Aldo-Keto Reductase 1C3 May Be a New Radioresistance Marker in Non-Small-Cell Lung Cancer

ORIGINAL ARTICLE Aldo-keto reductase 1C3 may be a new radioresistance marker in non-small-cell lung cancer

L Xie, J Yu, W Guo, L Wei, Y Liu, X Wang and X Song

Human aldo-keto reductase 1C3, type 2 3a-hydroxysteroid dehydrogenase (HSD)/type 5 17b-HSD (AKR1C3) is known to be involved in steroid, prostaglandin and lipid aldehyde metabolism. The role of AKR1C3 in the radiosensitivity to X-rays of human non-small- cell lung cancer (NSCLC) cells was explored. In this study, a specific small interfering RNA (siRNA) to target the AKR1C3 gene was used. A suite of readouts including cell survival were determined using a colony formation assay; apoptosis evaluated by Annexin V expression levels, irradiation-induced cytotoxicity established using a MTT cell viability assay and cell cycle distribution measured by flow cytometry were used in characterizing the role of the AKR1C3 gene. Although AKR1C3 was significantly overexpressed in both our radioresistant subclone cells and NSCLC tissues, a specific AKR1C3 siRNA significantly enhanced cell radiosensitivity and was concomitant with decreased expression of this gene. Furthermore, reduced interleukin-6 (IL-6)-mediated radioresistance was observed when siRNA was used to knock down AKR1C3 activity. This AKR1C3-mediated radioresistance was correlated with an arrest in the G2/M cell cycle and a decreased induction of apoptosis. AKR1C3 may present a potential therapeutic target in addressing radioresistance of NSCLC, and in particular in IL-6-mediated radioresistance.

Cancer Gene Therapy (2013) 20, 260–266; doi:10.1038/cgt.2013.15; published online 22 March 2013 Keywords: AKR1C3; NSCLC; radiation therapy; radioresistance

INTRODUCTION acquired tumor radioresistance in NSCLC. In this follow-on study, Radiation therapy (RT) is an integral part of modern cancer we examined the role of AKR1C3 and its mechanism of action in management. More than 50% of all newly diagnosed cancer conferring radioresistance in the NSCLC cell lines. patients worldwide receive RT alone or in combination with chemotherapy or surgery at some point in the course of their treatment.1 Of all cancers affecting the lung, non-small-cell lung MATERIALS AND METHODS cancer (NSCLC) accounts for B80% of these cases, and RT is Materials, cell line and tissue specimen from human patients considered the preferred treatment approach. However, intrinsic The human lung adenocarcinoma cell lines SPCA1 (obtained from and/or acquired resistance to RT is increasingly recognized China Centre for Type Culture Collection, CCTCC, Wuhan, China) and as a significant impediment to effective cancer treatment. The A549 (from American Type Culture Collection, Manassas, VA, USA) were underlying mechanism(s) associated with this intrinsic and/or maintained in Dulbecco’s modified Eagle’s medium (GIBCO, Carlsbad, CA, USA) supplemented with glutamine (2 mmol l À 1), antibiotics (penicillin/ acquired resistance of the cancerous tissue to radiation treatment À 1 remains uncertain. streptomycin, 10 units ml ) and 10% heat-inactivated fetal bovine serum (GIBCO) at 37 1Cin5%CO2. Cells were passaged every 2–3 days Human aldo-keto reductase (AKR) 1C3, type 2 3a-hydroxyster- to maintain exponential growth. Recombinant human interleukin-6 oid dehydrogenase (HSC)/type 5 17b-HSD (AKR1C3) is known to (IL-6) was purchased from R&D Systems (Minneapolis, MN, USA). Anti- be involved in the metabolism of steroids, prostaglandins AKR1C3 antibody was purchased from Abcam (Cambridge, MA,USA). Anti- (PGs) and lipid aldehydes.2,3 Specifically, AKR1C3 catalyzes the b-actin monoclonal antibody was purchased from Biovision (Milpitas, reduction of 4-androstene-3,17-dione to testosterone and estrone CA, USA). Secondary anti-mouse or anti-rabbit antibodies coupled to to 17b-estradiol in target tissues, which in turn promotes the horseradish peroxidase were from Santa Cruz Biotechnology (Santa Cruz, proliferation of hormone-dependent prostate and breast cancers, CA, USA). Tissue specimens of NSCLC were obtained from Department of Surgery respectively. AKR1C3 also catalyzes the reduction of PGH2 to PGF and PGD to 9a,11b-PGF , which limits antiproliferative at Shandong Cancer Hospital and Institute under the approval of the 2a 2 2 Institutional Review Board. The ethics committee of Shandong Cancer PG formation including 15-deoxy-D12,14-PGJ2, and contributes Hospital and Institute specifically waived the need for consent. A total of to a proliferative signaling response. AKR1C3 is overexpressed 27 specimens of NSCLC were obtained from patients who underwent in a wide variety of cancers, including breast and prostate surgical resection from 2008 to 2010 in the Department of Surgery at cancer.4–6 Shandong Cancer Hospital and Institute (Jinan, China). Of these samples, In a previous study,7 two radioresistant NSCLC subclones, 20 were from male patients with a mean age of 60 years old (45–73 years); A549/R and SPCA1/R, were established after sequential sublethal 7 from female patients with same mean age (46–74 years). They were irradiation of A549 and SPCA1 cells. Unexpectedly, we found pathologically diagnosed as stage I or II NSCLC, with Eastern Cooperative Oncology Group performance (ECOG) status of 0–2. Out of 27 patients, that AKR1C3 was significantly upregulated in radioresistant 12 (44.4%) were diagnosed with squamous cell cancer, 8 (29.6%) with cancer cells, suggesting that AKR1C3 may be a mediator of adenocarcinoma, 4 (14.8%) with NOS (not otherwise specified) NSCLC and

Shandong Provincial Key Laboratory of Radiation Oncology, Shandong Cancer Hospital and Institute, Jinan, Shandong Province, China. Correspondence: Professor X Song, Shandong Provincial Key Laboratory of Radiation Oncology, Shandong Cancer Hospital and Institute, 440 Ji-Yan Road, Jinan, Shandong Province 250117, China. E-mail: [email protected] Received 13 December 2012; revised 28 January 2013; accepted 26 February 2013; published online 22 March 2013 AKR1C3, a new radioresistance marker L Xie et al 261 3 (11.1%) with large-cell neuroendocrinal cancer. Before surgical therapy, the nonspecific control siRNA probe (sense, 50-GAUCUACAUACGAGCAC none of the patients had received neoadjuvant chemotherapy, RT or UAtt-30; antisense, 50-UAGUGCUCGUAUGUAGAUCtc-30) were synthesized immunotherapy. Tissue specimens were appraised immediately after by Ambion. Cells (5 Â 105) were seeded in 25 cm2 flasks 24 h before surgery, and part of the specimen was used for pathological examination, transfection in attaining 50–60% confluence, and then cultured in serum- whereas the remaining part was snap-frozen with liquid nitrogen and free OptiMEM (Invitrogen) for 4 h. Lipofectamine 2000 complexes were stored at À 80 1C for gene expression analysis. prepared in serum-free medium using 30 nM of AKR1C3-specific siRNA or control siRNA with 30 ml of Lipofectamine 2000 (Invitrogen) per well Microarray analysis following the manufacturer’s recommended protocol. After 20 min of incubation, complexes were added dropwise to cells and incubated at An aliquot of total RNA was purified to isolate mRNA using the Illumina 37 1C, 5% CO2, After 6 h, cells were returned to complete growth media (EI Segundo, CA, USA) Total Prep RNA Amplification kit by Ambion (Austin, (Dulbecco’s modified Eagle’s medium supplemented with 10% heat- TX, USA). Purified mRNA was converted to biotinylated double-stranded inactivated fetal calf serum). At 24 h after transfection, cells were collected complementary DNA and hybridized to Illumina Human-6 v2 Expression to evaluate gene expression or irradiated at room temperature using a BeadChip following the manufacturer’s protocol. Analysis of the genetic linear accelerator (6-MV X-ray, CLINAC 2100C, Varian, Palo Alto, CA, USA) expression was performed using GeneSpring GX software, by performing with a dose rate of 3 Gy min À 1. nonparametric t-test (Mann–Whitney rank test) without any error correction on the samples. Genes were considered statistically significant at Po0.05. Assay for radiosensitivity Cell survival after X-ray irradiation was measured by clonogenic assay. Cells RNA extraction and real-time reverse transcriptase-PCR (RT-PCR) plated in 60 mm tissue culture dish were irradiated at concentrations analysis ranging from 0 to 12 Gy. The appropriate plating density was aimed to produce 20–100 surviving colonies per well. These cells were incubated at Total RNA was isolated from culture cells using Trizol reagent (Invitrogen, 37 1C for 10–14 days (three plates/radiation concentration). After fixation Carlsbad, CA, USA) in accordance the with manufacture’s procedures. with acetic acid–methanol (1:4) and staining with diluted crystal violet 1 Reverse transcription was performed at 37 C for 15 min in a volume of (1:30), colonies consisting of X50 cells were counted under a light m m m 10 l containing 2 lof5Â PrimeScript buffer, 0.5 l of PrimeScript RT microscope. Results from the triplicate plates were averaged and divided Enzyme Mix I, 0.5 ml of random 6-mer primers and 0.5 ml of Oligo dT primer by initial seeded cells to yield survival rate of clones for each concentration, (TaKaRa, Dalian, China). Reverse transcription enzyme was inactivated at and the surviving fraction was determined. All survival curves represent a 1 85 C for 5 s. The complementary DNA products were used for real-time minimum of three independent experiments. The sensitizer enhancement RT-PCR. ratio (SER) at 1% survival level in cells was defined as SER ¼ mean Specific primers for real-time PCR (Table 1) were designed using Primer inactivation dose (transfected with si-control)/mean inactivation dose Express software (Applied Biosystems, Carlsbad, CA, USA) for each mRNA (transfected with si-AKR1C3). SER 41 indicates radiosensitization. that preferentially spanning intron–exon boundaries to avoid amplification of genomic DNA. Reactions were performed in 25 ml volumes, containing 12.5 mlof2Â SYBR Premix Ex Tag, 5 mM of specific primers and 200 ng of Detection of apoptotic cells complementary DNA template. Amplifications were carried out on an Cell apoptosis was evaluated using the Annexin V–FITC Apoptosis ABI Prism 7000 Sequence Analyzer (Grand Island, NY, USA) with the Detection Kit (BD Biosciences Pharmingen, San Jose, CA, USA) followed following cycle program: 1 cycle: 95 1C/10 s; 40 cycles: 95 1C/5 s and 60 1C/ by fluorescence-activated cell sorting (FACS) analysis. Cells were treated 1 min. The relative gene expression level was calculated by comparing with trypsin–EDTA in phosphate-buffered saline at pH 7.5, washed threshold cycle (Ct) values of samples to that of the reference. All data with normal medium and cold phosphate-buffered saline, and then were normalized to b-actin. Accordingly, DCt ¼ (mean Ct value of gene)– resuspended in 1 Â binding buffer. Annexin V (5 ml) and propidium iodide (mean Ct value of b-actin), and DDCt ¼ DCt (selected cells)–DCt (parental (10 ml) were added to the cells, vortexed and incubated for 15 min in the cells). The relative gene expression in a particular sample was then given -DDCt dark. Finally, cells were diluted with 1 Â binding buffer (400 ml), and by the following: 2 value. samples evaluated by flow cytometry (FACS Calibur, BD Biosciences) using Cellquest software. Western blotting Cells were lysed in ice-cold lysis buffer (0.15 M NaCl, 50 mM Tris-Cl, pH 7.4, MTT cell viability assay 2mM EDTA, 5 mM dithiothreitol, 0.5% Triton 100, 0.2 mM phenylmethyl- The effect of irradiation was also evaluated by conventional MTT cell sulfonyl fluoride, 1 mgmlÀ 1 aprotinin), supernatants recovered and the viability assay, and results are presented as a percentage of the control. total cellular protein concentration was determined with the method of Briefly, 1 Â 104 cells per well were seeded in 96-well plates and cultured in Bradford. Equal amounts of protein were loaded, and resolved by sodium Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine dodecyl sulfate polyacrylamide gel electrophoresis before electrotransfer serum for 8 h. Following radiation treatment (12 Gy), 10 mlof5glÀ 1 to a polyvinylidene difluoride membrane (Amersham Biosciences, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solu- Buckinghamshire, UK), and then the membrane was probed with the tion was added and incubated for 4 h at 37 1C. Formazan crystals that form appropriate antibodies. were solubilized with 100 ml of acidified (0.01 M HCl) 10% sodium dodecyl sulfate for 24 h. Absorbance was read on a Bio-Rad 680 microplate reader Transfection of siRNA and irradiation (Bio-Rad, Hercules, CA, USA) at 570 nm and results reported relative to a The primers used in generating the double-stranded small interfering RNA reference wavelength of 630 nm. (siRNA) probe for AKR1C3 interference studies (sense, 50-GGAACUUUCACC 0 0 0 AACAGAUtt-3 ; antisense, 5 -AUCUGUUGGUGAAAGUUCCtc-3 ) as well as Cell cycle analysis Cells (1 Â 106) were fixed in 70% ethanol, at À 20 1C, overnight. Cells were Table 1. Primer sequences for real-time quantitative PCR then centrifuged at 1000 r.p.m. for 5 min and washed once in phosphate- buffered saline. Cells were resuspended in 1 ml of propidium iodide/Triton X-100 staining solution with RNase A (0.1% Triton X-100, 200 mgmlÀ 1 Gene Primers from À 1 5’ to 3’ DNase-free RNase A, 20 mgml propidium iodide) and stained for 30 min at room temperature. Analysis was Flow cytometry analysis was carried out AKR1C3 FP TGCCTGTATTGGGATTTG on a FACS Calibur instrument (Becton Dickinson, Bedford, MA, USA). The RP CCTGCTCCTCATTATTGTAT distribution of cell cycle phases was determined using ModiFit software b-Actin FP TTAGTTGCGTTACACCCTTTC (Topsham, ME, USA). Two independent experiments were carried out. RP GCTGTCACCTTCACCGTTC Abbreviations: AKR1C3, aldo-keto reductase 1C3, type 2 3a-hydroxysteroid Statistical analysis dehydrogenase (HSD)/type 5 17b-HSD; FP, forward primer; RP, reverse primer. Statistical analysis was performed using the t-test. The results with P-values of o0.05 were considered to be statistically significant.

