DNA Technology

TERMINOLOGY Similar terms — often used interchangeably • Biotechnology: the manipulation of organisms to produce a product. – Fermentation, artificial breeding, pharmaceutical and nutritional supplements, and now… • Genetic engineering: the direct manipulation Biotechnology: “Any technological application that uses biological system or living of an organism’s DNA. organisms to make or modify the process or products for specific use.” • Recombinant DNA: insertion of DNA from one source into another. • Transgenics: producing an organism with foreign DNA inserted into its genome.

RESTRICTION ENZYMES TOOLS & TECHNIQUES • Restriction Digests • RFLP — “genetic fingerprinting” • Hybridizations & Molecular Probes • Polymerase Chain Reaction (PCR) • Recombinant DNA • Bacteria produce special enzymes to chop up viral DNA. • Gene Cloning • Biotechnologist use these “restriction enzymes” to cut DNA in specific places (restriction sites). • Transgenics • Many restriction enzymes cut the DNA polymer in a • Gene Expression Analyses staggered pattern that produce “sticky” single-stranded • Genome Mapping & Sequencing ends to the DNA fragments.

RESTRICTION FRAGMENT RESTRICTION DIGEST ANALYSIS → RESTRICTION FRAGMENTS DNA Technology as a diagnostic tool • Everyone’s DNA is unique • Closer the relationship the more similar the DNA • Restriction Fragment Length Polymorphisms – RFLPs – “Ruff-lips”

Heyer 1 DNA Technology

RESTRICTION FRAGMENT LENGTH POLYMORPHISM USES OF RESTRICTION FRAGMENT ANALYSIS • Electrophoresis of fragments • Criminology

USES OF USES OF RESTRICTION RESTRICTION FRAGMENT ANALYSIS FRAGMENT ANALYSIS • Missing persons • Criminology • Missing persons • Paternity

RESTRICTION FRAGMENT USES OF RESTRICTION ANALYSIS FRAGMENT ANALYSIS A DNA T • Medicine Normal allele SNP – Inborn errors Single Nucleotide Polymorphism of metabolism results in altered restriction site • Carriers C • Prenatal testing G Disease-causing – Provirus DNA allele • Genetic markers — within or near allele — inherited with allele

Heyer 2 DNA Technology

MOLECULAR PROBES CAN RESTRICTION FRAGMENT IDENTIFY SPECIFIC GENES ANALYSIS

• “Southern Hybridization: DNA/RNA hybrid molecule Blotting”

Characterization: Southern blot Characterization: Northern blot hybridization hybridization

X RNA X

x salt X RNA -transfer of DNA from a gel to a membrane (e.g., nitrocellulose, nylon) -transfer of RNA from a gel to a membrane (e.g., nitrocellulose, nylon) -developed by Edwin Southern -reveals mRNA size (and approximate protein size), tissue- and organ- specific expression, and kinetic patterns of expression

RESTRICTION FRAGMENT Characterization: Western blotting ANALYSIS

Normal β -globin allele Enzyme 175 bp 201 bp Large fragment X Protein • Comparing two DdeI DdeI DdeI DdeI reaction different or Sickle-cell mutant β-globin allele X DNA React with 376 bp Large fragment Antibody molecules, DdeI DdeI DdeI (a) DdeI restriction sites in normal and sickle-cell alleles of such as two β-globin gene. X Normal Sickle-cell alleles for a allele allele x Buffer; requires electric current gene Large X fragment

376 bp 201 bp -transfer of protein from a gel to a membrane (e.g., nitrocellulose, nylon) 175 bp -requires the use of an electric current to facilitate transfer (b) Electrophoresis of restriction fragments from normal Figure 20.9a,b and sickle-cell alleles.

