104, Bull. Eur. Ass. Fish Pathol., 35(3) 2015
ȱȱ scuticociliatosis in cultured common dentex (Dentex dentex) in Turkey
E. Turgay1*, T. M. Steinum2ǰȱǯȱǯȱ û3ȱȱǯȱ ó1
1Istanbul University, Faculty of Fisheries, 34134, Fatih, Istanbul, Turkey; 2Istanbul University, Faculty of Science, Molecular Biology and Genetics Department, 34134, Fatih, Istanbul, Turkey; 3Dr. Lutę Kirdar Kartal Education and Research ospital, Department of Pathology, 34890, Kartal, Istanbul, Turkey
Abstract In this study, Miamiensis avidus (syn. Philasterides dicentrarchi) ȱęȱ¢ȱȱȱȱ ȱȱȱȱȱȱȱȱȱȱȱ¡ȱǻDentex dentex). ȱȱȱȱ¢ȱ ȱȱ ȱȱ ȱŗŞȱķȱȱȱȱęȱȱ ȱȱȱȱȱ¢ǯȱȱȱȱȱ¡ȱȱǻŗŖȬŗśȱ ȱȱ Ǽȱ ȱȱȱȱȱȱȱȱ¢ȱȱ¡ǯȱȱȱ ȱȱȱȱęȱȱȱȱȱ¢ȱǰȱȱęȱȱ- ȱȱǰȱȱȱȱĚȱȱȱȱ¢ȱȱȱȱ distended abdominal cavity and an enlarged spleen. Light microscopic examination revealed that ȱȱȱȱęȱ ȱ¢ȱȱ ȱȬǰȱ¢ȱȱǰȱȱ ȱ some encompassed multiple erythrocytes in their cytoplasm, when observed HE-stained histologi- ȱǯȱȱȱ ȱęȱȱMiamiensis avidus by both partial 18S ribosomal RNA (18S rRNA) and cytochrome c oxidase subunit I (COX1) genes sequence analysis, while morphological characterisation was not done. In addition, Vibrioȱǯȱ ȱȱȱȱȱȱęȱȱ ęǰȱ ȱȱ ȱȱȱ¢ȱȱȱ¢ȱȬȱȱȱęȱ ȱ- ǯȱȱȱ ǰȱȱȱȱęȱȱȱȱȱ¢ȱMiamiensis avidus in cultured common dentex.
Introduction ȱȱȱȱ¢ȱȱȱȱ ǰȱȱęȱȱȱȱȱ ȱȱȱȱȱȱ¢ȱȱ ȱȱȱȱȱ ȱę- ȱȱȱ¢ȱȱȱ ȱ cant economic consequences to aquaculture ȱȱęȱǰȱȱȱ worldwide (Scholz, 1999; Piazzon et al., 2013). ȱěȱȱȱȱȱę- ȱǰȱ ȱȱȱȱęȱ ¢ȱȱȱȱęȱȱȱȱ comprise Philasterides dicentrarchiȱȱȱ ȱȱȱȱǰȱȱ sea bass (Dicentrarchus labrax) (Dragesco et al., restriction, overcrowding and nutritional de- 1995), turbot (Scophthalmus maximus) (Iglesias ę¢ȱǻ£ǰȱŗşşşDzȱǰȱŘŖŖŝǼǯȱ et al., 2001), seadragons (Phycodurus eques and Phyllopteryx taeniolatus) (Umehara et al., 2003; Free-living scuticociliates (Protozoa, Ciliophora, ȱȱǯǰȱŘŖŖŞǼȱȱȦ ȱ Ǽȱ¢ȱȱȱȱ- ĚȱǻParalichthys olivaceus) (Kim et al.,
ȘȱȱȂȱȬDZȱ¢ȓǯǯ Bull. Eur. Ass. Fish Pathol., 35(3) 2015, 105