& 2013 Nature America, Inc. Cancer Gene Therapy (2013), 260 – 266 AKR1C3, a new radioresistance marker L Xie et al 262 RESULTS also involved in human NSCLC, 27 human NSCLC cancerous tissue Increased levels of AKR1C3 are present in radioresistant cell lines samples along with paired paracancerous tissues were analyzed In previous studies, following eight rounds of sublethal irradiation, by western blot analysis. In 19 of the 27 cases analyzed, the two radioresistant NSCLC cell subclones were established (A549/R AKR1C3 protein level was higher than levels found in the paired and SPCA1/R).7 Comparison of A549/R and SPCA1/R model cell paracancerous tissues (Figure 2). On an average, the AKR1C3 lines to the parent cell line identified the AKR1C3 gene as one of proteins were approximately threefold higher in cancerous tissues the most responsive and highly expressed genes in the microarray compared with those detected in the paracancerous samples. panel (Figure 1a). Quantitative RT-PCR and western blot analysis were used to validate the changes in AKR1C3 gene expression AKR1C3 knockdown increases radiosensitivity in NSCLC cells observed by microarray. AKR1C3 mRNA (Figure 1b) and protein To further confirm the role of AKR1C3 in regulating NSCLC cell (Figure 1c) levels were significantly upregulated in A549/R and radiosensitivity, both the parental A549 and A549/R cell lines were SPCA1/R cells. AKR1C3 protein level in A549/R and SPCA1/R were transiently transfected with a specific AKR1C3 siRNA (si-AKR1C3) 6.2-fold and 3.5-fold greater than that observed in the parental to knock down its expression. At 24 h after transfection, AKR1C3 cells, respectively. expression was markedly inhibited (490% at mRNA level), as shown in Figures 3a and b. Furthermore, a clonogenic survival Human NSCLC tissue overexpress AKR1C3 assay showed that knockdown of AKR1C3 in these cell lines Although AKR1C3 has been reported to be overexpressed in a resulted in fewer surviving colonies than controls with increasing wide variety of cancers, including breast and prostate cancer,4–6 to doses of radiation (Figure 3c). A significant increase of radio- date there has been no reports of altered expression of this sensitivity was observed in both A549 and A549/R cells protein in lung cancers. Therefore, to determine if AKR1C3 was transfected with si-AKR1C3 relative to si-control transfected cells at 12 Gy (Po0.05). Si-AKR1C3 caused a radiosensitization with a SER of 1.13 in A549 cells and a SER of 1.21 in A549/R cells. Results from this analysis suggest that irradiation-mediated upregulation of the AKR1C3 gene is linked to radioresistance and that by blocking this gene, tumors can effectively be interrupted.

