised that elevated levels of Adamts5 in mdx muscle were responsible for excessive ECM processing and exacerbation of the dystrophic pathology. Mdx and Adamts-/- mice were crossed to investigate this hypothesis. Prior to analysing ADAMTS5 in the mdx setting, it was important to establish whether a muscle phenotype existed in C57/BL6: Adamts5-/- mice.

Aims and hypotheses

Overall hypothesis:

ADAMTS5 is involved in the remodelling of healthy muscle, and in the pathology of muscular dystrophy.

Specific hypotheses:

1. ADAMTS5 expression and activity influence muscle growth and function.

2. ADAMTS5 is involved in exercise-induced muscle adaptations.

3. Genetic ablation of Adamts5 will ameliorate the pathology of the mdx mouse.

4. The absence of ADAMTS5 will affect protein abundance in the ECM proteome.

Specific Aims:

1. Do C57/BL6:Adamts5-/- mice present with a muscle phenotype?

2. Does genetic ablation of Adamts5 affect muscle adaptations to exercise?

3. Does genetic ablation of Adamts5 ameliorate the pathology of the mdx mouse?

4. Does genetic ablation of Adamts5 affect the abundance of ECM proteins in the proteome of C57/BL6:Adamts5-/- fibroblasts?

2. Materials and methods 2.1. Animal work All experiments involving the use of animals were approved by the Murdoch Childrens Research Institute (MCRI) animal ethics committee (see Table 2.1). Animals were cared for in accordance with the ‘Australian Code of Practice for the Care of Animals for Scientific Purposes’ published by the National Health and Medical Council (Canberra, Australia). Mice were housed at the Disease Model Unit at the MCRI, where they lived in 12 hour light/dark cycles, and were given access to food and water ad libitum.

Table 2.1 Animal ethics application numbers

Mouse Animal ethics ID C57/BL6 A732 C57/BL6:Adamts5-/- A732 C57/BL6:Adamts5-/- exercised A745 Mdx A730

Throughout this thesis C57/BL6:Adamts5-/- mice will compared to their C57/BL6+/+ littermate controls, and will be referred to as KO and WT mice respectively. The KO mouse was created by Deltagen Inc. (San Carlos, CA) and purchased from Jackson Laboratories. Adamts5 was inactivated in KO mice by homologous recombination in embryonic stem cells. Briefly, a cassette consisting of a 5’ internal ribosome entry site, a nuclear-targeted Lac-Z reporter gene; and a neomycin selectable marker in its 3’ half were inserted into exon 2 of the Adamts5 gene. This replaced the 134 nucleotides of exon 2, a region that includes the catalytic active site and the myogenic regulatory factor-binding enhancer of Adamts5 (2).

A central focus of this thesis was the role of ADAMTS5 in the mdx mouse model of muscular dystrophy. The mdx mouse originated from a nonsense mutation in the dystrophin gene of C57BL/10 mice (245, 246). It has subsequently become the standard animal model for pre-clinical DMD research. Mdx and C57/BL6:Adamts5+/- mice were crossed to create mdx:Adamts5+/+ (mdx wt) and mdx:Adamts5-/- (mdx ko) mice. Throughout this thesis, mdx wt and mdx ko mice will be analysed in relation to WT mice.

2.1.1. Adamts5 genotyping protocol Mice were genotyped for Adamts5 using the following protocol. Ear clips were heated to 100C in 0.5M NaOH for 10 minutes. The mixture was then briefly vortexed, before 1M of Tris-HCl pH 8 was added. Samples were then centrifuged at 13,000 g for 6 minutes. A multiplex PCR reaction was performed using primers that recognised both the WT and KO alleles. The sizes of the PCR products were: KO = 424 base pairs (bp), heterozygote = 271 bp and 424 bp, WT = 271 bp. The Sigma primers arrived freeze-dried and were made up to 200 M using TE buffer (10mM Tris pH 7.7, 1mM EDTA).

Table 2.2 Adamts5 primers

Primer Sequence Type TS5-KO GGG CCA GCT CAT TCC TCC CAC TCA T knockout TS5-WT GCA TAC CAC TCC AAA CTT AGA GAG G wild-type TS5-C CGC AGC TGA CTG CTC TTG TGC TTG common

A multiplex PCR reaction was performed using the following volumes of reagents: 5.2L of H2O,

0.6L of 25mM MgCl2 (cat # A351H, Promega), 0.8L of 2.5mM deoxyribonucleotides (dNTPs) (cat # U1515, Promega), 0.6L of KO primer, 0.6L of WT primer, 0.6L of Common primer, 0.1L of GoTaq DNA Polymerase (cat # M3001, Promega), 1L of 5X Green GoTaq Reaction Buffer (cat # M791A, Promega), and 0.5L of the DNA sample. The PCR reaction consisted of 35 cycles: 10 minutes at 95C, 30 seconds at 94C, 30 seconds at 60C, 1 minute at 72C, 5 minutes at 72C, with a final hold step at 12C. Gel electrophoresis was performed using 3L of the PCR product on a 1.5% agarose gel with 5L of Gel Red (cat # 41002, Gene Target Solutions, NSW, Australia).

2.1.2. Endpoint protocol At experimental endpoint, animals were euthanized by cervical dislocation whilst under isoflurane-induced inhalational anaesthesia (4 L/min). Prior to euthanasia, blood was sampled by cardiac puncture using a 1mL syringe and 25 gauge needle. Next, the heart and diaphragm where removed and depending on the experiment were either snap frozen in liquid nitrogen or fixed in paraformaldehyde (PFA). The hind limb muscles were dissected out in the following order: tibialis anterior (TA), extensor digitorum longus (EDL), soleus, and finally the quadriceps (Figure 2.1). Once excised, the muscles were weighed, snap frozen in liquid nitrogen, and placed on dry ice.

Figure 2.1 The hind-limb muscles of a mouse

Hind-limb muscles from anterior to posterior: tibialis anterior (TA), extensor digitorum longus (EDL), soleus (Sol), quadriceps (Quad).

Muscles for histology were embedded on a cork block containing 5% (w/v) tragacanth gum (Sigma, USA) in water. Care was taken to ensure that the muscle fibres ran perpendicular to the block, thereby allowing transverse sections to be cut on the cryostat. The mounted muscle block was immersed for 20 seconds in liquid nitrogen cooled isopentane (Chem-Supply, Adelaide, Australia). The blocks were blot-dried and transferred to dry ice before storage at -80°C.

2.1.3. Creatine Kinase assay Plasma creatine kinase is an established diagnostic marker for muscle injury (293, 321). As described above, blood was sampled by cardiac puncture and then immediately stored on ice. The blood was centrifuged at 8,000g for five minutes at 4°C. The clear plasma supernatant was retained and the pellet was discarded. The creatine kinase activity was quantified from the plasma preparation using the CK-NAC Reagent kit (Thermo Electron Corporation, Waltham, USA).

In a 96-well plate, samples were run in a ratio of 1:20 of plasma/CK buffer (5µL sample lysate with 100µL of CK assay buffer). Three technical replicates per cell lysate were analysed. A Paradigm Detection Platform (Beckman-Coulter, USA) was used to determine the optical density. The program consisted of 30 cycles of 20 seconds, run at the primary wavelength of 340 nm. The linear rate of absorbance change (ΔAbs/min) was applied to the following formula: U/L = ΔAbs/min x factor (total µL / (6.3 x sample µL x path length)). Technical replicates were averaged, followed by averaging of biological replicates within each group.

2.1.4. Hydroxyproline assay The hydroxyproline content of WT, mdx wt and mdx ko diaphragms were compared to assess collagen deposition and fibrosis (322, 323). The protocol was adapted by Dr Liam Hunt.

Muscle samples were thawed and excess tendon was removed. After weighing, samples were placed into labelled glass screw cap tubes. Individual muscles were acid-hydrolysed at 120ºC overnight in 5M HCl (10mg muscle weight/mL). The tubes were heated inside a heat block that was lined with aluminium foil and filled with sand. The tubes were placed in the sand and covered with aluminium (all performed in a fume hood). After 18 hours the tubes were cooled, transferred to 1.5mL Eppendorf tubes, and centrifuged at 12,000g for five minutes.

A 50μL aliquot of each sample was placed into new tubes along with the following hydroxyproline standards (mg/mL in HCl): 0.25, 0.125, 0.0625, 0.03125, 0.015625, 0.007813, 0.003906, as well as a HCl blank. Samples and standards were then incubated at room temperature for 25 minutes in 0.2M Chloramine T (cat # C9887, Sigma) dissolved in a solution consisting of 1mL of dH2O, 1mL of n-propanol, made up to 10mL with acetate citrate buffer (120g of sodium acetate trihydrate (cat # S7670, Sigma), 46g of citric acid (cat # C7129, Sigma), 12mL of glacial acetic acid (cat # A6283, Sigma), 34g of sodium hydroxide, pH 6.5, made to 1L with dH2O). A 500μL volume of Ehrlich’s Reagent (1.5g of DMAB (4-dimethylamino-benzaldehyde) in 5mL of n-propanol and 5mL concentrated HCl-32%) was then added and samples were incubated at 65ºC for 10 minutes. Following removal from the heat, 100μL of each sample was pipetted into a 96 well plate and read at 550nm on a Biotek Synergy 2 Spectrophotometer (Winooski, USA).

A standard curve was generated from a plot of absorbance versus concentration. Hydroxyproline concentrations were interpolated from the standard curve. Concentration (μg/mL) was divided by factor of 20 (tissue was hydrolysed in HCl at 20mg/mL) to give a concentration of hydroxyproline in μg per mg of tissue. Values ranged between 1-5μg/mg depending on the age and strain of the mouse.

2.1.5. Voluntary wheel exercise C57/BL6 mice were voluntarily exercised to investigate the role of ADAMTS5 in exercise- induced muscle adaptations. Nine week old WT and KO mice were housed in modified cages with built-in exercise wheels attached to a computer for recording the distance run (324). The mice were free to exercise for a three week period that consisted of one week of acclimatisation, followed by a two week recording period. Mice ran varying daily distances during recording, with some not running at all for days on end. As a means of standardising the level of exercise performed, any mouse that ran under 1km/day for more than three consecutive days was

48 considered a ‘non-runner’ and excluded from the study. Activity that registered as under 1 rotation was counted as incomplete and was also not analysed.

2.1.6. In situ muscle function Measuring muscle function is an important end-point for assessing the efficacy of muscular dystrophy treatments (325). This study measured muscle function using an in situ setup (Figure 2.2). In comparison to ex vivo techniques, the in situ approach offers a more physiological evaluation of muscle function as the blood and nerve supplies remain intact (325). Briefly, the distal tendon of the TA muscle was exposed and attached to a lever arm that recorded the force produced by electrical stimulation of the sciatic nerve.

Training for this technique was provided by Professor Gordon Lynch and Tim Naim at the University of Melbourne. Doctor Peter Houweling at the MCRI assisted in apparatus setup and technical troubleshooting. In addition, Peter helped with calibration of the force transducer, which was performed routinely with a set of 50mg – 1g weights (Masscal Precision Weighing equipment, Melbourne Australia).

For the duration of the protocol mice were deeply anaesthetised such that they were not responsive to tactile stimulation. Mice were anaesthetised inside a clear Perspex box using inhalational isoflurane (4L/min). Once sufficiently anaesthetised, the mice were carefully transferred from the box to a nose cone on top of a heat mat, with anaesthesia maintained at 2L/min. After approximately five minutes the degree of anaesthesia was checked by paw pinch, and when deemed sufficient the lower right leg was sprayed with 70% ethanol to minimise hair interference during the surgery. An initial incision was made using fine scissors on the lateral side of the ankle. Great care was taken to not cut any blood supply in this highly vascularised area. A combination of small cuts and blunt dissecting were performed from the ankle in a proximal direction to the quadriceps muscle, and then distally to expose the tendons of the feet. Ringers solution (1.2mM

NaH2PO4, 1mM MgSO4, 4.83mM KCl, 137mM NaCl, 24mM NaHCO3, 2mM CaCl2, 10mM glucose) was added continuously to ensure that the muscle did not dry out.

When the TA muscle was sufficiently exposed, the distal tendon was cut below the ankle and pulled through the tough exterior fascia until free. A 12cm piece of silicon coated suture silk (5/0, 0.5m, black 12 x 18, Covidien) was tied around the tendon in a series of clockwise and anti- clockwise knots, and then cut off at both ends. This knot served as the anchor, after which a second knot was tied immediately proximal to form the loop for attaching the muscle to the transducer. Finally, a shallow incision was made approximately 1cm above the knee between the biceps femoris muscle and the quadriceps femoris muscles, with care taken not to impact on the distal caudal femoral artery. This incision removed the fascia between the two muscles and

49 allowed access to the deeper lying sciatic nerve. A wire electrode was positioned under the sciatic nerve and another electrode was placed on top of the nerve, with care taken to ensure that the electrodes were not touching. The position of the electrodes was secured using adhesive tape. At this point the mouse was carefully transferred to a nose cone adjacent to another functional rig.

The functional apparatus used was the 1300A 1.0N in situ/ex vivo/in vitro Muscle Test System (Aurora Scientific). Once the mouse was secure inside the nose cone, it was positioned on the heated platform of the apparatus (Figure 2.2). The foot was secured by pinning the lower portion of it to the platform, after which the knee was secured by tightening two threaded pins over the patella tendon. Next, the previously created silk loop was tied to the lever arm and the position of the arm manipulated to create a slack tension in the muscle. The Dynamic Muscle Control (DMC) system was used to control the delivery of electrical signals from the stimulator to the electrodes. The electrodes then stimulated the TA muscle to contract via electrical stimulation of the sciatic nerve, with the resulting force produced by the muscle measured by the transducer.

Optimum length (Lo) was determined by micromanipulations of the muscle length and a series of 1Hz twitch contractions to determine the length at which maximal force was produced. When this length was reached, the transducer position was secured and the Lo measured with 150mm Digital

Vernier micro-calipers (Kincrome). After determining the optimal length (Lo), the muscle was stimulated at incremental frequencies of 5, 10, 20, 30, 40, 50, 75, 100, 150, 200 and 250Hz to assess the force-frequency relationship. The absolute maximal isometric tetanic force (Po) was measured at 150Hz, and then normalised according to the length, wet muscle mass and cross sectional area of the muscle to give the specific force (sPo). Absolute force (kN) was normalised to calculate the specific force (kN•m2) using the formula: sPo = Po x (muscle mass/ Lo x 1.06).

The fatigue protocol was performed to compare the function of WT, KO, mdx wt, and mdx ko mice over a four minute period of repeated stimulation. It must be stressed that the fatigue protocol did not elicit muscle damage, but rather caused a reversible decline in muscle performance. In the protocol, Po was measured every five seconds for four minutes, the muscle was then allowed to recover, with Po measured at 1, 2, 3, 5 and 10 minutes post-fatigue (326). At completion of the protocol the mouse was euthanised and the tested TA muscle carefully excised.

Functional data was obtained from the Aurora built-in Dynamic Muscle Analysis High Throughput (DMA-HT) software, and was then analysed using a customised Microsoft Excel worksheet.

Figure 2.2 The in situ muscle function setup

Top image: (1) PC for performing commands, acquiring data, and analysis; (2) Electrical stimulator; (3) Dual-mode lever system for controlling muscle length and measuring muscle force. Bottom image: (4) Dual fine/coarse controls for accurate positioning of the tissue and adjustments of muscle length; (5) Lever arm with muscle attached via silk; (6) Knee clamp; (7) Temperature controlled platform; (8) Anaesthetic nose cone and stimulating electrodes.

2.2. Histology

2.2.1. Cryostat protocol Frozen muscle blocks were cryo-sectioned at -20°C on a Leica CM30505 cryostat. Briefly, the muscle block was attached to the chuck using optimal cutting temperature compound (OCT) (Sakura Finetek, USA). The block was then orientated for transverse sectioning and trimmed until the full face of the muscle mid belly was exposed. Sections were cut at 10µm, with typically four sections per slide (Menzel Glaser, Germany). Slides were kept at room temperature for five minutes and then transferred to dry ice, after which they were stored at -20°C.

2.2.2. Measuring myofibre size Myofibre size was measured from muscle cross sectional images using ImageJ. Briefly, a multi- channel image was opened and split into a black and white 8-bit image displaying only the laminin-α2 boundaries of myofibres (Figure 2.3). Next, the threshold of the black and white image was adjusted to produce a suitable cross-sectional mask encompassing all fibres. The image was analysed using the ‘analyse particles’ function, which measures the number, area, and minimum Feret’s diameter of all fibres (exclusion criteria of 300-infinity pixel2). The minimal Feret’s diameter is defined as the closest possible distance between the two parallel tangents of an object (327). It is a more robust measure of muscle fibre size than cross sectional area, as it minimises the experimental errors that can occur if muscle is sectioned at an incorrect angle (e.g. oblique or longitudinal sections) (327).

Figure 2.3 A representative mask of transverse muscle sections used for calculating minimal Feret’s diameter

2.2.3. Haematoxylin & Eosin histochemistry Haematoxylin and eosin (H & E) staining was performed on frozen sections mounted onto glass slides. Initially, slides were immersed in 70% ethanol for five seconds, followed by a 10 second distilled water wash, and Harris haematoxylin staining (Sigma-Aldrich) for 30 seconds. Slides were then immersed in distilled water for 10 seconds, followed by Scott’s tap water (8 drops of ammonia per 300mL of Milli-Q H2O for a further 10 seconds. The next step was 70% ethanol for 10 seconds, followed by 1% (w/v) Eosin-Y (Sigma-Aldrich) in 70% ethanol for one minute. Sections were then dehydrated through repeat 10 second dips in 95% and 100% ethanol. Finally, slides were cleared in xylene for 30 seconds and cover slip mounted with Pertex (Medite Medizintechnik, Germany).

2.2.4. H & E damage quantification The area of myofibre necrosis is a commonly used measure of muscle damage in the mdx mouse model of muscular dystrophy (266, 292). Image J was used to highlight areas of muscle necrosis, which was then divided by the entire area of the muscle section to calculate the percentage of muscle necrosis (328).

In healthy muscle, the myonucleus is located at the periphery of myofibres. However, when muscle is damaged it undergoes cycles of degeneration and regeneration, resulting in newly formed myofibres with centrally located nuclei. The proportion of myofibres with centrally located nuclei can be used as a marker of previously necrotic tissue (268). The cell counter function in Image J was used to count the number of myofibres within a muscle section that contained centrally located nuclei. The number of myofibres with centrally located nuclei was divided by the total number of myofibres to calculate the proportion.

2.2.5. NADH histochemistry Nicotinamide adenine dinucleotide tetrazolium (NADH) staining provides a measure of muscle oxidative capacity. Oxidative myofibres stain darker due to a larger number of mitochondria, while glycolytic myofibres appear lighter. The chemical reaction responsible consists of the mitochondrial enzyme NADH-dehydrogenase reacting with nicotinamide adenine dinucleotide tetrazolium. The reaction produces an insoluble coloured formazin product within the inter- myofibrillar matrix.

Prior to the protocol, NADH (cat # N4505, Sigma) and nitro blue tetrazolium (NBT) (cat # N6876-500MG, Sigma) solutions were made up separately in Tris-buffer. The two solutions were then combined in an equal ratio and applied to sections (approximately 50µL/slide) for 30 minutes at 37°C. Sections were then washed three times in Milli-Q, followed by approximately 30 seconds of 30%, 60%, 90%, 60%, 30%, 60%, 90%, 60%, 30%, 60%, 90% acetone (30mL volumes) and

53 two more Milli-Q washes. Finally, slides were dried and cover slip mounted with Polyvinyl alcohol mounting medium (PVA) (Sigma-Aldrich).

2.2.6. X-gal staining of muscle sections and fibroblasts Adamts5 KO mice contain an intragenic Lac-Z reporter under the control of the Adamts5 promoter. Therefore, β-galactosidase staining was used to identify Adamts5 promoter activity in muscle tissue, myoblasts, and fibroblasts. Positive staining validated the successful insertion of the Lac-Z gene, and hence knockout of Adamts5.

Samples were fixed in 0.2% glutaraldehyde for 10 minutes at 4C, and washed in washing solution

(2mM MgCl2, 0.01% Sodium-deoxycholate, 0.02% Nonidet P-40 in phosphate buffered saline (PBS)) three times at room temperature. Slides and cells were incubated overnight (16 hours) at

37C in the stain solution (0.375mM of K3Fe(CN)6, 0.375mM of K4Fe(CN)6, 1mg/mL of 5- bromo-4-chloro-3-indolyl-β-D-galactopyranoside in dimethylformamide). The following wash steps were then performed: PBS for 30 seconds, Milli-Q for 30 seconds, Scott’s Tap water for 10 seconds, 70% Ethanol for 10 seconds, Eosin for one minute, two 95% Ethanol steps for 10 seconds each, two 100% Ethanol steps for 10 seconds each, and finally two Xylene steps for one minute each. Slides were then coverslip mounted using DPX mounting media (Sigma-Aldrich).

2.3. Immuno-histochemistry

2.3.1. Immuno-histochemistry antibodies

Table 2.3 Primary antibodies used for immuno-histochemistry

Primary Antibody (clone) Cat number Dilution Target Isotype Manufacturer Species Laminin-α2 (4H8-2) SC-5954 1/200 Rat IgG Santa Cruz MYHC-2a (N2.261) SC-53096 1/200 Mouse IgG1 Santa Cruz MYHC-1 (NOQ7.5.4D) MAB1628 1/100 Mouse IgG Chemicon

MYHC-2 (MY32) M4276 1/50 Mouse IgG1 Sigma MYHC-2b BF-F3 1/10 Mouse IgM DHSB (supernatant)

CD31 (PECAM-1) 557355 1/200 Mouse IgG2a BD Pharmingen Versican (GAG-β domain) AB1033 1/200 Rabbit IgG Chemicon Versican V0/1 (DPEAAE) PA1-1748A 1/200 Rabbit IgG Fisher

Table 2.4 Secondary and conjugated antibodies used for immuno-histochemistry

Label Cat number Dilution Target Isotype Manufacturer Species Alexa Fluor 488 A-21202 1/250 Mouse IgG Life Technologies

Alexa Fluor 594 A-21203 1/250 Mouse IgG Life Technologies

Alexa Fluor 594 A-21207 1/250 Rabbit IgG Life Technologies

Alexa Fluor 488 A-11006 1/250 Rat IgG Life Technologies

Alexa Fluor 594 A21209 1/250 Rat IgG Life Technologies

Alexa Fluor 350 A-21093 1/250 Rat IgG Life Technologies

Zenon Alexa 350 Z25000 - Mouse IgG Life Technologies Zenon Alexa 488 Z25002 - Mouse IgG Life Technologies Zenon Alexa 594 Z25007 - Mouse IgG Life Technologies

2.3.2. Versican immunostaining The antibody dilutions used for all immuno-histochemical steps are displayed in Table 2.3. Muscle sections were outlined using a water resistant wax Pap pen (Thermo Fisher) and incubated in PBS for 20 minutes. Sections were then blocked for 45 minutes in 10% goat serum made up in PBS, washed three in PBS, and incubated with the rat anti-laminin-α2 and rabbit anti-versican primary antibodies (both 1/200 in PBS). Three more PBS washes preceded the one hour secondary antibody incubation with anti-rabbit Alexa 594 and anti-rat 488 (1/250 in PBS-T (0.1% Tween- 20)) at room temperature. Followed by three final PBS washes and the application of 4', 6- diamidino-2-phenylindole (DAPI) for nuclear visualisation (10μg/mL in PBS). Slides were PVA mounted and imaged on a Zeiss Axio Imager microscope. Image analysis was performed using Image-j. Any protocols that diverged from the aforementioned will be discussed later in more detail.

2.3.3. DPEAAE Immunostaining Neo-epitope antibody detection is a common strategy for investigating the proteolytic activity of proteases such as ADAMTS5. The technique uses antibodies raised against the neo-epitope sequence to detect N- terminal protein fragments generated by proteolysis (103). In this study, neo-epitope antibody detection of the cleaved form of versican (DPEAAE) was used as a readout of ADAMTS activity.

Sections were initially fixed in 5% PFA at room temperature for five minutes, and then blocked in 10% goat serum/PBS at room temperature for one hour. The primary antibody step consisted of an overnight incubation at 4°C using rat anti-laminin-α2 and rabbit anti-DPEAAE (both 1/200 in PBS). After three PBS washes, the secondary antibodies of anti-rabbit Alexa 594 and anti-rat 488 were added at 1/250 in PBS-T (0.1% Tween-20) for one hour at room temperature. A final PBS wash preceded coverslip mounting with PVA. A representative DPEAAE (green)/laminin- α2 (red) /DAPI (blue) image is presented below, along with a no secondary antibody negative control image.

2.3.4. MYHC fibre typing The proportions of muscle fibre types were quantified based on their immuno-expression of myosin heavy chain isoforms. Initial fibre typing was performed in the soleus muscle using an antibody for MYHC-1, and another that detected all MYHC-2 isoforms. After observing a delay in the fast to slow transition in the soleus muscle of KO mice, a MYHC-2a antibody was purchased to fibre type the EDL muscle. MYHC-1 was not stained for in the EDL as it is not expressed this muscle (27).

Soleus protocol Muscle sections were outlined using a water resistant wax Pap-pen (Thermo Fisher), incubated in PBS for 20 minutes, blocked for 45 minutes in 10% goat serum (made up in 1 x PBS), and then washed three times in PBS. At the end of the block, the rat anti-laminin-α2 primary antibody (1/200 in PBS) was added for one hour at room temperature (or at 4°C overnight). Three PBS washes were then performed. At the end of the laminin incubation, MYHC primary antibody- Zenon conjugates were prepared in PBS as per the manufacturer’s instructions. MYHC-1 (1/100) was conjugated to Zenon-594, while MYHC-2 (1/50) was conjugated to Zenon-488. The conjugated mixtures were added to the muscle sections and incubated in the dark, along with the Alexa anti-rat 350 secondary antibody. After 45 minutes the muscle sections were washed three more times in PBS-T. Slides were then mounted with PVA and cover-slipped.

EDL protocol Muscle sections were outlined using a water resistant wax Pap-pen (Thermo Fisher) and incubated in PBS for a period of 20 minutes. They were then blocked for 45 minutes in 10% goat serum with anti-mouse HRP (1/500) in PBS. The sections were then washed three times in PBS. Laminin-α2 (1/200) and MYHC-2a (1/200) primary antibodies were made up in PBS and added for one hour. Three more PBS washes preceded addition of Alexa anti-rat 594 and Alexa anti- mouse 488 secondary antibodies (1/250 in PBS) for one hour. The secondary antibodies were removed by three more PBS washes. Slides were then mounted with PVA and cover-slipped.

Fibre typing was then performed by counting the numbers of each fibre type on the ImageJ cell counter. The total number for each isoform was divided by the total number of myofibres in the muscle to give the MYHC proportion. Figure 2.4a shows a soleus muscle with MYHC-1 (red) and MYHC-2 (green) fibres. Fibres that stained positive (orange) for both MYHC isoforms were termed intermediate (MYHC-1/MYHC-2).

Figure 2.4 Representative immunohistochemical images of solei and EDL muscles using MYHC antibodies

Transverse sections of 12 week old WT mouse muscles. (A) Soleus muscle sections were incubated in MYHC primary antibodies and then Zenon-labeled. MYHC-1 fibres stained red and MYHC-2 stained green, while fibres that stained positive (orange) for both MYHC isoforms were termed intermediate (MYHC-1/MYHC-2). The circled area highlights (1) MYHC-1 , (2) MYHC- 2, and (i) intermediate fibres (positive for both MYHC-1 and MYHC-2); (B) EDL muscle sections were incubated with a MYHC-2a primary antibody that stained green (the black areas with no staining represent MYHC-2x and MYHC-2b fibres as no MYHC-1 fibres are present in the murine EDL muscle). 2.3.5. CD31 capillary density Frozen sections were thawed and pre-fixed with 5% PFA, followed by a 30 minute block in 10% goat serum made up in PBS. Sections were incubated overnight at 4°C in rat anti-laminin-α2 and mouse anti-CD31 (Platelet endothelial cell adhesion molecule) primary antibodies made up in PBS. Following PBS washing, the Alexa Fluor IgG anti-rat 488 and anti-mouse 594 secondary

57 antibodies were added for one hour. This was followed by a final round of three washes and PVA coverslip mounting.

Analysis was performed by creating a composite image of the CD31 (red) channel in Image-J. A grid of crosses was overlayed at 5000 pixels2 (20 x 15 = 300 crosses) over the composite image. A cell counter was clicked for any CD31 positive (red) cell that fell upon any of the 300 green crosses in the grid (Image 2.5). The number of CD31-positive cells was then divided by the total number of crosses (300), and multiplied by 100 to calculate the percentage vascularity.

Figure 2.5 CD31 grid analysis from the soleus muscles

A representative muscle section immuno-stained for CD31. Overlayed is the 300 cross grid used for quantitating CD31 positive fibres. Any red cell that fell upon any of the 300 green crosses was counted as CD31 positive. 2.3.6. Mdx IgG immuno-histochemistry The proportion of total fibres that were immunoglobulin (IgG) positive was used as an index of dying myofibres within the mdx muscle (329). IgG is a large molecule that resides outside of the myofibre in healthy muscle. When the sarcolemma is damaged, IgG is able to leak into the cell, where it can be detected using immuno-histochemistry. Briefly, 10µm frozen muscle sections were thawed, hydrated with PBS, and then blocked for 30 minutes with 10% goat serum in PBS. To allow the myofibre boundary to be visualised, a rat anti-laminin-α2 primary antibody was added at 1/200 for an overnight incubation at 4°C. After three PBS washes, anti-rat Alexa 594 and anti-mouse Alexa 488 secondary antibodies were added at 1/250 for one hour. Three more PBS washes were performed to wash off the secondary antibody, before cover slip mounting with (PVA) (Sigma-Aldrich).

2.4. RNA isolation and quantitative real-time PCR

2.4.1. RNA isolation RNA was isolated using an adapted SV Total RNA Isolation System (cat # Z3105, Promega). All muscles were kept on dry ice in the fume hood for the duration of the homogenising steps, and all centrifuge spins were performed at 12,000g.

For the TA muscle, 1mL of Tri-reagent (Sigma-Aldrich) was added to 1.5mL Eppendorf tubes containing the snap frozen TA muscles (500μL Trizol soleus and EDL muscles). The muscle was homogenised using a T10 IKA homogeniser and transferred to a fresh 1.5mL Eppendorf tube on wet ice. A 100μL volume of 1-Bromo-3-chloropropane (BCP) (Sigma-Aldrich) was added, mixed well by inversion, and left to stand at room temperature for 10 minutes. The tube was then centrifuged at 4ºC for 15 minutes. The aqueous phase was transferred to a new tube (typically 600μL, with care taken to take same amount from each sample). An equal volume (600μL) of SV binding buffer (0.9% ethanol, SV lysis buffer, β-mercaptoethanol) was added to the aqueous sample.

The solution was mixed by inversion and transferred to a spin column (with collection tube beneath). The column was centrifuged for one minute at room temperature and the flow through discarded. A 0.6mL volume of SV wash buffer was added (Promega kit with ethanol added), centrifuged for one minute at room temperature and the flow through discarded. A 49μL volume of DNAse solution (Yellow core buffer, 90mM MnCl2, DNase I) was added to each column and incubated at room temperature for 15 minutes. Next, 200μL of DNAse stop solution was added (Promega with ethanol added) and centrifuged for one minute. SV wash solution (600μL) was added and centrifuged for one minute at room temperature, with the flow through discarded. An additional 250μL of SV wash solution was added and centrifuged for two minutes, with the flow through discarded. The column was then transferred to an elution tube, 40μL of nuclease free water was added and left to sit for one minute, after which it was centrifuged for two minutes. The RNA concentration was determined using a Nanodrop-1000 (Thermo-scientific).

Please note: a slightly modified protocol was used for isolating RNA from fibroblasts. This method is described in the Methods section of Chapter 6.

2.4.2. Reverse transcription quantitative real-time PCR Relative transcript levels of genes of interest were examined by real-time quantitative polymerase chain reaction (qRT-PCR) of reverse transcribed samples.

A 25μL reverse transcription reaction was performed in two steps. Initially, the volume of RNA required for 500ng was calculated. This RNA volume was added to 1μL of random oligo-hexamer primers (cat # C1181, Promega), and then made up to 17μL with nuclease free water. Samples were heated for five minutes at 70ºC, and then placed on wet ice for one minute. During heating, a master mix was made consisting of: 1.3μL of 10mM dNTPs (cat # U1515, Promega), 5μL of 5x Reaction Buffer, 0.6μL of RNAse (cat # N2611, Promega), and 1μL of reverse transcriptase (cat # M3001, Promega). Following the heat step, 8μL of the master mix was added to each sample, creating a total volume of 25μL. The mixture was then incubated at 37 ºC for one hour. The reaction was stopped by heating at 70 ºC for 15 minutes, and the cDNA was stored at -20ºC.

The qRT-PCR reaction mixture contained 2μL of cDNA, 5μL of ‘SYBR Green Real-Time PCR master mix’ (cat # 600882, Integrated Sciences), 2.5μL of nuclease free water, and 0.25μL of both forward and reverse oligonucleotide primers at a concentration of 20μM. The qRT-PCR protocol was performed on a Light Cycler 480 (Roche Applied Science, Basel, Switzerland). The program parameters were: pre-incubation at 50ºC for five minutes, followed by 95ºC for five minutes and then 40 cycles of 95 ºC for 20 seconds for denaturing, 60 ºC for 30 seconds of annealing, and 72ºC for 30 seconds of amplicon extension.

2.4.3. Primers Oligonucleotide primers were designed using ‘Primer-BLAST’ (http://www.ncbi.nlm.nih.gov) and obtained from Sigma-Aldrich. The aim was to produce amplicons of 50-250 bp for detection by ‘Sybr Green’ based qRT-PCR. Primers were tested for efficiency by serial dilution of cDNAs to determine E, the ratio at which amplicon concentrations increase as the Ct decreases by one. Primers were only accepted for use if 1.8≤E≤2.2. Primer sequences are presented in Table 2.5.

