The Expression Cassette Determines the Functional Activity of Ribozymes in Mammalian Cells by Controlling Their Intracellular Localization

The expression cassette determines the functional activity of ribozymes in mammalian cells by controlling their intracellular localization

EDOUARD BERTRAND,1,2 DANIELA CASTANOTTO,1 CHEN ZHOU,4 CECILE CARBONNELLE,1 NAN SOOK LEE,1 PAUL GOOD,5 SASWATI CHATTERJEE,3 THIERRY GRANGE,2 RAYMOND PICTET,2 DONALD KOHN,4 DAVID ENGELKE,5 and JOHN J. ROSSI1 1Department of Molecular Biology, Beckman Research Institute of the City of Hope, Duarte, California 91010, USA 2Université Paris VII-Inst. J. Monod; Tour 43 2, pl. Jussieu; 75251 Paris, France 3Division of Pediatrics, City of Hope National Medical Center, Duarte, California 91010, USA 4Children’s Hospital of Los Angeles, University of Southern California, Los Angeles, California 90027, USA 5Department of Biological Chemistry, University of Michigan Medical School, Ann Arbor, Michigan 48109, USA

ABSTRACT In order to better understand the influence of RNA transcript context on RNA localization and catalytic RNA efficacy in vivo, we have constructed and characterized several expression cassettes useful for transcribing short RNAs with well defined 5 and 3 appended flanking sequences. These cassettes contain promoter sequences from the human U1 snRNA, U6 snRNA, or tRNAMeti genes, fused to various processing/stabilizing sequences. The levels of expression and the sub-cellular localization of the resulting RNAs were determined and compared with those obtained from Pol II promoters normally linked to mRNA production, which include a cap and polyadenylation signal. The tRNA, U1, and U6 transcripts were nuclear in localization and expressed at the highest levels, while the standard Pol II promoted transcripts were cytoplasmic and present at lower levels. The ability of these cassettes to confer ribozyme activity in vivo was tested with two assays. First, an SIV-growth hormone reporter gene was transiently transfected into human embryonic kidney cells expressing an anti-SIV ribozyme. Second, cultured T lymphocytes expressing an anti-HIV ribozyme were challenged with HIV. In both cases, we found that the ribozymes were effective only when expressed as capped, polyadenylated RNAs transcribed from Pol II cassettes that generate a cytoplasmically localized ribozyme that facilitates co-localization with its target. We also show that the inability of the other cassettes to support ribozyme-mediated inhibitory activity against their cytoplasmic target is very likely due to the resulting nuclear localization of these ribozymes. These studies demonstrate that the ribozyme expression cassette determines its intracellular localization and, hence, its corresponding functional activity. Keywords: HIV; regulatory RNA; RNA localization; SIV

INTRODUCTION 1992; amphibians, Saxena & Ackerman, 1990; flies, Zhao Since their discovery in 1982 (Kruger et al., 1982; & Pick, 1993; mammals, Sarver et al., 1990, Larsson Guerrier-Takada et al., 1983), ribozymes that possess et al., 1994). However, ribozyme efficiency appears to sequence-specific endoribonuclease activity have been be highly variable, at least in mammals. They can yield used widely as tools for suppression of gene expres- as much as 90% suppression of expression of the tar- sion, via inactivation of the targeted RNAs (for a re- geted gene, but they can also be ineffective (L’Huillier view, see Bertrand & Rossi, 1996). The hammerhead et al., 1992; Lo et al., 1992; Bertrand et al., 1994 and catalytic motif has been employed successfully for gene unpubl. obs.). The parameters determining ribozyme suppression studies in many different organisms (bac- activity in vivo are just starting to be understood (re- teria, Sioud & Drlica, 1991; plants, Steinecke et al., viewed in Bertrand & Rossi, 1996). One of the most critical factors seems to be the association step between the ribozyme and its target. Indeed, the cova- Reprint requests to: John J. Rossi, Department of Molecular Biol- ogy, Beckman Research Institute of the City of Hope, Duarte, Cali- lent linkage (cis-ribozyme) or the co-packaging of the fornia 91010, USA; e-mail: [email protected]. ribozyme with its target greatly increases ribozyme 75 76 E. Bertrand et al. efficiency in vivo (Dropulic et al., 1992; Bertrand et al., 1993, 1994; Sullenger & Cech, 1993). This seems also to be true for antisense RNAs, because it has been shown that only antisense–sense combinations with high association rates in vitro were efficient in vivo (Persson et al., 1990a, 1990b; Rittner et al., 1993). The importance of the association step emphasizes the significance of utilizing the appropriate ribozyme or antisense expression vector. Indeed, to facilitate interaction with the target RNA, the expression vector should in theory: (1) have a high transcription rate; (2) produce a stable RNA; (3) transcribe a ribozyme or an antisense devoid of inhibitory secondary structure; and (4) localize the ribozyme or the antisense within the same subcellular compartment as the target. As such, the development of suitable expression vectors is a major issue in the field of therapeutic RNAs. However, current expression vectors have been developed and characterized on the basis of the first three criteria, and the resulting intracellular localization of the ribozyme often has been neglected, if not ignored totally (Ber- trand et al., 1994; Noonberg et al., 1994; Thompson et al., 1995). We have constructed numerous expression cassettes based on existing ribozyme and antisense expression systems (Sullenger et al., 1990; Chatterjee et al., 1992; Bertrand et al., 1994; Noonberg et al., 1994). Ribozyme transcripts from each of these expression units were then compared for their levels of expression and re- sultant subcellular localization. The most interesting expression cassettes were further tested for their ability to supply functional ribozyme activity in cell culture, using two model systems. From these experiments, we can conclude that the type of expression cassette determines the intracellular compartmentalization of the ribozyme, and that the resulting ribozyme/target co-localization is a primary determinant of ribozyme efficacy in vivo, as opposed to other factors such as absolute levels of expression.

RESULTS

Ribozyme design and in vitro activity

The anti-tat ribozyme is targeted against the exon 1 of FIGURE 1. Design and in vitro cleavage activity of the TAR1 ribo- the tat ORF of HIV-1, and has been described and zyme. A: Schematic representation of the RNA target for the TAR1 characterized previously (Zhou et al., 1994). The sec- ribozyme. The sequence and secondary structure of the target RNA are shown. This corresponds to the whole sequence of the TAR ond ribozyme used in this study, the TAR1 ribozyme, region of SIV. The sequence that base pairs with the TAR1 ribozyme is targeted against the TAR region of SIVsmmh4 is overlined. The cleavage site is indicated by an arrow. The result- (Fig. 1A). This region has been shown to be highly ing cleavage products (P1 and P2) are indicated. B: In vitro cleavage activity of the TAR1 ribozyme. Radiolabeled target RNA (5 nM) was susceptible to antisense-mediated inhibition of gene incubated with 50 nM of ribozyme for 60 min at 37 °C. Positions of function (Chatterjee et al., 1992). The base pairing re- the target RNA and the two cleavage products are indicated. Sizes of gion is 54 bases in length, but has an asymmetric shape: the products were calculated from their electrophoretic mobility. Heterogeneity of the 3Ј cleavage product is due to heterogeneity of it makes 49 base pairs with its target on the side 3Ј to T7 transcript termination. The mutant ribozyme has a G5 to A base the catalytic core, but only 5 base pairs on the 5Ј side change in the catalytic core, rendering it inactive. (Fig. 1A). This asymmetric design was chosen because it satisfied two otherwise contradictory criteria: (1) a Intracellular ribozyme localization and efficiency 77 ribozyme-target pairing length of about 60 bases, which has been shown to be optimal in vivo (Crisell et al., 1993); and (2) a fast dissociation rate of one of the two cleavage products, as predicted from in vitro ribozyme kinetics (Fedor & Uhlenbeck, 1992; Hertel et al., 1994). The fast dissociation rate is important, because as long as the cleavage products are bound to the ribozyme arms, they may be inaccessible to exonuclease degradation in vivo (Brawerman, 1990). The asymmetric TAR1 ribozyme was tested in vitro with a target RNA corresponding to the first 140 transcribed nucleotides of SIV, and that contained the entire SIV TAR region (Fig. 1A). The results show that, despite the fact that the TAR target is highly structured, the TAR1 ribozyme is able to cleave its target at the predicted site (Fig. 1B). Furthermore, the cleavage product bound to the short arm of the ribozyme is released rapidly because it can be detected easily in a nondenaturing gel (data not shown). Lack of total cleavage of the substrate in the single-turnover reaction is most likely the result of ribozyme and/or substrate conformations that are not capable of intermolecular base pairing (Fedor & Uhlenbeck, 1990), because both the ribozyme and substrate have strong intramolecular pairing structures.