Heyer 3 DNA Technology

Polymerase Chain Reaction Polymerase Chain Reaction

• PCR All you need: • A heat-block that can • Copies DNA rapidly and precisely fragments change temperature • Million copies/hr (Thermocycler) • Primers bracketing the • Enough for RFLPs sequence of interest analysis, probes, • A special heat-stable DNA-polymerase from sequencing, etc. a bacteria inhabiting hot-springs

With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro.!

Polymerase Chain Reaction RECOMBINANT DNA TECHNOLOGY 5ʹ 3ʹ Genomic DNA • The PCR procedure Target sequence 3ʹ 5ʹ TECHNIQUE The starting materials for PCR are • Set of techniques for combining genes 1 Denaturation: 5ʹ 3ʹ double-stranded DNA containing the target nucleotide Heat briefly sequence to be copied, a heat-resistant DNA to separate – In a test tube DNA strands polymerase, all four nucleotides, and two short, single- 3ʹ 5ʹ stranded DNA molecules that serve as primers. One – Different sources of DNA primer is complementary to one strand at one end of Cycle 1 2 Annealing: the target sequence; the second is complementary to yields Cool to allow Primers – Same species 2 primers to the other strand at the other end of the sequence. hydrogen-bond. molecules – Different species 3 Extension: RESULTS DNA polymerase New • During each PCR cycle, the target adds nucleotides nucleo- DNA sequence is doubled. to the 3ʹ end of tides • Transferring genes • By the end of the third cycle, one-fourth of the each primer molecules correspond exactly to the target – Into cells “The bad news is they’re all dark meat...”

sequence, with both strands of the correct length. Cycle 2 (See white boxes in Cycle 3.) yields – Where they can be replicated 4 • After 20 or so cycles, the target sequence molecules molecules outnumber all others by a billionfold or Cycle 3 more. yields 8 molecules; 2 molecules (in white boxes) Figure 20.7 match target sequence

GENES FROM ONE CELL CAN BE PLASMIDS CAN BE USED TO INSERTED INTO ANOTHER CELL CUSTOMIZE BACTERIA

“Genetic Engineering” Cut and Paste: ü Restriction digest ü Anneal sticky ends ü DNA ligase ü Voila! ø Recombinant DNA

Heyer 4 DNA Technology

Gene Cloning Gene Cloning

APPLICATION Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research. 4 Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene. TECHNIQUE In this example, a human gene is inserted into a plasmid from E. coli. The plasmid contains the ampR gene, which makes E. coli cells resistant to the antibiotic ampicillin. It also contains Recombinant the lacZ gene, which encodes β-galactosidase. This enzyme hydrolyzes a molecular mimic of bacteria lactose (X-gal) to form a blue product. Only three plasmids and three human DNA fragments are shown, but millions of copies of the plasmid and a mixture of millions of different human DNA fragments would be present in the samples. 5 Plate the bacteria on agar containing ampicillin and X-gal. Incubate until 1 Isolate plasmid DNA and human DNA. Bacterial cell lacZ gene colonies grow. (lactose Human Colony carrying non- Colony carrying breakdown) cell recombinant plasmid recombinant plasmid with intact lacZ gene with disrupted lacZ gene 2 Cut both DNA samples with the same restriction Restriction enzyme site Bacterial R amp gene clone (ampicillin Bacterial Gene of resistance) plasmid interest 3 Mix the DNAs; they join by base pairing. The products are recombinant plasmids and Sticky ends Human DNA many nonrecombinant plasmids. fragments RESULTS Only a cell that took up a plasmid, which has the ampR gene, will reproduce and form a colony. Colonies with nonrecombinant plasmids will be blue, because they can hydrolyze X-gal. Colonies with recombinant plasmids, in which lacZ is disrupted, will be white, because they cannot hydrolyze X-gal. By screening the white colonies with a nucleic acid probe (see Figure 20.5), researchers can identify clones of bacterial cells carrying the gene of interest. Figure 20.4 Recombinant DNA plasmids

