Submitted for partial fulfillment of Doctor of Philosophy (PhD)

ANALYSING THE ROLE OF AUTOPHAGY IN ALZHEIMER’S DISEASE PATHOGENESIS USING THE ZEBRAFISH MODEL SYSTEM

Swamynathan Ganesan

Supervised by Assoc. Prof. Michael Lardelli and Prof. Rob Richards

Discipline of Genetics and Evolution

School of Biological Sciences

The University of Adelaide

Australia Table of contents

Acknowledgements 1

List of Publications contributed to during Ph.D. candidature 3

Abstract 4

CHAPTER I

Introduction 6

Summary of Chapters II-VI and links between them 39

CHAPTER II 41

Research Paper 1 42

CHAPTER III 57

Research Paper 2 58

CHAPTER IV 83

Research Paper 3 84

CHAPTER V 111

Research Paper 4 112

CHAPTER VI 130

Research Paper 5 131

CHAPTER VII 151

Discussion 152

References 162

APPENDIX 191

Research Paper 6 192

i

Abbreviations

Ab Antibody

BSA Bovine Serum Albumin cDNA Complementary Deoxyribonucleic acid

Ct Cycle threshold

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid dNTP Dinucleotide triphosphate

EDTA Ethylene diamine tetra-acetic acid gDNA Genomic DNA mg Milligram ml Milliliter mRNA Messenger Ribonucleic acid

MW Molecular Weight nM Nano molar

°C Degree Celcius

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

RNA Ribonucleic acid rpm Revolutions per minute

RT Room temperature

µg Microgram

µL Microliter

µM Micromolar

iii

Acknowledgements

I would like to thank my supervisor, Associate Prof. Michael Lardelli, for giving me an opportunity to work in an exciting project. Your continued guidance, support and patience throughout the project are the reasons for my successful completion. Your knowledge and passion towards science are some of the things I admired and without your support and guidance this thesis would not have been possible. You have been an excellent supervisor and have shaped up my critical thinking abilities.

I would like to thank Prof. Rob Richards, my co-supervisor for giving valuable suggestions to improve my project during meetings and discussions. A special thanks to

Prof. Frank Grutzner for organising the reviews and meeting and for your feedbacks.

I would like to thank my collaborators in Perth, especially Prof. Ralph Martins,

Dr. Giuseppe Verdile and Dr. Prashant Bharadwaj for providing me support and guidance throughout my project.

I would like to thank Dr. Morgan Newman, for helping me throughout my project and always ready to assist and guide me when I am stuck. You have been a great support for me and without your help it would have been difficult for me to finish on time.

I would like to thank the members of the Alzheimer’s disease genetics laboratory,

Dr. Esmaeil, Dr. Lachlan, Tanya, Haowei, Matt, Kate for your support, assistance and advice.

1

Special thanks to Dr. Hani and Anne Lim for being there for me for the past 4 years and providing me with all the encouragement, support and guidance for finishing my thesis.

I had the most memorable years spending with you guys and which I will cherish forever.

A special thanks to all the past and present members of the Genetics discipline particularly, Dr. Simon, Dr. Zeeshan, Dr. Clare, Dr. Saumya, Dr. Amanda, Dr. Rakesh,

Dr. Zhipeng, Adrian, Ashfiqul Alam and Dawei for the advice and help during the course of my project.

I would like to express my gratitude to the University of Adelaide for providing me scholarship and funding for this project.

I would like to thank all my friends especially to Dr. Arunesh and Reuben Jacob. You guys have been there for me in my good and bad times and I am really grateful for that.

Thanks for all the odd hour chats and discussions. Thanks for the distractions you guys provided when I am stuck up with my project. I wouldn’t have completed this without your support and help.

Finally, I would like to thank all my family members especially my wife, for being the pillar of support during my studies. I am forever grateful to my mum and dad for their love and support.

2

LIST OF PUBLICATIONS CONTRIBUTED TO DURING

Ph.D. CANDIDATURE

Identification and expression analysis of the zebrafish orthologues of mammalian MAP1LC3 gene family.

Swamynathan Ganesan, Seyyed Hani Moussavi Nik, Morgan Newman, Michael Lardelli.

Experimental Cell Research, 2014

Hypoxia alters expression of Zebrafish Microtubule-associated protein Tau (mapta, maptb) gene transcripts.

Seyyed Hani Moussavi Nik, Morgan Newman, Swamynathan Ganesan, Mengqi Chen, Ralph Martins, Giuseppe Verdile and Michael Lardelli.

BMC Research Notes, 2014

3

Abstract

Alzheimer’s disease (AD) is the most common form of dementia and is characterized by the formation of neuritic plaques and neurofibrillary tangles in the brain. The plaques are composed of β-amyloid peptides resulting from the cleavage of the

Amyloid Precursor Protein (AβPP) by β-secretase and then by γ-secretase. Failure in clearance of these peptides results in the formation of these senile plaques. Autophagy is a degradative pathway in cells responsible for protein clearance and its dysfunction has been implicated in AD pathogenesis. Moreover, the PRESENILINs which are central in AβPP processing also have functional roles in autophagy. Other contributing factors of AD progression such as hypoxia, ER stress, and mitochondrial dysfunction are also related to autophagy.

Zebrafish embryos are a suitable system in which to monitor autophagy and investigate its implications for AD pathogenesis. Assays to monitor autophagy can be carried out efficiently in zebrafish embryos. In Chapter II of this thesis, we identified the zebrafish orthologues of the mammalian MAP1LC3 gene family which is comprised of important proteins involved in autophagy. We identified two genes namely map1lc3a and map1lc3b through phylogeny and conserved synteny analysis. Using the LC3 immunoblot assay, we validated that the LC3II/LC3I ratio is significantly increased in the presence of rapamycin and sodium azide with chloroquine. This was used to confirm that hypoxia induces autophagy in 72 hpf zebrafish larvae. Similarly, results of qPCR assays also showed increased map1lc3a transcript levels in the presence of both rapamycin and sodium azide. However transcript levels of map1lc3b were reduced

4 under these same conditions. In Chapter III of this thesis, we used the LC3 immunoblot assay to monitor the effects of truncations of PRESENILIN proteins on autophagy. PRESENILINs are critical for the autophagy pathway but in our study, truncations of PRESENILIN proteins (zPsen1Δ4 and zPsen2Δ4) do not affect autophagy in zebrafish larvae. We also showed that rapamycin has the ability to induce autophagy in explanted zebrafish adult brains. In Chapter IV, we tested a chemical,

Latrepirdine, to see whether it can induce autophagy in zebrafish larvae. Using the LC3 immunoblot assay and TEM analysis we showed that Latrepirdine at a 5µM concentration can induce autophagy in zebrafish larvae. As a continuation, in

Chapter V, we tested two Latrepirdine-related drugs (Harmol and P7C3) on zebrafish larvae to observe whether they show similar effects. Both these drugs did not appear to have an effect on autophagy or apoptosis in 72 hpf zebrafish larvae. In Chapter VI we developed a novel assay based on poly-glutamine repeats fused to GFP (polyQ80-GFP) to monitor autophagy. Using this assay we showed that polyQ degradation in cells occur in an autophagy-dependent manner. This assay will be a useful tool to monitor autophagy in zebrafish larvae in future. In conclusion, zebrafish serves as an excellent tool to analyze autophagy. Various assays to monitor autophagy can be efficiently carried out using zebrafish embryos.

5

Chapter I

Literature Review

6

Introduction

AD is a progressive neurodegenerative disorder and the most common form of age- associated dementia [1]. Nearly 18 million people are affected by this disease worldwide. Also it is quite alarming to know that by 2025 there will be 34 million people with AD worldwide. The major contributing factor in this increase is ageing of the world’s population. Other environmental factors include lifestyle changes, high cholesterol diet, lack of exercise, head trauma, smoking and depression. Increasing age correlates with the aggregation of misfolded proteins and failure in clearance leading to the death of neurons which is manifested in most neurodegenerative diseases. Among

AD patients nearly 95% of these suffer from sporadic AD, while the remaining 5% suffer from Familial Alzheimer’s Disease (FAD) [1]. The familial forms show

Autosomal Dominant inheritance which may be attributed to mutations. In comparison, sporadic AD does not exhibit any dominant inheritance pattern but genetic risk factors are certainly involved. In spite of the differences between sporadic AD and FAD at the genetic level, they share similarities in histopathological features exhibited during the disease. The primary symptoms of both these forms relate to impairment of learning and memory characterised by language problems, recall of old memories (episodic memory) and remembering learned facts (semantic memory) [2]. The various molecular events which contribute to disease progression finally cause neurodegeneration which eventually manifests as behavioural and neuropsychiatric changes.

1. Genetics of AD pathogenesis & Neurodegeneration

The major pathological features observed during AD are neuritic plaques and neurofibrillary tangles (NFT) [3]. These are localised in particular areas of the cerebral cortex namely the frontal lobe governing intelligence, the temporal lobe governing 7

memory and the parietal lobe governing language [4]. Deposition and accumulation of amyloid β peptide causes neuritic plaques while aggregation of hyperphosphorylated tau protein (microtubule associated protein tau, MAPT) causes NFTs. The neuritic plaques are composed of a central core of amyloid surrounded by astrocytes and microglia [5]. The deposition of neuritic plaques and NFTs is correlated with the triggering of a series of dysfunctions in cellular processes leading to cell death [5].

The APP gene coding for the AMYLOID BETA A4 PRECURSOR PROTEIN, was the first gene to be identified with mutations giving inherited susceptibility to FAD. APP is a type I transmembrane domain protein expressed in various tissues. APP is proteolytically processed by β-secretase to form a C-99 fragment which is then further cleaved by γ-secretase resulting in the formation of Aβ peptides [6]. According to the β- amyloid hypothesis there is a disruption in the mechanism of proteolytic cleavage arising either from mutations in the APP gene or associated Presenilin 1 and 2 genes which results in the over production of Aβ peptides [3]. The proteolytic cleavage of

APP by γ-secretase results in the formation of β-40 and β-42 peptides [7]. The β-42 peptide is noted to be an important component of Aβ plaques with the β42/ β40 ratio possibly determining pathogenesis [8]. Aβ monomers polymerise to form the protofibrils which aggregate to form fibrils. The fibrils are 7-10 mm in diameter and interact with several other proteins leading finally to the accumulation of Aβ as amyloid plaques outside neuronal cells [9]. Together with NFTs these trigger the inflammatory pathways leading to neuronal death. The role of Aβ peptides in AD progression is debatable with certain studies completely ruling out the effects of β-amyloid in AD pathogenesis [1]. However the β-amyloid hypothesis suggests that APP acts as a central platform coordinating the cumulative effects seen in AD pathogenesis.

8

Extracellular

Plasma Membrane

Intracellular

Figure 1 – Processing of AMYLOID BETA A4 PRECURSOR PROTEIN. Proteolytic cleavage by β-secretase and γ-secretase forms β-amyloid. (Diagram taken from Zhang et al 2007) [10].

1.1. The Presenilins and γ-secretase complex

The PRESENILIN proteins (PSEN1 and PSEN2) are components of the γ-secretase complex [11]. They are transmembrane proteins which catalyze intramembranous cleavage of various membrane proteins including Notch, Jagged, E-cadherin and APP

[12]. They have been recently localized to the MAM (Microtubule Associated

Membrane) which forms a bridge between the ER and Mitochondria [13]. The MAM is a specialized compartment of the ER comprising the MAM proteins designed for specific functions such as lipid metabolism, calcium homeostasis and proteolytic processing [14]. The PSEN1 and PSEN2 genes have been mapped in chromosomes 14 and 1 respectively. The Presenilin hypothesis is based on the fact that mutations in these

9

two genes are responsible for aberrant cleavage of APP by the γ-secretase complex resulting in the accumulation and formation of β-amyloid plaques [15]. The fact that nearly 200 mutations have been identified in the presenilin genes with dominant negative effects supports the hypothesis. γ-secretase complexes also contain nicastrin

(NCT), anterior pharynx defective-1 (APH1) and presenilin enhancer γ-secretase subunit (PSENEN) proteins [16]. The complex is stabilised by APH1 and NCT while

PSENEN enhances the proteolytic activity of the complex [17]. APP is cleaved first by

β-secretase to leave a transmembrane C-99 fragment which is acted upon by the γ- secretase complex to liberate the β42 and β40 peptides along with AICD (The APP

Intracellular Domain) [18]. Kogel et al have shown that AICD levels causes transcriptional repression of Alzheimer’s disease susceptibility genes thereby making neurons prone to ER stress-induced apoptosis [19]. Also, mutations in PSEN1 are known to disrupt cholesterol metabolism, calcium homeostasis and mitochondrial dynamics [20]. However the exact mechanisms by which these gene mutations contribute to AD pathology is yet to be fully understood.

Figure 2 - Structure of the Presenilins and γ-secretase complex (Diagram taken from

De Strooper et al - 2008) [21]. 10

1.2. The Autophagy Hypothesis

Autophagy is one of the major degradative pathways for long lived proteins and organelles. It is essential for maintaining the balance between protein synthesis and degradation (Protein turnover) [22]. The autophagic pathway occurs at basal levels under normal conditions but can be upregulated under stress conditions [23]. It plays a crucial role in various biochemical pathways of embryogenesis, growth and development [24]. Three types of autophagy occur in cells. Macroautophagy is the most common and involves the degradation of cellular materials through specialized structures called autophagosomes. Microautophagy involves the direct degradation of cytoplasmic organelles and proteins by lysosomes. A specialized type of autophagy referred to as Chaperone-mediated autophagy involves the degradation of specific peptides that are recognised by the chaperone proteins [25]. Autophagy can play a critical role in degrading neuritic peptides and tangles which are the pathological features observed in AD progression [26]. Studies in AD patients have consistently shown the failure of autophagy which clearly highlights the role played by autophagy in

AD [27]. There are reports identifying the increased presence of autophagosomes and lysosomes in the neocortex region of AD brain which clearly indicates that autophagy is stalled [28]. Pathogenic mutations in APP and PRESENILIN (PSEN1 and PSEN2), involved in AD progression also plays a key role in disrupting lysosomal function suggesting that these factors are interlinked [29]. PRESENILINs are needed for the targeting of V-ATPase Vo a1 subunit to lysosomes and also for the activation of lysosomal proteases during autophagy [28]. PSEN1 mutations in the fibroblasts of AD patients cause impairment of autophagy and accelerate neuronal cell death due to β- amyloid aggregation [30]. Overexpression of the APP gene in mice results in the disruption of the autophagic pathway but the mechanism is not well understood [31]. 11

This evidence supports that the failure of autophagy in neurons is a primary event that triggers neuronal accumulation of autophagic vacuoles (AV) containing APP metabolites and Aβ in AD brain. Recently it has been shown that defects in autophagy causes β-amyloid accumulation which leads to cognitive dysfunction and neurodegeneration [32]. Also Nixon et al have shown that there is an accumulation of autophagic vacuoles (AV) due to the failure in the fusion of these AVs to the lysosomes in neurons even when autophagy is induced [33]. This shows that autophagic induction is not by itself sufficient and also requires the lysosomal fusion of the autophagic vacuoles (AV) for the pathway to have an effect.

Figure 3 - Types of autophagy pathway occurring in cells (Diagram taken from

Okamoto et al – 2014) [34]. 12

2. Autophagy-lysosome pathway (Macroautophagy)

The autophagy-lysosome pathway is a complex pathway involving the interactions of multiple protein complexes and is not fully elucidated. There are nearly 30 ATG

(Autophagy Related Genes) genes identified in yeast, most of them constitutively expressed [35]. A number of genes can influence the induction and inhibition of autophagy. The ribosomal protein S6 when phosphorylated by Tor (Target of

Rapamycin) kinase inhibits autophagy [36]. Dephosphorylation of S6 protein by inhibition of Tor kinase using rapamycin treatment induces autophagy [37].

Experimental evidence suggests that during phosphorylation, Tap42 is phosphorylated by Tor2 which interacts with PP2A (Protein Phosphatase) and inhibits its activity [38].

Rapamycin treatment inhibits the activity of Tor2 and, subsequently, Tap42 thereby enhancing the activity of PP2A [39]. The drug rapamycin is a macrolide antibiotic with immune suppressant properties and a potent inducer of autophagy. It binds to its receptor FKBP-12 and this complex binds to mTOR thereby inhibiting its activity. This event enhances the dephosphorylation activity of PP2A leading to the induction of autophagy. Studies using mouse models have shown that rapamycin induces autophagy and could be used as a drug to reduce Aβ deposition in earlier stages of FAD [40].

Rapamycin has been shown to increase the life span of genetically modified mice by inhibiting the mTOR signalling pathway [41].

Another important complex in autophagy is the ATG13-ATG1 complex. ATG1 is an important protein kinase which is involved not only in the autophagic pathway but also in the Cvt pathway. The Cvt pathway (Cytoplasm to Vacuole Targeting pathway) involves the transport of the precursor proteins of various hydrolytic enzymes from the cytoplasm to vacuoles for their activation [42]. One interesting factor observed is that

13

the Cvt pathway occurs in nutrient rich conditions while the autophagic pathway is involved in starvation conditions. ATG1 is known to play a role in switching between the two pathways depending on the nutrient conditions. Tor is activated under nutrient rich conditions which phosphorylates ATG13 and prevents it from binding to ATG1. So the free ATG1 binds with ATG11 and initiates the Cvt pathway [43]. But under starvation conditions ATG13 is dephosphorylated causing it to bind tightly with ATG1 resulting in triggering of the autophagic pathway [44]. ATG1 then binds with ATG17 which completes the process of autophagic initiation [45].

A protein conjugation system is involved in autophagosome formation which involves the cytoplasmic sequestration process [46]. In this process ATG12 is covalently attached to ATG5 by the action of ATG7 and ATG10 which function as conjugating enzymes. The c-terminal glycine of ATG12 and the cysteine of ATG7 forms a thioester bond [47]. Then ATG12 is transferred to ATG10 where the process of thioester bond formation is repeated. Finally ATG12 forms a covalent linkage with ATG5 which is catalysed by ATG10. The ATG12-ATG5 conjugate is then acted upon by another protein ATG16 forming an ATG12-ATG5-ATG16 complex [48]. This complex plays a critical role in the formation and elongation of autophagosome membrane. Another protein namely ATG8 (LC3- mammalian orthologue), is required for the completion of autophagosome formation. ATG8 conjugates covalently with

Phosphatidylethanolamine (PE) forming an amide bond between the amino group of PE and the c-terminal glycine of ATG8. This is carried out with the help of the ATG7 and

ATG3 proteins [49]. At this point ATG7 protein binds with the autophagosome and is involved in regulating the size of the autophagosome.

14

The movement of the autophagosome to the lysosome is mainly carried out by the proteins of the VPS Complex and SNARE machinery which includes VAM3 and

VAM7 for efficient docking and fusion with the lysosome [50]. The VPS is present as 2 complex systems. Complex 1 consists of VPS34/VPS15/ATG6/ATG14 which is involved in the autophagic pathway whereas Complex 2 consists of

VPS34/VPS15/ATG6/VPS38 that is involved in the Cvt pathway [49]. Also evidence, suggests that microtubules (actin filaments) also play a vital role in autophagosome movement to the lysosome [51]. The proteolytic cleavage of substrates in the lysosome is carried out by cathepsin D which is an acid aspartic endopeptidase [52]. Cathepsin D is encoded by the cat D gene and is the major lysosomal constituent involved in autophagy.

Figure 4 - Autophagy-Lysosome Pathway (Diagram taken from Watada et al – 2010)

[53].

15

3. Autophagy & AD pathogenesis

3.1. Role of autophagy in AD pathology

Autophagy plays an important role in maintaining cell homeostasis and a balance between protein synthesis and protein degradation [54]. Also it is very much needed for recycling of damaged organelles and cellular components. It has a variety of roles at cellular level which are implicated in a number of diseases caused by autophagy dysfunction. Moreover it is associated with numerous neurodegenerative disorders such as Huntington disease, Parkinson’s disease and Alzheimer’s disease [55]. In AD, where there is accumulation of β-amyloid plaques and neurofibrillary tangles, autophagic dysfunction may be a contributing factor. Autophagic dysfunction is believed to be one of the leading causes of failure in clearance of β-amyloid peptides in AD brains resulting in the formation of neuritic plaques and neurofibrillary tangles [56].

Autophagic dysfunction manifests as problems in protein turnover leading to the accumulation of toxic proteins in cells and induction of cell death. Reports have pointed out that dysfunction of the lysosomal system is the major cause for neuronal cell death in AD [57]. One of the major pieces of evidence for this is the presence of autophagosome vacuoles (AV) containing partial protein degradation around neuritic plaques. The accumulation of AV indicates that they are not properly translocated to the lysosome for degradation due to the disruption of the autophagic pathway [56]. These findings suggest that although autophagy is initiated in AD it is not completed, i.e.) the fusion of the autophagosome to the lysosome is impaired resulting in the accumulation of β-amyloid peptides. Another interesting factor observed is that all the AD genes, namely APP, PSEN1 and PSEN2 play a major role in induction of autophagy [58].

However the mechanism by which they affect autophagy is not clearly understood.

16

Autophagosomes filled with β-amyloid are observed in AD brain [57]. Autophagosome vacuole accumulation is seen mainly in older AD patients compared to younger patients supporting that the decline of the autophagy mechanism with age, may be the real culprit. There are conflicting views regarding the roles played by autophagy and their interplay with presenilins in neurodegeneration.

3.2. PRESENILINs

3.2.1. The Structure and function of Presenilin Proteins

PRESENILINs are highly conserved transmembrane proteins, 50kDa in size localized mainly in the ER and Golgi apparatus [59]. Recently, they have been found to be present in the MAM which is a specialized region of the ER interlinking the mitochondria and ER [14]. Studies have shown that they are also expressed in the cell’s plasma membranes, but their levels of expression there are low compared to in the mitochondria or ER [60]. The exact localization and structure of presenilins within the cell is yet to be elucidated and will play an important role in determining their cellular function.

3.2.2. Presenilin Structural Topology

PRESENILINs have been suggested to contain 10 hydrophobic domains using hydropathy plots [61]. These domains differ greatly in their size and hydrophobicity.

Topological evidence suggests that PRESENILINs have a series of TM domains interlinked with hydrophilic loops with the N-terminus and loops serving as potential protein binding sites [61]. One model suggests the presence of 8 hydrophobic domains

17

that span the transmembrane lipid layer with a hydrophilic loop in between the TM6 and TM7 domain (Figure 3) [62]. Also, glycosylation sites introduced into the full length PRESENILIN protein by site directed mutagenesis have revealed that the NH2 - terminal domain faces the cytoplasm while the COOH - terminal faces the luminal space of the ER [63]. The hydrophilic loop domain located between the TM6 and TM7 domains faces the cytoplasm and plays an integral part in presenilin function.

3.2.3. Catalytic sites of the γ-secretase complex

Another important discovery regarding presenilin structure is the presence of aspartate residues in TM6 and TM7 respectively. These aspartates are thought to be the actual catalytic sites of the γ-secretase complex [64]. This supports the idea that presenilins function as aspartyl proteases. Experiments carried out with Asp-mutant presenilins have resulted in lowered Aβ production indicating a role for aspartate residues in APP processing [65], [66]. The presenilin holoprotein is unstable and is actively cleaved by presenilinase in a proteolytic mechanism to yield a 35kDa N-terminal fragment (NTF) and a 20kDa C-terminal fragment (CTF) [67]. These fragments dimerize to form a heterodimer. It has been shown that the heterodimer is more stable than the holoprotein.

3.2.4. Endoproteolysis by Presenilins

Mutations in the aspartate residues of the TM6 and TM7 domains prevent endoproteolysis and heterodimer formation in cell lines [68]. Interestingly, heterodimer formation is limited by cellular factors and is not increased when presenilins are overexpressed [69]. Studies carried out using peptidometric inhibitors blocking aspartyl 18

proteases resulted in blockage of γ-secretase activity [70]. This evidence indicates that a heterodimeric interface containing 2 aspartate residues is the active sites of γ-secretase.

The presenilins and the other proteins of the γ-secretase complex cause the proteolysis of various TM proteins through this aspartate catalytic site. The conserved aspartates are important not only for APP processing but also for the heterodimer formation that protects presenilins from degradation [71].

Figure 5 - PRESENILIN Transmembrane topology (Diagram from De Strooper et al –

2007) [72].

3.2.5. Functions of Presenilin Proteins

Presenilins are essential for performing various cellular activities such as protein processing and trafficking and are involved in various metabolic pathways [73]. Apart from cleaving intramembranous proteins through γ-secretase activity they are also

19

involved in Ca2+ homeostasis and various cellular pathways [74]. Enrico et al reported that presenilins are required to control Ca2+ concentration in the ER. PSEN2 mutants causes Ca2+ leakage from the ER creating an imbalance in shuttling of Ca2+ between

ER and mitochondria [75].

3.2.5.1.Presenilins in signal transduction

Studies have shown that PSEN1 and PSEN2 function is needed for proliferation and signal transduction events in B cells [76]. Presenilins have been shown to play roles during developmental processes especially those involving Notch signalling [77].

Disruption of the murine PSEN1 gene affects the Notch signalling pathway leading to defects in somite and skeleton formation [78]. The sel-12 gene in C.elegans encodes a

Presenilin Sel-12 protein, which is involved in the Notch signalling pathway [79].

Another signalling pathway that is influenced by PSEN1 is the Wnt signalling pathway where presenilins interact with catenins [80].

3.2.5.2.Presenilins in Apoptosis

In addition to Notch signalling and Wnt signaling pathways, presenilins also play an important role in apoptosis. Apoptosis is essential for maintaining the correct number of cells in an organism [81]. Studies using C.elegans have reported 3 genes to be involved in apoptosis namely Ced-3, Ced-4 and Ced-9 [82]. Caspases (mammalian homologues of Ced-3) serve as apoptotic signals and induces apoptosis in cells, whereas Bcl-2

2+ (mammalian homologue of Ced-9) prevents apoptosis by lowering Ca levels in mitochondria [83]. The activation of caspases is dependent on cell type and the type of receptors which serve as apoptotic signals [84]. These caspases are involved in cleaving a wide range of substrates and, more importantly, they cleave presenilins [85].

20

There is experimental evidence showing that presenilins binds to proteins involved in cell adhesion and signalling pathways [86]. Studies on differentiated PC12 cells transfected with full length PSEN2 showed enhanced apoptosis while injection with antisense PSEN2 constructs protected against apoptosis [87]. Overexpression of presenilins enhances apoptosis through H2O2, β-amyloid or through TNF-α that act as apoptotic signals [87]. Wild type PSEN2 has been shown to inhibit the NFκB/JNK cascade which is the signal transduction pathway preceding apoptosis but when cells were transfected with PSEN2 constructs containing a deletion in the TM7 domain they were protected against apoptosis [87]. These findings support the importance of presenilin function in apoptosis.

Figure 6 – Functions of PRESENILIN proteins. The PRESENILIN proteins interact with various molecular processes in cells and have multi-functional roles.

21

3.3. Mutations and Alternative Splicing of Presenilin Genes

Sato et al used positional cloning approaches and was successful in identifying PSEN1 as a candidate gene of AD [88]. Mutations in the presenilin genes are thought to be a cause of FAD. There are nearly 200 mutations identified in the presenilins with 185 mutations identified in PSEN1 alone. The majority of the mutations identified correspond to exon7 (42) and exon5 (38) of PSEN1. Also the TM3 (19) and TM5 (17) domains of PSEN1 are the regions showing the highest number of mutations. One interesting observation with these mutations is that these mutations never result in a truncation or loss of the protein [72]. The earlier evidence of missense mutations led to the belief that there is a gain of function due to these mutations [89]. Now recent studies have shown that there is a loss of γ-secretase activity associated with these mutations.

3.3.1. Mutations in the Catalytic sites of the Presenilins

As discussed earlier, mutations in the conserved aspartate residues present between

TM6 and TM7 affect both the maturation of presenilins and also their activity in γ- secretase complexes [90]. The Asp257 residue of PSEN1 when mutated causes a decrease in the cleavage and production of NICD of Notch signalling pathway [91].

Kulic et al have reported that the Asp286 mutation affects Notch signalling but not APP cleavage suggesting that PSEN1 has different catalytic sites for the pathways [92]. In contrast, mutating a CTF aspartyl residue affects both the Notch and APP processing.