Design of the expression cassettes

We have developed seven different cassettes for ribo- FIGURE 2. Schematic representation of the RNA expression cas- zyme and antisense expression (Fig. 2). The promoters settes. The initiation site and the direction of transcription are indi- were derived from four genes: human U1 snRNA, hu- cated with arrows. Sites where the ribozyme is inserted are indicated Meti with a black box. Pm stands for promoter; AATAA for the AAV man tRNA , human U6 snRNA, and the Rous Sar- polyadenylation signal; U1 term for the U1 transcription termina- coma Virus LTR. The RSV LTR Pol II promoter was tion signal; STL1 for the STL1 stem-loop; Ts for a stretch of five linked to a cloning site followed by the polyadenyla- thymidines that serve as a Pol III transcription termination signal. Fragment sizes are not drawn to scale. tion site of the Adeno-Associated virus (cassette referred to as RSV). Three expression cassettes have been derived from the U1 gene, which also utilizes RNA polymerase II. STL1 stem loop and a Pol III transcription termination However, in contrast to the RSV promoter, it harbors a signal. specialized termination signal and the resulting tran- Two cassettes were derived from the U6 gene, which scripts are not polyadenylated (Hernandez, 1985). The also utilizes RNA polymerase III. However, in contrast U1 promoter has first been linked directly to a cloning to the tRNA gene, the promoter is positioned 5Ј to the site followed by its transcription termination signal transcribed region (Lobo et al., 1990). In the first U6 (cassette referred to as RU1, Bertrand et al., 1994). The construct (referred to as U6ϩ1), the promoter sequence resulting transcripts include only 10 bases of mature ends at the first transcribed nucleotide, and is fol- U1snRNA at its 3Ј end. To stabilize this 3Ј end, we lowed by a cloning site, the STL1 stem-loop, and a have inserted either a stem-loop (STL1, see the Mate- Pol III transcription termination signal. The second rial and methods; cassette referred to as RU1 stem), or construct (referred to as U6ϩ19) is identical, except the last 157 bases of U1 snRNA sequence (referred to that the first 16 nt of U6 snRNA are included in the as IU1, Bertrand et al., 1994) before the transcription transcripts. These 19 bases of U6 snRNA form a stem- termination signal. loop, which has been included in order to stabilize the The tRNA cassette (referred to as tRNA) contains the 5Ј end of the uncapped U6 transcript (Singh et al., human tRNAMeti sequence, which includes an internal 1990; Good et al., 1996). Pol III promoter. However, the last 10 bases of the To further facilitate gene transfer in vivo, the ex- mature tRNA have been removed in order to block 3Ј pression cassettes were cloned into both an Adeno- end processing of the transcript (Adeniyi-Jones et al., Associated virus vector (AAV; pCWRSV, Chatterjee 1984), and replaced by a cloning site followed by the et al., 1992) and a retroviral vector derived from 78 E. Bertrand et al.

MoMuLV (pG1Na, Zhou et al., 1994). Both vectors con- RNA expression levels were measured with a quan- tain a neomycin phosphotransferase gene to allow for titative primer extension assay (see Materials and Meth- selection of stable transfectants and/or transductants. ods), the results of which are presented in Table 1. The tRNA, U6ϩ19, and IU1 cassettes expressed about 5 ϫ 4 Expression levels of the RNA synthesized 10 RNA molecules per cell, whereas the U6ϩ1 and by the different cassettes RSV cassettes produced, respectively, 4 and 10 times lower amounts of transcript. Because the U6ϩ1 and The TAR1 ribozyme was inserted into each of the ex- U6ϩ19 cassettes have the same promoter, these results pression cassettes in the context of the AAV vector. suggest that the first stem-loop of U6 snRNA (tran- The expression vectors were then transiently trans- scribed nucleotides ϩ1toϩ19) increased the tran- fected into 293 cells and the cellular RNAs were ana- script stability by about fourfold. Similarly, comparison lyzed by primer extension assays (Fig. 3A). The cassettes of the IU1 cassette with RU1 or RU1 stem shows that expressed readily detectable levels of ribozymes, with the last 157 nt of U1 snRNA stabilize the transcript the notable exception of RU1 and RU1 stem, from which derived from IU1 by at least 500-fold relative to tran- ribozyme expression was barely detectable (Fig. 3A). scripts lacking this 157-base sequence. Furthermore, the primer extensions demonstrate that Because transiently transfected cells are not likely to each of the cassettes initiated transcription at the ex- achieve steady-state levels of expression of the trans- pected site. Because northern blot experiments indi- fected gene, we performed similar primer extension cated that ribozymes transcribed from these cassettes analyses on RNAs isolated from stably transfected cells. have the predicted size (Good et al., 1996), it also dem- Each vector was transfected into 293 cells by the onstrates that 3Ј processing of the transcripts occurred calcium–phosphate procedure. To avoid variability due as expected. to integration site and gene copy number, a large num-

FIGURE 3. Expression of the TAR1 ribozyme from the various cassettes. A,B: Primer extension analyses of total RNA from 293 cells expressing the TAR1 ribozyme from the various cassettes. Total RNAs were probed with an oligo specific for the TAR1 ribozyme. Each expression cassette generates different primer extension products because the 5Ј ends of the various transcripts differ in their distance from the ribozyme primer. The different products are indicated with an arrow along with the name of the cassette producing them. Transiently transfected cells are shown in A. Pools of stably transfected cells are shown in B. Results from quantifying the radioactive primer extension products are presented in Table 1. Intracellular ribozyme localization and efficiency 79

TABLE 1. Expression levels of the ribozyme TAR1 asym in 293 cells transfected with various expression vectors.a

pRSV pIU1 ptRNA pU6ϩ1 pU6ϩ19 pRU1 stem pRU1

Transient transfection 5,100 44,000 55,000 12,600 50,000 Ͻ500 UDb Stable transfection 400 2,050 2,700 150 330 NDc NDc