Table 2.5 Primers designed for qRT-PCR

Gene name Gene Forward primer Reverse primer Accession Number

Adamts1 NM_009621 CCTGTGAAGCCAAAGGCATTG TGCACACAGACAGAGGTAGAGT

Adamts15 NM_001024139 GCTCATCTGCCGAGCCAAT CAGCCAGCCTTGATGCACTT

Adamts4 NM_172845 CAAGCAGTCGGGCTCCTT GATCGTGACCACATCGCTGTA

Adamts5 NM_011782 GCTACTGCACAGGGAAGAGG GGCAGGACACCTGCATATTT

Adamts9 NM_175314 TTGTTGTCTCCATGTCCAAAAG ATTGCTGAGGTTTGTCCTCAAT

BGN NM_007542 CACCTGGACCACAACAAAA TCCGAATCTGATTGTGACCTA

Ppp3ca NM_19055 CAAAGCGCTACTGTTGAGGC ATTCGGTCTAAGCCCTTGGC

CASP1 NM_009807 AGGCATGCCGTGGAGAGA TGAGCCCCTGACAGGATGTCTCC

Col1α1 NM_007742.4 CGGAGAAGAAGGAAAACGAG CTTCACCAGGAGAACCTTTGG

Col6α1 NM_009933.4 GAAAAAGGAGAGGCCGGTGATGAA GTCCAATGGGGCCAGCCTCAC

DCN NM_007833.6 CTGGACCTGCAAAACAACAA CGTTCCAATTTCACCAAAGG HPRT NM_001034035 GATTAGCGATGATGAACCAGGTT TCCAAATCCTCGGCATAATGAT

IL-1β NM_008361.4 GAAAGACGGCACACCCACC AGACAAACCGTTTTTCCATCTTC

LUM NM_008524 TGCTCGAGCTTGATCTCTCC GCGCAGATGCTTGATCTTGG

Myh4 NM_17884 ACCAGAGCTTATTGAGATGCTT AGCTTGTAAATGGCCACCTTT

Myh1 NM_17879 GCTTCAAGTTTGGACCCACG GGCTTGTTCTGAGCCTCGAT

Myh7 NM_140781 AGCATTCTCCTGCTGTTTCCTTAC AAGCCCAGGCCTGTAGAAGAG

Myh2 NM_17882 AAGCTCCAAGGACCCTCTTATT TTCCCTGCATCTTTGCTCTGA

MyoD NM_010866.2 TTTGCCAGAGCAGGAGCCCCTC TTCGAACACCTGAGCGAGCGC

NF-kβ1 NM_008689 GTAACAGCAGGACCCAAGGA TCCGCCTTCTGCTTGTAGAT

NLRP3 NM_145827 AGAGCCTACAGTTGGGTGAAATG CCACGCCTACCAGGAAATCTC P2RX7 NM_001038839 GAGTATCCCAGGCGCGGTGC AGTGCAGGTCGGGGAGCTTCT

Pax7 NM_011039.2 GAGTTCGATTAGCCGAGTGC CGGGTTCTGATTCCACATCT

PPARGC1A NM_19017 AGCCGTGACCACTGACAACGAG GCTGCATGGTTCTGAGTGCTAAG

TLR2 NM_011905 TCCGAATTGCATCACCGGTCAGA AGACCTGGAGCGGCCATCACA

TNF NM_013693 CAAATGGCCTCCCTCTCAT TGGGCTACAGGCTTGTCACT

VEGFA NM_22339 CCAGCGAAGCTACTGCCGTCCA ACAGCGCATCAGCGGCACAC Hspg2 NM_001081249 ACCAAGGAGAAGTTCGAGCA CTTCCCAGGTAGCCAAATCA

2.4.4. Quantitative RT-PCR Analysis Quantitative RT-PCR data was expressed as the mean of normalised expression, which meant that linear levels of transcript were presented normalised to the housekeeper (330).

The formula used to calculate normalised expression was (Ax) / (By).

A was the efficiency of amplification of the housekeeper, B was the efficiency of the gene of interest, x was the housekeeper Ct and y was the gene of interest Ct (118). The cycle threshold (Ct) was defined as the cycle at which the fluorescence of the amplicon was detectable. Amplicon Cts were derived from the Light Cycler program.

2.5. Muscle protein analysis

2.5.1. Protein extraction Frozen muscles were powdered using a pestle and mortar, with extreme care taken to minimise thawing. The pestle and muscle samples were kept on dry ice, while liquid nitrogen was poured into a chamber below the mortar. The muscle sample was then placed into the chilled mortar and powdered with the pestle. The contents of the mortar were then poured into a pre-chilled 1.5mL Eppendorf, and placed on dry ice. A complete protease inhibitor tablet (Roche, Australia) was dissolved in 10mL of RIPA Lysis Buffer (cat # R0278, Sigma) and kept cold on wet ice. The volume of RIPA buffer used was dependent on the muscle mass, but as a guide approximately 500L and 200L were used for the TA and solei muscles respectively. Samples were then homogenised using a T10 IKA homogeniser. The homogeniser probe was washed in Milli-Q and 70% ethanol between samples. Protein samples were then stored at -80°C ready for quantification.

2.5.2. Protein quantification Protein concentrations were measured using a 2D protein quantitation kit (GE Life Sciences, cat# 80-6483-56). A standard curve consisting of 0g/mL, 10g/mL, 20g/mL, 30g/mL, 40g/mL, and 50g/mL was setup from a 2mg/mL stock BSA solution. Duplicates (10L) of each protein sample were aliquoted into 2mL microtubes. A 500L volume of component UPPA-I was added to each standard and protein sample and then vortexed. An additional 500L of component UPPA-II was added to each tube, vortexed and spun at 14,000g for five minutes. The supernatant was discarded.

A 1:5 working solution of the GE Copper Solution was prepared, added to all samples and vortexed to help resuspend the pellet. Working Colour solution A was diluted 1:100 with Working Colour Reagent B to create an AB working copper solution. A 1mL volume of the AB working copper reagent was added immediately to each tube, mixed by inversion and left to incubate for 20 minutes at room temperature. A 100L aliquot of each standard and sample was pipetted, in duplicate, into a 96 well plate. The absorbance was read at 490nm using Gen5 on the Biotek Synergy 2 Spectrophotometer (Winooski, USA). After calculating a standard curve, the protein concentration for each sample was calculated (duplicates averaged) and expressed in g/L.

2.5.3. Chondroitinase treatment Muscle samples were deglycosylated with chondroitinase ABC to remove glycosaminoglycan side chains, thus allowing for immunoblotting of the versican core protein. Chondroitinase ABC (cat # E1028-02, AMS Biotechnology Europe Ltd) was made up 1:5 in C1 buffer (50mM Tris

HCl, pH 8, 50mM C2H3NaO2, and a protease inhibitor tablet (Roche, Australia)). For example, for 50L protein samples; 24L of chondroitinase ABC was added to 96L of buffer, of which 5L was required per sample. The reaction was performed in a thermomixer (Eppendorf) set to 400rpm at 37°C for 17 hours.

2.5.4. SDS-PAGE The quantity of protein prepared was dependent on the sample and experiment, but typically consisted of 5μg of protein, 1X NuPAGE® LDS Sample Buffer, 50mM of dithiothreitol (DTT), in 20μL. Samples were heated at 65°C for 10 minutes. Next, 1D electrophoresis was performed using BOLT 4-12% Bis-Tris 12-well precast gels (Life Technologies, Australia), and run in 3-(N- morpholino) propanesulfonic acid (MOPS) buffer (Life Technologies, Australia). Electrophoresis was performed at 120 volts for approximately 90 minutes, with some variations depending on the experiment.

2.5.5. Silver and coomassie staining Silver staining was used for proteomic experiments as it is a more sensitive method of protein detection compared to coomassie (331). Following SDS-page, the gels were silver stained to compare the abundance of WT and KO proteins prior to LC-MS/MS. All staining and wash steps were performed on a rocker. The gel was fixed for 30 minutes (50% methanol, 12% acetic acid, 0.05% formaldehyde), and then washed three times in 100mL of 35% ethanol for 10 minutes each. Gels were incubated for two minutes in sensitising solution (freshly prepared 0.02%

Na2S2O3), accompanied by gentle agitation, followed by three more Milli-Q washes. The gels were incubated for 20 minutes in chilled silver stain (0.2% AgNO3, 0.076% formaldehyde), and then washed two times in Milli-Q. To develop the gels, an initial 50mL of chilled developer was added (5% Na2CO3, 0.05% formaldehyde, 0.0004% Na2S2O3), followed by a second 50mL volume. Development was stopped by adding 100mL of stop solution (50% methanol, 12% acetic acid), with care taken to avoid yellow backgrounds and over-development (331).

Protein gels were also stained using Coomassie Brilliant Blue for one hour at room temperature on the rocker (332). The coomassie staining solution was made by dissolving 0.05% (w/v) of Coomassie Brilliant Blue R-250 (cat # 161-0400, Biorad) in a solution of 50% (v/v) methanol, 10% (v/v) acetic acid, and 40% (v/v) Milli-Q. After one hour, the gels were placed in a de-stain solution consisting of 20% (v/v) methanol, 10% (v/v) acetic acid, and 70% (v/v) Milli-Q. Gels were left to de-stain on the rocker overnight, with fresh de-stain solution added in the morning. The coomassie and silver stained gels were scanned using a GE Labscanner III.

2.5.6. Western blots Proteins were resolved by SDS-PAGE and transferred onto methanol-activated Polyvinylidene fluoride (PVDF) membranes (cat # IPVH00010, Merck Millipore) using the Biorad Criterion setup at 80V for 55 minutes at 4°C. Membranes were blocked for two hours in 10% non-fat skim milk powder dissolved in Tris-buffered saline containing 0.1% Tween-20 (TBS-T). The primary antibody was diluted in TBS-T and added to the membrane overnight at 4°C. The next morning the membrane was washed with TBS-T three times for 5 minutes, before the secondary antibody (diluted in TBS-T) was added and the membrane was incubated for one hour at room temperature. The primary and secondary antibodies used for Western blotting are presented in Table 2.6. Following secondary antibody incubation, membranes were washed with with TBS-T three times for 5 minutes, followed by the addition of enhanced chemi-luminesence Western blotting analysis system reagents (GE Healthcare, New Jersey, USA). Following development, membranes were visualised using the GE ImageQuant LAS 4000 system. The density of the bands were analysed in Image J using the following protocol: http://lukemiller.org/index.php/2010/11/analyzing-gels- and-western-blots-with-image-j/.

Table 2.6 Antibodies used for Western blotting

Name Cat number Dilution Species Isotype Manufacturer Versican V0/1 PA1-1748A 1/1000 Rabbit IgG Fisher (DPEAAE) primary Vinculin V9131-100UL 1/2000 Mouse IgG Sigma-Aldrich primary HRP secondary 18-8817-30 1/5000 Mouse IgG Jomar Life Research HRP secondary 7074S 1/5000 Rabbit IgG Genesearch

2.6. Statistics All data was graphically represented as the mean ± the standard error of the mean (SEM) and sample size (n) is reported for all experiments. Graphpad Prism (Graphpad Software Inc., La Jolla, USA) was used to perform statistical tests of significance. A 95% confidence interval was accepted where P ≤ 0.05 was deemed significant. An unpaired 2-tailed Student’s t-test was used to compare the mean and error of data where only two groups were analysed. Prior to the Student’s t-test, mean normalised expression between groups was analysed using the Kolmogorov-Smirnov test to assess the normality of the data. The muscle fatigue data in Chapter 5 was analysed by two- way ANOVA with Tukey’s multiple comparison test, and presented as mean ± SEM. The recovery component of the fatigue protocol was analysed by unpaired 2-tailed Student’s t-test and presented as mean ± SEM.

3. ADAMTS5 expression and activity in postnatal skeletal muscle 3.1. Introduction Skeletal muscle is composed of syncytial myofibres, which are created during myogenesis by the fusing of neighbouring myoblasts. Myofibres appear around embryonic days 12-14 (333), with the neuromuscular junction forming at E16-17 (334). Morphometric analysis of mice between the ages of P7 and P56 (adulthood) has shown that an increase in fibre size (hypertrophy) is the predominant mechanism responsible for postnatal murine muscle growth (179, 335). Early hypertrophy occurs through a rapid increase in the number of myonuclei, which are supplied by resident muscle satellite cells (179). The later stages of muscle growth are controlled by the IGF1- Akt-mTOR pathway, which helps regulate the overall rates of protein synthesis and degradation (178).

Embryonic cells are surrounded by a transitional pericellular matrix consisting of hyaluronan, and proteoglycans such aggrecan and versican. The gene expression of proteoglycans is elevated during this period, where they are believed to modulate the activity of cytokines, proteinases, cell adhesion molecules, and growth factors, as well as aiding in cell adhesion and migration (88, 306). Heparan- chondroitin- and dermatan-sulphate proteoglycans are all expressed in muscle, but for the purposes of this thesis versican, decorin, biglycan and lumican will be discussed as they are known proteolytic targets of ADAMTS5 (93, 336-338). Versican is a large chondroitin- sulphate proteoglycan expressed early in myogenesis, while the small leucine-rich proteoglycan decorin appears later (106). Decorin is the most highly expressed proteoglycan in skeletal muscle (339), where it helps regulate myoblast density by inhibiting migration and facilitating differentiation (340). Biglycan expression is lower in adult skeletal muscle, but is upregulated in the newly formed myotubes of regenerating muscle (125).

The gene expression of metalloproteinases is also elevated during embryogenesis (306). In muscle development, the balance between matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinases (TIMPs) helps determine myoblast migration and differentiation (341). In a wound healing assay performed in the C2C12 myoblast cell line, MMP-1 stimulated myoblast migration by increasing N-cadherin and β-catenin expression (342). The precise manner by which metalloproteinases facilitate myoblast differentiation is unknown, but it has been proposed that their proteolytic activity may help remove ECM components that hinder cell membrane fusion (343). ADAMTS5 is another metalloproteinase that has been implicated in the clearance of matrix proteins to facilitate muscle development (1).

ADAMTS5 is a proteoglycanase with proteolytic activity towards the hyalectan group of chondroitin-sulphate proteoglycans, namely; aggrecan, versican, brevican, and neurocan (87). ADAMTS5 is expressed in dermal fibroblasts, where its cleavage of proteoglycans is believed to be important for maintaining an optimal ECM content (95). Fibroblasts isolated from the dermis of Adamts5-/- mice contain more full length versican in their ECM than fibroblasts from WT mice (95). The accumulation of versican was taken to reflect reduced proteolytic processing. This was confirmed using antibody detection of cleaved (DPEAAE) versican, where the amount of DPEAAE was significantly reduced in Adamts5-/- mice (95, 104, 110, 174, 175). Neo-epitope detection of DPEAAE has become a major tool for studying the proteolytic activity of ADAMTS5.

Initial interest in ADAMTS5 during myogenesis arose from β-galactosidase staining showing Adamts5 promoter activity in developing skeletal muscle and nerves at E16.5 (2). Subsequent work reported elevated expression of Adamts1, Adamts4, Adamts5, and Adamts15 in mouse muscle at E15.5, which is a critical time point where myoblasts migrate and fuse to form myotubes (1). Significantly, the expression of Adamts5 at E15.5 correlated with an elevated expression of versican (V0/1) (1). This work went on to investigate muscle development in three and seven week old KO mice, where the presence of centrally located nuclei in KO muscle was interpreted as a sign of delayed muscle growth (1). However, the significance of this result is unclear as centrally located nuclei are a marker of muscle damage (327), rather than muscle growth.

Stupka et al used siRNA to investigate the myogenic effects of Adamts5 knockdown in the C2C12 cell culture model. They demonstrated that ADAMTS5 activity is involved in myoblast fusion in vitro (1). This work also investigated the effect of Adamts5 ablation on versican processing in embryonic and postnatal muscle. In embryonic muscle, the absence of Adamts5 did not inhibit versican processing, which suggests that other versican-cleaving proteinases may be compensating (1). This was not the case postnatally, where a significant reduction in versican processing was observed in KO muscle compared to WT (1).

As mentioned, Adamts5 expression and activity has been implicated in myoblast fusion and myotube formation. However, nothing is known about its postnatal functions. The lack of an overt myopathy in Adamts5-/- mice has been attributed to compensation by other versican-cleaving proteinases (1). Therefore, this thesis investigated postnatal muscle growth and function in adult WT and Adamts5-/- (KO) mice, as well as the expression and activity of Adamts5. Further information regarding Adamts5 expression and activity was gleaned from fibroblasts that were isolated and cultured from WT and KO muscle. Characterising the role of ADAMTS5 in healthy muscle also served as a control for the mdx mouse model of muscular dystrophy, which will be discussed in Chapter 5.

3.2. Results

3.2.1. Fibroblasts express Adamts5 in the muscle ECM To determine where Adamts5 was expressed in muscle and which cells were responsible for producing it, muscle sections from WT and KO mice were stained with X-gal. X-gal tests for the presence of β-galactosidase, an enzyme produced from the lac-Z gene. As KO mice contain a nuclear-targeted Lac-Z reporter inserted in place of exon 2 of the Adamts5 gene, positive staining signifies sites of Adamts5 promoter activity. Positive X-gal staining was detected in the perimysium and endomysium of KO muscle (Figure 3.1A), thus confirming the KO genotype. The perimysial and endomysial staining pattern, combined with the lack of staining inside myofibres (Figure 3.1B) suggested that ADAMTS5 was being produced by fibroblasts in the ECM.

Previous work showed that dermal fibroblasts were capable of producing Adamts5 (95). Fibroblasts were extracted from the hind-limb muscles of WT and KO mice and stained with X- gal to investigate whether fibroblasts were responsible for producing ADAMTS5. Positive X-gal staining was detected in KO fibroblast cultures only (Figure 3.1C), with no staining detected in the myoblast cultures (Figure 3.1D). This data confirmed that fibroblasts in the muscle ECM were responsible for producing ADAMTS5. Quantitative RT-PCR analysis using RNA extracted from WT fibroblasts further demonstrated that Adamts5 was expressed by fibroblasts (Figure 3.1E).

Figure 3.1 Adamts5 is expressed by fibroblasts in the endomysium and perimysium of skeletal muscle

(A) X-gal staining from the soleus muscle of 12 week old WT and KO mice; (B) Higher magnification image of X-gal staining in KO muscle (arrow indicates perimysium); (C) Fibroblasts extracted from the hind-limb muscles of 4 week old male WT and KO mice. The fibroblasts (P4) were grown for 7 days and then stained with X-gal - note that positive staining was detected in KO fibroblasts only; (D) X-gal staining in KO myoblast cultures (image courtesy of Chris Kintakas); (E) Fibroblast Adamts5 gene expression presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, n = 3).

3.2.2. Adamts proteinase gene expression in WT and KO muscle After confirming the expression of Adamts5 in fibroblasts, the expression of other Adamts family members were characterised in skeletal muscle to determine if there was any compensatory upregulation of Adamts proteinases in KO mice. Previous work has demonstrated a functional overlap between Adamts9 and Adamts20 expression during palate formation (344), but it is unknown whether a similar relationship exists between Adamts5 and other members in skeletal muscle. In embryonic muscle, it has been proposed that Adamts15 is able to compensate for the absence of Adamts5 (1).

The gene expression of Adamts1, Adamts4, Adamts5, Adamts9, and Adamts15 were profiled as they all share substrate specificity for versican (100-103). Adamts1 displayed the highest expression in WT and KO muscle, while the lowest expression was observed for Adamts4. The genetic ablation of Adamts5 did not affect the gene expression of Adamts1, Adamts9, or Adamts15. A small, but significant 3-fold upregulation in Adamts4 expression was observed in the TA muscle of KO mice (Figure 3.2).

Figure 3.2 Gene expression of Adamts proteinases in WT and KO muscle from 12 week old male mice

Gene expression presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM *, p < 0.05, n = 5). Adamts4 was the only gene upregulated in the absence of Adamts5. Note the different y-axis scales to emphasise the relative difference in expression.

3.2.3. Proteoglycan gene expression in WT and KO muscle The gene expression of known proteoglycan targets of ADAMTS5 were analysed in WT and KO muscles. The two groups did not differ in their expression of versican, lumican, biglycan, or decorin at 12 weeks of age (Figure 3.3). In WT and KO muscle the highest expression was observed for decorin, and the lowest for versican.

Figure 3.3 Gene expression of proteoglycans in WT and KO muscle from 12 week old male mice

Gene expression of versican (Hspg2), lumican (LUM), biglycan (BGN), and decorin (DCN) presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, n = 5). No significant differences were observed between WT and KO muscles.

3.2.4. ADAMTS5 is a major versicanase in skeletal muscle After investigating the expression pattern of Adamts proteinases and their proteoglycan targets, the proteolytic processing of versican was investigated. As mentioned previously, ADAMTS1, ADAMTS4, ADAMTS5, ADAMTS9, and ADAMTS15 have overlapping substrate specificity for versican (100-103). After observing minimal compensation in the expression of other Adamts proteinases in KO muscle, the proteolytic processing of versican was investigated. Neo-epitope antibody detection of the cleaved G1-DPEAAE form of versican was utilised as a readout of ADAMTS proteolytic activity, with differences between WT and KO mice attributable to ADAMTS5. Immunoblotting and immuno-histochemical techniques both detected less DPEAAE in KO muscle compared to WT muscle (Figure 3.4). This demonstrates that versican cleavage in muscle is significantly reduced by the absence of Adamts5.

Figure 3.4 Proteolytic processing of versican in WT and KO skeletal muscle

(A) Immunoblots of whole muscle soleus extracts from 12 week old male mice using the versican V0/V1 (DPEAAE) neo-epitope antibody. 10µg of protein was loaded. Below: an anti-vinculin loading control for all samples; (B) Relative density of WT and KO DPEAAE bands adjusted to vinculin loading control (n = 3, ** p < 0.01); (C) Immuno-histochemical V0/V1 (DPEAAE) neo- epitope antibody detection in TA muscle sections from 12 week old male mice.

3.2.5. Adamts5 ablation does not affect postnatal muscle growth As previous work suggested that ADAMTS5 was required for myoblast fusion (1), this study aimed to investigate the effect of Adamts5 ablation on postnatal muscle growth. To test this, the body masses of WT and KO mice were monitored from 6 to 12 weeks of age. No significant difference in body mass was evident over this age range (Figure 3.5A). Muscle mass and myofibre size were also analysed to provide information regarding postnatal muscle growth. No differences were observed in the muscle masses of the EDL, soleus, TA, or hearts of WT and KO mice at 12 weeks of age (Figure 3.5B). Myofibre size, measured from the minimal Feret’s diameter, was not different between the two groups (Figure 3.5C). A previous study proposed that the presence of centrally located nuclei in the muscles of 3 and 7 week old KO mice was a sign of delayed muscle growth (1). Figure 3.5D shows that no centrally located nuclei were observed in either group at 12 weeks of age. Taken together, these results demonstrate that ADAMTS5 is not required for postnatal muscle growth.

Figure 3.5 Adamts5 ablation does not affect postnatal muscle growth

(A) Body mass of WT and KO mice from 6 to 12 weeks of age (n = 13); (B) Masses of the EDL, soleus, TA and heart from 12 week old mice normalised to body mass (n = 9); (C) Muscle fibre size measured from the minimal Feret’s diameter of 12 week old male mice (n = 5); (D) The proportion of centrally located nuclei in 12 week old male mice. This proportion was calculated based on the number of myofibres with centrally located nuclei relative to the total number of myofibres (n = 4). The data was analysed by Student’s t-tests and presented as mean ± SEM. No significant differences were observed between the two groups.

3.2.6. Adamts5 ablation does not affect muscle force production A previous study showing Adamts5 expression at the neuromuscular junction (2) suggested that ADAMTS5 may play a role in muscle function. TA muscle function was assessed in WT and KO mice using an in situ muscle contractile system. After determining the optimal muscle length (Figure 3.6A), the absolute isometric tetanic force was measured at 150Hz, and then normalised according to size of the muscle to give the specific force. No differences in either absolute or specific force production were evident between WT and KO muscle (Figure 3.6B and C respectively). The muscle fatigue protocol consisted of 60 maximal tetanic contractions over a 240 second period, followed by a recovery period. No difference in fatigue resistance was evident between the two groups (Figure 3.6D).

Figure 3.6 Adamts5 ablation does not affect muscle function

TA muscle function in 12 week old male WT and KO mice. (A) Optimal muscle length during a maximal twitch contraction; (B) Maximal absolute force at 150Hz; (C) Maximal specific force normalised to muscle mass and cross sectional area at 150Hz; the data was analysed by unpaired Student’s t-test and presented as mean ± SEM (*, p < 0.05, n = 12); (D) The fatigue protocol consisted of 60 maximal contractions every 4 seconds, followed by a recovery period where maximal force was recorded at 1, 2, 3, 5 and 10 minutes post-fatigue. The fatigue data was analysed by two-way ANOVA with Tukey’s multiple comparison test and presented as mean ± SEM (n = 12).

3.2.7. Versican proteolysis and localisation in muscle It is not known if versican remains in the matrix after proteolysis. To answer this question, immuno-histochemical staining was performed using antibodies for full length versican and the DPEAAE cleaved form. The images in Figure 3.7 demonstrates that both forms of versican were detected in pericellular locations around myofibres. Full length versican was expressed strongly in the perimysium, while the DPEAAE appearance was more punctate and concentrated around the endomysium.

Figure 3.7 Localisation of full length and cleaved versican (DPEAAE) around myofibres

Immuno-histochemical detection of full length versican and the versican V0/V1 DPEAAE neo- epitope fragment in TA muscle sections from 12 week old male WT mice. The laminin-α2 myofibre boundaries are depicted in red, versican and DPEAAE in green, and the DAPI stained nuclei in blue.

3.2.8. Spatial versican processing in muscle Figure 3.8 depicts the spatial processing of versican in (A) the endomysium surrounding myofibres, (B) around individual nerve fibres, and (C) around blood vessels. The positive DPEAAE staining around motor nerves and endothelial cells demonstrates that ADAMTS processing of versican is occurring at these locations. The pattern of DPEAAE staining around motor nerves fits with previous X-gal data in the developing neuromuscular junction (345).

Figure 3.8 Spatial processing of versican in muscle from 12 week old male mice

Positive immunostaining with the versican V0/V1 DPEAAE neo-epitope fragment in TA muscle sections from 12 week old male WT mice. Depicted in this figure is the co-localisation of DPEAAE with (A) laminin-α2 around myofibres; (B) laminin-α2 around nerve fibres; and (C) the endothelial cell marker Cd31, around blood vessels.

3.3. Discussion Adamts5 is expressed in embryonic and postnatal skeletal muscle (2, 3), but its functional role in muscle is unknown. Muscle growth and function in adult WT and KO mice were investigated in this chapter. Another focus was the versicanase activity of ADAMTS5, as it has been proposed to be involved in the ECM remodelling of embryonic muscle. The gene expression of other Adamts proteinases were investigated to determine if any compensatory upregulation occurs in the muscles of KO mice.

3.3.1. ADAMTS5 is not required for postnatal muscle growth A putative important role for ADAMTS5 in embryonic muscle development was postulated by Stupka et al (1), who interpreted the presence of centrally located nuclei in three and seven week old KO muscle as a sign of delayed muscle growth (1). Aside from questioning the significance of reporting central nuclei as a parameter of muscle growth, no mention was made of the number of animals or the muscle type used for the central nuclei counts (1). In this thesis no centrally located nuclei were observed in the muscles of sedentary 12 week old WT or KO mice. The role of ADAMTS5 in postnatal growth was also investigated based on the body mass, muscle mass, and muscle sizes of 12 week old WT and KO mice. No differences were observed between the two groups in any of these growth parameters. This data demonstrates that ADAMTS5 is not required for postnatal muscle growth.

3.3.2. Other ADAMTS members do not compensate for the absence of ADAMTS5 After observing no difference in the postnatal growth of KO muscle, qRT-PCR was performed to test for a compensatory upregulation in the expression of another Adamts member. In embryonic muscle, it has been proposed that Adamts15 can compensate for the absence of Adamts5 (1). However, only the expression of Adamts4 was upregulated in KO muscle. Based on the significantly impaired versicanase activity in KO muscle, it appears that this modest upregulation in Adamts4 expression does not compensate for the absence of Adamts5. This data suggests that minimal cooperative compensation exists amongst these Adamts versicanases in postnatal skeletal muscle.

3.3.3. ADAMTS5 is the major versicanase in muscle During myogenesis, it has been suggested that ADAMTS proteinases are able to proteolytically compensate for the absence of other members (2, 104). The minimal upregulation of other Adamts members in KO muscle suggested that versican processing might be impaired in these mice. ADAMTS proteolytic activity was evaluated using the DPEAAE neo-epitope antibody. It was

76 demonstrated that versican cleavage was greatly reduced by the absence of ADAMTS5 in KO muscle. Therefore, the small increase in Adamts4 expression in KO muscle was not sufficient to compensate for the loss of ADAMTS5 activity. This result, when combined with the gene expression data, demonstrates that despite the same amount of versican being produced, less was cleaved in KO muscle. Taken together these results strongly suggest that ADAMTS5 is the main ADAMTS responsible for versican cleavage in muscle.

3.3.4. Adamts5 ablation does not affect muscle force production The expression of Adamts5 and its proteoglycan targets have been localised to the neuromuscular junction (2, 38, 124, 346). As this location is critical for excitation-contraction coupling, TA muscle function was compared in WT and KO mice. Muscle function was assessed based on force producing capacity and fatigue resistance, with no differences evident between WT and KO mice. This result demonstrates that ADAMTS5 is not critical to the force-producing capacity of skeletal muscle. It is important to note that despite supramaximal stimulation, differences in transmission cannot be ruled out according to the neuromuscular junction patency effect.

3.3.5. Spatial versican processing It has previously been shown that cleaved versican remains in the matrix following proteolytic processing (1). This thesis supports these findings by showing that cleaved (DPEAAE) and full length versican are localised to similar areas of the ECM. This observation makes intuitive sense as the DPEAAE antibody is specific for the new C-terminus of versican fragments created by the cleavage of full length versican at Glu441-Ala442 in the GAG-β region. The GAG- β region is located at the N-terminal G1-domain of versican, which is anchored to the ECM via its binding to hyaluronan (92). Therefore, it appears that both cleaved and uncleaved forms of versican remain bound to hyaluronan within the matrix. The endomysial and perimysial DPEAAE staining also fits with the location of Adamts5 promoter activity indicated by X-gal histochemistry.

However, the ratio of DPEAAE and full length versican does not take into consideration cleavage by other proteinases. ADAMTS1, ADAMTS4, ADAMTS5, ADAMTS9, and ADAMTS20 all cleave versican (100-103). In addition, it has been proposed that matrilysin, plasmin, MMPs, serine and cysteine proteases are all capable of cleaving versican (347-351), although their proteolytic activity in muscle is unknown. These cleavage events are unlikely to be specific for Glu441-Ala442 in the GAG-β region of versican. However, cleavage at sites towards the N-terminal of Glu441-Ala442 will affect the amount of GAG-β versican available for subsequent ADAMTS processing.

Versican processing around nerves and blood vessels was visualised using immuno-histochemical staining of WT muscle. Adamts5 expression has previously been localised to the neuromuscular

77 junction in developing muscle (2), while cleaved versican (DPEAAE) fragments have been shown to associate with endothelial cells (5). These results point to the possibility that ADAMTS proteinases may play a role in ECM remodelling at the neuromuscular junction and in the formation of new blood vessels (angiogenesis). Future studies will use α-bungarotoxin in conjunction with DPEAAE to stain the neuromuscular junction.

3.4. Conclusion This chapter showed that ADAMTS5 is made by fibroblasts in the perimysium and endomysium surrounding myofibres. It was also demonstrated that ADAMTS5 is the major versicanase in muscle, but the functional significance of this remains unknown. Adamts5-/- mice did not present with any abnormalities in terms of postnatal growth or muscle strength, thus refuting the hypothesis that ADAMTS5-versican processing is required for postnatal muscle development. Another significant finding was the processing of versican by ADAMTS proteinases around nerve fibres and blood vessels of WT mice. These results suggest that further functional tests are required to tease out the role of ADAMTS5 in terms of neuromuscular signalling and angiogenesis in muscle. To address these questions WT and KO mice were exercised and the results are presented in Chapter 4.

4. ADAMTS5 is required for exercise- induced muscle adaptations 4.1. Introduction The aim of this chapter was to investigate whether ADAMTS5 expression and activity affects the ability of muscle to adapt to exercise. Immunostaining from Chapter 3 suggest that ADAMTS5 may be involved in neuromuscular signalling and angiogenesis in muscle. It was hypothesised that challenging homeostasis through exercise would elicit phenotypic differences between WT and KO mice. Voluntary wheel exercise was utilised as a tool for investigating how changes in ECM processing affect the ability of muscle to adapt to exercise.

Muscle adapts to exercise through changes at the myofibrillar, angiogenic and neuromuscular levels, with the changes dependent on the metabolic demands of the activity. In endurance exercise, the pattern of nerve impulses delivered to the muscle increases the expression of genes related to the slow fibre type program (183). This induces a fast to slow switch in the expression of myosin heavy chain (MYHC) isoforms, as well as an increase in angiogenesis (182). At the neuromuscular junction, endurance exercise increases nerve terminal branching (352, 353). Endurance exercise also significantly increases the diameter of α-motoneurons in the soleus muscle of rats (354). Five days of voluntary wheel exercise increases the size of dendritic arbors (355), although the functional significance of such changes in motoneuron morphology have subsequently been questioned (356).

ECM turnover in healthy muscle is maintained by the basal expression of proteinases. However, when homeostasis is challenged by stimuli such as exercise, injury, or disease, a greater level of ECM turnover is required. Skeletal muscle adapts to exercise at the myofibrillar and angiogenic level, but the impact of ECM remodelling on these adaptations remains relatively unexplored. It is known that the basement membrane is reorganised during exercise-induced remodelling of human capillaries, with ECM proteases implicated in the process (357). MMP activity is required for activity-induced angiogenesis in rat skeletal muscle, because MMP inhibition prevented basement membrane remodelling and the growth of new capillaries (202).

A variety of MMPs are upregulated in humans and rats during exercise (6-8). Interestingly, the intensity of the endurance exercise influences the degree of MMP upregulation, with the changes occurring predominantly in fast twitch muscle fibres (8). In another study, a cohort of middle aged men performed endurance and strength training over a 12 week period, with the resultant changes in ECM gene expression analysed (201). Of the 289 genes that were upregulated following long term training, 20% were ECM related. The majority of proteoglycans expressed

79 in muscle were upregulated following exercise, as was Adamts4, which increased 18.9-fold (201). However, this thesis is the first investigation of ADAMTS5 in exercised muscle.