ŘŖŖŚǼǯȱ ȱǰȱȱ¢ȱMiamiensis ȱ ȱȱ ȱȱȱȱ avidus were recorded in the seahorse ( ippo- reaching to the indoor tanks. No recirculated campus erectus) (Thompson and Moewus, 1964), ȱ ȱȱȱȱ¢ǯȱȱȱ ȱ ȱĚȱǻParalichthys olivaceus) (Jung et ȱȱ¡ȱęȱȱȱȱęȱ ǯǰȱŘŖŖŝDzȱȱȱǯǰȱŘŖŗŖǼǰȱȱȱ ȱ ȱȱȱȱ ȱ¢ǯȱȱęȱ ȱ Zealand groper (Polyprion oxygeneios) (Salinas et ȱȱ¢ȱȱŘśȱȦ3. The al., 2012), as well as Pseudocohnilembus persalinus water temperature was 18 ºC, salinity was 30‰ ȱȱȱĚȱǻ ȱȱǯǰȱŘŖŖŚǼȱȱ ȱȱȱ¢ȱ ȱȱŗƖǯ rainbow trout (Oncorhynchus mykiss) (Jones et al., 2010). Finally, scuticociliatosis was recorded ooȱofȱ ȱȱȱȱęȱȱǻThunnus mac- ȱȱȱȱ¡ȱ coyii) (Munday et al., 1997) caused by Uronema ȱǻŗŖȬŗśȱȱȱ Ǽȱ ȱȱȱ nigricansȱȱȱȱȱęȱȱȱ ȱȱȱȱȱ¢ȱȱ¡- in an aquarium (Cheung et al., 1980) and olive ȱȱȱ ǯȱȱ¢ȱȱ Ěȱǻ ȱȱǯǰȱŘŖŖŗǼȱȱ¢ȱU. marinum. ǰȱęȱ ȱ£ȱ ȱȱ- ȱȱŘȬ¡¢ȱǻǼǯ In this study, Miamiensis avidus (syn. Philaste- rides dicentrarchi) ȱęȱ¢ȱȱ ȱ¡ȱȱȱȱęȱ ȱ ȱȱȱȱȱȱȱȱ carried out under a light microscope (Olympus disease outbreak in cultured common dentex ŘŗǼȱ¢ȱȱȱȱȱ (Dentex dentex) which occured in a commercial ȱȱȱȱǯȱ ǰȱ ęȱȱȱȱȱȱȱ¢ǯȱ gill, skin, liver, spleen and muscle tissue samples ȱȱ ǰȱȱȱȱęȱȱȱ ȱȱ ȱȱȱȱȱȱȱ scuticociliatosis caused by M. avidus in cultured ę¡ȱȱȱȱȱȱ¢ǯȱ common dentex. ȱȱ ȱȱę¡ȱȱŗŖƖȱȬ ěȱǰȱȱȱȱ- Materials and methods ȱȱĜȱ ¡ȱȱȱȱȱ The present study was approved by Istanbul 5 μm by standard methodology. These tissue ¢ȱȱĴȱȱȱ- sections were stained with hematoxylin and ȱȱǻȱDZȱŘŖŗŘȦŗŗřǼǯ ȱǻ Ǽȱȱ¡ȱ¢ȱȱ histological changes. ȱo¢ The scuticociliatosis outbreak occurred during ȱȱȱ¡ȱ ȱ May 2013 in a commercial hatchery located in ȱȱȱȱǻǰȱȱȱ ȱȱȱ¢ǯȱȱ - kidney) and streaked onto Marine Agar 2216 ȱ ȱȱȱ ȱȱȱȱ¢ȱ ǻǼȱȱȱǯȱȱȱ ȱȱĚ Ȭȱ¢ǯȱ ȱ ȱ ȱȱȱŘŘȱķȱȱŚŞȬŝŘȱȱȱȱ ęȱȱȱȱĴȱǰȱȱȱ- ȱȱȱȱ¢ȱȱ ȱ ȱ ȱȱę¢ȱȱȱȱ selected and re-streaked onto the same media ęȱ¢ȱȱȱǯȱȱ to obtain pure cultures. 106, Bull. Eur. Ass. Fish Pathol., 35(3) 2015
ȱ¡o primer set (Suau et al., 1999). The primers used The isolates on Marine Agar 2216 plates were in this study are given in Table 1. ȱȱȱȱŘŘŗŜȱǻǼȱȱ- ȱȱȱŘŘǚȱȱȱȱǯȱ ȱ ȱ ¡ȱ ȱ ȱ ȱ śŖȱ ΐȱ ȱȱ ȱ¡ȱȱȱȱȱ volume, included approximately 50 ng template ¢ȱȱȱę¡ȱȱȱȱ ǰȱŖǯŚȱΐȱȱȱǰȱȱȱ¡ȱ
