Pitx1 Regulates Cement Gland Development in Xenopus Laevis Through Activation of Transcriptional Targets and Inhibition of BMP Signaling

City University of New York (CUNY) CUNY Academic Works

Publications and Research Queens College

2018

Pitx1 Regulates Cement Gland Development in Xenopus laevis through Activation of Transcriptional Targets and Inhibition of BMP Signaling

Ye Jin CUNY Graduate Center

Daniel C. Weinstein CUNY Queens College

How does access to this work benefit ou?y Let us know!

More information about this work at: https://academicworks.cuny.edu/qc_pubs/234 Discover additional works at: https://academicworks.cuny.edu

This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] Pitx1 regulates cement gland development in Xenopus laevis through activation of transcriptional targets and inhibition of BMP signaling Ye Jin1 and Daniel C. Weinstein2* 1PhD Program in Biology, The Graduate Center, The City University of New York, New York, NY 10016, USA 2Department of Biology, Queens College, The City University of New York, 65-30 Kissena Boulevard, Queens, NY 11367. Tel: +1-718-997-4552. E-mail address: [email protected]

*Corresponding author

Abstract The cement gland in Xenopus laevis has long been used as a model to study the interplay of cell signaling and transcription factors during embryogenesis. It has been shown that an intermediate level of Bone Morphogenetic Protein (BMP) signaling is essential for cement gland formation. In addition, several transcription factors have been linked to cement gland development. One of these, the homeodomain-containing protein Pitx1, can generate ectopic cement gland formation; however, the mechanisms underlying this process remain obscure. We report here, for the first time, a requirement for Pitx proteins in cement gland formation, in vivo: knockdown of both pitx1 and the closely related pitx2c inhibit endogenous cement gland formation. Pitx1 transcriptionally activates cement gland differentiation genes through both direct and indirect mechanisms, and functions as a transcriptional activator to inhibit BMP signaling. This inhibition, required for the expression of pitx genes, is partially mediated by Pitx1-dependent follistatin expression. Complete suppression of BMP signaling inhibits induction of cement gland markers by Pitx1; furthermore, we find that Pitx1 physically interacts with Smad1, an intracellular transducer of BMP signaling. We propose a model of cement gland formation in which Pitx1 limits local BMP signaling within the cement gland primordium, and recruits Smad1 to activate direct downstream targets.

Introduction The cement gland, as its name implies, secretes a sticky mucus that allows amphibian larvae to adhere to hard surfaces before young tadpoles are able to swim freely in the aquatic environment. The cement gland is an outer layer ectodermal structure located at the anterior end of the Xenopus laevis tadpole, at the border between dorsal (neural) and ventral (epidermal) fates; thus, it has long been used as a model to study early embryonic patterning and differentiation (Bradley et al., 1996; Sive and Bradley, 1996).

Dorsal-ventral patterning in the Xenopus ectoderm is regulated by signaling through the Bone Morphogenetic Protein receptors (BMPRs), expressed throughout the gastrula stage ectoderm (Hawley et al., 1995; Suzuki et al., 1997b; Wilson and Hemmati-Brivanlou, 1995; Xu et al., 1995). Ventrally, high levels of Bone Morphogenetic Protein (BMP) ligands bind to the BMPRs, initiating a signaling cascade that results in the activation and nuclear retention of the intracellular Smad1/5-Smad4 complex, the transactivation of BMP target genes, and the initiation of the program for epidermal differentiation (Suzuki et al., 1997a; Wilson et al., 1997). Dorsally, extracellular BMP antagonists secreted by the Spemann Organizer bind BMP ligands and prevent them from activating their cognate receptors—Smad1/5 signaling remains inactive, BMP target genes are not activated and the dorsal ectoderm subsequently differentiates as neural tissue, the “default” fate of the ectoderm (reviewed in Weinstein and Hemmati-Brivanlou, 1999). The formation of the cement gland, located at the anterior border between dorsal and ventral ectoderm, has been related to intermediate levels of BMP signaling (Knecht and Harland, 1997; Wilson et al., 1997).

Several transcription factors have also been implicated in cement gland formation, including Otx2, Pitx1, and Pitx2c. The homeobox gene otx2 is expressed in a broad anterior region including the cement gland primordium (Gammill and Sive, 2000). Two other homeobox genes, pitx1 and pitx2c, but not the pitx2 isoform pitx2b, are

co-expressed in the presumptive cement gland (Schweickert et al., 2001b). Otx2 was reported to promote anterior fates and control cement gland differentiation in the presence of BMP activity (Gammill and Sive, 1997, 2000, 2001); furthermore, cement gland induction by Otx2 is abolished by knockdown of Pitx1 or Pitx2c proteins (Schweickert et al., 2001a). Misexpression of pitx1 or pitx2c also induces ectopic cement gland formation, through targets and signaling pathways that remain elusive (Chang et al., 2001; Schweickert et al., 2001a). Here, we demonstrate for the first time that the Pitx proteins are required for cement gland formation, in vivo. We identify direct and indirect target genes of Pitx1. We also find that Pitx1 may function as a transcriptional activator to indirectly inhibit BMP signaling in the presumptive cement gland tissue; the inhibition is partially mediated by Follistatin, whose expression within the cement gland primordium depends on Pitx1. Restoration of BMP signaling inhibited by pitx1 misexpression blocks the expression of pitx2 and endogenous pitx1, whereas suppression of BMP signaling attenuates Pitx1-induced cement gland markers. Finally, we find physical interaction between Pitx1 and Smad1. Taken together, these results demonstrate the requirement for Pitx proteins during cement gland differentiation, mediated through activation of transcriptional targets and inhibition of BMP signaling.

Materials and methods RNA preparation, explant dissection, and embryo culture RNA was synthesized in vitro in the presence of cap analog using the mMessage mMachine kit (Ambion). Microinjection, explant dissection, and embryo culture were performed as described (Hemmati-Brivanlou and Melton, 1994; Wilson and Hemmati-Brivanlou, 1995). Dexamethasone and cycloheximide treatment were performed as described (Chung et al., 2010). For all animal cap experiments, a minimum of five explants was used for each condition; each experiment was performed at least three times.