The DPEAAE immuno-histochemical staining from Figure 3.8 demonstrated that versican was processed by ADAMTS proteinases around endothelial cells and motor nerves in WT muscle. Given that angiogenic and neuromuscular pathways are essential for muscle adaptations to exercise, it was hypothesised that ADAMTS5-mediated ECM remodelling may be involved in the process. This chapter investigates the effect of exercise on the expression and activity of ECM proteins and Adamts proteinases. The ability of muscle to adapt to exercise was also assessed from myofibrillar and angiogenic changes in WT and KO mice.

4.2. Results

4.2.1. Voluntary wheel exercise in WT and KO mice Voluntary wheel exercise was used to study exercise-induced muscle remodelling. Nine week old WT and KO mice were housed for three weeks in cages that contained an in-built exercise wheel. The mice were given one week to acclimatise to the wheels, after which exercise related parameters were recorded for the final two weeks of exercise. As the exercise was voluntary, not all mice ran over the two week period. To standardise the exercise performed by both groups, any mouse that ran under 1km/day for more than three consecutive days was excluded from the study. Over the two week recording period no difference was observed between WT and KO mice in either the daily distance or the total distance run (Figure 4.1A and B).

Note: in figures sedentary and exercised mice will be referred to as Sed and Ex respectively.

Figure 4.1 Analysis of voluntary wheel exercise in WT and KO mice from 12 week old male mice

(A) Daily distance run over the two week recording period; (B) Total distance run over the two week recording period. The data was analysed by unpaired Student’s t-test and presented as mean ± SEM (n = 6). No significant differences were observed between the two groups.

4.2.2. The effect of exercise on postnatal growth in WT and KO mice The body masses of WT and KO mice decreased following three weeks of voluntary wheel exercise (Figure 4.2A). No difference was observed between WT and KO mice in terms of their absolute muscle masses (Figure 4.2 B), but when normalised to body mass, the relative muscle mass of the soleus, TA, and heart of WT mice increased with exercise (Figure 4.2C). The soleus muscle of exercised KO mice showed a small increase in relative mass compared to sedentary KO mice, but no changes were observed in the other muscles examined. The EDL muscle of WT mice displayed a significant reduction in fibre size with exercise (Figure 4.2D), while the TA muscle of both WT and KO mice exhibited non-significant decreases (WT: p = 0.057, KO: p = 0.054). Satellite cell activation has been proposed as a mechanism for exercise-induced muscle growth (358). Exercise-induced activation of satellite cells was investigated by analysing the gene expression of Pax7 in WT and KO muscles. The expression of Pax7 was significantly increased following exercise in the EDL and solei muscles of WT mice, while only the EDL of KO mice displayed a significant increase in Pax7 expression (Figure 4.2E).

Figure 4.2 The effect of voluntary exercise on postnatal growth in 12 week old male WT and KO mice

(A) Body mass of sedentary (sed) and exercised (ex) WT and KO mice (n = 6); (B) Absolute masses of the EDL, soleus, TA, and heart muscles from sedentary and exercised WT and KO mice (n = 6); (C) Masses of the EDL, soleus, TA, and heart muscles normalised to body mass ; (D) The fibre size of the EDL, soleus, and TA muscles was measured from the minimal Feret’s diameter (n = 5); (E) Pax7 gene expression presented as mean normalised expression (MNE) relative to the house keeper gene HPRT (n = 5). The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (*, p < 0.05, **, p < 0.01, ***, p < 0.001).

4.2.3. The effect of exercise on Adamts gene expression Before investigating the role of ADAMTS5 in exercise-induced remodelling, it was important to examine the effect of exercise on Adamts gene expression (Figure 4.3). In both WT and KO muscle, exercise decreased the expression of Adamts1 and Adamts9. The gene expression of Adamts4 was increased in the soleus muscle of WT mice after exercise, while Adamts5 expression was increased in the soleus and TA muscles of WT mice after exercise. However, it is important to note that the baseline (sedentary) expression of Adamts5 in WT mice was far greater than that of Adamts4, as was the magnitude of upregulation following exercise. Interestingly, exercise did not upregulate any Adamts members in KO muscle.

Figure 4.3 The effect of exercise on Adamts expression in WT and KO muscle from 12 week old male mice

4.2.4. Exercise increases proteoglycan gene expression The gene expression of ADAMTS5 proteoglycan targets were investigated in WT and KO muscle following exercise. Exercise increased the expression of versican in the soleus muscle of WT mice only (Figure 4.4). The muscle expression of lumican was upregulated by exercise in both WT and KO mice. Biglycan gene expression was upregulated following exercise only in the WT soleus muscle. In comparing the different muscle types, the soleus muscle displayed the largest changes in proteoglycan expression with exercise.

Figure 4.4 Exercise increases the gene expression of proteoglycans in WT and KO muscle from 12 week old male mice

Gene expression of versican (Hspg2), lumican (LUM), biglycan (BGN), and decorin (DCN). Gene expression presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, *, p < 0.05, ***, p < 0.001, n = 5).

4.2.5. Exercise does not increase versican processing in muscle In Chapter 3 it was shown that ADAMTS5 is the main proteinase responsible for versican processing in muscle. Based on the upregulated muscle expression of Adamts5 in exercised WT mice, it was hypothesised that versican processing would be increased by exercise. The amount of versican processed was analysed by DPEAAE immunoblotting (Figure 4.5A). Despite appearing increased in exercised WT mice, when adjusted to the vinculin loading control, the DPEAAE density of exercised samples were not greater than sedentary mice (Figure 4.5B). As was reported in Chapter 3, the DPEAAE density in KO muscles was significantly lower than WT.

Figure 4.5 The effect of exercise on versican processing in WT and KO soleus muscles from 12 week old male mice

(A) Immunoblotting of whole muscle solei extracts from 12 week old male mice using the versican V0/V1 (DPEAAE) neo-epitope antibody. 10µg of protein was loaded. The anti-vinculin loading control is displayed below for all samples; (B) Relative density of WT and KO DPEAAE bands adjusted to the vinculin loading control. The data was analysed by unpaired Student’s t- tests (mean ± SEM, **, p < 0.002, n = 3).

4.2.6. Exercise-induced MYHC adaptations in WT and KO muscle Muscle adapts to endurance exercise through changes in muscle fibre type and angiogenesis. In this study, adaptations were quantified by immuno-histochemical staining of muscle sections using antibodies for MYHC isoforms and the endothelial cell marker, CD31. Normal endurance exercise adaptations involve switching from glycolytic to more oxidative fibre types, as well as an increase in muscle capillary density. Following three weeks of exercise, WT muscle displayed the expected oxidative fibre type shift and increased vascularity, while these adaptations were delayed in KO mice. To investigate these exercise-induced adaptations across the full spectrum of fibre types, the slow-twitch soleus muscle and fast-twitch EDL muscle were profiled.

As a slow twitch muscle, the soleus is characterised by a preponderance of MYHC-1 fibres and minimal fast type fibres. MYHC isoform switching in the solei muscle was assessed using primary antibodies for MYHC-1 and MYHC-2, which were directly labelled using Zenon-594 (red) and Zenon-488 (green) respectively. Fibres that stained positive (orange) for both MYHC isoforms were termed intermediate (MYHC-1/MYHC-2). Following exercise, the proportion of MYHC-1 fibres increased in the solei of WT mice (p = 0.058), with a concurrent decrease in MYHC-2 fibres (Figure 4.6A). The proportion of MYHC-1 fibres did not increase the solei of KO mice (p = 0.448), but changes in MYHC-2 and intermediate fibres were observed. This suggests that following exercise, the switch from fast to slow fibres is delayed in KO muscle, with significantly more fibres being found in the intermediate transition.

Previous work has demonstrated that MYHC-1 is not expressed in the EDL muscles of mice. As this experiment focused on the proportion of fast and slow fibres in the EDL, a MYHC-2a primary antibody was used in combination with an Alexa-488 secondary antibody (green). Any unstained fibres represented a combination of MYHC-2x and MYHC-2b isoforms. The EDL of both WT and KO mice showed a significant increase in the proportion of MYHC-2a fibres following exercise (Figure 4.6C), but the magnitude of the change was far greater in WT (18% to 44%) compared to KO mice (18% to 31%). The concurrent decrease in the proportion of fast MYHC- 2b/x fibres also displayed a similar pattern, with WT proportions changing dramatically with exercise (82% to 56%) and KO mice to a far lesser extent (82% to 69%).

Figure 4.6 Exercise-induced fibre type transitions in WT and KO muscle from 12 week old male mice

All measures were derived from ImageJ quantification of immuno-histochemical staining. (A) Proportion of fibres expressing MYHC-1 only, intermediate (both MYHC-1 and MYHC-2), and MYHC-2 only in the solei muscles of sedentary and exercised WT and KO mice (n = 6); (B) A representative image from the soleus muscle showing MYHC-1 positive fibres in red and MYHC- 2 fibres in green, intermediate fibres stained orange; (C) Proportion of fibres expressing MYHC- 2a and MYHC-2b/x in the EDL muscles of sedentary and exercised WT and KO mice (n = 6); (D) A representative EDL image showing MYHC-1 positive fibres in red and MYHC-2 fibres in green. The data was analysed by unpaired Student’s t-tests (mean ± SEM, *, p < 0.05, **, p < 0.01, ****, p < 0.0001 ).

As the largest fibre type transition was observed in the EDL muscles of WT and KO mice, the gene expression of MYHC isoforms were investigated in the EDL. In support of the immuno- histochemical data from Figure 4.6C, qRT-PCR analysis demonstrated that exercise increased the expression of MYHC-2a and decreased the expression of MYHC-2b in WT mice (Figure 4.7). These changes in MYHC gene expression were not observed in exercised KO mice.

Figure 4.7 Gene expression of MYHC isoforms in the EDL muscle of 12 week old male WT and KO mice

Gene expression of MYHC-1 (Myh7), MYHC-2a (Myh2), MYHC-2x (Myh1), and MYHC-2b (Myh4) presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, *, p < 0.05, n = 6).

4.2.7. Exercise-induced angiogenesis in WT and KO muscle After observing differences in MYHC isoform expression between WT and KO mice, exercise- induced angiogenesis was investigated using CD31 (Platelet endothelial cell adhesion molecule), which is an endothelial cell marker. Capillary density was quantitated from CD31 immuno- stained muscle sections using ImageJ grid analysis. Figure 4.8A demonstrates that the capillary density of EDL and solei muscles from WT mice increased significantly with exercise. In KO muscle, no change in capillary density was observed following the same level of exercise in either muscle type.

Figure 4.8 Exercise-induced angiogenesis in WT and KO muscle from 12 week old male mice

All measures derive from immuno-histochemical quantification using ImageJ grid analysis. (A) Muscle vascularity expressed as the number of capillaries (red CD31 positive staining) relative to an overlayed 300 point grid (n = 5); (B) A representative CD31 image from a soleus muscle. The data was analysed by unpaired Student’s t-test and presented as mean ± SEM. (*, p < 0.05, **, p < 0.01).

4.2.8. Gene expression of metabolic pathways in WT and KO muscle The gene expression of potential downstream pathways were investigated in an attempt to explain the delayed exercise-induced muscle adaptations observed in KO muscle. Vascular endothelial growth factor (VEGF-α), calcineurin, and peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) are all involved in how muscle adapts to exercise. VEGFα is a major pro-angiogenic factor, calcineurin forms part of the NFAT pathway that helps regulate muscle fibre types, and PGC-1α has been implicated as the master regulator of exercise-induced remodelling (183, 185). Interestingly, despite phenotypic differences in their adaptive responses to exercise, none of these genes were upregulated in either group (Figure 4.9). Unexpectedly, the expression of PGC-1α and VEGFα were downregulated in both WT and KO muscle following exercise. This result may be due to the timing of when the mice were sampled. After changes at the protein level, the expression of these factors may be downregulated as part of a negative feedback system. The synchronised downregulation of both factors fits due to the fact that PGC- 1α mediates exercise-induced skeletal muscle VEGF expression in mice (359).

Figure 4.9 The effect of exercise on the gene expression of metabolic genes in WT and KO muscle from 12 week old male mice

Gene expression of (A) Vascular endothelial growth factor (VEGF- α); (B) Calcineurin (PP3ca); (C) Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1a). Gene expression presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, *, p < 0.05, ***, p < 0.001, n = 5). s

4.3. Discussion

4.3.1. ADAMTS5 is involved in how muscle adapts to exercise This chapter investigated how the absence of ADAMTS5 affects the ability of muscle to adapt to exercise. Muscle adapts to exercise through changes in contractile, metabolic, and vascular proteins. The absence of ADAMTS5 affected the expression of MYHC isoforms in exercised soleus and EDL muscles, which was interpreted as a delay in the transition from the fast to slow fibre type programs. The significantly greater proportion of intermediate fibres in the soleus muscles of KO mice appears to reflect this delay from fast to slow fibre types. Fibre typing in the EDL muscle strengthened this result as the switch from MYHC-2a to MYHC-2b/x in KO mice was also delayed.

To ensure that the fibre type proportions were in line with previously published numbers, the sedentary WT data was compared with those of Bloemberg et al. (27), who reported a split of 31% MYHC-1 and 69% MYHC-2 in the soleus muscle, which is similar to the 31% and 67% (with 2% intermediate fibres) observed in this thesis. In the EDL muscle, Bloemberg et al. reported no MYHC-1 fibres, approximately 13% MYHC-2a, 31% MYHC-2x, and 56% MYHC- 2b (87% total for MYHC-2x and MYHC-b). This is again comparable to the 18% MYHC-2a and 82% MYHC-2x/b observed in the sedentary WT mice from this study.

The gene expression of MYHC isoforms in the EDL muscle confirmed the immunostaining result, thus suggesting that the expression of Myhc isoforms was affected by the absence of Adamts5. It is unlikely that ADAMTS5 directly affects Myhc expression, but rather that the absence of its activity produces downstream changes. Previous work has demonstrated that metalloprotease activity influences muscle fibre types. The muscles of Mmp9 KO mice contain significantly more MYHC-2b fibres compared to WT (140). The mechanism responsible was not ascertained, but the neuromuscular expression of Mmp9 was implicated (139).

In Chapter 3 ADAMTS-mediated versican processing was observed around nerve fibres and blood vessels. The relationship between proteoglycan processing and nerves has formed the basis of much research into improving recovery from spinal cord injuries. In particular, chondroitin- sulphate proteoglycans have been shown to inhibit axon growth in vivo. (360). This work showed that the removal of proteoglycan GAG side chains through chondroitinase ABC administration promoted axon regeneration and functional recovery (360). ADAMTS activity may also be involved in spinal cord regeneration, as it has been shown that cleaved versican (DPEAAE) fragments co-localise with blood vessels in injured mouse spinal cords (361).

The absence of ADAMTS5 proteolytic activity in KO muscle may create a versican-rich matrix that is inhibitory for motor neuron-muscle communication. Inhibition of this connection would affect the ability of the muscle to switch to the slow fibre program following endurance exercise. As versican and Adamts5 are upregulated by exercise in WT mice, the absence of ADAMTS5 activity in KO mice may be more profound in exercised compared to sedentary mice. It is not known if this inhibition is specific to endurance exercise, but it would be interesting to modify the exercise regime to activate the fast fibre program and observe if it is affected also.

This chapter demonstrated that the absence of ADAMTS5 inhibits exercise-induced angiogenesis in skeletal muscle. A two-fold increase in capillary density is believed to precede the oxidative fibre type shift that occurs in C57/BL6 mice following four weeks of voluntary running (182). This finding led to the proposal that endurance exercise induces angiogenesis in a subpopulation of MYHC-2b and MYHC-2x fibres, which then act as permissive factors for the subsequent switching to MYHC-2a fibres (182). If changes in vascularity precede fibre type switching, the temporal nature of these adaptations may provide insights into how ECM processing influences muscle adaptations to exercise.

ADAMTS5 contains central and C-terminal thrombospondin domains (167). In vitro work has shown that the central thrombospondin domain of ADAMTS5 inhibits endothelial cell formation (199). Subsequent work demonstrated that the central thrombospondin domain of ADAMTS5 suppressed tumour angiogenesis independently of its proteolytic activity (362). However, this effect was observed in models of cancer, which may not carry over to skeletal muscle. In addition, both pro- and anti-angiogenic roles for ADAMTS1 have been reported (5, 363). It is feasible that ADAMTS5 may also possess a similar duality in terms of its angiogenic functions.

If indeed the thrombospondin domain of ADAMTS5 is critical for angiogenesis, then this could be tested by exercising mice in which only the catalytic domain of Adamts5 is absent. The Adamts5 Δ-cat mouse was created by Cre-mediated excision of the exon encoding for the catalytic domain of ADAMTS5 (155). In theory, only proteolytic activity is ablated in these animals, but the binding capacity of ADAMTS5 is retained. A comparison of sedentary and exercised Adamts5 Δ-cat mice with the current Adamts5 global KO mice would allow the thrombospondin binding versus proteolytic activities of ADAMTS5 to be investigated.

4.3.2. Exercise-induced hypertrophy is absent in KO muscle Voluntary wheel exercise reduces the body mass of C57/BL6 mice (358). This chapter supports this established finding by demonstrating that the body masses of exercised WT and KO mice were significantly lower than sedentary mice. No difference was observed between WT and KO mice in terms of their absolute muscle masses. However, upon normalisation to body mass, both

94 groups displayed significant increases in muscle mass following exercise. Increased muscle growth has previously been observed after three weeks of exercise, with the changes partly attributed to satellite cell activation (358). The gene expression of Pax7 was analysed to investigate the involvement of satellite cell activation, but no correlation with the muscle mass data was observed.

Upon closer inspection, it appears that the increase in relative muscle mass is not due to muscle hypertrophy, but rather a change in the body composition of these mice. The muscle masses haven’t increased with exercise, rather the body masses that they are being normalised to have decreased. This exercise-induced decrease in body mass likely reflects a decrease in the amount of adipose tissue in these mice. Both WT and KO mice appear leaner following exercise, which explains why their relative muscle masses are increased.

The size of individual WT and KO myofibres were reduced by exercise. The reduction in myofibre size that occurs following endurance exercise has been attributed to a shift in muscle fibre type (364). Endurance exercise increases the proportion of smaller oxidative fibres, and decreases the proportion of larger glycolytic fibres. Therefore, it is likely that the decrease in fibre size reflects an increase in oxidative muscle fibres. The dramatic decrease in the size of EDL fibres in WT mice is most likely due to the more pronounced shift from fast to slow fibre types, as was discussed above in Section 4.3.1.

4.3.3. The effect of exercise on gene expression of ECM proteins Exercise-induced remodelling of the ECM results in an upregulation of many ECM proteases (6- 8). In WT muscle, exercise increased the gene expression of Adamts5 and Adamts4. Adamts4 expression has previously been shown to be elevated 18.9-fold in human subjects following acute exercise (201). Intriguingly, no exercise-induced upregulation in Adamts expression was observed in KO mice. As the mechanism responsible for the upregulation of Adamts proteinases in WT mice is unknown, it is not clear how the absence of Adamts5 might inhibit the exercise-induced upregulation of other members in KO mice. It has been proposed that ECM protein changes following exercise reflect reorganisation of the basement membrane, with the degree of remodelling proportional to the severity of the exercise (7). In future experiments it may be informative to compare electron micrographs of the ECM from exercised WT and KO muscle to identify differences in the basement membrane organisation.

In Chapter 3 it was demonstrated that fibroblasts make Adamts5 in the muscle ECM. However, in different contexts, other cell types are capable of producing ECM proteases. In tumour models, VEGF-α is able to induce endothelial cell expression of Adamts1 and Mmp15, which then facilitates degradation of the venular basement membrane (5). Significantly, Mmp2 gene

95 expression has been detected in laser-dissected human muscle fibres (6). As the ECM was absent from these fibres, this demonstrates that myofibres themselves can contribute to the production of ECM proteinases. These findings pose the question as to whether an exercise-induced cell type contributes to the elevated expression of Adamts proteinases following exercise.

The gene expression of versican, lumican, and biglycan were upregulated in WT muscle, while only lumican was up in the KO. A possible reason for the disparity in Adamts gene expression between exercised WT and KO muscle could be proteoglycan expression. One might expect that an increase in the production of the target protein to trigger an increase in the expression of the protease. However, it is also important to consider the fact that analysing gene expression at the end of the experiment does not reflect the expression during key periods of adaptation. The expression of ECM and metabolic proteins may be higher between 7 and 14 days of exercise, as this is the time point where major angiogenic and myogenic changes are occurring (182). In the future experiments WT and KO mice will be sampled over a range of time points to provide a temporal map of how these genes change as muscles adapt to exercise.

4.3.4. Muscle adaptations and ECM cleavage Given that versican cleavage is a primary function of ADAMTS5, the effect of exercise on versican processing was investigated in WT and KO muscle. It was demonstrated that exercise does not increase versican processing in either WT or KO muscle. Where and when versican is processed appears to be more critical to ECM remodelling than the amount cleaved. ADAMTS- cleaved versican fragments were shown to co-localise with endothelial cells in muscle, which fits with the lack of exercise-induced angiogenesis observed in KO muscle. Likewise, versican processing by ADAMTS proteinases was detected at the neuromuscular junction.

It is also important to consider the ECM as a reservoir for various factors and cytokines. Proteoglycan cleavage by ADAMTS5 may liberate factors from the matrix that influence how the muscle remodels. MMP proteolytic cleavage of collagen XVIII releases a fragment that influences endothelial cell migration, thus affecting angiogenesis (198). Similarly, DPEAAE fragments created by ADAMTS1 are associated with pathological angiogenesis (5). DPEAAE co-localises with endothelial cells in muscle, which suggests that ADAMTS5-mediated versican cleavage may be required for endothelial cell migration, with the significance becoming more pronounced during remodelling.

It is unclear whether versican cleavage is required for muscle adaptations. In limb morphogenesis, ADAMTS-mediated generation of active versican fragments were more important than clearance of the versican matrix (104). It was demonstrated that recombinant versican DPEAAE fragments influence interdigital web regression, possibly through binding and influencing cell-matrix

96 interactions (104). Therefore, it is possible that the DPEAAE fragment itself acts as a signalling ligand to influence how muscle adapts to exercise.

4.4. Conclusion A significant role for ADAMTS5 in skeletal muscle is revealed when the homeostatic balance of the muscle is challenged by a voluntary exercise stimulus. The precise role of ADAMTS5 in this context is unknown, but ADAMTS5 does influence the way muscle adapts to exercise. Exercise upregulates the expression of versican, Adamts4 and Adamts5 in WT muscle, but does not affect the amount of versican cleaved. ADAMTS processing of proteoglycans around endothelial cells and at the neuromuscular junction may affect the ability of muscle to adapt to exercise. Future experiments will test this theory using electron microscopy, confocal microscopy, and nerve function tests. In addition, RNA sequencing of exercised WT and KO muscle may reveal the pathway activated or inhibited in KO muscle that prevents the normal exercise-induced adaptations. Future studies will also use non-voluntary treadmill exercise to examine whether these effects are specific to endurance exercise. Immunohistochemistry using α-bungarotoxin and DPEAAE to stain the neuromuscular junction will also provide more information regarding versican processing and neuromuscular adaptations.

5. Does genetic ablation of Adamts5 ameliorate the dystrophic pathology of mdx mice? 5.1. Introduction The role of ADAMTS5 in healthy muscle was explored in the previous chapters. This chapter investigates whether genetic ablation of Adamts5 ameliorates the dystrophic pathology of mdx mice. The mdx mouse is the model of choice for preclinical and proof of concept DMD studies (250). The absence of dystrophin from mdx mice initiates a cycle of secondary muscle damage characterised by inflammation, necrosis, degeneration, and incomplete muscle regeneration. Fibroblasts play an important role in this damage cycle, where they contribute to ECM production and remodelling. Fibrosis in dystrophic muscle results from a combination of increased collagen synthesis and aberrant expression of MMPs and TIMPs (230). Mild fibrosis has been observed in the limb muscles of 10-13 week old mdx mice, with fibrosis becoming more extensive beyond six months of age (280, 365, 366).

Matrix metalloproteinases are implicated in the mdx mouse pathology, with the gene expression of MMP-3, -8, -9, -10, -12, -14, and -15 all upregulated in mdx muscle (303). Increased MMP-9 levels exacerbate the mdx phenotype (282, 304) and contribute towards dystrophic cardiomyopathies (305). The therapeutic targeting of these matrix metalloproteinases represents a promising new approach for treating dystrophic secondary muscle damage, in particular fibrosis (303). Mdx mice treated with the broad spectrum MMP inhibitor Batimastat show reduced necrosis, fibrosis, macrophage infiltration, and centrally nucleated fibres, as well as improved diaphragm muscle function (303). Similarly, targeting MMP-2 and MMP-9 using Pirfenidone ameliorates mdx fibrosis (315).

The combination of MMP-targeted therapies (303, 315) and microarray work showing significant upregulation of Adamts5 throughout the lifespan of mdx mice (3) paved the way for this investigation into the role of ADAMTS5 in dystrophic muscle. More recently, ELISA analysis has revealed that ADAMTS5 is upregulated 7.6-fold in the serum of mdx mice, and 3.4-fold in the serum of DMD patients (4). Versican, lumican and biglycan, known ADAMTS5 proteoglycan targets, are also significantly elevated in mdx muscle (273).

The aim of this chapter was to investigate how ADAMTS5 impacts the dystrophic pathology. Immuno-histochemical localisation of ADAMTS-cleaved versican fragments around satellite cells suggests that these proteinases may be involved in muscle regeneration (1). In Chapter 3 it

98 was demonstrated that ADAMTS5 is dispensable for normal muscle development. However, this does not exclude the possibility that it is involved in adult muscle regeneration. Although adult satellite cells derive from an embryonic-like population, muscle development and regeneration are distinct processes controlled by different factors (367).

Another possibility is that ADAMTS5 cleavage of proteoglycan targets contribute to the elevated inflammatory response of dystrophic muscle. Damage-associated molecular patterns (DAMPs) are endogenous molecules that induce inflammatory pathways via binding to Toll-like and purinergic receptors (368). DAMPs are released from the ECM following tissue injury (10, 119, 135, 209, 295, 368-370). The ECM proteins versican, biglycan, decorin, fibronectin, and tenascin have all been implicated as DAMPs capable of triggering inflammatory responses (209, 210, 213, 295, 371, 372). ADAMTS5 is capable of cleaving all of the aforementioned ECM proteins (93, 336-338), which raises the possibility that ADAMTS5-ECM processing may be releasing ligands to activate inflammatory pathways in dystrophic muscle.

In this study, the role of ADAMTS5 in dystrophic muscle was investigated by comparing the pathology of mdx:Adamts5+/+ (mdx wt) and mdx:Adamts5-/-(mdx ko) mice. It was hypothesised that the elevated expression of Adamts5 in mdx muscle caused increased ECM processing and thus exacerbation of the dystrophic pathology. The aim was to reduce inflammation, fibrosis, necrosis, and improve muscle function in the mdx mouse through genetic ablation of Adamts5.

5.2. Results

5.2.1. Gene expression of Adamts5 and versican in mdx muscle Initial interest in ADAMTS5 as a potential therapeutic target in dystrophic muscle was fuelled by work showing elevated Adamts5 expression in mdx muscle (3). To validate this finding, qRT- PCR analysis was performed on the muscles of 12 week old mdx wt and mdx ko mice. Figure 5.1 confirms that Adamts5 expression was elevated by 2-fold in the EDL and soleus, and 1.6-fold in the TA of mdx wt muscle compared to WT. This figure also shows that the expression of versican was elevated by 3.5-fold, 3-fold and 2-fold in the EDL, soleus, and TA muscles of mdx wt mice. In mdx ko mice, versican mRNA was up 2.5-fold, 3-fold, and 2-fold respectively in the EDL, soleus, and TA muscles.

Figure 5.1 Adamts5 and versican mRNAs are upregulated in 12 week old mdx muscle

Gene expression of Adamts5 and versican (Hspg2) presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, *, p < 0.05, **, p < 0.01, ***, p < 0.001, n = 6).

100

5.2.2. ADAMTS-versican processing in mdx muscle Based on the elevated expression of Adamts5 and versican in mdx wt muscle, it was hypothesised that versican proteolysis would also be increased relative to WT. To test this, a Western blot using the G1-DPEAAE neo-epitope antibody was performed on muscle extracts from mdx and WT mice. The DPEAAE fragment arises from ADAMTS-mediated proteolysis of versican. In support of the initial hypothesis, Figure 5.2 demonstrates that versican cleavage was greater in mdx wt muscle compared to WT. Versican cleavage was drastically reduced in mdx ko muscle compared to WT and mdx wt, thus strengthening the notion that ADAMTS5 is the main versicanase in skeletal muscle.

Figure 5.2 Increased ADAMTS-processing of versican in mdx muscle

(A) Immunoblotting of whole muscle TA extracts from 12 week old male mice using the versican V0/V1 (DPEAAE) neo-epitope antibody. 5µg of protein was loaded. The anti-vinculin loading control is displayed below for all samples; (B) Relative density of WT, mdx wt, and mdx ko DPEAAE bands adjusted to the vinculin loading control. The data was analysed by unpaired Student’s t-tests (mean ± SEM, **, p < 0.002, n = 3).

101

5.2.3. The expression of other ADAMTS versicanases are not upregulated in mdx ko muscle The Western blot in Figure 5.2 demonstrated that ADAMTS5 was the major versicanase in dystrophic muscle. However, it was still important to confirm that no other Adamts versicanases were upregulated in the absence of Adamts5. The known ADAMTS versicanases are ADAMTS1, ADAMTS4, ADAMTS5, ADAMTS9, and ADAMTS15 (100-103). Quantitative RT-PCR analysis of mdx wt and mdx ko muscle revealed that Adamts1 was most highly expressed in mdx muscle, but due to variability it was not significantly elevated compared to the WT (Figure 5.3). Despite a comparatively reduced expression, Adamts4 was up 9-fold and 7.5-fold in mdx wt and mdx ko respectively compared to the WT. Adamts4 was the only member upregulated in mdx ko muscle compared to WT. The gene expression of Adamts5 was significantly upregulated by 1.6- fold in mdx wt muscle compared to WT muscle.

Figure 5.3 Gene expression of Adamts proteinases in the TA muscles of 12 week old male mdx mice

Gene expression presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, *, p < 0.05, **, p < 0.01, ***, p < 0.001, n = 6). Note the different y-axis scales to emphasise the relative difference in expression

102

5.2.4. Proteoglycan expression in mdx muscle Reported ADAMTS5 proteoglycan targets were profiled in the TA muscles of mdx wt and mdx ko mice. Versican gene expression was upregulated by 3.7-fold and 4-fold in mdx wt and mdx ko muscle respectively, compared to WT (Figure 5.4). There was no difference in the expression of biglycan or lumican between the groups. Decorin was the most highly expressed proteoglycan in mdx muscle, but its expression was significantly downregulated compared to WT mice. Proteoglycan gene expression was not affected by the absence of Adamts5 in mdx mice.

Figure 5.4 Gene expression of proteoglycans in the TA muscle of 12 week old male mdx mice

103

5.2.5. Mdx muscle growth is not affected by Adamts5 ablation Prior to profiling the damage phenotypes of mdx wt and mdx ko muscle, it was vital to ensure that postnatal mdx growth was not affected by the ablation of Adamts5. Postnatal growth was assessed from body mass, muscle mass, and myofibre size. The two groups did not differ in their body masses between six and 12 weeks of age (Figure 5.5A). Similarly, Adamts5 ablation did not affect muscle mass or myofibre size (Figures 5.5B and C). The variance coefficient, which gives a numerical expression of fibre size variability (265, 327), was also consistent between the groups (Figure 5.5D).

Figure 5.5 Body mass, muscle mass and muscle size of mdx wt and mdx ko mice

(A) Mdx body mass from 6 to 12 weeks of age (n = 11); (B) Quadriceps (QUAD), Gastrocnemius (GAST), Tibialis anterior (TA), extensor digitorum longus (EDL), soleus (SOL), and heart masses from 12 week old mdx mice (n = 14); (C) TA muscle fibre size was measured from the minimal Feret’s diameter of 12 week old mdx mice (n = 14); (D) TA muscle fibre variance of 12 week old mdx mice (n = 14). The variance coefficient was calculated using the formula: (fibre size standard deviation x 1000) / fibre size mean. The data was analysed by unpaired Students t-test and presented as mean ± SEM. No significant differences were observed between the two groups.

104

5.2.6. Adamts5 ablation reduces serum creatine kinase in mdx mice The central aim of this chapter was to assess whether dystrophic muscle damage was ameliorated by the genetic ablation of Adamts5. The parameters used to assess dystrophic muscle damage were: the concentration of serum creatine kinase, the area of muscle necrosis, the proportion of IgG positive myofibres, and the percentage of myofibres with centrally located nuclei. Elevated serum creatine kinase is a commonly used diagnostic marker of sarcolemmal damage. Figure 5.6 demonstrates that serum creatine kinase was reduced by 48% in mdx ko mice compared to mdx wt at 12 weeks of age.

Figure 5.6 Genetic ablation of Adamts5 reduces serum creatine kinase (CK) levels in 12 week old male mdx mice

The data was analysed by unpaired Student’s t-test and presented as mean ± SEM (*, p < 0.05, n = 16).

105

5.2.7. Adamts5 ablation does not reduce mdx muscle necrosis The muscles of 12 week old mdx mice are characterised by large areas of myofibre necrosis, regeneration, and remodelling. Necrotic areas are identified based on fragmented sarcoplasms, inflammatory cell infiltration, and areas of myofibre regeneration (328). Myofibre necrosis was quantified relative to the total area of the TA muscle, with no difference observed between the two groups (Figure 5.7B). Despite the high sample size, the data was quite variable for both groups, and in particular for the mdx wt animals. Overall, these results demonstrate that genetic ablation of Adamts5 does not reduce necrosis in the TA muscle of 12 week old mdx mice.