Also, mutating both the aspartate residues (Asp257 and Asp285) results in reduced β- amyloid production, but an increase in the C-99 fragment suggesting impaired γ- secretase activity [68]. Another interesting piece of evidence is that there is an increase in the Aβ42/ Aβ40 ratio linked to certain PSEN1 mutations in FAD, while some mutations do not interfere with Aβ42/ Aβ40 ratio [93]. Mutations at conserved residues 22

result in altered Aβ and an increase in the Aβ42/ Aβ40 ratio. Nearly 75% of the mutations identified were found in highly conserved residues which suggest the importance of these mutations in AD pathology.

3.3.2. Effect of mutations on Notch Signaling & APP Processing

Song et al have shown that proteolytic release of NICD in Notch signalling is impaired by PSEN1 mutations [94]. Also FAD linked mutations result in accumulation of β- catenin which is a proteolytic substrate of the presenilins [95]. PSEN1 mutations have also been shown to inhibit the PI3K pathway and to cause over phosphorylation of tau proteins [96]. The Ca2+ pump is also affected by presenilin mutations that cause a Ca2+ leakage from ER [97]. Some PSEN1 mutations result in protein misfolding thereby impairing PSEN1 structure and activity [98]. Landman et al have reported that PSEN1 mutations cause aberrant phosphatidyl inositol 4,5 bis phosphate (PIP2) metabolism which is involved in membrane trafficking in mouse embryonic fibroblasts [20]. This experimental evidence indicates that presenilin mutations lead to a loss of function in the γ-secretase complex. Analysing deeply it can be concluded that there is a loss of function biochemically but gain of function genetically. Therefore more mutations should be examined to support the loss of function theory.

3.3.3. Alternative Splicing of the Presenilin Genes

The presenilin gene consists of 12 exons which undergo alternative splicing to yield different splice forms of varied functions. Two naturally occurring splice forms are the

PS2V splice form in humans and PS1IV in zebrafish. In humans PSEN2 splicing occurs at exon 4 and removes exon 5 thereby joining exon 4 with exon 6 to bring about a truncated protein. Similarly in zebrafish this phenomenon is observed in exon 3 where 23

exon 4 is removed and exon 3 joins with exon 5 to form a truncated protein. Both these splicing events occur naturally and are induced by HMGA1 (High Mobility group protein) under hypoxia [99]. When cells are exposed to hypoxia the Hypoxia Inducing

Factor (HIF) is activated which in turn triggers HMGA1. The triggered HMGA1 binds to exon 5 of human PSEN2 at the splice acceptor sites thereby disrupting its activity and removes exon 5 which leads to the joining of exon 4 and exon 6 to produce a truncated protein. This splicing event is the same in zebrafish but occurs in exon 3 of PSEN1 [99].

The extent to which these alternative splicing events affect presenilin function is relatively unknown. Kwok et al have reported that L271V mutations lacking exon 8 result in a decrease in γ-secretase activity [100]. Similarly, mutation in exon 9 at the splice acceptor site results in effects on the endoproteolytic activity of γ-secretase [71].

Also truncated forms of presenilin have been found in sporadic AD [101]. Also in some frontotemporal dementia (FTD) cases, alternative splicing of presenilin exons are manifested [102]. Nornes et al have used zebrafish embryos to probe the effects of aberrant presenilin splicing. They have reported that aberrant splicing of exon 6 and exon 8 results in production of dominant negative phenotypes. They also reported that the truncated proteins produced interfered with the activity of the holoprotein [103].

This evidence supports the idea that alternative splicing of presenilins interferes with γ- secretase activity and thereby may be a major factor in AD pathology.

3.4. The Role of the Presenilins in autophagy

Researchers have attributed abnormalities in lysosomal system function as one of the main causes of neurodegeneration in AD [104]. They support their finding with the fact that accelerated amyloid processing and NFTs are also present in certain LSD

24

(Lysosomal Storage Disorders). Also autophagic vacuoles with partial digests are observed in a high number in the AD brain when compared to the normal brain suggesting that the autophagic pathway is impaired [27]. The autophagic flux (the rate of formation and clearance of autophagosome) is high in AD brains [105], [106]. Lee et al have shown that PSEN1 is required for lysosomal proteolysis and for autophagic clearance in mice blastocysts [28]. They have identified that PSEN1 is central for maturation and targeting of v-ATPase VO a1 subunit to lysosomes which is necessary for lysosomal acidification. In cells with PSEN1 mutations macroautophagy is stalled

[28]. Another important finding is that PSEN1 regulates the Rab7 and LAMP proteins which are involved in autophagosome maturation [28]. It is evident that presenilins have a role in various other interlinking pathways like Akt, PI3K, upregulation of acid hydrolases of lysosomes and mTOR signalling pathways but the nature of its role still remains unclear. There are contradictory views regarding whether induced autophagy or autophagy failure contributes to AD pathology and it will be important to investigate and understand the role of presenilins in autophagy and neuronal loss. Research should be focussed on what role presenilins play in lysosomal acidification and in activation of lysosomal proteases which remains unclear.

3.5. Function of lysosomal proteases in AD pathology

Cathepsins are major lysosomal proteases expressed in the brain and are essential for lysosomal proteolysis in the autophagic pathway. They display optimum activity at a pH of 6.5 which is essential for degrading proteins in the lysosomes. Cathepsin D

(CatD) & Cathepsin B (CatB) are important proteases that play a central role in AD pathology.

25

Cathepsin D (CatD):

The inactive form of CatD (52kDa) is proteolyzed in lysosomes to form light (14kDa) and heavy (32kDa) chains held together by disulphide bonds [107]. The main role of

CatD is to degrade damaged and long lived proteins in the lysosome to help in protein turnover. Aberrant autophagic activity is shown in the mouse brain with deletion at

CatD and the phenotype is similar to that seen in lysosomal storage disorders [108].

Studies in fibroblast cell lines with mutations in PSEN1 (leu392val), PSEN2

(met146leu) and APP (val717leu) have shown that CatD levels are lowered when compared to normal [107]. CatD cleaves apoE to release its NTF which is considered to be toxic, whereas the CTF is found in plaques where it is bound with Aβ [109].

Therefore when autophagy is inhibited through CatD mutation, degradation of apoE is weak and the level of Aβ is increased. In contrast, increased expression of lysosomal enzymes could also be used to protect against neurodegeneration in the early stages of

AD. Van der Hilst et al showed that amyloid fibril accumulation could be halted by increasing CatD expression and activity [110]. Also individuals showing CatD polymorphism rs17571 were at high risk of developing AD even though they were apoEε4 non-carriers [111].

Cathepsin B (CatB):

CatB has been found to colocalize with cysC (a cysteine protease inhibitor) and Aβ1-42 in amyloid plaques [112]. CatB is known to have secretase activity and cleaves APP at the β-secretase cleavage site [113]. Recent studies have indicated an anti-amyloidogenic activity of CatB wherein it causes c-terminal degradation of Aβ peptides [114].

Mueller-Steiner et al has shown that CatB induces c-terminal truncation of Aβ1-42 , thereby forming non-toxic peptides and degrading Aβ assemblies and have proposed that decreased Aβ levels could be achieved by enhancing CatB activity [115]. Another 26

interesting observation is that CatB levels are higher in plasma in AD patients which suggests that CatB expression is high in response to higher Aβ levels in brain [112].

CatB plays a vital role in APP, tau and apoE processing. Reports have suggested that

Aβ induced abnormal protein deposition can be prevented by activating the lysosomal system [116]. These studies highlight that presenilins regulate the mechanism of cathepsins and therefore the cathepsins could be modulated to have a protective effect in AD.

4. Chemical Modulators of autophagy :

4.1. Modulation of mTOR signaling pathway :

The mammalian target of rapamycin (mTOR) is a catalytic subunit composed of two distinct subunits namely the mTORC1 (complex 1) and mTORC2 (complex 2) [117]. It is a serine-threonine kinase belonging to a highly conserved phosphatidylinositol kinase related protein family [118]. Interestingly, there seems to be a high level of homology between the protein sequences across different eukaryotes with several structural motifs conserved [119]. The mTORC1 complex consists of mLST8/GβL, PRAS40 (proline- rich Akt substrate of 40kDa), Raptor (regulatory-associated protein of mTOR) and

Deptor (DEP domain contacting mTOR-interacting protein) [120]. It has been shown that environmental factors such as nutrients, growth factors and stress can regulate the mTORC1 complex [121]. Phosphorylation of mTORC2, the other kinase subunit of the complex leads to the activation of the Akt pathway [122]. PI3-kinase acts as an upstream activator of the mTOR signaling pathway while the S6 kinases (S6K) serve as the best characterised downstream effectors [123]. The mTOR signaling pathway is required for growth and development and disruption of this mTOR pathway results in 27

embryonic lethality and developmental defects [124]. Dysregulation of the mTOR signalling pathway has been linked to numerous human diseases including immunological disorders, cardiovascular diseases, metabolic diseases, neurological diseases and cancer which suggest the critical role played by the pathway in proper functioning of the cell [123]. Studies have shown that increased mTOR activity results in an over experession of genes that support the growth, proliferation and survival of cancer cells [125]. Shah et al have reported that persistent mTOR activation may result in downregulation of insulin signaling which is one of the risk factors for type 2 diabetes [126]. Experiments carried out on transgenic mice have shown that mTOR inhibition by rapamycin prevents cardiac hypertrophy showing that stress induced cardiac hypertrophy is related to mTOR signaling pathway [127]. Reports have suggested that mTOR signaling is essential to maintain the cellular homeostasis critical for the health of cells of the nervous system [128].

4.2. Mechanism of autophagy induction using chemical inducers:

The Autophagy pathway has been shown to have a protective role in several neurodegenerative disorders [129]. Recent studies show that mTOR inhibitors might clear accumulated protein aggregates which are characteristic pathological hallmarks seen in neurological disorders such as Huntington’s disease and Alzheimer’s disease

[130]. Several chemicals have been tested for their inhibitory effects of the mTOR pathway. Rapamycin is one of the drugs that has shown promising effects and commonly used to induce autophagy across different model organisms. Rapamycin, also known as sirolimus is a natural product found in a species of streptomyces bacteria

[131]. It was originally used as an anti-bacterial and anti-fungal drug. It has been a US- 28

FDA approved immunosuppressant drug for several years and is also commonly used for the treatment of cardiovascular diseases [132]. Several recent studies have used rapamycin as an autophagy inducer to reduce the accumulation of damaged peptides which are seen in several neurodegenerative diseases [133]. Research using mammalian cells has shown that rapamycin induces autophagy by inhibiting the kinase activity of mTOR by enabling formation of a complex between raptor-mTOR and immunophilin

FK506-binding protein of 12kDa (FKBP12) [134]. Dehay et al have shown that dopaminergic nigrostriatal degeneration could be attenuated by the addition of rapamycin as it counteracts the molecular changes linked with ageing [135] .

Interestingly, studies carried out on a mouse model of Parkinson’s disease concluded the neuroprotective effects of rapamycin are due to its ability to induce lysosome mediated autophagic degradation [136]. Rapamycin has been shown to induce autophagy in a number of model organisms and cell lines. Currently several studies are being carried out in zebrafish using rapamycin to efficiently induce autophagy and provide protective effects against neurodegeneration. Since Rapamycin is shown to have several side effects, research to explore other drugs with similar effects is currently being pursued.

Another potential mTOR inhibitor which is currently being tested is Torin1. Torin1 is a chemical compound belonging to the family of pyridinonequinoline class of kinase inhibitors [137]. Torin1 has been shown to inhibit both the mTORC1 and mTORC2 complex by directly binding to the kinase domain [138]. They are a class of compounds that compete with ATP to bind to mTORC2 and thereby block autophagy [139]. It has a much better blocking effect of the mTOR complex than rapamycin since it blocks both mTORC1 and mTORC2. It has been shown that Torin1 also block PI3K binding sites

29

as well as inhibiting the mTOR complex and thereby block the upstream PI3K pathway as well [140]. Hong et al based their studies on neuroendocrine lung tumor cells and have suggested that Torin1 could have an effect on the AKT pathway and that there could be crosstalk between the AKT pathway and the autophagy pathway. They found that in cell lines treated with Torin1, expression levels of p62 were increased in comparison to control samples suggesting that the AKT pathway may have an opposing effect on autophagy [141]. Scientists have been successful in identifying another class of compounds named Torin-2 which have a much better synthetic route and pharmacokinetic properties than Torin-1 [142]. Research is now focussed on using

Torin-2 for therapeutic applications as well as to characterise the pathways that are regulated by the Torins.

4.3. Effects of lysosomal inhibitors on autophagic pathway

Autophagy has been shown to play a central role in several metabolic disorders and human diseases [143]. Extensive studies have been carried out to modulate autophagy for treating metabolic disorders [144]. Autophagy can be blocked by chemicals to determine the real autophagic flux occurring in a cell at a particular time point [145].

The autophagic flux at a particular time point can be monitored by determining the conversion of one form of LC3 to another (LC3I to LC3II) [146]. In fact, it is now de rigeur in the field to use lysosomal inhibitors to validate the conversion of LC3I to

LC3II in order to determine the autophagic flux [147]. The use of lysosomal inhibitors blocks the degradation of LC3II and thereby reflects the precise number of autophagosomes in a cell at a particular time point. This will clearly differentiate if a problem in the pathway lies in induction of autophagy or in the step of lysosomal 30

degradation. There are two mechanisms by which these lysosomal inhibitors could have an effect on the autophagy pathway. They could either inhibit the fusion of autophagosomes with lysosomes thereby resulting in the accumulation of non-degraded autophagosomes in the cell [148]. Alternatively they could raise the lysosomal pH and so inhibit the activity of the lysosomal enzymes thereby resulting in the formation of non-degraded or partially degraded autophagosomes [149]. Several compounds have been tested for their use as lysosomal inhibitors in order to modulate the autophagy pathway.

Chloroquine (CQ) is one of the earliest compounds that has been tested to block autophagy pathway [150]. Chloroquine belongs to the 4-aminoquinoline family of compounds and has been used as an anti-malarial drug for decades [151]. It is rapidly absorbed and becomes widely distributed in the body. It is known to be a lysosomotropic compound that inhibits endosomal acidification [152]. Chloroquine accumulates inside lysosomes and increases lysosomal pH, thereby making lysosomal enzymes less active. This inhibition of lysosomal enzymes results in the inhibition of the fusion of autophagosomes with the lysosomes as well as inhibition at lysosomal protein degradation [153]. Accumulation of autophagic vacuoles has been shown to trigger autophagic cell death [154]. Studies carried out on human melanoma cell lines have indicated that Chloroquine can be used effectively to inhibit autophagy.

Furthermore, a study has shown that Chloroquine is cytotoxic to melanoma cells in vitro and might be used as an effective therapy in multiple melanoma cell lines [155].

Chloroquine is known to deplete glutathione and affect the cellular redox state of cells in human glioblastoma cell lines [156]. Geng et al have stated that Chloroquine when added to glioma cells results in the accumulation of autophagosomes and causes cell

31

death which is p53 independent [157]. Zaidi et al have found that Chloroquine induces caspases-3 activation which induces apoptosis in neurons [158]. Also, reports have suggested that autophagy and apoptosis may be interconnected and Chloroquine may affect both pathways [159]. Research is currently being carried out to find the mechanisms by which Chloroquine induces apoptosis or autophagy and the interplay between these two pathways.

Bafilomycin A1 is another drug that has shown promising results as a lysosomal inhibitor in various studies [160]. Bafilomycin belongs to the family of toxic macrolides derived from Streptomyces griseus [161]. In addition to its anti-fungal and anti-bacterial activities it has been shown to have anti-malarial activity as well [162]. Bafilomycin A1 inhibits autophagy by blocking the v-ATPase which is required for lysosomal acidification [163]. Interestingly the activity of Bafilomycin A1 is also dependent on its concentration. Bafilomycin inhibits the vacuolar ATPases at nanomolar concentration whereas at micromolar concentration it inhibits the P-ATPases present in bacteria [164].

Higher concentrations of bafilomycin could induce apoptosis by inhibiting cell growth

[165]. Ohkuma et al have reported that apoptosis is induced by bafilomycin as a result of v-ATPase inhibition and cytosol acidification [166]. Based on these properties

Teplova et al have suggested that Bafilomycin A1 has the ability to impair mitochondrial functions [167]. It has been shown to affect mitochondrial dynamics and cause loss of motility and depolarization of mitochondria in boar spermatozoa [168].

Studies carried out on A431 cell lines have indicated that bafilomycin inhibits the lysosomal degradation of endocytosed EGF completely [149]. Bafilomycin also interferes with the sorting and transport of vacuolar proteins in a cell [169]. Yamamoto et al have used rat hepatoma cell line to show that bafilomycin inhibits the fusion of

32

autophagosomes and lysosomes thereby preventing the degradation of autophagic vacuoles [170]. Interestingly schaka et al tried to look at the neuroprotective effects of bafilomycin and found promising results when bafilomycin is added to cultured cerebellar granule neurons from mice at a very low concentration along with

Chloroquine. In those cells bafilomycin is seen to inhibit Chloroquine-induced apoptosis and thereby provides neuroprotection [154]. This evidence suggests that more studies must be carried out to investigate the role played by bafilomycin in altering mitochondrial and lysosomal dynamics in a cell.

One of the first identified and widely studied autophagy inhibitors is a synthetic intermediate compound called 3-Methyladenine (3-MA) [171]. It is a potent inhibitor of autophagy and primarily interferes with the formation of autophagosomes [172]. 3-MA blocks autophagic flux by inducing the activity of phosphofructokinase and pyruvate kinase primarily caused by glycogen breakdown and release of cAMP [173]. Seglen et al have shown that it decreases the cytoplasmic volume fraction of autophagosomes along with the inhibition of intracellular protein degradation, thereby completely inhibiting autophagy [174]. Interestingly, hepatocytes treated with 3-MA showed a lower density of lysosomes in a Percoll density gradient. Also, the intralysosomal pH was increased when 3-MA was added to intact hepatocytes but not in isolated lysosomes which indicates that possibly a metabolite of 3-MA is actually responsible for this activity [173]. Recent studies have found that 3-MA could act as an autophagy inhibitor by targeting the PI3K pathway and blocking the production of PI3P which is essential for autophagy initiation [175]. Kong and co-workers have shown that 3-MA can inhibit the activity of class I, II, III PI3K but only class III PI3K is involved in autophagy [176]. Experiments carried out on mouse embryonic fibroblast cell lines

33

have concluded that 3-MA may actually have a dual role in modulating autophagy.

They suggest that at optimal concentrations and short exposure times it blocks the PI3K pathway and inhibit autophagy whereas at prolonged exposures it may induce autophagy. They speculate that the induction of autophagy may be due to continuous inhibition of the PI3K pathway. In addition they also found that 3-MA upregulates p62 expression and p62 has been shown to control autophagy and apoptosis [177]. 3-MA is currently widely used to monitor autophagy in different model organisms and has been tested for its therapeutic use in various human diseases.

Other autophagy inhibitors encompass a group of protease inhibitors. These protease inhibitors block specifically the activity of lysosomal proteases and thereby inhibit the degradation of autophagosomes. Some of the major protease inhibitors currently used includes Pepstatin, E-64D and Leupeptin. It has to be noted that these chemicals must be used in combination to obtain the desired effect. Pepstatin A is an aspartyl protease inhibitor that is not membrane permeable and must be used along with E-64D to block autophagy. E-64D is membrane permeable and blocks the activity of lysosomal hydrolases. It is used in combination with Pepstatin A. Leupeptin can be used in combination with either Pepstatin or E-64D and inhibits the activity of cathepsins in lysosomes [147]. Research is currently focussed on identifying inhibitors that specifically inhibit the autophagy pathway without interfering with downstream pathways and which have better therapeutic value.

34

Table 1: Chemical compounds tested for action on autophagy in zebrafish

Inducers of Autophagy Inhibitors of Autophagy

Rapamycin Chloroquine

Torin1 Bafilomycin A1

Tunicamycin 3-Methyladenine

Resveratrol Protease Inhibitors (Pepstatin & E-64D)

Trehalose Wortmannin

5. Novel compounds tested for clearance of β-amyloid by inducing autophagy

5.1. Latrepirdine modulates autophagy

Latrepirdine (DimebonTM) is an antihistamine which was tested as a therapeutic drug for Alzheimer’s disease (AD) and Huntington’s disease (HD) patients [178].

Latrepirdine is a molecule with a heterocyclic conformation and possess a wide range of pharmacological functions. It has been shown to protect mitochondrial function, modulate receptor activities, enhance autophagy and reduce amyloid aggregation in AD mice models [179-182]. Perez et al showed that Latrepirdine alters the hippocampal amyloid pathology and protects against β-amyloid toxicity in AD mice [183]. Similarly

35

it has been shown to possess neuroprotective properties against ischaemic neuronal damage [184].

In a recent report, Bharadwaj et al demonstrated that Latrepirdine upregulates autophagic marker in yeast including an increase in the transport of Atg8 to the vacuole

(lysosome) and enhancing vacuolar activity [185]. Further they also demonstrated that

Latrepirdine has the ability to reduce Aβ42 accumulation and toxicity in an in vitro GFP tagged Aβ yeast expression system [185]. Similar findings of induction of autophagy by

Latrepirdine were observed in mammalian models [186-188]. Steele et al reported that

Latrepirdine can induce mTOR dependent autophagy in cultured mammalian cells

[187]. Similarly, Latrepirdine treatment to AD transgenic mice improved learning behaviour and reduced the accumulation of Aβ42 and α-synuclein [189]. Latrepirdine was also shown to stimulate the degradation of α-synuclein by elevating the autophagy pathway in differentiated human neuroblastoma cells [189]. These studies indicate that

Latrepirdine has the ability to induce the autophagy pathway and thereby enabling the clearance of Aβ aggregates.

5.2. Latrepirdine related compounds and their effects on autophagy

During Phase III clinical trials, Latrepirdine did not show significant effects over placebo; therefore research has been focussed on identifying structural analogues of

Latrepirdine that may be effective for the treatment of AD and other neurodegenerative disorders. The chemical structure of Latrepirdine consists of a β-carboline (9H- pyrido[3,4-b]indole) backbone. The β-carboline backbone is commonly seen in naturally occurring alkaloids. These alkaloids are bioactive class of compounds that have been traditionally used in oriental medicine with a wide range of biological activity [190]. The core indole structure and the pyridine ring of the β-carboline family 36

of alkaloids have been shown to affect multiple CNS targets [191]. Harmol is one of the first β-carboline alkaloid that have been demonstrated to have cytotoxic effects on cancer cells [192]. Abe et al using Human Non-small cell Lung Cancer A549 cell lines demonstrated the ability of harmol to induce cell death via autophagy [193]. Current research is focused on understanding the mode of action and the biochemical pathways altered by these drugs. A recent study identified a new class of carboline compounds, aminopropylcarbazoles (P7C3 and P7C3A20) in an in vivo chemical screen, which enhance hippocampal neurogenesis and ameliorate cognitive decline in adult mice

[182]. In more recent studies, P7C3 was shown to block 1-methyl-4-phenyl-1,2,3,6- tetrahydropyridine (MPTP)-mediated cell death of dopaminergic neurons in a mouse model adult of PD and alleviate loss of motor neurons in the G93A-SOD1 mutant mouse model of ALS [194, 195]. These observations show that P7C3 compounds may regulate similar pathways in cells and provide further proof for the neuroprotective functions of these compounds. Although there are few studies in the literature about

Latrpirdine related compounds, research now is gaining momentum to identify and understand the mode of action of these drugs. Screening and therapeutic assessment of structural analogues of Latrepirdine presents value for structure based drug design and for the development of novel drugs which may provide better options for the treatment of AD and other neurodegenerative diseases in the future.

6. Zebrafish as a model to study autophagy

Recently, zebrafish have been widely used as a vertebrate model to study various genetic and biochemical pathways owing to their fecundity, optical clarity and speed of development [196]. Zebrafish embryos are numerous, optically transparent and can be 37

subjected to various gene manipulation techniques which makes them suitable candidates for in vivo studies of development [197]. Zebrafish is suitable for both blocking of protein translation using morpholinos or for over expression of protein expression by mRNA injection [198]. Also the zebrafish genome possesses genes orthologous to human APP and the PRESENILINs which makes it a suitable system in which to study AD [199]. Newman et al developed a transgenic zebrafish exhibiting β- amyloid toxicity [200]. This laboratory’s recent studies have established the suitability of zebrafish as a model in which to investigate the molecular basis of AD pathology.

Zebrafish remains as a good model system in which the autophagic pathway can be elucidated. Autophagy could be monitored in zebrafish embryos using various established assays and techniques [197]. Gene knock down studies in zebrafish are efficient and cost- effective in comparison with mice have been carried out to determine the role of myotubularins in the regulation of autophagy [201]. He et al developed

GFP-LC3 and GFP-Gabarap transgenic fishes and used them as model systems to assay autophagic activity [202]. Also, zebrafish embryos have been used to screen potential drugs to identify those that can induce autophagy and were effective in identifying novel drugs [203]. Various studies in the past have validated the use of zebrafish as an advantageous vertebrate model system to monitor autophagy. Zebrafish can be used efficiently to analyse autophagy using various chemical modulators to give us better insight of their role in AD pathogenesis.

38

Summary of Chapters and Links between Chapters II-VI

The primary aim of my thesis was to investigate the role of autophagy in Alzheimer’s disease using the zebrafish model system. This involved developing assays to monitor autophagy and also testing of various compounds that can potentially induce autophagy in zebrafish embryos. Although autophagy has been investigated in other model organisms, my work helped to validate various assays for monitoring autophagy in the zebrafish model system. It also enabled us to identify various novel compounds that can be tested for autophagy induction including in AD research.

The II chapter of my thesis is a published paper titled “Identification and expression analysis of the zebrafish orthologues of the mammalian MAP1LC3 gene family”. In this paper I identified the zebrafish orthologues of MAP1LC3A and MAP1LC3B which are important proteins involved in autophagic flux in cells. We characterised the expression of these genes during different stages of development as well as under the influence of chemicals that induce autophagy or hypoxia.

The III chapter of my thesis is a methodology manuscript, where we have validated the LC3II/LC3I immunoblot assay using zebrafish embryos and adult brain samples.

The LC3II/LC3I immunoblot assay is a common assay used to monitor autophagic flux in different model systems. In my work I have shown that the assay can be used effectively to monitor autophagy in zebrafish embryos.

In Chapter IV of my thesis, I validated the autophagy-inducing effects of Latrepiridine, a chemical that has been tested previously for stimulation of autophagy as well as for use as a therapeutic agent for AD. No previous study tested latrepiridine for autophagy- inducing effects in zebrafish.

39

Chapter V of my thesis is a continuation of latrepiridine study of Chapter 4, wherein I extended the assessment to other potential compounds that can induce autophagy. I tested 2 different compounds, structurally related to latrepiridine and which have better pharmacokinetic properties. There is no published work analysing the autophagy- inducing effects of these compounds in zebrafish.

Chapter VI of my thesis is a brief chapter in which I have tried to explore other possible assays that could be used to monitor autophagy in zebrafish. Together with others I have developed a novel assay using a Poly-Glutamine and GFP reporter system to observe relative autophagic flux in a cell. This assay can be used in future to investigate various aspects of autophagy in zebrafish.

40

Chapter II

Research Paper 1

Identification and expression analysis of the zebrafish orthologues of the mammalian MAP1LC3 gene family

41

Research Paper 1

Identification and expression analysis of the zebrafish orthologues of mammalian

MAP1LC3 gene family

Swamynathan Ganesan 1*, Seyyed Hani Moussavi Nik1, Morgan Newman1, Michael

Lardelli1.

1. Department of Genetics and Evolution, School of Biological Sciences,

The University of Adelaide, SA, 5005, Australia.