Constructs and morpholinos

The coding sequence of Pitx1 was isolated by PCR from cDNA derived from mid- neurula stage Xenopus laevis embryos using the following primers: 5’- GGAATTCACCATGGATTCCTTTAAAG; 5’-CCTCGAGTCAACTGTTATATTGGC, and cloned into the EcoRI and XhoI sites of the pCS2++ vector (Hollemann and Pieler, 1999). Pitx1 fusion constructs were generated by PCR. For VP16-Pitx1, residues 410-490 of the VP16 transcriptional activator were fused upstream of the complete coding sequence of Xenopus pitx1 (Hollemann and Pieler, 1999; Kessler, 1997). For EnR-Pitx1, residues 1-298 of the Drosophila Engrailed transcriptional repressor were fused upstream of the complete coding sequence of Xenopus pitx1 (Hollemann and Pieler, 1999; Kessler, 1997). For Pitx1-Myc, six Myc epitopes were fused downstream of full-length Xenopus pitx1. A fusion construct of the ligand-binding domain of the human glucocorticoid receptor and Xenopus pitx1 (Pitx1-GR) was a gift from John Wallingford (Chung et al., 2010). pCS2-hSmad1-WT was a gift from Edward De Robertis (Pera et al., 2003). pBS-XFS-319 was a gift from Ali Brivanlou (Hemmati-Brivanlou et al., 1994). The constitutively active BMP receptor type Ia was subcloned from pCMV-hBMPR-1A-CA (a gift from Lee Niswander & Peter ten Dijke) into the pCS2++ vector (Varley et al., 1998). pSP64T-noggin was a gift from Richard Harland (Smith and Harland, 1992). pCMV-SPORT6-Xag1 was purchased from Open Biosystems Dharmacon.

Morpholino oligonucleotides (MO) were heated for 10 minutes at 65°C, then quenched on ice prior to injection at two- or four-cell stages. Antisense morpholino oligonucleotides (Gene Tools, LLC) and mismatch (MM) control morpholinos used in this study are as follows: Pitx1-MO: 5’-CATGGTCAATCACTTCTGCTCATGA (Chung et al., 2010) Pitx2c-MO: 5’-GGTACAGTACAGTAGGCTCACAGAC Follistatin-MO: 5’-CCTTTCATTTAACATCCTCAGTGCT Pitx1-5MM: 5’-CATGcTgAATCAgTTCTcCTCATcA Pitx2c-5MM: 5’-GGTAgAcTAgAGTAGcCTCACAcAC Standard control MO: 5’-CCTCTTACCTCAGTTACAATTTATA

Reverse transcription-polymerase chain reaction (RT-PCR) RT-PCR was performed as described (Wilson and Hemmati-Brivanlou, 1995). Primers used in this study are as follows: EF1α (forward, 5’-CAGATTGGTGCTGGATATGC; reverse, 5’- ACTGCCTTGATGACTCCTAG); ODC (forward, 5’-AATGGATTTCAGAGACCA; reverse, 5’-CCAAGGCTAAAGTTGCAG); Xag1 (forward, 5’-CTGACTGTCCGATCAGAC; reverse, 5’- GAGTTGCTTCTCTGGCAT); Xcg (forward, 5’-ACCAAAAGCACTCCGTCAAC; reverse, 5’- TTGGCGCAGTGGAACTAAAG); agr2 (forward, 5’-CCAGCAAAAGTCTCAAAGCC; reverse, 5’-TGGATACCTTGGTGTTCAGC); nkx3.1 (forward, 5’- ACATGTCCCATCCAGTCAAG; reverse, 5’-CGTTTCTGTTGCTGCTTTGC); TGFβ1 (forward, 5’-AGCTGCGCATGTACAAGAAG; reverse, 5’-TTTCCTCTGCACGTTTCAGC); bmp4 (forward, 5’-TGACACGGGCAAGAAGAAAG; reverse, 5’- TCCAAATGCTCCTCGTGATG); sizzled (forward, 5’-CACTAACATGGCAGAAGTCG; reverse, 5’-GGAACCTGTCACAGTCTAAG); cv2 (forward, 5’- AATGTGCCTCACCTTTCCTG; reverse, 5’-TTACAGCGTTCACAGCAAGC); follistatin (forward, 5’-AAAAGACTTGCAGGGACGTG, reverse, 5’-ACAGGCATTTCTTTCCAGCG); pitx2b (forward, 5’-GGATTCACCAAAGTGGCAGT; reverse, 5’- TCAGTTTGTTGGTTCCTCTC); pitx2c (forward, 5’-TCCAGCCCAGACACTGCA; reverse, 5’-TGCATCAGTCCATTGAACTG); pitx1 (forward, 5’-AAATCCAAGCAGCACTCCAC; reverse, 5’-ACAACCCGCATAATCCAGAG); sim2 (forward, 5’- AACCATCGTTCACAACAGCC; reverse, 5’-AGTGGCAGTGTTCATTGTCG); crx (forward, 5’-AACAACTTTTACCAGGGCGC; reverse, 5’-TGCTTGCCTCTGAGTTTGTC); epha4 (forward, 5’-ATCAGCTCATGTTGGACTGC; reverse, 5’-AGCCAATCAAGCACAGAAGC); traf4 (forward, 5’-AAGACTCTGGCTGCAAACAC; reverse, 5’- TTGCCTCTGACCTTTGCTTC); xa-1 (forward, 5’-CCTTACCTCCAAAAGAAACCCC; reverse, 5’-TTTCCATTGCTGCCGTTGTG).

Whole-mount in situ hybridization Whole-mount in situ hybridization was performed as described (Suri et al., 2005). Anti-digoxygenin Fab fragments (Roche) coupled to alkaline phosphatase were used at 1:1000 dilution. Chromogenic reactions were performed using NBT/BCIP (Sigma).

Western blot analysis Western blot analysis was performed as described (Hama et al., 2002). Antibodies against phospho-Smad1/5 (Cell Signaling Technology), Smad1 (Cell Signaling Technology), and β-tubulin (Sigma) were used at 1:500, 1:1,000, and 1:1,000 dilutions, respectively. Secondary antibodies (donkey anti-rabbit IgG, or donkey anti-mouse IgG) coupled to horseradish peroxidase (Jackson ImmunoResearch) were used at 1:10,000 dilution.

Co-immunoprecipitation pitx1-myc RNA was injected into early cleavage stages embryos. Injected embryos were harvested at mid-neurula stages. Embryo lysates were incubated with either anti-Smad1 antibodies (333 µg/ml) at 1:100 dilution or normal Rabbit IgG (1 mg/ml) at 1:300 dilution (Cell Signaling Technology), followed by incubation with Dynabeads Protein G (Novex). The elution was subject to protein gel electrophoresis. Antibodies against Myc (Sigma) were used to probe the blot at 1:500 dilution. Secondary antibodies (donkey anti-mouse IgG) coupled to horseradish peroxidase (Jackson ImmunoResearch) were used at 1:10,000 dilution.

RNA-sequencing 400 pg pitx1 RNA was injected into the animal pole of early cleavage stages embryos. Ectodermal (animal cap) explants were dissected from injected embryos and from untreated control embryos at late blastula stages, and harvested at mid-neurula stages. RNA extracted from these two explant pools was sequenced and analyzed for relative transcript abundance (Genewiz); studies were performed in duplicate. RNA seq data generated from this work have been deposited in the Gene Expression Omnibus (GSE111454).