Identifying Clones Carrying Nucleic acid probe a Gene of Interest hybridization APPLICATION Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. TECHNIQUE Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This Colonies collection of bacterial colonies is the master plate. containing • A clone carrying the gene of interest gene of interest Master plate Master plate Probe – Can be identified with a radioactively DNA Solution Radioactive Gene of labeled nucleic acid probe that has a containing single-stranded interest probe DNA Film sequence complementary to the gene, a Single-stranded DNA from cell Filter Filter lifted and process called nucleic acid hybridization flipped over

Hybridization – Same procedure as identifying bands on on filter 1 A special filter paper is 2 The filter is treated to break 3 The filter is laid under 4 After the developed film pressed against the open the cells and denature photographic film, is flipped over, the a Southern blot master plate, their DNA; the resulting single- allowing any reference marks on the transferring cells to stranded DNA molecules are radioactive areas to film and master plate are the bottom side of the treated so that they stick to expose the film aligned to locate colonies filter. the filter. (autoradiography). carrying the gene of interest.

RESULTS Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different Figure 20.5 nucleotide sequences, the collection of bacterial clones can be screened for different genes.

PLASMIDS CAN BE USED TO Can Bacteria Express CUSTOMIZE BACTERIA Eukaryotic Genes? Some problems: • Since <2% of eukaryote DNA carries genetic information, how do you know which parts have genes? • Since bacteria do not do post-transcriptional modification, how can they express eukaryotic genes?

Answer: cDNA (complementary DNA)

Transgenics: transferring DNA from one organism into another

Heyer 5 DNA Technology

COMPLEMENTARY DNA PHARMACEUTICAL (RED) DNA in cDNA nucleus BIOTECHNOLOGY

• Collect mRNA from mRNAs in cytoplasm Transgenic cells of interest Reverse transcriptase Bacteria • Use mRNA Poly-A tail reverse transcriptase 5′ AAAAAA 3′ • Protein to synthesize 3′ TTTTT 5′ DNA Primer production complementary DNA strand (poly-dT) – Insulin from mRNA template 5′ AAA AAA 3′ – Growth hormone 3′ TTTTT 5′ → cDNA = eukaryotic gene – Erythropoietin without the introns – Hepatitis B vaccine for bacterial expression! 5′ 3′ 3′ 5′ DNA ª Can use labelled nucleotides polymerase → cDNA used as probes 5′ 3′ → identify regions of genes! 3′ 5′ cDNA

TRANSFORMING EUKARYOTES AGRICULTURAL (GREEN) WITH RECOMBINANT DNA BIOTECHNOLOGY Transgenic Plants, Fungi, & Animals • Agrobacterium Ti plasmid – Natural pathogen of broad-leaf plants – Ti plasmid inserts into plant chromosome • Microparticle accelerator “gene gun” – DNA fragments coated onto gold or tungsten particles – Particle blasted by gas pressure burst through tissue, leaving trail of DNA residue in cells • Microfiber “gene whiskers” – DNA fragments coated onto microscopic needles – Needles and cells suspended and shaken; impaled cells take up DNA from needles • Electroporation – Rapid electrical pulses induce cellular pores to open allowing small fragments of DNA to enter

AGRICULTURAL (GREEN) Agrobacterium tumefaciens with modified Ti plasmid BIOTECHNOLOGY — Vector for integrating modified T-DNA

Replace Ti plasmid tumor-causing genes with gene of interest and kanR — [kanomycin (herbicide) resistant gene]

Agrobacterium tumefaciens, Ti (tumor-inducing) plasmid kanomycin in media kills • Natural pathogen of broad-leaf plants non-transformed plant cells • Virulence proteins mediate transfer to cell and into nucleus, & recombination into host chromosome • T-DNA of Ti plasmid inserts into plant chromosome

