DOCSLIB.ORG

Pheromone-Gland-Specific Fatty-Acyl Reductase in the Adzuki Bean Borer

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pheromone-Gland-Specific Fatty-Acyl Reductase in the Adzuki Bean Borer Insect Biochemistry and Molecular Biology 39 (2009) 90–95 Contents lists available at ScienceDirect Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb Pheromone-gland-specific fatty-acyl reductase in the adzuki bean borer, Ostrinia scapulalis (Lepidoptera: Crambidae) Binu Antony a, Takeshi Fujii a, Ken’ichi Moto b, Shogo Matsumoto b, Mai Fukuzawa a, Ryo Nakano a, Sadahiro Tatsuki a, Yukio Ishikawa a,* a Laboratory of Applied Entomology, Graduate School of Agricultural and Life Sciences, University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan b Molecular Entomology Laboratory, RIKEN (The Institute of Physical and Chemical Research), Wako, Saitama 351-0198, Japan article info abstract Article history: The adzuki bean borer moth, Ostrinia scapulalis, uses a mixture of (E)-11- and (Z)-11-tetradecenyl Received 4 August 2008 acetates as a sex pheromone. At a step in the pheromone biosynthetic pathway, fatty-acyl precursors are Received in revised form converted to corresponding alcohols by an enzyme, fatty-acyl reductase (FAR). Here we report the 6 October 2008 cloning of FAR-like genes expressed in the pheromone gland of female O. scapulalis, and the character- Accepted 10 October 2008 ization of a single pheromone-gland-specific FAR (pgFAR) and its functional assay using an insect cell expression system. As many as thirteen FAR-like genes (FAR-I–FAR-XIII) were expressed in the phero- Keywords: mone gland of O. scapulalis; however, only one (FAR-XIII) was pheromone-gland-specific. The deduced Fatty-acyl reductase Pheromone gland amino acid sequence of FAR-XIII predicted a 462-aa protein with a conserved NAD(P)H-binding motif in Functional assay the N-terminal region, showing overall identity of 34% with the pgFAR of Bombyx mori. A functional assay Ostrinia using Sf9 cells transfected with an expression vector containing the open reading frame of the FAR-XIII gene has proven that FAR-XIII protein has the ability to convert a natural substrate, (Z)-11-tetradecenoic acid, to a corresponding alcohol, (Z)-11-tetradecenol. Ó 2008 Elsevier Ltd. All rights reserved. 1. Introduction mammalian FAR (Cheng and Russel, 2004) soon followed, no report on pgFARs in other insect species has appeared until now. In the Lepidopteran sex pheromones are mostly blends of fatty acid- present study, we aimed to clone and characterize the pgFAR gene derived C10–C18 compounds with 1–3 double bonds and a terminal of the adzuki bean borer, Ostrinia scapulalis, which uses a mixture of oxygenated functional group (Bjostad et al., 1987). Pheromones are (E)-11- and (Z)-11-tetradecenyl acetates (E11- and Z11-14:OAc) as synthesized in a pheromone gland, which is usually a modified a sex pheromone (Huang et al., 1997, 2002; Takanashi et al., 2005). membrane between the 8th and 9th abdominal segments, from We here report the successful cloning and functional assay of common fatty acids like palmitic acid via chain shortening by pheromone-gland-specific FAR from O. scapulalis. b-oxidation enzymes, introduction of a double bond by fatty-acyl desaturase, reduction by fatty-acyl reductase (FAR), and acetylation by acetyltransferase in the case of acetate pheromone or oxidation 2. Materials and methods by alcohol oxidase in the case of aldehyde pheromone (Tillman et al., 1999; Jurenka, 2003, 2004; Matsumoto et al., 2007). In the last 2.1. Insects two decades, information on the molecular characteristics of desaturases has amassed rapidly; however, information on the Female moths of O. scapulalis were collected at Matsudo, Japan, other enzymes involved in pheromone biosynthesis is quite and individually housed in a plastic cup to allow oviposition. The limited. offspring were reared on an artificial diet (SilkmateÔ 2S, Nosan The molecular characterization of FAR was first achieved by Corp., Yokohama, Japan) as previously described (Takanashi et al., Moto et al. (2003), who