Results Knockdown of pitx1 and pitx2c inhibits endogenous cement gland formation

While Pitx proteins are necessary for ectopic cement gland induction by Otx2 (Schweickert et al., 2001a), a requirement for Pitx proteins in the formation of the endogenous cement gland has not previously been demonstrated. To address this possibility, we designed antisense morpholino oligonucleotides to inhibit translation of pitx1 and the related pitx2c, the misexpression of which is also sufficient to induce ectopic cement gland formation (Pitx1-MO and Pitx2c-MO, respectively) (Chung et al., 2010). No significant effects on cement gland development were seen after injection of either Pitx1-MO or Pitx2c-MO, alone (data not shown); co-injection of Pitx1-MO and Pitx2c-MO, however, effectively inhibit endogenous cement gland formation in Xenopus embryos (40% of embryos with no observable cement gland, n=46) (compare Figs. 1A, B), while co-injection of Pitx1- 5MM and Pitx2c-5MM, morpholino oligonucleotides with 5 base pair target mismatches, does not effect native cement gland development (n=36) (compare Figs. 1A, C). Importantly, co-injection of pitx1 RNA with Pitx1-MO/Pitx2c-MO rescues cement gland development (6% of embryos with no observable cement gland, n=35) (Fig. 1D). Whole mount in situ hybridization analyses demonstrate that the expression of the early cement gland marker Xag1 is also strongly reduced following co-injection of Pitx1-MO and Pitx2c-MO (compare Figs. 1E, F); no reduction in Xag1 expression in observed following co-injection of Pitx1-5MM and Pitx2c-5MM, suggesting that loss of Pitx proteins inhibits development of the cement gland primordium (compare Figs. 1E, G) (Sive et al., 1989). These studies demonstrate that Pitx proteins are essential for endogenous cement gland differentiation in Xenopus. Our results also suggest redundancy between Pitx1 and Pitx2c proteins during cement gland development.

Pitx1 transcriptionally activates cement gland differentiation genes through direct and indirect mechanisms It has been shown that misexpression of pitx1 induces cement gland markers in animal cap explants (Chang et al., 2001; Schweickert et al., 2001a). In order to determine whether Pitx1 functions as a transcriptional activator or repressor, we engineered constructs of full-length Pitx1 fused to either the activation domain of

VP16 (VP16-Pitx1) or the repression domain of Engrailed (EnR-Pitx1). Injection of RNA encoding wild-type pitx1 causes the induction of cement gland markers Xag1 and agr2 (Fig. 2A) (Novoselov et al., 2003). Injection of RNA encoding VP16-pitx1 leads to the expression of cement gland markers in the animal caps, while injection of RNA encoding EnR-pitx1 does not (Fig. 2A). Results from these neomorphic constructs suggest that Pitx1 may act as a transcriptional activator in the context of cement gland formation.

We performed RNA Seq analysis to identify potential transcriptional targets of Pitx1. Ectodermal (animal cap) explants from embryos injected with pitx1 RNA and from untreated control embryos were harvested at mid-neurula stages; RNA was extracted from these two explant pools, then sequenced and analyzed for relative transcript abundance (Genewiz). We selected for transcripts that displayed a fourfold or greater increase in animal caps derived from embryos injected with pitx1 mRNA versus untreated animal caps. Among the candidates positively regulated by Pitx1 misexpression, we selected those that had been shown previously to be expressed in the cement gland primordium (Table I). We utilized cycloheximide assays to distinguish between potential direct and indirect targets of Pitx1. We would expect to see stimulation of genes that are directly activated by Pitx1 in the presence of the protein synthesis inhibitor cycloheximide; indirect targets of Pitx1 that require an intermediate round of protein synthesis for their activation would not be expected to show an increase in expression in the presence of cycloheximide. Thus, only those genes induced by Pitx1 in the presence of cycloheximide are putative direct targets (Rosa, 1989). In order to prevent Pitx1 from entering the nucleus prior to cycloheximide treatment, we utilized a fusion construct of Pitx1 and the ligand-binding domain of the Glucocorticoid Receptor (Pitx1-GR) (Chung et al., 2010). We injected RNA encoding pitx1-GR at early cleavage stages, and isolated animal caps from these and control embryos at late blastula stages. At stage 12, the stage at which endogenous zygotic expression of pitx1 is first observed in the presumptive cement gland region, dexamethasone was added to the excised animal caps to stimulate nuclear translocation of Pitx1-GR

(Hollemann and Pieler, 1999). We found that nkx3.1, tgfb1, sim2, crx, epha4 and traf4 are strongly induced by Pitx1-GR in both the presence and absence of cycloheximide, suggesting that they are directly activated by Pitx1 (Fig. 2B) (Coumailleau et al., 2000; Kalkan et al., 2009; Kondaiah et al., 1990; Newman and Krieg, 2002; Smith et al., 1997; Vignali et al., 2000). Xag1, Xcg, agr2, xa-1, pitx2c, mid1, stat5b and ern2, however, are very poorly induced when protein synthesis is inhibited (Fig. 2B and data not shown) (Campione et al., 1999; Jamrich and Sato, 1989; Pascal et al., 2001; Suzuki et al., 2010; Yuan et al., 2008). These results suggest that these latter genes may be indirect targets of Pitx1; their persistent, albeit weak, expression may be due to incomplete inhibition of protein synthesis. These studies suggest that Pitx1 drives the transcription of cement gland differentiation genes through direct and indirect mechanisms.

follistatin is a transcriptional target of Pitx1 in the developing cement gland Interestingly, RNA Seq analysis identified the BMP antagonist follistatin as a putative target of Pitx1, a result that we subsequently confirmed by reverse transcription PCR: injection of RNA encoding pitx1 leads to the induction of follistatin expression in mid-neurula stage ectodermal explants (Fig. 3A) (Fainsod et al., 1997). We were not able to determine whether or not follistatin is a direct target of Pitx1, because cycloheximide treatment alone leads to the strong induction of follistatin (Fig. 3B). To our knowledge, follistatin transcripts localized in the cement gland have not been previously reported. Our whole mount in situ hybridization analyses detect follistatin RNA in the anterior notochord, hindbrain, and pronephric kidneys, consistent with earlier published data (Figs. 3C, D) (Hemmati-Brivanlou et al., 1994). Interestingly, our analyses also reveal that follistatin RNA is indeed present in the presumptive cement gland region around stage 20 (66% of embryos with detectable follistatin staining within the cement gland primordium, n=29) (Fig. 3E); we did not observe follistatin transcripts in the cement gland region at earlier neurula stages, presumably because its expression is below the level of detection by in situ hybridization (data not shown). In order to examine whether follistatin expression in the cement gland is dependent on Pitx1, we injected either pitx1 RNA

or Pitx1-MO/Pitx2c-MO into the animal pole of early cleavage stages embryos. Depletion of Pitx proteins results in reduced follistatin staining in the presumptive cement gland region (36% of embryos with detectable follistatin staining, n=33) (Fig. 3F), while pitx1 overexpression results in expanded follistatin staining (77%, n=31) (Fig. 3G). Taken together, these results demonstrate that Pitx1 is necessary and sufficient for follistatin expression within the cement gland primordium.

