Journal of Asia-Pacific Biodiversity 8 (2015) 295e297

HOSTED BY Contents lists available at ScienceDirect

Journal of Asia-Pacific Biodiversity

journal homepage: http://www.elsevier.com/locate/japb

Original article Taxonomic notes on citrella (: ) with genital structures and DNA barcode from Korea

Da-Som Kim a, Chung-Won Choi b, Sanghyeob Lee b, Bong-Kyu Byun a,* a Department of Biological Science and Biotechnology, Hannam University, Daejeon, South Korea b Department of Plant Biotechnology and Plant Engineering Research Institute, Sejong University, Seoul, South Korea article info abstract

Article history: Until now, only one species, Phyllocnistis citrella Stainton, of the genus Phyllocnistis belonging to the Received 25 September 2015 family Gracillariidae is listed in Korea, without available information on its identification and Received in revised form morphology, which is now a very serious and important pest species in southern area. This study 14 October 2015 was carried out to provide the illustration with genital structure and DNA barcode data for rapid Accepted 14 October 2015 monitoring, which has not been presented in this country to date. Available online 26 October 2015 Copyright Ó 2015, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Production and hosting by Elsevier. This is an open access article under the CC BY-NC-ND license (http:// Keywords: leafminer creativecommons.org/licenses/by-nc-nd/4.0/). DNA barcode insect pests Korea Phyllocnistis

Introduction in 1993 (Urbaneja et al 2000). It is recently suggested that CLM may become a major economic pest in the near future due to The genus Phyllocnistis belongs to the family Gracillariidae that the climatic and environmental changes. While there are many includes 85 described species in the world (De Prins and De Prins studies on the occurrence, damage, and parasitoids of CLM for the 2005). It has a tiny size (wingspan, 5 mm) and shows high control of pests (Argov and Rössler 1996; Legaspi et al 1999; similarity in external morphological characteristics among the Garcia-Marí et al 2004), the external characteristics including allied species. For this reason, the genus Phyllocnistis has not the adult and genital illustration was not available relatively in been well studied until now compared with other genera of spite of their difficulty of identification. Gracillariidae. This study was carried out to identify correctly the external In Korea, only one species of Phyllocnistis was listed for the first morphological and genital characteristics of CLM. In addition, DNA time by Ko (1969) without the taxonomic information. There has barcode is required for the exact and rapid identification, which has been no further taxonomic study on this species till date (Park not yet been developed in Korea. All the available information on 1983; Byun et al 2009). the species, including distributional ranges and host plants, is It was first reported by Heppner (1993) in North America. presented in this study. Recently, it is treated as the major pest of Rutaceae, especially the genus Citrus spp., in the world, also called CLM (Jacas et al 1997; Materials and methods Song and Kang 2006). In North America, CLM lays eggs on the underside of leaves, and eclosion occurs within 2e10 days. After Collecting and rearing eclosion, the larvae mine into leaves, causing serious damage to the leaves (Heppner 1993). After its occurrence in one region, CLM The material examined for this study was obtained from the spreads across the whole country within 1 year, as was the case in Citrus Research Institute, National Institute of Horticultural & Herbal Science, Rural Development Administration, located in Seoguipo, Jeju-do, Korea in 2015, and are now deposited at the * Corresponding author. Tel.: þ8242 629 8892; fax: þ8242 629 8750. E-mail address: [email protected] (B.-K. Byun). Systematic Entomology Laboratory, Hannam University, Daejeon, Peer review under responsibility of National Science Museum of Korea (NSMK) and Korea. Larvae or pupae in the leaves of Citrus spp. were collected in Korea National Arboretum (KNA). a plastic bag for rearing and observation. http://dx.doi.org/10.1016/j.japb.2015.10.005 pISSN2287-884X eISSN2287-9544/Copyright Ó 2015, National Science Museum of Korea (NSMK) and Korea National Arboretum (KNA). Production and hosting by Elsevier. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 296 DS Kim et al. / Journal of Asia-Pacific Biodiversity 8 (2015) 295e297

Genitalia dissection and illustration

Male genitalia was dissected and mounted on the glass slides with an Euparal mountant following the method of Holloway et al (1987). Images of the species were taken by a digital camera attached to the microscope LEICA M205C (Leica Microsystems, Wetzlar, Germany). Abbreviations used in this study were as fol- lows: TLdtype locality; GSdgenitalia slide.