*Corresponding Author: Swamynathan Ganesan, Alzheimer’s disease Genetics Laboratory, School of Molecular and Biomedical Sciences, The University of Adelaide, Adelaide SA 5005, Australia. Tel. (+61) 88313 4863, Fax (+61) 88313 4362. Email: [email protected]

42

43 EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237

Available online at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/yexcr

Research Article Identification and expression analysis of the zebrafish orthologues of the mammalian MAP1LC3 gene family

Swamynathan Ganesann, Seyyed Hani Moussavi Nik, Morgan Newman, Michael Lardelli

Discipline of Genetics, Zebrafish Genetics Laboratory, School of Molecular and Biomedical Sciences, The University of Adelaide, SA 5005, Australia article information abstract

Article Chronology: Autophagy is the principle pathway within cells involved in clearing damaged proteins and organelles. Received 5 May 2014 Therefore autophagy is necessary to maintain the turnover balance of peptides and homoeostasis. Received in revised form Autophagy occurs at basal levels under normal conditions but can be upregulated by chemical inducers 9 July 2014 or stress conditions. The zebrafish (Danio rerio) serves as a versatile tool to understand the functions of Accepted 11 July 2014 genes implicated in autophagy. We report the identification of the zebrafish orthologues of mammalian Available online 19 July 2014 genes MAP1LC3A (map1lc3a)andMAP1LC3B (map1lc3b) by phylogenetic and conserved synteny fi Keywords: analysis and we examine their expression during embryonic development. The zebra sh map1lc3a and Alzheimer's disease map1lc3b genes both show maternally contributed transcripts in early embryogenesis. However, levels Autophagy of map1lc3a transcript steadily increase until at least 120 h post-fertilisation while the levels of LC3 map1lc3b show a more variable pattern across developmental time. We have also validated the LC3I Hypoxia ratio/LC3I immunoblot autophagy assay in the presence of chloroquine (a lysosomal proteolysis fi Rapamycin inhibitor). We found that the LC3II/LC3I ratio is signi cantly increased in the presence of sodium azide fi Chloroquine with chloroquine supporting that hypoxia induces autophagy in zebra sh. This was supported by our qPCR assay that showed increased map1lc3a transcript levels in the presence of sodium azide. In contrast, levels of map1lc3b transcripts were reduced in the presence of rapamycin but the decrease in the presence of sodium azide did not reach statistical significance. Our study supports the use of zebrafish for analysing the interplay between hypoxia, development and autophagy. & 2014 Elsevier Inc. All rights reserved.

Introduction cytoskeleton regulation [3]. They are abundantly expressed in the brain mainly during early developmental stages [4].Therearetwo The MAP (Microtubule Associated Protein) family encompasses a peptide forms, namely MAP1A and MAP1B, which differ in their group of proteins that are found in association with microtubules [1]. kinetic properties and phosphorylation mechanisms. They are highly MAP family proteins bind specifically to the microtubule lattice [2]. expressed in neurons and are thought to play an important role in They are involved in microtubular assembly, organelle transport and formation and development of neuronal cells [2].Boththese

nCorresponding author. Fax: þ61 88313 4362. E-mail addresses: [email protected] (S. Ganesan), [email protected] (S.H. Moussavi Nik), [email protected] (M. Newman), [email protected] (M. Lardelli). http://dx.doi.org/10.1016/j.yexcr.2014.07.014 0014-4827/& 2014 Elsevier Inc. All rights reserved. EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237 229

polypeptides consist of a heavy chain with different combinations of EC Directive 86/609/EEC for animal experiments and the Uniform light chains [5]. One of the important light chains that is abundantly Requirements for Manuscripts Submitted to Biomedical Journals. found in neurons is LC3 (light-chain 3) [5]. LC3 is proposed to be involved in the binding activities of MAP1A and MAP1B. Although Zebrafish husbandry and experimental procedures both MAP1A and MAP1B are involved in stabilizing microtubules, they are also thought to play key roles in interacting with other Danio rerio were bred and maintained at 28 1C on a 14 h light/10 h signalling proteins involved in the MAP kinase pathway [2].Inmost dark cycle. Embryos were collected from natural mating, grown in mammals, there are three different LC3 genes coding for three embryo medium (E3) and staged. different polypeptides – MAP1LC3A, MAP1LC3B and MAP1LC3C.These peptides differ in their post-translational processing. MAP1LC3A and Phylogenetic and synteny analyses MAP1LC3B are well characterised and are thought to be involved in autophagy while the function of MAP1LC3C is not well understood. The conserved regions of map1lc3a and map1lc3b protein sequences LC3 is a mammalian homologue of Atg8 (Saccharomyces cerevisiae) were aligned using ClustalW (Table 1) with a gap opening penalty of with 30% amino acid residue identity [6]. It is also one of the major 10.0 and gap extension penalty of 3.0 for the pairwise alignment biochemical markers of autophagy [7]. In the autophagy-lysosome stage and a gap opening penalty of 10.0 and gap extension penalty pathway, long lived proteins and cellular components are degraded in of 5.0 for the multiple alignment stage [18].TheprogramMrBayes the lysosome. This process is essential for normal cell homoeostasis was used for phylogenetic analysis [19]. The program was run under and for protein turnover [8]. Upon induction of autophagy LC3 binds the JC69 (Juke–Cantor) model, with estimated proportion, estimated to Phosphatidyl Ethanolamine (PE). This is essential for the extension gamma distribution parameter, and optimised tree topology. Esti- and formation of autophagosomes [9]. It is also critical for cargo mation of tree reliability was carried out by the Maximum Like- recognition in the lysosomes and for lysosomal degradation [10].LC3 lihood Test Method [20], using the GTR model as support. has two isoforms – LC3-I and LC3-II [11]. When autophagy is induced For analysis of conservation of synteny for map1lc3a, the follow- under normal conditions by starvation or by rapamycin treatment ing loci were investigated: in humans, region 34.5–35.1 M of LC3-I is modified to LC3-II [12]. LC3-II is a secondary ubiquitinated chromosome 20; in mouse, region 155.24–155.66 M of chromo- form that binds to autophagosomes. After the autophagosome fuses some 2; in bovine, region 64.47–64.95 M of chromosome 13; and with the lysosome, LC3-II is degraded by lysosomal proteases [11]. in zebrafish, region 26.11–2711–27.55 of chromosome 11. The genes The rate of formation of LC3-II from LC3-I determines the autophagic contained in the above regions were compared using the Sanger flux and is used as a measure of autophagic activity. Ensembl (http://www.ensembl.org/Danio_rerio/Info/Index)and The autophagic pathway occurs at basal levels under normal NCBI Entrez Gene databases (http://www.ncbi.nlm.nih.gov/gene) conditions but can be upregulated under stress conditions [13]. to identify homologues. It plays a crucial role in various biochemical pathways of embryogen- For analysis of conservation of synteny for map1lc3b, the following esis, growth, development and ageing [14].Reportshavesuggested loci were investigated: in humans, region 87.3–87.9 M of chromosome that autophagy can play a critical role in degrading the amyloid 16;inmouse,region121.6–121.9 M of chromosome 8; in bovine, peptides that form the amyloid plaques that are a pathological feature region 13.0–13.4 M of chromosome 18; and in zebrafish, region 13.1– observed in Alzheimer's disease (AD) brains [15]. Studies in AD 13.6 M of chromosome 25. The genes contained in the above regions patients have consistently shown failure of autophagy clearly high- were compared using the Sanger Ensembl (http://www.ensembl.org/ lighting the role played by this process in AD [16]. Mutations in the Danio_rerio/Info/Index) and NCBI Entrez Gene databases (http:// gene coding for the PRESENILIN1 protein (PSEN1) and that cause www.ncbi.nlm.nih.gov/gene) to identify homologues. cause Familial Alzheimer's Disease (FAD) also play a key role in disrupting lysosomal function suggesting that these factors are linked. RT-PCR assay and cloning of map1lc3a & map1lc3b cDNA Studies have shown that Presenilins are required for lysosomal acidification and for the activation of lysosomal proteases during Total RNA was extracted from whole embryos at 2, 24, 48, 56, 72, autophagy [17]. These studies suggest that autophagy may play a key 96, 120 h post-fertilisation (hpf) using the QIAGEN RNeasy mini role in AD progression. kit (QIAGEN, GmbH, Hilden, Germany). Zebrafish cDNAs were In this paper, we identify the zebrafish orthologue of mamma- generated using 5 μg of total RNA from embryos by reverse lian MAP1LC3A (map1lc3a) and MAP1LC3B (map1lc3b) by phylo- transcription (Super script ΙΙΙ kit; Invitrogen, Camarillo, USA). genetic and conserved synteny analysis and examine their For PCR amplification, 50 ng of the cDNA was used with expression during embryonic development of zebrafish. Analysis the primers: map1lc3a F (50–CGAGTCGACCGACAATTTAGC-30) of map1lc3a and map1lc3b function in zebrafish embryogenesis and map1lc3a R (50–TCCTTGCAACGATCAGCGAA-30); map1lc3b may be valuable for understanding their roles in autophagy and F (50- AATGTGACGATTGGACACGAGT -30) and map1lc3b R (50- the interplay of autophagy and other pathways in AD. AGTACAACAGCTCACGGTTATGC - 30). Control PCR primers for zebrafish β-actin were: β-actin F (50- TTCTGGTCGGTACTGG- TATTGTG -30) and β-actin R (50- ATCTTCATCAGGTAGTCTGT- CAGGTT-30) [21]. Materials and methods PCR was performed using Dynazyme DNA polymerase (Finn- zymes Oy, Espoo, Finland) for 35 cycles with a denaturation Ethics temperature of 94 1C for 30 s, an annealing temperature of 60 1C for 30 s and an extension temperature of 72 1C for 2 min. The PCR This work was conducted under the auspices of The Animal Ethics products were cloned in the pGEM-T vector (Promega, Madison, Committee of The University of Adelaide and in accordance with USA) and sequenced. 230 EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237

Table 1 – Protein sequences used in the phylogenetic analysis.

Common name Species name Sequence Sequence accession number

Zebrafish Danio rerio Map1lc3a NP_999904.1 Map1lc3b NP_955898.1 Map1lc3c NP_956592.1 Human Homo sapiens MAP1LC3A NP_115903.1 MAP1LC3B NP_073729.1 MAP1LC3C NP_001004343.1 Bull Bos taurus MAP1LC3A NP_001039640.1 MAP1LC3B NP_001001169.1 MAP1LC3C NP_001094528.1 Chicken Gallus gallus MAp1lc3a XP_417327.2 Map1lc3b NP_001026632.1 MAp1lc3c XP_419549.2 African Clawed Frog Xenopus laevis Map1lc3a NP_001079866.1 Map1lc3b NP_001089078.1 Map1lc3c NP_001090411.1

Quantitative PCR Drug treatment – autophagy inducers

Quantitative real time PCR was performed using POWER SYBR Green Wild-type embryos were collected and treated with the following PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and the drugs dissolved in DMSO. Rapamycin, which is a known inducer ABI 7000 Sequence Detection System (Applied Biosystems). The of autophagy, was added to a final concentration of 1 mMto relative standard curve method for quantification was used to 48 hpf embryos for 24 h [28,29]. Chloroquine, a chemical that determine the expression of experimental samples compared to a increases lysosomal pH thus inhibiting autophagy was added at a basis sample. Gene specificprimersweredesignedforamplification concentration of 50 mM to 56 hpf embryos for 16 h [25,30]. of map1lc3a (Qmap1lc3a.F:50–CGAGTCGACCGACAATTTAGC-30 and Sodium azide was used at a concentration of 100 mM on 66 hpf Qmap1lc3aR:50–TCCTTGCAACGATCAGCGAA-30), map1lc3b (Qmap1lc3 embryos for 6 h. All embryos (wild-type & drug treated) bF:50- AATGTGACGATTGGACACGAGT – 30 and Qmap1lc3bR:50 – AGTA were subjected to yolk-removal and lysis at 72 hpf for CAACAGCTCACGGTTATGC – 30) and for the ubiquitously expressed immunoblotting. control genes eef1a1a (Qeef1a1aF: 50–CCAACTTCAACGCTCAGGTCA-30 and Qeef1a1aR:50–CAAACTTGCAGGCGATGTGA-30)andβ-actin (Q β-ac tinF:50- TTCTGGTCGGTACTGGTATTGTG -30and β-actinR:50- ATCTTCAT CAGGTAGTCTGTCAGGTT -30) [21–26]. Western immunoblot analyses cDNA was serially diluted (100 ng, 50 ng, 25 ng, and 12.5 ng per reaction) to generate the standard curve. Amplification conditions Dechorionated and deyolked embryos were placed in sample were 2 min at 50 1C followed by 10 min at 95 1C and then 40–45 buffer (2% sodium dodecyl sulphate (SDS), 5% β-mercaptoethanol, cycles of 15 s at 95 1C and 1 min at 60 1C. The expression of 25% v/v glycerol, 0.0625 M Tris–HCl (pH 6.8), and bromophenol map1lc3a in wild-type embryos at 2, 24, 48, 56, 72, 96, and blue), heated immediately at 100 1C for 5 min, and then stored at 120 hpf was analysed. All qPCRs were done in triplicate and three 20 1C prior to protein separation on 15% SDS-polyacrylamide biological replicates were performed for each gene expression gels. Proteins were transferred to PVDF membranes using a analysis. Cycle thresholds obtained from each triplicate were semidry electrotransfer system. When immunoblotting with anti- averaged and normalised against the expression of eef1a1a. The LC3 antibodies, the membranes were blocked with 5% Western Blot fold changes of expression were determined by comparing each Blocking Solution in TBST, incubated with a 1/2000 dilution of experimental sample to the basis sample. primary antibodies in TBST containing 1% Western Blot Blocking Solution, washed in TBST, and incubated with a 1/10,000 dilution of anti-rabbit (Rockland Immunochemicals Inc., Gilbertsville, PA, USA). For incubation with anti-β-tubulin antibodies (Antibody E7, Developmental Studies Hybridoma Bank, The University of Iowa, Whole-mount in situ transcript hybridisation (WISH) IA, USA), the conditions were the same as for western immuno- blotting with anti-LC3 antibodies except that the primary anti- Wild-type embryos were collected and dechorionated at 18, 24, bodies were diluted 1/200 and donkey antimouse IgG secondary 36, 48, 72, 96, and 120 hpf for WISH. The embryos were then fixed antibodies (Jackson ImmunoResearch Laboratories Inc., West in 4% formaldehyde in PBS at 4 1C overnight and stored in 100% Grove, PA, USA) were diluted 1/10,000. After incubation with 1 0 methanol at 20 C. A Digoxigenin-11-uridine-5 -triphosphate secondary antibodies, all the membranes were washed four times (DIG) antisense labelled RNA probe was then generated using for 15 min in TBST and visualised with luminol reagents (Amresco, SP6 or T7 RNA polymerase from a cDNA amplified from a clone Ohio, USA) by exposure to X-ray films (GE Healthcare LTD, using M13 primers. WISH was then performed as previously Amersham Hyperfilm TM ECL, UK) and the ChemiDoc™ MP described [27]. imaging system (Bio-Rad, Hercules, CA, USA). EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237 231

Statistical analysis

Means and standard deviations were calculated for all variables. A students t-test was used to evaluate significant differences among 52 the groups. Each experiment was performed with 3 biological replicates. A criterion alpha level of Po0.05 was used for all statistical comparisons. All the data were analysed using Graph- Pad Prism version 6.0 (GraphPad Prism, La Jolla, CA).

Results

Identification of the zebrafish map1lc3a and map1lc3b genes by a phylogenetic approach

The MAP1LC3A and MAP1LC3B genes belong to the family of Microtubule Associated Proteins (MAP) [1]. These genes have been identified in major mammals (e.g., human, mouse, and bovine). To identify genes in zebrafish with possible orthology to MAP1LC3A and MAP1LC3B, we searched the NCBI and Ensembl genome databases using the human MAP1LC3A and MAP1LC3B protein sequences as probes. A tBLASTn search of the NCBI database using MAP1LC3A as a probe identified a gene located on chromosome 11 (NM_214739.1) with high sequence homology. The E-value of tBLASTn alignments between human MAP1LC3A and this candidate was 3e76 and sh Trpc4apash Myh7b Human Human NM_015638.2 NM_020884.3 0.0 0.0 sh Dynlrb1 Human NM_014183.2 1e fi fi was considerably smaller than other aligned sequences (E-value fi . Highest quality hits are shown in descending order. Probes were translations of for next candidate was 2e68). The amino acid (aa) residue Zebra identity between human MAP1LC3A and the putative protein sequence of the zebrafish candidate orthologue following Clus- talW alignment (see Materials and Methods) is 96% (Fig. 1A). map1lc3a Similarly a tBLASTn search of the NCBI database using MAP1LC3B as a probe identified a gene located on chromosome 25 (NM_199604.1) with high sequence homology. The E-value of

tBLASTn alignments between human MAP1LC3B and this candi- 53 date was 6e74 and was considerably smaller than other aligned sequences (E-value for next candidate was 2e65). The amino acid (aa) residue identity between human MAP1LC3B and the putative protein sequence of the zebrafish candidate orthologue following ClustalW alignment (see Materials and Methods) is 93% (Fig. 1A). Phylogenetic analysis was carried out using the program MrBayes comparing the zebrafish genes with the DNA sequences of the MAP1LC3A orthologues of human, mouse, and bovine, as well as the most closely related MAP gene family members from all these species, i.e., MAP1LC3B and MAP1LC3C, to examine the relationship between zebrafish genes and other members of the MAP1LC3 family. The results strongly support that the genes identified as map1lc3a and map1lc3b are zebrafish orthologues of human MAP1LC3A and MAP1LC3B respectively (Fig. 1B). sh XM_001335708.3 0.0 Zebra shsh NM_201188.1 NM_131569.2 5e 0.0 Zebra fi fi fi Synteny conservation analysis supports the results of the phylogenetic analysis

Synteny conservation analysis was performed to confirm the results of the phylogenetic analysis. Neighbouring genes on each side of the zebrafish candidate genes were investigated using the Summary of tBLASTn search results in the analysis of synteny conservation for

Sanger Ensembl database. This led to the identification of three – zebrafish genes, trpc4apa, myh7ba, and dynlRb1 that are apparent orthologues of genes syntenic with human MAP1LC3A on chro- Human MYH7B Zebra Table 2 ProbeHuman DYNLRB1Human TRPC4AP Zebra Zebra Target organsim Hits Quality (E-value) Probe Target organism Hits Quality (E-value) mosome 11 (Table 2). Interestingly, while the relative orientations full-length open reading frames of the relevant genes. 232 EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237

of the map1lc3a and dynlrb1 genes are conserved between zebrafish and mammals, a chromosomal rearrangement means that the orientation of these two genes with respect to trpc4apa and myh7ba differs between zebrafish and humans (Fig. 2). For 96 zebrafish map1lc3b, two genes, zcchc1 and slc7a5 (LOC797250) were identified that are orthologues of genes syntenic with human MAP1LC3B on chromosome 16 (Fig. 3)(Table 3). The locations of orthologues of these syntenic genes in mouse and bovine were also identified. tBLASTn searches confirmed that these neighbouring genes of human MAP1LC3A and MAP1LC3B showed their highest levels of identity with their zebrafish counterparts indicated above rather than other homologues in the zebrafish genome thus supporting their identification as orthologues. Therefore, analysis of synteny conservation supports the proposed orthology between zebrafish map1lc3a and human MAP1LC3A and between zebrafish map1lc3b and human MAP1LC3B.

Embryonic and early larval expression of map1lc3a & map1lc3b

The temporal expression of map1lc3a and map1lc3b mRNA in zebrafish embryos and early larvae at different timepoints was examined using a RT-PCR assay. Zebrafish map1lc3a and map1lc3b mRNAs were barely detectable in maternally contrib- sh Zcchc14 Human NM_015144.2 9e sh LOC797250 Human NM_003486.5 0.0 fi fi uted transcripts (i.e., at 2 hpf) and were observed at relatively . Highest quality hits are shown in descending order. Probes were translations of low levels by 24 hpf. They were easily detectable by the end of

Zebra embryogenesis (hatching) at 48 hpf. Expression then continued through to adulthood. These observations were confirmed by map1lc3b quantitative RT-PCR (qRT-PCR) showing that the relative gene expression levels of map1lc3a and map1lc3b are much lower in embryos at early stages of development in comparison to in larvae at 96 hpf and 120 hpf (Fig. 4). The expression of map1lc3a shows a fairly linear pattern of increase from 24 hpf to 120 hpf, 89 relative to the β-actin standard used [25,26]. In contrast, the transcript levels of map1lc3b rose to an early peak at around 56 hpf before declining until around 96 hpf and then rising again by 120 hpf (Fig. 5A).

Whole mount in-situ transcript hybridisation

To validate further the expression of map1lc3a and map1lc3b in zebrafish embryos, whole mount in situ transcript hybridisation (WISH) was performed on zebrafish embryos. After extended staining (3 days at room temperature) no specific staining was observable for either gene at 48 hpf indicating that the level of expression was too low to be detected by this technique. (As a sh NM_001128358.1 0.0 Zebra sh XM_001336490.4 9e positive control, the expected pattern of expression was observed fi fi in control embryos stained to reveal expression of neurogenin1 – data not shown).

Expression of zebrafish map1lc3a and map1lc3b following treatments to induce autophagy Summary of tBLASTn search results in the analysis of synteny conservation for

– To examine whether conditions known to induce autophagy cause increased transcript levels from the map1lc3a and map1lc3b genes, we examined their expression by qRT-PCR at 72 hpf [21–24,26].Embryos Table 3 ProbeHuman SLC7A5 Zebra Target organsim Hits Quality (E-value) Probe Target organism Hits Quality (E-value) full-length open reading frames of the relevant genes. Human ZCCHC14 Zebra at 48 hpf were treated for a further 24 h with rapamycin while EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237 233

Fig. 1 – (A) Alignment of the putative amino acid residue sequences of the zebrafish map1lc3a and map1lc3b candidates with the MAP1LC3A and MAP1LC3B proteins of humans, the mouse and bovines. The alignment was performed using ClustalW with gap opening penalty of 10.0 and gap extension penalty of 3.0 for the pairwise alignment stage and a gap opening penalty of 10.0 and gap extension penalty of 5.0 for the multiple alignment stage. Black shading indicates the identical residues. (B) Phylogenetic tree of the MAP1LC3A and MAP1LC3B protein family generated using MrBayes. Numbers represent the aLRT branch – support values. Sequences used in the phylogenetic analysis are shown in Table 1.

another cohort of embryos was subjected to mimicry of hypoxia by TheqRT-PCRanalysisshowedthattherelativelevelsofmap1lc3a exposure to sodium azide for 6 h starting at 66 hpf (see Materials and transcripts increase by approximately 1.4 fold under exposure to Methods). Levels of map1lc3a and map1lc3b transcripts in these either rapamycin or sodium azide. In contrast levels of map1lc3b embryos were compared to control (untreated) embryos at 72 hpf. transcripts were reduced in the presence of rapamycin but the 234 EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237

Fig. 2 – Schematic showing genes syntenic with the proposed zebrafish orthologue of human MAP1LC3A and those syntenic Fig. 3 – Schematic showing genes syntenic with the proposed with the human (Hs), mouse (Mm) and bovine (Bt) MAP1LC3A zebrafish orthologue of human MAP1LC3B and those syntenic genes. Numbers on the baselines indicate gene positions on the with the human (Hs), mouse (Mm) and bovine (Bt) MAP1LC3B chromosomes (M¼ megabases) (http://www.ensembl.org/ genes. Numbers on the baselines indicate gene positions on Danio_rerio/Info/Index). Arrows indicate the direction of gene the chromosomes (M¼ megabases) (http://www.ensembl.org/ transcription. The table shows the orthology relationships Danio_rerio/Info/Index). Arrows indicate the direction of gene between genes in different organisms. transcription. The table shows the orthology relationships between genes in different organisms. decrease in the presence of sodium azide did not reach statistical significance (Fig. 5B).

Increased LC3I ratio/LC3I ratio in the presence of a lysosomal inhibitor indicates increased autophagy in zebrafish embryos

The initiation of autophagy in a cell can be detected by analysis of the conversion of LC3I to LC3II. Therefore an increase in the LC3II/ LC3I ratio may indicate increased autophagic flux in cells. How- Fig. 4 – RT-PCRs detecting map1lc3a and map1lc3b transcripts ever, an increased LC3II/LC3I ratio alone is not accepted as at different developmental stages. sufficient to indicate increased autophagic flux [30]. For that, the LC3II/LC3I ratio must be shown to increase when lysosomal function is blocked, e.g. by chloroquine that increases lysosomal pH [30]. to examine the LC3II/LC3I ratio in zebrafish embryos at 72 hpf The mammalian MAP1LC3A and MAP1LC3B genes encode very with and without chloroquine and in the presence or absence of similar proteins and the zebrafish orthologues of these genes are autophagy inducers rapamycin and sodium azide. In every case, expected to do the same. Antibodies against “LC3” detect both including otherwise untreated control embryos, we observed a proteins and are used in western immunoblot assays to monitor significant increase in the LC3II/LC3I ratio in the presence of autophagy activity. He et al. used an antibody against mammalian chloroquine indicating autophagic flux (Fig. 6). This experiment LC3 to monitor the LC3II/LC3I ratio in zebrafish but this approach also confirmed the ability of rapamycin and chemical mimicry of has not yet been validated in zebrafish using the lysosomal hypoxia (sodium azide treatment) to increase the rate of autop- inhibitor chloroquine [29]. Therefore, we used the same antibody hagy in zebrafish (Fig. 6). EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237 235

Fig. 5 – (A) Relative gene expression level profiles of map1lc3a and map1lc3b mRNA at different developmental stages determined by qRT-PCR. The expression levels of map1lc3a and map1lc3b between samples were normalised against β-actin. Each experiment was replicated completely thrice with triplicate PCRs performed for each replicate. Error bars show standard deviation (SD). (B) Relative gene expression level profile of map1lc3a and map1lc3b mRNA at 72 h including after exposure to rapamycin and to sodium azide (to mimic hypoxia). The expression levels of map1lc3a and map1lc3b are normalised against eef1a1a. Each experiment was replicated thrice and triplicate PCRs were performed for each replicate. Error bars show standard errors of the means. ns; not statistically significant.

survival [31]. Autophagy has been widely studied in relation to Discussion various diseases including AD. Failure of autophagy due to mutations in the PRESENILIN1 gene has been implicated in AD [32].Togain Autophagy is the principle pathway in cells involved in clearing greater insight into autophagy, various animal models have been damaged proteins and organelles. It is, therefore, critical to cell used to study the components of the autophagic pathway. However, 236 EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237