PureLink™ Genomic DNA Mini Kit (Invitrogen) containing 4mM MgCl2 ǻȱęǼȱȱ ȱȱȱȂȱǯ Ȭȱ ȱǻȱęǼǯȱ- ęȱ ȱȱȱȱȱ¢ȱ ȱęoȱȱȱ¢ (Biometra, TPersonal) using programs with the Primer selection was based on the presumptive ȱDZȱȱȱȱ ęȱȱȱȱȱȱ şśǚȱȱřȱǰȱ ȱ¢ȱřŖȱ¢ȱǻȱŗŜǼȱ ȱȱȱȱȱȱěȱęǯȱ ȱřśȱ¢ȱǻȱCOX1ȱȱŗŞǼȱȱęȱ ȱȬęȱȱȱȱȱŗŞȱ ǻȱȱşśǚȱȱřŖȱǰȱȱȱśŜǚȱ ȱȱȱŜŞŚȱȱǻȱȱǯǰȱŘŖŖŞǼȱȱ ȱŗȱǰȱ¡ȱȱŝŘǚȱȱŗȱǼȱȱȱ ¢ȱȱȬęȱȱ ęȱ¡ȱȱȱŝŘǚȱȱŚȱǯ sets targeting the mitochondrially encoded cytochrome c oxidase subunit I (COX1) locus ¢ǰȱȱȱ ȱȱȱ ȱŚŘřȱȱ ȱȱǻȱȱǯǰȱŘŖŗřǼǯȱȱ ȱȱ£ǰȱȱ- ȱęǰȱȱ¡¢ȱśŚŖȱȱ ȱȱȱŗǯśƖȱȱȱȱȱ ȱȱȱȱŗŜȱȱȱ ȱ- ȱǻŖǯśȱȦǼȱȱ£ȱȱȱȱ ęȱȱȱȱȱȱȱ transilluminator.
Table 1. Primers used in this study.
Primer Sequence 5`- 3` Gene - Organism 384F a YTB GAT GGT AGT GTA TTG GA ŗŞȱȬȱȬę 1147R a GAC GGT ATC TRA TCG TCT TT ŗŞȱȬȱȬę OX09-142 b AGTAATAATAGAACATTTAACGAATTTAATAACAC COX1 - M. avidus OX09-143 b CGTCTTGTAATTAATAAATTTGTAAACGATAC COX1 - M. avidus OX09-144 b AACATAGAGCATATAGAGAGTACTCTAA COX1 - U. marinum OX09-145 b TTCATCCAGCTGTTGTTAATGT COX1 - U. marinum OX09-146 b TAAATCTAATCATCGTAATAATAGAGAATTGTTAG COX1 - P. persalinus OX09-147 b CTTATCGATACGACTAACTGCAT COX1 - P. persalinus OX09-148 b AAATCAAATCATAGAAATAATAGAGAATTTTTAAATG COX1 - P. longisetus OX09-149 b GCTCCAACACCAGTATATTTAATG COX1 - P. longisetus S-D-Bact-0008-a-S-20 c AGA GTT TGA TCC TGG CTC AG 16S - domain Bacteria S-*-Univ-0536-a-A-18 c GWA TTA CCG CGG CKG CTG Universal a: Dopheide et al., 2008, b: Whang et al., 2013, c: Suau et al., 1999. Bull. Eur. Ass. Fish Pathol., 35(3) 2015, 107
PCR products (one COX1, one 18S rRNA and but were also observed in the skeletal muscle ęȱŗŜȱǼȱ ȱęȱȱȱ and the gill, congruent to other reports (Iglesias bidirectionally by BM Labosis (Ankara, Turkey). et al., 2001; Umehara et al., 2003; Rossteuscher ȱȱȱ¢ȱ ȱȱ et al., 2008). The ciliate population was much in Bioedit v7.0.0 (Hall, 1999) using the ClustalX ȱȱȱȱȱȱȱȱȱȱ¡- 2.1 (Larkin et al., 2007) and BLASTN 2.2.20 ȱęȱȱȱȱȱȱȱ algorithm (Zhang et al., 2000). ȱȱȱȱ¢ǯȱ ǰȱ the parasite was not observed in any other inter- Results and discussion nal organ, as observed by Iglesias et al. (2001), Skin lesions have been reported as the most Umehara et al. (2003), Jung et al. (2007), and ȱęȱȱȱȱ Rossteuscher et al. (2008). In addition, no para- (Iglesias et al., 2001; Umehara et al., 2003; Jung ȱ ȱȱȱȱȱĚǯ ȱǯǰȱŘŖŖŝDzȱȱȱǯǰȱŘŖŖŞDzȱȱ et al., 2010). In accordance with these reports, ȱ Ȭȱȱǰȱȱȱȱ- ȱȱȱ¢ȱǰȱȱ ates were also seen encompassing multiple ęȱȱȱȱǰȱȱȱ erythrocytes in their cytoplasm (Figure 2a, ȱ ȱȱ¡ȱęȱȱȱęȱ ȱŘǼȱ ȱȱȱ¢ȱȱȱ sampled in this study. In some individuals hem- this parasite (Dragesco et al., 1995; Iglesias et al., orrhaging was also observed around the vent 2001; Jung et al., 2007; Rossteuscher et al., 2008). and in the ocular region, while some individuals had also erosions on the cranial region (Figure ¢ȱȱȱȱȱȱ ȱ- 1). In contrast to previous publications, abnor- ęȱȱȱȬęȱȱǰȱȱ mal swimming behaviour (Iglesias et al., 2001; similarly, skin-extracted DNA showed positive ȱȱǯǰȱŘŖŖŞDzȱȱȱǯǰȱŘŖŗŖǼȱ ęȱȱMiamiensis avidusȬęȱ ȱȱȱȱȱȱȱęǯ primers. According to 18S rRNA and COX1 ȱȱ¢ȱȱȱ ȱȱ ȱ¡ȱȱȱȱȱȱ sequences deposited in the GenBank data- ěȱęǰȱȱ¢ȱ ȱȱ base under accession number KP170493 and ȱȱȱĚȱȱȱ¢ȱ ȱȱ ŗŝŖŚşŚǰȱȱȱ ȱęȱȱMiamien- al. (2001) and Umehara et al. (2003). We also sis avidus (syn. Philasterides dicentrarchi). The top observed that the liver was hyperaemic and that ŗŚȱȱȱȱŗŞȱȱȱ ȱ ȱȱ ȱǯȱ ȱ ȱǰȱȱ all previously mentioned scuticociliate with ȱ ȱȱȦȱȱȱ şşȱȬȱŗŖŖƖȱȱ¢ǰȱȱ- ȱ ȱȱ¢ ȱĚǯ ously published M. avidus sequences obtained ȱȱȱȱęȱǻ şŗŚŜŜśǰȱ ȱ¡ȱȱ ȱȱȱ JN689230, EU831196, AY550080) and seahorse histological sections revealed that ovoid shaped, (GU572375). Subsequent 18S rRNA matches highly motile ciliates with a rounded posterior ȱǂȱşŜƖȱȱ¢ȱȱȱ ȱ ȱȱ¢ȱȱȱDzȱ related scuticociliates. For the COX1 gene se- epidermis, dermis and underlying muscle tissue quence, the 23 best matches were also M. avidus 108, Bull. Eur. Ass. Fish Pathol., 35(3) 2015
Figure 1. ¡ȱęȱȱȱȱȱȱ¡ȱȱȱȱ ȱȱęȱȱȱȱȱȱęȱȱȱȱ ȱȱȱǻǼǯ
a b
Figure 2. Ȭȱȱȱȱȱ¡ȱȱ ȱǻǼȱȱȱȱȱ ȱȱǻ ǼȱȱǻǼȱȱȱȱȱ¢ȱȱȱȱǻ ǼǯȱǻDZȱśȱΐǼǯ Bull. Eur. Ass. Fish Pathol., 35(3) 2015, 109