aExpressed in ribozyme molecules per cell. bUndetectable. cNot determined. ber of independent clones were selected for neomycin sette with some, but considerably lower amounts of resistance, pooled, and analyzed for ribozyme expres- transcripts from the U6ϩ19 or tRNA constructs (data sion by primer extension analyses (Fig. 3B). The stable not presented). cell lines showed two major differences when compared with the transiently transfected cells (Table 1): Subcellular localization of the RNA expressed (1) the absolute expression levels from all of the ex- from the different cassettes pression vectors were about 20 times lower; (2) the expression levels of pU6ϩ19 and pU6ϩ1, relative to To investigate the subcellular localization of the ribo- the other expression cassettes, were decreased by an zyme transcripts expressed from the different cas- additional 10 and 6 fold, respectively. The levels of settes, we used two complementary approaches. We expression derived from the pIU1, pRSV, and ptRNA first conducted nuclear versus cytoplasmic fractiona- cassettes were almost unchanged relative to each other. tions, followed by RNA isolation and quantitative Retroviral vectors are presently the most popular primer extension analyses of the ribozyme-containing vehicles for gene transfer into living cells and conse- transcripts (Fig. 4A). This approach allowed us to mea- quently for gene therapy applications. To assess the sure the amount of ribozyme in each cell compart- functionality of the expression cassettes when inserted ment. As a complementary approach, we performed in in a retroviral vector, the anti-tat (Zhou et al., 1994) situ hybridizations (Fig. 4B), which allow the exami- ribozyme was cloned into the IU1, U6ϩ19, and tRNA nation of individual cells as well as high intracellular cassettes. These cassettes were then cloned between resolution. Because 293 cells are relatively small cells the LTRs of a retroviral vector derived from MoMuLV with little cytoplasm, we had difficulty obtaining good (Zhou et al., 1994; vectors referred to as single-copy spatial resolution for our compartmentalization stud- vectors). Recombinant viruses were generated and ies. To overcome this limitation, we utilized the larger used to transduce CEM T-lymphocytes. The neomycin- COS cells for in situ hybridization experiments. These resistant cells were probed for ribozyme expression by cells were transiently transfected with the various TAR1 northern blot and primer extension analyses. Some- ribozyme expression cassettes, followed by processing what surprisingly, LTR to LTR transcripts containing for the in situ hybridizations. For cell fractionation the tat ribozyme were the primary RNA species de- experiments, we used the pools of stably transfected tected, and either no or only small amounts of tran- 293 cells expressing the TAR1 ribozyme. To monitor scripts initiating from the cloned promoters could be leakage of nuclear contents into the cytoplasmic frac- detected (data not presented). These results suggested tion, we probed for endogenous U6 snRNA, which is that the expression cassettes were functioning poorly expected to be entirely nuclear (Terns et al., 1993). The when inserted downstream of the LTR promoter of the amount of U6 snRNA leakage into the cytoplasm (in retrovirus. Similar inhibitory effects of the LTR pro- the range of 10–20%) was taken into account when moter on the expression of downstream cassettes have calculating the relative amount of cytoplasmic and nu- been observed for both Pol II and Pol III promoters. clear ribozyme. This inhibition has been attributed to transcriptional The cell fractionation experiments concurred with interference between the promoter of the LTR and the the in situ hybridizations. The TAR1 ribozymes were cassettes (Emerman & Temin, 1984, 1986; Sullenger predominantly nuclear when expressed from the tRNA, et al., 1990). It is possible to overcome this inhibition in IU1, U6ϩ1, and U6ϩ19 cassettes, and cytoplasmic when some situations by the use of double-copy vectors, in expressed from the RSV cassette. More specifically, the which the cassette is inserted within a nonfunctional tRNA ribozyme was found almost exclusively in the region of the LTR upstream of the viral promoter ele- nucleus: 95% of the ribozyme was found in the nu- ments (Sullenger et al., 1990). We constructed such cleus by cell fractionation (Fig. 4A), and 90% of the double-copy vectors, and northern analysis showed cells showed an exclusively nuclear signal by in situ that, in this location, readily detectable levels of ribo- hybridization (Fig. 4H). The IU1 ribozyme was also zyme expression could be obtained from the IU1 cas- found primarily in the nucleus: 80% of the ribozyme 80 E. Bertrand et al.

FIGURE 4. Intracellular localization of the TAR1 ribozymes produced by the various expression cassettes. A: Nucleo- cytoplasmic fractionation of the TAR1 ribozyme. Pools of stably transfected 293 cells were biochemically fractionated into nuclear and cytoplasmic RNA, and the amount of TAR1 ribozyme present in each fraction was quantified by primer extension (see text). The data are plotted as percent of the total amount of ribozyme (cytoplasmic plus nuclear). The columns are identified by the name of the expression cassette used to transfect the cells. B–H: In situ hybridization of COS cells expressing the TAR1 ribozyme. Transiently transfected COS cells were hybridized in situ with a probe specific for the TAR1 ribozyme. Probe detection was performed using the NBT/BCIP colorimetric reaction. Cells shown are identified by the expression cassette they were transfected with. Numbers in parentheses correspond to the percent of transfected cells that showed a similar ribozyme localization, except in D and G, where the numbers correspond to the percent of cells having a detectable amount of ribozyme in the cytoplasm (see text).

was present in the nuclear fraction (Fig. 4A), and 80% cytoplasmic partitioning varied greatly from cell to of the cells had an entirely nuclear signal (Fig. 4E). The cell, with 5–10% of the cells showing a signal almost U6ϩ1 and the U6ϩ19 cassettes generated RNAs with purely cytoplasmic (Fig. 4D,G). In contrast to the tRNA, very similar localization signals. The transcripts were IU1, and U6 driven transcripts, the RSV ribozyme was predominantly nuclear, but a significant fraction was found in the cytoplasm: 65% of the RNA was in the also present in the cytoplasm: 60% of the U6ϩ19 and cytoplasmic fraction (Fig. 4A) and 85% of the cells 70% of the U6ϩ1 ribozymes were nuclear by cell frac- showed a signal that was predominantly cytoplasmic tionation (Fig. 4A). Analysis of the cell population by (Fig. 4B). in situ hybridization gave a strong confirmation of the nuclear localization of the U6 ribozymes. Indeed, we Co-localization of the ribozyme expressed from found that most cells had a signal exclusively nuclear the different cassettes with its mRNA target (70–80% of the cells, Fig. 4C,F), whereas the others had a signal in both the cytoplasm and the nucleus Because the different cassettes showed differential lo- (20–30%). In this latter cell population, the nucleo- calization of the ribozyme, and because co-localization Intracellular ribozyme localization and efficiency 81 of the ribozyme with its target is potentially an impor- homogeneously distributed in the cell cytoplasm. How- tant determinant of ribozyme efficiency (Sullenger & ever, a very high degree of co-localization can still be Cech, 1993), it was of importance to determine the observed between the two RNAs (Fig. 5g,h,i). These intracellular localization of the ribozyme target. For results suggest that most target mRNA molecules are this purpose, we have constructed a reporter gene for very close in space to ribozyme molecules when they the TAR1 ribozyme by fusing the SIV promoter, in- are present in the same intracellular compartment. cluding the SIV TAR sequence, to the growth hormone (GH)-coding sequences (referred to as SIV-GH). In situ Suppression of gene expression by ribozymes hybridization analyses of the intracellular distribution expressed from the different cassettes of the resulting mRNA revealed that it was found almost exclusively in the cell cytoplasm, as expected for The ability of the cassettes to support ribozyme activ- an mRNA (90% of the cells showed a signal purely ity in vivo was tested in two model systems. In the cytoplasmic, Fig. 5a). These results suggest that co- first one, the stably transfected pools of 293 clones localization of the TAR1 ribozyme with its target should expressing the TAR1 ribozyme were transiently trans- not occur when the ribozyme is expressed from the fected with a combination of the SIV-GH reporter plas- U6ϩ1, U6ϩ19, tRNA, and IU1 cassettes, because these mid and a chloramphenicol acetyl transferase (CAT)- cassettes produce a nuclear ribozyme. However, it was expressing plasmid (pL30CAT, a gift of M. Fromont). not known whether or not co-expression of the ribo- For each transfection, the amount of GH produced zyme and the target, which can bind each other over was corrected for transfection efficiency by compari- 54 bases, could alter their respective intracellular lo- son with the specific CAT activity. The GH/CAT ratios calization. Indeed, it was conceivable that binding of obtained in the ribozyme-producing cell line were then the ribozyme to its target could occur in the nucleus, compared to those obtained in cell lines containing the before cytoplasmic export of the target. This could, in same vector, but expressing an irrelevant RNA. No turn, either block export of the mRNA target or, alter- ribozyme-mediated inhibition of GH expression was natively, promote export of the ribozyme together with detected with the U6, tRNA, and IU1 cassettes, but its target. It was therefore of importance to determine 40% inhibition was seen routinely with the RSV ribo- simultaneously the localization of both the ribozyme zyme cassette (Fig. 6A). Thus, only the RSV cassette is and its target in the same cell. This was accomplished able to support activity of the TAR1 ribozyme against by co-transfecting the various ribozyme expression cas- its SIV-GH mRNA target. settes with the SIV-GH reporter gene, and analyzing In the second model system, the pools of CEM T the intracellular distributions of both RNAs with a cells stably transduced with the retroviral vectors con- two-color fluorescent in situ hybridization protocol. taining the anti-tat ribozyme expression cassettes were The results clearly show that there is almost no ribo- challenged with HIV-1. The IU1 double-copy vector, zyme/target co-localization when the ribozyme is ex- in which the cassette was inserted upstream of the pressed from the U6ϩ1, U6ϩ19, IU1, or tRNA cassettes LTR promoter, was unable to inhibit HIV-1 growth (Fig. 5c,d,e,f). However, it was still possible that the (Fig. 6B). Because this vector expressed the ribozyme ribozyme could bind and cleave its target before it is from the IU1 cassette, these results suggest that the exported from the nucleus, and that rapid degradation IU1 cassette is not able to support anti-tat ribozyme of the target would not allow detection of the ribozyme/ activity. In contrast, the single-copy vectors, which target co-localization. To eliminate this possibility, we contain the various expression cassettes inserted be- repeated the same experiments with a mutant ribo- tween the LTRs, mediated inhibition of HIV-1 growth zyme, unable to cleave its target. Again, we found no (Fig. 6B). Because the ribozyme expressed from these co-localization between the ribozymes and their tar- constructs was detected only as a transcript initiating gets (data not shown). These data strongly support the from the LTR promoter, which is capped and polyade- hypothesis that the U6ϩ1, U6ϩ19, tRNA, and IU1 ri- nylated and hence cytoplasmic, these results show that bozymes are unable to bind their target before it is the LTR to LTR transcripts that include the anti-tat exported from the nucleus. ribozyme within the various cassette sequences are In contrast to the U6, tRNA, and IU1 ribozyme, the able to mediate ribozyme activity. RSV ribozyme was expected to be present in the same cellular compartment as its target, which is the cyto- DISCUSSION plasm. Two-color in situ hybridization experiments showed that this was indeed the case (Fig. 5b). To A major challenge in the use of ribozymes and anti- further analyze the degree of co-localization of the sense RNAs as therapeutic or genetic agents is the RSV ribozyme with its target, we performed a high- development of suitable expression vectors (Jennings resolution analysis using confocal laser scanning mi- & Molloy, 1987; Sullenger et al., 1990; Bertrand et al., croscopy. At this level of resolution (100 nm in a cell 1994; Noonberg et al., 1994; Thompson et al., 1995). with a thickness of 700 nm), both transcripts are non- Indeed, because binding of the therapeutic RNA to its 82 E. Bertrand et al.