AKR1C3 knockdown increases radiation-induced apoptosis An apoptosis assay was also performed to establish the impact of AKR1C3 on mediating the radiosensitivity of NSCLC cell lines. Apoptosis in cells exposure to X-ray irradiation (10 Gy dose) at indicated time (0, 48, 96 or 120 h) was determined using a standard Annexin V assay. A signiﬁcant increase in irradiation-induced apoptosis was observed for both A549 and A549/R cells transfected with si-AKR1C3, compared with the cells transfected with the si- control (Figure 4). This response was selective for the AKR1C3 gene as transfection of siRNA itself did not induce apoptosis.

AKR1C3 may function as an effector in IL-6-mediated radioresistance AKR1C3 is generally related to hormone-dependent cancer such as prostate and breast but not NSCLC. In efforts to begin to unravel the mechanism(s) of action of AKR1C3 in the context of NSCLC radiosensitivity, we addressed the putative role of IL-6 in mediating this response. Precedence for examining the role of this cytokine is based on previous studies that reported IL-6-associated increases of AKR1C3 promoter activity with concomitant increases

Figure 2. AKR1C3 is overexpressed in human non-small-cell lung Figure 1. Expression of AKR1C3 in non-small-cell lung cancer cancer (NSCLC). Human NSCLC cancerous tissue samples along (NSCLC) parental and radioresistant subclone cells. (a) Complemen- with paired paracancerous tissues were analyzed by western blot tary DNA (cDNA) microarray analysis, (b) real-time reverse tran- analysis. The total cellular protein concentration was determined scriptase-PCR (RT-PCR) and (c) western blot analysis were performed with the method of Bradford. Equal amounts of protein were loaded. to validate the expression of AKR1C3 in NSCLC radioresistant In 19 of the 27 cases analyzed, the AKR1C3 protein level was higher subclones (A549/R and SPCA1/R) and the parent cell lines. b-Actin than levels found in the cancerous tissues. The expression of b-actin was used as a reference gene in both real-time PCR and western gene was used as an internal control for each sample. C, cancer blot analyses. tissue; P, paracancerous tissue.