Fig. 6 – (A) Use of chloroquine in LC3II/I assays of autophagy in zebrafish larvae. Treatment of embryos with rapamycin or sodium azide was performed as described above. Embryos were deyolked at 72 h, lysed and subjected to SDS-PAGE before LC3II and LC3I were detected using anti-LC3 antibody. Anti-tubulin antibody was used as a loading control. (B) The LC3II/LC3I ratio was calculated using Image Lab software. The ratio for the control samples was adjusted to 1.0 and the other ratios were normalised to this. Each analysis was carried out in triplicate. Error bars show standard errors of the means. Con – Control, Rap - Rapamycin, Chl – Chloroquine, S/A - Sodium azide. only limited analysis has been performed using zebrafish (see supported by the increased levels of map1lc3a transcripts seen below) despite its utility as a model organism in AD research [33]. when autophagy is induced by rapamycin and mimicry of hypoxia A number of studies have described assays for autophagy in while map1lc3b transcript levels decreased under treatment with zebrafish. A transgenic zebrafish line bearing a fusion of GFP to rapamycin and showed no significant change under mimicry of MAP1LC3B has been constructed and used for monitoring of autop- hypoxia. hagy [29]. Also, immunoblot assays using antibodies against LC3 are In mammalian systems, increased levels of LC3II or increase in commonly used to monitor induction of autophagy [34–38]. However, the LC3II/LC3I ratio suggest either an induction of autophagosome the zebrafish orthologues of the MAPLC3A and MAP1LC3B genes that formation and autophagic flux or a failure in autophagosome code for LC3 remain poorly characterised. The primary aim of this turnover [29]. To differentiate between these two possibilities it is study was to identify zebrafish orthologues of these genes for analysis now de rigeur to carry out western immunoblotting against LC3I of their expression in embryos and early larvae. Using phylogenetic and LC3II in the presence of lysosomal inhibitors. An increase in and synteny conservation analysis we confirmedthepresenceofthe LC3II/LC3I ratio in the presence of a lysosomal inhibitor supports orthologous genes in zebrafish, map1lc3a & map1lc3b. that there is an induction in the formation of autophagosomes Both the zebrafish map1lc3a and map1lc3b genes show mater- and increased autophagic flux [30]. We have used chloroquine to nally contributed expression in early embryogenesis. However, demonstrate that the LC3II/LC3I ratio is significantly increased by levels of map1lc3a transcript steadily increase until at least exposure of zebrafish larvae to rapamycin or sodium azide (for 120 hpf while the levels of map1lc3b show a more variable mimicry of hypoxia) in their aqueous medium. pattern across developmental time. The reason for this is Our study supports that it is possible to analyse autophagy in vivo unknown but the retention of these two genes that encode very using zebrafish embryos/larvae. This is important since cells grown in similar proteins over more than 450 million years since the culture typically are under stress and can show unusual patterns of divergence of teleosts and tetrapods indicates that they probably gene expression due to their unusual growth medium and absence of have very important unique functions in autophagy and protein their normal three-dimensional cellular contacts. Furthermore, turnover in addition to any functional redundancy. This idea is mutant, immortalised cells have altered patterns of gene activity. As EXPERIMENTAL CELL RESEARCH 328 (2014) 228– 237 237

an alternative, the effects of various chemicals on autophagy can be [16] R.A. Nixon, D.S. Yang, Autophagy failure in Alzheimer's disease- analysed simply by their placement in the aqueous medium in which locating the primary defect, Neurobiol. Dis. 43 (1) (2011) – zebrafish embryos/larvae normally grow and develop. The ability to 38 45. [17] J.H. Lee, et al., Lysosomal proteolysis and autophagy require analyse autophagy in zebrafish embryos/larvae enhances the use of presenilin 1 and are disrupted by Alzheimer-related PS1 muta- the zebrafish model for investigation of the molecular mechanisms tions, Cell 141 (7) (2010) 1146–1158. underlying Alzheimer's disease. [18] F. Corpet, Multiple sequence alignment with hierarchical clus- tering, Nucleic Acids Res. 16 (1988) 22. [19] JP Huelsenbeck, F. Ronquist, MRBAYES: bayesian inference of phylogenetic trees, Bioinformatics 17 (8) (2001) 754–755. Acknowledgements [20] S Guindon, G.O., A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood, Syst. Biol. 52 This research was supported by funds from the School of (5) (2003) 696–704. Molecular and Biomedical Science and by an Adelaide Scholarship [21] S.H. Moussavi Nik, et al., The BACE1-PSEN-AbetaPP regulatory International to SG from the University of Adelaide. MN is axis has an ancient role in response to low oxygen/oxidative – supported by funds from the Australian National Health and stress, J. Alzheimers Dis. 28 (3) (2012) 515 530. [22] S.H. Moussavi Nik, M. Newman, M. Lardelli, The response of Medical Research Council (APP1061006). The sources of funding HMGA1 to changes in oxygen availability is evolutionarily listed above played no role in the study design; in the collection, conserved, Exp. Cell Res. 317 (11) (2011) 1503–1512. analysis and interpretation of data; in the writing of the report; or [23] S.H. Moussavi Nik, et al., The comparison of methods for in the decision to submit the paper for publication. The authors measuring oxidative stress in zebrafish brains, Zebrafish 11 (3) declare that they have no conflict of interest in this work. (2014) 248–254. [24] Y. Sugano, M. Lardelli, Identification and expression analysis of the zebrafish orthologue of Klotho, Dev. Genes Evol. 221 (3) references (2011) 179–186. [25] J. Cui, et al., Generation of transgenic zebrafish with liver-specific expression of EGFP-Lc3: a new in vivo model for investigation of [1] R.B. Vallee, G.S. Bloom, W.E. Theurkauf, Microtubule-associated liver autophagy, Biochem. Biophys. Res. Commun. 422 (2) (2012) proteins: subunits of the cytomatrix, J Cell Biol. 99 (1 Pt 2) (1984) 268–273. 38s–44s. [26] R. Tang, et al., Validation of zebrafish (Danio rerio) reference [2] S. Halpain, L. Dehmelt, The MAP1 family of microtubule- genes for quantitative real-time RT-PCR normalization, Acta associated proteins, Genome Biol. 7 (6) (2006) 224. Biochim. Biophys. Sin. (Shanghai) 39 (5) (2007) 384–390. [3] T.A. Schoenfeld, et al., MAP 1A and MAP 1B are structurally [27] M. Newman, et al., Altering presenilin gene activity in zebrafish related microtubule associated proteins with distinct develop- embryos causes changes in expression of genes with potential mental patterns in the CNS, J. Neurosci. 9 (5) (1989) 1712–1730. involvement in Alzheimer's disease pathogenesis, J. Alzheimers [4] G.S. Bloom, F.C. Luca, R.B. Vallee, Identification of high molecular Dis. 16 (1) (2009) 133–147. weight microtubule-associated proteins in anterior pituitary [28] C. He, D.J. Klionsky, Analyzing autophagy in zebrafish, Autophagy tissue and cells using taxol-dependent purification combined 6 (5) (2010) 642–644. with microtubule-associated protein specific antibodies, [29] C. He, et al., Assaying autophagic activity in transgenic GFP-Lc3 Biochemistry 24 (15) (1985) 4185–4191. and GFP-Gabarap zebrafish embryos, Autophagy 5 (4) (2009) [5] S.S. Mann, J.A. Hammarback, Molecular characterization of light 520–526. chain 3. A microtubule binding subunit of MAP1A and MAP1B, [30] D.J. Klionsky, et al., Guidelines for the use and interpretation of J. Biol. Chem. 269 (15) (1994) 11492–11497. assays for monitoring autophagy, Autophagy 8 (4) (2012) 445–544. [6] I. Tanida, T. Ueno, E. Kominami, LC3 and autophagy, Methods [31] N. Mizushima, Autophagy: process and function, Genes Dev. 21 Mol. Biol. 445 (2008) 77–88. (22) (2007) 2861–2873. [7] C. Behrends, et al., Network organization of the human autop- [32] D.M. Wolfe, et al., Autophagy failure in Alzheimer's disease and hagy system, Nature 466 (7302) (2010) 68–76. the role of defective lysosomal acidification, Eur. J. Neurosci. 37 [8] D. Lingwood, et al., Morphological homeostasis by autophagy, (12) (2013) 1949–1961. Autophagy 5 (7) (2009) 1039–1040. [33] M. Newman, et al., Zebrafish as a tool in Alzheimer's disease [9] C. He, D.J. Klionsky, Regulation mechanisms and signaling path- research, Biochim. Biophys. Acta 1812 (3) (2011) 346–352. ways of autophagy, Annu. Rev. Genet. 43 (2009) 67–93. [34] S.H. Kim, et al., Molecular cloning and expression analyses of [10] S. Pankiv, et al., p62/SQSTM1 binds directly to Atg8/LC3 to porcine MAP1LC3A in the granulosa cells of normal and minia- facilitate degradation of ubiquitinated protein aggregates by ture pig, Reprod. Biol. Endocrinol. 11 (2013) 8. autophagy, J. Biol. Chem. 282 (33) (2007) 24131–24145. [35] J. Xiao, et al., MiR-204 regulates cardiomyocyte autophagy [11] Y. Kabeya, et al., LC3, a mammalian homologue of yeast Apg8p, is induced by ischemia-reperfusion through LC3-II, J. Biomed. Sci. localized in autophagosome membranes after processing, EMBO 18 (2011) 35. J. 19 (21) (2000) 5720–5728. [36] B. Xie, et al., Restoration of klotho gene expression induces [12] I. Tanida, T. Ueno, E. Kominami, LC3 conjugation system in apoptosis and autophagy in gastric cancer cells: tumor sup- mammalian autophagy, Int. J. Biochem. Cell Biol. 36 (12) (2004) pressive role of klotho in gastric cancer, Cancer Cell Int. 13 (1) 2503–2518. (2013) 18. [13] K.W. Kim, et al., Autophagy upregulation by inhibitors of caspase- [37] G. Bellot, et al., Hypoxia-induced autophagy is mediated through 3 and mTOR enhances radiotherapy in a mouse model of lung hypoxia-inducible factor induction of BNIP3 and BNIP3L via their cancer, Autophagy 4 (5) (2008) 659–668. BH3 domains, Mol. Cell Biol. 29 (10) (2009) 2570–2581. [14] G.E. Mortimore, et al., Autophagy, Sub-cell. Biochem. 27 (1996) [38] M.A. Farg, V. Sundaramoorthy, J.M. Sultana, S. Yang, R.A. Atkin- 93–135. son, V. Levina, M.A. Halloran, P.A. Gleeson, I.P. Blair, K.Y. Soo, A.E. [15] D.S. Yang, et al., Therapeutic effects of remediating autophagy King, J.D. Atkin., C9ORF72, implicated in a mytrophic lateral failure in a mouse model of Alzheimer disease by enhancing sclerosis and frontotemporal dementia, regulates endosomal lysosomal proteolysis, Autophagy 7 (7) (2011) 788–789. trafficking, Hum. Mol. Genet 23 (13) (2014) 3579–3595. Corrigendum to Ganesan et al (2014) Experimental Cell Research 328:228-37

In Figure 5A, an inappropriate statistical test was used for qPCR comparisons of the relative expression of map1lc3b between 56 hpf and 96 hpf larvae. A corrected figure with the appropriate p-value is given below. The significant difference claimed previously (p=0.0374) between embryos at 56 hpf and 72 hpf can now only be claimed to be a possible trend (p=0.0558).

Figure 5(A) – Relative gene expression level profiles of map1lc3a and map1lc3b mRNA at different developmental stages determined by qRT-PCR. The expression levels of map1lc3a and map1lc3b between samples were normalised against β-actin.

Each experiment was replicated completely thrice with triplicate PCRs performed for each replicate. Error bars show standard deviation (SD). A two-tailed unpaired

Student’s t-test assuming unequal variance was used to find significant differences.

54

In Figures 5B and 6A of the paper, there were errors in statistical analyses. The analyses were repeated with appropriate tests and the corrected images are given below.

The raw data and analysis are also provided below as supplementary data. The previously claimed apparent trend to decreasing map1lc3b after exposure of embryos to sodium azide (p=0.0564) is now seen to be statistically significant (p=0.0303).

Figure 5 (B) – Relative gene expression level profiles of map1lc3a and map1lc3b mRNA at 72 h including after exposure to rapamycin and to sodium azide (to mimic hypoxia). The expression levels of map1lc3a and map1lc3b are normalised against eef1a1l1. Each experiment was replicated three times and triplicate PCRs were performed for each replicate. Error bars show standard errors of the means. A two- tailed unpaired Student’s t-test assuming unequal variance was used to find significant differences.

55

Figure 6 (A) – The LC3II/LC3I ratio was calculated using Image Lab software. Error bars represent standard errors of the means. A two-tailed unpaired Student’s t-test assuming unequal variance was used to find significant differences.

CON, control; RAP, rapamycin; S/A, sodium azide;

56

Supplementary Data

Table 1 - Relative gene expression level profiles of map1lc3a and map1lc3b mRNA at

72 h including after exposure to rapamycin and to sodium azide (to mimic hypoxia)

(Figure 5B). qPCR Raw Data (map1lc3a)

Slope -3.873 Intercept 26.225

Ef1a1l1 Primers Ct value Input Log Input

Control Set 1 19.9 1.633101 42.96363 20.29 1.532404 34.07249 20.59 1.454944 28.50654 Average 35.18088 Set 2 20.25 1.542732 34.89247 20.39 1.506584 32.10584 20.44 1.493674 31.1655 Average 32.72127 Set 3 20.2 1.555642 35.94526 20.23 1.547896 35.30983 20.12 1.576297 37.69619 Average 36.31709

Rapamycin Set 1 22 1.090886 12.3278 21.64 1.183837 15.26992 21.61 1.191583 15.54471 Average 14.38081 Set 2 21.71 1.165763 14.64748 21.59 1.196747 15.73065 21.56 1.204493 16.01374 Average 15.46396 Set 3 21.45 1.232894 17.096 21.73 1.160599 14.47435 21.49 1.222566 16.69423 Average 16.08819

Sodium Azide Set 1 22.19 1.041828 11.01103 22.13 1.05732 11.4109 21.8 1.142525 13.88434 Average 12.10209

Set 2 22.18 1.04441 11.07669 22.15 1.052156 11.27602 21.94 1.106377 12.77549 Average 11.7094 Set 3 22.17 1.046992 11.14274 22.08 1.07023 11.75519 21.87 1.124451 13.31838 Average 12.0721

Slope -4.038 Intercept 33.144

map1lc3a Primers Ct value Input Log Input

Control Set 1 26.24 1.709757 51.25749 26.09 1.746904 55.83473 26.4 1.670134 46.78792 Average 51.29338 Set 2 26.15 1.732046 53.95672 26.16 1.729569 53.64992 26.26 1.704804 50.67624 Average 52.76096 Set 3 26.17 1.727093 53.34486 26.3 1.694898 49.53344 26.28 1.699851 50.10158 Average 50.99329

Rapamycin Set 1 27.13 1.489351 30.85682 27.2 1.472016 29.6494 27.23 1.464586 29.1465 Average 29.88424 Set 2 27.05 1.509163 32.29706 27.04 1.511639 32.48175 27.03 1.514116 32.6675 Average 32.4821 Set 3 27 1.521545 33.23115 27.18 1.476969 29.98947 26.98 1.526498 33.6123 Average 32.27764

Sodium Azide Set 1 27.54 1.387816 24.42394 27.51 1.395245 24.84535 27.46 1.407628 25.56393 24.94441 Average

Set 2 27.53 1.390292 24.56361 27.46 1.407628 25.56393 27.48 1.402675 25.27404 Average 25.13386 Set 3 27.53 1.390292 24.56361 27.34 1.437345 27.37444 27.44 1.41258 25.85714 Average 25.93173

Relative expression of map1lc3a

Control Rapamycin Sod.Azide Set 1 1.45799 2.0780633 2.061165155 Set 2 1.612436 2.100504 2.146468373 Set 3 1.404113 2.0062937 2.148070488 Average 1.491513 2.0616204 2.118568005 SD 0.108132 0.0492105 0.04971878 SEM 0.06243 0.0284117 0.028705151

Statistical Analysis p-value Con VS Rap 0.0047 Con VS S/A 0.0036

qPCR raw data (map1lc3b)

Slope -3.3958 Intercept 31.393

Ef1a1l1 Primers Ct Value Input Log Input Set 1 Control 25.52 1.729489 53.64007 25.53 1.726545 53.27759 25.72 1.670593 46.83743 Average 51.2517

Rapamycin 25.37 1.773662 59.38292 25.32 1.788386 61.43073 25.25 1.808999 64.41683 Average 61.74349

Sod.Azide 23.7 2.265446 184.2661 23.42 2.3479 222.7924 23.56 2.306673 202.6156 Average 203.2247

Set 2 Control 23.96 2.18888 154.4829 24.12 2.141763 138.6 23.83 2.227163 168.7186 Average 153.9338

Rapamycin 22.77 2.539313 346.189 23.18 2.418576 262.1657 23.12 2.436245 273.0516 Average 293.8021

Sod.Azide 23.5 2.324342 211.0289 24.66 1.982743 96.10443 23.59 2.297839 198.5357 Average 168.5563

Set 3 Control 23.94 2.19477 156.5922 24 2.177101 150.3492 23.87 2.215384 164.204 Average 157.0485

Rapamycin 23.18 2.418576 262.1657 23.22 2.406797 255.1506 23.14 2.430355 269.3737 Average 262.23

Sod.Azide 22.02 2.760174 575.671 22.21 2.704223 506.0843 22.45 2.633547 430.0781 Average 468.0812

Slope -3.3106 Intercept 33.254

map1lc3b Primers Ct Value Input Log Input Set 1 Control 27.32 1.792424 62.00466 27.57 1.716909 52.10859 27.62 1.701806 50.32761 Average 54.81362

Rapamycin 27.41 1.765239 58.24236 27.39 1.77128 59.05819 27.22 1.82263 66.47071 Average 61.25709

Sod.Azide 26.09 2.163958 145.8674 26.06 2.17302 148.943 26 2.191144 155.29 Average 150.0335

Set 2 Control 25.52 2.336132 216.8365 25.67 2.290823 195.3545 25.54 2.330091 213.8411 Average 208.6774

Rapamycin 25.56 2.32405 210.8871 25.49 2.345194 221.4085 25.55 2.327071 212.359 Average 214.8848

Sod.Azide 26.18 2.136773 137.0165 26.39 2.07334 118.3969 26.3 2.100526 126.045 Average 127.1528

Set 3 Control 25.31 2.399565 250.9372 25.26 2.414668 259.8173 25.4 2.37238 235.7109 Average 248.8218

Rapamycin 26.04 2.179061 151.0293 26.06 2.17302 148.943 26.7 1.979702 95.43366 Average 131.802

Sod.Azide 26.67 1.988763 97.44585 26.66 1.991784 98.12597 26.52 2.034072 108.1614 Average 103.1437

Relative Expression of map1lc3b Con Rap Sod.Azide Set 1 1.069499 0.992122 0.738264 Set 2 1.35563 0.731393 0.754364 Set 3 1.584363 0.50262 0.220354 Average 1.336497 0.742045 0.570994 SD 0.257965 0.244925 0.30377 SEM 0.148936 0.141408 0.175381

Statistical Analysis p-value Con Vs Rap 0.0445 Con VS S/A 0.0303

Table 2 – Densitometric analysis of western blots using zebrafish larvae (control larvae and larvae treated with rapamycin or sodium azide in the presence and absence of chloroquine (Figure 6A). The intensity values of the LC3I and LC3II bands of each replicate are given.

Set 1 Control Rap S/A Control+Chl Rap+Chl S/A+Chl LC3I 10,493,721 8,703,024 20,550,564 1,130,330 1,110,912 1,226,412 LC3II 24,643,899 19,247,215 26,390,448 5,359,216 8,197,824 7,506,159

LC3II/LC3I RATIO 2.348442369 2.211554857 1.28417147 4.7412844 7.379363982 6.120422012

Set 2 Control Rap S/A Control+Chl Rap+Chl S/A+Chl LC3I 12,102,912 16,337,324 22,562,410 1,840,630 1,203,152 1,252,672 LC3II 22,690,464 19,404,422 21,907,795 4,087,435 8,290,578 7,269,504

LC3II/LC3I RATIO 1.874793769 1.187735641 0.97098648 2.22067173 6.890715388 5.803198283

Set 3 Control Rap S/A Control+Chl Rap+Chl S/A+Chl LC3I 1,581,660 2,442,405 2,164,374 2,951,100 2,554,378 3,930,564 LC3II 4,674,330 7,224,854 6,194,988 9,308,700 13,822,270 17,167,854

LC3II/LC3I RATIO 2.95533174 2.958090079 2.86225394 3.15431534 5.411207738 4.36778386

Control Rap S/A Control+Chl Rap+Chl S/A+Chl Set 1 2.348442369 2.211554857 1.28417147 4.7412844 7.379363982 6.120422012 Set 2 1.874793769 1.187735641 0.97098648 2.22067173 6.890715388 5.803198283 Set 3 2.95533174 2.958090079 2.86225394 3.15431534 5.411207738 4.36778386

Statistical Analysis p-value Rap Vs Rap+Chl 0.0051 S/A Vs S/A+Chl 0.0096 Con+Chl Vs Rap+Chl 0.0299

Chapter III

Research Paper 2

An Immunoblot LC3 assay to monitor the effect of presenilin truncations on autophagy using zebrafish

larvae

57

Research Paper 2

An Immunoblot LC3 assay to monitor the effect of presenilin truncations on autophagy using zebrafish larvae

Swamynathan Ganesan 1*, Morgan Newman1, Michael Lardelli1.

1. Department of Genetics and Evolution, School of Biological Sciences,

The University of Adelaide, SA, 5005, Australia.

*Corresponding Author: Swamynathan Ganesan, Alzheimer’s disease Genetics Laboratory, School of Molecular and Biomedical Sciences, The University of Adelaide, Adelaide SA 5005, Australia. Tel. (+61) 88313 4863, Fax (+61) 88313 4362. Email: [email protected]

58

59 Abstract

The PRESENILIN genes play a critical role in AD pathogenesis. Mutations in PSEN1 and PSEN2 affect γ-secretase activity and β-amyloid processing. However, the effects of these mutations on autophagy remain elusive. Using the LC3 immunoblot assay, we find that truncations of PRESENILIN proteins (zPsen1∆>4 and zPsen2∆>4) do not appear to alter autophagic flux in zebrafish larvae. We confirmed our findings by performing the LC3 immunoblot assay in the presence of a lysosomal inhibitor, chloroquine. In addition, we demonstrate that rapamycin can induce autophagy in explanted zebrafish adult brains. In contrast, sodium azide treatment (for chemical mimicry of hypoxia) does not have an effect.

60

Introduction

Alzheimer’s disease (AD) is a neurodegenerative disorder characterised by the accumulation of amyloid plaques and tau tangles in the brain [1]. Nearly 95% of AD patients suffer from late onset of sporadic AD while the remaining 5% suffer from FAD

[2]. Moreover, AD is a complex disease involving many contributing factors. The various genes and pathways which contribute to disease progression result in neurodegeneration which eventually manifests as behavioural and neuropsychiatric changes [3]. There are a number of hypotheses that attempt to account for the accumulation of β-amyloid (Aβ) as amyloid plaques in AD patients. Of these, the

‘amyloid cascade hypothesis’ is the most widely investigated and accepted mechanism

[4-6].

The PRESENILINs are the earliest genes along with AMYLOID-β A4 PRECURSOR

PROTEIN (AβPP) identified as responsible factors for the progression of AD [7]. The

PRESENILIN proteins (PSEN1 and PSEN2) form the catalytic components of γ- secretase complexes along with NICASTRIN, ANTERIOR PHARYNX DEFECTIVE

(APH) and PRESENILIN ENHANCER 2 [8-10]. Several transmembrane proteins such as Notch and AβPP are cleaved by a series of aspartyl proteases: α-,β-, and γ-secretase

[11]. β-secretase initiates the cleavage process of AMYLOID-β A4 PRECURSOR

PROTEIN (AβPP) resulting in the formation of a transmembrane C-99 fragment. The

C-99 fragment is then further cleaved by the γ-secretase complex to form Aβ [12].

Therefore Aβ production is dependent upon the proper functioning of the γ-secretase complex. Studies have shown that aberrant enzymatic activity of γ-secretase may lead to Aβ accumulation in the brain [13, 14]. Furthermore, some reports have suggested that

61

failure of clearance of these accumulated peptides may be one of the factors contributing to AD pathogenesis [15].

Autophagy is a major degradative pathway in cells essential for maintaining protein turnover and cellular homeostasis [16] It is an essential pathway for removal of damaged proteins and organelles to prevent their accumulation. Therefore it plays crucial roles in various biochemical pathways during embryogenesis, growth, development and ageing [17]. Macroautophagy, microautophagy and chaperone- mediated autophagy are the three types of autophagy that occur in cells.

Macroautophagy involves the degradation of damaged proteins and organelles through the formation of autophagosomes while microautophagy involves the engulfment of damaged cytosolic contents by lysosomes. In chaperone-mediated autophagy, a chaperone (HSC 70) binds to proteins containing a specific pentapeptide motif and translocates these proteins to lysosomes for degradation [18, 19]. Current research is focussed on elucidating the role played by autophagy in AD and its interplay with various other factors involved in AD pathogenesis. Lee et al have shown that presenilin

FAD mutations inhibit autophagy [20]. Studies have identified autophagy failure as a hallmark of AD brains implying an important role for this pathway in AD pathogenesis

[21]. Furthermore, reports showing that PRESENILIN1 protein is required for proper functioning of the autophagic pathway support the hypothesis that autophagy is involved in AD progression [22].

AD has been studied extensively in various model organisms. There has been little analysis of autophagy in zebrafish and research is ongoing to establish various assays to monitor autophagy in this organism. Autophagic flux can be monitored through the

LC3 immunoblot assay [23-25]. Other assays include analysis of lysosome number by

62

the use of lysotracker dye and microscopy [26]. In this study, we have attempted to establish more fully the use of the LC3 immunoblot assay in the zebrafish model organism. LC3, a Microbtubule associated protein involved in autophagy, has two proteolytic forms – LC3I & LC3II. Upon induction of autophagy LC3 converts from

LC3I to LC3II and facilitates the binding of autophagosomes to lysosomes [27].

Therefore determining the ratio of LC3II/LC3I can indicate the autophagic flux in a cell. In recent years, determination of the LC3II/LC3I ratio alone is regarded as insufficient and confirmation of autophagic flux by use of lysosomal inhibitors is now regarded as mandatory. Lysosomal inhibitors potentially block the degradation of autophagosomes leading to accumulation of LC3II and that confirms autophagic flux within a cell. In our laboratory, assays of Notch signalling and γ-secretase have been used to assess the activities of truncated forms of PRESENILIN protein [28, 29].

Truncations of the zebrafish Psen1 and Psen2 proteins after exon 4 coded sequence (i.e., zPsen1∆>4 and zPsen2∆>4 respectively) have differential effects on Notch signalling and cleavage of zebrafish Appa [28, 30]. Therefore, we wished to assess the effects of these truncations on autophagy to understand how they might contribute to AD pathogenesis.

In this study we tested the effect of PRESENILIN truncations on autophagic flux in zebrafish larvae in the presence of the commonly used lysosomal inhibitor chloroquine

[31].

63

Materials and Methods

Ethics

This work was conducted under the auspices of The Animal Ethics Committee of The

University of Adelaide and in accordance with EC Directive 86/609/EEC for animal experiments and the Uniform Requirements for Manuscripts Submitted to Biomedical

Journals.

Extraction of adult zebrafish brains

Adult zebrafish were collected from the tank and killed by plunging into ice water.

Their brains were removed. Adult brains were incubated in DMEM (Dulbecco's

Modified Eagle Medium) at 28 ºC. For chemical treatments to induce autophagy and mimic chemical hypoxia, the brains were incubated with 1 µM rapamycin or 100 µM

Sodium Azide respectively for 6 h in DMEM respectively at 28 ºC.

Drug Treatment

Wild-type embryos were collected and treated with the following drugs dissolved in

DMSO. Rapamycin, which is a known inducer of autophagy was added to a final concentration of 1 µM to 48 hpf embryos which were then incubated for a further 24 h at 28.5 ºC [26]. Chloroquine, a chemical that raises lysosomal pH and thus inhibits autophagy, was added at a final concentration of 50 µM to 56 hpf larvae which were then incubated for a further 16 h at 28.5 ºC. Similarly, a 50 µM concentration of chloroquine was added to normal and treated (rapamycin or sodium azide) adult brains in DMEM for 6 h at 28.5 ºC [32].

64

Construction and cloning of DNA expressing PRESENILIN truncations

Truncations of zebrafish PRESENILIN proteins after exon 4 sequence were amplified by PCR from zebrafish psen1 and psen2 cDNAs. (Note that, for the purposes of simplicity, we refer to zebrafish presenilin exons by their cognate human exon designations i.e., 3, 4, 5, etc.). PCR products were cloned into the pT2AL200R150G

(pT2) plasmid between the Bam HI and Cla I sites to form pT2-zPsen1Δ>4 and pT2- zPsen2Δ>4. (Note that pT2AL200R150G normally contains sequence coding for GFP.

However, for insertion of coding sequences for the Presenilin truncations the GFP gene was removed). The Presenilin truncations are fused at their N-termini to a FLAG™ antibody tag following a start codon within a consensus Kozak sequence. (Note that the former start/methionine codons of the psen genes are retained.)

Micro-injection of DNA and mRNA

Tol2 transposase (pCS-TP) mRNA was synthesized in vitro using the mMESSAGE

MACHINE SP6 Kit (Ambion Inc.,Austin, TX, USA). A DNA/RNA solution containing either 50ng/μl circular DNA of pT2 (empty vector) or pT2-zPsen1Δ>4 or pT2- zPsen2Δ>4 was combined with 25ng/μl transposase mRNA and injected into fertilized eggs at the one cell stage. For all presenilin truncation constructs 1/10th volume of pT2 was also included in the DNA/RNA mix. Only embryos observably expressing GFP

(from pT2) at 24 hpf were selected for the LC3 assay at 72 hpf. Expression of these constructs at 24 hours post-fertilisation (hpf) was confirmed by western blot using an antibody against the FLAG tag (data not shown).

65

Western immunoblot analyses

Dechorionated and deyolked 72 hpf larvae as well as normal and hypoxic brain samples were placed in sample buffer (2% sodium dodecyl sulfate (SDS), 5% β- mercaptoethanol, 25% v/v glycerol, 0.0625 M Tris–HCl (pH 6.8), and bromphenol blue), heated immediately at 100 ºC for 5 min, before storage at –20 ºC prior to protein separation on 15% SDS–polyacrylamide gels. Proteins were transferred to PVDF membranes using a wet electrotransfer system. When immunoblotting with anti-LC3 antibodies, the membranes were blocked with 5% Western Blot Blocking Solution in

TBST, incubated with a 1/2,000 dilution of primary antibodies in TBST containing 1%

Western Blot Blocking Solution, washed in TBST, and incubated with a 1/10,000 dilution of anti-rabbit (Rockland Immunochemicals Inc., Gilbertsville, PA, USA). For incubation with anti-β-tubulin antibodies (Antibody E7, Developmental Studies

Hybridoma Bank, The University of Iowa, IA, USA), the conditions were the same as for western immunoblotting with anti-LC3 antibodies except that the primary antibodies were diluted 1/200 and donkey antimouse IgG secondary antibodies (Jackson

ImmunoResearch Laboratories Inc., West Grove, PA, USA) were diluted 1/10,000.