ȱȱ ȱşŚȱȬȱşşƖȱȱ- Common dentex is a highly sensitive species ¢ȱȱȱȱȱȱ ȱȱȱȱȬȱȱ ȱȱȱȱȱęȱǻŞřŗŘŘŜǰȱ so stress-related high mortalities may be ex- ŞśśřŖŖǼǯȱȱ ȱȱȱȱ pected in common dentex culture (Tibaldi et scuticociliates (e.g. U. marinumǼȱ ȱ¢ȱǂȱ al., 1996; Rigos et al., 1998). Although various ŞřƖǯȱ¢ȱŖşȬŗŚŘȱȱŖşȬŗŚřȱȬ chemotherapeutics (Iglesias et al., 2002; Quin- ęȱȱǰȱȱȱ- tela et al., 2003) and susbstances (Salinas et al., ally encoded cytochrome c oxidase subunit I 2012) have been used to treat or improve the (COX1) gene, produced a band approximately protection against scuticociliatosis, there is no ŚŘŖȱȱȱȱȱ¡ȱȱM. avidus. ěȱȱȱȱȱȱȱ ǯȱǰȱȱȱȱ ȱȱȱęȱȱȱ ȱȱ such as reducing the environmental stress which ȱȱȱȱęȱęȱǯȱȱ ¢ȱȱȱ¢ȱȱȱȱȱ isolates showed the same characteristics (Gram ȱȱǰȱȱ¢ȱȱȱȱȱ negative, curved-rod shaped, motile bacterial ȱȱǯ cells) under light microscopy and being cy- ȱ¡ȱȱȱǯȱ According to 16S rRNA gene sequence analysis, ȱ¢ȱ ȱȱ¢ȱȱęȱ ȱęȱȱǻ Ȭ Řŗǰȱ Ȭ ŘŘǰȱ Ȭ ȱȱȱȱȱ¢ȱ Řřǰȱ Ȭ ŘŚǰȱ Ȭ ŘśǼȱ ȱęȱ ǻtG Ǽȱ ȱDZȱŗŗŘşŗŝǯ as Vibrio sp. and their corresponding sequences were deposited in the GenBank database under References ȱȱ ŗŝŖŚşśȬşǯȱȱęȱŗŜȱ Barber I (2007). Parasites, behaviour and ȱȱęǯȱApplied Animal Behaviour ȱȱ ȱşşǯŖƖȱ¢ȱȱ Science. 104ǰȱŘśŗȮŘŜŚǯ Vibrioȱǯȱȱȱȱȱ Cheung PJ, Nigrelli RF, and Ruggieri GD (1980). sources (DQ314530, DQ923441, AY174868, ȱȱȱ¢ȱȱUronema GU569097). Altough two more housekeeping marinum Dujardin (Ciliatea: Uronematidae) genes (rpoD and gyrBǼȱ ȱęȱȱ- ȱȱȱȱȱ¢ȱȱ quenced (data not shown), the Vibrio sp. isolates ȱȱȱȱęǯȱJournal of Fish Diseases 3, 295-303. ȱȱȱęȱȱȱȱǯ ȱǰȱȱ ǰȱĴȱȱȱ ȱ ȱ ǻŘŖŖŞǼǯȱȱ£ȱȱȱ In this work, M. avidus (syn. Philasterides di- ¢ȱȱȱęǯȱApplied and centrarchiǼȱ ȱęȱȱȱȱȱ Environmental Microbiology 74, 1740-1747. ȱȱȱȱȱȱȱ Dragesco A, Dragesco J, Coste F, Gasc C, common dentex (Dentex dentex). Additionally, Romestand B, Raymond J-C and Bouix Vibrioȱǯȱ ȱȱȱȱȱȱęȱ G (1995). Philasterides dicentrarchi, n. ȱęǰȱ ȱȱ ȱȱȱ sp., (Ciliophora, Scuticociliatida), a ȱȱȱȱ ¢ȱȱȱ¢ȱȬȱȱȱ Dicentrarchus labrax (Linnaeus, 1758), a ęȱ ȱěǯ ȱ ȱ ęǯȱ European Journal of 110, Bull. Eur. Ass. Fish Pathol., 35(3) 2015