FIGURE 5. Co-localization of the TAR1 ribozyme synthesized from the various expression cassettes with its SIV-GH mRNA target. Transiently transfected COS cells expressing the SIV-GH mRNA target alone (a), or together with the TAR1 ribozyme (b–i), were hybridized in situ with probes specific for the mRNA target or for the ribozyme. In a, probe detection was performed using the NBT/BCIP colorimetric reaction. In b–i, probes were detected with fluorescent antibodies. Green corresponds to the target mRNA, red to the ribozyme. When these two signals overlap, the color becomes yellow. a, transmitted light; b–f, epifluorescence microscopy; g–i, confocal laser scanning microscopy. Cells were transfected with the SIV-GH expression plasmid and the following ribozyme expression cassette: a, none; b, RSV; c, IU1; d, tRNA; e, U6ϩ1; f, U6ϩ19; g, RSV (only the green signal is shown); h, same cell as in g, but only the red signal is shown; i, same cell as in g and h, but both the red and green signals are shown. Intracellular ribozyme localization and efficiency 83

ing transcription and processing of well-defined RNAs. The promoters used for the expression cassettes were derived from the human tRNAMeti, the human U1snRNA, the human U6 snRNA genes, and the RSV LTR, and were fused to various processing and stabilizing sequences. These cassettes were inserted in the context of both an AAV vector and a MoMuLV retroviral vector, which are presently two of the most useful vectors for stably transducing cells in ex vivo human gene therapy approaches: retroviral vectors are already being used widely in human gene therapy trials, and AAV vectors are actively being developed because of their high transduction efficiency and ability to transduce nondivid- ing cells (Chatterjee et al., 1992; Kotin et al., 1992; Fisher- Adams et al., 1996). We have found that all the cassettes were functional in the context of the AAV vectors. In contrast, the tRNA and the U6 cassettes were inactive when inserted in the retroviral vectors. Such an inhibitory effect of the retroviral sequences on the expression of the inserted cassette has been observed often by others, and has been attributed to transcriptional interference between the promoter of the LTR and the cassettes (Emerman & Temin, 1984, 1986; Sullenger et al., 1990). This suggests that AAV vectors, which are devoid of endogenous promoters, may be more suitable for expressing ribozymes and antisense RNAs from foreign transcriptional cassettes.