DNA barcoding

In this study, we extracted DNA barcode (COI) from the spec- imen of Phyllocnistis citrella Stainton. In order to obtain the DNA barcode, protocols of Canadian Center for DNA Barcoding (Biodi- versity Institute of Ontario, University of Guelph, Guelph, Ont., Canada) were used in this study. Extraction was carried out with the NucleoGen Cell/Tissue Mini Kit (NecleoGen Inc., Korea). The region of COI (sets of 648 bp) was amplified with the primer LepF1/ LepR1 (Hebert et al 2004). DNA barcoding analysis of mt COI gene was performed by the process of sequencing with an automated DNA sequencer, which was applied with a 30 primer (50-TAAACTT- CAGGGTGACCAAAAAATCA-30)(Table 1).

Systematic accounts Figure 1. Phyllocnistis citrella Stainton: A, adult; B, male genitalia; C, aedeagus; and D, female genitalia. Order Lepidoptera Linnaeus, 1758 Family Gracillariidae Stainton, 1854 Subfamily Phyllocnistinae Herrich-Schäffer, 1857 Female genitalia (Figure 1D). Papillae anales moderate with numerous long hairs, apex slightly sharpened; apophyses ante- Genus Phyllocnistis Zeller, 1848 riores very short and as long as apophyses posteriores, a bit thick; Type species: Opostega suffusela Zeller, 1847 ductus bursae very thin, membranous, as long as corpus bursae; Phyllocnistis citrella Stainton, 1856 corpus bursae membranous, long, sack shaped with two different sized signa, having a shortly protruded projection on middle, (Figures 1AeD) Phyllocnistis citrella Stainton, 1856: 302e303. TL: Calcutta (West located on both the upper side and the downside. Material examined.1_,1\, Hare-ri, Namwon-Eup, Seoguipo, Jeju, Bengal, ). Syntype: BMNH. _ \ Phyllocnistis minutella van Deventer, 1904:87e89. May 13, 2015 (CW Choi & YK Park); 1 ,1 , same locality, June 15, 2015 (CW Choi & YK Park); 1_,1\, same locality, July 22, 2015 (CW Lithocolletis citricola Shiraki, 1913: 330. Choi & YK Park); 8_,4\, same locality, August 18, 2015 (CW Choi & YK Park)-GS-_5201, \5202-coll. SEL/HNU. Adult (Figure 1A). Wingspan 4.0e4.7 mm in male and female; length of head and thorax combined 0.6e0.7mm; length of Distribution. Korea (South, Jeju), Japan, , India, Spain, North America, Costa Rica. Cosmopolitan. Of Southeast-Asian origin, abdomen 1.7 mm. Head covered with whitish-silvery and short scales; antenna ciliate and brown with silvery scales; compound dispersed since 1900 to citrus-producing areas all over the world (De Prins and De Prins 2005). eye blackish. Thorax light brown, covered with shiny scales. Fore- wing very narrow, lanceolate, with two blackish streaks until Host plants. Citrus sp. (Stainton 1856: 303)- Rutaceae, Garcinia mangostana L.- Clusiaceae, (L.) Aiton, middle of cell horizontally, forming a blackish “y” on the middle of forewing. Ground color of forewing bright silver mixed with J. simplicifolium Forst. f.- Oleaceae, Loranthus sp.- Loranthaceae, Alseodaphne semecarpifolia Nees, Cinnamomum zeylanicum Blume- blackish streaks and some yellowish brown scales; blackish streaks in the apex and outer margin with short and tiny blackish dashes; Lauraceae (De Prins and De Prins 2005). Bionomics (Figures 2AeD). Larvae feed on the mesophylls of apex with a round blackish spot with long ciliae. Hindwing rather narrow, lanceolate with long silver hairs along the dorsum. Legs leaves and mine under the epidermal cell layer of leaves. They have four larval instars, which are 5e20 days in total; they suck the sap covered with whitish silvery hairs. fi Male genitalia (Figures 1B and 1C). Tegumen narrow, a bit of leaves in rst three instars. In the larval stages, they are bright green, but changes to ash brown from the head when they pupate. shorter than the valva, parallel with valva; uncus uncertain; valva long (2.2 times longer than saccus) and narrow, slightly extended Fourth-instar larvae form the silken cocoon, folding the edge of a leaf, which will protect them in pupal stages (Figures 2Ae2C). Then, with rounded termination and apex with short hairs; saccus as long as valva, rounded ventrally. Aedeagus moderate, apex relatively the pupae come out from the cocoon for emergence of adults, after e rounded, with a bit of tiny cornuti in the vesica. 6 22 days from pupation (Figure 2D). The mined leaves dry out because of a lack of chlorophylls, resulting in harvest damage in the Citrus farm (Lee et al 2015). Table 1. Primers used for extracting DNA barcode in this study. DNA barcode. The sequences of P. citrella Stainton in Korea is as Gene Name Sequence Reference follows (658 bp): AACATTATATTTTTTATTTGGAATTTGATCAGGAA Mitochondrial COI TAGTTGGTACTTCTTTAAGTTTATTAATTCGGATAGAATTAGGAAATCCA Forward LepF1 attcaaccaatcataaagatattgg (Hebert et al 2004) GGAAATTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCA Reverse LepR1 taaacttctggatgtccaaaaaatca (Hebert et al 2004) TGCTTTTATTATAATTTTTTTTATAGTGATACCTATAATAATTGGAGGATT DS Kim et al. / Journal of Asia-Pacific Biodiversity 8 (2015) 295e297 297