Cancer Gene Therapy (2013), 260 – 266 & 2013 Nature America, Inc. AKR1C3, a new radioresistance marker L Xie et al 263

Figure 4. Irradiation-induced apoptosis in A549 and A549/R cells transfected with si-AKR1C3 or si-control. Cells were transfected with si-AKR1C3 or si-control. At 24 h after transfection, cells were exposed to 10 Gy X-rays and incubated for 0, 48, 96 or 120 h after exposure to 10 Gy irradiation. Annexin V–ﬂuorescein isothiocyanate (FITC) and propidium iodide (PI) staining was performed, followed by ﬂuorescence-activated cell sorting (FACS) analysis and the percentage of apoptotic cells was counted. Results shown are based on three independent experiments. Errors bar represent the s.e.m., *Po0.05.

correlated with increased apoptosis in si-AKR1C3-transfected A549 cells (at day 2 12.27% apoptosis relative to 7.89% in control cells, Po0.05). These results suggest a role for AKR1C3 as a radiosensitivity mediator that may be a critical effector in IL-6-mediated radioresistance in human NSCLCs.

Radiosensitization induced by AKR1C3 knockdown is associated with G2/M arrest IL-6 has a direct stimulatory effect on the growth of many tumor cells via the activation of several signaling pathways as well as 10 Figure 3. AKR1C3 knockdown increases radiosensitivity in non- promoting tumor cell entry into the cell cycle. AKR1C3 catalyzes small-cell lung cancer (NSCLC) cells. (a) Real-time reverse transcrip- the reduction of PGH2 to PGF2a and PGD2 to 9a,11b-PGF2, which tase-PCR (RT-PCR) was performed on A549 and A549/R cells for limit the formation of anti-proliferative PGs, and contribute AKR1C3 mRNA level following 24 h of small interfering RNA (siRNA) to proliferative signaling. Here the cell cycle distribution in transfection. The y axis represents relative gene expression si-AKR1C3-transfected A549 cells was observed and compared calculated by dividing the AKR1C3 expression data by that of with the controls. The transfection of si-AKR1C3 accelerated cells b-actin. Error bars, s.d. of results in four independent experiments. into S and G /M phase obviously (Figure 6). At 24 h after (b) Upper panel shows the western blot analysis of AKR1C3 protein 2 in A549 and A549/R cells following 48 h of siRNA transfection. The transfection, percentage of G2/M phase in A549 cells transfected lower panel shows b-actin expression as a control. (c) Radiation cell with si-AKR1C3 were 26.20, and 21.69% in controls (data not survival curves for A549 and A549/R cells transfected with si-AKR1C3 shown). After irradiation with 10 Gy X-ray, more and more cells or si-control. A signiﬁcant increase of radiosensitivity was observed entered G2/M phase and this difference remained for at least 24 h in both A549 and A549/R cells transfected with si-AKR1C3 versus (77.13% vs 68.93% at 24 h). These ﬁndings accounted for that si-control. Data represent means with s.d. from three independent AKR1C3 knockdown in A549 cells increase sensitivity to irradiation. experiments, *Po0.05.

DISCUSSION in gene expression.8 In addition, irradiation corresponded with The aldo-keto reductases (AKRs) comprise a functionally diverse increased levels of IL-6 that were linked with increased cell family of proteins encoded by 15 distinct genes.11 Members of the proliferation and associated radioresistance.9 The addition of IL-6 AKR superfamily are generally located in the cytosol, function as to A549 cells resulted in increased AKR1C3 protein expression monomeric proteins, share a common (a/b)8-barrel structural (Figure 5a) and the presence of this cytokine conferred radio- motif and exhibit NAD(P)(H)-dependent oxidoreductases resistance to the cells (Figure 5b). This IL-6-induced radioresistance activity. Four human AKR1C isoforms have been cloned and was signiﬁcantly interrupted (Po0.05) in irradiated A549 cells characterized, including AKR1C1 (20a (3a)-hydroxysteroid (10 Gy) when the AKR1C3 expression was selectively blocked by dehydrogenase (HSD)),12 AKR1C2 (type 3 3a-HSD),13,14 AKR1C3 siRNA transfection strategies. Figure 5c illustrates a signiﬁcant (type 2 3a/type 5 17b-HSD)15,16 and AKR1C4 (type 1 3a-HSD).14 reduction in cell viability in si-AKR1C3-transfected A549 cells (59.7 Natural substrates for these enzymes include steroids, PGs and to 39.9% viability at day 6, Po0.01). This reduced cell viability lipid aldehydes.17 Based on enzyme kinetics, AKR1C3 possesses

& 2013 Nature America, Inc. Cancer Gene Therapy (2013), 260 – 266 AKR1C3, a new radioresistance marker L Xie et al 264

Figure 5. Effects of AKR1C3 on interleukin-6 (IL-6)-mediated radioresistance. (a) A549 cells were treated with 10 mglÀ 1 IL-6 for 48 h. Cell lysates were subjected to western blot analysis using antibodies against the AKR1C3 protein; b-actin provided a protein loading control. (b) Cell viability assay of A549 cells after 10 Gy irradiation. (c) At 24 h after transfection with si-AKR1C3 or si-control, cells were exposed to 10 Gy X-rays with or without 10 mglÀ 1 IL-6. Cell viabilities of A549 cells at 0, 2, 4 and 6 days after radiation exposure were detected by an MTT assay (96 wells, n ¼ 6). (d) Irradiation-induced apoptosis was analyzed by ﬂow cytometry at 48 h after radiation of A549 cells. The percentage of apoptotic cells was counted (Po0.05).