After incubation with secondary antibodies, all the membranes were washed four times for 15 min in TBST and visualized with luminol reagents (Amresco, Ohio, USA) by exposure to X-ray films (GE Healthcare LTD, Amersham Hyperfilm TM ECL, UK) and the ChemiDoc™ MP imaging system (Bio-Rad, Hercules, CA, USA). The densitometric values for LC3I and LC3II bands were calculated using Image J software

(NIH, USA). The values were then used to calculate the LC3II/LC3I ratio. Analysis were performed in triplicate and statistical analysis was carried out using Graph Pad

Prism version 6.0 (GraphPad Prism, La Jolla, CA).

66

Statistical Analysis

A Student’s two-tailed unpaired t-test assuming unequal variances was used to evaluate significant differences between controls and samples from different treatments. p-values are shown within the figures. Error bars given in figures represent SEMs of three full experimental replicates for the immunoblot assays.

Results

Rapamycin induces autophagy in explanted zebrafish adult brains

Zebrafish adult brains were explanted and treated with rapamycin for induction of autophagy. The experiment was carried out in the presence of chloroquine, a lysosomal inhibitor as suggested by the Autophagy Forum [31]. The autophagic flux in a cell could be evaluated by determining the LC3 turnover or the LC3II/LC3I ratio in the presence and absence of lysosomal inhibitors. The use of lysosomal inhibitors could help us to determine the real autophagic flux in a cell [31].

The Adult brain samples treated with rapamycin (6 h) showed an increased LC3II/LC3I ratio in the absence of chloroquine when compared to normal adult brain samples. Also they showed a consistent increase in the LC3II/LC3I ratio in the presence of chloroquine when compared to normal adult brain samples treated similarly with chloroquine. This supports that there is a real increase in autophagic flux which has been confirmed in the presence of chloroquine at 6 h treatment. Thus we can confirm that rapamycin induces autophagy in explanted zebrafish adult brain samples treated for

6 h (Figure 1A&B).

67

Sodium Azide does not induce autophagy in explanted zebrafish brains

Hypoxia is observed in sporadic AD brains and is thought to be involved in AD pathogenesis [33]. The response of cells to hypoxia is still unclear and therefore we wished to see whether autophagy is induced as a response to hypoxia. We have previously shown that mimicry of hypoxia using sodium azide can upregulate the unfolded protein response (UPR) in zebrafish embryos [30]. Therefore we wished to investigate whether sodium azide might upregulate autophagy in explanted adult zebrafish brains.

Explanted adult brains were treated with 100 µM sodium azide for 6 h in the presence and absence of 50 µM chloroquine. The sodium azide-treated adult brains did not show a significant difference in the LC3II/LC3I ratio when compared to normal adult brains onto sodium azide-treated adult brains in the presence of chloroquine. This suggests that sodium azide treatment at that time point did not have an inducing effect on autophagy in zebrafish adult brains. A 6 h sodium azide treatment may be insufficient to induce autophagy and longer treatment may be required to see this effect on explanted zebrafish adult brains (Figure 2A&B).

LC3 immunoblot assay to test the effects of truncations of Psen1 (zPsen1∆>4) &

Psen2 (zPsen2∆>4) on autophagy in zebrafish

PRESENILINs are proposed to play key roles in AD pathogenesis. Recent evidence has shown that they may regulate the autophagy pathway. Although their role in relation to the pathway is debatable, evidence exists that they may be required for lysosomal acidification [20]. Previously in our laboratory we have developed several truncations of both the zebrafish Psen1 and Psen2 proteins and have tested them for their effects on

68

notch signaling and γ-secretase cleavage of APP-like substrate assays [28, 29]. Morgan et al demonstrated that stimulation of γ-secretase activity by PS2V-like molecule

(zPsen1∆>4) require the presence of full length zebrafish Psen1 protein [28]. Similarly,

Moussavi Nik et al showed that zPsen1∆>4 but not zPsen2∆>4 can suppress the unfolded protein response (UPR), a pro-survival pathway [30]. Therefore we developed the LC3 immunoblot assay to test the effects of these truncations on autophagy to gain a better understanding of how autophagy may play a role in AD pathogenesis.

Zebrafish embryos were injected with DNA of either pT2-zPsen1Δ>4 or pT2- zPsen2Δ>4, (i.e., truncations of either zebrafish Psen1 or Psen2 after exon 4 in pT2 vector) and treated with the specified chemicals (refer to Materials and Methods). The samples were separated on SDS-PAGE gels and detected using the LC3 antibody. The autophagic flux was determined by examining LC3II/LC3I ratios. The LC3II/LC3I ratios for the zebrafish zPsen1∆>4 and zPsen2∆>4 truncations were then compared with controls to look for significant differences (Figure 3A&B).

Neither Psen1 truncation (zPsen1∆>4) nor Psen2 truncation (zPsen2∆>4) show significant effects on autophagy

Embryos injected with both zPsen1∆>4 and zPsen2∆>4 initially showed a difference in the LC3II/LC3I ratio however this occurred in the absence of a lysosomal inhibitor. To validate this difference in the ratio the experiment was also performed in the presence of a lysosomal inhibitor as suggested by the Autophagy Forum [31]. Therefore we repeated the same LC3 immunoblot assay in the presence of chloroquine, a lysosomal inhibitor. In the presence of chloroquine, embryos injected with zPsen1∆>4 showed no significant difference in the LC3II/LC3I ratio when compared to controls at 72 hpf

(Figure 4A&B). Similarly, when embryos were injected with zPsen2∆>4 and treated 69

with chloroquine there was no significant difference in the LC3II/LC3I ratio observed between them and embryos injected with zPsen2∆>4 only (Figure 5A&B). This suggests that neither zPsen1∆>4 nor zPsen2∆>4 show significant effects on autophagy in zebrafish larvae at 72 hpf.

Discussion

AD is a complex multifactorial disease involving various genetic and environmental factors [34]. Earlier research has identified genes for AMYLOID-β A4 PRECURSOR

PROTEIN (APP) and the PRESENILINs as important genetic factors responsible for

AD pathogenesis [35]. PRESENILINs are components of the γ-secretase complex which cleaves AMYLOID-β A4 PRECURSOR PROTEIN (APP) to release β-amyloid

[36]. Mutations in PRESENILIN genes have been attributed to causing structural and functional defects to the γ-secretase complex [37]. Apart from directly contributing to

AD pathogenesis, PRESENILINs are also thought to be involved indirectly by regulating various other pathways related to AD such as ER stress, mitochondrial function and autophagy [38, 39].

Autophagy is one pathway that is known to play a crucial role in AD pathogenesis. It is a regulatory pathway involved in degrading damaged peptides and maintaining cellular homeostasis [40]. Several studies have shown that failure in autophagy leads to the aggregation of β-amyloid in neurons [41, 42]. Moreover PRESENILINs are also thought to be involved in the process of lysosomal acidification [20, 43].

We have previously identified the zebrafish co-orthologues of the mammalian

MAP1LC3 gene family and elucidated their expression patterns during development

[44]. Standard assays to monitor autophagy such as immunoblotting for LC3, an

70

autophagy marker and use of lysotracker dyes have already been established in zebrafish [45, 46]. Also transgenic fish bearing GFP-LC3 constructs have been used to monitor autophagy [32, 47].

The primary aim of this study was to develop a simple assay to determine the effects of these presenilin truncations on autophagy in zebrafish larvae. Rapamycin which is a known inducer of autophagy has been shown to induce autophagy in several animal models including zebrafish. In our study we wanted to test whether rapamycin could be used to induce autophagy in explanted adult zebrafish brains. Through this study, we have confirmed that rapamycin effectively induces autophagy in explanted zebrafish adult brain samples in addition to in zebrafish embryos as previously reported.

In the second part of our study, we used this LC3 immunoblot assay to test the effects on autophagy of the zPsen1∆>4 and zPsen2∆>4 truncations that have differential effects on γ-secretase activity and the UPR. These truncations are structurally similar to a naturally forming variant of PSEN2, PS2V which is involved in the response of neurons to hypoxia and in AD progression. Previously, we showed that PS2V-like molecule (zPsen1∆>4) can stimulate the γ-secretase activity in the presence of full- length zebrafish Psen1 protein [28]. In continuation, we have recently demonstrated that it can also suppress the UPR. The ability to suppress the UPR was observed with only zPsen1∆>4 and not the zPsen2∆>4 truncation in zebrafish embryos [30]. The UPR and autophagy are both survival mechanisms activated by cells in response to stress and protein aggregation [48]. Matsumoto et al reported that the UPR may induce autophagy as a response to ER stress and protein aggregation suggesting that there is a cross talk between these two pathways [49]. Since we have observed that zPsen1∆>4 and zPsen2∆>4 truncations have contrasting effects on UPR, we thought that testing the

71

effects of these truncations on autophagy might reveal a link between these two pathways.

Our study revealed that neither zPsen1∆>4 nor zPsen2∆>4 significantly alter autophagic flux in cells assayed by changes in the LC3II/LC3I ratio. These conclusions are based upon the results obtained when each experiment was performed in triplicate.

However more replicates would be required to give greater certainty to our conclusions.

Further work will involve analysis of the effects on autophagy of other truncations of the PRESENILIN proteins. This work has shown that zebrafish embryos can be used effectively to measure autophagy in relation to AD pathogenesis.

72

Figures

Rapamycin induces autophagy in explanted zebrafish adult brains.

Figure 1 – (A) LC3 Immunoblot Assay using Adult Brain samples with rapamycin and/or chloroquine treatments. The blots were probed using anti-LC3 antibody and tubulin was detected as a loading control. (B) The LC3II/LC3I ratio was calculated using Image J software. Error bars represent standard errors of the means (n=3). AB, adult brain; Rap, rapamycin; Chl, chloroquine;

73

Sodium Azide treatment does not induce autophagy in explanted zebrafish adult brains.

Figure 2 – (A) LC3 Immunoblot Assay using Adult Brain samples with sodium azide and/or chloroquine treatments. The blots were probed using anti-LC3 antibody and tubulin was detected as a loading control. (B) The LC3II/LC3I ratio was calculated using Image J software. Error bars represent standard errors of the means (n=3). AB, adult brain; S/A, sodium azide; Chl, chloroquine;

74

Testing the effects of zPsen1∆>4 and zPsen2∆>4 on autophagy using the LC3 immunoblot assay.

Figure 3 – (A) Embryos were injected with DNA of either pT2-zPsen1Δ>4 or pT2-zPsen2Δ>4 truncations. Larvae were collected for western blotting at 72 hpf. The samples were run on SDS-PAGE and probed using anti-LC3 antibody. Tubulin was detected as a loading control. (B) The LC3II/LC3I ratio was calculated using Image J software. Error bars represent standard errors of the means (n=3).

75

zPsen1∆>4 fails to cause a significant change in autophagy in zebrafish larvae at

72 hpf.

Figures 4 – (A) Embryos were injected with pT2-zPsen1Δ>4 DNA and a sub-group was subjected to chloroquine treatment. Larvae were collected for western blotting at

72 hpf. The samples were run on SDS-PAGE and probed using anti-LC3 antibody.

Tubulin was detected as a loading control. (B) The LC3II/LC3I ratio was calculated using Image J software. Error bars represent standard errors of the means (n=3).

76

zPsen2∆>4 fails to cause a significant change in autophagy in zebrafish larvae at

72hpf.

Figures 5 – (A) Embryos were injected with pT2-zPsen2Δ>4 DNA and a sub-group was subjected to chloroquine treatment. Larvae were collected for western blotting at

72 hpf. The samples were run on SDS-PAGE and probed using anti-LC3 antibody.

Tubulin was detected as a loading control. (B) The LC3II/LC3I ratio was calculated using Image J software. Error bars represent standard errors of the means (n=3).

77

References

1. Newman, M., I.F. Musgrave, and M. Lardelli, Alzheimer disease:

amyloidogenesis, the presenilins and animal models. Biochim Biophys Acta,

2007. 1772(3): p. 285-97.

2. Robakis, N.K., Mechanisms of AD neurodegeneration may be independent of

Abeta and its derivatives. Neurobiol Aging, 2011. 32(3): p. 372-9.

3. Aggarwal, N.T., et al., Mild cognitive impairment in different functional

domains and incident Alzheimer's disease. J Neurol Neurosurg Psychiatry, 2005.

76(11): p. 1479-84.

4. Hardy, J.A. and G.A. Higgins, Alzheimer's disease: the amyloid cascade

hypothesis. Science, 1992. 256(5054): p. 184-5.

5. Tanzi, R.E. and L. Bertram, Twenty years of the Alzheimer's disease amyloid

hypothesis: a genetic perspective. Cell, 2005. 120(4): p. 545-55.

6. Butcher, J., Alzheimer's amyloid hypothesis gains support. Lancet, 2000.

356(9248): p. 2161.

7. Van Broeckhoven, C., Presenilins and Alzheimer disease. Nat Genet, 1995.

11(3): p. 230-2.

8. Ehehalt, R., et al., Amyloidogenic processing of the Alzheimer beta-amyloid

precursor protein depends on lipid rafts. J Cell Biol, 2003. 160(1): p. 113-23.

9. Haass, C. and H. Steiner, Alzheimer disease gamma-secretase: a complex story

of GxGD-type presenilin proteases. Trends Cell Biol, 2002. 12(12): p. 556-62.

10. Supnet, C. and I. Bezprozvanny, Presenilins as endoplasmic reticulum calcium

leak channels and Alzheimer's disease pathogenesis. Sci China Life Sci, 2011.

54(8): p. 744-51.

78

11. Haass, C. and D.J. Selkoe, Cellular processing of beta-amyloid precursor

protein and the genesis of amyloid beta-peptide. Cell, 1993. 75(6): p. 1039-42.

12. Munter, L.M., et al., Aberrant amyloid precursor protein (APP) processing in

hereditary forms of Alzheimer disease caused by APP familial Alzheimer

disease mutations can be rescued by mutations in the APP GxxxG motif. J Biol

Chem, 2010. 285(28): p. 21636-43.

13. Selkoe, D.J., The cell biology of beta-amyloid precursor protein and presenilin

in Alzheimer's disease. Trends Cell Biol, 1998. 8(11): p. 447-53.

14. Selkoe, D.J., Toward a comprehensive theory for Alzheimer's disease.

Hypothesis: Alzheimer's disease is caused by the cerebral accumulation and

cytotoxicity of amyloid beta-protein. Ann N Y Acad Sci, 2000. 924: p. 17-25.

15. Moreira, P.I., et al., Autophagy in Alzheimer's disease. Expert Rev Neurother,

2010. 10(7): p. 1209-18.

16. Yang, D.S., J.H. Lee, and R.A. Nixon, Monitoring autophagy in Alzheimer's

disease and related neurodegenerative diseases. Methods in enzymology, 2009.

453: p. 111-44.

17. Mortimore, G.E., et al., Autophagy. Sub-cellular biochemistry, 1996. 27: p. 93-

135.

18. Boya, P., F. Reggiori, and P. Codogno, Emerging regulation and functions of

autophagy. Nat Cell Biol, 2013. 15(7): p. 713-20.

19. Reggiori, F., et al., Selective types of autophagy. Int J Cell Biol, 2012. 2012: p.

156272.

20. Lee, J.H., et al., Lysosomal proteolysis and autophagy require presenilin 1 and

are disrupted by Alzheimer-related PS1 mutations. Cell, 2010. 141(7): p. 1146-

58. 79

21. Nixon, R.A. and D.S. Yang, Autophagy failure in Alzheimer's disease-locating

the primary defect. Neurobiology of disease, 2011. 43(1): p. 38-45.

22. Neely, K.M., K.N. Green, and F.M. LaFerla, Presenilin is necessary for efficient

proteolysis through the autophagy-lysosome system in a gamma-secretase-

independent manner. J Neurosci, 2011. 31(8): p. 2781-91.

23. Tanida, I., T. Ueno, and E. Kominami, LC3 conjugation system in mammalian

autophagy. Int J Biochem Cell Biol, 2004. 36(12): p. 2503-18.

24. Liu, C., et al., Roles of autophagy-related genes Beclin-1 and LC3 in the

development and progression of prostate cancer and benign prostatic

hyperplasia. Biomed Rep, 2013. 1(6): p. 855-860.

25. Kimura, S., et al., Monitoring autophagy in mammalian cultured cells through

the dynamics of LC3. Methods Enzymol, 2009. 452: p. 1-12.

26. He, C. and D.J. Klionsky, Analyzing autophagy in zebrafish. Autophagy, 2010.

6(5).

27. McLeland, C.B., J. Rodriguez, and S.T. Stern, Autophagy monitoring assay:

qualitative analysis of MAP LC3-I to II conversion by immunoblot. Methods

Mol Biol, 2011. 697: p. 199-206.

28. Newman, M., et al., Differential, dominant activation and inhibition of Notch

signalling and APP cleavage by truncations of PSEN1 in human disease. Hum

Mol Genet, 2014. 23(3): p. 602-17.

29. Wilson, L. and M. Lardelli, The development of an in vivo gamma-secretase

assay using zebrafish embryos. J Alzheimers Dis, 2013. 36(3): p. 521-34.

30. Moussavi Nik, S.H., et al., Alzheimer's disease-related peptide PS2V plays

ancient, conserved roles in suppression of the unfolded protein response under

hypoxia and stimulation of gamma-secretase activity. Hum Mol Genet, 2015. 80

31. Klionsky, D.J., et al., Guidelines for the use and interpretation of assays for

monitoring autophagy. Autophagy, 2012. 8(4): p. 445-544.

32. Cui, J., et al., Generation of transgenic zebrafish with liver-specific expression

of EGFP-Lc3: a new in vivo model for investigation of liver autophagy.

Biochem Biophys Res Commun, 2012. 422(2): p. 268-73.

33. Grammas, P., et al., Brain microvasculature and hypoxia-related proteins in

Alzheimer's disease. Int J Clin Exp Pathol, 2011. 4(6): p. 616-27.

34. Lautenschlager, N., A. Kurz, and U. Muller, [Inheritable causes and risk factors

of Alzheimer's disease]. Nervenarzt, 1999. 70(3): p. 195-205.

35. Iwatsubo, T. and T. Tomita, [Genetic factors in the pathogenesis of Alzheimer's

disease: roles of beta-amyloid and presenilins]. Tanpakushitsu Kakusan Koso,

1998. 43(13): p. 1963-72.

36. Takasugi, N., et al., The mechanism of gamma-secretase activities through high

molecular weight complex formation of presenilins is conserved in Drosophila

melanogaster and mammals. J Biol Chem, 2002. 277(51): p. 50198-205.

37. Hardy, J., Putting presenilins centre stage. Introduction to the Talking Point on

the role of presenilin mutations in Alzheimer disease. EMBO Rep, 2007. 8(2): p.

134-5.

38. Nelson, O., et al., Familial Alzheimer's disease mutations in presenilins: effects

on endoplasmic reticulum calcium homeostasis and correlation with clinical

phenotypes. J Alzheimers Dis, 2010. 21(3): p. 781-93.

39. Tu, H., et al., Presenilins form ER Ca2+ leak channels, a function disrupted by

familial Alzheimer's disease-linked mutations. Cell, 2006. 126(5): p. 981-93.

81

40. Boland, B., et al., Autophagy induction and autophagosome clearance in

neurons: relationship to autophagic pathology in Alzheimer's disease. J

Neurosci, 2008. 28(27): p. 6926-37.

41. Nixon, R.A. and D.S. Yang, Autophagy failure in Alzheimer's disease--locating

the primary defect. Neurobiol Dis, 2011. 43(1): p. 38-45.

42. Wolfe, D.M., et al., Autophagy failure in Alzheimer's disease and the role of

defective lysosomal acidification. Eur J Neurosci, 2013. 37(12): p. 1949-61.

43. Pasternak, S.H., et al., Presenilin-1, nicastrin, amyloid precursor protein, and

gamma-secretase activity are co-localized in the lysosomal membrane. J Biol

Chem, 2003. 278(29): p. 26687-94.

44. Ganesan, S., et al., Identification and expression analysis of the zebrafish

orthologues of the mammalian MAP1LC3 gene family. Exp Cell Res, 2014.

328(1): p. 228-37.

45. He, C. and D.J. Klionsky, Analyzing autophagy in zebrafish. Autophagy, 2010.

6(5): p. 642-4.

46. Fleming, A. and D.C. Rubinsztein, Zebrafish as a model to understand

autophagy and its role in neurological disease. Biochim Biophys Acta, 2011.

1812(4): p. 520-6.

47. He, C., et al., Assaying autophagic activity in transgenic GFP-Lc3 and GFP-

Gabarap zebrafish embryos. Autophagy, 2009. 5(4): p. 520-6.

48. Lee, D.Y., J. Lee, and B. Sugden, The unfolded protein response and

autophagy: herpesviruses rule! J Virol, 2009. 83(3): p. 1168-72.

49. Matsumoto, H., et al., Selection of autophagy or apoptosis in cells exposed to

ER-stress depends on ATF4 expression pattern with or without CHOP

expression. Biol Open, 2013. 2(10): p. 1084-90. 82

Supplementary Data

Table 1 – Densitometric analysis of western blots of zebrafish adult brain samples

(Rapamycin and Chloroquine Treatment - Figure 1B). The intensity values of the

LC3I and LC3II bands of each replicate are given. AB, Adult Brain; Rap,

Rapamycin; Chl, Chloroquine.

SET 1 AB AB+Rap AB+Chl AB+Rap+Chl LC3 I 5,511,009 3,058,848 2,730,672 3,239,943 LC3II 5,670,741 6,169,509 3,221,400 9,229,632

LC3II/LC3I RATIO 1.028984166 2.01693873 1.17970961 2.848701968

SET 2 AB AB+Rap AB+Chl AB+Rap+Chl LC3 I 5,521,354 6,968,520 8,778,540 5,885,144 LC3II 3,170,719 11,639,225 8,158,560 12,903,028

LC3II/LC3I RATIO 0.574264755 1.670257817 0.9293755 2.192474475

SET 3 AB AB+Rap AB+Chl AB+Rap+Chl LC3 I 10,995,957 9,257,220 10,229,688 7,997,472 LC3II 8,333,349 16,868,790 9,155,552 14,864,920

LC3II/LC3I RATIO 0.757855728 1.822230648 0.894998166 1.85870235

Statistical Analysis p-value AB vs AB+Rap 0.004 AB +Chl vs AB+Rap+Chl 0.0371 AB+Rap vs AB+Rap+Chl 0.2475

Table 2 - Densitometric analysis of western blots of zebrafish adult brain samples

(Sodium Azide and Chloroquine Treatment - Figure 2B). The intensity values of the LC3I and LC3II bands of each replicate are given. AB, Adult Brain; Rap,

Rapamycin; Chl, Chloroquine.

SET 1 AB AB+S/A AB+Chl AB+S/A+Chl LC3 I 4,871,520 3,178,278 6,490,156 11,815,215 LC3II 3,686,331 1,857,114 4,417,132 5,042,382

LC3II/LC3I RATIO 0.756710637 0.584314525 0.680589496 0.426770228

SET 2 AB AB+S/A AB+Chl AB+S/A+Chl LC3 I 2,856,874 1,830,960 5,403,684 3,167,146 LC3II 2,109,685 1,407,195 4,502,940 2,250,918

LC3II/LC3I RATIO 0.738459239 0.76855584 0.833309276 0.710708632

SET 3 AB AB+S/A AB+Chl AB+S/A+Chl LC3 I 5,209,380 7,844,472 14,921,350 8,491,878 LC3II 3,383,545 4,034,232 10,988,100 5,013,468

LC3II/LC3I RATIO 0.649510114 0.51427706 0.736401197 0.590383894

Statistical analysis p-value AB Vs AB+S/A 0.352 AB+Chl Vs AB+S/A+Chl 0.1573 AB+S/A Vs AB+S/A+Chl 0.6996

Table 3 - Densitometric analysis of western blots of zebrafish larvae (control and embryos injected with zPsen1∆>4 & zPsen2∆>4 truncations with rapamycin treatment - Figure 3B). The intensity values of the LC3I and LC3II bands of each replicate are given. Rap, Rapamycin; Chl, Chloroquine.

Set 1 Con.GFP Con.GFP+Rap zPsen1Δ>4 zPsen1Δ>4+Rap zPsen2Δ>4 zPsen2Δ>4+Rap LC3I 1,420,150 1,535,490 1,571,718 1,713,183 2,874,738 3,344,350 LC3II 3,385,450 4,840,385 5,315,832 6,016,761 6,733,581 10,120,600

LC3II/LC3I Ratio 2.383867901 3.152338993 3.382179246 3.512036367 2.342328588 3.02617848

Set 2 Con.GFP Con.GFP+Rap zPsen1Δ>4 zPsen1Δ>4+Rap zPsen2Δ>4 zPsen2Δ>4+Rap LC3I - - 1 1.94 0.53 0.6 LC3II 2.66 1.49 4.01 8.04 2.83 3.42

LC3II/LC3I Ratio 2.66 1.49 4.01 4.144329897 5.339622642 5.7

Set 3 Con.GFP Con.GFP+Rap zPsen1Δ>4 zPsen1Δ>4+Rap zPsen2Δ>4 zPsen2Δ>4+Rap LC3I 4,001,965 6,538,981 8,241,100 4,034,403 5,421,654 5,849,305 LC3II 13,082,355 17,077,554 19,771,625 11,571,912 16,248,924 13,397,560

LC3II/LC3I Ratio 3.268982862 2.611653712 2.399148779 2.868308397 2.997041862 2.29045331

Statistical Analysis p-value zPsen1Δ>4 Vs zPsen1Δ4+Rap 0.7039 zPsen2Δ>4 Vs zPsen2Δ4+Rap 0.9389 Con.GFP Vs zPsen1Δ4 0.4236 Con.GFP Vs zPsen2Δ4 0.4815

Table 4 - Densitometric analysis of western blots of zebrafish larvae (control and embryos injected with zPsen1∆>4 truncation with rapamycin and chloroquine treatment - Figure 4B). The intensity values of the LC3I and LC3II bands of each replicate are given. Rap, Rapamycin; Chl, Chloroquine.

Set 1 Con.GFP+Chl Con.GFP+Rap+Chl zPsen1Δ4+Chl zPsen1Δ4+Rap+Chl LC3I 1,252,212 1,025,496 1,267,344 2,004,336 LC3II 6,092,190 10,839,672 3,099,924 8,761,140

LC3II/LC3I Ratio 4.865142644 10.57017482 2.446000454 4.371093469

Set 2 Con.GFP+Chl Con.GFP+Rap+Chl zPsen1Δ4+Chl zPsen1Δ4+Rap+Chl LC3I 432,405 1,463,808 890,624 564,366 LC3II 3,203,631 11,855,168 5,103,840 4,560,468

LC3II/LC3I Ratio 7.408866687 8.098854495 5.730633803 8.080692317

Set 3 Con.GFP+Chl Con.GFP+Rap+Chl zPsen1Δ4+Chl zPsen1Δ4+Rap+Chl LC3I 1,074,645 1,171,578 1,068,768 1,784,286 LC3II 5,321,283 8,461,574 4,306,095 11,376,298

LC3II/LC3I Ratio 4.951665899 7.222373585 4.02902688 6.375826521

Statistical Analysis p-value Con.GFP+Chl Vs Con.GFP+Rap+Chl 0.0933 Con.GFP+Chl Vs zPsen1Δ4+Chl 0.2568 zPsen1Δ4+Chl Vs zPsen1Δ4+Rap+Chl 0.1989

Table 5 - Densitometric analysis of western blots of zebrafish larvae (control and embryos injected with zPsen2∆>4 truncation with rapamycin and chloroquine treatment - Figure 5B). The intensity values of the LC3I and LC3II bands of each replicate are given. Rap, Rapamycin; Chl, Chloroquine.