Intracellular fate of the RNA expressed from the various cassettes

Expression levels

FIGURE 6. Inhibition of mRNA target expression conferred by the Five expression cassettes promoted high levels of ri- expression cassettes synthesizing either the TAR1 or the anti-tat bozyme expression in transiently transfected cells (see ribozyme. A: Inhibition of expression of the SIV-GH reporter gene in 293 cells expressing the TAR1 ribozyme. Columns are identified by the Results and Fig. 2 for a detailed description of the the name of the cassette expressing the TAR1 ribozyme. Levels of expression cassettes). We obtained 55,000 copy/cell for GH/CAT obtained in the ribozyme-producing cell line are ex- the tRNA cassette, 12,000 for U6ϩ1, 50,000 for U6ϩ19, pressed as the percent of GH/CAT expressed in the control cell line, which contains the same expression vector minus the ribozyme in- 44,000 for IU1, and 5,100 for RSV. These expression sert. The average of data from five series of triplicate transfections levels correspond well to similar analyses we have (Ϯ SD) are shown. B: Inhibition of HIV-1 replication in CEM T cells conducted with different hammerhead ribozymes (Ber- expressing the anti-tat ribozyme. The amount p24 HIV antigen present in the culture supernatant seven days after HIV-1 infection is shown. trand et al., 1994; Good et al., 1996). It therefore ap- Columns are identified by the name of the vector used to transduce pears that the binding sequence of the ribozyme does the CEM T cells. SC, the original retroviral vector (pG1Na) that not influence its ability to accumulate inside the cell, contained no expression cassettes; DC-IU1, double-copy vector containing the IU1 cassette; SC-IU1, single-copy vector containing the and that any hammerhead ribozyme expressed from IU1 cassette; SC-tRNA, single-copy vector containing the tRNA cas- these cassettes is likely to accumulate to similar levels. sette; SC-U6ϩ19, single-copy vector containing the U6ϩ19 cassette. The U1-driven transcripts are not polyadenylated All the expression cassettes contained the sequence of the anti-tat ribozyme. and the U6 RNAs are not capped. The 3Ј end of the U1 and the 5Ј end of the U6 transcripts are therefore not protected against exonuclease degradation. Compar- ison of the expression levels of the IU1 cassette with target appears rate-limiting in vivo (Sullenger & Cech, that from either the RU1 or RU1 stem cassettes shows 1993; Bertrand et al., 1994), ideal vectors should allow that insertion of U1 snRNA sequences at the 3Ј end production of a functional therapeutic RNA at high of the transcripts stabilizes them at least 500 fold. levels. For this purpose, we have constructed and tested Similarly, comparison of the expression levels of the a number of expression cassettes capable of signal- U6ϩ1 and the U6ϩ19 cassettes shows that the stem- 84 E. Bertrand et al. loop located at the 5Ј end of the U6ϩ19 transcript leakage of the RNA transcripts in the cytoplasm dur- stabilized it fourfold. It therefore appears that protec- ing cell division. In contrast to the tRNA, IU1, U6ϩ1, tion of both ends of the RNA against exonuclease deg- and U6ϩ19 cassettes, the RSV ribozymes were cyto- radation is important to obtain high steady-state levels plasmic. This result was consistent with the fact that of expression. RSV transcripts are capped and polyadenylated, and Analyses of the ribozyme expression levels in stably should therefore be exported efficiently to the cell transfected cells confirmed the results obtained in tran- cytoplasm. sient transfection, with the exception of the dispropor- tionate reductions of the expression levels of the U6ϩ1 Functional activity of ribozymes expressed and U6ϩ19 cassettes, which were 80- and 150-fold, from the various cassettes is determined respectively. One possibility that could explain this large by their intracellular localization reduction is the saturation of a nuclease in the transiently transfected cells, which would allow higher lev- The ability of the expression cassettes to generate func- els of the U6 ribozymes to accumulate. Because the 3Ј tional ribozyme activity in vivo was tested in two model end of the tRNA ribozyme is identical to the one of the systems. In the first one, the TAR1 ribozyme, which is U6 ribozymes, and because the tRNA cassette does not directed against the TAR sequence of SIV, was stably show such a large change in expression levels, the expressed in 293 cells. Ribozyme activity was then mea- saturable nuclease is predicted to attack the 5Ј end of sured via inhibition of expression of an SIV-GH re- the U6 transcripts. An additional 8 nt at the 5Ј end of porter gene transiently transfected in those cells. We U6 sequence, which appends 27 bases of U6 snRNA to found that the tRNA, IU1, U6ϩ1, and U6ϩ19 cassettes the ribozyme, allows its efficient capping (Good et al., did not support ribozyme activity, whereas the RSV 1996). Experiments comparing expression levels of the ribozyme was active. In the second test system, CEM same ribozyme insert expressed from the U6ϩ19 ver- T-cells were transduced with retroviral vectors con- sus U6ϩ27 cassettes substantiate the assumption that taining the anti-tat ribozyme expression cassettes, and the capped transcripts accumulate to higher levels than further challenged with HIV-1. We found that the ri- the uncapped transcripts (Good et al., 1996). bozyme was very active when synthesized as an LTR to LTR transcript that contained the sequences of the expression cassettes, but inactive when expressed from Intracellular localization the IU1 cassette. Taken together, these results show The intracellular localization of the ribozymes ex- that TAR1 and anti-tat ribozymes are active only when pressed from the various transcriptional cassettes was transcribed from standard Pol II cassettes, which gen- analyzed both by cell fractionation experiments and erate capped and polyadenylated RNAs and conse- by in situ hybridization. We have found that the quent cytoplasmic localization. tRNAMeti cassette generated ribozyme transcripts that There are a few possibilities that could explain the are almost exclusively nuclear. Because the tRNA moi- inactivity of the ribozymes when expressed from the ety in this cassette has been altered to block 3Ј pro- IU1, tRNA, and U6 cassettes. First, ribozyme expres- cessing, this finding is consistent with previous reports sion levels obtained from these cassettes might not be demonstrating that 3Ј processing is linked to nucleo- sufficient to mediate a measurable ribozyme activity. cytoplasmic export, and that altered tRNA transcripts Because the ribozyme expression levels obtained from are not exported efficiently (Cotten & Birnstiel, 1989; these cassettes are similar or up to sevenfold greater Boelens et al., 1995). The IU1 ribozyme was also pre- than the ones obtained from the standard Pol II pro- dominantly nuclear. Because this cassette contains all moters, this seems unlikely. Second, the secondary or the sequences necessary for U1snRNA processing, tertiary structure adopted by the ribozyme synthe- export/import, and snRNP assembly (Parry et al., 1989), sized from these cassettes might be deleterious to its this result suggests that the IU1 ribozyme forms a activity. The results obtained with the retroviral vec- U1snRNA-like particle in vivo. The ribozymes synthe- tors indicate that this is not the case. The secondary sized from the U6ϩ1 and the U6ϩ19 cassettes were structures framing the ribozyme in the various expres- also exclusively nuclear in most cells (70–80% of the sion cassettes are very stable: they include a partial transfected cells), but were also present in various tRNA structure, the U1snRNA moiety, the STL1 stem- amounts in the cytoplasm of the remaining cells (20– loop, and the first stem-loop of U6 snRNA. The sec- 30%). This cytoplasmic localization of the ribozyme in ondary structure adopted by the ribozyme when it is a significant subfraction of the cell population was embedded in the expression cassettes, but synthesized somewhat surprising, because the U6 transcripts lack as an LTR to LTR transcript, is therefore very likely to sequences promoting cytoplasmic export, and have a be identical to the one the ribozyme takes when tran- stretch of Us at their 3Ј end that may act as a nuclear scribed directly from the cassette promoters. Because retention signal (Terns et al., 1993; Boelens et al., 1995). these LTR to LTR transcripts mediate ribozyme activ- This limited cytoplasmic localization could be due to ity, it shows that the secondary structure of the ribo- Intracellular ribozyme localization and efficiency 85 zyme conferred by the expression cassette does not and could therefore determine the precise intracellular inhibit its activity in vivo. This model was tested in an localization of polyadenylated RNA. in vitro cleavage reaction as follows. The TAR1 ribo- Taken altogether, our results show that the ribozyme expression cassettes were transiently transfected zymes synthesized from the U6, tRNA, and IU1 cas- into 293 cells, and total cellular RNAs from these cells settes are inactive because they are nuclear, whereas were incubated in vitro with a radiolabeled substrate their mRNA target accumulates in the cytoplasm. In after normalizing the amount of ribozyme present in contrast, ribozymes synthesized by standard Pol II ex- each sample. The ribozymes synthesized in vivo from pression cassettes are co-localized with their mRNA the various cassettes, or in vitro with T7 RNA poly- target in the cell cytoplasm, and are active. This dem- merase, had similar in vitro activities (data not shown). onstrates that intracellular ribozyme localization is a It thus seems unlikely that the secondary structure critical determinant of its activity in vivo. This conclu- conferred by the various cassettes inhibited ribozyme sion is further supported by the fact that the IU1 cas- activity. sette has been shown previously to support ribozyme The last explanation for the inability of the tRNA, activity, but only against a target RNA expressed from IU1, and U6 cassettes to support ribozyme activity the same cassette (Bertrand et al., 1994). Because both was that the intracellular localization of the ribozyme RNAs are located in the nucleus in that case, it sug- prohibited its binding to the target RNA, and therefore gests that the critical parameter is not the ribozyme rendered it inactive. To test this hypothesis, we ana- localization per se, but is the ability of the ribozyme to lyzed simultaneously the intracellular localization of co-localize with its target. This conclusion confirms the ribozyme and its target with a two-color fluores- previous work by Sullenger and Cech showing that cent in situ hybridization method. Almost no ribozyme/ co-packaging of a ribozyme with target transcript in a target co-localization could be observed in cells: the retroviral particle greatly enhanced ribozyme activity tRNA, IU1, and U6 ribozymes were in the nucleus, (Sullenger & Cech, 1993). However, our study extends whereas their mRNA target was in the cytoplasm. How- that work by demonstrating that ribozyme/target co- ever, because the mRNA target is synthesized in the localization is also critical with respect to intracellular nucleus and then exported to the cytoplasm where it compartmentalization. Our work also demonstrates that accumulates, it was still possible that the ribozymes the intracellular localization of the ribozyme is deter- could bind their target on its way out of the nucleus. mined by the cassette from which it is expressed. There- To examine this possibility, we performed the same fore, future development of ribozyme or antisense experiment using a mutant ribozyme. Because the bind- expression cassettes should consider carefully intracel- ing of the mutant ribozyme to its target is quite stable lular localization of the resulting therapeutic RNA, and (they base pair over 54 bases), ribozyme/target bind- not only its expression levels and requirement to adopt ing occurring in the nucleus was expected to result an active conformation. The results presented here also either in retention of the mRNA target in the nucleus suggest that insertion of a nuclear export sequence in or in export of the ribozyme to the cytoplasm. How- the U6, tRNA, and IU1 cassettes should improve greatly ever, the mutant ribozyme and its target mRNA were their ability to support ribozyme and antisense activ- still largely located in separate cell compartments, sug- ity in vivo. gesting that the nuclear ribozymes were unable to bind their target during its synthesis and transport from the MATERIALS AND METHODS nucleus. In contrast to the U6, tRNA, and IU1 cassettes, the Expression plasmids and DNA templates ribozymes transcribed by the RSV and the MoMuLV for in vitro transcription promoters were active. Examination of the intracellu- All plasmids were constructed using standard techniques lar localization of the RSV ribozymes showed that they (Maniatis et al., 1982). When cloning involved oligonucleo- were present in the same cytoplasmic compartment as tides or PCR products, the insert was subjected to DNA their target RNA. High-resolution confocal imaging sequencing. A detailed restriction map of every plasmid is analyses further demonstrated that both RNAs were available upon request. not homogeneously distributed in the cell cytoplasm, The ribozyme expression cassettes and vectors are de- but their localization overlapped almost completely. scribed in the Results and in Figure 2. The AAV plasmids Similar co-localization patterns were observed with were derived from pCWRSPN (Chatterjee et al., 1992), and other transcripts that did not base pair with the target the retroviral plasmids were derived from pG1Na (Strata- gene). The STL1 stem-loop present in some of the cassettes mRNA, but that were also synthesized by Pol II cas- has the following sequence: 5Ј-AGCGGACTTCGGTCCGCT- settes (data not shown). It is therefore very likely that 3Ј. This stem-loop was followed directly by the TTTT se- this high degree of co-localization is induced by a com- quence, and the resulting stretch of five Ts served as a Pol III mon feature shared among these transcripts. One such terminator, which was included in all the constructs involv- possible element is the polyA tail. Indeed, the polyA ing STL1. The reporter gene pSIV-GH was generated by clon- tail associates with filamentous actin (Taneja et al., 1992), ing the SIV smmh4 promoter including the TAR sequence 86 E. Bertrand et al.