Byun BK, Park KT, Bae YS, et al. 2009. A checklist of the microlepidoptera in Korea (Lepidoptera). Pocheon: Korea National Arboretum. De Prins W, De Prins J. 2005. World catalogue of insect,InGracillariidae, Vol. 6. Stenstrup: Apollo Books. Garcia-Marı F, Vercher R, Costa-Comelles J, et al. 2004. Establishment of Citrostichus phyllocnistoides (Hymenoptera: Eulophidae) as a biological control agent for the citrus leafminer Phyllocnistis citrella (Lepidoptera: Gracillariidae) in Spain. Bio- logical Control 29:215e226. Hebert PDN, Penton EH, Burns J, et al. 2004. Ten species in one: DNA barcoding revealed cryptic species in the neotropical skipper butterfly, Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States of America 101:14812e14817. Heppner JB. 1993. Citrus leafminer, Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae: Phyllocnistinae). Entomology Circular No. 359, Division of Plant Industry, Florida Department of Agriculture and Consumer Services. pp 1e2. Herrich-Schäffer GAW. 1857. Sammlungen des Vereines. 5. Insecten. Correspondenz Blatt des Zoologisch-mineralogischen Vereines in Regensburg 11:33e70 (in German). Holloway JD, Bradely JD, Carter DJ. 1987. CIE guides to of importance to man 1. Lepidoptera. London: CAB International Institute of Entomology. Jacas JA, Garrido A, Margaix C, et al. 1997. Screening of citrus rootstocks and citrus- related species for resistance to Phyllocnistis citrella (Lepidoptera: Gracillar- Figure 2. Pupa of Phyllocnistis citrella: A, pupa within the leaf of host plant; B, pupa in iidae). Crop Protection 16:701e705. cocoon; C, pupa before emergence; and D, pupa after emergence. Ko JH. 1969. A list of forest insect pests in Korea. Seoul: Forest Research Institute. Lee S, Kim IK, Park YK, et al. 2015. Preliminary survey of indigenous parasites TGGAAATTGATTAGTTCCTATTATATTAGGAGCTCCTGATATAGCTTTCC associated with Phyllocnistis citrella Stainton (Lepidoptera, Phyllocnistidae) in CACGACTTAATAATATAAGATTTTGATTATTACCCCCATCTTTACTATTAT Jeju, Korea. Journal of Asia-Pacific Biodiversity 8:371e374. http://dx.doi.org/10. TAATTTCAAGAAGTTTAGTTGAAAACGGAGCTGGAACAGGATGAACAG 1016/j.japb.2015.09.002. Legaspi JC, French JV, Schauff ME, et al. 1999. The citrus leafminer Phyllocnistis ́ TTTACCCACCATTATCATCTAATATTGCCCACGGTGGTAGATCAGTTGAT citrella (Lepidoptera: Gracillariidae) in South Texas: incidence and parasitism. TTAGCTATTTTTTCTTTACACTTAGCTGGTATTAGTTCAATTTTAGGTGCT Florida