Pitx1 may function as a transcriptional activator to inhibit BMP/Smad1 signaling Follistatin has been shown to antagonize BMP signaling through direct binding to extracellular BMP ligands (Fainsod et al., 1997; Iemura et al., 1998). Since follistatin has been characterized as a transcriptional target of Pitx1, we were interested in examining whether Pitx1 regulates BMP signaling through Follistatin. Misexpression of pitx1 in animal caps inhibits the BMP-responsive target genes bmp4 and sizzled in a dose dependent manner (Fig. 4A) (Lee et al., 2006; Reversade and De Robertis, 2005). Moreover, Western blot analysis shows that injection of RNA encoding pitx1 decreases C-terminal phosphorylation of the BMP pathway transducer Smad1/5, without affecting the overall level of Smad1 protein (Fig. 4B). In order to determine whether Pitx1 functions as an activator or repressor in the context of BMP signal inhibition, we examined expression of BMP target genes in animal caps derived from embryos injected with RNA encoding VP16-pitx1 or EnR-pitx1. VP16-Pitx1 inhibits the BMP-responsive genes bmp4, sizzled and cv2, similar to that seen following injection of wild-type pitx1 RNA, while EnR-Pitx1 does not affect BMP target genes expression (Fig. 4C) (Ambrosio et al., 2008). These results support the idea that Pitx1-mediated inhibition of BMP signaling is achieved via transcriptional targets of Pitx1. Next, we designed and utilized antisense morpholino oligonucleotides to inhibit translation of follistatin (Follistatin-MO). Co-injection of Follistatin-MO and RNA encoding pitx1 partially rescues expression of sizzled, but not expression of other BMP-responsive genes inhibited by Pitx1 (Fig. 4D and data not shown), suggesting that Pitx1 suppresses BMP signaling through activation of both follistatin and additional target genes. We did not, however, identify other BMP pathway inhibitors among the candidate Pitx1 targets from our RNA Seq analysis.

Inhibition of BMP signaling is required for the expression of pitx genes According to one prominent model for cement gland induction, moderate inhibition of BMP signaling in the ectoderm gives rise to the cement gland (Knecht and Harland, 1997; Wilson et al., 1997). Since our studies demonstrate that Pitx1 inhibits BMP signaling, we were interested to see whether enhancement of BMP signaling could interfere with Pitx1-induced cement gland formation. We found that exogenous Smad1 or constitutively active BMP receptor Ia (CA-BMPRIa) rescues expression of the BMP-responsive gene sizzled, but has no effect on Pitx1-induced expression of the cement gland markers Xag1 and Xcg (Fig. 5A); Otx2-mediated induction of Xcg expression is also unaffected by misexpression of Smad1 (Gammill and Sive, 2000). We did observe, however, that expression of endogenous pitx1 and of two transcript variants of pitx2, pitx2b and pitx2c, are suppressed by elevated BMP signaling (Fig. 5A). Consistently, in situ hybridization assays demonstrated that embryos with enhanced BMP signaling exhibit significantly decreased pitx1 expression within the cement gland primordium in vivo (compare Figs. 5B, C). In conclusion, elevated BMP signaling suppresses induction of endogenous pitx1 and pitx2 by exogenous pitx1 in explant assays, and suppresses pitx1 expression in the developing cement gland.

BMP/Smad1 signaling is required for cement gland development Gammill and Sive have demonstrated that coincident BMP4 activity and otx2 expression are correlated with cement gland formation (Gammill and Sive, 2000). We examined the ability of Pitx1 to induce cement gland under conditions of low BMP/Smad1 signaling. Co-injection of RNA encoding pitx1 and the extracellular BMP antagonist noggin inhibits expression of Pitx1-induced cement gland differentiation genes, including potential direct target genes of Pitx1 (Fig. 5D); this result indicates that BMP signaling, or the embryonic environment generated as a consequence of BMP signaling, is required for the expression of cement gland markers. It has been reported that Smad1 physically interacts with Pitx1 in mouse corticotroph cells; this interaction results in the suppression of the Pitx1 target gene

proopiomelanocortin (Nudi et al., 2005). We constructed a Pitx1-Myc epitope- tagged vector (Pitx1-Myc), and injected pitx1-myc synthetic RNA into early cleavage stage embryos. Immunoprecipitation and Western blot analysis demonstrated that native Smad1 binds to exogenous Pitx1 in Xenopus embryos (Fig. 5E). These studies suggest that the dependence of Pitx1-mediated cement gland gene expression on BMP signaling may involve physical association of Pitx1 and Smad1; this interaction would be expected to stimulate, rather than inhibit, transactivation by Pitx1 in the context of cement gland formation.

Discussion In this study, we report that Pitx1 and the related protein Pitx2c are required for endogenous cement gland development. Pitx1 transcriptionally activates cement gland differentiation genes, both directly and indirectly. Pitx1 may function as a transcriptional activator to inhibit BMP/Smad1 signaling; this inhibition is required for pitx1 and pitx2 expression in the cement gland primordium, and is mediated in part by Pitx1-dependent upregulation of follistatin. Conversely, suppression of BMP signaling abrogates Pitx1-induced cement gland marker expression; this requirement for BMP signaling may involve the observed physical interaction between Pitx1 and Smad1. Our studies thus suggest a multi-faceted role for Pitx1 during the formation of the cement gland. Pitx1 stimulates expression of downstream direct targets within the cement gland primordium, possibly through the formation of a transactivating complex that includes Smad1. On the other hand, Pitx1 restricts local BMP signaling, via targets that include follistatin, to maintain the expression of pitx genes and potentially other factors required for cement gland development.

Pitx1 shares several functional similarities with Otx2. Both factors induce ectopic cement gland formation when misexpressed in Xenopus embryos, and both suppress BMP target genes in a dose-dependent manner (Gammill and Sive, 2000; Schweickert et al., 2001a). Our results support the possibility that both pitx1 and

pitx2c are directly activated by Otx2 activity; moreover, Wardle and Sive have proposed that the cement gland develops at the intersection of three overlapping regions of the ectoderm: otx2-expressing dorsal-anterior cells, ventral-lateral cells with adequate levels of BMP signaling, and outer layer ectodermal cells (reviewed in Wardle and Sive, 2003). Our studies are consistent with this model, and enrich our understanding of cement gland development.