(bases 1–650: Hirsch et al., 1989) upstream of the GH coding 20 days (EMEM containing 400 ␮g/mL active G418, Life sequence of p0GH (Selden et al., 1986). Technologies). All the clones growing in one 10-cm plate The TAR1 ribozyme was obtained by cloning in were then pooled and further cultivated in EMEM-G418 me- pGEM9Zf(Ϫ) (Promega) the PCR products generated from dium. For transient expression of the TAR1 ribozyme target pSIV-GH with the following oligos: 5Ј-ACTCACGTCGA (i.e., SIV-GH mRNA), these pools of 293 cells were trans- CCTGCTGCTG(T)ATGAGTGCGTGAGGACGAAAGAGA fected with 2.6 ng of pSIV-GH, 33.4 ng of pL30CAT, and 964 ACCTCCCAGGGC and 5Ј-AGCTAGTCTAGAGGTCGCTC ng of pGEM9Zf(Ϫ) per 8 ϫ 105 cells. The precipitate was left TGCGGAGAGAGG. The catalytic core of the ribozyme is on the cells for 6 h, the cells were then subjected to a glycerol underlined. The base in parentheses is the one that replaces shock, and analyzed after 23 more hours. the preceding G in the mutant ribozyme. The resulting plasmid, pGEM-TAR1rbz, was then linearized and used as tem- plate for in vitro transcription. CEM T cells, recombinant retroviruses, The DNA templates for in vitro transcription of the sub- and HIV-1 infection assays strate TAR were generated directly by PCR, using the CEM T cells were cultured as described previously (Zhou SIVsmmh4 plasmid (Hirsch et al., 1989) and the following et al., 1994). Cells producing the anti-tat ribozyme vectors oligos: 5Ј-taatacgactcactatagGTCGCTCTGCGGAGAGGC and were derived from the PA317 packaging cell line. These vec- 5Ј-TTTAAGCAAGCAAGCGTGGAG. The sequence of the tors were then used to transduce CEM T cells, as described T7 promoter is in lower-case letters. In vitro transcription of previously (Zhou et al., 1994). The resulting pools of G418- this PCR product allows synthesis of an RNA corresponding resistant clones were then challenged with HIV-1: 4 ϫ 105 to transcribed nucleotides ϩ1toϩ140 of SIVsmmh4. cells were resuspended in their culture medium containing 12,000 TCID50 (MOI ϭ 0.02) of HIV-1 strain HIV-IIIb. After In vitro RNA synthesis and ribozyme assays 24 h, free virus was washed off and the cells were resuspended in 2 mL of their culture medium. Seven days later, The ribozyme and substrate DNA templates were tran- the culture supernatant was collected and assayed for HIV-1 scribed in vitro with T7 RNA polymerase in the presence or p24 antigen production, as described previously (Zhou et al., 32 absence of ␣- P UTP, as described previously (Bertrand 1994). et al., 1994). After transcription, the RNAs were phenol/ chloroform extracted, and purified on denaturing polyacrylamide gels. They were eluted overnight in 3 mL of water Cellular RNA extraction and analysis containing 150 mM NaCl, 1 mM EDTA, and 20 mM Tris, Total cellular RNAs were extracted by the guanidinium pH 8. The RNAs contained in the gel pieces were then de- thiocyanate–phenol-chloroform method (Chomczynski, 1989). salted by reverse-chromatography on a C18 column (Sep- Cytoplasmic RNAs were extracted as described previously pack light, Waters), dried, and resuspended in water. RNA (Bertrand et al., 1993). Nuclear RNAs were prepared as fol- concentrations were then determined by counting the incor- lows: 107 cells were resuspended and washed twice in ice- porated radioactivity, or by measuring the optical density of cold PBS, and then resuspended in 7 mL of ice-cold buffer H the RNA solution. (15 mM NaCl, 60 mM KCl, 1 mM EDTA, 10 mM Tris, NP40 For the cleavage assays, the RNAs were first denatured 0.2%, sucrose 5%, pH 7.5). The cell lysates were then trans- separately in water for 1 min at 90 °C, followed by incuba- ferred into a Dounce (pestle A), and nuclei were released tion at room temperature for 5 min. They were then rena- using four slow up and down strokes of the pestle. The turated for 5 min at 37 °C in the presence of 1 mM EDTA, nuclei were then purified by centrifugation (3,500 ϫ g for 140 mM NaCl, 20 mM MgCl2, 20 mM Tris, pH 7.5, and then 20 min) through a sucrose cushion (buffer H without NP40 mixed together. The reactions were stopped by addition of and containing 10% sucrose). Nuclear RNAs were extracted an equal volume of a solution containing 25 mM EDTA. The from the pellet with the same procedure as that used for total reactions were then precipitated with ethanol, resuspended RNAs. in 80% formamide containing 5 mM EDTA, and then loaded The RNAs were analyzed by primer extension with oligos on a denaturing polyacrylamide gel. After migration, the specific for the TAR1 ribozyme (5Ј-GGTCGCTCTGCGGA gels were dried, autoradiographed, and then quantified on a GAGAG) and for the human U6snRNA (5Ј-TATGGAACGC Phosphoimager scanner (Bio-Rad). TTCACGAATTTG), as described previously (Bertrand et al., 1994), or by northern analysis with a probe specific for the Cell culture, transfection, and generation anti-tat ribozyme (Zhou et al., 1994). For the quantitative of recombinant viruses primer extension assays, the RNA to be analyzed was prepared by in vitro transcription, gel purified, and quantified by measuring the optical density of the solution. An equal 293 cells amount of cellular RNA extracted from transfected cells (the Human 293 cells (Chatterjee et al., 1992) were grown in experimental samples) was then subjected to primer exten- Ca2ϩMg2ϩ free EMEM supplemented with 10% fetal calf sion, as well as known amounts of the RNA made in vitro, serum. Transfections were performed with the calcium phos- and diluted into the same amount of cellular RNA from phate co-precipitation procedure, as recommended by the untransfected cells (the standard samples). Reaction prod- manufacturer (Pharmacia). For stable clones, transfections ucts were then separated by denaturing PAGE. We checked were performed with 10 ␮g of plasmid DNA per 7 ϫ 106 that an equal amount was loaded in each lane by counting cells. Forty-eight hours after transfection, the cells were di- the samples immediately before loading. The gels were then vided 1/10 and then cultured under selective conditions for dried and quantified on a Phosphoimager scanner. The quan- Intracellular ribozyme localization and efficiency 87 tity of the analyzed RNA present in the experimental sam- tration, which was determined with a Bradford test (Bio- ples was then calculated using the standard samples as Rad). The GH secreted in the supernatant was detected with references. The number of analyzed RNA molecules per cell a radio-immuno assay, as recommended by the manufac- was then calculated assuming that a cell contains 30 pg of turer (Nichols Institute). RNA. For transiently transfected cells, we assumed that 20% of the cells were expressing the transfected gene. Further- more, the ribozyme expression plasmids were co-transfected ACKNOWLEDGMENTS with a CAT expression vector, and variations in transfection efficiencies were corrected by analyzing an aliquot of the We thank S. Li for her help in determining the ribozyme transfected cells for their specific CAT activity. activity in vivo; the Service d’Imagerie of the Institut J. Monod for their help with the confocal microscope; and V. Hirsch for the generous gift of psmmh4. We also thank R.