3a-HSD, 3b-HSD, 17b-HSD and 11-ketoprostaglandin reductase have been shown to be overexpressed in NSCLC patients activities, and catalyzes estrogen, progesterone, androgen and PG undergoing chemoradiation therapy.25 IL-6 has been implicated metabolism.2,16,18 As a result, AKR1C3 is capable of indirectly in the modulation of growth and differentiation in many cancers regulating ligand access to various nuclear receptors, including and is associated with poor prognosis in renal cell carcinoma, estrogen receptor, progesterone receptor, androgen receptor ovarian cancer, lymphoma, melanoma and prostate cancer.26 and peroxisome proliferator-activated receptor, and regulating Overexpression of IL-6 protects LNCaP cells from undergoing trans-activation activities of these nuclear receptors through apoptosis induced by androgen deprivation therapy.27 IL-6 intracrine actions.4 The presence of AKR1C3 has been increases the levels of AKR1C3 mRNA and protein expression in demonstrated in steroid hormone-dependent cells including both LNCaP and CWR22rv1 cells, and upregulates AKR1C3 breast cells,3 endometrial cells,19 prostate cells and Leydig promoter activity.8 Results from the current study showed that cells.20 De-regulated expression of AKR1C3 has been IL-6 can increase radioresistance and AKR1C3 gene expression in demonstrated in multiple types of hormone-related cancers, A549 cells. The radioresistance caused by IL-6 was significantly including breast cancer,5 endometrial cancer19 and prostate inhibited in cells transfected with AKR1C3 siRNA (Figure 5), cancer.6,21 A variant allele of AKR1C3 decreases the risk of lung suggesting that AKR1C3 is involved in this process and may be a and prostate cancers.22 AKR1C3 was recently reported to mediate critical modulator in radiosensitivity. the metabolic activation of a clinical trial antitumor agent PR104.23 Response to radiation is thought to have multifactorial Of the many genes whose expression was altered in our etiologies. The possible underlying mechanisms by which AKR1C3 microarray analysis of radioresistant NSCLC cell lines, AKR1C3 may enhance cell survival upon radiation exposure remain to be emerged as one of the most dramatically upregulated of the elucidated. The conventional notion is that AKR1C3 enhances genes identified (Figure 1). We have shown that AKR1C3 is also survival of tumor cells primarily through suppression of apoptosis- overexpressed in human NSCLC tissue samples (Figure 2), which related cell death. However, there also seemed to be additional implicates the role of this gene product in enhancing mechanisms. By activating Ras/Raf/MEK/Erk1/2, IL-6 stimulates the malignant potential of lung cancers. Specifically in this study, tumor cell proliferation.10,28 IL-6 which activates STAT-3 (signal we investigated the role that AKR1C3 may play in mediating transducer and activator of transcription 3) to upregulate the radiation resistance commonly exhibited by tumor cells, which expression of cyclins D1, D2 and B1, and MYC, and downregulate remains a significant challenge in treating this pleiotropic disease. the expression of cdk inhibitor p21Cip1, serves in promoting entry Transient attenuation of AKR1C3 expression by siRNA resulted in into the cell cycle.10,29 It is well established that tumor cells are an increased rate of radiation-induced apoptosis (Figure 3) and sensitive to radiation-induced cell death when synchronized in the 30 may provide a new therapeutic approach in overcoming radio- G2/M phase of the cell cycle. Apoptosis after G2/M cell cycle sensitivity associated with lung cancer treatments. arrest could be a key mechanism of the cell-killing effects of The emergence of tumors after radiotherapy has been irradiation.31–33 We observed that AKR1C3 siRNA treatment altered attributed to repopulation of tumors from cells surviving the cell cycle distribution, resulting in an increased G2/M fraction irradiation. Radiation is known to induce multiple biological (Figure 6). Above finding suggests that blocking ASR1C3 expres- responses at the cellular and tissue levels mediated often by early sion in tumor cells may provide shift the cells into a more activation of cytokine cascades that promote the growth and radiosensitive stage of the cell cycle and thus more responsive to survival of tumor tissue.24 Proinflammatory cytokines such as IL-6 radiation treatment.

Cancer Gene Therapy (2013), 260 – 266 & 2013 Nature America, Inc. AKR1C3, a new radioresistance marker L Xie et al 265

Figure 6. AKR1C3 knockdown enhances G2/M arrest induced by X-rays. A549 cells were transfected with si-control (a) or si-AKR1C3 (b). At 24 h after transfection, cells were exposed to 10 Gy X-ray. Analysis of cell cycle progression was performed by ﬂow cytometry as described in the Materials and methods at indicated times following irradiation. Distributions of cells in each phase of a cell cycle were expressed as percentage of total cell analyzed. Representative graph from three independent experiments with similar results is shown.