succeeded in identifying the pheromone- 2005). Pupae were sexed, and female pupae were maintained at gland-specific FAR (pgFAR) in Bombyx mori (Matsumoto et al., 23.0 Æ 2.0 C under a 16-h light: 8-h dark photoperiod. Emerged 2007). Although a report on the molecular characterization of female moths were collected daily during mid scotophase. Females 2–4 days old were used for experiments. In terms of pheromone production type, females of this natural population are a mixture of * Corresponding author. Tel.: þ81 3 5841 1851; fax: þ81 3 5841 5061. E-type, Z-type and their hybrids, the hybrids being the most E-mail address: [email protected] (Y. Ishikawa). abundant (Takanashi et al., 2005). E-type, Z-type and hybrids 0965-1748/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2008.10.008 B. Antony et al. / Insect Biochemistry and Molecular Biology 39 (2009) 90–95 91 produce a 99:1, 3:97, and 64:36 mixture of E11-14:OAc and Table 1 Z11-14:OAc, respectively (Huang et al., 2002). Primers used for degenerate PCR and RACE experiments of FAR-XIII. Name Sequence (50–30) þ 2.2. Poly(A) RNA isolation and cDNA synthesis Degenerate primers Os_F1_deg ACNGGHTTYMTDGGVAA Poly(A)þ RNA (mRNA) was purified from the pheromone gland Os_F2_deg YAYRTDTCBACWGCHTA of females using a FastTrack MAG mRNA isolation kit (Invitrogen, Os_R2_deg RTADGCWGTVGAHAYRT FAR_Gen_R GMTTTKGTGTANGYRTAYGTRTTHGG Carlsbad, CA) as follows. The terminal abdominal segments (TAS) of FAR_LAT_F ACNGGNGSNACNGGNTT female moths were extruded by applying gentle pressure to the FAR_LAT_Rev_TCN RTANGCNGTNGANACRT abdomen, and cut with micro-scissors. The TAS (n ¼ 60) were FAR_LAT_Rev_AGY RTANGCNGTRCTNACRT washed in insect ringer 3 times and then cut at the level of the RACE Primers lateral apophysis on one side to open the TAS. Fat bodies and other FARXIII30F1 AGCAGACAGAAGACCTGACCATTGAAGC inner tissues were removed from the TAS as thoroughly as possible FARXIII30F2 CAGAAGACCTGACCATTGAAGCGA FARXIII50R1 CCTCGCTTCAATGGTCAGGTCTTC with a fine needle. Then the 8th–9th intersegmental membranes, 0 FARXIII5 R2 GCTTCAATGGTCAGGTCTTCTGTCTGCT which include pheromone-producing cells, were incubated at 37 C FARXIII_30W_I GTCTCTAGCCGATACAGTAATG for 30 min in 250 ml of insect ringer with 1% trypsin and 2.5 mlof FARXIII_30W_II GGCAACAAAGGAGTCAAGG RNase inhibitor (40 U/ml, Takara Bio Inc., Ohtsu, Japan) to separate FARXIII_30W_III CGATGTCACTGAAATTGAGTGG pheromone-producing cells from the cuticle. After cooling to room FARXIIIFL_F1 CAGTCTAGAAAAATGTCAGC FARXIIIFL_R1b GCTCAAAAACTACTGGACCG temperature, it was centrifuged at 3000 Â g for 5 min and then washed 2 times in the above solution without trypsin. After centrifugation, 100 ml of lysis buffer L4 (FastTrack MAG mRNA the WizardÒ SV Gel and PCR Clean-up system (Promega, Madison, isolation kit, Invitrogen) was added and digested tissues were WI), and ligated into a pGEMÒ-T easy vector (Promega), and passed through a 23-gauge needle, and thereafter mRNA was iso- transformed into Escherichia coli competent cells (JM109, Takara lated by following the manufacturer’s protocol, with the addition of Bio). Recombinant clones were amplified with M13 universal DNase (Qiagen, Valencia, CA) treatment. primers, and sequenced in both directions using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) on an 2.3. cDNA normalization ABI PRISM 310 Genetic Analyzer (Applied Biosystems). In parallel to the effort to obtain FAR fragments by degenerate The first-strand cDNA was prepared from mRNA extracted from PCR, a cDNA library was constructed and screened randomly. The the TAS of female O. scapulalis using a SMARTÔ PCR cDNA library normalized cDNA was directly ligated into a pGEMÒ-T easy vector construction kit (Clontech, Mountain View, CA) following the following the manufacturer’s protocol, and transformed into E. coli manufacturer’s instructions except that the CDS-3M adaptor cells. Recombinant clones were subjected to PCR using the provided in the Trimmer Direct kit (Evrogen, Moscow, Russia) was universal primers. The products of 1–2 kb were purified using the used