Entomologist 82:305e316. th ATTAATTTTATTACAACAATTATTAATATACGAATTAATAAAATAACTTTA Linnaeus C. 1758. Systema naturae.10 ed. Stockholm: Laurentius Salvius [In Swedish]. GATTCTATATCCTTATTTGTTTGATCAGTTGGAATTACAGCCTTATTATTA Park KT. 1983. Gracillariidae. In: Shin YH, Park KT, Nam SH, editors. Illustrated CTTTTATCTTTACCTGTATTAGCTGGAGCTATTACAATATTATTAACTGAC flora and fauna of Korea,.Insecta IX, Vol. 27. Seoul: Ministry of Education (in CGAAACTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAA Korean). Shiraki T. 1913. Investigations upon general insect pests. Formosa Agricultural TTCTTTATCAACATTTATTC Experiment Station Special Report 8. pp 670 (in Japanese). Song JH, Kang SH. 2006. Responses of citrus leafminer, Phyllocnistis citrella (Lepi- doptera: Gracillariidae) for a sex component, (Z,Z)-7, 11-hex- Acknowledgments adecadienal on Jeju Island. Korean Journal of Applied Entomology 45:161e167 (in Korean). This study was funded by the project “Identification of Parasit- Stainton HT. 1854. Insecta britannica,InLepidoptera: Tineina, Vol. 3. London: Lovell Reeve. oids of Citrus Leafminer and Development of Their Indoor Breeding Stainton HT. 1856. Descriptions of three species of Indian micro-Lepidoptera. Technology” (Project No.: PJ010253012015) of the Rural Develop- Transactions of the Entomological Society of London, N.S. (series 2) 3:301e ment Administration in Korea. We wish to express our sincere 304. thanks to Young-Kyu Park of the Korea Beneficial Insects Laboratory Urbaneja A, Llácer E, Tomás O, et al. 2000. Indigenous natural enemies associated with Phyllocnistis citrella (Lepidoptera: Gracillariidae) in Eastern Spain. Biolog- for collecting the samples of the species for our study. ical Control 18:199e207. Zeller PC. 1847. Bemerkungen über die auf einer Reise nach Italien und Sicilien beobachteten Schmetterlingsarten X. (Schluss von Isis Heft XI. Pag. 859). Isis, References oder enzyklopädische Zeitung von Oken 12:881e904 (in German). Zeller PC. 1848. Die Gattungen der mit Augendeckeln versehenen blattminirenden Argov Y, Rössler Y. 1996. Introduction, release and recovery of several exotic natural Schaben. Linnaea Entomologica 3:248e344 (in German). enemies for biological control of the citrus , Phyllocnistis citrella,in van Deventer W. 1904. Over de ontwikkelingstoestanden van eenige Microlepi- . Phytoparasitica 24:33e38. doptera van Java. Tijdschrift voor Entomologie 46:79e89 (in Dutch).