Figure 5.7 Genetic ablation of Adamts5 does not reduce muscle remodelling/ regeneration in 12 week old male mdx mice

(A) Representative H&E images of mdx wt and mdx ko TA muscles. The arrows indicate inflammatory cell infiltration, while the circled areas show myofibres undergoing regeneration; (B) Necrosis expressed as a percentage of total TA muscle area. The data was analysed by unpaired Students t-test and presented as mean ± SEM (n = 16). No significant differences were observed between the two groups.

106

5.2.8. Adamts5 ablation does not reduce mdx sarcolemmal damage The proportion of immunoglobulin (IgG) positive myofibres relative to the total number of fibres is a marker of damage in dystrophic muscle. IgG is able to infiltrate the sarcolemma and enter damaged myofibres. Sarcolemmal damage was quantified based on the immuno-histochemical detection of myofibres that stained positive for IgG. No difference was observed in the proportion of IgG positive myofibres in the TA muscles of mdx wt and mdx ko mice (Figure 5.8).

Figure 5.8 Genetic ablation of Adamts5 does not reduce the number of IgG-positive fibres in 12 week old male mdx mice

(A) Percentage of IgG positive fibres relative to the total number of fibres in the TA muscle; (B) Representative IgG images of mdx wt and mdx ko TA muscles. The data was analysed by unpaired Student’s t-test and presented as mean ± SEM (n = 16). No significant differences were observed between the two groups.

107

5.2.9. Adamts5 ablation reduces central nuclei in mdx muscle In healthy muscle, the myonucleus is located at the periphery of myofibres. However, when muscle is damaged it undergoes cycles of degeneration and regeneration, resulting in newly formed myofibres with centrally located nuclei. The proportion of myofibres with centrally located nuclei can be used as a marker of previously necrotic/regenerated tissue (268). Genetic ablation of Adamts5 results in a small, but significant reduction in the proportion of centrally located nuclei in mdx muscle (Figure 5.9A). To investigate if this was due to lower levels of muscle damage from earlier in the life of mdx ko mice, necrotic damage at three weeks of age was also analysed (Figure 5.9B). At three weeks, muscle necrosis was not reduced in mdx ko mice compared to mdx wt (p = 0.068). However, due to the variability inherent within the mdx phenotype, the sample size of five may be too small to fully interrogate the differences.

Figure 5.9 The proportion of previous muscle damage from 12 and 3 week old mdx wt and mdx ko mice

(A) The proportion of centrally located nuclei in 12 week old male mdx wt and mdx ko mice. This proportion was calculated based on the number of myofibres with centrally located nuclei relative to the total number of myofibres (n = 16); (B) TA muscle necrosis in mdx wt and mdx ko mice at 3 week. Necrosis is expressed as a percentage of the total muscle area (n = 5). The data was analysed by unpaired Students t-test and presented as mean ± SEM (*, p < 0.05).

108

5.2.10. Adamts5 ablation does not affect the gene expression of Pax7 in mdx muscle Following on from the reduced proportion of centrally located nuclei observed in mdx ko muscle, the gene expression of the satellite cell marker, Pax7, was analysed to further probe the regenerative capacity of these mice. After muscle damage, satellite cells are activated as they enter the proliferative stage of muscle regeneration, which is reflected by increased expression of the transcription factor Pax7 (373, 374). Pax7 expression has been used as a measure of satellite cell activation, and hence muscle regeneration, in mdx mice (204). In this study, no differences were detected between mdx wt and mdx ko mice in their expression of Pax7 (Figure 5.10). However, the most unexpected result was the similar expression of Pax7 in WT and mdx muscle. This means that despite the increased levels of muscle damage and regeneration occurring in these mdx mice, the expression of Pax7 was not elevated compared to WT mice at 12 weeks of age. This is most likely due to the timing of when the mice were sampled, as the pathology of mdx mice stabilises by 12 weeks (249). The gene expression of Pax7 is elevated in the muscles of six week old mdx mice (375). Therefore, it is likely that the gene expression of Pax7 was greatly elevated in mdx wt and mdx ko muscles earlier in life whilst muscle damage was still ongoing.

Figure 5.10 Genetic ablation of Adamts5 does not alter the gene expression of Pax7 in the TA muscles of 12 week old male mdx mice

Gene expression presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, n = 6). No significant differences were observed between the two groups.

109

5.2.11. Adamts5 ablation does not ameliorate mdx diaphragm fibrosis Fibrosis is caused by an imbalance in the synthesis versus degradation of ECM proteins (272). It was hypothesised that the reduced proteolytic processing of ECM proteins in the muscles of mdx ko mice would result in reduced muscle fibrosis. No obvious fibrosis was observed in the limb muscles of either mdx ko or mdx wt mice. However, the diaphragm of mdx mice more closely replicates the fibrosis observed in DMD patients. Therefore, the levels of fibrosis was quantified in the diaphragms of mdx wt and mdx ko mice. Hydroxyproline content was utilised as a measure of collagen deposition and fibrosis in this experiment. As expected, hydroxyproline was elevated in mdx muscle compared to WT at 12 weeks. However, the genetic ablation of Adamts5 did not reduce the level of diaphragm hydroxyproline at either 12 or 24 weeks of age in mdx ko mice compared to mdx wt (Figure 5.11). Variability within the small sample size may explain the lack of significant differences in the hydroxyproline content at 24 weeks of age.

Figure 5.11 Genetic ablation of Adamts5 does not ameliorate diaphragm fibrosis in male mdx mice

Hydroxyproline content expressed per µg of muscle tissue wet weight. The data was analysed by unpaired Student’s t-test and presented as mean ± SEM (n = 8 at 12 weeks, n = 4 at 24 weeks). No significant differences were observed between the two groups.

110

5.2.12. Adamts5 ablation does not affect the expression of inflammatory cytokines in mdx muscle It was hypothesised that ADAMTS5 processing of ECM proteins exacerbated the inflammatory pathology of mdx mice. The inflammatory pathology in dystrophic muscle was investigated by quantitating the gene expression of various inflammatory factors. EGF-like module-containing mucin-like hormone receptor-like 1 (F4/80) is a macrophage marker, Tumour necrosis factor alpha (TNF-α) is an inflammatory cytokine, and Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) is a protein complex that helps control cytokine production. No differences were observed in the gene expression of F4/80, TNF-α, or NF-kB between mdx wt and mdx ko (Figure 5.12A-C).

The gene expression of Toll-like receptor 2 (TLR2) and P2X purinoceptor 7 (P2X7) were also profiled as soluble proteoglycans have been shown to operate as DAMP signals via TLR2 and P2X7 during inflammatory responses (209). DAMP binding of TLR2 and P2X7 activate the NACHT, LRR and PYD domains-containing protein 3 (NLRP3) inflammasome (295). Inflammasomes are innate immune receptors that regulate Caspase-1 (CASP1) activation, and hence the proteolytic maturation and secretion of the downstream inflammatory cytokine Interleukin-1 beta (IL-1β) (208). No differences were observed in the gene expression of TLR2, P2X7, NLRP3, CASP1, or NF-kB between mdx wt and mdx ko mice (Figure 5.12D-H). Based on the inflammatory factors profiled, the data suggests that genetic ablation of Adamts5 does not ameliorate the inflammatory response in dystrophic muscle.

111

Figure 5.12 Genetic ablation of Adamts5 does not alter the gene expression of inflammatory factors in the TA muscles of 12 week male mdx mice

Gene expression presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. (A) EGF-like module-containing mucin-like hormone receptor-like 1 (F4/80); (B) Tumour necrosis factor alpha (TNF-α); (C) Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB); (D) Toll-like receptor 2 (TLR2); (E) NACHT, LRR and PYD domains- containing protein 3 (NLRP3); (F) P2X purinoceptor 7 (P2X7); (G) Caspase-1 (CASP1); (H) Interleukin-1 beta (IL-1β); (G); The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM, n = 6, * p < 0.05). No significant differences were observed between the two mdx groups.

112

5.2.13. Muscle function in mdx wt and mdx ko mice An improvement in muscle function is the ultimate outcome measure for therapies aimed at ameliorating the dystrophic pathology. TA muscle function was tested in mdx mice using an in situ muscle physiology setup (described in methods section 2.1). There was no difference in the maximal absolute force production of WT, mdx wt, or mdx ko mice (Figure 5.13A). However, when studying dystrophic muscle function it is essential to normalise tetanic force to muscle size, as the muscles of mdx mice are larger than their age-matched controls (376). When corrected for the cross sectional area of the muscle, the maximal tetanic (specific) force was lower in both mdx groups compared to WT (Figure 5.13B). Most importantly, no difference was observed in the maximal tetanic capacity of mdx wt and mdx ko mice. This demonstrates that genetic ablation of Adamts5 does not improve the force producing capacity of mdx muscle.

Figure 5.13 Genetic ablation of Adamts5 does not improve force production in the TA muscle of 12 week old mdx mice

(A) Absolute maximal force at 150Hz stimulation; (B) Maximal specific force normalised to muscle mass and cross sectional area at 150Hz stimulation; (C) Optimal muscle length at maximal twitch force production; (n = 12 for WT, n = 10 for mdx). The data was analysed by unpaired Students t-test and presented as mean ± SEM (*, p < 0.05).

113

5.2.14. The genetic ablation of Adamts5 improves the fatigue resistance of mdx mice Muscle fatigue is another means of assessing the functional improvement of a given therapeutic intervention in mdx mice. The muscle fatigue protocol consisted of 60 maximal tetanic contractions over a 240 second period, followed by a recovery period at 1, 2, 3, 5, and 10 minutes post-fatigue. Figure 5.14 separates the fatigue period into three components, fatigue 1 (0-100 seconds), fatigue 2 (100-240 seconds), and recovery. Over the course of fatigue 1, mdx wt (p = 0.0001) and mdx ko (p = 0.004) mice both fatigued significantly more than WT mice. During this initial period, no difference was observed between mdx wt and mdx ko mice.

During fatigue 2 mdx wt fatigued significantly more than WT mice (p = 0.004), but no difference was observed between mdx ko mice and WT mice. Over this period, mdx ko mice displayed a 7% improvement in fatigue resistance compared to mdx wt mice (p = 0.009). Therefore, after a sharp initial drop in force production, mdx ko mice fatigued in a similar manner to WT mice. Importantly, mdx ko mice maintained this WT-like function throughout the entire recovery period. An improved recovery from fatigue was also observed in mdx ko mice compared to mdx wt mice at one and three minutes post-fatigue. The recovery of mdx wt mice was significantly impaired compared to WT mice at three, five, and 10 minutes post-fatigue. Importantly, by 10 minutes post-fatigue both mdx wt and mdx ko mice had recovered to a similar extent. This demonstrates that despite a significant differences in their fatigue profiles, both groups were able to recover from the protocol. The precise mechanism responsible for the significant improvement in mdx ko fatigue resistance is unclear, but may be due to differences in metabolic properties, excitation- contraction coupling, or levels of previous muscle damage.

114

Figure 5.14 Genetic ablation of Adamts5 improves the fatigue resistance of TA muscles in 12 week old male mdx mice

The fatigue protocol consisted of 60 maximal contractions every four seconds, followed by a recovery period where maximal tetanic force was recorded at 1, 2, 3, 5 and 10 minutes post- fatigue. The figure can be divided into three components; fatigue 1, fatigue 2 and recovery. The fatigue 1 component (0-100 seconds) for all groups was analysed by two-way ANOVA with Tukey’s multiple comparison test, and presented as mean ± SEM (++ WT vs mdx ko p = 0.004, mdx ko vs mdx wt non-significant, ### WT vs mdx wt p = 0.0001). The fatigue 2 component (100- 240 seconds) for all groups was analysed by two-way ANOVA with Tukey’s multiple comparison test, and presented as mean ± SEM (WT vs mdx ko non-significant, ** mdx ko vs mdx wt p = 0.009, ## WT vs mdx wt p = 0.004). The recovery component was analysed by unpaired 2-tailed t-test (* mdx ko vs mdx wt p < 0.05, # WT vs mdx wt p < 0.05, n = 10).

115

5.2.15. The oxidative properties of mdx wt and mdx ko muscle A number of parameters were analysed to ascertain the mechanism responsible for the improved fatigue resistance in mdx ko muscle. As oxidative muscle fibres are more resistant to fatigue, the oxidative capacity of mdx wt and mdx ko muscles was analysed based on their fibre type (MYHC isoform composition) and NADH intensity.

In the fibre typing experiment, the myofibre boundaries were stained green using wheat germ agglutinin, and the MYHC isoforms were labelled as follows: MYHC-2b red, MYHC-2a blue, MYHC-1 green, and the absence of staining (black fibres) signified the MYHC-2x isoform. Fibre typing for MYHC isoforms in mdx tissue is complicated by the chronic levels of inflammation and muscle damage. The muscle damage meant that the blue (MYHC-2a), green (MYHC-1) and black (MYHC-2x) staining could not be quantified with any confidence. For this reason, the only MYHC isoform analysed was MYHC-2b. No difference was observed in the proportion of MYHC-2b positive fibres quantified from the immunostaining of mdx wt and mdx ko muscle (Figure 5.15A). In addition, no differences were found in the gene expression of either MYHC- 2a (MYH2) or MYHC-2b (MYH4) (Figure 5.15E and F respectively).

In NADH stained muscle, oxidative myofibres appear darker due to a larger number of mitochondria, while glycolytic myofibres appear lighter. Quantification of the NADH staining intensity revealed no differences between the two groups (Figure 5.15C). The gene expression of calcineurin and peroxisome-proliferator-activated receptor-gamma co-activator-1 (PGC-1α) were also analysed as part of the metabolic profiling of WT and KO muscle. Calcineurin forms part of the NFAT pathway that helps regulate muscle fibre types, while PGC-1α is also a vital coactivator of fibre type specificity (183, 185). The expression of neither calcineurin or PGC-1α was altered by the genetic ablation of Adamts5 in mdx mice (Figure 5.15G and H). These results further suggest that the fatigue differences observed between mdx wt and mdx ko muscle were not due to differences in their oxidative profiles.

116

Figure 5.15 Genetic ablation of Adamts5 does not alter the oxidative profile of the TA muscle of 12 week old male mdx mice

(A) Proportion of fibres expressing MYHC-2b in TA muscles as measured from immuno- histochemical staining of mdx wt and mdx ko TA muscles (n = 4); (B) Representative MYHC staining (MYHC-2b = red, MYHC-2x = black, MYHC-2a = blue, MYHC-1 = green); (C) Intensity of greyscale NADH staining from mdx wt and mdx ko TA muscles (n = 7); (D) Representative NADH images from mdx wt and mdx ko muscles - note the darker appearance of the oxidative fibres; (E) MYHC-2a (Myh2) gene expression in mdx wt and mdx ko TA muscles (n = 6); (F) MYHC-2b (Myh4) gene expression in mdx wt and mdx ko TA muscles (n = 6); (G) Calcineurin (Pp3ca) gene expression (n = 7); (H) Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) gene expression (n = 7). The gene expression data was presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. The data was analysed by Kolmogorov-Smirnov and unpaired Student’s t-tests (mean ± SEM). No significant differences were observed between the two groups.

117

5.3. Discussion

5.3.1. Elevated Adamts5 expression and activity in mdx muscle The aim of this chapter was to investigate Adamts5 ablation as a treatment for the mdx mouse model of muscular dystrophy. It was hypothesised that excessive proteoglycan processing by ADAMTS5 exacerbated the dystrophic pathology in mdx muscle. Prior to investigating the pathology, it was important to confirm the increased expression and activity of ADAMTS5 in mdx muscle. The gene expression data presented in this work supports previous findings in demonstrating that Adamts5 is upregulated in adult mdx muscle (3).

The precise mechanism responsible for the elevated expression of Adamts5 in dystrophic muscle is unknown. Marotta et al proposed that Adamts5 was upregulated as part of a functional network of genes that included the secreted ECM protein Postn (periostin), and the thrombospondin- containing proteins Spon1 (spondin-1) and Thbs1 (thrombospondin-1) (3). As mentioned earlier, ADAMTS5 contains two thrombospondin-1 repeats in its primary structure, one at its centre and another at its C-terminus (167). Most studies have focused on the proteolytic activity of ADAMTS5, but factors binding to its C-terminal thrombospondin-1 repeats may also be functionally significant. This notion would certainly fit with the phenotypes observed in Adamts5- deficient muscle. Thrombospondin-1 is expressed during inflammation and angiogenesis (377), and has been implicated in the dysferlinopathies, where it may be involved in the recruitment of macrophages to damaged muscle tissue (378).

Future experiments utilising the Adamts5 Δ-cat mice may help shed some light on the significance of ADAMTS5 binding in dystrophic muscle. Adamts5 Δ-cat mice express all ancillary domains, but lack ADAMTS5 proteolytic activity due to an in-frame deletion of exon 3 in the catalytic domain (155, 168, 379). A comparison of mdx ko and mdx:Adamts5Δ-cat mice would provide insight as to how much of the improvement in muscle fatigue is due to the binding of ECM proteins to the C-terminus of ADAMTS5 versus the proteolytic activity of ADAMTS5.

It is reasonable to speculate that the increased production of ECM proteins, in particular proteoglycan targets, might trigger an increase in the expression of ECM proteases. The gene expression of versican was elevated 3-fold in mdx wt muscle compared to WT, which supports previous work in mdx muscle (273). Versican mRNA and protein are both upregulated in DMD muscle compared to controls (302). The fact that versican expression is elevated in mdx ko muscle demonstrates that regardless of whether Adamts5 is expressed, versican production is elevated in mdx muscle. Although no direct link between versican expression and dystrophic fibrosis has been made, the increased production of ECM proteins, such as versican, is often interpreted as a secondary response to muscle damage, which is then believed to exacerbate muscle fibrosis (273).

118

However, mdx muscle exhibits a low level of fibrosis at 12 weeks of age compared to adult DMD patients. Therefore, it is possible that the increased versican production serves an additional function. Caceres et al have proposed that proteoglycan expression is increased in dystrophic muscle as part of a myo-proliferative response that facilitates regeneration (301).

Despite the same level of versican being produced in mdx wt and mdx ko mice, no compensatory upregulation was observed in the expression of Adamts members in mdx ko mice. The gene expression of Adamts4 was upregulated in both mdx wt and mdx ko muscle. Versican cleavage was used to test the hypothesis that ADAMTS5 activity is elevated in mdx muscle compared to WT. In support of the hypothesis, versican cleavage was significantly greater in the muscles of mdx wt compared to WT mice. When analysed alongside the expression data, it appears that the upregulation of both Adamts4 and Adamts5 is responsible for this increase in versican cleavage. However, despite an upregulation in Adamts4 expression, Adamts5-deficient muscle display a greatly reduced level of versican cleavage. These drastically reduced DPEAAE levels in mdx ko muscle suggest that ADAMTS5 is more active in cleaving versican than ADAMTS4 in skeletal muscle. This finding strengthens the notion that ADAMTS5 is the main ADAMTS responsible for versican proteolysis in skeletal muscle.

5.3.2. Adamts5 ablation does not ameliorate muscle damage in 12 week old mdx mice Recent muscle damage was assessed based on the percentage area of muscle necrosis, the serum creatine kinase concentration, and the proportions of IgG-positive fibres, while previous damage was assessed from the proportion of centrally located nuclei. Muscle necrosis was not different between mdx wt and mdx ko mice at 12 weeks of age. The two groups also showed no difference in their proportion of IgG-positive fibres, which is a measure of sarcolemmal integrity. However, according to another measure of sarcolemmal integrity, the creatine kinase concentration, mdx ko mice showed lower levels than mdx wt. Creatine kinase is a universally accepted measure of muscle damage in both the laboratory and clinical settings (269, 321). It provides a global assessment of muscle damage as it is based on the creatine kinase pool released into the serum from all muscles. Creatine kinase is a more sensitive measure of muscle damage than the proportion of IgG-positive fibres. IgG-positive fibre detection is based on the same principal as Evans blue dye (EBD) quantification. Positive EBD staining signifies that albumin, which EBD binds to, has leaked through the membranes of damaged muscle fibres (380). However, the limitation of techniques such as EBD and IgG is that the number of IgG or EBD-positive fibres do not always accurately reflect the number of necrotic fibres (381). Therefore, creatine kinase concentration is the most sensitive and commonly used techniques for assessing sarcolemmal damage in dystrophic muscle.

119

The TA muscles of mdx ko mice displayed a lower proportion of centrally located nuclei than mdx wt mice. The reduced numbers of centrally located nuclei is likely due to these mice experiencing less muscle damage earlier in their lives (289). The lack of significance in the myofibre necrosis data at 3 weeks of age (p = 0.068) suggests that variability and sample size may be an issue. Additional animals are required for this time point to help confirm whether mdx ko mice are protected from muscle damage earlier in life.

5.3.3. Adamts5 ablation does not reduce the gene expression of inflammatory factors in dystrophic muscle Dystrophic muscle is characterised by an elevated expression of inflammatory cytokines (273), but the role of ECM remodelling in this inflammatory signature remains relatively unknown. This study sort to reduce inflammation in the mdx mouse through the genetic ablation of Adamts5. This hypothesis was based on the idea that ADAMTS5 proteolytic activity liberates ECM DAMP fragments that exacerbate the inflammatory pathology. The ADAMTS5 ECM targets versican, biglycan, decorin, fibronectin, and tenascin have all been implicated as DAMPs capable of triggering inflammatory responses (209, 210, 213, 295, 371, 372). The soluble form of biglycan can act as a DAMP for the NLRP3 inflammasome during kidney inflammation (295). Therefore, the gene expression of proteoglycans, inflammatory cytokines, and down-stream inflammasome components were compared between mdx wt and mdx ko mice.

No differences were observed in the expression of biglycan or decorin between mdx wt and mdx ko mice. Similarly, the expression of inflammatory factors NF-κβ, TNF-α, CASP1, IL-1β and the inflammasome components TLR2, P2X7, and NLRP3 were not affected by the ablation of Adamts5. Based on the gene expression profiling performed in this study, it appears that ablation of ADAMTS5 does not ameliorate the inflammatory response in dystrophic muscle. It is important to point out the limitations of this approach, as it did not investigate protein levels or the role of other inflammatory cells. In addition, the age of the mice may be a factor. Adamts5 expression is not different between mdx and control mice at three weeks of age, but then spikes after three weeks to remain consistently elevated up until nine months of age (104). Meanwhile, the mdx mouse displays an acute period of inflammation at three weeks of age, and then stabilises by 12 weeks (265-267). This suggests that the strongest correlation between Adamts5 expression and inflammation occurs at three weeks of age. Therefore, analysing the gene expression of inflammatory cytokines at 12 weeks of age may not be the most informative way of probing the relationship between ADAMTS5 and inflammation. Future experiments will focus on the expression of inflammatory factors in mdx wt and mdx ko mice at three weeks of age.

120

5.3.4. Adamts5 ablation does not improve mdx muscle strength The function of the TA muscle was assessed using an in situ muscle contractile system. It was hypothesised that Adamts5 ablation would reduce muscle damage and thus improve muscle function. The results demonstrate that Adamts5 ablation did not improve mdx muscle strength. Given that no significant amelioration of muscle damage was observed in mdx ko mice, it fits that muscle strength would not be improved.

5.3.5. Adamts5 ablation improves mdx fatigue resistance The only functional parameter where a difference between the groups was observed was fatigue, with mdx ko mice showing significantly greater resistance to fatigue than mdx wt. Following 60 tetanic contractions WT mice fatigued by 31%, while mdx wt and mdx ko mice fatigued by 40% and 33% respectively. Fatigue drops of 30% or more have been attributed to a reduction in the myoplasmic free calcium concentration during tetanus (35). A number of mechanisms have been proposed for the reduction in tetanic calcium levels, including: metabolic calcium release failure, which is dependent on the metabolic profile of the muscle; and impaired propagation of action potentials into the t-tubular system (35). Based on the inhibited metabolic response to exercise observed in KO muscle from Chapter 4, the metabolic components of muscle fatigue were investigated in mdx mice. The initial hypothesis was that Adamts5 ablation had increased the oxidative profile of the muscle. However, analysis of NADH, and MYHC at the mRNA and protein level revealed no differences between mdx wt and mdx ko mice. Similarly, gene expression analysis of PGC-1α and calcineurin detected no differences between the groups. Based on the mRNA expression of these key factors, the improved fatigue resistance in mdx ko mice appears to be occurring independent of the metabolic profile of the muscle.

The absence of a metabolic phenotype suggests that mdx wt and mdx ko mice may differ in the function of their t-tubular system. As mentioned earlier, t-tubular failure has been proposed as a mechanism responsible for muscle fatigue (35). Drops in muscle force of 30% of more have been attributed to an impaired propogation of action potentials into the t-tubular system, with potassium ions possibly playing a role (35). Interestingly, proteoglycan expression has been detected in the t-tubules of skeletal muscle (38). This raises the question as to whether proteolgycan processing in the t-tubules may be involved in how muscle fatigues? It may be that excessive versican processing in the t-tubules inhibits muscle function and calcium reuptake following repeated bouts of fatiguing contractions. The fact that no improvement in fatigue resistance was observed in KO mice may be due the lower expression and activity of ADAMTS5 in these mice. In mdx mice, the elevated production of ADAMTS5 may result in excessive cleavage of versican in the t-tubular system, thus impacting on muscle fatigue resistance. Confocal immuno-staining of

121 longitudinal t-tubule sections for cleaved and un-cleaved versican may provide further information regarding the relationship between ADAMTS processing and muscle function.

MMP inhibition using the anti-fibrotic agent suramin protects against contraction induced fatigue in the mdx diaphragm (318). As β-dystroglycan is a known proteolytic target of MMP-9 (382), Taniguti et al proposed that the improved fatigue resistance was due to a reduction in MMP-9 cleavage of β-dystroglycan. More recently, work using mdx MMP-9 knockout mice has suggested that proteases other than MMP-9 may be responsible for β-dystroglycan processing in mdx mice (283). Similarly, the improved fatigue resistance in mdx ko muscle observed in this study may be due to reduced ADAMTS5 processing of target ECM proteins.

5.4. Conclusion This chapter showed that the expression and activity of ADAMTS5 is elevated in mdx muscle, thus strengthening the notion that it may be a potential biomarker for muscular dystrophy (4). To investigate the role of ADAMTS5 in dystrophic muscle, the pathology of mdx wt and mdx ko mice were compared. Despite reduced serum creatine kinase levels, reduced centrally located nuclei, and improved fatigue resistance, no amelioration was observed in terms of fibrosis, necrosis, inflammation, or muscle strength at 12 weeks of age. In comparison to current pre-clinical therapies, where all of the aforementioned damage parameters were ameliorated in the mdx mouse (244, 383, 384), the findings of this thesis do not support the genetic ablation of Adamts5 as a viable therapy for dystrophic muscle.

However, the 12 week old central nuclei and 3 week old necrosis data for mdx ko mice suggests that ADAMTS5 plays a role in dystrophic pathology, especially earlier in the disease. This would fit with previous work showing that MMP-9 has differential roles in mdx muscle depending on the age of the mice (283). Less previous damage in mdx ko muscle might also explain their improved resistance to muscle fatigue. Adamts5 ablation did not affect individual tetanic contractions (specific muscle force), but did improve the performance of the muscle over a sustained period. Therefore, the fatigue resistance could be viewed more as a protection against damage caused by multiple tetanic contractions.

To probe these questions further the pathology of three week old mdx ko mice will be investigated, as well as a pharmacological intervention aimed at inhibiting ADAMTS5 in mdx mice across a range of ages. Temporally mapping the effect of inhibition across the lifespan of the mice will indicate whether ADAMTS5 plays a role in the dystrophic pathology of younger mdx mice.

122

6. Proteomic analysis of ADAMTS5 in the fibroblast matrisome 6.1. Introduction Proteases, such as ADAMTS5, help regulate protein localisation; shedding from the cell surface; activation or inactivation of other proteases, cytokines and growth factors; and the release of proteolytic cleavage products (385). ADAMTS proteinases have been implicated in the maintenance of the pericellular matrix in embryonic tissue (95, 166), but their role in the adult ECM remains relatively unexplored. The aim of this chapter was to investigate the effect of Adamts5 ablation on the ECM proteome, which is now defined as the matrisome (386). The matrisome is an ensemble of genes encoding ECM and ECM-associated proteins (386). ECM proteins are broadly divided into core matrisome and matrisome-associated proteins (43). The core matrisome is made up of ECM glycoproteins, collagens, and proteoglycans (387); while matrisome-associated proteins are comprised of ECM-affiliated proteins such as annexins and syndecans, ECM regulators including matrix metalloproteinases and ADAMTS proteinases, and secreted factors such as chemokines and growth factors (386).

Chapter 3 demonstrated that fibroblasts were responsible for producing ADAMTS5 in the muscle ECM. Therefore, to investigate the role of ADAMTS5 in the matrisome, primary fibroblasts were isolated from the hind limb muscles of WT and KO mice and grown in culture. Label-free mass spectrometry (MS) was then performed on proteins extracted from WT and KO fibroblasts using a sequential extraction protocol.

The sequential extraction protocol was adapted from a previous study where proteoglycans were isolated from human carotid arteries (388). This approach reduced cellular protein contamination, thus increasing the likelihood of identifying less abundant ECM proteins (388, 389). The sequential extraction comprised three steps; the first step was NaCl treatment to extract loosely bound proteins, followed by decellularisation in sodium dodecyl sulphate (SDS), and a final guanidine-hydrochloride (GuHCl) denaturing step. It has previously been demonstrated that SDS removes cellular components from tissues through the solubilisation of the cytoplasmic and nuclear membranes (390). GuHCl treatment is the most effective method for solubilising the most strongly bound ECM components, including proteoglycans, glycoproteins, and basement membrane proteins (388, 391).

The combination of solubility-based protein fractionation and label-free quantitative tandem MS have been used to investigate the proteomes of human cardiac tissue and mouse cartilage (388, 392). The present study is the first to perform sequential protein extractions and MS on muscle

123 derived fibroblasts. The aim was to examine how the absence of ADAMTS5 affected the composition of the matrix both in terms of protein abundance and solubility, with particular focus on known ADAMTS5 substrates such as: versican, biglycan, decorin, fibronectin, tenascin-C, and fibromodulin (1, 336, 337). WT and KO matrisomes were also profiled by comparing their relative abundance of ECM proteins.

124

6.2. Methods

6.2.1. Isolating primary fibroblasts from muscle In this experiment primary fibroblasts were isolated from skeletal muscle and grown in culture for proteomic analysis. To achieve this fibroblasts were separated from a mixed population of cells that also contained myoblasts (393, 394). Briefly, four week old WT and KO mice were culled by cervical dislocation and placed into a beaker containing 70% ethanol. After five minutes soaking in ethanol the skin was peeled away to expose the hind-limb muscles. The hind-limb muscles (quadriceps, gastrocnemius, soleus, extensor digitorum longus, tibialis anterior) were dissected out and placed on ice in a 50ml falcon tube containing PBS and penicillin-streptomycin (Pen/Strep) (ThermoFisher, 10,000 U/mL, cat # 15140122).

Muscles were transferred to a small petri dish for the removal of fat and tendons. PBS was added liberally to ensure that the muscles did not dry out. Excess PBS was removed, and the muscles were minced using curved scissors against the side of the petri dish. A working solution consisting of collagenase (5mg/mL, cat # LS004196, Worthington) and dispase (1.2U/mL, cat# LS02104, Worthington) was made up and filter sterilized using a 0.22μm2 syringe filter. A 25mL serological pipette was then used to transfer the muscle mixture to a 100mL Schott bottle with a magnetic stirrer. A general rule was followed that if the muscle pieces were able to pass through the pipette, the muscles were minced finely enough. Otherwise, further mincing was performed. A 4mL volume of the collagenase/dispase working solution was added to each bottle, and the cultures were digested at 37C for 30 minutes using a magnetic stirrer.

Following digestion, 10mL of Dulbecco's modified eagle medium (DMEM) with 10% Foetal bovine serum (FBS) (GE Life Sciences, cat# SH30243.01) was added, and the samples were transferred to 50mL falcon tubes. The tubes were centrifuged at 1500g for five minutes, followed by gentle aspiration of the supernatants. A 0.025% trypsin in EDTA solution was added, and the mixtures were returned to glass bottles for another 15 minute digestion at 37C using a magnetic stirrer. Next, 10mL of DMEM and 10% FBS media was added, and the cell suspensions were passed through a 100m cell strainer into a 50mL falcon tube. Samples were then centrifuged at 1500g for five minutes, followed by gentle aspiration of the supernatants. Cell pellets were resuspended in 10mL of DMEM and 10% FBS media, and cultured in T75 flasks for one hour at 37C. As only the fibroblasts are adherent at this time point, media aspiration removes the myoblasts, leaving behind only fibroblast cultures at the bottom of the flasks (394).

125

6.2.2. Tissue culture Three biological replicates were setup per genotype, with each replicate consisting of four mice. The biological replicates (WT1-WT3) were then split again into two technical replicates (e.g. WT1 created WT1a and WT1b). After their third passage, the fibroblasts were split 1:2 and grown on 92mm dishes for five days until confluent in 10ml of media (DMEM, 10% FBS, 3.7g/L pen- strep). After five days, the media was changed and Na-ascorbate was added to a final concentration of 0.25mM. Ascorbate treatment promotes the deposition of an extensive ECM in culture (395). The fibroblasts were grown for an additional 14 days, with daily Na-ascorbate treatment (0.25mM), and media changes every three days. After a total of 19 days in culture, the media was changed from DMEM and 10% FBS to DMEM and 5% FBS to reduce the likelihood of serum proteins interfering with the MS analysis. The cultures were grown overnight and then harvested for protein and RNA extraction.

6.2.3. RNA extraction RNA was extracted from P4 fibroblasts after 19 days in culture. The media was removed from the dishes and 2ml of warm collagenase (2mg/ml in 5% foetal calf serum and pen-strep) was added. The dishes were then incubated at 37ºC for 20 minutes. After digestion, 5ml of 0.25% trypsin/EDTA was added and incubated at 37ºC for a further 20 minutes. The mixture was then pipetted up and down, before being transferred to 15ml centrifuge tubes for centrifugation at 15,000g for five minutes. All subsequent steps were performed according to the Zymo RNA isolation kit (Promega, SV Total RNA Isolation system, Z3105). At the completion of the protocol RNA was eluted into DNase/RNase-free tubes and stored at -80ºC.

6.2.4. Sequential protein extraction Techniques such as sequential protein extractions allow for the isolation of relatively insoluble ECM proteins (396). Sequential protein extractions also enrich for the MS analysis of the less abundant ECM proteins (388), as well as increasing the signal to noise ratio for the detection of a larger range of proteins (389).