Set 1 Con.GFP+Chl Con.GFP+Rap+Chl zPsen2Δ4+Chl zPsen2Δ4+Rap+Chl LC3I 1,648,595 1,915,082 1,017,784 1,169,850 LC3II 4,691,245 7,433,152 3,601,626 3,834,075

LC3II/LC3I Ratio 2.845601861 3.881375314 3.538693868 3.27740736

Set 2 Con.GFP+Chl Con.GFP+Rap+Chl zPsen2Δ4+Chl zPsen2Δ4+Rap+Chl LC3I 1,605,505 911,845 450,080 2,711,674 LC3II 3,954,005 1,698,180 2,691,374 12,366,064

LC3II/LC3I Ratio 2.462779624 1.862355993 5.979768041 4.560306291

Set 3 Con.GFP+Chl Con.GFP+Rap+Chl zPsen2Δ4+Chl zPsen2Δ4+Rap+Chl LC3I 1,939,546 965,898 1,292,452 1,555,208 LC3II 13,564,484 11,368,444 20,074,794 32,077,436

LC3II/LC3I Ratio 6.993638718 11.76981835 15.53233234 20.62581725

Statistical Analysis p-value Con.GFP+Chl Vs Con.GFP+Rap+Chl 0.6416 Con.GFP+Chl Vs zPsen2Δ4+Chl 0.3698 zPsen2Δ4+Chl Vs zPsen2Δ4+Rap+Chl 0.8742

Chapter IV

Research Paper 3

Latrepirdine (DimebonTM) induces autophagy in

zebrafish larvae

83

Latrepirdine (DimebonTM) induces autophagy in zebrafish larvae

Swamynathan Ganesan 1*Ŧ, Anne Lim 1 Ŧ, Seyyed Hani Moussavi Nik 1, Morgan

Newman 1, Prashant Bharadwaj 2, Giuseppe Verdile 2, Ralph Martins 2, 3, 4, Michael

Lardelli 1.

1. Department of Genetics and Evolution, School of Biological Sciences,

The University of Adelaide, SA, 5005, Australia.

2. Centre of Excellence for Alzheimer's Disease Research and Care, School of Medical

Sciences, Edith Cowan University, Joondalup, WA, Australia.

3. School of Psychiatry and Clinical Neuroscience, University of Western Australia,

Crawley, WA, Australia.

4. The Sir James McCusker Alzheimer's Disease Research Unit, Hollywood Private

Hospital, Nedlands, WA, Australia.

SG Ŧ and AL Ŧ contributed equally to this work.

*Corresponding Author: Swamynathan Ganesan,

Alzheimer’s disease Genetics Laboratory, School of Molecular and Biomedical Sciences, The University of Adelaide, Adelaide SA 5005, Australia. Tel. (+61) 88313 4863, Fax (+61) 88313 4362. Email: [email protected]

84

85 86 Abstract

Latrepirdine is one of the several drugs that have been tested to combat AD.

Latrepirdine has been shown to induce autophagy and reduce β-amyloid aggregation.

However the effects of Latrepirdine have not been tested on zebrafish embryos. Here we use zebrafish embryos to test whether Latrepirdine can induce autophagy. We test

Latrepirdine at a series of concentrations and find that a 5 µM concentration of

Latrepirdine can induce autophagy in zebrafish larvae. This is evident from a LC3 immunoblot assay, where we observe an increase in the LC3II/LC3I ratio in the presence of a lysosomal inhibitor, chloroquine. Our TEM analysis supports the finding that latrepirdine induces autophagy in zebrafish larvae at 72 hpf.

87

Introduction

Living organisms are under constant external stress by environmental factor. They respond to these external factors by altering their cellular structure through various molecular pathways. One such pathway found in most living organisms is autophagy

[1]. In this paper we discuss about macroautophagy (referred to as autophagy), which primarily involves the degradation of proteins and organelles through the formation of autophagosomes. The other forms of autophagy include microautophagy, which involves the direct degradation of cytoplasmic cargo by lysosomes and chaperone- mediated autophagy which involves the binding of chaperones (HSC 70) to specific proteins and enabling their lysosomal degradation [2, 3]. Autophagy degrades proteins, protein aggregates and whole organelles to maintain cellular homeostasis [4]. The proteins and organelles degraded by autophagy provide substrates required for cellular metabolism [5]. Unlike apoptosis, autophagy promotes cell survival mechanism allowing cells to recover from damage and restore normal functioning [6]. Although initially thought to function only in clearing harmful peptides from the cell, current research has shown that it may have other significant functions in cellular metabolism

[7]. Studies have shown that it may play a significant role during ageing, development and in other process which require constant protein turnover.

Recently autophagy has been implicated in cancer, neurodegenerative disorders and other metabolic disorders [8]. Most of these disorders are multifactorial and involve many of other factors for their progression. Therefore it becomes important to investigate whether autophagy is protective or contributes to the progression of a disease. Alzheimer’s disease is one of the few disorders investigated in detail for the role of autophagy. Several studies in the past have highlighted that autophagy has a

88

crucial role in the progression of Alzheimer’s disease (AD), in which it may have contradictory actions [9-11]. Some studies have shown that autophagy is impaired as a result of AD progression [12]. Other studies have shown that autophagy may be modulated to enhance β-amyloid clearance which is a pathological feature observed in

AD and that this may slow down disease progression [13].

Several drugs have been tested for their effectiveness in reducing amyloid plaque formation [14]. Latrepirdine is one drug that has undergone clinical trials of relevance to AD pathogenesis. Studies have shown that latrepirdine possesses neuroprotective properties and improves cognition and behaviour in animal models [15, 16]. It has also been shown to be involved in mitochondrial function, calcium homeostasis and other pathways related to AD pathogenesis [17]. A study on cultured cells by Lermontova et al (2001) has shown that Latrepirdine inhibits the neurotoxic effects of β-amyloid and protects cells from cytotoxicity [18].

Zebrafish is widely used as an animal model to investigate various biochemical pathways that contribute to AD pathogenesis [19]. Zebrafish serves as an excellent tool to either over-express genes or to block gene expression by using morpholino antisense oligonucleotides [20, 21]. Zebrafish embryos are optically transparent and chemicals can be directly added to their aqueous support medium making it easy to analyse their effects on various biochemical pathways [22, 23]. Previously we have shown that autophagy can be analysed in zebrafish embryos by using various chemicals that induce and inhibit this function. We have also validated that autophagy can be monitored effectively in zebrafish embryos using the LC3 immunoblot assay [24].

In the work described in this paper, we use 3-day old zebrafish larvae to test whether

Latrepirdine (Dimebon) induces autophagy. Although Latrepirdine has been shown to 89

induce autophagy in cell lines, we report here the inductive effect of latrepirdine on autophagy in zebrafish. We show that autophagy induced by Latrepirdine can be monitored more sensitively in zebrafish embryos by direct observation of autophagosomes by transmission electron microscopy (TEM). Our findings support the use of zebrafish as a system in which to investigate the effects of Latrepirdine in vivo.

Materials and Methods

Ethics

This work was conducted under the auspices of The Animal Ethics Committee of The

University of Adelaide and in accordance with EC Directive 86/609/EEC for animal experiments and the Uniform Requirements for Manuscripts Submitted to Biomedical

Journals.

Zebrafish husbandry and experimental procedures

Wild-type zebrafish were maintained in a recirculated water system with a 14 hour light/10 hour dark cycle. Fertilized embryos were placed in petri plates containing embryo medium (E3) and grown at 28 ˚C in a humid incubator.

Drug Treatment

Latrepirdine (Dimebon) was added to 66 hpf larvae for 6 h at the concentrations specified in the experimental descriptions (1 µM to 200 µM). Chloroquine, a lysosomal inhibitor was added to a final concentration of 50 µM at 56 hpf followed by incubation for a further 16 h [22, 25]. At 72 hpf, all larvae were deyolked. The deyolked samples were then lysed with sample lysis buffer and immunoblotted.

90

Western immunoblot analyses

Deyolked larvae were placed in sample buffer (2% sodium dodecyl sulfate (SDS), 5%

β-mercaptoethanol, 25% v/v glycerol, 0.0625 M Tris–HCl (pH 6.8), and bromphenol blue), and then heated immediately at 100 ºC for 5 min. Samples were run on 15%

SDS-PAGE gels and proteins were transferred to PVDF membranes using a wet electrotransfer system. The membranes were blocked with 5% Western Blocking

Solution in TBST and then probed with anti-LC3 antibody and anti-β-tubulin antibody

(Antibody E7, Developmental Studies Hybridoma Bank, The University of Iowa, IA,

USA) which was used as a loading control. The blots were visualized using luminol reagents (Amresco, Ohio, USA) and the ChemiDoc™ MP imaging system (Bio-Rad,

Hercules, CA, USA).

Transmission electron microscopy

To observe the number of autophagosomes in zebrafish cells, treated and untreated larvae were grown to the 72 hpf stage. The larvae were fixed in 4% paraformaldehyde,

1.25% glutaraldehyde in PBS with 4% sucrose, pH 7.2 overnight at 4 ˚C, and then rinsed in washing buffer (PBS with 4% sucrose) twice for ten minutes. Larvae were post-fixed in 2% osmium tetroxide for 45 minutes on a rotator, followed by dehydration through an ethanol series of 70, 90, 95 and 100%. The ethanol was replaced by propylene oxide for 15 minutes followed by a mixture of propylene oxide and resin at a

1:1 ratio for 45 minutes. This was followed by 100% resin infiltration overnight. The embryos were then embedded in fresh resin and the resin polymerized at 70 ˚C for 24 hours. The embedded larvae were sectioned coronally in a rostral to caudal direction through the head of the embryo using an ultramicrotome. The depth at which sections were obtained was approximately 100-130 μm from the rostral end of the head, roughly 91

one-fifth into the eye to obtain an ultrathin 85 nm section of the forebrain. The ultrathin sections were stained with uranyl acetate and lead citrate and imaged on an Olympus-

SIS Veleta CCD camera in a FEI Tecnai G2 Spirit TEM (FEI, Oregon, USA). Images were obtained from 10 cells per larva. Thus, the cells observed for counting of autophagosomes were 30 per treatment.

Statistical analysis

Each experiment was carried out with 3 biological replicates (n=3). Data were analysed using GraphPad Version 6.0 (GraphPad Prism, La Jolla, CA). For the LC3II/LC3I assays, since single clutches of larvae were used to generate the various treatments of any biological replicate, differences among the groups were evaluated using a two- tailed paired t-test. For the TEM analysis, the treatments were conducted on one clutch of larvae and cells from three separate larvae from each treatment were analysed. P- values were calculated for all the comparisons and p<0.05 was considered significant.

Results

Determining the concentration of Latrepirdine that can induce autophagy in zebrafish embryos by an LC3 immunoblot assay

The most commonly used assay to measure autophagy is monitoring of the conversion of LC3, an autophagy marker. LC3 is a microtubule associated protein that is present in cytosol as LC3I and LC3II. Upon induction of autophagy, the cytosol LC3I undergoes lipidation with phosphotidyl ethanolamine (PE) and converts to LC3II which then binds to autophagosomes. Therefore determining the ratio of LC3II to LC3I reveals changes in autophagic activity.

92

Latrepirdine has been shown to induce autophagy in cell lines and in mice but no study has shown whether this effect can be generalised to other in vivo models. Since we are interested in the use of zebrafish to study Alzheimer’s disease, we carried out an initial screening of Latrepirdine at different concentrations to find out an optimum concentration that might induce autophagy in zebrafish larvae. We performed a standard LC3 Immunoblot assay on 72 hpf zebrafish embryos treated with a range of concentrations of Latrepirdine. In our initial screening we used Latrepirdine concentrations ranging from 50µM to 200µM. We then calculated the LC3II/LC3I ratio and did not find any significant difference in the ratio between control and Latrepirdine- treated samples (Figure 1A&B). Previous studies have demonstrated that a 10 nM concentration of Latrepirdine can induce autophagy in SH-SY5Y cells [26]. A very high concentration of Latrepirdine could be a reason for not finding any significant change and we decided to do a screen with lower concentrations of Latrepirdine.

In our second screen, we used Latrepirdine at concentrations in the range of 1µM to

50µM and performed the LC3 immunoblot assay. We found the most significant increase in the LC3II/LC3I ratio was observed between samples treated with 5 µM

Latrepirdine and untreated control samples at 72 hpf. We saw that the autophagic induction increases gradually with increasing Latrepirdine concentration and reaches a maximum increase at 5 µM of Latrepirdine when compared to untreated wild-type larvae (Figure 2A&B).

Currently, a standard requirement to validate observations of changes in LC3 isoform ratios is to observe the effects on LC3II of lysosomal inhibition. (If a treatment has increased autophagic flux then lysosomal inhibition should result in relative LC3II

93

accumulation). Therefore we performed the LC3 immunoblot assay in the presence of chloroquine, a lysosomal inhibitor to validate our findings further.

Induction of autophagy by Latrepirdine is confirmed by an increase in the LC3II/I ratio in the presence of chloroquine

The LC3 immunoblot assay performed using the 5 µM concentration of Latrepirdine that had shown an increase in the LC3II/LC3I ratio. No significant morphological changes were observed when larvae were treated with 5 µM Latrepirdine and chloroquine either in combination or alone suggesting that these treatments are not toxic

(Figure 3). Larvae treated with 5 µM Latrepirdine and chloroquine showed a significant increase in the LC3II/LC3I ratio when compared to wild-type larvae treated with chloroquine alone. This supported our finding that 5 µM Latrepirdine induces autophagy in zebrafish larvae (Figure 4A&B).

Determining induction of autophagy by counting the number of autophagic vacuoles using transmission electron microscopy (TEM)

Autophagosomes were first discovered using electron microscopy [27]. Transmission electron microscopy (TEM) is a widely used technique to assess numbers of autophagic vacuoles in cells. Electron microscopy produces high resolution images of autophagosomes which give a visual validation of the presence of autophagic vesicles assessed in other assays such as using the LC3 immunoblot assay. In electron microscopy autophagosomes can be identified as membrane bound vesicles that contain cytosolic materials such as organelles [28]. Our LC3 immunoblot assay showed that autophagy can be induced by Latrepirdine in zebrafish larvae. In order to validate further our LC3 immunoblot assay findings, we used TEM to quantitate the number of

94

autophagic vacuoles present in the brains of treated and untreated zebrafish larvae. To do this we treated larvae using the same conditions used for the immunoblot assay and then processed the larvae for TEM. All embryos were sectioned in the forebrain region, approximately 100-130 μm from the rostral extremity of the head. We chose cells from brain sections because LC3 levels are known to be high in the brain and Latrepirdine is proposed as a treatment for the neurodegenerative disease AD. We used the presence of the mandibular cartilage and ethmoid plate of the larva as a visual guide to confirm that we were observing cells from similar regions of each larva (Figure 5). Cells from the centre of the ventral area of the forebrain were chosen since these cells appeared fairly uniform in morphology and may represent a more homogenous cell type (Figure 5).

We analysed the number of autophagosomes present in ten cells per zebrafish larva and repeated this in triplicate, using three biological replicates. Cells of untreated larvae rarely contained autophagosomes, but treatment of larvae with only chloroquine increased the number of autophagosomes in cells by more than three-fold (Figure 6).

This appears to indicate that under normal conditions, autophagosomes are degraded rapidly after induction in larvae and chloroquine treatment blocks their degradation by inhibiting the activity of lysosomal enzymes. We found that treatment with 5 µM

Latrepirdine significantly increased the number of autophagosomes present in cells when compared with untreated larvae (Figure 7). For a more accurate assessment of autophagic flux, we compared larvae treated with 5 µM Latrepirdine in the presence of chloroquine to larvae treated with chloroquine only as was done in our immunoblot analyses. We found that Latrepirdine significantly increased the number of autophagic vacuoles present in cells (Figure 7). Our TEM results are in agreement with the LC3

95

immunoblot assay and indicate that 5 µM Latrepirdine causes induction of autophagy in the brains of zebrafish larvae at 72 h.

Discussion

AD is a complex multifactorial disorder characterised by the accumulation of β-amyloid in plaques in the brain [29-31]. β-amyloid accumulation is one of the important pathological features observed during the progression of the disease, therefore much research has focussed on the neurotoxicity of β-amyloid aggregation. Research has also identified several other factors influencing AD progression [32]. One such factor is autophagy. It is thought that failure of β-amyloid clearance due to a block in the autophagy pathway might play a critical role in AD progression [33, 34]. This has led to studies of several compounds that can possibly induce autophagy and might potentially alleviate AD symptoms [35].

In recent times, research has focussed on identifying potential drugs that might alleviate

AD symptoms by reducing β-amyloid aggregation through stimulation of autophagy.

Latrepirdine is one such drug that has been tested for amyloid clearance on yeast and mouse models [36, 37]. Initially studied as an anti-histamine drug, subsequent research has tested whether Latrepirdine has any other neuroprotective properties [38]. Studies have shown promising results regarding the effectiveness of Latrepirdine for reducing symptoms in several neurodegenerative disorders. While some research carried out on

Latrepirdine has suggested that it acts as a neuroprotector and enhances improvement in cognition and behaviour [15, 39, 40], other studies have shown that it can also reduce the aggregation of β-amyloid [41]. Moreover it has also been shown to interact with several other pathways involved in neurodegenerative disorders [42]. Although

Latrepirdine has been shown to have neuroprotective properties, the pathways and 96

mechanisms it interacts with to achieve this are still unknown. Therefore further research is required to characterize this chemical and to understand the various critical pathways influenced by it.

In our study, we examined whether Latrepirdine can induce autophagy in zebrafish larvae. Zebrafish is an excellent tool for dissection of molecular pathways as embryos and, to some extent, larvae can be manipulated to over-express or inhibit gene activity

[43]. Also chemicals can be directly added to the fish’s support medium making it simple to observe effects at the molecular level and in animal behaviour. One aim of our study was to test whether treatment with Latrepirdine has any morphological effects on early zebrafish development since this may indicate drug toxicity. Latrepirdine treatment of developing zebrafish embryos did not result in any gross morphological changes. Another aim was to find an optimum concentration of Latrepirdine for induction of autophagy in zebrafish larvae. Through our concentration screening we identified that Latrepirdine at 5 µM concentration induces autophagy in zebrafish larvae by 72 h. Further testing of 5 µM Latrepirdine in the presence of the lysosomal inhibitor, chloroquine, confirmed the induction of autophagy by this drug. To support the findings of our LC3 immunoblot assay we performed a TEM analysis. The

TEM analysis allowed actual quantification of autophagosomes and supported the findings of the LC3 assays.

In conclusion we have shown that exposure of developing zebrafish larvae to 5 µM

Latrepirdine can induce autophagy in zebrafish by 72 hpf. Our observations are consistent with other published studies showing that Latrepirdine can induce autophagy in a number of other animal models and cell lines. The activity of Latrepirdine in zebrafish opens up several avenues to understanding and testing the properties of this

97

drug with respect to AD progression. This also supports the use of zebrafish in testing of other drugs that may have potential in treatment of AD.

98

Figures

Figure 1 – (A) LC3 Immunoblot assay to analyse the effect on autophagy of concentrations of 50 µM-200 µM of Latrepirdine. Zebrafish larvae were treated with the Latrepirdine concentrations shown from 66 hpf before deyolking at 72 h, lysis and

SDS-PAGE followed by detection of LC3II and LC3I using an anti-LC3 antibody.

Anti-tubulin antibody was used as a loading control. (B) The LC3II/LC3I ratio was calculated using Image Lab software. Each analysis was carried out in triplicate. Error bars represent standard error of means (n=3).

99

Figure 2 – (A) LC3 Immunoblot assay to analyse the effect on autophagy of concentrations of 1 µM-50 µM of Latrepirdine. Larvae were treated with the

Latrepirdine concentrations shown from 66 hpf. Larvae were then deyolked at 72 h, lysed and subjected to SDS-PAGE before LC3II and LC3I were detected by immunoblotting using an anti-LC3 antibody. Anti-tubulin antibody was used as a loading control. (B) The LC3II/LC3I ratio was calculated using Image Lab software.

Each analysis was carried out in triplicate. Error bars represent standard errors of means.

100

Figure 3 – Dissection microscope images of zebrafish larvae at 72hpf showing the absence of morphological changes under 5 µM Latrepirdine and chloroquine treatment.

Representative image of respective treatments are shown. CQ, Chloroquine;

101

Figure 4 – LC3 Immunoblot assay carried in the presence of chloroquine, a lysosomal inhibitor. Larvae treated with 5 µM Latrepirdine and chloroquine were deyolked at 72 h, lysed and subjected to SDS-PAGE before LC3II and LC3I were detected by immunoblotting using an anti-LC3 antibody. Anti-tubulin antibody was used as a loading control. (B) The LC3II/LC3I ratio was calculated using Image Lab software.

Each analysis was carried out in triplicate. Error bars represent standard errors of means. CQ, Chloroquine;

102

Figure 5 – TEM image showing a transverse section through the head of a zebrafish larva at 72 h. The ventral forebrain in which cells were imaged in our TEM studies is indicated by asterisks (*) within the boxed region. The ethmoid plate (E) and mandibular cartilage (M) were used as visual references to locate a similar area of the brain for imaging in the various treatment samples and replicates. L, lens; IPL, inner plexiform layer; OPL, outer plexiform layer; GCL, ganglion cell layer;

103

Figure 6 - TEM of autophagic vacuoles present in a cell. Electron microscopy images from cells from the ventral forebrain of larvae treated with (a) control (b) 5 μM

Latrepirdine (c) control with chloroquine (d) 5 μM Latrepirdine with chloroquine. Each image shows the presence or absence of autophagic vacuoles in a cell from the brain of a 72 hpf larva. Arrows indicate autophagic vacuoles. The control cell, panel (a) does not contain any autophagic vacuoles. Panel (d) is a composite of two images of a single cell as autophagic vacuoles were located in different regions within the cell.

104

Figure 7 - The quantification of autophagosomes using TEM indicates that Latrepirdine increases the number of autophagosomes present in cells in the ventral forebrain of zebrafish larvae. Autophagosomes were counted in ten cells per embryo and the experiment was done using three separate larvae (n=3). Error bars represent standard deviation, statistical significance values are from a two-tailed unpaired student’s t-test assuming unequal variance.

105

References

1. Rikiishi, H., Novel Insights into the Interplay between Apoptosis and

Autophagy. Int J Cell Biol, 2012. 2012: p. 317645.

2. Boya, P., F. Reggiori, and P. Codogno, Emerging regulation and functions of

autophagy. Nat Cell Biol, 2013. 15(7): p. 713-20.

3. Reggiori, F., et al., Selective types of autophagy. Int J Cell Biol, 2012. 2012: p.

156272.

4. Mizushima, N. and B. Levine, Autophagy in mammalian development and

differentiation. Nat Cell Biol, 2010. 12(9): p. 823-30.

5. Parzych, K.R. and D.J. Klionsky, An overview of autophagy: morphology,

mechanism, and regulation. Antioxid Redox Signal, 2014. 20(3): p. 460-73.

6. Altman, J.K., et al., Autophagy is a survival mechanism of acute myelogenous

leukemia precursors during dual mTORC2/mTORC1 targeting. Clin Cancer

Res, 2014. 20(9): p. 2400-9.

7. Kim, K.H. and M.S. Lee, Autophagy--a key player in cellular and body

metabolism. Nat Rev Endocrinol, 2014. 10(6): p. 322-37.

8. Shintani, T. and D.J. Klionsky, Autophagy in health and disease: a double-

edged sword. Science, 2004. 306(5698): p. 990-5.

9. Tung, Y.T., et al., Autophagy: a double-edged sword in Alzheimer's disease. J

Biosci, 2012. 37(1): p. 157-65.

10. Boland, B., et al., Autophagy induction and autophagosome clearance in

neurons: relationship to autophagic pathology in Alzheimer's disease. The

Journal of neuroscience : the official journal of the Society for Neuroscience,

2008. 28(27): p. 6926-37.

106

11. Yang, D.S., J.H. Lee, and R.A. Nixon, Monitoring autophagy in Alzheimer's

disease and related neurodegenerative diseases. Methods in enzymology, 2009.

453: p. 111-44.

12. Li, L., X. Zhang, and W. Le, Autophagy dysfunction in Alzheimer's disease.

Neurodegener Dis, 2010. 7(4): p. 265-71.

13. Zhu, X.C., et al., Autophagy modulation for Alzheimer's disease therapy. Mol

Neurobiol, 2013. 48(3): p. 702-14.

14. Nakamura, Y., [New anti-AD drugs--their possibilities and issues]. Seishin

Shinkeigaku Zasshi, 2012. 114(3): p. 255-61.

15. Bachurin, S., et al., Antihistamine agent Dimebon as a novel neuroprotector and

a cognition enhancer. Ann N Y Acad Sci, 2001. 939: p. 425-35.

16. Lermontova, N.N., et al., Dimebon improves learning in animals with

experimental Alzheimer's disease. Bull Exp Biol Med, 2000. 129(6): p. 544-6.

17. Wu, J., Q. Li, and I. Bezprozvanny, Evaluation of Dimebon in cellular model of

Huntington's disease. Mol Neurodegener, 2008. 3: p. 15.

18. Lermontova, N.N., et al., Dimebon and tacrine inhibit neurotoxic action of beta-

amyloid in culture and block L-type Ca(2+) channels. Bull Exp Biol Med, 2001.

132(5): p. 1079-83.

19. Newman, M., et al., Zebrafish as a tool in Alzheimer's disease research.

Biochim Biophys Acta, 2011. 1812(3): p. 346-52.

20. Nornes, S., et al., Interference with splicing of Presenilin transcripts has potent

dominant negative effects on Presenilin activity. Hum Mol Genet, 2008. 17(3):

p. 402-12.

21. Nornes, S., et al., Independent and cooperative action of Psen2 with Psen1 in

zebrafish embryos. Exp Cell Res, 2009. 315(16): p. 2791-801. 107

22. Ganesan, S., et al., Identification and expression analysis of the zebrafish

orthologues of the mammalian MAP1LC3 gene family. Exp Cell Res, 2014.

23. Moussavi Nik, S.H., et al., The comparison of methods for measuring oxidative

stress in zebrafish brains. Zebrafish, 2014. 11(3): p. 248-54.

24. Ganesan, S., et al., Identification and expression analysis of the zebrafish

orthologues of the mammalian MAP1LC3 gene family. Exp Cell Res, 2014.

328(1): p. 228-37.

25. Cui, J., et al., Generation of transgenic zebrafish with liver-specific expression

of EGFP-Lc3: a new in vivo model for investigation of liver autophagy.

Biochem Biophys Res Commun, 2012. 422(2): p. 268-73.

26. Steele, J.W., et al., Latrepirdine stimulates autophagy and reduces

accumulation of alpha-synuclein in cells and in mouse brain. Mol Psychiatry,

2013. 18(8): p. 882-8.

27. Novikoff, A.B., The proximal tubule cell in experimental hydronephrosis. J

Biophys Biochem Cytol, 1959. 6(1): p. 136-8.

28. Eskelinen, E.L., Maturation of autophagic vacuoles in Mammalian cells.

Autophagy, 2005. 1(1): p. 1-10.

29. Capetillo-Zarate, E., et al., Intraneuronal Abeta accumulation, amyloid plaques,

and synapse pathology in Alzheimer's disease. Neurodegener Dis, 2012. 10(1-

4): p. 56-9.

30. Yilmazer-Hanke, D.M., Alzheimer's disease. The density of amygdalar neuritic

plaques is associated with the severity of neurofibrillary pathology and the

degree of beta-amyloid protein deposition in the cerebral cortex. Acta Anat

(Basel), 1998. 162(1): p. 46-55.

108

31. Mann, S.S. and J.A. Hammarback, Molecular characterization of light chain 3.

A microtubule binding subunit of MAP1A and MAP1B. J Biol Chem, 1994.

269(15): p. 11492-7.

32. Munoz, D.G. and H. Feldman, Causes of Alzheimer's disease. CMAJ, 2000.

162(1): p. 65-72.

33. Nixon, R.A. and D.S. Yang, Autophagy failure in Alzheimer's disease--locating

the primary defect. Neurobiol Dis, 2011. 43(1): p. 38-45.

34. Wolfe, D.M., et al., Autophagy failure in Alzheimer's disease and the role of

defective lysosomal acidification. Eur J Neurosci, 2013. 37(12): p. 1949-61.

35. Yang, D.S., et al., Therapeutic effects of remediating autophagy failure in a

mouse model of Alzheimer disease by enhancing lysosomal proteolysis.

Autophagy, 2011. 7(7): p. 788-9.

36. Bharadwaj, P.R., et al., Latrepirdine (dimebon) enhances autophagy and

reduces intracellular GFP-Abeta42 levels in yeast. J Alzheimers Dis, 2012.

32(4): p. 949-67.

37. Steele, J.W. and S. Gandy, Latrepirdine (Dimebon(R)), a potential Alzheimer

therapeutic, regulates autophagy and neuropathology in an Alzheimer mouse

model. Autophagy, 2013. 9(4): p. 617-8.