Heyer 6 DNA Technology

AGRICULTURAL (GREEN) AGRICULTURAL (GREEN) BIOTECHNOLOGY BIOTECHNOLOGY

soybean Top U.S. GMO* Crops Top U.S. GMO* Crops * Genetically Modified Organism * Genetically Modified Organism corn cotton Some proposed benefits of GMO crops: • Intrinsic pesticide (bacterial insect pathogens) • Herbiside resistance • Enhanced productivity • Enhanced shelf life (FlaverSaver® tomatoes) HT: herbicide-tolerant Bt: insect-resistant • Frost resistance

GENE MICROINJECTION AND ANIMAL CLONING TRANSGENIC RESEARCH

• Microinjection is labor intensive • Mice • Cloning embryos is slow, expensive, and produces that are few recombinant subjects susceptible to • Thus, use only for gene human cancers products with huge or viruses potential profits to justify – Test the expense and effort. therapies

PHARMACEUTICAL AGRICULTURAL The latest hot tool! BIOTECHNOLOGY CRISPR & CAS “Pharming” • CRISPR: “clustered regularly interspaced short palindromic repeats” – Repeating DNA sequences flanking unique proviral DNA. – Proviral DNA transcribed as “guideRNA” (gRNA or crRNA) • CAS: CRISPR-associated proteins – Bind to gRNA – Use “target sequence” of gRNA to specifically bind/cut new invading viral DNA • NOW, if we replace the gRNA on CAS with an RNA sequence of our choice, we can cut DNA at any specific site! – 20-nt target sequence much more specific than 4–8-nt sequence of restriction sites. – Customizable! https://www.youtube.com/watch?t=141&v=2pp17E4E-O8

Heyer 7 DNA Technology

Analysis of Gene Expression Analysis of Gene Expression Microarrays of mRNAs in situ Hybridization of mRNAs 3′ 5′ 3′ 5′ TAACGGTTCCAGC CTCAAGTTGCTCT • Investigate which ATTGCCAAGGTCG GAGTTCAACGAGA • Investigate which 5′ 3′ 5′ 3′ genes are being wg mRNA en mRNA genes are being Cells Cells expressed by expressing expressing expressed by the wg gene the en gene

which tissues and Head Thorax Abdomen which tissues and at which time at which time

Each dot is a well containing copies of DNA fragments that carry a specific gene. Genes expressed in first tissue.

50 µm T1 T2 T3 A1 A2 A3 A4 A5 Genes expressed in second tissue. Segment boundary

Genes expressed in both tissues. Drosophila embryo

Genes expressed

in neither tissue.

► DNA microarray Head Thorax Abdomen Fig. 20.13 (actual size) Fig. 20.10

Genetic Mapping: Construction of a Human Relative Ordering of Markers Genomic Library

Cytogenetic map Chromosome Chromosome banding bands pattern and location of • Gene Mapping specific genes by fluorescence in situ hybridization (FISH) Genes located & genomics by FISH 1 Genetic (linkage) mapping • The initial stage Ordering of genetic markers such as RFLPs, simple sequence DNA, in mapping a large and other polymorphisms (about 200 per chromosome) Genetic genome is to markers

construct a 2 Physical mapping Ordering of large over- lapping fragments linkage map of cloned in YAC and BAC vectors, followed by ordering of smaller Overlapping several thousand fragments cloned in fragments phage and plasmid genetic markers vectors

3 DNA sequencing spaced throughout Determination of nucleotide sequence of …GACTTCATCGGTATCGAACT… each small fragment and each of the assembly of the partial sequences into the com- chromosomes plete genome sequence Figure 20.11

Storing Cloned Genes in Sequences of Base Pairs Mapping DNA Libraries • A genomic library made using bacteria – Is the collection of recombinant vector clones produced by cloning DNA fragments derived from

an entire genome Foreign genome cut up with restriction enzyme

or

Bacterial Recombinant plasmids Recombinant clones phage DNA Phage clones

(a) Plasmid library (b) Phage library

Heyer 8