After 19 days in culture, P4 fibroblasts were extracted using the sequential three step protocol consisting of: an initial salt step to isolate ‘readily soluble’ proteins (NaCl fraction), followed by an SDS extraction for ‘intracellular proteins’ (SDS fraction), with the ‘poorly soluble’ proteins were extracted in the final GuHCl fraction. All reagents were prepared using keratin-free solutions and instruments inside an Airclean 600 PCR Workstation. All of the solutions used for protein work were made up using Milli-Q water.

126

Extraction protocol The cell layer was washed thoroughly with two 5mL volumes of warm PBS for five minutes each. Using tweezers, the cells and the deposited extracellular matrix were dislodged from the dish as a tissue-like layer and transferred to a 1.5mL Eppendorf. Excess PBS was removed after gentle centrifugation at 400g for five minutes.

Samples were deglycosylated using chondroitinase ABC to remove chondroitin, keratan, and heparan sulphate glycosaminoglycan (GAG) chains from proteoglycans. In addition to helping extract proteoglycans, enzymatic deglycosylation also reduces GAG interference during MS analysis (388). Chondroitinase ABC was made up to 0.1mU/L (5mU/L stock, AMS Biotechnology Europe Ltd, E1028-02) in 400L of chondroitinase buffer (50mM Tris HCl, pH 8, 50mM Na acetate, Sigma protease inhibitor tablet, cOmplete Mini EDTA-free, cat # 11836170001) and added to the samples. Following chondroitinase treatment, samples were incubated for six hours at 37ºC, with gentle mixing every two hours.

The first step of the sequential extraction protocol was isolation of readily soluble proteins using an isotonic NaCl solution. NaCl was added to a final concentration of 0.15M using a buffer consisting of 50mM Tris HCl pH 7.5, 50mM Na acetate and protease inhibitors. Eppendorf tubes were sealed with parafilm and rotated at 5 rpm overnight (4ºC). The next morning, samples were gently centrifuged at 400g for five minutes. The supernatants were transferred to 15ml falcon tubes and a nine times volume (9mL) of ice cold absolute ethanol was added, mixed by inversion, and stored at -20ºC. These samples will subsequently be referred to as the NaCl fraction.

The NaCl pellet was treated with 0.1% SDS in 50mM Tris HCl pH 7.5, 50mM Na acetate and protease inhibitors. Samples were sealed with parafilm and slowly rotated overnight in the cold room at 5 rpm. The following day samples were centrifuged at 13,000g for 20 minutes at 4ºC. The supernatants were transferred to 15ml falcon tubes and a nine times volume (9mL) of ice cold absolute ethanol was added, mixed by inversion, and stored at -20 ºC. These samples will subsequently be referred to as the SDS fraction.

The final pellet was resuspended in 1mL of 4M GuHCl (pH 5.8), 50mM Na acetate, 10mM EDTA, 65mM dithiothreitol (DTT), and protease inhibitors. Samples were sealed with parafilm and rotated at 5 rpm overnight at 4ºC.The following day samples were centrifuged at 13,000g for 20 minutes at 4ºC. The supernatants were transferred to 15ml falcon tubes and a nine times volume (9mL) of ice cold absolute ethanol was added, mixed by inversion, and store at -20ºC. These samples will subsequently be referred to as the GuHCl fraction.

127

Figure 6.1 The isolation of muscle-derived fibroblasts for tissue culture, RNA extraction, sequential protein extraction, and proteomics

(A) Fibroblasts were isolated for tissue culture from the hind-limb muscles of four week old male WT and KO mice. Each biological replicate consisted of four mice (e.g. WT1, KO1), which were then split in culture to create technical replicates (e.g. WT1a, WT1b). P3 fibroblasts were cultured for six days, while P4 fibroblasts were cultured for 19 days with ascorbate treatment; (B) Phase contrast images of P4 WT and KO fibroblasts grown in culture for five days; (C) RNA was extracted from P3 fibroblasts after six days in culture, and from P4 fibroblasts after 19 days in culture for subsequent qRT-PCR analysis; (D) After 19 days in culture, proteins were isolated in a three step sequence consisting of: an initial extraction in 0.15M NaCl, decellularisation in 0.1% SDS, and a final extraction in 4M GuHCl; (E) Sequentially extracted proteins were separated by liquid chromatography (LC) and analysed by tandem mass spectrometry (MS/MS).

128

Protein precipitation Following storage at -20ºC, the three fractions were transferred to 15mL glass corex tubes and centrifuged at 10,000g for 20 minutes at 4ºC. The resultant supernatants were discarded and the pellets were washed with 10mL of ice cold 70% ethanol, and centrifuged again at 10,000g for 20 minutes at 4ºC. The supernatant was discarded and the pellets were washed again three time in ice cold 70% ethanol. The final pellet was resuspended in 7M urea, 2M thiourea, and 30mM Tris pH 8.5. NaCl, SDS, and GuHCl samples were stored at -80ºC until ready for in solution digestion.

Protein quantification Protein concentrations were measured using a 2D protein quantitation kit (GE Life Sciences, cat# 80-6483-56). Briefly, a standard curve consisting of 0g, 10g, 20g, 30g, 40g, and 50g was setup in duplicate from a 2mg/mL stock BSA solution. The protocol was followed in accordance with the manufacturer’s instructions. At the end of the protocol, 100L aliquots of the standards and samples were pipetted, in duplicate, into a 96 well plate, with the absorbance read at 490nm using Gen5 on the Biotek Synergy 2 Spectrophotometer (Winooski, USA). After calculating a standard curve, the protein concentration for each sample was calculated (duplicates averaged) and expressed in g/L.

6.2.5. SDS-page and silver staining SDS-page was performed as follows: 5µg of protein, 5μL of NuPAGE® LDS Sample Buffer (4X), 50mM DTT, up to 20μL with Milli-Q. Protein samples were heated at 65°C for 10 minutes. Next, 1D electrophoresis was performed using BOLT 4-12% Bis-Tris 12-well precast gels (Life Technologies, Australia), and run in 3-(N-morpholino) propanesulfonic acid (MOPS) buffer (Life Technologies, Australia). Electrophoresis was performed at 160 volts for 50 minutes.

Silver staining is a sensitive protein detection method (331). Following SDS-page, the gels were silver stained to compare the abundance of WT and KO proteins prior to LC-MS/MS. All staining and wash steps were performed on a rocker. The gel was fixed for 30 minutes (50% methanol, 12% acetic acid, 0.05% formaldehyde), and then washed three times in 100mL of 35% ethanol for 10 minutes each. Gels were incubated for two minutes in sensitising solution (freshly prepared

0.02% Na2S2O3), accompanied by gentle agitation, followed by three more Milli-Q washes. The gels were incubated for 20 minutes in chilled silver stain (0.2% AgNO3, 0.076% formaldehyde), and then washed two times in Milli-Q. To develop the gels, an initial 50mL of chilled developer was added (5% Na2CO3, 0.05% formaldehyde, 0.0004% Na2S2O3), followed by a second 50mL volume. Development was stopped by adding 100mL of stop solution (50% methanol, 12% acetic acid), with care taken to avoid yellow backgrounds and over-development (331).

129

6.2.6. Proteomics

In solution protein digestion Proteins underwent a stepwise protocol of reduction and alkylation with DTT and iodoacetamide, followed by trypsin digestion. Dithiothreitol reduces the disulphide bonds between cysteine residues, and iodoacetamide modifies the reactive cysteine groups to form carboxylmethylated cysteines that are not capable of re-forming disulphide bonds. Dithiothreitol (10mM) was added to 20μg of protein and incubated overnight at 4°C. Prior to incubation, the tubes were flushed with nitrogen to minimise oxidation. The following morning, iodoacetamide was added to a final concentration of 50mM and incubated at room temperature for two hours.

Prior to MS/MS, protein samples must be enzymatically digested into peptides (397). Proteins were co-precipitated overnight at -20°C with 1μg of trypsin in 500μL of ice cold absolute methanol. The trypsin-protein precipitates were then centrifuged at 10,000g for 20 minutes at 4°C. The supernatant was removed and an additional 500μL of ice cold absolute methanol was added. The spin was repeated, supernatant removed, and the pellet air dried for five minutes. The pellets were reconstituted in 20μL of 100mM ammonium bicarbonate and incubated at 37°C for five hours, with an additional 1μg of trypsin added after two hours. Digests were terminated by freezing at -80°C.

Formic acid and acetonitrile gradients are commonly used to separate proteins by High Performance Liquid Chromatography (HPLC) prior to MS. Therefore, 0.1% formic acid and 3% acetonitrile were added to the samples to prepare them for HPLC. A final clean-up step was then performed to remove excess salts and compounds that may interfere with the peptide ionization (398). As part of the clean-up samples were transferred to a 30K Nanosep cartridge (Pall Life Sciences) and centrifuged at 10,000g at room temperature for 10 minutes (or until no volume remained above the filter). The filtrate was transferred to Exigent sample vials and then stored at -20°C. Finally, samples were re-suspended in 20μL of 3% acetonitrile, 97% Milli-Q and 0.1% formic acid, sonicated, and vortexed for 20 minutes each. Samples were then analysed by liquid chromatography-tandem mass spectrometry (LC-MS/MS).

In gel protein digestion All steps were performed in an Airclean 600 PCR Workstation. The first step was to wipe the glass plate with methanol and place the gel on top of the plate. The gel bands of interest were cut out using a sterile scalpel blade (Swann Morton, 3-3L-5-7-9-B3) and placed into 100μL of de- stain solution (30mM ferricyanide, 100mM sodium thiosulphate dissolved in Milli-Q water and mixed 1:1). Samples were incubated for eight minutes, with constant flicking to mix the samples. De-stain was removed and samples were washed three times in 200μL of Milli-Q water for five

130 minutes each wash. Samples were then dried using a Mi-Vac Duo-concentrator (Barnstead Genevac) for two hours at 30°C, and the resulting gel pieces were stored at -20°C.

Reduction and alkylation The gels pieces were re-hydrated in a 20μL of 10mM DTT and 40mM ammonium bicarbonate. Samples were incubated at 60°C for 40 minutes. After removing the DTT solution, samples were incubated in the dark for one hour in 20μL of a solution containing 50mM iodoacetamide and 40mM of ammonium bicarbonate. After one hour the solution was removed and samples were washed three times with Milli-Q water with gentle shaking for a five minutes per wash.

Trypsin digestion Digestion buffer was prepared and stored on ice (10% acetonitrile, 40mM ammonium bicarbonate, made up to 1mL with Milli-Q water). Next, 3μg of trypsin (Sigma Aldrich, cat # T6567-5X20UG) was added to 150μL of digestion buffer and stored on ice. Gel pieces were hydrated further by the addition of 30μL of digestion buffer. Samples were then incubated in 15μL of trypsin solution (0.3μg of trypsin per sample) at room temperature for one hour. After one hour, any liquid was removed and 15μL of digestion buffer was added. Samples then underwent digestion at 37°C for 18 hours.

Extraction The next morning samples were incubated in 5μL of 10% formic acid at room temperature for 10 minutes. Another 10 minute room temperature incubation followed in 10μL of 50% acetonitrile and 1% formic acid. Samples were then concentrated to a volume below 10μL using the Mi-Vac Duo-concentrator. A further 15μL of 0.1% formic acid was added and samples were stored at - 80°C until ready for LC-MS/MS processing.

LC-MS/MS protocol Samples were submitted for processing at the Mass Spectrometry and Proteomics facility at The University of Melbourne, Bio21 Institute. LC-MS/MS was performed on a LTQ Orbitrap Elite (Thermo Scientific) with a nano-electrospray interface coupled to an Ultimate 3000 RSLC nano- system (Dionex). The nano-LC system was equipped with an Acclaim Pepmap nano-trap column (Dionex – C18, 100 Å, 75µm x 2cm) and an Acclaim Pep-map analytical column (Dionex C18, 2µm, 100 Å, 75µm x 15cm). A total volume of 5µL of the peptide mix was loaded onto a Pepmap nano-trap column at an isocratic flow of 5µL/min using a solution of 3% acetonitrile and 0.1% formic acid for five minutes, before the enrichment column was switched in-line with the analytical column.

The eluents used for the liquid chromatography were 0.1% (v/v) formic acid (solvent A) and

100% CH3CN/0.1% formic acid (v/v) (solvent B). The following gradient increases were used:

131

6% to 10% solvent B over 12 minutes, 10% to 30% solvent B over 20 minutes, 30% to 45% solvent B over 2 minutes, 45% to 80% over two minutes and maintained at 80% solvent B for three minutes. Equilibration was achieved at 3% solvent B for seven minutes, before the next sample was injected. The LTQ Orbitrap Elite mass spectrometer was operated in the data dependent mode with a nano ESI spray voltage of +2.0kv, capillary temperature of 250°C and a S-lens RF value of 60%. Spectral data was acquired in positive mode with full scanning from 300-1650 (m/z) at 240,000 resolution. Collision induced dissociation (CID) analysis was performed in the linear ion trap, with the 10 most intense peptide ions with charge states ≥ 2 isolated and fragmented using normalized a collision energy of 35 and an activation Q of 0.25.

MS analysis

Maxquant Raw files were downloaded from the Mass Spectrometry and Proteomics facility server and analysed using Maxquant version 1.5 (399). A fasta file of the complete Mus musculus proteome was obtained from Uniprot (34029 sequences, July 2015) to allow spectra to be searched using the Maxquant Andromeda internal search engine. The Maxquant settings used were: label free quantification variables left as default, except that ‘match between runs’ was selected with a match time window of two minutes, variable modification selections were oxidation (M) and acetyl (protein N-terminal), fixed modifications were Carbamidomethyl (C), the specific enzyme was Trypsin/P with maximum missed cleavages set to 2, peptide and protein false discovery rates were set to 0.01 with maximal posterior error probability at 0.01, the minimal peptide length was 7 and the number of minimum peptide and ‘razor and unique peptides’ was set to 1, which meant that for a protein group to be counted at least 1 ‘unique or razor peptide’ had to be identified.

Maxquant summed the raw protein intensities from unique and razor peptide intensities, which were then then normalized using the MaxLFQ algorithm to give the label free quantification (LFQ) intensity values (399). The LFQ intensities were used to compare the amount of individual proteins across samples, i.e. to detect if a protein was more or less abundant in the KO compared to WT. An alternative readout produced in Maxquant was the intensity based absolute quantification (iBAQ) value. iBAQ values were calculated in MaxQuant by dividing the raw protein intensities by the number of theoretical peptides. iBAQ is better suited for quantifying the amount of protein in a given sample, or in this case the intensity of proteins within a gel band.

Perseus Perseus is a comprehensive statistical tool for the analysis of quantitative protein abundance data generated by MS (400). LFQ and iBAQ values were imported into Perseus (v1.4.1.3) for quantification. The Perseus settings used were: ‘filter rows based on categorical column’, select

132

‘reverse’, ‘only identified by site’ and ‘contaminant’ hits, log transform the data. Data was grouped using ‘annotation rows’ according to genotypes and/or fraction, rows were filtered based on ‘valid values’, the expression column was renamed using ‘rename columns [reg.ex.]’, data was analysed by hierarchical clustering to produce PCA plots, missing values were imputated using ‘replace missing values from normal distribution’. This imputation method for missing proteins was performed from a narrow normal distribution at the detection limit of a protein. The LFQ data was analysed in two ways; the first was WT vs KO across a combination of all fractions (NaCl, SDS, GuHCl), and the second was a comparison of WT vs KO for each individual fraction.

For both fractionated and combined analysis, a protein was retained for further analysis based on a number of key criteria. First, the protein had to be represented by at least two peptides. Second, values had to be detected in at least one biological replicate from both WT and KO groups. Proteins that passed these first two rounds of filtering were filtered one more time based on the requirement that values were detected in at least three out of the six samples. Statistical testing was performed by comparing the LFQ intensities of WT and KO samples in Perseus. A ‘two sample t-tests’ was performed, with the results displayed as the fold difference of KO relative to WT. Relative protein abundances across genotypes were calculated using t-test values with a permutation false discovery rate of 0.01, S=1, and 250 randomisations. The t-test difference produced in Perseus was converted to fold change in Microsoft Excel using the formulas: =2^(t- test difference) for positive values, =-(2^(- t-test difference)) for negative values. Protein ratios and significance values were used to identify proteins that were altered >1.5 fold with a p < 0.05. Graphpad Prism 7 was used to create volcano plots based on log2 (fold change) vs –log10(p value).

133

6.3. Results and discussion

6.3.1. Adamts and proteoglycan gene expression RNA was isolated from P3 and P4 fibroblasts to profile the expression of Adamts proteinases and ECM proteins. The expression of Adamts1, Adamts4, Adamts5, Adamts9, and Adamts15 was analysed as they all share substrate specificity for versican, the proteoglycan target utilised in this study as a readout of ADAMTS activity (100-103). Figure 6.2A confirms the expression of Adamts5 in WT fibroblasts, as well as the lack of expression in KO fibroblasts. Adamts1 was the most highly expressed, while Adamts4, Adamts9 and Adamts15 were lowly expressed. As was the case in muscle, none of the profiled Adamts proteinases were upregulated in KO fibroblasts to compensate for the absence of Adamts5. The expression of Adamts proteinases was not different between P3 and P4 fibroblasts.

The gene expression of key ECM proteins; versican, biglycan, collagen VI (Col6α1), and fibronectin, was compared between WT and KO fibroblasts to ascertain if the absence of ADAMTS5 affected the ability of fibroblasts to produce a matrix. The gene expression of these key ECM proteins was not different between the genotypes (Figure 6.2B). P4 fibroblasts were cultured for 19 days with Na-ascorbate to promote collagen secretion and ECM deposition, while P3 fibroblasts were cultured for six days without ascorbate. Interestingly, neither the addition of ascorbate, nor an extra 13 days in culture affected the expression of the ECM genes profiled in the P3 and P4 fibroblasts (Figure 6.2B).

To rule out myoblast contamination in the fibroblast cultures, the gene expression of the myogenic regulatory factor MyoD was analysed by qRT-PCR. In comparison with the muscle positive control, no MyoD expression was detected in WT or KO fibroblasts (Figure 6.2C), which signifies no detectable myoblast contamination in the fibroblast cultures.

134

Figure 6.2 The gene expression of Adamts proteinases, ECM proteins, and MyoD in WT and KO fibroblasts qRT-PCR analysis was performed on mRNA extracted from P3 and P4 WT and KO fibroblasts. (A) Gene expression of Adamts1, Adamts4, Adamts5, Adamts9, and Adamts15 in P3 and P4 fibroblasts; (B) Gene expression of the ECM proteins versican (V0, V1, V2, and V3 isoforms), biglycan, Col6a1, and fibronectin Adamts15 in P3 and P4 fibroblasts; (C) Gene expression of the myogenic marker MyoD in P4 fibroblasts (WT muscle used as a positive control). Gene expression data presented as mean normalised expression (MNE) relative to the house keeper gene HPRT. Analysis was performed by Kolmogorov-Smirnov and unpaired Student’s t-tests (n = 3). No significant differences were observed between the two groups.

135

6.3.2. Silver staining of WT and KO proteins in sequential extracts Despite identical culture and extraction conditions, the concentration of KO proteins were consistently greater than WT in the GuHCl fraction (Figure 6.3A). The GuHCl fraction contains a large proportion of the less soluble ECM components. Therefore, the differing amounts of protein extracted between the two genotypes may reflect differences in the extractability of ECM proteins. The notion of ECM protein extractability will be discussed later by comparing the protein abundances of NaCl and GuHCl fractions.

Following 1D gel electrophoresis proteins were visualised by silver staining. No obvious differences were observed between the groups in either the NaCl or SDS gels. However, differences were evident at the top (approximately 260kD) and bottom (approximately 80kD) of the GuHCl gel. The prominent upper and lower bands present in the WT samples were absent in the KO (Figure 6.3B). To investigate precisely which proteins were responsible for the GuHCl differences, the gel bands of interest were excised, digested, and analysed by MS.

Figure 6.3 Silver stained WT and KO protein extracts from sequential extracts

(A) Protein concentrations of WT and KO samples across the three sequential fractions; (B) Silver staining of the three WT and KO biological replicates across NaCl, SDS and GuHCl fractions (5μg loaded). The boxed areas on the far right highlight bands of interest that were excised from the GuHCl gel for in-gel digestion and proteomic analysis.

The gel bands of interest were investigated using iBAQ proteomic analysis. iBAQ analysis is used to compare the abundance of proteins within a sample (401). In the standard Perseus bioinformatic setup, all bovine and keratin contaminants were filtered and removed. After initially observing no

136 significant iBAQ differences between WT and KO, the data was reanalysed with all contaminants retained. Upon re-analysing the data, there were significant differences between the two groups in terms of bovine serum albumin (BSA) (Figure 6.4B). Significantly, the molecular weight of BSA (66kD) also corresponds with the lower band of interest. BSA contamination would most likely come from the FBS in the cell culture medium. The most obvious explanation for why contamination was detected in the WT samples only is inconsistencies in the wash steps. However, this explanation is unlikely as the contamination was detected in the GuHCl fraction. At the GuCHl fraction both samples had undergone 24 hours of serum reduction, and several rounds of washes and buffer changes.

The concentration of KO protein was on average 2.8-times greater than WT in the GuHCl fraction. This difference may be due to differences in the extractability, or solubility of ECM proteins. The KO matrix may be less compact, and hence easier to extract. It has previously been proposed that ADAMTS5 cleavage of versican-hyaluronan aggregates is critical for the maintenance of a compact provisional matrix (166). Therefore, the solubility differences between WT and KO may result from differences in the compactness of the matrix arising due to the absence of ADAMTS5. Differences in the matrix composition and/or extractability between WT and KO may also help explain the BSA contamination. If indeed the WT matrix is harder to extract, then it may be that more BSA is bound to proteins in the WT matrix compared to the KO matrix. Therefore, the BSA contamination may reflect differences in ECM binding and solubility. Ultrastructural analysis of WT and KO samples may provide more information regarding the structure and compactness of these matrices (396).

137

Figure 6.4 Identification of protein bands from MS analysis of WT and KO GuHCl in gel digests

Absolute protein iBAQ values and the iBAQ percentage of proteins, as calculated from the summed iBAQ value for the entire gel band. The iBAQ percentage provides a relative proportion for each protein within the gel band. Proteins were listed from highest iBAQ percentage to lowest (top to bottom of table). (A) The lower gel band (~80kD) with accompanying protein table; (B) The upper gel band (~260kD) with accompanying protein table.

138

6.3.3. Principal Component Analysis of WT and KO combined data The initial WT vs KO abundance comparison was performed using the combined LFQ intensities of NaCl, SDS, and GuHCl extracts. Principal Component Analysis was performed on these combined protein abundances (LFQ intensities) to give a readout of the variability between the samples. Figure 6.5 shows that the KO samples grouped closely, but that large variability was observed between the three WT samples. In particular, WT3 grouped with the KO samples. This observation fits with the protein concentrations of the WT samples (Figure 6.3A), where WT3 was consistently different to the other two samples across all three extracts. Due to the low number of biological replicates in this experiment, no outlying samples were removed for MS analysis. In the future, increasing the number of replicates may help to placate the variability inherent in the analysis of complex samples.

Figure 6.5 Principal component analysis of combined WT and KO replicates

The LFQ intensities of WT and KO samples were compared in Perseus to generate a principal component analysis. The KO samples grouped closely, but variability was observed between the WT samples.

139

6.3.4. Comparing the protein abundance of WT and KO samples from a combined analysis of all three extracts The initial comparison of protein abundance between WT and KO was performed using the combined LFQ intensities of NaCl, SDS, and GuHCl extracts. Following Perseus bioinformatic processing, a total of 1356 proteins were retained for analysis. This number is comparable to previous proteomic investigations of human primary dermal fibroblasts where a total of 1831 proteins were reported (402), while another study used sequential fractions to extract 819 proteins from murine cartilage (396).

In this experiment, protein abundance differences were considered significant if they met the criteria of greater than 1.5-fold difference, and a p value of less than 0.05. Two tailed t-tests were performed in Perseus and the results were displayed as the fold difference of KO relative to WT. Based on the significance criteria, 23 proteins were more abundant in the KO and only three proteins were more abundant in the WT (Figure 6.6A). The majority of the proteins upregulated in the KO perform functions related to membrane traficking, ribosomal binding, and metabolism. The largest difference was observed in Atp5l (ATP synthase subunit g, mitochondrial), which was 8.32-fold more abundant in the KO than WT.

This study focused on how the absence of ADAMTS5 affects the abundance of proteins in the ECM. ECM proteins were identified by comparing the total protein list alongside the matrisome list of ECM proteins. From the total protein list, 104 ECM proteins were detected. In comparison, of the 1831 total proteins extracted from human primary dermal fibroblasts by Kuttner et al., 664 were ECM proteins (402). However, major differences exist between the two studies in terms of experimental design, as well as the definition of what constitutes the ECM. In the Kuttner study a large proportion of proteins were extracted earlier in the conditioned media, with the remaining ECM harvested using a combination of Triton and SDS, not GuHCl as was used in this experiment. Proteomic analysis of the conditioned media is an important difference to consider as ADAMTS5 acts extracellularly. Secondly, this thesis defined ECM proteins based on whether they were included in the matrisome inventory (43), while Kuttner et al defined ECM proteins based on ‘GO terms’, with only 20% of their identified ECM proteins considered as components of the matrisome (402).

The only two ECM proteins that were significantly different between WT and KO were collagen α- 1(XV) and fibromodulin, which were increased by 2.36-fold and 1.57-fold respectively in the KO (Figure 6.6B). Fibromodulin is a small leucine-rich repeat proteoglycan involved in collagen fibrillogenesis. ADAMTS5 cleaves fibromodulin in vitro (336). This result raises the question as to whether the lack of cleavage in KO fibroblasts affects the abundance of fibromodulin? However, there were no significant differences in the abundance of any other proteoglycan between WT and KO. Although non-significant, the abundance of the proteoglycan targets versican, biglycan, decorin, and

140 lumican were consistently higher in KO compared to WT (Figure 6.6C). The lack of significance suggests that variability may be an issue, with previous PCA analysis showing a significant amount of variability in the WT samples. Future experiments with additional WT samples may help to reduce the amount of sample variability.

141

Figure 6.6 Comparison of WT vs KO protein abundances

Protein abundance displayed as the fold difference of KO relative to WT. (A) The abundance of all proteins in KO compared to WT samples; (B) The abundance of ECM proteins in KO compared to WT samples. Proteins were considered significantly different if they met the criteria of >1.5-fold (blue dotted line) and p < 0.05 (red dotted line) (n = 3); (C) Proteoglycan abundance differences between WT and KO.

142

6.3.5. Principal Component Analysis of sequential extracts from WT and KO samples Sequential protein extractions were performed to increase the MS signal to noise ratio, thus increasing the probability of successful protein identifications (389). The sequential extractions produced three separate fractions; NaCl, SDS, and GuHCl, with each subsequent fraction containing proteins of decreasing solubility. Label-free MS analysis of the three different fractions allowed for the interrogation of both protein abundance and solubility differences between the two genotypes (396).

As was shown earlier in the Principal Component Analysis for the combined fraction analysis, a large amount of variability was observed between the three WT samples. To understand where this variability originated, Principal Component Analysis was also performed on WT and KO ‘a’ and ‘b’ technical replicates from each individual extraction fraction (Figure 6.7A). All samples grouped according to their extraction fractions, but again variability was observed between the WT samples, in particular in the SDS fraction. Figure 6.7A shows that the variability was caused by a combination of biological and technical differences within genotypes. Despite this variation, the small sample size of three meant that it was not feasible to remove outliers from the Max Quant and Perseus analysis. Technical replicates were combined in Max Quant to create single biological replicates (e.g. WT1a and WT1b combined). Figure 6.7B shows that combining technical replicates reduced the amount of variability within each genotype, especially in the SDS fraction. All of the subsequent data presented in this chapter is based on three biological replicates from each genotype at the three extraction fractions (NaCl, SDS, and GuHCl).

143

Figure 6.7 Principal component analysis of WT and KO replicates in NaCl, SDS and GuHCl extraction fractions

The LFQ intensities of WT and KO samples were compared in Perseus to generate a principal component analysis. (A) Plots of technical replicates from each extraction fraction; (B) biological replicates were created by combining technical replicates from each extraction fraction. The data clustered according to the fraction in which they were extracted. Variability was observed between the WT samples, in particular in the SDS fraction.

144

6.3.6. WT and KO matrisomes from sequential extracts Protein lists generated in Perseus were analysed alongside the matrisome list to identify ECM proteins. Figure 6.8 depicts the matrisomes of both WT and KO samples as the same ECM proteins were extracted in each group. In this study 79 ECM proteins were extracted in both the NaCl and SDS fractions, and 54 were extracted in the GuHCl fraction. In comparison, sequential extractions of cardiac muscle produced 71, 28, and 84 ECM proteins from the NaCl, SDS, and GuHCl fractions respectively (388).

As mentioned earlier, the matrisome can be divided into core-matrisome proteins (ECM glycoproteins, collagens, and proteoglycans), and matrisome-associated proteins (ECM-affiliated proteins, ECM regulators and secreted factors) (386). Figure 6.8 shows the transition from predominantly matrisome- associated proteins to core-matrisome proteins. This transition reflects the solubility of the proteins extracted in each successive fraction. In theory, loosely bound ECM components and soluble proteins should be more abundant in the NaCl fraction, while intracellular proteins should be extracted by the SDS step, with the remaining less soluble ECM fraction collected using GuHCl (388).

As expected, the mildly dissociative NaCl buffer produced extracts that were enriched in secreted factors, while the denaturing guanidine buffer produced extracts that were enriched in ECM glycoproteins and collagens. A previous sequential extraction study reported an enrichment of proteoglycans in the GuHCl fraction, but the current study did not observe a difference between the three fractions in terms of proteoglycan abundance. The comparable protein compositions of the NaCl and SDS extracts suggests that a large number of proteins were carried over into the later. Extending the NaCl extraction time may reduce this carry over for future experiments.

The absolute number of core-matrisome proteins did not change significantly between the fractions, which can be explained by the fact that peptides from these proteins were detected across multiple fractions. However, the proportion of core-matrisome proteins increased with each successive fraction, which reflects the lower abundance of the more soluble matrisome-associated proteins. The proteoglycans present in all three fractions were heparan-sulphate proteoglycan 2, prolargin, and the ADAMTS5 targets biglycan, and versican. The small leucine-rich proteoglycans decorin, lumican, and fibromodulin, which are all ADAMTS5 targets, were found in the NaCl and SDS fractions only.

145

Figure 6.8 The Matrisomes of WT and KO fibroblasts across NaCl, SDS and GuHCl fractions

The donut plots divide the ECM proteins into core matrisome (blue) and matrisome-associated (red). The core and associated protein groups were divided further into ECM glycoproteins, collagens, proteoglycans, ECM-affiliated proteins, ECM regulators, and secreted factors. As the same ECM proteins were present in both genotypes, these donut plots depict the matrisome of both WT and KO samples.

146

6.3.7. Comparing the protein abundance and solubility of WT and KO samples between fractions Protein abundance differences from within individual extraction fractions were compared between the two genotypes. In the NaCl fraction, macrophage colony-stimulating factor (-1.96-fold) and collectin- 12 (-1.83-fold) were less abundant in the KO (Figure 6.9A), while in the SDS fraction secreted frizzled- related protein 1 (1.67-fold) and elastin microfibril interface 1 (emilin-1) (8.7-fold) were increased in the KO (Figure 6.9B). In the GuHCl fraction procollagen-lysine,2-oxoglutarate 5-dioxygenase 3 (1.72- fold) was more abundant in the KO, and fibrillin-1 (-5.6-fold) was down in the KO (Figure 6.9C).

The two largest differences were observed in emilin-1 and fibrillin-1, both of which are glycoproteins involved in microfibril/elastin formation. The fact that such large abundance differences were observed in individual fractions, but not in the combined analysis, suggests that differences may exist in their extractability. It is likely that the same amount of the protein is present in both the WT and KO, but that the two groups differ in terms of the distribution of the protein across the fractions.

Previous work has proposed a connection between ADAMTS proteinases and fibrillin-1 (80). This association was first identified from mutations in ADAMTS10, ADAMTS17, ADAMTSL2, and ADAMTSL4, which were shown to phenocopy disorders caused by mutations in fibrillin-1 (403). The mechanism responsible is unknown, but may be related to structural homology, or their related roles in microfibril biogenesis (403). It has been demonstrated that ADAMTS10 is capable of cleaving fibrillin- 1 (404), but it is not known whether ADAMTS5 is also capable of processing fibrillin-1. Following its secretion from cells, fibrillin-1 is proteolytically processed by furin/PACE to remove C- and N-terminal pro-peptides. This proteolytic step and the assembly of fibrillin-1 occur at either the cell surface or in the pericellular matrix, which are locations where ADAMTS proteinases function. Cell-surface proteoglycans are also involved in fibrillin-1 assembly (405). More specifically, the C-terminal (G3 domain) of versican was shown to bind fibrillin-1 in a calcium dependent manner (81). The functional significance of this connection was not demonstrated, but may involve stabilisation of the microfibril via the connection to the hyaluronan-rich matrix (81). The current understanding is that ADAMTS5 cleaves versican close to its N-terminus, which theoretically should not prevent the C-terminal of versican from binding to fibrillin-1. However, data from this experiment demonstrates that the absence of ADAMTS5 affects the abundance of fibrillin-1 in the GuHCl fraction, possibly due to changes in the solubility of the protein. Therefore it may be that ADAMTS5 versican processing is influencing how fibrillin-1 is bound within the matrix, and hence its extractability.

The extractability, or solubility, of a protein can be quantified by comparing its abundance between the soluble (NaCl) and insoluble (GuHCl) fractions (396). In WT samples, fibrillin-1 was 106-fold more abundant in the GuHCl fraction compared to the NaCl fraction, while it was only 24-fold more abundant

147 in the GuHCl fraction in the KO. This result fits with the fact that fibrillin-1 was more abundant in the WT relative to the KO in the GuHCl fraction. This may be because more fibrillin-1 remains within the insoluble pellet of KO samples than in WT samples. It remains to be validated, but it may be that the absence of ADAMTS5 affects the solubility of fibrillin-1, possibly via proteolytic processing.