Our studies provide insight into why intermediate BMP signaling is optimal for cement gland development. 1) High BMP activity is not favorable for cement gland development—embryos with high CA-BMPRIa expression lose the entire cement gland (data not shown); we find that expression of pitx1 and pitx2 are suppressed by CA-BMPRIa. Follistatin knockdown fails to have an appreciable effect on cement gland formation, probably because other factors present in the region still antagonize BMP signaling and provide an appropriate environment for the expression of pitx genes (data not shown). 2) Low BMP activity is also not favorable for cement gland development—attenuation of BMP signaling causes a strong reduction of cement gland markers induced by either Otx2 or Pitx1 (Gammill and Sive, 2000) (Fig. 5D). Both studies indicate synergy between Otx2 or Pitx1 and BMP pathway activity in the context of cement gland induction, which explains why Pitx1- and Otx2-dependent ectopic cement glands are only seen in ventral-lateral regions of the embryo, never in the dorsal neural plate where BMP activity is lowest (Chang et al., 2001; Gammill and Sive, 1997; Schweickert et al., 2001a). We propose that moderate inhibition of BMP signaling in the ectoderm first establishes a zone suitable for expression of pitx1 and pitx2c. Once the expression of cement gland inducers is initiated, Pitx1 and other transcription factors begin to activate their direct targets within the cement gland primordium. Moderate BMP inhibition may be required throughout the period of native cement gland differentiation, in order to maintain expression of pitx genes. Under experimental pitx1-overexpressing conditions, embryos still display ectopic cement glands, even when ventralized by high levels of CA-BMPRIa (data not shown), indicating that pitx1 overexpression can

substitute for loss of endogenous expression of pitx genes caused by high BMP activity.

Pitx1 may activate downstream indirect transcriptional targets through its putative direct target, TGFβ1. TGFβ1 alone has been shown to induce Xag1 and gsc (Deglincerti et al., 2015), which can also be achieved through Pitx1 misexpression (Fig. 2A and data not shown). In addition, analysis of the Xag1 promoter reveals that ATF/CREB-like family members regulate Xag1 expression through an Otx2- dependent pathway (Wardle et al., 2002). It has been reported that ATF-2 plays a crucial role in transducing TGFβ signaling (Kim et al., 2007; Lim et al., 2005), which raises the possibility that Xag1 expression is under the control of TGFβ1. Other reports have indicated that connective tissue growth factor (CTGF) or Coco elevate TGFβ1 signaling through enhanced binding of TGFβ1 to its cognate receptor complex (Abreu et al., 2002; Deglincerti et al., 2015). Since neither factor is expressed in regions close to the cement gland (Mercurio et al., 2004; Vonica and Brivanlou, 2007), we speculate that other factors that enhance TGFβ1 signaling are present at the anterior of the Xenopus embryo. Since Follistatin, like CTGF and Coco, is an extracellular BMP antagonist, it is possible that Follistatin also binds to TGFβ1 and promotes the latter’s activity.

Another putative direct target of Pitx1 that emerged from our study is the homeobox gene nkx3.1. Due to genome duplication in Xenopus laevis, there are two closely-related nkx3.1 genes, nkx3.1-a and nkx3.1-b (Newman and Krieg, 2002). RNA Seq analyses demonstrated that both genes are upregulated by Pitx1 misexpression. It was reported that Nkx3.1-b restricts cell proliferation in somites; no extra cement gland formation was described in these studies (Newman and Krieg, 2002). We injected nkx3.1-a RNA into the early cleavage stages embryos; however, injected embryos do not exhibit either enlarged or ectopic cement glands (data not shown). Thus, it is possible that Nkx3.1 is not involved in the induction of the cement gland. Other potential direct targets of Pitx1 are currently under investigation in our lab.

Schweickert et al. have shown that their Pitx morphants display a high rate of axial defects, which they attribute to a requirement for Pitx2 in the specification of mesoderm and endoderm during gastrulation (Faucourt et al., 2001; Schweickert et al., 2001a). In our study, embryos injected with both Pitx1 and Pitx2c morpholinos have shortened axes with a reduction in head structures (Figs. 1B and 3F). Co- injection of pitx1 RNA rescues cement gland, body axis defects and partially rescues craniofacial structures, suggesting that these two genes do not share complete redundancy in head development (Fig. 1D). In addition to their co-expression in the cement gland, pitx1 and pitx2c are both expressed in the stomodeum, adenohypophysis and midbrain; pitx2c transcripts are localized in the eye musculature and head mesenchyme, while pitx1 mRNA is expressed in lens (Schweickert et al., 2001b). The expression of pitx genes in these anterior tissues may help to explain the severe craniofacial defects in our pitx morphants.

The expression pattern of pitx1 is highly conserved between Xenopus laevis and Mus musculus. Although the cement gland does not exist in mouse, localization of pitx1 transcripts is found in other mucus-secreting tissues, such as the submandibular glands (Lanctot et al., 1997). More than 50% of mucus-containing saliva secreted into the oral cavity is produced by the oral epithelium-derived submandibular glands, which are a pair of major salivary glands located beneath the mandible (reviewed in Proctor, 2016). It was reported that pitx1-/- mice exhibit loss of the submandibular glands, indicating that Pitx1 protein is required for gland development (Szeto et al., 1999). The requirement for pitx1 in the development of both the Xenopus cement gland and the mouse submandibular glands suggest that Pitx1 plays an important role in the formation of mucus-secreting glands, and the production of mucus, across the tetrapod superclass.

Acknowledgements We would like to thank T. Haremaki for work on initial stages of the project. We also thank J. Wallingford, A. Brivanlou, R. Harland, E.M. De Robertis, L. Niswander, and P. ten Dijke for gifts of plasmids. This work is supported by PHS Grants R03HD077015

and R15GM124577 (both to DCW), and with funds from Queens College of the City University of New York and the Professional Staff Congress-City University of New York.

Figure legends Fig. 1. Knockdown of pitx1 and pitx2c inhibits endogenous cement gland formation and Xag1 expression. (A) 0% of uninjected embryos (n=56) lack an observable cement gland. (B) 40% of tadpole stage embryos (n=46) lack an observable cement gland following injection of Pitx1-MO and Pitx2c-MO. (C) 0% embryos (n=36) lack an observable cement gland following injection of Pitx1-5MM and Pitx2c-5MM. (D) Cement gland in Pitx1-MO and Pitx2c-MO-injected embryo is rescued by injection of pitx1 RNA: 6% of embryos (n=35) lack an observable cement gland. (E) 73% of uninjected neurula stage embryos (n=22) exhibit strong Xag1 staining. (F) 36% of embryos (n=28) display strong Xag1 staining following injection of Pitx1-MO and Pitx2c-MO. (G) 80% of embryos (n=20) exhibit strong Xag1 staining following injection of Pitx1-5MM and Pitx2c-5MM. Embryos in (A-D) are lateral views, anterior to left; embryos in (E-G) are ventral views, anterior to top. Morpholino oligos were injected into the animal pole of early cleavage stages embryos. Black arrows indicate actual or expected sites of the cement gland; black arrowheads indicate Xag1 staining.