The results indicated that AKR1C3 indeed plays an important radiotherapy practice in Sweden 2001--summary and conclusions. Acta Oncol role in radiosensitivity of NSCLC cancer cells, especially in the 2003; 42: 357–365. IL-6-mediated signaling pathway. AKR1C3-mediated radioresis- 2 Penning TM, Burczynski ME, Jez JM, Hung CF, Lin HK, Ma H et al. Human 3alpha-hydroxysteroid dehydrogenase isoforms (AKR1C1-AKR1C4) of the tance may be due to the reduction of G2/M phase arrest associated with radiation treatment and a decrease in radiation- aldo-keto reductase superfamily: functional plasticity and tissue distribution induced apoptosis. This study contributes basic information as to reveals roles in the inactivation and formation of male and female sex hormones. Biochem J 2000; 351(Pt 1): 67–77. the role of AKR1C3 in radioresistance, which may eventually lead 3 Lin HK, Steckelbroeck S, Fung KM, Jones AN, Penning TM. Characterization to the validation of AKR1C3 as a predictive biomarker for lung of a monoclonal antibody for human aldo-keto reductase AKR1C3 (type 2 3alpha- cancer. This study provides valuable initial insight of a protein hydroxysteroid dehydrogenase/type 5 17beta-hydroxysteroid dehydrogenase); target that shows potential for developing a new radiosensitive immunohistochemical detection in breast and prostate. Steroids 2004; 69: therapeutic strategy. 795–801. 4 Penning TM, Steckelbroeck S, Bauman DR, Miller MW, Jin Y, Peehl DM et al. Aldo-keto reductase (AKR) 1C3: role in prostate disease and the development of CONFLICT OF INTEREST specific inhibitors. Mol Cell Endocrinol 2006; 248: 182–191. 5 Lewis MJ, Wiebe JP, Heathcote JG. Expression of progesterone metabolizing The authors declare no conflict of interest. enzyme genes (AKR1C1, AKR1C2, AKR1C3, SRD5A1, SRD5A2) is altered in human breast carcinoma. BMC Cancer 2004; 4: 27. 6 Stanbrough M, Bubley GJ, Ross K, Golub TR, Rubin MA, Penning TM et al. ACKNOWLEDGEMENTS Increased expression of genes converting adrenal androgens to testosterone in androgen-independent prostate cancer. Cancer Res 2006; 66: 2815–2825. We thank Maureen Dolan, Guolei Zhou and Nadia Awar for revising the manuscript. 7 Xie L, Song X, Yu J, Guo W, Wei L, Liu Y et al. Solute carrier protein family may This work was supported by grants from the National Science Foundation of China involve in radiation-induced radioresistance of non-small cell lung cancer. (30801066) and the Natural Science Foundation of Shandong Province J Cancer Res Clin Oncol 2011; 137: 1739–1747. (ZR2010HZ002 and ZR2010HM031). 8 Chun JY, Nadiminty N, Dutt S, Lou W, Yang JC, Kung HJ et al. Interleukin-6 regulates androgen synthesis in prostate cancer cells. Clin Cancer Res 2009; 15: 4815–4822. REFERENCES 9 Chen CC, Chen WC, Lu CH, Wang WH, Lin PY, Lee KD et al. Significance of 1 Ringborg U, Bergqvist D, Brorsson B, Cavallin-Stahl E, Ceberg J, Einhorn N et al. interleukin-6 signaling in the resistance of pharyngeal cancer to irradiation and The Swedish Council on Technology Assessment in Health Care (SBU) systematic the epidermal growth factor receptor inhibitor. Int J Radiat Oncol Biol Phys 2010; overview of radiotherapy for cancer including a prospective survey of 76: 1214–1224.