instead of the CDSIII 30 PCR primer. The cDNA was precipitated WizardÒ SV Gel and PCR Clean-up system, and sequenced. with ethanol and dissolved in RNase-free water to a final concen- tration of 100 ng/ml. The amplification of the first-strand cDNA and 2.5. Sequence data analysis duplex-specific nuclease treatment were carried out following the manufacturer’s protocol. PCR was performed using an Advantage 2 Partial gene sequences obtained were joined using BioEdit PCR kit with a 50 PCR primer (Clontech) under the following (BioEdit, North Carolina State University, USA), and aligned using conditions: 18 cycles of 95 C for 7 s, 66 C for 30 s, and 72 C for the Clustal W program with the sequence of B. mori pgFAR (Moto 6 min. The first and second amplifications of the normalized cDNA et al., 2003), and sequences of the human, mouse and jojoba FARs. were performed with the Trimmer direct PCR primers M1 and M2 Genealogical analysis of FAR genes was carried out using neighbor- under the above conditions for 18 and 12 thermal cycles, respec- joining method with TREECON for windows version 1.3b (Univer- tively. After Proteinase K treatment, SfiI digestion, and purification sity of Konstanz, Germany) with jojoba FAR (JJFAR) (Metz et al., with a chroma spin column (Clontech), the normalized cDNA was 2000) as an outgroup. ethanol precipitated and dissolved in PCR water (Advantage 2 PCR kit, Clontech) to a concentration of 100 ng/ml. The normalized cDNA 2.6. Tissue specificity studies by RT-PCR was checked for the presence of the D11-desaturase gene by PCR using desL1/desR1 primers (Fukuzawa et al., 2006). Total RNA was isolated from the whole head, thorax, and abdomen (with and without TAS) of 3-day-old O. scapulalis female 2.4. Degenerate PCR amplification and cloning moths (n ¼ 10), and whole head, thorax, and abdomen of male moths (n ¼ 10) using an RNeasy mini kit (Qiagen) with DNase Degenerate primers for the amplification of FAR genes were treatment.
Load more

Recommended publications
  • Did the Introduction of Maize Into Europe Provide Enemy-Free Space to Ostrinia Nubilalis? Parasitism Differences Between Two Sibling Species of the Genus Ostrinia
    Did the introduction of maize into Europe provide enemy-free space to Ostrinia nubilalis? Parasitism differences between two sibling species of the genus Ostrinia B. PE´ LISSIE´ * à1,S.PONSARD à,Y.S.TOKAREV§,P.AUDIOT*,C.PE´ LISSIER–, R. SABATIER*, S. MEUSNIER*, J. CHAUFAUX**, M. DELOS ,E.CAMPAN–, J. M. MALYSHàà,A.N.FROLOVàà &D.BOURGUET* *Centre de Biologie et de Gestion des Populations (CBGP) UMR INRA-IRD-CIRAD-Montpellier SupAgro, Campus International de Baillarguet, Montferrier-sur-Lez Cedex, France Universite´ de Toulouse, UPS, EDB (Laboratoire Evolution et Diversite´ Biologique), Toulouse, France àCNRS; EDB (Laboratoire Evolution et Diversite´ Biologique); Toulouse, France §Laboratory for Microbiological Control, All-Russian Institute for Plant Protection, St. Petersburg-Pushkin, Russia –Laboratoire d’Ecologie Fonctionnelle, UMR 5245 (CNRS-UPS-INPT), Universite´ P. Sabatier Toulouse III, Toulouse Cedex, France **Unite´ Ge´ne´tique Microbienne et Environnement, INRA La Minie`re, Guyancourt Cedex, France DRAF-SRPV, Cite´ Administrative Baˆt. E, Toulouse Cedex, France ààLaboratory for Phytosanitary Diagnostics and Forecasts, All-Russian Institute for Plant Protection, St. Petersburg-Pushkin, Russia Keywords: Abstract agricultural pest; We examined whether maize offers enemy-free space (EFS) to its pest Ostrinia ecological speciation; nubilalis, and may thereby have contributed to its divergence from the sibling enemy-free space; species, Ostrinia scapulalis, feeding mainly on mugwort, when introduced into Lydella thompsoni; Europe five centuries ago. We collected Ostrinia larvae on maize (70 Macrocentrus cingulum; populations, 8425 individuals) and mugwort (10 populations, 1184 individ- microsporidia; uals) and recorded parasitism using both traditional (counting emerging molecular detection; parasitoids) and molecular methods (detection by specific polymerase chain Ostrinia nubilalis; reaction).