Fig. 2. Pitx1 transcriptionally activates cement gland differentiation genes both directly and indirectly. (A) Injection of VP16-pitx1 RNA, or wild-type pitx1 RNA, leads to induction of cement gland markers. Indicated doses of pitx1, VP16-pitx1, and EnR-pitx1 RNA were injected at early cleavage stages. RT-PCR analysis was performed on animal caps collected at mid-neurula stages after dissection at late blastula stages. (B) nkx3.1, TGFβ1, sim2, crx, epha4 and traf4, but not Xag1, Xcg, agr2 or xa-1, are strongly induced by Pitx1-GR in both the presence and absence of cycloheximide. 400 pg pitx1-GR RNA was injected into early cleavage stages embryos. RT-PCR analysis was performed on animal caps dissected at late blastula stages and cultured with or without dexamethasone and/or cycloheximide until mid-neurula stages. Dexamethasone (10 µM) was added 10 minutes after cycloheximide (10 µg/ml) addition at stage 12, as listed. Dexamethasone and/or cycloheximide treatments were for approximately 5 hours. EF1α is used as a loading

control (Krieg et al., 1989). The -RT lane contains all reagents except reverse transcriptase, and is used as a negative control.

Fig. 3. follistatin expression in the cement gland is dependent on Pitx1. (A) Injection of pitx1 RNA results in the induction of follistatin. 400 pg pitx1 RNA was injected at early cleavage stages. RT-PCR analysis was performed on animal caps harvested at mid-neurula stages after dissection at late blastula stages. (B) Cycloheximide treatment results in strong expression of follistatin. (C) follistatin expression is observed in anterior notochord at early neurula stages. (D) follistatin expression is observed in the hindbrain (arrow) and pronephros (arrowheads) at late neurula stages. (E) 66% of uninjected late neurula stage embryos (n=29) have detectable follistatin staining in the presumptive cement gland region. (F) 36% of embryos (n=33) have detectable follistatin staining in the cement gland primordium following injection of Pitx1-MO and Pitx2c-MO; (G) 77% of embryos (n=31) have expanded follistatin staining following injection of pitx1 RNA. Morpholino oligos or pitx1 RNA were injected into the animal pole of early cleavage stages embryos. Embryos in (C, D) are dorsal views, anterior to left; embryos in (E-G) are ventral views, anterior to left. Black arrows and arrowheads indicate actual or expected follistatin staining.

Fig. 4. Pitx1 may function as a transcriptional activator to inhibit BMP signaling. RT- PCR analysis (A, C and D) and Western blot analysis (B) were performed on animal caps harvested at mid-neurula stages after dissection at late blastula stages. (A) Injection of pitx1 RNA inhibits BMP targets in a dose dependent manner. 10 pg to 400 pg pitx1 RNA was injected at early cleavage stages, as listed. Ornithine decarboxylase (ODC) is used as a loading control (Bassez et al., 1990). (B) Injection of pitx1 RNA results in decreased C-terminal phosphorylation of Smad1/5; total levels of Smad1 are not significantly affected. Embryos were injected with 20 pg, 100 pg and 400 pg pitx1 RNA at early cleavage stages, as listed. β-tubulin is used as a loading control. (C) Injection of VP16-pitx1 RNA leads to down-regulation of BMP target genes, similar to that seen with wild-type pitx1; injection of EnR-pitx1 RNA

does not alter expression of BMP-responsive genes. Indicated doses of pitx1, VP16- pitx1, and EnR-pitx1 RNA were injected at early cleavage stages. (D) Pitx1-mediated inhibition of the BMP target gene sizzled is partially rescued by co-injection of Follistatin-MO. 200 pg pitx1 RNA was co-injected with 192 ng Follistatin-MO or scrambled control morpholino oligo at early cleavage stages.

Fig. 5. Inhibition of BMP signaling is required for the expression of pitx genes, while BMP/Smad1 signaling is required for cement gland development. (A) Pitx1- mediated inhibition of the BMP target gene sizzled is rescued by co-expression of either Smad1 or CA-BMPRIa. Pitx1-mediated induction of two pitx2 transcript variants, pitx2b and pitx2c, as well as endogenous pitx1, are down-regulated following enhancement of BMP signaling. 50 pg pitx1 RNA was either injected alone or co-injected with 1.6 ng smad1 or CA-BMPRIa RNA at early cleavage stages. RT- PCR analysis was performed on animal caps harvested at mid-neurula stages after dissection at late blastula stages. (B) 90% of neurula stage control embryos (n=20) display strong pitx1 staining. Water was injected into the animal pole of 4-cell stage Xenopus embryos. (C) 88% of embryos (n=16) exhibit weak and spatially restricted pitx1 staining following injection of 500 pg CA-BMPRIa RNA at early cleavage stages. Embryo views are anterior, ventral to bottom. (D) Injection of noggin RNA inhibits Pitx1-mediated induction of cement gland differentiation genes. 400 pg pitx1-GR RNA and/or 20 pg noggin RNA were injected into Xenopus embryos. RT-PCR analysis was performed on animal caps dissected at late blastula stages and cultured with or without dexamethasone until mid-neurula stages. Dexamethasone (10 µM) was added to animal caps at stage 12. (E) Pitx1 binds to Smad1. 2 ng pitx1-myc RNA was injected at early cleavage stages. Pull-down of native Smad1 from injected embryos leads to co-immunoprecipitation of exogenous Pitx1. Normal rabbit IgG antibodies was used in parallel studies as a negative control.

Table I. Candidate Pitx1 target genes from RNA Seq analysis expressed in the developing cement gland. Table I. Gene name References anterior gradient 1 (Xag1) (Sive et al., 1989) mucin 2 (Xcg) (Jamrich and Sato, 1989) anterior gradient 2 (agr2) (Novoselov et al., 2003) anterior and ectodermic-specific protein (xa-1) (Sive and Bradley, 1996) cone-rod homeobox (crx) (Vignali et al., 2000) paired like homeodomain 2 (pitx2) (Campione et al., 1999) Nk3 homeobox1 (nkx3.1) (Newman and Krieg, 2002) transforming growth factor beta 1 (tgfb1) (Kondaiah et al., 1990) EPH receptor A4 (epha4) (Smith et al., 1997) forkhead box E3 (foxe3) (Murato and Hashimoto, 2009) midline1 (mid1) (Suzuki et al., 2010) signal transducer and activator of transcription (Pascal et al., 2001) 5B (stat5b) TNF receptor associated factor 4 (traf4) (Kalkan et al., 2009) single-minded family bHLH transcription factor2 (Coumailleau et al., 2000) (sim2) endoplasmic reticulum to nucleus signaling 2 (Yuan et al., 2008) (ern2)