148

Figure 6.9 Comparing the abundance of proteins from WT and KO samples in NaCl, SDS, and GuHCl extractions

(A-C): The abundance of proteins from WT and KO samples. The volcano plots are presented as KO relative to WT, meaning that proteins above the upper blue dotted line are more abundant in KO, and proteins below the bottom blue dotted line are more abundant in WT. Proteins were considered significantly different if they met the criteria of >1.5-fold (blue dotted line) and p < 0.05 (red dotted line) (n = 3). (A) KO vs WT protein abundance from the NaCl fraction. Macrophage colony-stimulating factor and collectin-12 were more abundant in the WT than the KO. (B) KO vs WT protein abundance from the SDS fraction. Secreted frizzled-related protein 1 and emilin-1 were more abundant in the KO. (C) KO vs WT protein abundance from the GuHCl fraction. Procollagen-lysine was more abundant in the KO, and fibrillin-1 was higher in the WT.

149

6.3.8. Versican proteolysis and abundance ADAMTS processing of versican produces a cleavage product with the sequence DPEAAE at the C- terminus that can be detected with a specific neo-epitope antibody (103). It was hypothesised that the absence of ADAMTS5 proteolytic activity would result in less versican cleavage, which would be reflected in reduced DPEAAE immunostaining in KO fibroblasts. It was also hypothesised that the DPEAAE fragment would be liberated from the matrix upon cleavage, and hence would be detected in the readily soluble NaCl fragment.

Despite being designed to detect only the cleaved DPEAAE versican fragment, the DPEAAE antibody also detects full length (uncleaved) versican (personal communication with Dr Carmela Ricciardelli). The presence of uncleaved versican, coupled with the absence of cleaved versican in the GuHCl fraction (Figure 6.10), supports the hypothesis that cleaved versican is more soluble than the uncleaved form. However, despite equal protein loadings of each fraction (10µg), a greater amount of both cleaved and uncleaved versican (bottom and top bands respectively in Figure 6.10) were detected in the NaCl fraction compared to the GuHCl fraction. If cleaved versican was liberated from the matrix, then by deduction the uncleaved form should remain in the matrix and be more abundant in the less soluble GuHCl fraction. It may be that versican does remain within the matrix following cleavage, but it is unclear why so much of the uncleaved form should be present in the readily soluble fraction. Immuno- staining from Chapter 3 supports this result by demonstrating that cleaved and full length versican are present in similar locations in the ECM around myofibres.

The abundance of versican was not different between WT and KO in any of the extraction fractions (Figure 6.9). This result was supported by the DPEAAE Western blot which showed that versican cleavage was not different between WT and KO fibroblasts (Figure 6.10). WT and KO fibroblasts did not differ in terms of versican expression, and no other ADAMTS proteinases were upregulated to compensate for the absence of ADAMTS5 (Figure 6.2). Expression does not reflect activity, therefore one of the profiled versicanases may well be responsible for cleaving versican to produce the DPEAAE fragment, or alternatively another protease could be responsible.

The most perplexing result from the DPEAAE Western Blot was the large difference in versican cleavage between fibroblasts and the skeletal muscle positive control. In KO muscle the cleavage of versican was significantly different compared to the WT, but no cleavage differences were evident between WT and KO fibroblasts. The fibroblasts were derived from WT and KO skeletal muscle, but it appears that either the tissue culture steps have altered the matrix environment such that ADAMTS5 is not active, or that a co-factor necessary for cleavage was absent from the fibroblast ECM. Fibulin-1 has been shown to co-localise with versican and act as a co-factor for ADAMTS5-mediated versican proteolysis (104). Fibulin-1 was not detected in any WT or KO fibroblast extraction fractions, which raises the possibility that its absence may be affecting ADAMTS5-mediated versican proteolysis.

150

Alternatively, the DPEAAE fragment in fibroblasts may be lost in the conditioned media during tissue culture. Therefore, future experiments using conditioned media extracted earlier in the protocol may be more informative than the current approach.

Figure 6.10 WT and KO versican proteolysis in fibroblasts and muscle

Western blots of NaCl and GuHCl fractions from muscle derived fibroblasts using the versican V0/V1 (DPEAAE) neo-epitope antibody. 10µg of protein was loaded into each well and a skeletal muscle positive control is displayed in the far right lanes.

151

6.4. Conclusions and future directions This thesis employed solubility-based protein fractionation to investigate differences in ECM protein abundance between WT and KO fibroblasts. Differences were observed in the abundance of some ECM proteins, including: fibromodulin, collagen α-1(XV), macrophage colony-stimulating factor, collectin- 12, secreted frizzled-related protein 1, elastin microfibril interface 1 (emilin-1), procollagen-lysine,2- oxoglutarate 5-dioxygenase 3, and fibrillin-1. Fibromodulin and fibrillin-1 are particularly interesting in the context of ADAMTS5. Fibromodulin is a small leucine-rich repeat proteoglycan cleaved by ADAMTS5 in vitro (336), while fibrillin-1 binds to the C-terminal (G3 domain) of versican (81). This result raises the question as to whether the absence of ADAMTS5 proteolytic activity in KO fibroblasts affects the abundance of fibromodulin and fibrillin-1? However, it is hard to draw conclusions from this result given that there were no significant differences in the abundance of any other proteoglycans, as well as the large variability observed within WT samples.

Versican cleavage was not affected by ADAMTS5 ablation in KO fibroblasts. Therefore, this thesis did not elucidate how proteolytic processing affects the abundance, and/or solubility of ECM proteins. It is also unclear as to whether the versican processing result can be extrapolated to other proteoglycans, i.e. is the processing of any proteolytic target different between WT and KO. If not, then this may help explain why little differences were observed in the abundance of ECM proteins between WT and KO matrisomes. To test these questions, future experiments will focus on in vivo label-free proteomic analysis of skeletal muscle tissue. Fluorescence-activated cell sorting (FACS) may also help to decipher abundance differences, as well as any possible communication between cell types within the muscle.

Label free LC-MS/MS may be a powerful tool for investigating abundance differences between samples, but it does not provide direct evidence regarding the proteolytic activity of a protease. Elucidating the full impact of a protease requires detection of specific cleavage peptides (406). Aggrecan and versican processing by ADAMTS members can be interrogated using neo-epitope antibodies specific to newly produced N- or C-terminal fragments created by proteolysis. However, this tool is only applicable for single proteolytic events, which means it does not take into account multiple cleavages, or processing by additional proteases (93). An additional versican cleavage site was discovered in the V0 isoform from aortic extracts (103), but more undoubtedly await discovery.

TAILS (Terminal amine isotopic labelling of substrates) is a powerful new proteomic platform for protease substrate discovery and N-termini proteome analysis (407). The technique uses negative selection and primary amine labelling to enrich for N-terminal peptides of interest. A recent study utilised TAILS to characterise protein abundance and cleavage differences between WT mice and mice deficient in MMP2 (408). Future experiments that incorporate both TAILS and label free LC-MS/MS on a larger sample size will allow us to further elucidate abundance differences, as well as help to validate potentially new cleavage substrates, such as fibrillin-1.

152

7. General Discussion

A study investigating cartilage destruction in arthritis reported that Adamts5-/- mice presented with no muscle phenotype (155). However, subsequent works showed that ADAMTS5 was expressed during embryonic muscle development (2), that it was involved in pericellular matrix clearance during myoblast fusion (1), and that its expression was upregulated in DMD and the mdx mouse model (3, 4). This thesis aimed to investigate the role of ADAMTS5 in postnatal muscle growth, function, and adaptation to exercise, as well as its role in the mdx mouse pathology. Based on the lack of a viable ADAMTS5 antibody (personal communication with Prof. Amanda Fosang), and previous ADAMTS5 research in skeletal muscle (1), versican processing was utilised as a readout of ADAMTS activity (100- 103).

In Chapter 3 the expression and activity of ADAMTS proteinases were profiled in skeletal muscle. The chapter also set out to investigate whether the absence of ADAMTS5 produced a muscle phenotype in KO mice. The absence of ADAMTS5 did produce differences in ADAMTS activity, as measured from versican cleavage differences between WT and KO muscle. However, despite these apparent differences in activity, KO mice did not present with a muscle phenotype, which was assessed based on postnatal muscle growth and function. Compensation from other ADAMTS members was ruled out as no major differences were observed in the gene expression of known ADAMTS versicanases between the two groups. Therefore, it was concluded that despite being the main versicanase in muscle, ADAMTS5 is dispensable for adult muscle development, and function.

Functional skeletal muscle changes occur under various conditions and in response to a wide range of pathological and physiological stimuli, with most requiring remodelling of the ECM by degradation (6). Immuno-blotting for the cleaved form of versican showed that degradation was not greater in exercised mice compared to sedentary mice. However, it may not be the amount of processing that is significant in ECM remodelling, but rather where the processing occurs. ADAMTS-mediated processing of versican was detected at the neuromuscular junction and around endothelial cells. Previous work has shown that proteolytic processing of ECM proteins is important for angiogenesis (5), while Adamts5 has been detected in the developing neuromuscular junction (2). The significance of spatial versican processing has been discussed previously in a developmental model of inter-digital web regression (104). This work demonstrated that the presence of ADAMTS-cleaved versican at specific locations was critical for web regression (104). The authors went on to show that DPEAAE performs biological functions by adding recombinant forms of the fragment (104).

Exercising WT and KO mice demonstrated that ADAMTS5 was indeed involved in how muscle adapts, but the extent to which phenotypic differences can be attributed to ECM remodelling events, such as

153 versican processing, is unknown. Exercise experiments using the Adamts5 Δ-cat mouse, in which only proteolytic activity is ablated, would provide information as to how much ADAMTS5 ECM processing is responsible for exercise-induced muscle adaptations. Likewise, experiments utilising conditional Adamts knockout mice may provide more information regarding ADAMTS5 spatial proteolysis.

Central to this thesis was the hypothesis that the genetic ablation of ADAMTS5 would ameliorate the mdx dystrophic pathology. The most promising results observed in mdx ko mice were the reduced creatine kinase concentration and improved fatigue resistance. The precise mechanism that links ADAMTS5 activity and muscle fatigue remains to be elucidated, but based on these preliminary results could involve angiogenesis, neuromuscular signalling, or t-tubule function. Blood flow and oxygen delivery are critical factors that influence muscle fatigue (24). The co-localised detection of ADAMTS- cleaved versican fragments with endothelial cells, coupled with the inhibited exercise-induced angiogenesis observed in exercised KO muscle suggest that the ADAMTS5 fatigue phenotype may be mediated through angiogenic changes. Alternatively, proteoglycan expression in the t-tubules of skeletal muscle suggest that ADAMTS activity in this environment may also influence muscle function (38). Confocal immuno-staining of longitudinal t-tubule sections for cleaved and un-cleaved ADAMTS substrates may provide further information regarding the relationship between ADAMTS processing and muscle function.

Despite the reduced creatine kinase concentration and improved fatigue resistance in mdx ko mice, the overall mdx pathology was not ameliorated sufficiently enough for the approach to be considered a therapeutic target for muscular dystrophy. However, the elevated expression and activity of ADAMTS5 in mdx muscle warrants further research. Coen-Stass et al showed that ADAMTS5 protein levels were elevated in the serum of both mdx mice and DMD patients, which they went on to show could be used as a responsive biomarker for the disease (4). This thesis has created a base from which key questions involving ADAMTS5 in dystrophic muscle can be explored. It is imperative that we understand why ADAMTS5 activity and expression levels are elevated in dystrophic muscle, and how antisense oligonucleotide exon skipping restores these to normal levels (4).

It was hypothesised that reducing the amount of DPEAAE liberated from the matrix would ameliorate the dystrophic pathology. As mentioned previously, mdx ko mice did not show a consistent pathological amelioration, despite the reduction in DPEAAE levels. However, previous work has demonstrated that the DPEAAE fragment is biologically active (104), and functions as a DAMP inflammatory signal in macrophages (9). The gene expression analysis of inflammatory factors did not reveal any differences between mdx wt and mdx ko mice. However, experiments utilising flow cytometry and recombinant DPEAAE would be more informative in regards to the possible inflammatory function of this abundant fragment in dystrophic muscle.

154

It is important to highlight that investigating the DPEAAE fragment as a readout of ADAMTS5 activity has both technical and theoretical limitations. Neo-epitope DPEAAE antibody detection is not a true reflection of enzyme activity because the technique is specific for only a single proteolytic event and as such cannot account for multiple cleavages (93). Also, as the antibody cannot distinguish between enzymes of identical activity, the DPEAAE fragment could theoretically be generated by any of ADAMTS1, ADAMTS4, ADAMTS5, ADAMTS9 or ADAMTS20 (100-103). In future experiments it will also be important to investigate the relationship between ADAMTS5 and other known substrates. The advent of proteomic tools such as TAILS (Terminal amine isotopic labelling of substrates) has paved the way for the discovery of new substrates (407). Versican remains the only recognised ADAMTS5 substrate in skeletal muscle, but a plethora of targets have been identified in other tissues: clusterin, tenascin, decorin, biglycan, prolargin, collagen α-1(II), aggrecan, fibronectin, lumican, brevican, neurocan, reelin, matrilin-4 and α2-macroglobulin (87, 93, 102, 152, 155, 156, 336-338, 409). Significantly, versican, biglycan, decorin, fibronectin, and tenascin have all been implicated as DAMPs capable of triggering inflammatory responses (209, 210, 213, 295, 371, 372), which still raises the possibility that ADAMTS5-ECM processing may be releasing ligands to activate inflammatory pathways in dystrophic muscle.

Prior to the undertaking of this thesis, almost nothing was known about ADAMTS activity or expression in skeletal muscle. Proteases are notoriously complex and difficult entities to investigate. The author hopes that these experiments have shed some light on the role of ADAMTS5 in healthy and dystrophic muscle. A central finding was that ADAMTS5 is dispensable during normal muscle development, but is then required when homeostasis is challenged. The ECM is highly responsive to altered use and disease, with these changes most likely due to adaptations in muscle fibroblasts (410). ADAMTS5 is produced by fibroblasts, and appears to play important roles in skeletal muscle when the ECM is remodelled to meet the demands of a stimulus such as exercise, or the pathological conditions of muscular dystrophy. Applying modern proteomic techniques to both exercised and dystrophic muscle will offer further insights into the relationship between ECM remodelling and skeletal muscle.

155

8. References

1. Stupka N, Kintakas C, White JD, Fraser FW, Hanciu M, Aramaki-Hattori N, et al. Versican processing by a disintegrin-like and metalloproteinase domain with thrombospondin-1 repeats proteinases-5 and -15 facilitates myoblast fusion. J Biol Chem. 2013;288(3):1907-17. 2. McCulloch DR, Le Goff C, Bhatt S, Dixon LJ, Sandy JD, Apte SS. Adamts5, the gene encoding a proteoglycan-degrading metalloprotease, is expressed by specific cell lineages during mouse embryonic development and in adult tissues. Gene Expr Patterns. 2009;9(5):314-23. 3. Marotta M, Ruiz-Roig C, Sarria Y, Peiro JL, Nunez F, Ceron J, et al. Muscle genome-wide expression profiling during disease evolution in mdx mice. Physiol Genomics. 2009;37(2):119-32. 4. Coenen-Stass AM, McClorey G, Manzano R, Betts CA, Blain A, Saleh AF, et al. Identification of novel, therapy-responsive protein biomarkers in a mouse model of Duchenne muscular dystrophy by aptamer-based serum proteomics. Sci Rep. 2015;5:17014. 5. Fu Y, Nagy JA, Brown LF, Shih SC, Johnson PY, Chan CK, et al. Proteolytic cleavage of versican and involvement of ADAMTS-1 in VEGF-A/VPF-induced pathological angiogenesis. J Histochem Cytochem. 2011;59(5):463-73. 6. Rullman E, Norrbom J, Stromberg A, Wagsater D, Rundqvist H, Haas T, et al. Endurance exercise activates matrix metalloproteinases in human skeletal muscle. J Appl Physiol. 2009;106(3):804-12. 7. Koskinen SO, Wang W, Ahtikoski AM, Kjaer M, Han XY, Komulainen J, et al. Acute exercise induced changes in rat skeletal muscle mRNAs and proteins regulating type IV collagen content. Am J Physiol Regul Integr Comp Physiol. 2001;280(5):R1292-300. 8. Carmeli E, Moas M, Lennon S, Powers SK. High intensity exercise increases expression of matrix metalloproteinases in fast skeletal muscle fibres. Exp Physiol. 2005;90(4):613-9. 9. Hope C, Foulcer S, Jagodinsky J, Chen SX, Jensen JL, Patel S, et al. Immunoregulatory roles of versican proteolysis in the myeloma microenvironment. Blood. 2016;128(5):680-5. 10. Moreth K, Iozzo RV, Schaefer L. Small leucine-rich proteoglycans orchestrate receptor crosstalk during inflammation. Cell Cycle. 2012;11(11):2084-91. 11. Richards A, G., Anderson TF, Hance RT. A microtome sectioning technique for electron microscopy illustrated with sections of striated muscle. ProcSoc Exp Biol Med. 1942;51:148-52. 12. Hall CE, Jakus MA, Schmitt FO. The structure of certain muscle fibrils as revealed by the use of electron stains. . Jour App Phys. 1945;16:459-65. 13. Huxley AF, Niedergerke R. Structural changes in muscle during contraction; interference microscopy of living muscle fibres. Nature. 1954;173(4412):971-3. 14. Price HM. THE SKELETAL MUSCLE FIBER IN THE LIGHT OF ELECTRON MICROSCOPE STUDIES. A REVIEW. Am J Med. 1963;35:589-605. 15. Saladin KS. Anatomy and Physiology: The Unity of Form and Function. 5th ed: McGraw Hill; 2010. 16. Jenniskens GJ, Veerkamp JH, van Kuppevelt TH. Heparan sulfates in skeletal muscle development and physiology. J Cell Physiol. 2006;206(2):283-94. 17. Schiaffino S, Reggiani C. Molecular diversity of myofibrillar proteins: gene regulation and functional significance. Physiol Rev. 1996;76(2):371-423. 18. Ebashi S, Ebashi F. Alpha-actinin, a new structural protein from striated muscle. I. Preparation and action on actomyosinatp interaction. J Biochem. 1965;58(1):7-12. 19. Biressi S, Molinaro M, Cossu G. Cellular heterogeneity during vertebrate skeletal muscle development. Dev Biol. 2007;308(2):281-93. 20. Mauro A. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol. 1961;9:493-5. 21. Charge SB, Rudnicki MA. Cellular and molecular regulation of muscle regeneration. Physiol Rev. 2004;84(1):209-38. 22. Schiaffino S, Reggiani C. Myosin isoforms in mammalian skeletal muscle. J Appl Physiol. 1994;77(2):493-501.

156

23. Barany M. ATPase activity of myosin correlated with speed of muscle shortening. J Gen Physiol. 1967;50(6):Suppl:197-218. 24. Allen DG, Lamb GD, Westerblad H. Skeletal muscle fatigue: cellular mechanisms. Physiol Rev. 2008;88(1):287-332. 25. Buller AJ, Eccles JC, Eccles RM. Interactions between motoneurones and muscles in respect of the characteristic speeds of their responses. J Physiol. 1960;150:417-39. 26. Salmons S, Sreter FA. Significance of impulse activity in the transformation of skeletal muscle type. Nature. 1976;263(5572):30-4. 27. Bloemberg D, Quadrilatero J. Rapid determination of myosin heavy chain expression in rat, mouse, and human skeletal muscle using multicolor immunofluorescence analysis. PLoS One. 2012;7(4):e35273. 28. Sandow A. Excitation-contraction coupling in muscular response. Yale J Biol Med. 1952;25(3):176-201. 29. Campbell KP, Stull JT. Skeletal muscle basement membrane-sarcolemma-cytoskeleton interaction minireview series. J Biol Chem. 2003;278(15):12599-600. 30. Gillies AR, Lieber RL. Structure and function of the skeletal muscle extracellular matrix. Muscle Nerve. 2011;44(3):318-31. 31. Grounds MD, Sorokin L, White J. Strength at the extracellular matrix-muscle interface. Scand J Med Sci Sports. 2005;15(6):381-91. 32. MacIntosh BRG, P.F. McComas, I.J. . Skeletal Muscle: Form and Function. Second Edition ed: Human Kinetics; 2006. 33. Lee S, Russ, D., Binder-Macleod, S. . Force-frequency of relation of skeletal muscle. In: Marc D. Binder NH, Uwe Windhorst, editor. Encyclopedia of Neuroscience. California: Elsevier; 2009. p. 1608-11. 34. Tipton CM. ACSM's Advanced Exercise Physiology: Lippincott Williams & Wilkins; 2006. 35. Allen DG, Lannergren J, Westerblad H. Muscle cell function during prolonged activity: cellular mechanisms of fatigue. Exp Physiol. 1995;80(4):497-527. 36. Eberstein A SA. Fatigue mechanisms in muscle fibers. In: Gutman E HP, editor. The Effect of Use and Disuse on the Neuromuscular Functions. Amsterdam: Elsevier; 1963. p. 515-26. 37. Nielsen OB, Ortenblad N, Lamb GD, Stephenson DG. Excitability of the T-tubular system in rat skeletal muscle: roles of K+ and Na+ gradients and Na+-K+ pump activity. J Physiol. 2004;557(Pt 1):133-46. 38. Davis AK, Carlson SS. Proteoglycans are present in the transverse tubule system of skeletal muscle. Matrix Biol. 1995;14(8):607-21. 39. Westerblad H, Allen DG, Lannergren J. Muscle fatigue: lactic acid or inorganic phosphate the major cause? News in physiological sciences : an international journal of physiology produced jointly by the International Union of Physiological Sciences and the American Physiological Society. 2002;17:17-21. 40. Bruton JD, Lannergren J, Westerblad H. Effects of CO2-induced acidification on the fatigue resistance of single mouse muscle fibers at 28 degrees C. J Appl Physiol (1985). 1998;85(2):478-83. 41. Frantz C, Stewart KM, Weaver VM. The extracellular matrix at a glance. J Cell Sci. 2010;123(Pt 24):4195-200. 42. Jarvelainen H, Sainio A, Koulu M, Wight TN, Penttinen R. Extracellular matrix molecules: potential targets in pharmacotherapy. Pharmacol Rev. 2009;61(2):198-223. 43. Hynes RO, Naba A. Overview of the matrisome--an inventory of extracellular matrix constituents and functions. Cold Spring Harb Perspect Biol. 2012;4(1):a004903. 44. Apte SS, Parks WC. Metalloproteinases: A parade of functions in matrix biology and an outlook for the future. Matrix Biol. 2015;44-46:1-6. 45. Ibraghimov-Beskrovnaya O, Ervasti JM, Leveille CJ, Slaughter CA, Sernett SW, Campbell KP. Primary structure of dystrophin-associated glycoproteins linking dystrophin to the extracellular matrix. Nature. 1992;355(6362):696-702. 46. Ervasti JM, Campbell KP. A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin. J Cell Biol. 1993;122(4):809-23. 47. Gee SH, Montanaro F, Lindenbaum MH, Carbonetto S. Dystroglycan-alpha, a dystrophin- associated glycoprotein, is a functional agrin receptor. Cell. 1994;77(5):675-86.

157

48. Colognato H, Winkelmann DA, Yurchenco PD. Laminin polymerization induces a receptor- cytoskeleton network. J Cell Biol. 1999;145(3):619-31. 49. Rando TA. The dystrophin-glycoprotein complex, cellular signaling, and the regulation of cell survival in the muscular dystrophies. Muscle Nerve. 2001;24(12):1575-94. 50. Gumerson JD, Michele DE. The dystrophin-glycoprotein complex in the prevention of muscle damage. J Biomed Biotechnol. 2011;2011:210797. 51. Rafii MS, Hagiwara H, Mercado ML, Seo NS, Xu T, Dugan T, et al. Biglycan binds to alpha- and gamma-sarcoglycan and regulates their expression during development. J Cell Physiol. 2006;209(2):439-47. 52. Crosbie RH, Lebakken CS, Holt KH, Venzke DP, Straub V, Lee JC, et al. Membrane targeting and stabilization of sarcospan is mediated by the sarcoglycan subcomplex. J Cell Biol. 1999;145(1):153-65. 53. Maecker HT, Todd SC, Levy S. The tetraspanin superfamily: molecular facilitators. FASEB J. 1997;11(6):428-42. 54. Adams ME, Kramarcy N, Krall SP, Rossi SG, Rotundo RL, Sealock R, et al. Absence of alpha- syntrophin leads to structurally aberrant neuromuscular synapses deficient in utrophin. J Cell Biol. 2000;150(6):1385-98. 55. Yoshida M, Hama H, Ishikawa-Sakurai M, Imamura M, Mizuno Y, Araishi K, et al. Biochemical evidence for association of dystrobrevin with the sarcoglycan-sarcospan complex as a basis for understanding sarcoglycanopathy. Hum Mol Genet. 2000;9(7):1033-40. 56. Guiraud S, Chen H, Burns DT, Davies KE. Advances in genetic therapeutic strategies for Duchenne muscular dystrophy. Exp Physiol. 2015. 57. Hoffman EP, Brown RH, Jr., Kunkel LM. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 1987;51(6):919-28. 58. Tokarz SA, Duncan NM, Rash SM, Sadeghi A, Dewan AK, Pillers DA. Redefinition of dystrophin isoform distribution in mouse tissue by RT-PCR implies role in nonmuscle manifestations of duchenne muscular dystrophy. Mol Genet Metab. 1998;65(4):272-81. 59. Bies RD, Caskey CT, Fenwick R. An intact cysteine-rich domain is required for dystrophin function. J Clin Invest. 1992;90(2):666-72. 60. Campbell KP, Kahl SD. Association of dystrophin and an integral membrane glycoprotein. Nature. 1989;338(6212):259-62. 61. Jorgensen LH, Blain A, Greally E, Laval SH, Blamire AM, Davison BJ, et al. Long-term blocking of calcium channels in mdx mice results in differential effects on heart and skeletal muscle. Am J Pathol. 2011;178(1):273-83. 62. Ohlendieck K, Campbell KP. Dystrophin-associated proteins are greatly reduced in skeletal muscle from mdx mice. J Cell Biol. 1991;115(6):1685-94. 63. Love DR, Hill DF, Dickson G, Spurr NK, Byth BC, Marsden RF, et al. An autosomal transcript in skeletal muscle with homology to dystrophin. Nature. 1989;339(6219):55-8. 64. Helliwell TR, Man NT, Morris GE, Davies KE. The dystrophin-related protein, utrophin, is expressed on the sarcolemma of regenerating human skeletal muscle fibres in dystrophies and inflammatory myopathies. Neuromuscul Disord. 1992;2(3):177-84. 65. Tinsley J, Deconinck N, Fisher R, Kahn D, Phelps S, Gillis JM, et al. Expression of full-length utrophin prevents muscular dystrophy in mdx mice. Nat Med. 1998;4(12):1441-4. 66. Rafael JA, Tinsley JM, Potter AC, Deconinck AE, Davies KE. Skeletal muscle-specific expression of a utrophin transgene rescues utrophin-dystrophin deficient mice. Nat Genet. 1998;19(1):79-82. 67. Blake DJ, Tinsley JM, Davies KE. Utrophin: a structural and functional comparison to dystrophin. Brain Pathol. 1996;6(1):37-47. 68. Lee GM, Johnstone B, Jacobson K, Caterson B. The dynamic structure of the pericellular matrix on living cells. J Cell Biol. 1993;123(6 Pt 2):1899-907. 69. Sanes JR. The basement membrane/basal lamina of skeletal muscle. J Biol Chem. 2003;278(15):12601-4. 70. Mathew SJ, Hansen JM, Merrell AJ, Murphy MM, Lawson JA, Hutcheson DA, et al. Connective tissue fibroblasts and Tcf4 regulate myogenesis. Development. 2011;138(2):371-84.

158

71. Lund DK, Cornelison DD. Enter the matrix: shape, signal and superhighway. FEBS J. 2013;280(17):4089-99. 72. Grounds M. Complexity of extracellular matrix and skeletal muscle regeneration. In: Schiaffino S, Partridge TA, editors. Skeletal muscle repair and regeneration. London: Springer; 2008. p. 269-301. 73. Kjaer M. Role of extracellular matrix in adaptation of tendon and skeletal muscle to mechanical loading. Physiol Rev. 2004;84(2):649-98. 74. Burkin DJ, Kaufman SJ. The alpha7beta1 integrin in muscle development and disease. Cell Tissue Res. 1999;296(1):183-90. 75. Martin PT, Kaufman SJ, Kramer RH, Sanes JR. Synaptic integrins in developing, adult, and mutant muscle: selective association of alpha1, alpha7A, and alpha7B integrins with the neuromuscular junction. Dev Biol. 1996;174(1):125-39. 76. Hodges BL, Hayashi YK, Nonaka I, Wang W, Arahata K, Kaufman SJ. Altered expression of the alpha7beta1 integrin in human and murine muscular dystrophies. J Cell Sci. 1997;110 ( Pt 22):2873- 81. 77. Heller KN, Montgomery CL, Shontz KM, Clark KR, Mendell JR, Rodino-Klapac LR. Human alpha7 Integrin Gene (ITGA7) Delivered by Adeno-Associated Virus Extends Survival of Severely Affected Dystrophin/Utrophin-Deficient Mice. Hum Gene Ther. 2015;26(10):647-56. 78. Wise SG, Weiss AS. Tropoelastin. Int J Biochem Cell Biol. 2009;41(3):494-7. 79. Handford PA, Downing AK, Reinhardt DP, Sakai LY. Fibrillin: from domain structure to supramolecular assembly. Matrix Biol. 2000;19(6):457-70. 80. Hubmacher D, Apte SS. Genetic and functional linkage between ADAMTS superfamily proteins and fibrillin-1: a novel mechanism influencing microfibril assembly and function. Cell Mol Life Sci. 2011;68(19):3137-48. 81. Isogai Z, Aspberg A, Keene DR, Ono RN, Reinhardt DP, Sakai LY. Versican interacts with fibrillin-1 and links extracellular microfibrils to other connective tissue networks. J Biol Chem. 2002;277(6):4565-72. 82. Hayes AJ, Gibson MA, Shu C, Melrose J. Confocal microscopy demonstrates association of LTBP-2 in fibrillin-1 microfibrils and colocalisation with perlecan in the disc cell pericellular matrix. Tissue Cell. 2014;46(3):185-97. 83. Robertson IB, Horiguchi M, Zilberberg L, Dabovic B, Hadjiolova K, Rifkin DB. Latent TGF- beta-binding proteins. Matrix Biol. 2015;47:44-53. 84. Gelse K, Poschl E, Aigner T. Collagens--structure, function, and biosynthesis. Adv Drug Deliv Rev. 2003;55(12):1531-46. 85. Chiquet M, Fluck M. Ectopic expression of tenascin-C. J Cell Sci. 2003;116(Pt 19):3851; author reply -3; discussion 3. 86. Iozzo RV, Murdoch AD. Proteoglycans of the extracellular environment: clues from the gene and protein side offer novel perspectives in molecular diversity and function. FASEB J. 1996;10(5):598-614. 87. Schaefer L, Schaefer RM. Proteoglycans: from structural compounds to signaling molecules. Cell Tissue Res. 2010;339(1):237-46. 88. Brandan E, Gutierrez J. Role of skeletal muscle proteoglycans during myogenesis. Matrix Biol. 2013. 89. Iozzo RV, Schaefer L. Proteoglycan form and function: A comprehensive nomenclature of proteoglycans. Matrix Biol. 2015;42:11-55. 90. Iozzo RV. Matrix proteoglycans: from molecular design to cellular function. Annu Rev Biochem. 1998;67:609-52. 91. Zimmermann DR, Ruoslahti E. Multiple domains of the large fibroblast proteoglycan, versican. The EMBO journal. 1989;8(10):2975-81. 92. Wu YJ, La Pierre DP, Wu J, Yee AJ, Yang BB. The interaction of versican with its binding partners. Cell Res. 2005;15(7):483-94. 93. Stanton H, Melrose J, Little CB, Fosang AJ. Proteoglycan degradation by the ADAMTS family of proteinases. Biochim Biophys Acta. 2011;1812(12):1616-29. 94. Shinomura T, Zako M, Ito K, Ujita M, Kimata K. The gene structure and organization of mouse PG-M, a large chondroitin sulfate proteoglycan. Genomic background for the generation of multiple PG-M transcripts. J Biol Chem. 1995;270(17):10328-33.