    [Show full text]
  • Species Specificity and Intraspecific Variation in the Chemical Profiles Of
    bioRxiv preprint doi: https://doi.org/10.1101/573469; this version posted June 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Species specificity and intraspecific variation in the chemical profiles of Heliconius butterflies across a large geographic range Kathy Darragh1,2, Gabriela Montejo-Kovacevich1, Krzysztof M. Kozak2, Colin R. Morrison2,3, Clarisse M. E. Figueiredo4, Jonathan S. Ready4, Camilo Salazar5, Mauricio Linares5, Kelsey J. R. P. Byers1,2, Richard M. Merrill2,6, W. Owen McMillan2, Stefan Schulz7, Chris D. Jiggins1,2 1Department of Zoology, University of Cambridge, Cambridge, Cambridgeshire, United Kingdom 2Smithsonian Tropical Research Institute, Panama City, Panama 3Department of Integrative Biology, The University of Texas at Austin, Austin, Texas, United States 4Institute for Biological Sciences, Universidade Federal do Pará, Belém, Pará, Brazil 5Biology Program, Faculty of Natural Sciences and Mathematics, Universidad del Rosario, Bogota, Colombia 6Division of Evolutionary Biology, Faculty of Biology, Ludwig-Maximilians-Universität München, Munich, Germany 7Institute of Organic Chemistry, Technische Universität Braunschweig, Braunschweig, Germany bioRxiv preprint doi: https://doi.org/10.1101/573469; this version posted June 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Traits important for mate choice and behavioural isolation are predicted to be under strong stabilising selection within species, however such traits can also exhibit variation at the population level driven by neutral and adaptive evolutionary processes.
    [Show full text]
  • Transcriptome Analysis and Identification of Genes Involved in Moth Sex Pheromone Biosynthetic Pathways
    Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations 2019 Transcriptome analysis and identification of genes involved in moth sex pheromone biosynthetic pathways Xiaoyi Dou Iowa State University Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Entomology Commons Recommended Citation Dou, Xiaoyi, "Transcriptome analysis and identification of genes involved in moth sex pheromone biosynthetic pathways" (2019). Graduate Theses and Dissertations. 17671. https://lib.dr.iastate.edu/etd/17671 This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Transcriptome analysis and identification of genes involved in moth sex pheromone biosynthetic pathways by Xiaoyi Dou A dissertation submitted to the graduate faculty in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Major: Entomology Program of Study Committee: Russell A. Jurenka, Major Professor Ryan C. Smith Joel R. Coats Amy L. Toth Hua Bai The student author, whose presentation of the scholarship herein was approved by the program of study committee, is solely responsible for the content of this dissertation. The Graduate College will ensure this dissertation is globally accessible and will not permit alterations after a degree is conferred Iowa State University Ames, Iowa 2019 Copyright © Xiaoyi Dou, 2019. All rights reserved. ii DEDICATION This study is dedicated to my family who have been my source of inspiration and give me strength.