References Abreu, J.G., Ketpura, N.I., Reversade, B., De Robertis, E.M., 2002. Connective-tissue growth factor (CTGF) modulates cell signalling by BMP and TGF-beta. Nat Cell Biol 4, 599-604. Ambrosio, A.L., Taelman, V.F., Lee, H.X., Metzinger, C.A., Coffinier, C., De Robertis, E.M., 2008. Crossveinless-2 Is a BMP feedback inhibitor that binds Chordin/BMP to regulate Xenopus embryonic patterning. Dev Cell 15, 248-260. Bassez, T., Paris, J., Omilli, F., Dorel, C., Osborne, H.B., 1990. Post-transcriptional regulation of ornithine decarboxylase in Xenopus laevis oocytes. Development 110, 955-962. Bradley, L., Wainstock, D., Sive, H., 1996. Positive and negative signals modulate formation of the Xenopus cement gland. Development 122, 2739-2750. Campione, M., Steinbeisser, H., Schweickert, A., Deissler, K., van Bebber, F., Lowe, L.A., Nowotschin, S., Viebahn, C., Haffter, P., Kuehn, M.R., Blum, M., 1999. The homeobox gene Pitx2: mediator of asymmetric left-right signaling in vertebrate heart and gut looping. Development 126, 1225-1234. Chang, W., KhosrowShahian, F., Chang, R., Crawford, M.J., 2001. xPitx1 plays a role in specifying cement gland and head during early Xenopus development. Genesis 29, 78-90. Chung, M.I., Nascone-Yoder, N.M., Grover, S.A., Drysdale, T.A., Wallingford, J.B., 2010. Direct activation of Shroom3 transcription by Pitx proteins drives epithelial morphogenesis in the developing gut. Development 137, 1339-1349. Coumailleau, P., Penrad-Mobayed, M., Lecomte, C., Bollerot, K., Simon, F., Poellinger, L., Angelier, N., 2000. Characterization and developmental expression of xSim, a Xenopus bHLH/PAS gene related to the Drosophila neurogenic master gene single-minded. Mech Dev 99, 163-166. Deglincerti, A., Haremaki, T., Warmflash, A., Sorre, B., Brivanlou, A.H., 2015. Coco is a dual activity modulator of TGFbeta signaling. Development 142, 2678-2685. Fainsod, A., Deissler, K., Yelin, R., Marom, K., Epstein, M., Pillemer, G., Steinbeisser, H., Blum, M., 1997. The dorsalizing and neural inducing gene follistatin is an antagonist of BMP-4. Mech Dev 63, 39-50. Faucourt, M., Houliston, E., Besnardeau, L., Kimelman, D., Lepage, T., 2001. The pitx2 homeobox protein is required early for endoderm formation and nodal signaling. Dev Biol 229, 287-306. Gammill, L.S., Sive, H., 1997. Identification of otx2 target genes and restrictions in ectodermal competence during Xenopus cement gland formation. Development 124, 471-481.

Gammill, L.S., Sive, H., 2000. Coincidence of otx2 and BMP4 signaling correlates with Xenopus cement gland formation. Mech Dev 92, 217-226. Gammill, L.S., Sive, H., 2001. otx2 expression in the ectoderm activates anterior neural determination and is required for Xenopus cement gland formation. Dev Biol 240, 223-236. Hama, J., Suri, C., Haremaki, T., Weinstein, D.C., 2002. The molecular basis of Src kinase specificity during vertebrate mesoderm formation. J Biol Chem 277, 19806-19810. Hawley, S.H., Wunnenberg-Stapleton, K., Hashimoto, C., Laurent, M.N., Watabe, T., Blumberg, B.W., Cho, K.W., 1995. Disruption of BMP signals in embryonic Xenopus ectoderm leads to direct neural induction. Genes Dev 9, 2923-2935. Hemmati-Brivanlou, A., Kelly, O.G., Melton, D.A., 1994. Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell 77, 283-295. Hemmati-Brivanlou, A., Melton, D.A., 1994. Inhibition of activin receptor signaling promotes neuralization in Xenopus. Cell 77, 273-281. Hollemann, T., Pieler, T., 1999. Xpitx-1: a homeobox gene expressed during pituitary and cement gland formation of Xenopus embryos. Mech Dev 88, 249-252. Iemura, S., Yamamoto, T.S., Takagi, C., Uchiyama, H., Natsume, T., Shimasaki, S., Sugino, H., Ueno, N., 1998. Direct binding of follistatin to a complex of bone-morphogenetic protein and its receptor inhibits ventral and epidermal cell fates in early Xenopus embryo. Proc Natl Acad Sci U S A 95, 9337-9342. Jamrich, M., Sato, S., 1989. Differential gene expression in the anterior neural plate during gastrulation of Xenopus laevis. Development 105, 779-786. Kalkan, T., Iwasaki, Y., Park, C.Y., Thomsen, G.H., 2009. Tumor necrosis factor-receptor- associated factor-4 is a positive regulator of transforming growth factor-beta signaling that affects neural crest formation. Mol Biol Cell 20, 3436-3450. Kessler, D.S., 1997. Siamois is required for formation of Spemann's organizer. Proc Natl Acad Sci U S A 94, 13017-13022. Kim, E.S., Sohn, Y.W., Moon, A., 2007. TGF-beta-induced transcriptional activation of MMP-2 is mediated by activating transcription factor (ATF)2 in human breast epithelial cells. Cancer Lett 252, 147-156. Knecht, A.K., Harland, R.M., 1997. Mechanisms of dorsal-ventral patterning in noggin-induced neural tissue. Development 124, 2477-2488.

Kondaiah, P., Sands, M.J., Smith, J.M., Fields, A., Roberts, A.B., Sporn, M.B., Melton, D.A., 1990. Identification of a novel transforming growth factor-beta (TGF-beta 5) mRNA in Xenopus laevis. J Biol Chem 265, 1089-1093. Krieg, P.A., Varnum, S.M., Wormington, W.M., Melton, D.A., 1989. The mRNA encoding elongation factor 1-alpha (EF-1 alpha) is a major transcript at the midblastula transition in Xenopus. Dev Biol 133, 93-100. Lanctot, C., Lamolet, B., Drouin, J., 1997. The bicoid-related homeoprotein Ptx1 defines the most anterior domain of the embryo and differentiates posterior from anterior lateral mesoderm. Development 124, 2807-2817. Lee, H.X., Ambrosio, A.L., Reversade, B., De Robertis, E.M., 2006. Embryonic dorsal-ventral signaling: secreted frizzled-related proteins as inhibitors of tolloid proteinases. Cell 124, 147-159. Lim, J.Y., Park, S.J., Hwang, H.Y., Park, E.J., Nam, J.H., Kim, J., Park, S.I., 2005. TGF-beta1 induces cardiac hypertrophic responses via PKC-dependent ATF-2 activation. J Mol Cell Cardiol 39, 627- 636. Mercurio, S., Latinkic, B., Itasaki, N., Krumlauf, R., Smith, J.C., 2004. Connective-tissue growth factor modulates WNT signalling and interacts with the WNT receptor complex. Development 131, 2137-2147. Murato, Y., Hashimoto, C., 2009. Xhairy2 functions in Xenopus lens development by regulating p27(xic1) expression. Dev Dyn 238, 2179-2192. Newman, C.S., Krieg, P.A., 2002. Xenopus bagpipe-related gene, koza, may play a role in regulation of cell proliferation. Dev Dyn 225, 571-580. Novoselov, V.V., Alexandrova, E.M., Ermakova, G.V., Zaraisky, A.G., 2003. Expression zones of three novel genes abut the developing anterior neural plate of Xenopus embryo. Gene Expr Patterns 3, 225-230. Nudi, M., Ouimette, J.F., Drouin, J., 2005. Bone morphogenic protein (Smad)-mediated repression of proopiomelanocortin transcription by interference with Pitx/Tpit activity. Mol Endocrinol 19, 1329-1342. Pascal, A., Riou, J.F., Carron, C., Boucaut, J.C., Umbhauer, M., 2001. Cloning and developmental expression of STAT5 in Xenopus laevis. Mech Dev 106, 171-174. Pera, E.M., Ikeda, A., Eivers, E., De Robertis, E.M., 2003. Integration of IGF, FGF, and anti-BMP signals via Smad1 phosphorylation in neural induction. Genes Dev 17, 3023-3028. Proctor, G.B., 2016. The physiology of salivary secretion. Periodontol 2000 70, 11-25.