38. Okun, I., et al., From anti-allergic to anti-Alzheimer's: Molecular pharmacology

of Dimebon. Curr Alzheimer Res, 2010. 7(2): p. 97-112.

39. Doody, R.S., et al., Effect of dimebon on cognition, activities of daily living,

behaviour, and global function in patients with mild-to-moderate Alzheimer's

disease: a randomised, double-blind, placebo-controlled study. Lancet, 2008.

372(9634): p. 207-15.

109

40. Egea, J., et al., Neuroprotective effect of dimebon against ischemic neuronal

damage. Neuroscience, 2014. 267: p. 11-21.

41. Ustyugov, A.A., et al., Dimebon reduces the levels of aggregated amyloidogenic

protein forms in detergent-insoluble fractions in vivo. Bull Exp Biol Med, 2012.

152(6): p. 731-3.

42. Zhang, S., et al., Dimebon (latrepirdine) enhances mitochondrial function and

protects neuronal cells from death. J Alzheimers Dis, 2010. 21(2): p. 389-402.

43. Newman, M., E. Ebrahimie, and M. Lardelli, Using the zebrafish model for

Alzheimer's disease research. Front Genet, 2014. 5: p. 189.

110

Supplementary Data

Table 1 – Densitometric analysis of western blots using zebrafish larvae (control larvae and larvae treated with concentrations of 50 µM - 200 µM of Latrepirdine

(Figure 1B). The intensity values of the LC3I and LC3II bands of each replicate are given.

Set 1 Control 50µM 100µM 125µM 150µM LC3I 2,924,565 3,066,416 3,050,582 4,251,522 4,596,696 LC3II 8,201,865 7,402,063 8,745,948 17,500,032 13,469,248

LC3II/LC3I Ratio 2.804473486 2.413913507 2.866976859 4.116180511 2.930202041

Set 2 Control 50µM 100µM 125µM 150µM LC3I 2,798,684 1,803,822 2,384,046 2,401,584 2,161,632 LC3II 10,905,293 11,003,508 12,686,490 10,768,800 8,330,112

LC3II/LC3I Ratio 3.896578892 6.100107439 5.321411584 4.484040533 3.853621708

Set 3 Control 50µM 100µM 125µM 150µM LC3I 4,933,026 6,504,685 8,707,920 9,521,875 8,195,550 LC3II 11,437,027 14,438,655 20,533,812 25,887,840 21,719,350

LC3II/LC3I Ratio 2.318460718 2.219731624 2.358061627 2.718775451 2.650139405

Set 1 175µM 200µM LC3I 4,325,832 5,720,767 LC3II 5,133,618 14,662,662

LC3II/LC3I Ratio 1.186735407 2.563058765

Set 2 175µM 200µM LC3I 4,373,692 3,965,998 LC3II 16,447,500 12,690,068

LC3II/LC3I Ratio 3.760552869 3.199716187

Set 3 175µM 200µM LC3I 13,653,935 7,232,114 LC3II 28,555,259 19,131,712

LC3II/LC3I Ratio 2.091357473 2.645383079

Statistical Analysis p-value Control Vs 50µM 0.5582 Control Vs 100µM 0.3821 Control Vs 125µM 0.1102 Control Vs 150µM 0.3303 Control Vs 175µM 0.3023 Control Vs 200µM 0.5625

Table 2 – Densitometric analysis of western blots using zebrafish larvae (control larvae and larvae treated with concentrations of 1 µM - 50 µM of latrepirdine

(Figure 2B). The intensity values of the LC3I and LC3II bands of each replicate are given.

Set 1 Control 1µM 2.5µM 5µM 10µM 50µM LC3I 6,372,826 5,346,250 9,046,125 3,505,680 5,724,950 6,585,696 LC3II 4,425,341 5,253,942 9,433,113 4,535,028 6,295,100 8,033,088

LC3II/LC3I Ratio 0.694407944 0.982734066 1.042779422 1.293622921 1.099590389 1.219778137

Set 2 Control 1µM 2.5µM 5µM 10µM 50µM LC3I 8,845,912 8,648,350 7,465,635 8,320,884 10,600,795 6,663,519 LC3II 13,098,473 15,102,150 15,076,485 19,418,880 20,593,362 11,166,401

LC3II/LC3I Ratio 1.48073743 1.746246394 2.019451125 2.333752039 1.942624303 1.675751356

Set 3 Control 1µM 2.5µM 5µM 10µM 50µM LC3I 2,588,572 3,867,540 3,040,477 4,953,832 3,415,808 3,487,146 LC3II 6,558,051 10,069,680 8,627,743 16,778,638 9,748,244 11,419,095

LC3II/LC3I Ratio 2.533462851 2.603639523 2.837628109 3.38700182 2.85386181 3.274624865

Statistical Analysis p-value Control Vs 1µM 0.0952 Control Vs 2.5µM 0.0313 Control Vs 5µM 0.0119 Control Vs 10µM 0.0106 Control Vs 50µM 0.0919

Table 3 – Densitometric analysis of western blots of zebrafish larvae (control larvae and larvae treated with 5 µM Latrepirdine and 50 µM chloroquine (Figure

4B). The intensity values of the LC3I and LC3II bands of each replicate are given.

Set 1 Con+Chl Lat(5µM)+Chl LC3I 724,458 560,306 LC3II 2,606,352 2,379,271

LC3II/LC3I Ratio 3.59765784 4.246377872

Set 2 Con+Chl Lat(5µM)+Chl LC3I 605,324 565,600 LC3II 2,077,921 2,264,800

LC3II/LC3I Ratio 3.4327418 4.004243281

Set 3 Con+Chl Lat(5µM)+Chl LC3I 676,623 1,356,390 LC3II 1,198,717 3,056,382

LC3II/LC3I Ratio 1.77161728 2.253320948

Statistical Analysis p-value Con+Chl Vs Lat(5µM)+Chl 0.0072

Table 4 – Counting of autophagosomes in 10 cells from the ventral forebrain of a

72hpf zebrafish larva. 3 biological replicates were performed using TEM (Figure

7) Lat, Latrepirdine; CQ, Chloroquine;

Control Control+CQ Lat Lat + CQ Sample 1 Sample 1 Sample 1 Sample 1 Cell 1 0 Cell 1 1 Cell 1 1 Cell 1 2 Cell 2 0 Cell 2 1 Cell 2 1 Cell 2 3 Cell 3 0 Cell 3 1 Cell 3 1 Cell 3 4 Cell 4 0 Cell 4 1 Cell 4 4 Cell 4 2 Cell 5 0 Cell 5 1 Cell 5 1 Cell 5 3 Cell 6 1 Cell 6 1 Cell 6 2 Cell 6 3 Cell 7 0 Cell 7 0 Cell 7 0 Cell 7 5 Cell 8 2 Cell 8 1 Cell 8 1 Cell 8 0 Cell 9 0 Cell 9 0 Cell 9 0 Cell 9 3 Cell 10 0 Cell 10 1 Cell 10 2 Cell 10 Average 3 8 13 25

Sample 2 Sample 2 Sample 2 Sample 2 Cell 1 0 Cell 1 1 Cell 1 1 Cell 1 2 Cell 2 1 Cell 2 1 Cell 2 1 Cell 2 4 Cell 3 0 Cell 3 0 Cell 3 2 Cell 3 3 Cell 4 0 Cell 4 3 Cell 4 1 Cell 4 2 Cell 5 1 Cell 5 2 Cell 5 2 Cell 5 1 Cell 6 1 Cell 6 1 Cell 6 1 Cell 6 1 Cell 7 0 Cell 7 0 Cell 7 2 Cell 7 0 Cell 8 0 Cell 8 0 Cell 8 0 Cell 8 1 Cell 9 0 Cell 9 1 Cell 9 0 Cell 9 2 Cell 10 0 Cell 10 2 Cell 10 1 Cell 10 2 Average 3 11 11 18

Sample 3 Sample 3 Sample 3 Sample 3 Cell 1 0 Cell 1 0 Cell 1 1 Cell 1 3 Cell 2 0 Cell 2 0 Cell 2 1 Cell 2 2 Cell 3 0 Cell 3 2 Cell 3 1 Cell 3 3 Cell 4 0 Cell 4 1 Cell 4 3 Cell 4 0 Cell 5 0 Cell 5 1 Cell 5 3 Cell 5 1 Cell 6 0 Cell 6 1 Cell 6 1 Cell 6 3 Cell 7 0 Cell 7 1 Cell 7 2 Cell 7 2 Cell 8 0 Cell 8 0 Cell 8 1 Cell 8 1 Cell 9 1 Cell 9 1 Cell 9 0 Cell 9 3 Cell 10 0 Cell 10 0 Cell 10 1 Cell 10 3 Average 1 7 14 21

Total Number of Autophagosomes

Control 7 Control + Chloroquine (50µM) 26 Latrepirdine (5µM) 38 Latrepirdine (5µM) + Chloroquine (50µM) 64

Statistical Analysis p-value Control Vs Lat 0.001 Control Vs Con+CQ 0.0176 Lat Vs Lat+CQ 0.035 Con+CQ Vs Lat+CQ 0.0102

Chapter V

Research Paper 4

Latrepirdine-related drugs (Harmol & P7C3) do not

significantly induce autophagy in zebrafish larvae

111

Latrepirdine-related drugs (Harmol & P7C3) do not significantly induce autophagy in zebrafish larvae

Swamynathan Ganesan 1, Prashant Bharadwaj2, Giuseppe Verdile2, Ralph Martins2,3,4,

Michael Lardelli1.

1. Department of Genetics and Evolution, School of Biological Sciences,

The University of Adelaide, SA, 5005, Australia.

2. Centre of Excellence for Alzheimer's Disease Research and Care, School of Medical

Sciences, Edith Cowan University, Joondalup, WA, Australia.

3. School of Psychiatry and Clinical Neuroscience, University of Western Australia,

Crawley, WA, Australia.

4. The Sir James McCusker Alzheimer's Disease Research Unit, Hollywood Private

Hospital, Nedlands, WA, Australia.

*Corresponding Author: Swamynathan Ganesan, Alzheimer’s disease Genetics Laboratory, School of Molecular and Biomedical Sciences, The University of Adelaide, Adelaide SA 5005, Australia. Tel. (+61) 88313 4863, Fax (+61) 88313 4362. Email: [email protected]

112

113 114 Abstract

We have previously used analysis of zebrafish larvae to show that the drug Latrepirdine

(Dimebon) can stimulate autophagy. Here we used zebrafish larvae to test whether the

Latrepirdine-related drugs Harmol and P7C3 also can affect this cellular function. We did not observe any significant induction of autophagy by either Harmol or P7C3.

Further, both Harmol and P7C3 lack an effect on apoptosis as evident from an acridine orange-based assay.

115

Introduction

AD is a complex neurodegenerative disorder affecting millions worldwide. Research has identified several genetic and environmental factors that contribute to the progression of the disease [1, 2]. This has led to the development of various potential therapies and drugs aimed at reducing disease progression and improving the conditions of patients. Most drugs that are tested for treatment of AD are based on reducing β- amyloid formation which is thought to be critically involved in the disease [3].

However, factors other than Aβ are involved in disease progression [4-6]. These factors must be addressed to provide a holistic approach for AD treatment.

One current research focus is identification of pathways that might be altered to stimulate β-amyloid degradation rather than preventing its synthesis [7-10]. This has been stimulated by studies that have shown that autophagy is impaired during AD progression [11]. Studies have linked failure of autophagy to failure to clear β-amyloid resulting in its aggregation and in other AD manifestations [12].

The autophagy pathway is the primary cellular pathway responsible for degrading aggregated and damaged proteins and organelles [13]. It is the pathway that keeps the cell free of protein aggregation and enables proper cell function through recycling of these proteins [14]. Damaged proteins and organelles are sequestered into autophagosomes and are degraded by a process called macroautophagy. In some instances, microautophagy takes place which involves the engulfment of damaged organelles by lysosomes. A third type of autophagy called chaperone-mediated autophagy is more specific and involves the binding of HSC 70 chaperone to proteins containing a specific pentapeptide motif resulting in their degradation [15, 16]. Errors in

116 autophagy are observed in various disorders involving misfolded and aggregated proteins such as Alzheimer’s disease (AD) and Parkinson’s disease (PD) [17, 18].

Latrepirdine (Dimebon) was one of the first compounds to be tested as a therapeutic drug for neurodegenerative disorders [19, 20]. Since it has failed in clinical trials, currently research is focussed on identifying chemical derivatives and measuring their ability to induce autophagy. Two such derivatives are Harmol and P7C3. These may have similar modes of action to that of Latrepirdine. In our study we tested whether harmol and P7C3 can induce autophagy in zebrafish.

Materials and Methods

Drug Treatment

Zebrafish larvae at 66 hours post fertilization (hpf) were treated with a 5 µM concentration of Harmol (Sigma Aldrich, St. Louis, USA) or 5 µM concentration of

P7C3 (Sigma Aldrich, St. Louis, USA) for a further 6 h. Chloroquine (Sigma Aldrich,

St. Louis, USA) at a concentration of 50 µM was added to larvae at 56 hpf and these were then incubated at 28ºC for a further 16 h. All larvae were incubated until 72 hpf.

Sample Preparation

At 72 hpf, zebrafish larvae were deyolked and placed in a microfuge tube for lysis in protein lysis buffer (2% sodium dodecyl sulfate (SDS), 5% β-mercaptoethanol, 25% v/v glycerol, 0.0625 M Tris–HCl (pH 6.8), and bromphenol blue). The tubes were heated to

100 ºC for 10 mins. The samples were immediately used for immunoblotting.

117

Immunoblotting

Lysates from ten larvae were loaded on 15% PAGE gels along with Precision Protein

Marker™ and run at a low voltage. The gels were then transferred onto PVDF membranes through a wet electro transfer system (BioRad, Hercules, CA, USA) for 90 minutes at 4 ºC. After transfer, the membranes were blocked with 5% blocking solution for 60 minutes at 37 ºC. The blots were then incubated with anti-LC3 antibody (1/2000 dilution) (Novus Biologicals, Colorado, USA) for 24 hrs at 4 ºC followed by secondary incubation with anti-rabbit antibody (Rockland Immunochemicals Inc., Gilbertsville,

PA, USA). β-tubulin was used as a loading control. ECL solution (Amresco, Ohio,

USA) was used to visualize the bands using a ChemiDoc™ MP imaging system (Bio-

Rad, Hercules, CA, USA). LC3 band densities were quantified using Image J software

(NIH, USA).

Acridine Orange Apoptosis Assay

Larvae were treated with Harmol (5 µM) or P7C3 (5 µM). Ten larvae per sample were taken for the apoptosis assay. The experiment was replicated three times (n=3). At 72 hpf, larvae were stained with acridine orange (Sigma Aldrich, St. Louis, USA) at a concentration of 2 µg/ml in embryo medium in petri dishes. The petri dishes were then wrapped in aluminium foil to prevent bleaching and incubated for 30 mins. Larvae were then washed repeatedly with embryo medium before transfer to watch glasses. The watch glasses for each group (Control, Harmol and P7C3) with ten larvae were observed under a fluorescence microscope (Zeiss Axioplan 2, Carl Zeiss Microscopy,

Jena, Germany). The larvae were observed with the GFP filter set (excitation 473, emission 520) at a magnification of 25X. Images were captured with identical exposure parameters for analysis using Image J software (NIH, USA). The background pixels

118 were removed using the wand (tracing) tool and the measurement tool was used to measure the median pixel value for each group. The median brightness pixel value was then compared between control and treated (Harmol or P7C3) samples [21].

Statistical Analysis

All experiments were carried out with 3 biological replicates (n=3). GraphPad Prism version 6.0 (GraphPad Prism, La Jolla, CA) was used to analyse the data. The error bars represent standard error of the means (n=3) and a Student’s two-tailed unpaired t-test assuming unequal variances was used to detect statistically significant differences.

Results and Discussion

Harmol and P7C3 do not significantly induce autophagy in zebrafish larvae

Zebrafish embryos have been used to monitor autophagy by assessing the turnover of

LC3I to LC3II. When autophagy is induced LC3I is converted to LC3II and the ratio of

LC3II/I can be used to determine the relative level of autophagy. However an increase in the LC3II/LC3I ratio must be confirmed in the presence of a lysosomal inhibitor to validate that there is an autophagic flux. In this study, we wished to test whether the

Latrepirdine-related compounds Harmol and P7C3 could also induce autophagy.

Harmol belongs to the family of naturally existing β-carboline alkaloids. They are known to possess neuroprotective and antitumour effects and have been used in traditional medicine [22]. Yamada et al showed that harmol can induce apoptosis through caspase-8 activation in human lung carcinoma cells and suggested harmol as a chemotherapeutic drug candidate for cancer treatment [23]. Harmol has also been shown to induce autophagy in lung cancer A549 cell lines but has never been tested on zebrafish larvae [24]. In this study we tested harmol on 72 hfp larvae to find out

119 whether it could induce autophagy in these animals. Zebrafish larvae were treated with harmol and chloroquine as described above (refer to Materials and Methods). Harmol treatment did not observably affect the morphology of the larvae at 72 hpf (Figure 1).

A 6 h treatment with harmol at 5 µM concentration showed an increasing trend in the

LC3II/LC3I ratio when compared to control untreated larvae. Also larvae treated with

Harmol (5 µM) together with chloroquine (50 µM) showed an increasing trend in the

LC3II/LC3I ratio in comparison with larvae treated only with chloroquine (50 µM). In order to further confirm our findings, we compared the LC3II/LC3I ratio in Harmol

(5 µM) treated larvae in the presence and absence of chloroquine (50 µM). There appears to be a possible increase in the LC3II/LC3I ratio in harmol (5µM) treated larvae with chloroquine (50 µM) when compared with larvae treated with Harmol

(5 µM) alone but the increase did not reach statistical significance (Figure 2A&B).

Similarly P7C3 is a compound identified to possess proneurogenic and neuroprotective properties [25]. Recently Lehmann et al used P7C3 to induce retinal apoptosis and treat retinal dystrophies in mutant zebrafish lines [26]. However, no previous studies have shown whether P7C3 can induce autophagy. In order to test whether this compound can induce autophagy, we performed the LC3 immunoblot assay in the presence of chloroquine, a lysosomal inhibitor. Larvae treated with P7C3 did not show any observable changes in morphology when compared to untreated larvae (Figure 3).

Larvae treated with P7C3 (5 µM) alone showed an increasing trend in the LC3II/LC3I ratio when compared to untreated 72 hpf control larvae. Similarly the LC3II/LC3I ratio was seen to show an increasing trend in larvae treated with P7C3 (5 µM) and chloroquine (50 µM) when compared with larvae treated with chloroquine (50 µM) alone. Also when larvae treated with P7C3 (5 µM) in the presence and absence of

120 chloroquine (50 µM) were compared; the LC3II/LC3I ratio appeared to be increased but the increase did not reach statistical significance (Figure 4A&B).

Effects of Harmol and P7C3 on apoptosis

A recent study has shown that Harmol apparently also induces apoptosis. Therefore we tested whether either harmol or P7C3 have an effect on apoptosis in zebrafish larvae

[23, 27]. Apoptosis can be measured in zebrafish larvae using the Acridine Orange

Fluorescence assay developed by our laboratory [21]. The median relative brightness is a measure of acridine orange fluorescence in larvae and was calculated for each group

[untreated controls vs Harmol (5 µM) or P7C3 (5 µM) treated samples]. There was no significant difference in the median relative brightness between control untreated samples and either of the treated samples [Harmol (5 µM) or P7C3 (5 µM)]. This suggests that neither Harmol nor P7C3 at a concentration of 5µM has an effect on apoptosis in 72 hpf larvae (Figure 5).

In conclusion, although we have shown that Latrepirdine can induce autophagy in 72 hpf zebrafish larvae, we could not observe similar effects for Latrepirdine-related drugs

(Harmol and P7C3). Our immunoblot analysis shows that both Harmol and P7C3 do not statistically induce autophagy, but the number of replicates has to be increased to give greater certainty to our conclusions. From this study, it appears that treatment with

Harmol (5 µM) or P7C3 (5 µM) also failed to show a statistically significant induction of apoptosis in 72 hpf zebrafish larvae.

121

Figures

Harmol and/or chloroquine treatment on zebrafish larvae

Figure 1 – Larvae were treated with Harmol (5 µM) and/or chloroquine (50 µM) and incubated until 72 hpf. Harmol (5 µM) and/or chloroquine (50 µM) treatment showed no observable morphological changes. Representative images of the respective treatments. CQ- Chloroquine.

122

Harmol does not significantly induce autophagy in zebrafish larvae

Figures 2 – (A) Larvae were treated with Harmol (5 µM) and/or chloroquine (50 µM).

The samples were subjected to the LC3 Immunoblot assay. (B) Graph showing the

LC3II/LC3I ratio for 3 biological replicates (n=3). Error bars represent standard errors of the means.

123

P7C3 and/or chloroquine treatment on zebrafish larvae

Figure 3 – Larvae were treated with P7C3 (5 µM) and/or chloroquine (50 µM) and incubated until 72 hpf. P7C3 (5 µM) and/or chloroquine (50 µM) treatment showed no observable morphological changes. Representative images of the respective treatments.

CQ- Chloroquine.

124

P7C3 do not significantly induce autophagy in zebrafish larvae

Figure 4 – (A) Larvae were treated with P7C3 (5 µM) and/or chloroquine (50 µM). The samples were subjected to the LC3 Immunoblot assay. (B) Graph showing the

LC3II/LC3I ratio for 3 biological replicates (n=3). Error bars represent standard errors of the means.

125

Acridine Orange Assay to measure apoptosis in zebrafish larvae

Figure 5 – The median relative brightness values of the acridine orange fluroscence apoptosis assay between control and treated samples (Harmol or P7C3). Ten larvae were counted for each group and the assay was performed with 3 biological replicates

(n=3). Error bars represent standard errors of the means.

126

References

1. Holscher, C., Possible causes of Alzheimer's disease: amyloid fragments, free

radicals, and calcium homeostasis. Neurobiol Dis, 1998. 5(3): p. 129-41.

2. Munoz, D.G. and H. Feldman, Causes of Alzheimer's disease. CMAJ, 2000.

162(1): p. 65-72.

3. Kisilevsky, R., Anti-amyloid drugs: potential in the treatment of diseases

associated with aging. Drugs Aging, 1996. 8(2): p. 75-83.

4. Butterfield, D.A. and C.M. Lauderback, Lipid peroxidation and protein

oxidation in Alzheimer's disease brain: potential causes and consequences

involving amyloid beta-peptide-associated free radical oxidative stress. Free

Radic Biol Med, 2002. 32(11): p. 1050-60.

5. Chen, Q., et al., Loss of presenilin function causes Alzheimer's disease-like

neurodegeneration in the mouse. J Neurosci Res, 2008. 86(7): p. 1615-25.

6. Smith, M.A., G. Perry, and W.A. Pryor, Causes and consequences of oxidative

stress in Alzheimer's disease. Free Radic Biol Med, 2002. 32(11): p. 1049.

7. Mentlein, R., R. Ludwig, and I. Martensen, Proteolytic degradation of

Alzheimer's disease amyloid beta-peptide by a metalloproteinase from microglia

cells. J Neurochem, 1998. 70(2): p. 721-6.

8. Morelli, L., et al., The degradation of amyloid beta as a therapeutic strategy in

Alzheimer's disease and cerebrovascular amyloidoses. Neurochem Res, 2002.

27(11): p. 1387-99.

9. Paresce, D.M., H. Chung, and F.R. Maxfield, Slow degradation of aggregates of

the Alzheimer's disease amyloid beta-protein by microglial cells. J Biol Chem,

1997. 272(46): p. 29390-7.

127

10. Wang, D.S., D.W. Dickson, and J.S. Malter, beta-Amyloid degradation and

Alzheimer's disease. J Biomed Biotechnol, 2006. 2006(3): p. 58406.

11. Nixon, R.A. and D.S. Yang, Autophagy failure in Alzheimer's disease--locating

the primary defect. Neurobiol Dis, 2011. 43(1): p. 38-45.

12. Wolfe, D.M., et al., Autophagy failure in Alzheimer's disease and the role of

defective lysosomal acidification. Eur J Neurosci, 2013. 37(12): p. 1949-61.

13. Klionsky, D.J. and S.D. Emr, Autophagy as a regulated pathway of cellular

degradation. Science, 2000. 290(5497): p. 1717-21.

14. Eskelinen, E.L. and P. Saftig, Autophagy: a lysosomal degradation pathway

with a central role in health and disease. Biochim Biophys Acta, 2009. 1793(4):

p. 664-73.

15. Boya, P., F. Reggiori, and P. Codogno, Emerging regulation and functions of

autophagy. Nat Cell Biol, 2013. 15(7): p. 713-20.

16. Reggiori, F., et al., Selective types of autophagy. Int J Cell Biol, 2012. 2012: p.

156272.

17. Heras-Sandoval, D., et al., The role of PI3K/AKT/mTOR pathway in the

modulation of autophagy and the clearance of protein aggregates in

neurodegeneration. Cell Signal, 2014. 26(12): p. 2694-701.

18. Pan, T., et al., The role of autophagy-lysosome pathway in neurodegeneration

associated with Parkinson's disease. Brain, 2008. 131(Pt 8): p. 1969-78.

19. Bachurin, S., et al., Antihistamine agent Dimebon as a novel neuroprotector and

a cognition enhancer. Ann N Y Acad Sci, 2001. 939: p. 425-35.

20. Burns, A. and R. Jacoby, Dimebon in Alzheimer's disease: old drug for new

indication. Lancet, 2008. 372(9634): p. 179-80.

128

21. Tucker, B. and M. Lardelli, A rapid apoptosis assay measuring relative acridine

orange fluorescence in zebrafish embryos. Zebrafish, 2007. 4(2): p. 113-6.

22. Naranjo, C., Ayahuasca, caapi, yage. Psychotropic properties of the harmala

alkaloids. Psychopharmacol Bull, 1967. 4(3): p. 16-7.

23. Abe, A. and H. Yamada, Harmol induces apoptosis by caspase-8 activation

independently of Fas/Fas ligand interaction in human lung carcinoma H596

cells. Anticancer Drugs, 2009. 20(5): p. 373-81.

24. Abe, A., et al., The beta-carboline alkaloid harmol induces cell death via

autophagy but not apoptosis in human non-small cell lung cancer A549 cells.

Biol Pharm Bull, 2011. 34(8): p. 1264-72.

25. Saxe, J.P., Screening: Your brain on drugs. Nat Chem Biol, 2010. 6(9): p. 639-

40.

26. Asai-Coakwell, M., et al., Contribution of growth differentiation factor 6-

dependent cell survival to early-onset retinal dystrophies. Hum Mol Genet,

2013. 22(7): p. 1432-42.

27. Abe, A. and H. Kokuba, Harmol induces autophagy and subsequent apoptosis

in U251MG human glioma cells through the downregulation of survivin. Oncol

Rep, 2013. 29(4): p. 1333-42.

129

Supplementary Data

Table 1 – Densitometric analysis of western blots using zebrafish larvae (untreated controls and treated with 5 µM Harmol and/or 50 µM chloroquine - Figure 2B).

The intensity values of the LC3I and LC3II bands of each replicate are given.

(Chl, Chloroquine)

Set 1 Control Harmol Con+Chl Harmol+Chl LC3I 1,006,176 952,737 1,310,830 2,554,215 LC3II 722,907 1,372,118 3,659,420 9,924,661

LC3II/LC3I Ratio 0.718469731 1.440185487 2.791681606 3.885601251

Set 2 Control Harmol Con+Chl Harmol+Chl LC3I 2,949,712 2,229,457 2,336,100 3,157,232 LC3II 2,903,212 3,733,747 4,002,000 19,302,348

LC3II/LC3I Ratio 0.984235749 1.674733803 1.713111596 6.11369326

Set 3 Control Harmol Con+Chl Harmol+Chl LC3I 1,476,000 1,832,037 1,310,445 2,046,150 LC3II 4,195,800 5,459,232 3,826,122 4,697,700

LC3II/LC3I Ratio 2.842682927 2.979869948 2.919712006 2.295872737

Statistical Analysis p-value Con Vs Harmol 0.5672 Harmol Vs Harmol+Chl 0.1944 Con+Chl Vs Harmol+Chl 0.2776 Con VS Harmol+Chl 0.1316

Table 2 – Densitometric analysis of western blots using zebrafish larvae (untreated controls and treated with 5 µM P7C3 and/or 50 µM chloroquine - Figure 4B). The intensity values of the LC3I and LC3II bands of each replicate are given.