    [Show full text]
  • Susceptibility of Three Species of the Genus Ostrinia (Lepidoptera: Crambidae) to Nosema Pyrausta (Microsporidia: Nosematida)
    BIO Web of Conferences 21, 00040 (2020) https://doi.org/10.1051/bioconf/20202100040 XI International Scientific and Practical Conference “Biological Plant Protection is the Basis of Agroecosystems Stabilization” Susceptibility of three species of the genus Ostrinia (Lepidoptera: Crambidae) to Nosema pyrausta (Microsporidia: Nosematida) Inna Grushevaya*, Anastasia Ignatieva, and Yuri Tokarev All-Russian Institute of Plant Protection, sh. Podbelskogo 3, St. Petersburg, Pushkin 196608 Russia Abstract. Microsporidia are obligate intracellular parasites that affect the population density of many insect pests. In particular, infection with Nosema pyrausta is one of the major mortality factors for the European corn borer Ostrinia nubilalis, the Asian corn borer Ostrinia furnacalis and the adzuki bean borer Ostrinia scapulalis. The purpose of the work is to compare the susceptibility to N. pyrausta and pathogenesis of three species of moths of the genus Ostrinia. Studies conducted over 2 years have shown that in all three species of host insects under laboratory conditions, both during oral infection and transovarian transmission of infection (in the daughter generations of experimentally infected insects), only diplokaryotic spores formed corresponding to the main morphotype of the genus Nosema. Mean lethal time increased with instar of larvae used for infection but didn’t differ between the three species. The rates of transovarial transmission of N. pyrausta were also similar. Thus, all the insect species examined may equally participate in the parasite persistence in nature and serve as model laboratory hosts for parasitological research and mass propagation of the microsporidium. 1 Introduction A study of the population biology of the European corn moth Ostrinia nubilalis (Hbn., 1796), as a dangerous pest of maize, reveals regular changes in the dynamics of insect populations, indicating the formation and gradual improvement of mechanisms for regulating its numbers in agricultural ecosystems involving maize as the main crop [1].
    [Show full text]
  • Early Quality Assessment Lessens Pheromone Specificity in a Moth
    Early quality assessment lessens pheromone specificity in a moth Zsolt Kárpátia, Marco Tasinb, Ring T. Cardéc, and Teun Dekkerd,1 aDepartment of Zoology, Plant Protection Institute, Centre for Agricultural Research, Hungarian Academy of Sciences, H-1525, Budapest, Hungary; bUnit of Integrated Plant Protection and dUnit of Chemical Ecology, Swedish University of Agricultural Sciences, SE-230 53 Alnarp, Sweden; and cDepartment of Entomology, University of California, Riverside, CA 92521 Edited by John G. Hildebrand, University of Arizona, Tucson, AZ, and approved March 27, 2013 (received for review October 4, 2012) Pheromone orientation in moths is an exemplar of olfactory from activation, wing fanning, taking flight, locking onto the acuity. To avoid heterospecific mating, males respond to female- plume, and landing (7). An emergent property of studies on moth produced blends with high specificity and temporal resolution. A pheromone orientation is that blend ratios are equally important finely tuned sensory to projection neuron network secures spec- from activation to source finding (7). In line with this, it is thought ificity, and this network is thought to assess pheromone quality that males continuously assess quality during reiterative encounters continually during orientation. We tested whether male moths do with pheromone filaments in spatiotemporally dynamic plumes. indeed evaluate each pheromone encounter and surprisingly The crambid moth Ostrinia nubilalis is a species well known found that male European corn borer moths instead generalize for its narrow tuning to a binary blend of female produced (Z)- across successive encounters. Although initially highly ratio spe- 11-tetradecenyl acetate (Z11) and (E)-11-tetradecenyl acetate cific, once “locked on” to the pheromone plume the acceptable (E11) (8, 9).