159

95. Hattori N, Carrino DA, Lauer ME, Vasanji A, Wylie JD, Nelson CM, et al. Pericellular versican regulates the fibroblast-myofibroblast transition: a role for ADAMTS5 protease-mediated proteolysis. J Biol Chem. 2011;286(39):34298-310. 96. Wight TN, Kinsella MG, Evanko SP, Potter-Perigo S, Merrilees MJ. Versican and the Regulation of Cell Phenotype in Disease. Biochim Biophys Acta. 2014. 97. Lemire JM, Merrilees MJ, Braun KR, Wight TN. Overexpression of the V3 variant of versican alters arterial smooth muscle cell adhesion, migration, and proliferation in vitro. J Cell Physiol. 2002;190(1):38-45. 98. Zhang Z, Miao L, Wang L. Inflammation amplification by versican: the first mediator. Int J Mol Sci. 2012;13(6):6873-82. 99. Murasawa Y, Watanabe K, Yoneda M, Zako M, Kimata K, Sakai LY, et al. Homotypic versican G1 domain interactions enhance hyaluronan incorporation into fibrillin microfibrils. J Biol Chem. 2013;288(40):29170-81. 100. Silver DL, Hou L, Somerville R, Young ME, Apte SS, Pavan WJ. The secreted metalloprotease ADAMTS20 is required for melanoblast survival. PLoS Genet. 2008;4(2):e1000003. 101. Somerville RP, Longpre JM, Jungers KA, Engle JM, Ross M, Evanko S, et al. Characterization of ADAMTS-9 and ADAMTS-20 as a distinct ADAMTS subfamily related to Caenorhabditis elegans GON-1. J Biol Chem. 2003;278(11):9503-13. 102. Longpre JM, McCulloch DR, Koo BH, Alexander JP, Apte SS, Leduc R. Characterization of proADAMTS5 processing by proprotein convertases. Int J Biochem Cell Biol. 2009;41(5):1116-26. 103. Sandy JD, Westling J, Kenagy RD, Iruela-Arispe ML, Verscharen C, Rodriguez-Mazaneque JC, et al. Versican V1 proteolysis in human aorta in vivo occurs at the Glu441-Ala442 bond, a site that is cleaved by recombinant ADAMTS-1 and ADAMTS-4. J Biol Chem. 2001;276(16):13372-8. 104. McCulloch DR, Nelson CM, Dixon LJ, Silver DL, Wylie JD, Lindner V, et al. ADAMTS metalloproteases generate active versican fragments that regulate interdigital web regression. Dev Cell. 2009;17(5):687-98. 105. Fernandez MS, Dennis JE, Drushel RF, Carrino DA, Kimata K, Yamagata M, et al. The dynamics of compartmentalization of embryonic muscle by extracellular matrix molecules. Dev Biol. 1991;147(1):46-61. 106. Carrino DA, Sorrell JM, Caplan AI. Dynamic expression of proteoglycans during chicken skeletal muscle development and maturation. Poult Sci. 1999;78(5):769-77. 107. Velleman SG, Sporer KR, Ernst CW, Reed KM, Strasburg GM. Versican, matrix Gla protein, and death-associated protein expression affect muscle satellite cell proliferation and differentiation. Poult Sci. 2012;91(8):1964-73. 108. Sporer KR, Tempelman RJ, Ernst CW, Reed KM, Velleman SG, Strasburg GM. Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle. BMC Genomics. 2011;12:143. 109. Kern CB, Norris RA, Thompson RP, Argraves WS, Fairey SE, Reyes L, et al. Versican proteolysis mediates myocardial regression during outflow tract development. Dev Dyn. 2007;236(3):671-83. 110. Dupuis LE, McCulloch DR, McGarity JD, Bahan A, Wessels A, Weber D, et al. Altered versican cleavage in ADAMTS5 deficient mice; a novel etiology of myxomatous valve disease. Dev Biol. 2011;357(1):152-64. 111. Aspberg A, Miura R, Bourdoulous S, Shimonaka M, Heinegard D, Schachner M, et al. The C- type lectin domains of lecticans, a family of aggregating chondroitin sulfate proteoglycans, bind tenascin-R by protein-protein interactions independent of carbohydrate moiety. Proc Natl Acad Sci U S A. 1997;94(19):10116-21. 112. Yamagata M, Shinomura T, Kimata K. Tissue variation of two large chondroitin sulfate proteoglycans (PG-M/versican and PG-H/aggrecan) in chick embryos. Anat Embryol (Berl). 1993;187(5):433-44. 113. Liu BP, Cafferty WB, Budel SO, Strittmatter SM. Extracellular regulators of axonal growth in the adult central nervous system. Philos Trans R Soc Lond B Biol Sci. 2006;361(1473):1593-610. 114. Frischknecht R, Seidenbecher CI. Brevican: a key proteoglycan in the perisynaptic extracellular matrix of the brain. Int J Biochem Cell Biol. 2012;44(7):1051-4.

160

115. Tamer TM. Hyaluronan and synovial joint: function, distribution and healing. Interdiscip Toxicol. 2013;6(3):111-25. 116. Hascall VC, Majors AK, De La Motte CA, Evanko SP, Wang A, Drazba JA, et al. Intracellular hyaluronan: a new frontier for inflammation? Biochim Biophys Acta. 2004;1673(1-2):3-12. 117. Reed RK, Lilja K, Laurent TC. Hyaluronan in the rat with special reference to the skin. Acta Physiol Scand. 1988;134(3):405-11. 118. Hunt LC, Gorman C, Kintakas C, McCulloch DR, Mackie EJ, White JD. Hyaluronan synthesis and myogenesis: a requirement for hyaluronan synthesis during myogenic differentiation independent of pericellular matrix formation. J Biol Chem. 2013;288(18):13006-21. 119. Iozzo RV, Schaefer L. Proteoglycans in health and disease: novel regulatory signaling mechanisms evoked by the small leucine-rich proteoglycans. FEBS J. 2010;277(19):3864-75. 120. Schaefer L, Iozzo RV. Biological functions of the small leucine-rich proteoglycans: from genetics to signal transduction. J Biol Chem. 2008;283(31):21305-9. 121. McBride OW, Fisher LW, Young MF. Localization of PGI (biglycan, BGN) and PGII (decorin, DCN, PG-40) genes on human chromosomes Xq13-qter and 12q, respectively. Genomics. 1990;6(2):219-25. 122. Scott IC, Imamura Y, Pappano WN, Troedel JM, Recklies AD, Roughley PJ, et al. Bone morphogenetic protein-1 processes probiglycan. J Biol Chem. 2000;275(39):30504-11. 123. Nastase MV, Young MF, Schaefer L. Biglycan: a multivalent proteoglycan providing structure and signals. J Histochem Cytochem. 2012;60(12):963-75. 124. Bowe MA, Mendis DB, Fallon JR. The small leucine-rich repeat proteoglycan biglycan binds to alpha-dystroglycan and is upregulated in dystrophic muscle. J Cell Biol. 2000;148(4):801-10. 125. Casar JC, McKechnie BA, Fallon JR, Young MF, Brandan E. Transient up-regulation of biglycan during skeletal muscle regeneration: delayed fiber growth along with decorin increase in biglycan-deficient mice. Dev Biol. 2004;268(2):358-71. 126. Abe S, Hirose D, Kado S, Iwanuma O, Saka H, Yanagisawa N, et al. Increased expression of decorin during the regeneration stage of mdx mouse. Anat Sci Int. 2009;84(4):305-11. 127. Ruoslahti E. Structure and biology of proteoglycans. Annu Rev Cell Biol. 1988;4:229-55. 128. Keene DR, San Antonio JD, Mayne R, McQuillan DJ, Sarris G, Santoro SA, et al. Decorin binds near the C terminus of type I collagen. J Biol Chem. 2000;275(29):21801-4. 129. Neill T, Schaefer L, Iozzo RV. Decorin: a guardian from the matrix. Am J Pathol. 2012;181(2):380-7. 130. Chakravarti S. Functions of lumican and fibromodulin: lessons from knockout mice. Glycoconj J. 2002;19(4-5):287-93. 131. Nikitovic D, Katonis P, Tsatsakis A, Karamanos NK, Tzanakakis GN. Lumican, a small leucine-rich proteoglycan. IUBMB Life. 2008;60(12):818-23. 132. Li LF, Chen BX, Tsai YH, Kao WW, Yang CT, Chu PH. Lumican expression in diaphragm induced by mechanical ventilation. PLoS One. 2011;6(9):e24692. 133. Tingbo MG, Pedersen ME, Kolset SO, Enersen G, Hannesson KO. Lumican is a major small leucine-rich proteoglycan (SLRP) in Atlantic cod (Gadus morhua L.) skeletal muscle. Glycoconj J. 2012;29(1):13-23. 134. Chakravarti S, Magnuson T, Lass JH, Jepsen KJ, LaMantia C, Carroll H. Lumican regulates collagen fibril assembly: skin fragility and corneal opacity in the absence of lumican. J Cell Biol. 1998;141(5):1277-86. 135. Frey H, Schroeder N, Manon-Jensen T, Iozzo RV, Schaefer L. Biological interplay between proteoglycans and their innate immune receptors in inflammation. FEBS J. 2013;280(10):2165-79. 136. Bortoluzzi S, Scannapieco P, Cestaro A, Danieli GA, Schiaffino S. Computational reconstruction of the human skeletal muscle secretome. Proteins. 2006;62(3):776-92. 137. Colige A, Vandenberghe I, Thiry M, Lambert CA, Van Beeumen J, Li SW, et al. Cloning and characterization of ADAMTS-14, a novel ADAMTS displaying high homology with ADAMTS-2 and ADAMTS-3. J Biol Chem. 2002;277(8):5756-66. 138. Murphy G, Gavrilovic J. Proteolysis and cell migration: creating a path? Curr Opin Cell Biol. 1999;11(5):614-21.

161

139. Kherif S, Lafuma C, Dehaupas M, Lachkar S, Fournier JG, Verdiere-Sahuque M, et al. Expression of matrix metalloproteinases 2 and 9 in regenerating skeletal muscle: a study in experimentally injured and mdx muscles. Dev Biol. 1999;205(1):158-70. 140. Mehan RS, Greybeck BJ, Emmons K, Byrnes WC, Allen DL. Matrix metalloproteinase-9 deficiency results in decreased fiber cross-sectional area and alters fiber type distribution in mouse hindlimb skeletal muscle. Cells Tissues Organs. 2011;194(6):510-20. 141. Chirco R, Liu XW, Jung KK, Kim HR. Novel functions of TIMPs in cell signaling. Cancer Metastasis Rev. 2006;25(1):99-113. 142. Williamson RA, Marston FA, Angal S, Koklitis P, Panico M, Morris HR, et al. Disulphide bond assignment in human tissue inhibitor of metalloproteinases (TIMP). Biochem J. 1990;268(2):267-74. 143. Murphy G, Houbrechts A, Cockett MI, Williamson RA, O'Shea M, Docherty AJ. The N- terminal domain of tissue inhibitor of metalloproteinases retains metalloproteinase inhibitory activity. Biochemistry. 1991;30(33):8097-102. 144. Lambert E, Dasse E, Haye B, Petitfrere E. TIMPs as multifacial proteins. Crit Rev Oncol Hematol. 2004;49(3):187-98. 145. Blavier L, Henriet P, Imren S, Declerck YA. Tissue inhibitors of matrix metalloproteinases in cancer. Ann N Y Acad Sci. 1999;878:108-19. 146. Kashiwagi M, Tortorella M, Nagase H, Brew K. TIMP-3 is a potent inhibitor of aggrecanase 1 (ADAM-TS4) and aggrecanase 2 (ADAM-TS5). J Biol Chem. 2001;276(16):12501-4. 147. Jung KK, Liu XW, Chirco R, Fridman R, Kim HR. Identification of CD63 as a tissue inhibitor of metalloproteinase-1 interacting cell surface protein. The EMBO journal. 2006;25(17):3934-42. 148. Qi JH, Ebrahem Q, Moore N, Murphy G, Claesson-Welsh L, Bond M, et al. A novel function for tissue inhibitor of metalloproteinases-3 (TIMP3): inhibition of angiogenesis by blockage of VEGF binding to VEGF receptor-2. Nat Med. 2003;9(4):407-15. 149. Seo DW, Li H, Guedez L, Wingfield PT, Diaz T, Salloum R, et al. TIMP-2 mediated inhibition of angiogenesis: an MMP-independent mechanism. Cell. 2003;114(2):171-80. 150. Kuno K, Kanada N, Nakashima E, Fujiki F, Ichimura F, Matsushima K. Molecular cloning of a gene encoding a new type of metalloproteinase-disintegrin family protein with thrombospondin motifs as an inflammation associated gene. J Biol Chem. 1997;272(1):556-62. 151. Apte SS. A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the ADAMTS family. Int J Biochem Cell Biol. 2004;36(6):981-5. 152. Kelwick R, Desanlis I, Wheeler GN, Edwards DR. The ADAMTS (A Disintegrin and Metalloproteinase with Thrombospondin motifs) family. Genome Biol. 2015;16:113. 153. Nagase H, Kashiwagi M. Aggrecanases and cartilage matrix degradation. Arthritis Res Ther. 2003;5(2):94-103. 154. Rogerson FM, Stanton H, East CJ, Golub SB, Tutolo L, Farmer PJ, et al. Evidence of a novel aggrecan-degrading activity in cartilage: Studies of mice deficient in both ADAMTS-4 and ADAMTS- 5. Arthritis Rheum. 2008;58(6):1664-73. 155. Stanton H, Rogerson FM, East CJ, Golub SB, Lawlor KE, Meeker CT, et al. ADAMTS5 is the major aggrecanase in mouse cartilage in vivo and in vitro. Nature. 2005;434(7033):648-52. 156. Matthews RT, Gary SC, Zerillo C, Pratta M, Solomon K, Arner EC, et al. Brain-enriched hyaluronan binding (BEHAB)/brevican cleavage in a glioma cell line is mediated by a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) family member. J Biol Chem. 2000;275(30):22695-703. 157. Gomis-Ruth FX. Catalytic domain architecture of metzincin metalloproteases. J Biol Chem. 2009;284(23):15353-7. 158. Mosyak L, Georgiadis K, Shane T, Svenson K, Hebert T, McDonagh T, et al. Crystal structures of the two major aggrecan degrading enzymes, ADAMTS4 and ADAMTS5. Protein Sci. 2008;17(1):16-21. 159. Apte SS. A disintegrin-like and metalloprotease (reprolysin-type) with thrombospondin type 1 motif (ADAMTS) superfamily: functions and mechanisms. J Biol Chem. 2009;284(46):31493-7. 160. Rodriguez-Manzaneque JC, Milchanowski AB, Dufour EK, Leduc R, Iruela-Arispe ML. Characterization of METH-1/ADAMTS1 processing reveals two distinct active forms. J Biol Chem. 2000;275(43):33471-9.

162

161. Somerville RP, Longpre JM, Apel ED, Lewis RM, Wang LW, Sanes JR, et al. ADAMTS7B, the full-length product of the ADAMTS7 gene, is a chondroitin sulfate proteoglycan containing a mucin domain. J Biol Chem. 2004;279(34):35159-75. 162. Wang P, Tortorella M, England K, Malfait AM, Thomas G, Arner EC, et al. Proprotein convertase furin interacts with and cleaves pro-ADAMTS4 (Aggrecanase-1) in the trans-Golgi network. J Biol Chem. 2004;279(15):15434-40. 163. Kuno K, Terashima Y, Matsushima K. ADAMTS-1 is an active metalloproteinase associated with the extracellular matrix. J Biol Chem. 1999;274(26):18821-6. 164. Koo BH, Longpre JM, Somerville RP, Alexander JP, Leduc R, Apte SS. Cell-surface processing of pro-ADAMTS9 by furin. J Biol Chem. 2006;281(18):12485-94. 165. Gao G, Westling J, Thompson VP, Howell TD, Gottschall PE, Sandy JD. Activation of the proteolytic activity of ADAMTS4 (aggrecanase-1) by C-terminal truncation. J Biol Chem. 2002;277(13):11034-41. 166. Nandadasa S, Foulcer S, Apte SS. The multiple, complex roles of versican and its proteolytic turnover by ADAMTS proteases during embryogenesis. Matrix Biol. 2014;35:34-41. 167. Hurskainen TL, Hirohata S, Seldin MF, Apte SS. ADAM-TS5, ADAM-TS6, and ADAM-TS7, novel members of a new family of zinc metalloproteases. General features and genomic distribution of the ADAM-TS family. J Biol Chem. 1999;274(36):25555-63. 168. Glasson SS, Askew R, Sheppard B, Carito B, Blanchet T, Ma HL, et al. Deletion of active ADAMTS5 prevents cartilage degradation in a murine model of osteoarthritis. Nature. 2005;434(7033):644-8. 169. Kintakas C, McCulloch DR. Emerging roles for ADAMTS5 during development and disease. Matrix Biol. 2011;30(5-6):311-7. 170. Barthel KK, Liu X. A transcriptional enhancer from the coding region of ADAMTS5. PLoS One. 2008;3(5):e2184. 171. Groma G, Grskovic I, Schael S, Ehlen HW, Wagener R, Fosang A, et al. Matrilin-4 is processed by ADAMTS-5 in late Golgi vesicles present in growth plate chondrocytes of defined differentiation state. Matrix Biol. 2011;30(4):275-80. 172. Chockalingam PS, Zeng W, Morris EA, Flannery CR. Release of hyaluronan and hyaladherins (aggrecan G1 domain and link proteins) from articular cartilage exposed to ADAMTS-4 (aggrecanase 1) or ADAMTS-5 (aggrecanase 2). Arthritis Rheum. 2004;50(9):2839-48. 173. Foulcer SJ, Nelson CM, Quintero MV, Kuberan B, Larkin J, Dours-Zimmermann MT, et al. Determinants of versican-V1 proteoglycan processing by the metalloproteinase ADAMTS5. J Biol Chem. 2014;289(40):27859-73. 174. Dupuis LE, Osinska H, Weinstein MB, Hinton RB, Kern CB. Insufficient versican cleavage and Smad2 phosphorylation results in bicuspid aortic and pulmonary valves. J Mol Cell Cardiol. 2013;60:50-9. 175. Didangelos A, Mayr U, Monaco C, Mayr M. Novel role of ADAMTS-5 protein in proteoglycan turnover and lipoprotein retention in atherosclerosis. J Biol Chem. 2012;287(23):19341-5. 176. Gorski DJ, Xiao W, Li J, Luo W, Lauer M, Kisiday J, et al. Deletion of ADAMTS5 does not affect aggrecan or versican degradation but promotes glucose uptake and proteoglycan synthesis in murine adipose derived stromal cells. Matrix Biol. 2015. 177. Hynes RO. The extracellular matrix: not just pretty fibrils. Science. 2009;326(5957):1216-9. 178. Schiaffino S, Dyar KA, Ciciliot S, Blaauw B, Sandri M. Mechanisms regulating skeletal muscle growth and atrophy. FEBS J. 2013;280(17):4294-314. 179. White RB, Bierinx AS, Gnocchi VF, Zammit PS. Dynamics of muscle fibre growth during postnatal mouse development. BMC developmental biology. 2010;10:21. 180. Mavalli MD, DiGirolamo DJ, Fan Y, Riddle RC, Campbell KS, van Groen T, et al. Distinct growth hormone receptor signaling modes regulate skeletal muscle development and insulin sensitivity in mice. J Clin Invest. 2010;120(11):4007-20. 181. Musaro A, McCullagh K, Paul A, Houghton L, Dobrowolny G, Molinaro M, et al. Localized Igf-1 transgene expression sustains hypertrophy and regeneration in senescent skeletal muscle. Nat Genet. 2001;27(2):195-200. 182. Waters RE, Rotevatn S, Li P, Annex BH, Yan Z. Voluntary running induces fiber type-specific angiogenesis in mouse skeletal muscle. Am J Physiol Cell Physiol. 2004;287(5):C1342-8.

163

183. Chin ER, Olson EN, Richardson JA, Yang Q, Humphries C, Shelton JM, et al. A calcineurin- dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev. 1998;12(16):2499- 509. 184. Yan Z, Okutsu M, Akhtar YN, Lira VA. Regulation of exercise-induced fiber type transformation, mitochondrial biogenesis, and angiogenesis in skeletal muscle. J Appl Physiol. 2011;110(1):264-74. 185. Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, et al. Transcriptional co-activator PGC-1 alpha drives the formation of slow-twitch muscle fibres. Nature. 2002;418(6899):797-801. 186. Tadaishi M, Miura S, Kai Y, Kano Y, Oishi Y, Ezaki O. Skeletal muscle-specific expression of PGC-1alpha-b, an exercise-responsive isoform, increases exercise capacity and peak oxygen uptake. PLoS One. 2011;6(12):e28290. 187. Narkar VA, Fan W, Downes M, Yu RT, Jonker JW, Alaynick WA, et al. Exercise and PGC- 1alpha-independent synchronization of type I muscle metabolism and vasculature by ERRgamma. Cell Metab. 2011;13(3):283-93. 188. Chinsomboon J, Ruas J, Gupta RK, Thom R, Shoag J, Rowe GC, et al. The transcriptional coactivator PGC-1alpha mediates exercise-induced angiogenesis in skeletal muscle. Proc Natl Acad Sci U S A. 2009;106(50):21401-6. 189. Leick L, Wojtaszewski JF, Johansen ST, Kiilerich K, Comes G, Hellsten Y, et al. PGC-1alpha is not mandatory for exercise- and training-induced adaptive gene responses in mouse skeletal muscle. Am J Physiol Endocrinol Metab. 2008;294(2):E463-74. 190. Yang HT, Ogilvie RW, Terjung RL. Heparin increases exercise-induced collateral blood flow in rats with femoral artery ligation. Circ Res. 1995;76(3):448-56. 191. Dudley GA, Abraham WM, Terjung RL. Influence of exercise intensity and duration on biochemical adaptations in skeletal muscle. J Appl Physiol Respir Environ Exerc Physiol. 1982;53(4):844-50. 192. Bruns RR, Palade GE. Studies on blood capillaries. I. General organization of blood capillaries in muscle. J Cell Biol. 1968;37(2):244-76. 193. Prior BM, Yang HT, Terjung RL. What makes vessels grow with exercise training? J Appl Physiol. 2004;97(3):1119-28. 194. Geudens I, Gerhardt H. Coordinating cell behaviour during blood vessel formation. Development. 2011;138(21):4569-83. 195. Haas TL, Nwadozi E. Regulation of skeletal muscle capillary growth in exercise and disease. Appl Physiol Nutr Metab. 2015;40(12):1221-32. 196. Egginton S, Zhou AL, Brown MD, Hudlicka O. Unorthodox angiogenesis in skeletal muscle. Cardiovasc Res. 2001;49(3):634-46. 197. Birot OJ, Koulmann N, Peinnequin A, Bigard XA. Exercise-induced expression of vascular endothelial growth factor mRNA in rat skeletal muscle is dependent on fibre type. J Physiol. 2003;552(Pt 1):213-21. 198. Faye C, Moreau C, Chautard E, Jetne R, Fukai N, Ruggiero F, et al. Molecular interplay between endostatin, integrins, and heparan sulfate. J Biol Chem. 2009;284(33):22029-40. 199. Sharghi-Namini S, Fan H, Sulochana KN, Potturi P, Xiang W, Chong YS, et al. The first but not the second thrombospondin type 1 repeat of ADAMTS5 functions as an angiogenesis inhibitor. Biochem Biophys Res Commun. 2008;371(2):215-9. 200. Lee S, Jilani SM, Nikolova GV, Carpizo D, Iruela-Arispe ML. Processing of VEGF-A by matrix metalloproteinases regulates bioavailability and vascular patterning in tumors. J Cell Biol. 2005;169(4):681-91. 201. Hjorth M, Norheim F, Meen AJ, Pourteymour S, Lee S, Holen T, et al. The effect of acute and long-term physical activity on extracellular matrix and serglycin in human skeletal muscle. Physiol Rep. 2015;3(8). 202. Haas TL, Milkiewicz M, Davis SJ, Zhou AL, Egginton S, Brown MD, et al. Matrix metalloproteinase activity is required for activity-induced angiogenesis in rat skeletal muscle. Am J Physiol Heart Circ Physiol. 2000;279(4):H1540-7. 203. Moyer AL, Wagner KR. Regeneration versus fibrosis in skeletal muscle. Curr Opin Rheumatol. 2011;23(6):568-73.

164

204. Villalta SA, Rinaldi C, Deng B, Liu G, Fedor B, Tidball JG. Interleukin-10 reduces the pathology of mdx muscular dystrophy by deactivating M1 macrophages and modulating macrophage phenotype. Hum Mol Genet. 2011;20(4):790-805. 205. Serrano AL, Munoz-Canoves P. Regulation and dysregulation of fibrosis in skeletal muscle. Exp Cell Res. 2010;316(18):3050-8. 206. Tidball JG, Villalta SA. Regulatory interactions between muscle and the immune system during muscle regeneration. Am J Physiol Regul Integr Comp Physiol. 2010;298(5):R1173-87. 207. Tidball JG. Inflammatory processes in muscle injury and repair. Am J Physiol Regul Integr Comp Physiol. 2005;288(2):R345-53. 208. Gross O, Thomas CJ, Guarda G, Tschopp J. The inflammasome: an integrated view. Immunol Rev. 2011;243(1):136-51. 209. Schaefer L, Babelova A, Kiss E, Hausser HJ, Baliova M, Krzyzankova M, et al. The matrix component biglycan is proinflammatory and signals through Toll-like receptors 4 and 2 in macrophages. J Clin Invest. 2005;115(8):2223-33. 210. Merline R, Moreth K, Beckmann J, Nastase MV, Zeng-Brouwers J, Tralhao JG, et al. Signaling by the matrix proteoglycan decorin controls inflammation and cancer through PDCD4 and MicroRNA- 21. Sci Signal. 2011;4(199):ra75. 211. Asplund A, Friden V, Stillemark-Billton P, Camejo G, Bondjers G. Macrophages exposed to hypoxia secrete proteoglycans for which LDL has higher affinity. Atherosclerosis. 2011;215(1):77-81. 212. Wight TN, Kang I, Merrilees MJ. Versican and the control of inflammation. Matrix Biol. 2014;35:152-61. 213. Kim S, Takahashi H, Lin WW, Descargues P, Grivennikov S, Kim Y, et al. Carcinoma- produced factors activate myeloid cells through TLR2 to stimulate metastasis. Nature. 2009;457(7225):102-6. 214. Seale P, Sabourin LA, Girgis-Gabardo A, Mansouri A, Gruss P, Rudnicki MA. Pax7 is required for the specification of myogenic satellite cells. Cell. 2000;102(6):777-86. 215. Czerwinska AM, Streminska W, Ciemerych MA, Grabowska I. Mouse gastrocnemius muscle regeneration after mechanical or cardiotoxin injury. Folia Histochem Cytobiol. 2012;50(1):144-53. 216. Chang NC, Rudnicki MA. Satellite cells: the architects of skeletal muscle. Curr Top Dev Biol. 2014;107:161-81. 217. Boldrin L, Muntoni F, Morgan JE. Are human and mouse satellite cells really the same? J Histochem Cytochem. 2010;58(11):941-55. 218. Emery AE. The muscular dystrophies. Lancet. 2002;359(9307):687-95. 219. Mercuri E, Muntoni F. Muscular dystrophies. Lancet. 2013;381(9869):845-60. 220. Aartsma-Rus A, Van Deutekom JC, Fokkema IF, Van Ommen GJ, Den Dunnen JT. Entries in the Leiden Duchenne muscular dystrophy mutation database: an overview of mutation types and paradoxical cases that confirm the reading-frame rule. Muscle Nerve. 2006;34(2):135-44. 221. Kornegay JN, Spurney CF, Nghiem PP, Brinkmeyer-Langford CL, Hoffman EP, Nagaraju K. Pharmacologic management of Duchenne muscular dystrophy: target identification and preclinical trials. ILAR J. 2014;55(1):119-49. 222. Muntoni F. Cardiomyopathy in muscular dystrophies. Curr Opin Neurol. 2003;16(5):577-83. 223. Gulati S, Saxena A, Kumar V, Kalra V. Duchenne muscular dystrophy: prevalence and patterns of cardiac involvement. Indian J Pediatr. 2005;72(5):389-93. 224. Mavrogeni S, Papavasiliou A, Spargias K, Constandoulakis P, Papadopoulos G, Karanasios E, et al. Myocardial inflammation in Duchenne Muscular Dystrophy as a precipitating factor for heart failure: a prospective study. BMC Neurol. 2010;10:33. 225. Nigro G, Comi LI, Politano L, Bain RJ. The incidence and evolution of cardiomyopathy in Duchenne muscular dystrophy. Int J Cardiol. 1990;26(3):271-7. 226. Connolly AM, Schierbecker J, Renna R, Florence J. High dose weekly oral prednisone improves strength in boys with Duchenne muscular dystrophy. Neuromuscul Disord. 2002;12(10):917- 25. 227. Partridge TA. Impending therapies for Duchenne muscular dystrophy. Curr Opin Neurol. 2011;24(5):415-22. 228. McDonald CM, Henricson EK, Abresch RT, Florence J, Eagle M, Gappmaier E, et al. The 6- minute walk test and other clinical endpoints in duchenne muscular dystrophy: reliability, concurrent

165 validity, and minimal clinically important differences from a multicenter study. Muscle Nerve. 2013;48(3):357-68. 229. Vo AH, McNally EM. Modifier genes and their effect on Duchenne muscular dystrophy. Curr Opin Neurol. 2015;28(5):528-34. 230. Nadarajah VD, van Putten M, Chaouch A, Garrood P, Straub V, Lochmuller H, et al. Serum matrix metalloproteinase-9 (MMP-9) as a biomarker for monitoring disease progression in Duchenne muscular dystrophy (DMD). Neuromuscul Disord. 2011;21(8):569-78. 231. Chamberlain JS. Dystrophin Levels Required for Genetic Correction of Duchenne Muscular Dystrophy. Basic Appl Myol 1997;7(3&4):255-7. 232. van Ommen GJ, van Deutekom J, Aartsma-Rus A. The therapeutic potential of antisense- mediated exon skipping. Curr Opin Mol Ther. 2008;10(2):140-9. 233. McElroy SP, Nomura T, Torrie LS, Warbrick E, Gartner U, Wood G, et al. A lack of premature termination codon read-through efficacy of PTC124 (Ataluren) in a diverse array of reporter assays. PLoS Biol. 2013;11(6):e1001593. 234. Hoffman EP, Connor EM. Orphan drug development in muscular dystrophy: update on two large clinical trials of dystrophin rescue therapies. Discov Med. 2013;16(89):233-9. 235. Voit T, Topaloglu H, Straub V, Muntoni F, Deconinck N, Campion G, et al. Safety and efficacy of drisapersen for the treatment of Duchenne muscular dystrophy (DEMAND II): an exploratory, randomised, placebo-controlled phase 2 study. Lancet Neurol. 2014;13(10):987-96. 236. Aartsma-Rus A, Fokkema I, Verschuuren J, Ginjaar I, van Deutekom J, van Ommen GJ, et al. Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum Mutat. 2009;30(3):293-9. 237. Goemans NM, Tulinius M, van den Akker JT, Burm BE, Ekhart PF, Heuvelmans N, et al. Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med. 2011;364(16):1513-22. 238. Mendell JR, Rodino-Klapac LR, Sahenk Z, Roush K, Bird L, Lowes LP, et al. Eteplirsen for the treatment of Duchenne muscular dystrophy. Ann Neurol. 2013;74(5):637-47. 239. Betts CA, Saleh AF, Carr CA, Hammond SM, Coenen-Stass AM, Godfrey C, et al. Prevention of exercised induced cardiomyopathy following Pip-PMO treatment in dystrophic mdx mice. Sci Rep. 2015;5:8986. 240. Goyenvalle A, Griffith G, Babbs A, El Andaloussi S, Ezzat K, Avril A, et al. Functional correction in mouse models of muscular dystrophy using exon-skipping tricyclo-DNA oligomers. Nat Med. 2015;21(3):270-5. 241. Long C, McAnally JR, Shelton JM, Mireault AA, Bassel-Duby R, Olson EN. Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA. Science. 2014;345(6201):1184-8. 242. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual- RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337(6096):816-21. 243. Tinsley J, Robinson N, Davies KE. Safety, tolerability, and pharmacokinetics of SMT C1100, a 2-arylbenzoxazole utrophin modulator, following single- and multiple-dose administration to healthy male adult volunteers. J Clin Pharmacol. 2015;55(6):698-707. 244. Guiraud S, Squire SE, Edwards B, Chen H, Burns DT, Shah N, et al. Second-generation compound for the modulation of utrophin in the therapy of DMD. Hum Mol Genet. 2015;24(15):4212- 24. 245. Sicinski P, Geng Y, Ryder-Cook AS, Barnard EA, Darlison MG, Barnard PJ. The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science. 1989;244(4912):1578-80. 246. Bulfield G, Siller WG, Wight PA, Moore KJ. X chromosome-linked muscular dystrophy (mdx) in the mouse. Proc Natl Acad Sci U S A. 1984;81(4):1189-92. 247. Torres LF, Duchen LW. The mutant mdx: inherited myopathy in the mouse. Morphological studies of nerves, muscles and end-plates. Brain. 1987;110 ( Pt 2):269-99. 248. Gillis JM. Understanding dystrophinopathies: an inventory of the structural and functional consequences of the absence of dystrophin in muscles of the mdx mouse. J Muscle Res Cell Motil. 1999;20(7):605-25. 249. Grounds MD. Two-tiered hypotheses for Duchenne muscular dystrophy. Cell Mol Life Sci. 2008;65(11):1621-5.