Reversade, B., De Robertis, E.M., 2005. Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field. Cell 123, 1147-1160. Rosa, F.M., 1989. Mix.1, a homeobox mRNA inducible by mesoderm inducers, is expressed mostly in the presumptive endodermal cells of Xenopus embryos. Cell 57, 965-974. Schweickert, A., Deissler, K., Blum, M., Steinbeisser, H., 2001a. Pitx1 and Pitx2c are required for ectopic cement gland formation in Xenopus laevis. Genesis 30, 144-148. Schweickert, A., Steinbeisser, H., Blum, M., 2001b. Differential gene expression of Xenopus Pitx1, Pitx2b and Pitx2c during cement gland, stomodeum and pituitary development. Mech Dev 107, 191-194. Sive, H., Bradley, L., 1996. A sticky problem: the Xenopus cement gland as a paradigm for anteroposterior patterning. Dev Dyn 205, 265-280. Sive, H.L., Hattori, K., Weintraub, H., 1989. Progressive determination during formation of the anteroposterior axis in Xenopus laevis. Cell 58, 171-180. Smith, A., Robinson, V., Patel, K., Wilkinson, D.G., 1997. The EphA4 and EphB1 receptor tyrosine kinases and ephrin-B2 ligand regulate targeted migration of branchial neural crest cells. Curr Biol 7, 561-570. Smith, W.C., Harland, R.M., 1992. Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell 70, 829-840. Suri, C., Haremaki, T., Weinstein, D.C., 2005. Xema, a foxi-class gene expressed in the gastrula stage Xenopus ectoderm, is required for the suppression of mesendoderm. Development 132, 2733-2742. Suzuki, A., Chang, C., Yingling, J.M., Wang, X.F., Hemmati-Brivanlou, A., 1997a. Smad5 induces ventral fates in Xenopus embryo. Dev Biol 184, 402-405. Suzuki, A., Kaneko, E., Ueno, N., Hemmati-Brivanlou, A., 1997b. Regulation of epidermal induction by BMP2 and BMP7 signaling. Dev Biol 189, 112-122. Suzuki, M., Hara, Y., Takagi, C., Yamamoto, T.S., Ueno, N., 2010. MID1 and MID2 are required for Xenopus neural tube closure through the regulation of microtubule organization. Development 137, 2329-2339. Szeto, D.P., Rodriguez-Esteban, C., Ryan, A.K., O'Connell, S.M., Liu, F., Kioussi, C., Gleiberman, A.S., Izpisua-Belmonte, J.C., Rosenfeld, M.G., 1999. Role of the Bicoid-related homeodomain factor Pitx1 in specifying hindlimb morphogenesis and pituitary development. Genes Dev 13, 484-494.

Varley, J.E., McPherson, C.E., Zou, H., Niswander, L., Maxwell, G.D., 1998. Expression of a constitutively active type I BMP receptor using a retroviral vector promotes the development of adrenergic cells in neural crest cultures. Dev Biol 196, 107-118. Vignali, R., Colombetti, S., Lupo, G., Zhang, W., Stachel, S., Harland, R.M., Barsacchi, G., 2000. Xotx5b, a new member of the Otx gene family, may be involved in anterior and eye development in Xenopus laevis. Mech Dev 96, 3-13. Vonica, A., Brivanlou, A.H., 2007. The left-right axis is regulated by the interplay of Coco, Xnr1 and derriere in Xenopus embryos. Dev Biol 303, 281-294. Wardle, F.C., Sive, H.L., 2003. What's your position? the Xenopus cement gland as a paradigm of regional specification. Bioessays 25, 717-726. Wardle, F.C., Wainstock, D.H., Sive, H.L., 2002. Cement gland-specific activation of the Xag1 promoter is regulated by co-operation of putative Ets and ATF/CREB transcription factors. Development 129, 4387-4397. Weinstein, D.C., Hemmati-Brivanlou, A., 1999. Neural induction. Annu Rev Cell Dev Biol 15, 411- 433. Wilson, P.A., Hemmati-Brivanlou, A., 1995. Induction of epidermis and inhibition of neural fate by Bmp-4. Nature 376, 331-333. Wilson, P.A., Lagna, G., Suzuki, A., Hemmati-Brivanlou, A., 1997. Concentration-dependent patterning of the Xenopus ectoderm by BMP4 and its signal transducer Smad1. Development 124, 3177-3184. Xu, R.H., Kim, J., Taira, M., Zhan, S., Sredni, D., Kung, H.F., 1995. A dominant negative bone morphogenetic protein 4 receptor causes neuralization in Xenopus ectoderm. Biochem Biophys Res Commun 212, 212-219. Yuan, L., Cao, Y., Oswald, F., Knochel, W., 2008. IRE1beta is required for mesoderm formation in Xenopus embryos. Mech Dev 125, 207-222.

26 © 2018. This manuscript version is made available under the CC-BY-NC-ND 4.0 license http://creativecommons.org/licenses/by-nc-nd/4.0/ © 2018. This manuscript version is made available under the CC-BY-NC-ND 4.0 license http://creativecommons.org/licenses/by-nc-nd/4.0/ © 2018. This manuscript version is made available under the CC-BY-NC-ND 4.0 license http://creativecommons.org/licenses/by-nc-nd/4.0/ © 2018. This manuscript version is made available under the CC-BY-NC-ND 4.0 license http://creativecommons.org/licenses/by-nc-nd/4.0/ © 2018. This manuscript version is made available under the CC-BY-NC-ND 4.0 license http://creativecommons.org/licenses/by-nc-nd/4.0/ © 2018. This manuscript version is made available under the CC-BY-NC-ND 4.0 license http://creativecommons.org/licenses/by-nc-nd/4.0/