    [Show full text]
  • Or How Two Maize Pests of the Genus Ostrinia
    ’Becoming a species by becoming a pest’ or how two maize pests of the genus Ostrinia possibly evolved through parallel ecological speciation events Denis Bourguet, Sergine Ponsard, Rejane Streiff, Serge Meusnier, Philippe Audiot, Jing Li, Zhen-Ying Wang To cite this version: Denis Bourguet, Sergine Ponsard, Rejane Streiff, Serge Meusnier, Philippe Audiot, et al.. ’Becom- ing a species by becoming a pest’ or how two maize pests of the genus Ostrinia possibly evolved through parallel ecological speciation events. Molecular Ecology, Wiley, 2014, 23 (2), pp.325-342. 10.1111/mec.12608. hal-01837253 HAL Id: hal-01837253 https://hal.archives-ouvertes.fr/hal-01837253 Submitted on 12 Aug 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ‘Becoming a species by becoming a pest’ or how two maize pests of the genus Ostrinia possibly evolved through parallel ecological speciation events DENIS BOURGUET,* SERGINE PONSARD,†‡§¶ REJANE STREIFF,* SERGE MEUSNIER,* PHILIPPE AUDIOT,* JING LI†‡§** and ZHEN-YING WANG§ *Centre de Biologie pour la Gestion des Populations
    [Show full text]
  • This Is the Peer Reviewed Version of the Following Article: Aizpurua O, Budinski I, Georgiakakis P, Gopalakrishnan S, Ibañez C
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Digital Repository of Archived Publications - Institute for Biological Research Sinisa... This is the peer reviewed version of the following article: Aizpurua O, Budinski I, Georgiakakis P, Gopalakrishnan S, Ibañez C, Mata V, Rebelo H, Russo D, Szodoray-Parádi F, Zhelyazkova V, Zrncic V, Gilbert MTP, Alberdi A. Agriculture shapes the trophic niche of a bat preying on multiple pest arthropods across Europe: Evidence from DNA metabarcoding. Mol Ecol. 2018, which has been published in final form at https:doi.org/10.1111/mec.14474. This article may be used for non-commercial purposes in accordance with Wiley Terms and Conditions for Self-Archiving. Received: 23 August 2017 | Revised: 6 November 2017 | Accepted: 8 December 2017 DOI: 10.1111/mec.14474 ORIGINAL ARTICLE Agriculture shapes the trophic niche of a bat preying on multiple pest arthropods across Europe: Evidence from DNA metabarcoding Ostaizka Aizpurua1 | Ivana Budinski2 | Panagiotis Georgiakakis3 | Shyam Gopalakrishnan1 | Carlos Ibanez~ 4 | Vanessa Mata5 | Hugo Rebelo5 | Danilo Russo6 | Farkas Szodoray-Paradi 7 | Violeta Zhelyazkova8 | Vida Zrncic9 | M. Thomas P. Gilbert1,10 | Antton Alberdi1 1Section for Evolutionary Genomics, Natural History Museum of Denmark, Abstract University of Copenhagen, Copenhagen, The interaction between agricultural production and wildlife can shape, and even Denmark condition, the functioning of both systems. In this study, we i) explored the degree 2Department of Genetic Research, Institute for Biological Research “Sinisa Stankovic”, to which a widespread European bat, namely the common bent-wing bat Min- University of Belgrade, Belgrade, Serbia iopterus schreibersii, consumes crop-damaging insects at a continental scale, and ii) 3Department of Biology School of Sciences and Engineering, University of Crete, tested whether its dietary niche is shaped by the extension and type of agricultural Irakleio, Greece fields.
    [Show full text]
  • Wolbachia Infections in Aedes Aegypti Differ Markedly in Their Response to Cyclical Heat Stress
    bioRxiv preprint doi: https://doi.org/10.1101/073106; this version posted September 4, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Wolbachia infections in Aedes aegypti differ markedly in their response to cyclical heat stress Perran A. Ross1*, Itsanun Wiwatanaratanabutr1,2, Jason K. Axford1, Vanessa L. White1, Nancy M. Endersby-Harshman1 and Ary A. Hoffmann1 1Pest and Environmental Adaptation Research Group, Bio21 Institute and the School of BioSciences, The University of Melbourne, Parkville, Victoria, Australia 2Department of Plant Production Technology, Faculty of Agricultural Technology, King Mongkut's Institute of Technology Ladkrabang, Bangkok 10520, Thailand *Corresponding author bioRxiv preprint doi: https://doi.org/10.1101/073106; this version posted September 4, 2016. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Abstract Aedes aegypti mosquitoes infected with Wolbachia bacteria are currently being released for arbovirus suppression around the world. Their potential to invade populations and persist will depend on interactions with environmental conditions, particularly as larvae are often exposed to fluctuating and extreme temperatures in the field. We reared Ae. aegypti larvae infected with different types of Wolbachia (wMel, wAlbB and wMelPop) under diurnal cyclical temperatures. Rearing wMel and wMelPop-infected larvae at 26-37°C reduced the expression of cytoplasmic incompatibility, a reproductive manipulation induced by Wolbachia.