-J. Lin, Sandra In situ hybridization Hilliker, and Nicolas Winston for critical reading of the manuscript and their helpful discussions. This work was sup- The in situ hybridizations were performed according to the ported by the CNRS and by grants from the Department of protocol of Hill and Gunning (1993), with the exception of Health and Human Services, National Institutes of Health, the hybridization buffer, which contained 2ϫ SSC, 50% form- AI29329, AI25959, and AI33263. E.B. was also supported by amide, 0.2% BSA, 0.1% SDS, 0.1% Sarkosyl, 20% dextran fellowships from l’Association de la Recherche contre le Can- sulfate, 500 ␮g/mL tRNA. The RNA probes were labeled cer, and from the Federation pour la Recherche Medicale with digoxygenin- or biotin-UTP during transcription, as (Sidaction fellowship). recommended by the manufacturer (Boehringer). For colorimetric detection with the NBT/BCIP reaction, digoxigenin- labeled probes were detected using an antibody coupled to Received September 17, 1996; returned for revision October 17, alkaline phosphatase, as recommended by the manufacturer 1996; revised manuscript received October 25, 1996 (Boehringer). For fluorescent detection, digoxygenin was revealed with a sheep anti-digoxigenin (Boehringer, antibody dilution was 1/200), and then a donkey anti-sheep IgG anti- REFERENCES body conjugated to FITC (Sigma, 1/150). Biotin was revealed with a three-layer system: first extravidin (Sigma, Adeniyi-Jones S, Romeo P, Zasloff M. 1984. Generation of long read through transcripts in vivo and in vitro by deletion of 3Ј termi- 0.5 ␮g/mL), followed by a monoclonal anti-avidin con- nation and processing sequences in the human tRNAimet gene. jugated to biotin (Sigma, diluted 1/2,000), and then a Nucleic Acids Res 12:1101–1115. strepavidin-CY3 conjugate (Sigma, diluted 1/2,000). Anti- Bertrand E, Fromont-Racine M, Pictet R, Grange T. 1993. Visualiza- bodies were incubated for 30 min at 37 °C in AB buffer, and tion of the in vivo interaction of a regulatory protein with RNA. then washed twice for 15 min in AB buffer without BSA. AB Proc Natl Acad Sci USA 90:3496–3500. Bertrand E, Pictet R, Grange G. 1994. Can hammerhead ribozymes buffer is 150 mM NaCl, 100 mM Tris-HCl, 0.3% Triton, 1% be efficient tools for inactivating gene function? Nucleic Acids Res BSA, 0.1% SDS, 0.1% sarkosyl, pH 7.5. Before mounting, 22:293–300. slides were washed once in Tris-HCl, 150 mM NaCl, pH 7.5, Bertrand E, Rossi J. 1996. Anti-HIV therapeutic hammerhead ribo- dehydrated (5 min in ethanol 70%, 5 min in ethanol 100%), zymes: Targeting strategies and optimization of intracellular function. Nucleic Acids Mol Biol 10:301–313. dried, and mounted in glycerol-anti fading solution. Epiflu- Boelens W, Palacios I, Mattaj I. 1995. Nuclear retention of RNA as a orescence microscopy was performed using a Leitz Aris- mechanism for localization. RNA 1:273–283. toplan microscope. Micrographs were taken by successive Brawerman G. 1990. Mechanisms of mRNA decay. Trends Biotechnol exposure of the cells with blue light (FITC filter set) and 8:1990. green light (TRITC filter set). Pictures were then scanned Chatterjee S, Johnson P, Wong K. 1992. Dual-target inhibition of HIV-1 in vitro by means of an Adeno-associated antisense vector. and further treated with a computer to expand the initial Science 258:1485. dynamic range of both the green and red signals to their Chomczynski P. 1989. Isolation of RNA by the RNAzolTM B method. maximal possible range. Confocal Laser Scanning Micros- Cinna/Biotecx Bulletin 3. copy was performed using a Leica confocal imaging system Cotten M, Birnstiel ML. 1989. Ribozyme mediated destruction of RNA in vivo. EMBO J 8:3861–3866. (TCSD4D). Images were collected using an oil immersion Crisell P, Thompson S, James W. 1993. Inhibition of HIV-1 replica- lens (63ϫ, NA 1.4 plan Apochromat). For fluorescein and tion by ribozymes that show poor activity in vitro. Nucleic Acids CY3 excitation, an Argon Krypton laser operating with the Res 21:5251–5255. 488-nm and 568-nm lines, respectively, was used. The pin- Dropulic B, Lin NH, Martin MA, Kuan-Teh J. 1992. Functional char- hole of the confocal system was adjusted to allow a field acterization of a U5 ribozyme: Intracellular suppression of human immunodeficiency virus type 1 expression. J Virol 66:1432– depth of about 0.7 ␮m. In order to reduce noise, a line- 1441. averaging mode was used to integrate the signal collected Emerman M, Temin H. 1984. Genes with promoters in retrovirus over 8 lines, with a scan time of 2 s per frame and a rastor vectors can be independently suppressed by an epigenetic mech- size of 512 lines. Images were then treated as before. anism. Cell 39:459–467. Emerman M, Temin H. 1986. Quantitative analysis of gene suppression in integrated retrovirus vectors. Mol Cell Biol 6:792–800. CAT and GH Fedor M, Uhlenbeck O. 1990. Substrate sequence effects on hammerhead catalytic efficiency. Proc Natl Acad Sci USA 87:1668– Cellular protein extracts and CAT dosages were performed 1672. Fedor M, Uhlenbeck O. 1992. Kinetics of intermolecular cleavage by as previously described (Neumann et al., 1987; Bertrand hammerhead ribozymes. Biochemistry 31:12042–12054. et al., 1994). CAT specific activity was calculated by dividing Fisher-Adams G, Wong KK Jr., Podsakoff G, Forman SJ, Chatterjee S. the CAT activity in the sample by the total protein concen- 1996. Integration of adeno-associated virus vectors in CD34ϩ 88 E. Bertrand et al.