Protistology 31, 327-340. Paralichthys olivaceus. Diseases of Aquatic Organisms 62, 239-244. ȱ ȱ ǻŗşşşǼǯȱ DZȱ ȱ Ȭ¢ȱ biological sequence alignment editor and Larkin MA, Blackshields G, Brown NP, ¢ȱȱȱ ȱşśȦşŞȦǯȱ ȱǰȱ Ĵȱǰȱȱ ǰȱ Nucleic Acids Symposium Series 41, 95-98. Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ and Higgins DG Iglesias R, Paramá A, Álvarez MF, Leiro J (2007). Clustal W and Clustal X version 2.0. and Sanmartín ML (2002). Antiprotozoals Bioinformatics 23, 2947-2948. ěȱȱȱȱȱȱ ęȱ ȱ Philasterides dicentrarchi. ȱǰȱȱǰȱȱǰȱȱȱ Diseases of Aquatic Organisms 49, 191-197. and Shimada A (2010). Pathological study ȱȱȱěȱȱ Iglesias R, Paramá A, Alvarez MF, Leiro J, ȱĚȱǻParalichthys olivaceus) in Fernández J and Sanmartín ML (2001). Japan. Journal of Veterinary Medical Science Philasterides dicentrarchi (Ciliophora, 72, 1359-1362. Scuticociliatida) as the causative agent ȱ ȱ ȱ ȱ ȱ ¢ȱǰȱȂȱ ǰȱĴȱǰȱȱ ȱ Scophthalmus maximus in Galicia (NW ȱ ȱȱǻŗşşŝǼǯȱȱȱ Spain). Diseases of Aquatic Organisms 46, due to the scuticociliate Uronema nigricans 47-55. ȱȬǰȱȱęȱȱThunnus maccoyii. Diseases of Aquatic Organisms 30, Jee B-Y, Kim Y-C and Park MS (2001). 17-25. ¢ȱ ȱ ¢ȱ ȱ ȱ ȱȱȱȱȱ Piazzon MC, Leiro J and Lamas J (2013). ȱĚȱParalichthys olivaceus. Diseases Fish immunity to scuticociliate parasites. of Aquatic Organisms 47, 49-55. Developmental & Comparative Immunology 41ǰȱŘŚŞȮŘśŜǯ Jones SRM, Prosperi-Porta G and LaPatra SE ǻŘŖŗŖǼǯȱȱ ȱȱPseudocohnilembus Quintela JM, Peinador C, Gonzalez L, Iglesias persalinus (Ciliophora: Scuticociliatida) R, Parama A, Alvarez F and Sanmartin ML, From Freshwater-Reared Rainbow Trout, Riguera R (2003). Piperazine N-substituted Oncorhynchus mykiss. Journal of Parasitology naphthyridines, pyridothienopyrimidines 96, 1014-1016. and pyridothienotriazines: new antiprotozoals active against Philasterides Jung S-J, Kitamura S-I, Song J-Y and Oh M-J dicentrarchi. European Journal of Medicinal (2007). Miamiensis avidus (Ciliophora: Chemistry 38, 265-275. Ǽȱȱ¢ȱȱȱ ȱĚȱParalichthys olivaceus and is a Rigos G, Grigorakis K, Nengas I, ȱ¢¢ȱȱPhilasterides dicentrarchi. Christophilogiannis P, Yiagnisi M, Diseases of Aquatic Organisms 73, 227-234. Koutsodimou M, Andriopoulou A and Alexis M (1998). Stress-related pathology Kim SM, Cho JB, Kim SK, Nam YK and Kim ȱȱęȱȱȱȱȱ