    [Show full text]
  • Managing Resistance to Bt Crops in a Genetically Variable Insect Herbivore, Ostrinia Nubilalis
    Ecological Applications, 20(5), 2010, pp. 1228–1236 Ó 2010 by the Ecological Society of America Managing resistance to Bt crops in a genetically variable insect herbivore, Ostrinia nubilalis 1,4 2 3 MEGAN E. O’ROURKE, THOMAS W. SAPPINGTON, AND SHELBY J. FLEISCHER 1Department of Ecology and Evolutionary Biology, Cornell University, Corson Hall, E149, Ithaca, New York 14853 USA 2USDA Agricultural Research Service, Corn Insects and Crop Genetics Research Unit, Genetics Laboratory, Iowa State University, Ames, Iowa 50011 USA 3501 ASI Building, Department of Entomology, Pennsylvania State University, University Park, Pennsylvania 16802 USA Abstract. To slow the resistance evolution of the European corn borer (ECB) to Cry proteins expressed in transgenic Bacillus thuringensis (Bt) corn, the United States Environmental Protection Agency (EPA) has adopted an insect resistance management (IRM) plan that relies on a ‘‘high dose/refuge’’ strategy. However, this IRM plan does not consider possible ecological differences between the two ECB pheromone races (E and Z). Using carbon isotope analysis, we found that unstructured (non-corn) refuges contribute more to E race (18%) than to Z race (4%) populations of ECB in upstate New York (USA). Furthermore, feeding on non-corn hosts is associated with decreased body mass and reduced fecundity. We also show that the geographic range of E-race ECB is restricted within the range of the Z race and that E-race ECB are increasingly dominant in regions with increasing non- corn habitat. While the proportion of E-race ECB developing in unstructured refuges is higher than previously assumed, low rates of unstructured refuge use by the Z race, evidence for reduced fecundity when reared on non-corn hosts, and complete sympatry within the E race range all argue against a relaxation of current IRM refuge standards in corn based on alternative-host use.
    [Show full text]
  • Sex Chromosomes and Sex Determination in Lepidoptera
    Review Article Sex Dev 2008;1:332–346 Received: September 25, 2007 DOI: 10.1159/000111765 Accepted: October 24, 2007 Sex Chromosomes and Sex Determination in Lepidoptera a b c W. Traut K. Sahara F. Marec a Universität Lübeck, Zentrum für Medizinische Strukturbiologie, Institut für Biologie, Lübeck, Germany; b Laboratory of Applied Molecular Entomology, Research Institute of Agriculture, Hokkaido University, c Sapporo , Japan; Biology Centre ASCR, Institute of Entomology and Faculty of Science, University of South Bohemia, České Budĕjovice , Czech Republic Key Words heterochromatic body which grows with increasing degree Balanced lethal ؒ Butterfly ؒ Evolution ؒ Intersex ؒ of polyploidy in somatic cells. It is used as a marker for the .Moth ؒ Sex chromatin ؒ Sex-determining pathway ؒ genetic sex in studies of intersexes and Wolbachia infections -W chromosome ؒ Wolbachia The sex chromosome system is being exploited in economi cally important species. Special strains have been devised for mass rearing of male-only broods in the silkworm for Abstract higher silk production and in pest species for the release of The speciose insect order Lepidoptera (moths and butter- sterile males in pest management programs. flies) and their closest relatives, Trichoptera (caddis flies), Copyright © 2008 S. Karger AG, Basel share a female-heterogametic sex chromosome system. Originally a Z/ZZ (female/male) system, it evolved by chro- mosome rearrangement to a WZ/ZZ (female/male) system in Sex chromosomes stand out from the rest of the chro- the most species-rich branch of Lepidoptera, a monophy- mosome complement by being structurally different, letic group consisting of Ditrysia and Tischeriina, which having a different behaviour in meiosis, sometimes being together comprise more than 98% of all species.