166

250. Willmann R, Possekel S, Dubach-Powell J, Meier T, Ruegg MA. Mammalian animal models for Duchenne muscular dystrophy. Neuromuscul Disord. 2009;19(4):241-9. 251. Quinlan JG, Hahn HS, Wong BL, Lorenz JN, Wenisch AS, Levin LS. Evolution of the mdx mouse cardiomyopathy: physiological and morphological findings. Neuromuscul Disord. 2004;14(8- 9):491-6. 252. Ascah A, Khairallah M, Daussin F, Bourcier-Lucas C, Godin R, Allen BG, et al. Stress-induced opening of the permeability transition pore in the dystrophin-deficient heart is attenuated by acute treatment with sildenafil. Am J Physiol Heart Circ Physiol. 2011;300(1):H144-53. 253. Danialou G, Comtois AS, Dudley R, Karpati G, Vincent G, Des Rosiers C, et al. Dystrophin- deficient cardiomyocytes are abnormally vulnerable to mechanical stress-induced contractile failure and injury. FASEB J. 2001;15(9):1655-7. 254. Chu V, Otero JM, Lopez O, Sullivan MF, Morgan JP, Amende I, et al. Electrocardiographic findings in mdx mice: a cardiac phenotype of Duchenne muscular dystrophy. Muscle Nerve. 2002;26(4):513-9. 255. Stuckey DJ, Carr CA, Camelliti P, Tyler DJ, Davies KE, Clarke K. In vivo MRI characterization of progressive cardiac dysfunction in the mdx mouse model of muscular dystrophy. PLoS One. 2012;7(1):e28569. 256. McArdle A, Edwards RH, Jackson MJ. Effects of contractile activity on muscle damage in the dystrophin-deficient mdx mouse. Clin Sci (Lond). 1991;80(4):367-71. 257. Petrof BJ, Shrager JB, Stedman HH, Kelly AM, Sweeney HL. Dystrophin protects the sarcolemma from stresses developed during muscle contraction. Proc Natl Acad Sci U S A. 1993;90(8):3710-4. 258. Dellorusso C, Crawford RW, Chamberlain JS, Brooks SV. Tibialis anterior muscles in mdx mice are highly susceptible to contraction-induced injury. J Muscle Res Cell Motil. 2001;22(5):467-75. 259. Deconinck N, Dan B. Pathophysiology of duchenne muscular dystrophy: current hypotheses. Pediatr Neurol. 2007;36(1):1-7. 260. Allen DG, Whitehead NP. Duchenne muscular dystrophy--what causes the increased membrane permeability in skeletal muscle? Int J Biochem Cell Biol. 2011;43(3):290-4. 261. Gailly P. New aspects of calcium signaling in skeletal muscle cells: implications in Duchenne muscular dystrophy. Biochim Biophys Acta. 2002;1600(1-2):38-44. 262. Turner PR, Westwood T, Regen CM, Steinhardt RA. Increased protein degradation results from elevated free calcium levels found in muscle from mdx mice. Nature. 1988;335(6192):735-8. 263. Whitehead NP, Yeung EW, Allen DG. Muscle damage in mdx (dystrophic) mice: role of calcium and reactive oxygen species. Clin Exp Pharmacol Physiol. 2006;33(7):657-62. 264. Mazala DA, Grange RW, Chin ER. The role of proteases in excitation-contraction coupling failure in muscular dystrophy. Am J Physiol Cell Physiol. 2015;308(1):C33-40. 265. Coulton GR, Morgan JE, Partridge TA, Sloper JC. The mdx mouse skeletal muscle myopathy: I. A histological, morphometric and biochemical investigation. Neuropathol Appl Neurobiol. 1988;14(1):53-70. 266. Grounds MD, Torrisi J. Anti-TNFalpha (Remicade) therapy protects dystrophic skeletal muscle from necrosis. FASEB J. 2004;18(6):676-82. 267. Disatnik MH, Dhawan J, Yu Y, Beal MF, Whirl MM, Franco AA, et al. Evidence of oxidative stress in mdx mouse muscle: studies of the pre-necrotic state. J Neurol Sci. 1998;161(1):77-84. 268. McGeachie JK, Grounds MD, Partridge TA, Morgan JE. Age-related changes in replication of myogenic cells in mdx mice: quantitative autoradiographic studies. J Neurol Sci. 1993;119(2):169-79. 269. Grounds MD, Radley HG, Lynch GS, Nagaraju K, De Luca A. Towards developing standard operating procedures for pre-clinical testing in the mdx mouse model of Duchenne muscular dystrophy. Neurobiol Dis. 2008;31(1):1-19. 270. Lynch GS, Hinkle RT, Chamberlain JS, Brooks SV, Faulkner JA. Force and power output of fast and slow skeletal muscles from mdx mice 6-28 months old. J Physiol. 2001;535(Pt 2):591-600. 271. Nathan C. Points of control in inflammation. Nature. 2002;420(6917):846-52. 272. Wynn TA. Cellular and molecular mechanisms of fibrosis. J Pathol. 2008;214(2):199-210. 273. Porter JD, Khanna S, Kaminski HJ, Rao JS, Merriam AP, Richmonds CR, et al. A chronic inflammatory response dominates the skeletal muscle molecular signature in dystrophin-deficient mdx mice. Hum Mol Genet. 2002;11(3):263-72.

167

274. Evans NP, Misyak SA, Robertson JL, Bassaganya-Riera J, Grange RW. Dysregulated intracellular signaling and inflammatory gene expression during initial disease onset in Duchenne muscular dystrophy. Am J Phys Med Rehabil. 2009;88(6):502-22. 275. Evans NP, Misyak SA, Robertson JL, Bassaganya-Riera J, Grange RW. Immune-mediated mechanisms potentially regulate the disease time-course of duchenne muscular dystrophy and provide targets for therapeutic intervention. PM R. 2009;1(8):755-68. 276. Tidball JG, Wehling-Henricks M. Evolving therapeutic strategies for Duchenne muscular dystrophy: targeting downstream events. Pediatr Res. 2004;56(6):831-41. 277. Wehling M, Spencer MJ, Tidball JG. A nitric oxide synthase transgene ameliorates muscular dystrophy in mdx mice. J Cell Biol. 2001;155(1):123-31. 278. Huang P, Zhao XS, Fields M, Ransohoff RM, Zhou L. Imatinib attenuates skeletal muscle dystrophy in mdx mice. FASEB J. 2009;23(8):2539-48. 279. Peterson JM, Guttridge DC. Skeletal muscle diseases, inflammation, and NF-kappaB signaling: insights and opportunities for therapeutic intervention. Int Rev Immunol. 2008;27(5):375-87. 280. Lefaucheur JP, Pastoret C, Sebille A. Phenotype of dystrophinopathy in old mdx mice. Anat Rec. 1995;242(1):70-6. 281. Vetrone SA, Montecino-Rodriguez E, Kudryashova E, Kramerova I, Hoffman EP, Liu SD, et al. Osteopontin promotes fibrosis in dystrophic mouse muscle by modulating immune cell subsets and intramuscular TGF-beta. J Clin Invest. 2009;119(6):1583-94. 282. Li H, Mittal A, Makonchuk DY, Bhatnagar S, Kumar A. Matrix metalloproteinase-9 inhibition ameliorates pathogenesis and improves skeletal muscle regeneration in muscular dystrophy. Hum Mol Genet. 2009;18(14):2584-98. 283. Shiba N, Miyazaki D, Yoshizawa T, Fukushima K, Shiba Y, Inaba Y, et al. Differential roles of MMP-9 in early and late stages of dystrophic muscles in a mouse model of Duchenne muscular dystrophy. Biochim Biophys Acta. 2015;1852(10 Pt A):2170-82. 284. Jejurikar SS, Kuzon WM, Jr. Satellite cell depletion in degenerative skeletal muscle. Apoptosis. 2003;8(6):573-8. 285. Ten Broek RW, Grefte S, Von den Hoff JW. Regulatory factors and cell populations involved in skeletal muscle regeneration. J Cell Physiol. 2010;224(1):7-16. 286. Messina S, Vita GL, Aguennouz M, Sframeli M, Romeo S, Rodolico C, et al. Activation of NF-kappaB pathway in Duchenne muscular dystrophy: relation to age. Acta Myol. 2011;30(1):16-23. 287. Radley HG, Grounds MD. Cromolyn administration (to block mast cell degranulation) reduces necrosis of dystrophic muscle in mdx mice. Neurobiol Dis. 2006;23(2):387-97. 288. Boer JM, de Meijer EJ, Mank EM, van Ommen GB, den Dunnen JT. Expression profiling in stably regenerating skeletal muscle of dystrophin-deficient mdx mice. Neuromuscul Disord. 2002;12 Suppl 1:S118-24. 289. Dubowitz V, Sewry, C. A. and Fitzsimons, R. B. Muscle Biopsy: A Practical Approach. London: Baillière Tindall; 1985. 290. Spencer MJ, Montecino-Rodriguez E, Dorshkind K, Tidball JG. Helper (CD4(+)) and cytotoxic (CD8(+)) T cells promote the pathology of dystrophin-deficient muscle. Clin Immunol. 2001;98(2):235-43. 291. Piers AT, Lavin T, Radley-Crabb HG, Bakker AJ, Grounds MD, Pinniger GJ. Blockade of TNF in vivo using cV1q antibody reduces contractile dysfunction of skeletal muscle in response to eccentric exercise in dystrophic mdx and normal mice. Neuromuscul Disord. 2011;21(2):132-41. 292. Hodgetts S, Radley H, Davies M, Grounds MD. Reduced necrosis of dystrophic muscle by depletion of host neutrophils, or blocking TNFalpha function with Etanercept in mdx mice. Neuromuscul Disord. 2006;16(9-10):591-602. 293. De Luca A, Nico B, Liantonio A, Didonna MP, Fraysse B, Pierno S, et al. A multidisciplinary evaluation of the effectiveness of cyclosporine a in dystrophic mdx mice. Am J Pathol. 2005;166(2):477-89. 294. Rawat R, Cohen TV, Ampong B, Francia D, Henriques-Pons A, Hoffman EP, et al. Inflammasome up-regulation and activation in dysferlin-deficient skeletal muscle. Am J Pathol. 2010;176(6):2891-900.

168

295. Babelova A, Moreth K, Tsalastra-Greul W, Zeng-Brouwers J, Eickelberg O, Young MF, et al. Biglycan, a danger signal that activates the NLRP3 inflammasome via toll-like and P2X receptors. J Biol Chem. 2009;284(36):24035-48. 296. Brandan E, Gutierrez J. Role of proteoglycans in the regulation of skeletal muscle fibrotic response. FEBS J. 2013. 297. Vidal B, Ardite E, Suelves M, Ruiz-Bonilla V, Janue A, Flick MJ, et al. Amelioration of Duchenne muscular dystrophy in mdx mice by elimination of matrix-associated fibrin-driven inflammation coupled to the alphaMbeta2 leukocyte integrin receptor. Hum Mol Genet. 2012. 298. Mikami T, Koyama S, Yabuta Y, Kitagawa H. Chondroitin sulfate is a crucial determinant for skeletal muscle development/regeneration and improvement of muscular dystrophies. J Biol Chem. 2012;287(46):38531-42. 299. Fadic R, Mezzano V, Alvarez K, Cabrera D, Holmgren J, Brandan E. Increase in decorin and biglycan in Duchenne Muscular Dystrophy: role of fibroblasts as cell source of these proteoglycans in the disease. J Cell Mol Med. 2006;10(3):758-69. 300. Haslett JN, Sanoudou D, Kho AT, Bennett RR, Greenberg SA, Kohane IS, et al. Gene expression comparison of biopsies from Duchenne muscular dystrophy (DMD) and normal skeletal muscle. Proc Natl Acad Sci U S A. 2002;99(23):15000-5. 301. Caceres S, Cuellar C, Casar JC, Garrido J, Schaefer L, Kresse H, et al. Synthesis of proteoglycans is augmented in dystrophic mdx mouse skeletal muscle. Eur J Cell Biol. 2000;79(3):173- 81. 302. Chen YW, Zhao P, Borup R, Hoffman EP. Expression profiling in the muscular dystrophies: identification of novel aspects of molecular pathophysiology. J Cell Biol. 2000;151(6):1321-36. 303. Kumar A, Bhatnagar S. Matrix metalloproteinase inhibitor batimastat alleviates pathology and improves skeletal muscle function in dystrophin-deficient mdx mice. Am J Pathol. 2010;177(1):248- 60. 304. Bani C, Lagrota-Candido J, Pinheiro DF, Leite PE, Salimena MC, Henriques-Pons A, et al. Pattern of metalloprotease activity and myofiber regeneration in skeletal muscles of mdx mice. Muscle Nerve. 2008;37(5):583-92. 305. Dahiya S, Givvimani S, Bhatnagar S, Qipshidze N, Tyagi SC, Kumar A. Osteopontin- stimulated expression of matrix metalloproteinase-9 causes cardiomyopathy in the mdx model of Duchenne muscular dystrophy. J Immunol. 2011;187(5):2723-31. 306. Carmeli E, Moas M, Reznick AZ, Coleman R. Matrix metalloproteinases and skeletal muscle: a brief review. Muscle Nerve. 2004;29(2):191-7. 307. Guerin CW, Holland PC. Synthesis and secretion of matrix-degrading metalloproteases by human skeletal muscle satellite cells. Dev Dyn. 1995;202(1):91-9. 308. Cao Y, Zhao Z, Gruszczynska-Biegala J, Zolkiewska A. Role of metalloprotease disintegrin ADAM12 in determination of quiescent reserve cells during myogenic differentiation in vitro. Molecular and cellular biology. 2003;23(19):6725-38. 309. Kharraz Y, Guerra J, Pessina P, Serrano AL, Munoz-Canoves P. Understanding the process of fibrosis in Duchenne muscular dystrophy. BioMed research international. 2014;2014:965631. 310. Stedman HH, Sweeney HL, Shrager JB, Maguire HC, Panettieri RA, Petrof B, et al. The mdx mouse diaphragm reproduces the degenerative changes of Duchenne muscular dystrophy. Nature. 1991;352(6335):536-9. 311. Yamaguchi Y, Mann DM, Ruoslahti E. Negative regulation of transforming growth factor-beta by the proteoglycan decorin. Nature. 1990;346(6281):281-4. 312. Taniguti AP, Pertille A, Matsumura CY, Santo Neto H, Marques MJ. Prevention of muscle fibrosis and myonecrosis in mdx mice by suramin, a TGF-beta1 blocker. Muscle Nerve. 2011;43(1):82- 7. 313. Bish LT, Yarchoan M, Sleeper MM, Gazzara JA, Morine KJ, Acosta P, et al. Chronic losartan administration reduces mortality and preserves cardiac but not skeletal muscle function in dystrophic mice. PLoS One. 2011;6(6):e20856. 314. Spurney CF, Sali A, Guerron AD, Iantorno M, Yu Q, Gordish-Dressman H, et al. Losartan decreases cardiac muscle fibrosis and improves cardiac function in dystrophin-deficient mdx mice. J Cardiovasc Pharmacol Ther. 2011;16(1):87-95.

169

315. Gosselin LE, Williams JE, Personius K, Farkas GA. A comparison of factors associated with collagen metabolism in different skeletal muscles from dystrophic (mdx) mice: impact of pirfenidone. Muscle Nerve. 2007;35(2):208-16. 316. Swiderski K, Todorov M, Gehrig SM, Naim T, Chee A, Stapleton DI, et al. Tranilast administration reduces fibrosis and improves fatigue resistance in muscles of mdx dystrophic mice. Fibrogenesis & tissue repair. 2014;7(1):1. 317. Ogura Y, Tajrishi MM, Sato S, Hindi SM, Kumar A. Therapeutic potential of matrix metalloproteinases in Duchenne muscular dystrophy. Front Cell Dev Biol. 2014;2:11. 318. Taniguti AP, Matsumura CY, Rodrigues-Simioni L, Santo Neto H, Marques MJ. Suramin affects metalloproteinase-9 activity and increases beta-dystroglycan levels in the diaphragm of the dystrophin-deficient mdx mouse. Muscle Nerve. 2012;46(5):810-3. 319. De Oliveira Moreira D, Pereira JA, Taniguti AP, Matsumura CY, Ramos LA, Areas MA, et al. Suramin attenuates dystrophin-deficient cardiomyopathy in the mdx mouse model of duchenne muscular dystrophy. Muscle Nerve. 2013;48(6):911-9. 320. LaPierre DP, Lee DY, Li SZ, Xie YZ, Zhong L, Sheng W, et al. The ability of versican to simultaneously cause apoptotic resistance and sensitivity. Cancer Res. 2007;67(10):4742-50. 321. Pearce JM, Pennington RJ, Walton JN. SERUM ENZYME STUDIES IN MUSCLE DISEASE. II. SERUM CREATINE KINASE ACTIVITY IN MUSCULAR DYSTROPHY AND IN OTHER MYOPATHIC AND NEUROPATHIC DISORDERS. J Neurol Neurosurg Psychiatry. 1964;27:96-9. 322. Carlson CG. Determination of hydroxyproline content as a measure of fibrosis in nondystrophic and dystrophic skeletal muscle. TREAT-NMD Activity A07: Accelerate preclinical phase of new therapeutic treatment developement. [Standard Operating Procedure]. In press 2010. 323. Reddy GK, Enwemeka CS. A simplified method for the analysis of hydroxyproline in biological tissues. Clinical biochemistry. 1996;29(3):225-9. 324. Smythe GM, White JD. Voluntary wheel running in dystrophin-deficient (mdx) mice: Relationships between exercise parameters and exacerbation of the dystrophic phenotype. PLoS Curr. 2011;3:RRN1295. 325. Lynch GS. Measuring isometric force of isolated mouse skeletal muscles in situ. TREAT-NMD Activity A07: Accelerate preclinical phase of new therapeutic treatment development. [Standard Operating Procedure]. In press 2011. 326. Stupka N, Schertzer JD, Bassel-Duby R, Olson EN, Lynch GS. Stimulation of calcineurin Aalpha activity attenuates muscle pathophysiology in mdx dystrophic mice. Am J Physiol Regul Integr Comp Physiol. 2008;294(3):R983-92. 327. Dubach-Powell J. Quantitative determination of muscle fiber diameter (minimal Feret’s diameter) and percentage of centralized nuclei. TREAT-NMD Activity A07: Accelerate preclinical phase of new therapeutic treatment development2008. 328. Grounds M. Quantification of histopathology in Haemotoxylin and Eosin stained muscle sections. TREAT-NMD Activity A07: Accelerate preclinical phase of new therapeutic treatment development. [Standard Operating Procedure]. In press 2011. 329. Janssen PM, Murray JD, Schill KE, Rastogi N, Schultz EJ, Tran T, et al. Prednisolone attenuates improvement of cardiac and skeletal contractile function and histopathology by lisinopril and spironolactone in the mdx mouse model of Duchenne muscular dystrophy. PLoS One. 2014;9(2):e88360. 330. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29(9):e45. 331. Oakley BR, Kirsch DR, Morris NR. A simplified ultrasensitive silver stain for detecting proteins in polyacrylamide gels. Anal Biochem. 1980;105(2):361-3. 332. Sasse J, Gallagher SR. Staining proteins in gels. Curr Protoc Immunol. 2004;Chapter 8:Unit 8 9. 333. Cossu G, Biressi S. Satellite cells, myoblasts and other occasional myogenic progenitors: possible origin, phenotypic features and role in muscle regeneration. Semin Cell Dev Biol. 2005;16(4- 5):623-31.

170

334. Ontell M, Kozeka K. Organogenesis of the mouse extensor digitorum logus muscle: a quantitative study. Am J Anat. 1984;171(2):149-61. 335. Ontell M, Feng KC, Klueber K, Dunn RF, Taylor F. Myosatellite cells, growth, and regeneration in murine dystrophic muscle: a quantitative study. Anat Rec. 1984;208(2):159-74. 336. Gendron C, Kashiwagi M, Lim NH, Enghild JJ, Thogersen IB, Hughes C, et al. Proteolytic activities of human ADAMTS-5: comparative studies with ADAMTS-4. J Biol Chem. 2007;282(25):18294-306. 337. Melching LI, Fisher WD, Lee ER, Mort JS, Roughley PJ. The cleavage of biglycan by aggrecanases. Osteoarthritis Cartilage. 2006;14(11):1147-54. 338. Giblin SP, Midwood KS. Tenascin-C: Form versus function. Cell Adh Migr. 2015;9(1-2):48- 82. 339. Velleman SG, Patterson RA, Nestor KE. Identification of decorin and chondroitin sulfate proteoglycans in turkey skeletal muscle. Poult Sci. 1997;76(3):506-10. 340. Olguin HC, Santander C, Brandan E. Inhibition of myoblast migration via decorin expression is critical for normal skeletal muscle differentiation. Dev Biol. 2003;259(2):209-24. 341. Lewis MP, Tippett HL, Sinanan AC, Morgan MJ, Hunt NP. Gelatinase-B (matrix metalloproteinase-9; MMP-9) secretion is involved in the migratory phase of human and murine muscle cell cultures. J Muscle Res Cell Motil. 2000;21(3):223-33. 342. Wang W, Pan H, Murray K, Jefferson BS, Li Y. Matrix metalloproteinase-1 promotes muscle cell migration and differentiation. Am J Pathol. 2009;174(2):541-9. 343. Chen X, Li Y. Role of matrix metalloproteinases in skeletal muscle: migration, differentiation, regeneration and fibrosis. Cell Adh Migr. 2009;3(4):337-41. 344. Enomoto H, Nelson CM, Somerville RP, Mielke K, Dixon LJ, Powell K, et al. Cooperation of two ADAMTS metalloproteases in closure of the mouse palate identifies a requirement for versican proteolysis in regulating palatal mesenchyme proliferation. Development. 2010;137(23):4029-38. 345. Wylie JD, Ho JC, Singh S, McCulloch DR, Apte SS. Adamts5 (aggrecanase-2) is widely expressed in the mouse musculoskeletal system and is induced in specific regions of knee joint explants by inflammatory cytokines. J Orthop Res. 2012;30(2):226-33. 346. Amenta AR, Creely HE, Mercado ML, Hagiwara H, McKechnie BA, Lechner BE, et al. Biglycan is an extracellular MuSK binding protein important for synapse stability. J Neurosci. 2012;32(7):2324-34. 347. Kenagy RD, Plaas AH, Wight TN. Versican degradation and vascular disease. Trends Cardiovasc Med. 2006;16(6):209-15. 348. Kenagy RD, Fischer JW, Davies MG, Berceli SA, Hawkins SM, Wight TN, et al. Increased plasmin and serine proteinase activity during flow-induced intimal atrophy in baboon PTFE grafts. Arterioscler Thromb Vasc Biol. 2002;22(3):400-4. 349. Passi A, Negrini D, Albertini R, Miserocchi G, De Luca G. The sensitivity of versican from rabbit lung to gelatinase A (MMP-2) and B (MMP-9) and its involvement in the development of hydraulic lung edema. FEBS Lett. 1999;456(1):93-6. 350. Sandy JD. A contentious issue finds some clarity: on the independent and complementary roles of aggrecanase activity and MMP activity in human joint aggrecanolysis. Osteoarthritis Cartilage. 2006;14(2):95-100. 351. Halpert I, Sires UI, Roby JD, Potter-Perigo S, Wight TN, Shapiro SD, et al. Matrilysin is expressed by lipid-laden macrophages at sites of potential rupture in atherosclerotic lesions and localizes to areas of versican deposition, a proteoglycan substrate for the enzyme. Proc Natl Acad Sci U S A. 1996;93(18):9748-53. 352. Deschenes MR, Maresh CM, Crivello JF, Armstrong LE, Kraemer WJ, Covault J. The effects of exercise training of different intensities on neuromuscular junction morphology. J Neurocytol. 1993;22(8):603-15. 353. Andonian MH, Fahim MA. Endurance exercise alters the morphology of fast- and slow-twitch rat neuromuscular junctions. Int J Sports Med. 1988;9(3):218-23. 354. Nakano H, Masuda K, Sasaki S, Katsuta S. Oxidative enzyme activity and soma size in motoneurons innervating the rat slow-twitch and fast-twitch muscles after chronic activity. Brain Res Bull. 1997;43(2):149-54.

171

355. Gazula VR, Roberts M, Luzzio C, Jawad AF, Kalb RG. Effects of limb exercise after spinal cord injury on motor neuron dendrite structure. J Comp Neurol. 2004;476(2):130-45. 356. Gardiner P, Dai Y, Heckman CJ. Effects of exercise training on alpha-motoneurons. J Appl Physiol. 2006;101(4):1228-36. 357. Baum O, Gubeli J, Frese S, Torchetti E, Malik C, Odriozola A, et al. Angiogenesis-related ultrastructural changes to capillaries in human skeletal muscle in response to endurance exercise. J Appl Physiol (1985). 2015;119(10):1118-26. 358. Leiter JR, Peeler J, Anderson JE. Exercise-induced muscle growth is muscle-specific and age- dependent. Muscle Nerve. 2011;43(6):828-38. 359. Leick L, Hellsten Y, Fentz J, Lyngby SS, Wojtaszewski JF, Hidalgo J, et al. PGC-1alpha mediates exercise-induced skeletal muscle VEGF expression in mice. Am J Physiol Endocrinol Metab. 2009;297(1):E92-103. 360. Bradbury EJ, Moon LD, Popat RJ, King VR, Bennett GS, Patel PN, et al. Chondroitinase ABC promotes functional recovery after spinal cord injury. Nature. 2002;416(6881):636-40. 361. Demircan K, Yonezawa T, Takigawa T, Topcu V, Erdogan S, Ucar F, et al. ADAMTS1, ADAMTS5, ADAMTS9 and aggrecanase-generated proteoglycan fragments are induced following spinal cord injury in mouse. Neurosci Lett. 2013;544:25-30. 362. Kumar S, Sharghi-Namini S, Rao N, Ge R. ADAMTS5 functions as an anti-angiogenic and anti-tumorigenic protein independent of its proteoglycanase activity. Am J Pathol. 2012;181(3):1056- 68. 363. Iruela-Arispe ML, Carpizo D, Luque A. ADAMTS1: a matrix metalloprotease with angioinhibitory properties. Ann N Y Acad Sci. 2003;995:183-90. 364. Hayes A, Lynch GS, Williams DA. The effects of endurance exercise on dystrophic mdx mice. I. Contractile and histochemical properties of intact muscles. Proc Biol Sci. 1993;253(1336):19-25. 365. Keeling RM, Golumbek PT, Streif EM, Connolly AM. Weekly oral prednisolone improves survival and strength in male mdx mice. Muscle Nerve. 2007;35(1):43-8. 366. Salimena MC, Lagrota-Candido J, Quirico-Santos T. Gender dimorphism influences extracellular matrix expression and regeneration of muscular tissue in mdx dystrophic mice. Histochem Cell Biol. 2004;122(5):435-44. 367. Lepper C, Conway SJ, Fan CM. Adult satellite cells and embryonic muscle progenitors have distinct genetic requirements. Nature. 2009;460(7255):627-31. 368. Schaefer L. Complexity of danger: the diverse nature of damage-associated molecular patterns. J Biol Chem. 2014;289(51):35237-45. 369. Moreth K, Brodbeck R, Babelova A, Gretz N, Spieker T, Zeng-Brouwers J, et al. The proteoglycan biglycan regulates expression of the B cell chemoattractant CXCL13 and aggravates murine lupus nephritis. J Clin Invest. 2010;120(12):4251-72. 370. Schaefer L, Iozzo RV. Small leucine-rich proteoglycans, at the crossroad of cancer growth and inflammation. Curr Opin Genet Dev. 2012;22(1):56-7. 371. Zhang X, Chen CT, Bhargava M, Torzilli PA. A Comparative Study of Fibronectin Cleavage by MMP-1, -3, -13, and -14. Cartilage. 2012;3(3):267-77. 372. Midwood K, Sacre S, Piccinini AM, Inglis J, Trebaul A, Chan E, et al. Tenascin-C is an endogenous activator of Toll-like receptor 4 that is essential for maintaining inflammation in arthritic joint disease. Nat Med. 2009;15(7):774-80. 373. Cornelison DD, Wold BJ. Single-cell analysis of regulatory gene expression in quiescent and activated mouse skeletal muscle satellite cells. Dev Biol. 1997;191(2):270-83. 374. Yablonka-Reuveni Z, Rivera AJ. Temporal expression of regulatory and structural muscle proteins during myogenesis of satellite cells on isolated adult rat fibers. Dev Biol. 1994;164(2):588- 603. 375. Yamane A, Akutsu S, Diekwisch TG, Matsuda R. Satellite cells and utrophin are not directly correlated with the degree of skeletal muscle damage in mdx mice. Am J Physiol Cell Physiol. 2005;289(1):C42-8. 376. Barton ER. Measuring isometric force of isolated mouse muscles in vitro. TREAT-NMD Activity A07: Accelerate preclinical phase of new therapeutic treatment developement. [Standard Operating Procedure]. In press 2011. 377. Adams JC, Lawler J. The thrombospondins. Int J Biochem Cell Biol. 2004;36(6):961-8.

172

378. Urao N, Mirza RE, Heydemann A, Garcia J, Koh TJ. Thrombospondin-1 levels correlate with macrophage activity and disease progression in dysferlin deficient mice. Neuromuscul Disord. 2016;26(3):240-51. 379. Kosasih HJ, Last K, Rogerson FM, Golub SB, Gauci SJ, Russo VC, et al. A Disintegrin and Metalloproteinase with Thrombospondin Motifs-5 (ADAMTS-5) Forms Catalytically Active Oligomers. J Biol Chem. 2016;291(7):3197-208. 380. Hamer PW, McGeachie JM, Davies MJ, Grounds MD. Evans Blue Dye as an in vivo marker of myofibre damage: optimising parameters for detecting initial myofibre membrane permeability. J Anat. 2002;200(Pt 1):69-79. 381. Shavlakadze T, White J, Hoh JF, Rosenthal N, Grounds MD. Targeted expression of insulin- like growth factor-I reduces early myofiber necrosis in dystrophic mdx mice. Mol Ther. 2004;10(5):829-43. 382. Yamada H, Saito F, Fukuta-Ohi H, Zhong D, Hase A, Arai K, et al. Processing of beta- dystroglycan by matrix metalloproteinase disrupts the link between the extracellular matrix and cell membrane via the dystroglycan complex. Hum Mol Genet. 2001;10(15):1563-9. 383. Gehrig SM, van der Poel C, Sayer TA, Schertzer JD, Henstridge DC, Church JE, et al. Hsp72 preserves muscle function and slows progression of severe muscular dystrophy. Nature. 2012;484(7394):394-8. 384. Uaesoontrachoon K, Quinn JL, Tatem KS, Van Der Meulen JH, Yu Q, Phadke A, et al. Long- term treatment with naproxcinod significantly improves skeletal and cardiac disease phenotype in the mdx mouse model of dystrophy. Hum Mol Genet. 2014;23(12):3239-49. 385. Lopez-Otin C, Overall CM. Protease degradomics: a new challenge for proteomics. Nat Rev Mol Cell Biol. 2002;3(7):509-19. 386. Naba A, Clauser KR, Hoersch S, Liu H, Carr SA, Hynes RO. The matrisome: in silico definition and in vivo characterization by proteomics of normal and tumor extracellular matrices. Mol Cell Proteomics. 2012;11(4):M111 014647. 387. Naba A, Clauser KR, Ding H, Whittaker CA, Carr SA, Hynes RO. The extracellular matrix: Tools and insights for the "omics" era. Matrix Biol. 2016;49:10-24. 388. Didangelos A, Yin X, Mandal K, Baumert M, Jahangiri M, Mayr M. Proteomics characterization of extracellular space components in the human aorta. Mol Cell Proteomics. 2010;9(9):2048-62. 389. Righetti PG, Castagna A, Antonioli P, Boschetti E. Prefractionation techniques in proteome analysis: the mining tools of the third millennium. Electrophoresis. 2005;26(2):297-319. 390. Korossis SA, Wilcox HE, Watterson KG, Kearney JN, Ingham E, Fisher J. In-vitro assessment of the functional performance of the decellularized intact porcine aortic root. J Heart Valve Dis. 2005;14(3):408-21; discussion 22. 391. Sajdera SW, Hascall VC. Proteinpolysaccharide complex from bovine nasal cartilage. A comparison of low and high shear extraction procedures. J Biol Chem. 1969;244(1):77-87. 392. Wilson R, Bateman JF. A robust method for proteomic characterization of mouse cartilage using solubility-based sequential fractionation and two-dimensional gel electrophoresis. Matrix Biol. 2008;27(8):709-12. 393. Murphy MM, Lawson JA, Mathew SJ, Hutcheson DA, Kardon G. Satellite cells, connective tissue fibroblasts and their interactions are crucial for muscle regeneration. Development. 2011;138(17):3625-37. 394. Rando TA, Blau HM. Primary mouse myoblast purification, characterization, and transplantation for cell-mediated gene therapy. J Cell Biol. 1994;125(6):1275-87. 395. Chan D, Lamande SR, Cole WG, Bateman JF. Regulation of procollagen synthesis and processing during ascorbate-induced extracellular matrix accumulation in vitro. Biochem J. 1990;269(1):175-81. 396. Wilson R, Diseberg AF, Gordon L, Zivkovic S, Tatarczuch L, Mackie EJ, et al. Comprehensive profiling of cartilage extracellular matrix formation and maturation using sequential extraction and label-free quantitative proteomics. Mol Cell Proteomics. 2010;9(6):1296-313. 397. Byron A, Humphries JD, Humphries MJ. Defining the extracellular matrix using proteomics. Int J Exp Pathol. 2013;94(2):75-92.

173

398. Gundry RL, White MY, Murray CI, Kane LA, Fu Q, Stanley BA, et al. Preparation of proteins and peptides for mass spectrometry analysis in a bottom-up proteomics workflow. Curr Protoc Mol Biol. 2009;Chapter 10:Unit10 25. 399. Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, Mann M. Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol Cell Proteomics. 2014;13(9):2513-26. 400. Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, et al. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat Methods. 2016;13(9):731-40. 401. Mann K, Mann M. Proteomic analysis of quail calcified eggshell matrix: a comparison to chicken and turkey eggshell proteomes. Proteome Sci. 2015;13:22. 402. Kuttner V, Mack C, Rigbolt KT, Kern JS, Schilling O, Busch H, et al. Global remodelling of cellular microenvironment due to loss of collagen VII. Mol Syst Biol. 2013;9:657. 403. Le Goff C, Cormier-Daire V. The ADAMTS(L) family and human genetic disorders. Hum Mol Genet. 2011;20(R2):R163-7. 404. Kutz WE, Wang LW, Bader HL, Majors AK, Iwata K, Traboulsi EI, et al. ADAMTS10 protein interacts with fibrillin-1 and promotes its deposition in extracellular matrix of cultured fibroblasts. J Biol Chem. 2011;286(19):17156-67. 405. Tiedemann K, Batge B, Muller PK, Reinhardt DP. Interactions of fibrillin-1 with heparin/heparan sulfate, implications for microfibrillar assembly. J Biol Chem. 2001;276(38):36035- 42. 406. Schlage P, auf dem Keller U. Proteomic approaches to uncover MMP function. Matrix Biol. 2015;44-46:232-8. 407. Kleifeld O, Doucet A, Prudova A, auf dem Keller U, Gioia M, Kizhakkedathu JN, et al. Identifying and quantifying proteolytic events and the natural N terminome by terminal amine isotopic labeling of substrates. Nature protocols. 2011;6(10):1578-611. 408. auf dem Keller U, Prudova A, Eckhard U, Fingleton B, Overall CM. Systems-level analysis of proteolytic events in increased vascular permeability and complement activation in skin inflammation. Sci Signal. 2013;6(258):rs2. 409. Zhen EY, Brittain IJ, Laska DA, Mitchell PG, Sumer EU, Karsdal MA, et al. Characterization of metalloprotease cleavage products of human articular cartilage. Arthritis Rheum. 2008;58(8):2420- 31. 410. Chapman MA, Meza R, Lieber RL. Skeletal muscle fibroblasts in health and disease. Differentiation. 2016;92(3):108-15.

174

Minerva Access is the Institutional Repository of The University of Melbourne

Author/s: Piers, Adam

Title: ADAMTS5 in healthy muscle and muscular dystrophy

Date: 2016

Persistent Link: http://hdl.handle.net/11343/127241

File Description: ADAMTS5 in healthy muscle and muscular dystrophy

Terms and Conditions: Terms and Conditions: Copyright in works deposited in Minerva Access is retained by the copyright owner. The work may not be altered without permission from the copyright owner. Readers may only download, print and save electronic copies of whole works for their own personal non-commercial use. Any use that exceeds these limits requires permission from the copyright owner. Attribution is essential when quoting or paraphrasing from these works.