human hematopoietic progenitor cells after transduction. Blood Persson C, Gerhart E, Wagner H, Nordstrom K. 1990a. Control rep- 88:492–504. lication of plasmid R1: Formation of an initial transient complex Good P, Krikos A, Li L, Bertrand E, Lee N, Giver L, Ellington A, Zaia is rate-limiting for antisens RNA-target RNA pairing. EMBO J J, Rossi J, Engelke D. 1996. Expression of small, therapeutic RNAs 9:3777–3785. in human cell nuclei. Gene Therapy. Forthcoming. Persson C, Gerhart E, Wagner H, Nordström K. 1990b. Control of Guerrier-Takada C, Gardiner K, Marsh T, Pace N, Altman S. 1983. replication of plasmid R1: Structures and sequences of the anti- The RNA moeity of ribonuclease P is the catalytic subunit of the sense RNA, CopA, required for its binding to the target RNA, enzyme. Cell 35:849–869. CopT. EMBO J 9:3767–3775. Hernandez N. 1985. Formation of the 3Ј end of U1 snRNA is di- Rittner C, Burmester C, Sczakiel G. 1993. In vitro selection of fast- rected by a conserved sequence located downstream of the cod- hybridizing and effective antisense RNAs directed against the ing region. EMBO J 4:1827–1837. human immunodeficiency virus type 1. Nucleic Acids Res 21:1381– Hertel KJ, Herschlag D, Uhlenbeck OC. 1994. A kinetic and thermo- 1387. dynamic framework for the hammerhead ribozyme reaction. Bio- Sarver N, Cantin EM, Chang PS, Zaia JA, Ladne PA, Stephens DA, chemistry 33:3374–3385. Rossi JJ. 1990. Ribozymes as potential anti-HIV-1 therapeutics Hill M, Gunning P. 1993. Beta and gamma actin mRNAs are differ- agents. Science 247:1222–1225. entially located within myoblasts. J Cell Biol 122:825–832. Saxena SK, Ackerman EJ. 1990. Ribozymes correctly cleave a model Hirsch V, Olmstead R, Murphey-Corb M, Purcell R, Johnson P. 1989. substrate and endogenous RNA in vivo. J Biol Chem 265:17106– SIV from Sooty mangabeys: An African non-human primate len- 17109. tivirus closely related to HIV-2. Nature 339:389–391. Selden R, Byrke-howie K, Rowe M, Goodman H, Moore D. 1986. Jennings PA, Molloy PL. 1987. Inhibition of SV40 replicon function Human growth hormone as a reporter gene in regulation stud- by engineered antisense RNA transcribed by RNA polymerase ies employing transient gene expression. Mol Cell Biol 6:3173– III. EMBO J 6:3043–3047. 3179. Kotin RM, Linden RM, Berns KI. 1992. Characterization of a pre- Singh R, Gupta S, Reddy R. 1990. Capping of mammalian U6 small ferred site on human chromosome 19q for integration of adeno- nuclear RNA in vitro is directed by a conserved stem-loop and associated virus DNA by non-homologous recombination. EMBO AUAUAC sequence: Conversion of a non-capped RNA into a J11:5071–5078. capped RNA. Mol Cell Biol 10:939–946. Kruger K, Grabowski PJ, Zaug A, Sands J, Gottschling DE, Cech TR. Sioud M, Drlica K. 1991. Prevention of human immunodeficiency 1982. Self-splicing RNA: Autoexcision and autocyclization of the virus type 1 integrase expression in Escherichia coli by a ribo- ribosomal RNA intervening sequences of Tetrahymena. Cell 31:147– zyme. Proc Natl Acad Sci USA 88:7303–7307. 157. Steinecke P, Herget T, Schreier PH. 1992. Expression of a chimeric L’Huillier PJ, Davis SR, Bellamy R. 1992. Cytoplasmic delivery of ribozyme gene results in endonucleolytic cleavage of target mRNA ribozymes leads to efficient reduction in ␣-lactalbumin mRNA and a concomitant reduction of gene expression in vivo. EMBO levels in C127I mouse cells. EMBO J 11:4411–4418. J11:1525–1530. Larsson S, Hotchkiss G, Andang M, Nyholm T, Inzunza J, Jansson I, Sullenger B, Lee T, Smith C, Ungers G, Gilboa E. 1990. Expression of Ahrlund-Richter L. 1994. Reduced Beta2-microglobulin mRNA chimeric tRNA-driven antisense transcripts renders NIH 3T3 cells levels in transgenic mice expressing a designed hammerhead highly resistant to Moloney murine leukemia virus replication. ribozyme. Nucleic Acids Res 22:2242–2248. Mol Cell Biol 10:6512–6523. Lo KM, Biasolo MA, Dehnhi G, Palu G, Haseltine WA. 1992. Inhi- Sullenger BA, Cech TR. 1993. Tethering ribozymes to a retroviral bition of replication of HIV-1 by retroviral vectors expressing packaging signal for destruction of viral RNA. Science 262:1566– tat-antisense and anti-tat ribozyme RNA. Virology 190:176–183. 1569. Lobo SM, Ifill S, Hernandez N. 1990. Cis-acting elements required Taneja K, Lifshitz L, Fay F, Singer R. 1992. Poly(A) RNA codistribu- for RNA polymerase II and III transcription: The human U2 and tion with microfilaments: Evaluation by in situ hybridization and U6 snRNA promoters. Nucleic Acids Res 18:2891–9899. quantitative digital imaging microscopy. J Cell Biol 119:1245–1260. Maniatis T, Fritsch EF, Sambrook J. 1982. Molecular cloning: A labo- Terns M, Dahlberg J, Lund E. 1993. Multiple cis-acting signals for ratory manual. Cold Spring Harbor, New York: Cold Spring Har- export of pre-U1 snRNA from the nucleus. Genes & Dev 7:1898– bor Laboratory Press. 1908. Neumann JR, Morency CA, Russian KO. 1987. A novel rapid assay Thompson J, Ayers D, Malmstrom T, McKenzie T, Ganousis L, Chow- for chloramphenicol acetyltransferase gene expression. BioTech- rira B, Couture L, Stinchcomb D. 1995. Improved accumulation niques 5:444–447. and activity of ribozymes expressed from a tRNA-based poly- Noonberg S, Scott G, Garovoy M, Benz C, Hunt C. 1994. In vivo merase III promoter. Nucleic Acids Res 23:2259–2268. generation of highly abundant sequence-specific oligonucleo- Zhao JJ, Pick L. 1993. Generating loss-of-function phenotypes of the tides for antisense and triplex gene regulation. Nucleic Acids Res fushi tarazu gene with a targeted ribozyme in Drosophila. Nature 22:2830–2836. 365:448–451. Parry HD, Scherly D, Mattaj IW. 1989. “Snurpogenesis:” the tran- Zhou C, Bahner I, Larson G, Zaia J, Rossi J, Kohn D. 1994. Inhibition scription and assembly of U snRNP components. Trends Biochem of HIV-1 in human T-lymphocytes by retrovirally transduced Sci 14:15–19. anti-tat and rev hammerhead ribozymes. Gene 149:3–39.