    [Show full text]
  • New WGS Data and Annotation of the Heterosomal Vs. Autosomal Localization of Ostrinia Scapulalis (Lepidoptera, Crambidae) Nuclear Genomic Scaffolds
    Data in Brief 20 (2018) 644–648 Contents lists available at ScienceDirect Data in Brief journal homepage: www.elsevier.com/locate/dib Data Article New WGS data and annotation of the heterosomal vs. autosomal localization of Ostrinia scapulalis (Lepidoptera, Crambidae) nuclear genomic scaffolds Louise Brousseau a,b,n, Sabine Nidelet a, Réjane Streiff a a CBGP, INRA, CIRAD, IRD, Montpellier SupAgro, Univ Montpellier, Montpellier, France b IRD, UMR DIADE Diversité - Adaptation - Développement, 911 Avenue Agropolis, BP64501, 34394 Mon- tpellier, France article info abstract Article history: Here, we introduce new whole-genome shotgun sequencing and Received 7 May 2018 annotation data describing the autosomal vs. Z-heterosomal locali- Received in revised form zation of nuclear genomic scaffolds of the moth species Ostrinia 9 July 2018 scapulalis. Four WGS libraries (corresponding to 2 males and Accepted 3 August 2018 2 females) were sequenced with an Illumina HiSeq2500 sequencing Available online 9 August 2018 technology, and the so-called ‘AD-ratio’ method was applied to dis- Keywords: tinguish between autosomal and Z-heterosomal scaffolds based on Ostrinia scapulalis sequencing depth comparisons between homogametic (male) and Genome heterogametic (female) libraries. A total of 25,760 scaffolds (corre- NGS sponding to 341.69 Mb) were labelled as autosomal and 1273 scaf- HiSeq2500 Depth analysis folds (15.29 Mb) were labelled as Z-heterosomal, totaling about AD-ratio 357 Mb. Besides, 4874 scaffolds (29.07 Mb) remain ambiguous Structural annotation because of a lack of AD-ratio reproducibility between the two repli- Sex-chromosome cates. The annotation method was evaluated a posteriori,bycom- Z-heterosome paring depth-based annotation with the exact localization of known Autosomes genes.
    [Show full text]
  • Terminal Investment in the Gustatory Appeal of Nuptial Food Gifts in Crickets
    doi: 10.1111/jeb.12703 Terminal investment in the gustatory appeal of nuptial food gifts in crickets K. R. DUFFIELD*, J. HUNT†, J. RAPKIN†,B.M.SADD*&S.K.SAKALUK* *Behavior, Ecology, Evolution & Systematics Section, School of Biological Sciences, Illinois State University, Normal, IL, USA †Center for Ecology & Conservation, College of Life and Environmental Sciences, University of Exeter, Penryn, UK Keywords: Abstract life-history theory; Investment in current versus future reproduction represents a prominent nuptial food gift; trade-off in life-history theory and is likely dependent on an individual’s life reproductive effort; expectancy. The terminal investment hypothesis posits that a reduction in spermatophylax; residual reproductive value (i.e. potential for future offspring) will result in terminal investment. increased investment in current reproduction. We tested the hypothesis that male decorated crickets (Gryllodes sigillatus), when cued to their impending mortality, should increase their reproductive effort by altering the composi- tion of their nuptial food gifts (i.e. spermatophylaxes) to increase their gusta- tory appeal to females. Using a repeated-measures design, we analysed the amino acid composition of spermatophylaxes derived from males both before and after injection of either a saline control or a solution of heat-killed bacte- ria. The latter, although nonpathogenic, represents an immune challenge that may signal an impending survival threat. One principal component explaining amino acid variation in spermatophylaxes, characterized by a high loading to histidine, was significantly lower in immune-challenged versus control males. The relevance of this difference for the gustatory appeal of gifts to females was assessed by mapping spermatophylax composition onto a fitness surface derived in an earlier study identifying the amino acid composition of sper- matophylaxes preferred by females.
    [Show full text]