& 2013 Nature America, Inc. Cancer Gene Therapy (2013), 260 – 266 AKR1C3, a new radioresistance marker L Xie et al 266 10 Bollrath J, Phesse TJ, von Burstin VA, Putoczki T, Bennecke M, Bateman T et al. 21 Wako K, Kawasaki T, Yamana K, Suzuki K, Jiang S, Umezu H et al. Expression of gp130-mediated Stat3 activation in enterocytes regulates cell survival and androgen receptor through androgen-converting enzymes is associated cell-cycle progression during colitis-associated tumorigenesis. Cancer Cell 2009; with biological aggressiveness in prostate cancer. J Clin Pathol 2008; 61: 15: 91–102. 448–454. 11 Jez JM, Flynn TG, Penning TM. A new nomenclature for the aldo-keto reductase 22 Penning TM, Byrns MC. Steroid hormone transforming aldo-keto reductases and superfamily. Biochem Pharmacol 1997; 54: 639–647. cancer. Ann NY Acad Sci 2009; 1155: 33–42. 12 Hara A, Matsuura K, Tamada Y, Sato K, Miyabe Y, Deyashiki Y et al. Relationship 23 Guise CP, Abbattista MR, Singleton RS, Holford SD, Connolly J, Dachs GU et al. The of human liver dihydrodiol dehydrogenases to hepatic bile-acid-binding bioreductive prodrug PR-104A is activated under aerobic conditions by human protein and an oxidoreductase of human colon cells. Biochem J 1996; 313(Pt 2): aldo-keto reductase 1C3. Cancer Res 70: 1573–1584. 373–376. 24 Bentzen SM. Preventing or reducing late side effects of radiation 13 Dufort I, Soucy P, Labrie F, Luu-The V. Molecular cloning of human type 3 3 therapy: radiobiology meets molecular pathology. Nat Rev Cancer 2006; 6: alpha-hydroxysteroid dehydrogenase that differs from 20 alpha-hydroxysteroid 702–713. dehydrogenase by seven amino acids. Biochem Biophys Res Commun 1996; 228: 25 Wang XS, Shi Q, Williams LA, Mao L, Cleeland CS, Komaki RR et al. Inflammatory 474–479. cytokines are associated with the development of symptom burden in patients 14 Deyashiki Y, Ogasawara A, Nakayama T, Nakanishi M, Miyabe Y, Sato K et al. with NSCLC undergoing concurrent chemoradiation therapy. Brain, Behav Immun Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol 2010; 24: 968–974. dehydrogenase isoenzymes that are identical with chlordecone reductase and 26 Simpson RJ, Hammacher A, Smith DK, Matthews JM, Ward LD. Interleukin-6: bile-acid binder. Biochem J 1994; 299: (Pt 2) 545–552. structure-function relationships. Protein Sci 1997; 6: 929–955. 15 Khanna M, Qin KN, Wang RW, Cheng KC. Substrate specificity, gene structure, 27 Lee SO, Lou W, Johnson CS, Trump DL, Gao AC. Interleukin-6 protects LNCaP cells and tissue-specific distribution of multiple human 3 alpha-hydroxysteroid from apoptosis induced by androgen deprivation through the Stat3 pathway. dehydrogenases. J Biol Chem 1995; 270: 20162–20168. Prostate 2004; 60: 178–186. 16 Lin HK, Jez JM, Schlegel BP, Peehl DM, Pachter JA, Penning TM. Expression and 28 Ara T, Song L, Shimada H, Keshelava N, Russell HV, Metelitsa LS et al. Interleukin-6 characterization of recombinant type 2 3 alpha-hydroxysteroid dehydrogenase in the bone marrow microenvironment promotes the growth and survival of (HSD) from human prostate: demonstration of bifunctional 3 alpha/17 beta-HSD neuroblastoma cells. Cancer Res 2009; 69: 329–337. activity and cellular distribution. Mol Endocrinol 1997; 11: 1971–1984. 29 Niu G, Bowman T, Huang M, Shivers S, Reintgen D, Daud A et al. Roles of activated 17 Hyndman D, Bauman DR, Heredia VV, Penning TM. The aldo-keto reductase Src and Stat3 signaling in melanoma tumor cell growth. Oncogene 2002; 21: superfamily homepage. Chem Biol Interact 2003; 143-144: 621–631. 7001–7010. 18 Steckelbroeck S, Jin Y, Gopishetty S, Oyesanmi B, Penning TM. Human 30 Norbury CJ, Hickson ID. Cellular responses to DNA damage. Annu Rev Pharmacol cytosolic 3alpha-hydroxysteroid dehydrogenases of the aldo-keto reductase Toxicol 2001; 41: 367–401. superfamily display significant 3beta-hydroxysteroid dehydrogenase activity: 31 Yang YC, Chao KS, Lin CP, Chen YY, Wang KL, Chen YJ. Oxaliplatin regulates DNA implications for steroid hormone metabolism and action. J Biol Chem 2004; 279: repair responding to ionizing radiation and enhances radiosensitivity of human 10784–10795. cervical cancer cells. Int J Gynecol Cancer 2009; 19: 782–786. 19 Rizner TL, Smuc T, Rupreht R, Sinkovec J, AKR1C1 Penning TM. and AKR1C3 may 32 Sahu RP, Epperly MW, Srivastava SK. Benzyl isothiocyanate sensitizes determine progesterone and estrogen ratios in endometrial cancer. Mol Cell human pancreatic cancer cells to radiation therapy. Front Biosci (Elite Ed) 2009; 1: Endocrinol 2006; 248: 126–135. 568–576. 20 Ashley RA, Yu Z, Fung KM, Frimberger D, Kropp BP, Penning TM et al. Develop- 33 Zhuang HQ, Wang JJ, Liao AY, Wang JD, Zhao Y. The biological effect of 125I mental evaluation of aldo-keto reductase 1C3 expression in the cryptorchid testis. seed continuous low dose rate irradiation in CL187 cells. J Exp Clin Cancer Res Urology 2010; 76: 67–72. 2009; 28: 12.

Cancer Gene Therapy (2013), 260 – 266 & 2013 Nature America, Inc.