ȱǻŘŖŖŚǼǯȱȱȱȱ ȱȱȱ¡ǰȱDentex dentex ȱ ȱ Ěȱ Paralichthys olivaceus (Linnaeus 1758). Bulletin of the European by Phiasterides dicentrarchi (Ciliophora: Association of Fish Pathologists 18, 15-18. Scuticociliatida). Diseases of Aquatic Organisms 62, 233-238. Rossteuscher S, Wenker C, Jermann T, Wahli T, Oldenberg E and Schmidt-Posthaus H Kim SM, Cho JB, Lee EH, Kwon SR, Kim (2008). Severe scuticociliate (Philasterides SK, Nam YK and Kim KH (2004b). dicentrarchiǼȱȱȱȱȱȱȱ Pseudocohnilembus persalinus (Ciliophora: dragons (Phycodurus eques and Phyllopteryx Scuticociitida) is an additional species taeniolatus). Veterinary Pathology 45, 546-550. ȱȱȱȱĚȱ Bull. Eur. Ass. Fish Pathol., 35(3) 2015, 111
Salinas I, Anderson SA, Wright J and Webb VL (2012). In vivo innate immune responses ȱȱǻPolyprion oxygeneios) against Miamiensis avidusȱȱȱȱȱ ȱ ȱ¢ȱȱȱ administration. Fish & Shellęsh Immunology 32, 8-15. £ȱȱǻŗşşşǼǯȱȱȱȱȱȱ ęǯȱVeterinary Parasitology 84ǰȱřŗŝȮřřśǯ Suau A, Bonnet R, Sutren M, Godon J-J, Gibson GR, Collins MD, Dore J (1999). Direct ¢ȱȱ ȱȱŗŜȱȱ ȱ¡ȱȱȱ¢ȱ Novel Molecular Species within the Human Gut. Applied and Environmental Microbiology 65, 4799-4807. Thompson JCJ and Moewus L (1964). Miamiensis avidus n. g., n. sp., a Marine Facultative Parasite in the Ciliate Order Hymenostomatida. Journal of Protozoology 11, 378-381. Tibaldi E, Beraldo P, Volpelli LA and Pinosa M ǻŗşşŜǼǯȱ ȱȱȱȱ¡ȱ (Dentex dentex L.) to varying protein level and protein to lipid ratio in practical diets. Aquaculture 139, 91-99. Umehara A, Kosuga Y and Hirose H (2003). ȱȱȱȱ ¢ȱȱ dragon Phyllopteryx taeniolatus. Parasitology International 52, 165-168. Whang I, Kang H-S and Lee J (2013). ȱ ȱ ȱ (Pseudocohnilembus persalinus, P. longisetus, Uronema marinum and Miamiensis avidus) based on the cox1 sequence. Parasitology International 62, 7-13. ȱ ǰȱ ĵȱǰȱȱȱȱȱȱ ǻŘŖŖŖǼǯȱȱ¢ȱȱȱȱ DNA sequences. Journal of Computational Biology 7, 203-214.