(Chl, Chloroquine)

Set 1 Control P7C3 Control+Chl P7C3+Chl LC3I 2,932,335 1,692,954 344,928 2,248,757 LC3II 2,474,550 2,524,014 613,584 5,539,058

LC3II/LC3I Ratio 0.843883799 1.490893432 1.778875591 2.463164317

Set 2 Control P7C3 Control+Chl P7C3+Chl LC3I 1,532,176 3,655,530 5,929,040 3,597,367 LC3II 1,312,790 3,948,390 7,561,580 11,777,163

LC3II/LC3I Ratio 0.8568141 1.080114238 1.27534643 3.273828609

Set 3 Control P7C3 Control+Chl P7C3+Chl LC3I 4,482,869 2,304,414 4,240,650 7,977,375 LC3II 2,258,297 1,487,178 1,667,139 6,866,325

LC3II/LC3I Ratio 0.503761542 0.645360599 0.393132892 0.860724863

Statistical Analysis p-value Con Vs P7C3 0.3044 P7C3 Vs P7C3+Chl 0.2484 Con+Chl Vs P7C3+Chl 0.2841 Con Vs P7C3+Chl 0.1719

Table 3 – Median relative brightness was measured for untreated control larvae and larvae treated with 5 µM harmol and 5 µM P7C3. Each experiment was performed in triplicate (Figure 5).

Control Harmol(5µM) P7C3(5µM)

Set 1 19.675 13.98 20.209

Set 2 13.261 13.032 19.577

Set 3 13.708 15.563 18.71

Statistical Analysis p-value Con Vs Harmol 0.5883 Con VS P7C3 0.192

Chapter VI

Research Paper 5

A novel Poly-Glutamine – GFP reporter assay to

monitor autophagy in zebrafish embryos

130

A novel Poly-Glutamine – GFP reporter assay to monitor autophagy in zebrafish embryos

Swamynathan Ganesan1, Morgan Newman1, Nilakshi Dhananjani Dhanushika

Ratnayake1, Esmaeil Ebrahimie1, Michael Lardelli1.

1. Department of Genetics and Evolution, School of Biological Sciences,

The University of Adelaide, SA, 5005, Australia.

*Corresponding Author: Swamynathan Ganesan, Alzheimer’s disease Genetics Laboratory, School of Molecular and Biomedical Sciences, The University of Adelaide, Adelaide SA 5005, Australia. Tel. (+61) 88313 4863, Fax (+61) 88313 4362. Email: [email protected]

131

132 133 Abstract

Extended stretches of poly-glutamine repeats in proteins can result in protein aggregation and are implicated in several neurodegenerative disorders. Identifying pathways that can degrade these proteins may prove beneficial. Autophagy is one pathway involved in protein clearance in cells and poly-glutamine repeats have been used as substrates in assays developed to monitor autophagy. We have designed a polyQ80-GFP construct to monitor autophagic flux in zebrafish embryos. We find that the degradation of polyQ 80 occurs in an autophagy-dependent manner during development. Further, we find that the degradation of polyQ 80 can be altered by chemically inducing or inhibiting autophagy.

134

Introduction

In any living organism, cells are the basic units of life which perform various metabolic activities required for the growth, proliferation and survival of the organism. All these metabolic activities require the functioning of various biochemical pathways, which in turn are dependent on the constant supply of energy and resources. In order to maintain cellular homeostasis, peptides are constantly formed and degraded and protein degradation is an important function for replenishment of the resources required for cellular metabolism [1].

Protein degradation is achieved in cells through two important pathways namely the autophagy pathways and the ubiquitin-proteosome pathway [2, 3]. Macroautophagy, microautophagy and chaperone-mediated autophagy are the three main types of autophagy involved in protein degradation. In macroautophagy, autophagosomes are formed which facilitates the delivery of damaged proteins and organelles to lysosomes for degradation. Microautophagy, on the other hand involves the direct engulfment of cytoplasmic cargo by lysosomes. Another type of autophagy involves the binding of chaperones (hsc70) to proteins with specific motifs and enabling their degradation through lysosomes [4, 5]. The route of protein degradation is dependent on the size and specificity of proteins and protein aggregates. Smaller proteins are degraded through the ubiquitin-proteosome pathway while larger peptides and, in some cases, damaged long- lived proteins, protein aggregates and organelles are degraded through the autophagy pathway [6].

In the ubiquitin-proteosome pathway, peptides are conjugated with ubiquitin (which serves as a signal) by E3 ubiquitin ligases and are targeted to a proteosome barrel, wherein they are degraded by the proteosomal enzymes to release peptides [7]. In the

135 case of the autophagy pathway, damaged proteins and organelles can be degraded [8].

Therefore the autophagy pathway is very important for maintaining the protein turnover in a cell and for ensuring proper functioning of cellular pathways [9].

The autophagy pathway has been studied in relation to the genes affected in various genetic and metabolic disorders which suggest their functional role in this process [10-

12]. In the past, several techniques to monitor autophagy have been developed in various model organisms [13, 14]. Recently, zebrafish has gained popularity as a model organism for the study of autophagy owing to the ease of manipulation and observation of this organism [15].

A number of assays have been exploited in zebrafish to study autophagy [16].

Traditionally Electron Microscopy was the first technique used to monitor autophagy by counting of autophagosome numbers in cells [17]. Later, monitoring of autophagy was performed by assessing the turnover of an autophagy protein marker, LC3 [18].

LC3 exhibits two different proteolytic forms namely LC3I and LC3II during autophagy

[19]. Immunoblotting of LC3 is still one of the standard protocols for determining the conversion of LC3I to LC3II [20]. Recently Fluorescent chemicals like MDC

(Monodansyl Cadaverine) have been used to label specifically autophagosomes and monitor autophagic flux in cells [21]. In addition to these techniques, He et al developed the first GFP-LC3 transgenic fish which is a valuable tool for autophagy assessment [22].

Although there are various assays to monitor autophagy in zebrafish, each assay has its own merits and disadvantages. There is a need to develop more assays and to improve existing ones. Researchers are focussed on developing new assays that could be used with ease to produce reliable results efficiently. Recent research has shown that

136 autophagic flux in cells can be measured by monitoring the degradation of substrates processed through the autophagy pathway [23]. It has been reported that several protein aggregates such as those comprised of α-synuclein and repeats of poly-glutamine are preferentially degraded through autophagy [24]. Therefore poly-glutamine repeats serve as potential substrates to monitor autophagic flux in cells.

Ju et al developed a quantifiable assay that can measure autophagic flux based on changes in degradation of poly-glutamine substrates in an autophagy dependent manner

[23]. Based on this, we have developed a poly-glutamine-GFP reporter to monitor autophagic flux in zebrafish embryos. In our assay, chemicals that are known to have an effect on the autophagy pathway were tested to see whether they had an effect on the degradation of the poly-glutamine substrate. The assay will serve as a simple and rapid method to monitor autophagy in zebrafish.

Materials and Methods

PolyQ80 Construct Design

The poly-glutamine-GFP (polyQ80-GFP) construct is designed to code for two proteins, one GFP with 80 amino acid repeats of glutamine fused to its N-terminus and a second GFP separated from the first by a v2A (viral 2A peptide) sequence. The v2A sequence acts as the linker sequence enabling the translation of the two protein products from one open reading frame through a ribosomal-skip mechanism during translation

[25]. Bam HI and Cla I restriction sites are also present in the construct to enable sub- cloning into the pT2AL200R150G (pT2) plasmid (Figure 1).

137

Polymerase chain reaction

Polymerase chain reactions (PCRs) were performed using Go Taq® DNA polymerase

(New England BioLabs®) for 25 cycles with the primers listed in Table 1. The reaction conditions are as follows : an initial denaturation step at 95ºC for 2 minutes, followed by 25 cycles of denaturation at 95ºC for 30 seconds, annealing at 60ºC for 30 seconds and extension at 72ºC for 30 seconds and a final elongation at 72ºC for 5 minutes.

Microinjection of the polyQ80-GFP construct in zebrafish embryos

The polyQ80-GFP coding sequence was synthesized by Genescript Inc., Piscataway,

NJ, USA. The construct was then sub-cloned into the pT2AL200R150G (pT2) plasmid between the Bam HI and Cla I sites (Note that pT2AL200R150G normally contains sequence coding for GFP. However, for insertion of the coding sequence for polyQ80-GFP this GFP gene has been removed. Tol2 transposase (pCS-TP) mRNA was synthesized in vitro using the mMESSAGE MACHINE SP6 Kit (Ambion Inc.,

Austin, TX, USA). Zebrafish embryos at one cell stage were then injected with

25ng/µL of the pT2 vector containing the polyQ80-GFP construct and 25ng/µL of transposase mRNA. Uninjected embryos or embryos injected with empty pT2 vector were used as controls. For the assay of changes in autophagy during development embryos expressing GFP were harvested at 24 hours post fertilisation (hpf), 36 hpf, 48 hpf and 72 hpf. Embryos were collected at 48hpf for the drug treatment assay.

Drug Treatment of zebrafish embryos

At 24 hpf, injected embryos expressing GFP were divided randomly into three equal sized groups; the untreated control group, rapamycin treated embryos and chloroquine treated embryos. Rapamycin was added at a final concentration of 1 µM to embryos at

138

30 hpf followed by incubation for a further 18 hrs. Chloroquine at a concentration of 50

µM was added to embryos at 30 hpf followed by incubation for a further 18 hrs. All the embryos, untreated as well as treated, were collected at 48 hpf for sample preparation.

Immunoblotting

Ten embryos per sample (treated and untreated) were collected at 48 hpf and deyolked.

After deyolking the embryos were mixed with sample lysis buffer (2% sodium dodecyl sulfate (SDS), 5% β-mercaptoethanol, 25% v/v glycerol, 0.0625 M Tris–HCl (pH 6.8), and bromphenol blue) and heated at 100ºC for 10 mins. The lysed samples were then used for immunoblotting. Samples were loaded onto 12% PAGE (Poly-Acrylamide Gel

Electrophoresis) gels and run initially at 120V for 30 mins. The samples were run on size separating gels for 1 h at 150V. A wet transfer system was used to transfer proteins from the gel onto nitrocellulose membrane (Protran, S&S). The transfer was carried out at 100V for 1.5 hrs. Blots were then probed with anti-GFP antibody (Rockland Inc.,

Limerick, PA, USA) after blocking for 1 h. This was followed by washes with TBST and incubation with secondary antibody (anti-goat) for 2 h. The blots were then washed again with TBST and the secondary antibody was detected using the Visiglo PlusTM

HRP chemiluminescent substrate kit (AMRESCO LLC, Solon, OH, USA). The imaging of the blots was carried out in a Biorad Imaging system (Biorad Inc., Berkeley, CA,

USA) and the densitometric analysis of the blots was carried out using Image J software

(NIH, USA).

Statistical Analysis

Graph Pad Prism was used for the statistical analysis. The error bars represent standard deviations. For the time point analysis a two-tailed paired t-test was used to analyse statistical differences. For the drug treatment assays a two-way analysis of variance

139

(ANOVA) followed by Tukey’s multiple comparison test was used to analyse statistical differences (see Supplementary Data for raw data and statistical analysis).

Results and Discussion

Analysis of polyQ80-GFP to free GFP ratio at different time points in developing zebrafish embryo/larval development

Zebrafish embryos were injected with the polyQ80-GFP construct and transposase mRNA and collected at 24 hpf, 36 hpf, 48 hpf and 72 hpf for immunoblotting.

Uninjected embryos for the respective time points were used as controls (Figure 2).

The ratio of polyQ80-GFP to that of free GFP was used to determine the relative stability of polyQ80-GFP at that particular time point. There seems to be no significant difference in the ratio between 24 hpf embryos and 36 hpf larvae. The ratio appears to reach a maximum at 48 hpf suggesting low levels of autophagy or peak accumulation of aggregated proteins around that developmental time. After 48 hpf, there appears to be a decreasing trend in the ratio until 72hpf (Figure 3A&B). This might be due to the fact that the aggregated protein itself may induce autophagy in zebrafish embryos/larvae.

Rapamycin and chloroquine alter the levels of polyQ80-GFP relative to free GFP in zebrafish embryos

Autophagy pathway can be modulated in zebrafish by exposing embryos or larvae to different chemical solutions. We wished to test whether degradation of polyQ80-GFP proceeds in an autophagy-dependent manner. In order to test this, zebrafish embryos were treated with rapamycin, a known inducer of autophagy or with chloroquine, a lysosomal inhibitor. The polyQ80-GFP to free GFP ratio was compared between untreated control samples and the chemically treated samples. The polyQ80-GFP to free

140

GFP ratio appeared to show a decreasing trend in rapamycin treated embryos when compared to untreated control embryos but the decrease did not reach statistical significance. This suggests that an induction in autophagy due to rapamycin treatment could possibly have resulted in an increase in the breakdown of polyQ80 (Figure

4A&B).

Similarly, embryos treated with chloroquine were compared to the untreated control samples. There appeared to be an increasing trend observed in the polyQ80-GFP to free

GFP ratio between chloroquine treated samples and untreated control embryos but the increase did not reach statistical significance. The possible increase suggests that there may be inhibition of breakdown of polyQ80-GFP in the presence of chloroquine

(Figure 4A&B). The outcomes of both the treatments (rapamycin and chloroquine) further support that polyQ80 may follow the autophagy pathway for its degradation.

In this study we designed a construct which consists of 80 repeats of glutamine fused with GFP that could be used as a substrate to monitor autophagic flux in zebrafish. We tested the efficiency of polyQ80-GFP clearance at different time points during zebrafish embryonic and larval development and found that at 72 hpf there is an increased trend in clearance as indicated through a reduction in polyQ80-GFP to free GFP ratio. This is consistent with the fact that autophagy has been shown to be effective after 48hpf in zebrafish [22]. This suggests that poly-glutamine repeats are cleared in cells through the autophagy pathway. In order to confirm further this finding, we tested whether manipulating the autophagy pathway can have an effect on polyQ80 clearance. We found that rapamycin treatment showed a possible increased trend in polyQ80-GFP clearance as evident from a reduced polyQ80-GFP to free GFP ratio. Similarly when embryos were treated with chloroquine, it appeared to inhibit polyQ80-GFP clearance as expected. This supports that polyQ80-GFP may be degraded via the autophagy

141 pathway. We rate however that the differences observed due to chemical stimulation or inhibition of autophagy did not reach statistical significance. Future work will involve testing of the polyQ80-GFP construct in mammalian tissue culture. Since autophagy in zebrafish larvae appears to be regulated after 48 hpf we will also test the effect of rapamycin and chloroquine at later, larval developmental stages.

142

Figures

Design of polyQ80-GFP construct.

Figure 1 – Diagram showing the design of the poly-glutamine (polyQ80-GFP) construct used for the assay. The construct codes for two proteins; polyQ80-GFP and free GFP. Restriction sites for Eco RV, Bam HI, Cla I and Eco RI flank the construct.

The coding sequence for the construct is given in supplementary data.

143

Immunoblot assay with uninjected zebrafish at different time points to show background antibody staining.

Figure 2 – Uninjected control embryos and larvae at different time points (24 hpf, 36 hpf, 48 hpf and 72 hpf) were subjected to immunoblotting using 12% PAGE gels. The blot was probed using anti-GFP antibody.

144

Immunoblot Assay with the polyQ80-GFP construct at different time points

Figure 3 – (A) Zebrafish embryos were injected with polyQ80-GFP construct and collected at different time points (24 hpf, 36 hpf, 48 hpf and 72 hpf). The samples were then resolved on SDS-PAGE gels and probed with an anti-GFP antibody. (B) The polyQ80-GFP to free GFP ratio was calculated using Image J software. The error bars represent standard deviations (n=3).

145

Rapamycin and Chloroquine alter relative stability of polyQ80-GFP in zebrafish embryos at 48hpf.

Figure 4 – (A) Zebrafish embryos injected with the polyQ80-GFP construct and subsequently treated with rapamycin (1µM) and chloroquine (50µM). The embryos were collected at 48 hpf and were run on 12% SDS-PAGE gels. The blots were then probed using anti-GFP antibody. (B) The polyQ80-GFP to free GFP ratio was calculated using Image J software. The error bars represent standard deviations (n=3).

PQ80, polyQ80; Rap, Rapamycin; CQ, Chloroquine.

146

Table 1

List of Primers used for the amplification, verification of polyQ80-GFP construct.

Primer Sequence

M13/pUC57 forward 5’-GTAAAACGACGGCCAGT-3’

M13/pUC57 reverse 5’-GGAAACAGCTATGACCATG-3’

PolyQ 80-GFP forward 5’-CAACAGCAGCAACAAATGGTGA-3’

PolyQ 80-GFP reverse 5’- TTGCTGTTGCTGTTGCATGGT-3’

147

References

1. Manna, P.T., et al., Constitutive endocytic recycling and protein kinase C-

mediated lysosomal degradation control K(ATP) channel surface density. J Biol

Chem, 2010. 285(8): p. 5963-73.

2. Pepato, M.T., et al., Role of different proteolytic pathways in degradation of

muscle protein from streptozotocin-diabetic rats. Am J Physiol, 1996. 271(2 Pt

1): p. E340-7.

3. Sims, J.M., et al., The pathways of protein synthesis and degradation in normal

heart and during development and regression of cardiac hypertrophy. Recent

Adv Stud Cardiac Struct Metab, 1976. 12: p. 19-28.

4. Boya, P., F. Reggiori, and P. Codogno, Emerging regulation and functions of

autophagy. Nat Cell Biol, 2013. 15(7): p. 713-20.

5. Reggiori, F., et al., Selective types of autophagy. Int J Cell Biol, 2012. 2012: p.

156272.

6. Lee, M.J., J.H. Lee, and D.C. Rubinsztein, Tau degradation: the ubiquitin-

proteasome system versus the autophagy-lysosome system. Prog Neurobiol,

2013. 105: p. 49-59.

7. del Pozo, J.C. and M. Estelle, Function of the ubiquitin-proteosome pathway in

auxin response. Trends Plant Sci, 1999. 4(3): p. 107-112.

8. Huang, W.P. and D.J. Klionsky, Autophagy in yeast: a review of the molecular

machinery. Cell Struct Funct, 2002. 27(6): p. 409-20.

9. Abeliovich, H. and D.J. Klionsky, Autophagy in yeast: mechanistic insights and

physiological function. Microbiol Mol Biol Rev, 2001. 65(3): p. 463-79, table of

contents.

148

10. Malicdan, M.C., S. Noguchi, and I. Nishino, Monitoring autophagy in muscle

diseases. Methods Enzymol, 2009. 453: p. 379-96.

11. Rautou, P.E., et al., Autophagy in liver diseases. J Hepatol, 2010. 53(6): p.

1123-34.

12. Ueno, T., E. Kominami, and Y. Uchiyama, [Autophagy and neurodegenerative

diseases]. Tanpakushitsu Kakusan Koso, 2006. 51(10 Suppl): p. 1525-31.

13. Mauvezin, C., et al., Assays to monitor autophagy in Drosophila. Methods,

2014. 68(1): p. 134-9.

14. Noda, T., Viability assays to monitor yeast autophagy. Methods Enzymol, 2008.

451: p. 27-32.

15. Fleming, A. and D.C. Rubinsztein, Zebrafish as a model to understand

autophagy and its role in neurological disease. Biochim Biophys Acta, 2011.

1812(4): p. 520-6.

16. He, C. and D.J. Klionsky, Analyzing autophagy in zebrafish. Autophagy, 2010.

6(5): p. 642-4.

17. Fengsrud, M., et al., Ultrastructural characterization of the delimiting

membranes of isolated autophagosomes and amphisomes by freeze-fracture

electron microscopy. Eur J Cell Biol, 2000. 79(12): p. 871-82.

18. Tanida, I., et al., Lysosomal turnover, but not a cellular level, of endogenous

LC3 is a marker for autophagy. Autophagy, 2005. 1(2): p. 84-91.

19. Kadowaki, M. and M.R. Karim, Cytosolic LC3 ratio as a quantitative index of

macroautophagy. Methods Enzymol, 2009. 452: p. 199-213.

20. Mizushima, N. and T. Yoshimori, How to interpret LC3 immunoblotting.

Autophagy, 2007. 3(6): p. 542-5.

149

21. Vazquez, C.L. and M.I. Colombo, Assays to assess autophagy induction and

fusion of autophagic vacuoles with a degradative compartment, using

monodansylcadaverine (MDC) and DQ-BSA. Methods Enzymol, 2009. 452: p.

85-95.

22. He, C., et al., Assaying autophagic activity in transgenic GFP-Lc3 and GFP-

Gabarap zebrafish embryos. Autophagy, 2009. 5(4): p. 520-6.

23. Ju, J.S., et al., Quantitation of selective autophagic protein aggregate

degradation in vitro and in vivo using luciferase reporters. Autophagy, 2009.

5(4): p. 511-9.

24. Klionsky, D.J., et al., Guidelines for the use and interpretation of assays for

monitoring autophagy. Autophagy, 2012. 8(4): p. 445-544.

25. Provost, E., J. Rhee, and S.D. Leach, Viral 2A peptides allow expression of

multiple proteins from a single ORF in transgenic zebrafish embryos. Genesis,

2007. 45(10): p. 625-9.

150

Supplementary Data

Sequence of the polyQ80-GFP construct – (Figure 1)

Overview

EcoRV-BamH1-Kozak-Start-PolyGlu80-GFP-v2A-GFP-Stop-Cla1-EcoRI-EcoRV

5’-GATATCGGATCCGCCACCATGCAACAACAACAACAACAACAACAACAA CAGCAACAACAACAACAACAACAACAACAACAGCAACAACAACAACAACA ACAACAACAACAGCAACAACAACAACAACAACAACAACAACAGCAACAAC AACAACAACAACAACAACAACAGCAACAACAACAACAACAACAACAACAA CAGCAACAACAACAACAACAACAACAACAACAGCAACAACAACAACAACA ACAACAACAACAGATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGG TGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCG TGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGT TCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCAC CCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCA GCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCAC CATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTT CGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAA GGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCC ACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACT TCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACT ACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACC ACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCG ATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCAT GGACGAGCTGTACAAGGGCTCCGGAGCTACAAATTTCTCTCTGTTGAAACA GGCTGGTGACGTCGAGGAGAATCCTGGCCCAATGGTGAGCAAGGGAGAGG AGCTGTTCACAGGAGTGGTGCCTATCCTGGTGGAGCTGGACGGAGACGTGA ACGGACACAAGTTCAGCGTGAGCGGAGAGGGAGAGGGAGACGCTACATAC GGAAAGCTGACACTGAAGTTCATCTGTACAACAGGAAAGCTGCCTGTGCCT TGGCCTACACTGGTGACAACACTGACATACGGAGTGCAGTGTTTCAGCAGA TACCCTGACCACATGAAGCAGCACGACTTCTTCAAGAGCGCTATGCCTGAG GGATACGTGCAGGAGAGAACAATCTTCTTCAAGGACGACGGAAACTACAA GACAAGAGCTGAGGTGAAGTTCGAGGGAGACACACTGGTGAACAGAATCG AGCTGAAGGGAATCGACTTCAAGGAGGACGGAAACATCCTGGGACACAAG CTGGAGTACAACTACAACAGCCACAACGTGTACATCATGGCTGACAAGCAG AAGAACGGAATCAAGGTGAACTTCAAGATCAGACACAACATCGAGGACGG AAGCGTGCAGCTGGCTGACCACTACCAGCAGAACACACCTATCGGAGACGG ACCTGTGCTGCTGCCTGACAACCACTACCTGAGCACACAGAGCGCTCTGAG CAAGGACCCTAACGAGAAGAGAGACCACATGGTGCTGCTGGAGTTCGTGAC AGCTGCTGGAATCACACTGGGAATGGACGAGCTGTACAAGTAGATCGATGA ATTCGATATC – 3’

Table 1 - Densitometric analysis of western blots using zebrafish embryos injected with polyQ80-GFP - Figure 3. The intensity values of the polyQ80-GFP and free

GFP bands of each replicate are given.

Set 1 24hpf 36hpf 48hpf 72hpf P80-GFP 1,810,494 6,177,654 3,797,694 3,490,200 GFP 5,098,149 14,050,791 8,051,390 12,762,675

P80 -GFP/Free GFP 0.355127714 0.439665923 0.471681784 0.273469316

Set 2 24hpf 36hpf 48hpf 72hpf P80-GFP 895,160 252,780 722,000 383,684 GFP 3,620,470 1,731,774 3,584,236 4,420,815

P80-GFP/Free GFP 0.247249666 0.145965929 0.201437629 0.086790332

Set 3 24hpf 36hpf 48hpf 72hpf P80-GFP 7,243,408 4,106,505 9,418,314 7,180,530 GFP 17,199,788 12,909,520 20,757,039 28,205,100

P80-GFP/Free GFP 0.421133563 0.318098969 0.453740729 0.254582682

Statistical analysis p-value 24 hpf Vs 36 hpf 0.5869 24 hpf Vs 48 hpf 0.5389 24 hpf Vs 72 hpf 0.038 36 hpf Vs 48 hpf 0.1412 36hpf Vs 72 hpf 0.1105 48 hpf Vs 72 hpf 0.0259

Table 2 - Densitometric analysis of western blots using zebrafish embryos injected with polyQ80-GFP and treated with 1µM rapamycin or 50µM chloroquine -

Figure 4. The intensity values of the polyQ80-GFP and free GFP bands of each replicate are given. (PQ80, polyQ80-GFP; Rap-rapamycin; Chl- chloroquine)

Set 1 PQ80 PQ80+Rap PQ80+Chl P80-GFP 6,416,690 1,761,200 1,959,672 GFP 15,765,680 4,431,832 3,878,688

P80 -GFP/GFP 0.407003694 0.397397735 0.505240947

Set 2 PQ80 PQ80+Rap PQ80+Chl P80-GFP 21,798,022 13,000,920 33,123,800 GFP 62,172,670 40,945,146 61,948,850

P80 -GFP/GFP 0.350604566 0.317520421 0.534695963

Set 3 PQ80 PQ80+Rap PQ80+Chl P80-GFP 12,886,110 12,558,600 10,927,345 GFP 28,036,284 29,178,144 20,636,005

P80 -GFP/GFP 0.459622609 0.430411201 0.529528123

Statistical Analysis

2-way ANOVA

Two-way ANOVA Ordinary Alpha 0.05 Source of Variation % of total variation P value P value summary Significant? Rep 19.20 0.1776 ns No Treat 66.82 0.0299 * Yes

ANOVA table SS DF MS F (DFn, DFd) P value Rep 0.008331 2 0.004166 F (2, 4) = 2.746 P = 0.1776 Treat 0.02900 2 0.01450 F (2, 4) = 9.559 P = 0.0299 Residual 0.006068 4 0.001517

Tukey’s Multiple Comparison Test

Tukey's multiple comparisons test Mean Diff. 95% CI of diff. Significant? Summary PQ80 vs. PQ80+Rapamycin 0.02542 -0.08791 to 0.1388 No ns PQ80 vs. PQ80+Chloroquine -0.1057 -0.2190 to 0.007661 No ns PQ80+Rapamycin vs. PQ80+Chloroquine -0.1311 -0.2444 to -0.01776 Yes *

Test details Mean 1 Mean 2 Mean Diff. SE of diff. PQ80 vs. PQ80+Rapamycin 0.4067 0.3812 0.02542 0.03180 PQ80 vs. PQ80+Chloroquine 0.4067 0.5123 -0.1057 0.03180 PQ80+Rapamycin vs. PQ80+Chloroquine 0.3812 0.5123 -0.1311 0.03180

N1 N2 q DF 3 3 1.131 4 3 3 4.700 4 3 3 5.830 4

Chapter VII

Discussion

151

Discussion

Alzheimer’s disease (AD) is the most common form of dementia that affects millions of people worldwide. Various genetic and environmental risk factors have been identified that could potentially play a critical role in AD pathogenesis. Apart from the common genetic and environmental factors, several risk factors such as hypoxia, oxidative stress, mitochondrial dysfunction, ageing, vascular bleeding and autophagy have been associated with AD [204-209]. The mechanism by which these risk factors help in disease progression is not yet fully understood. Therefore research is needed to elucidate the pathways that are affected and to develop therapeutic targets for AD.

The main aim of this thesis is to use the zebrafish model system to analyse the autophagy pathway and understand its relevance to AD pathogenesis. Autophagy, a

“self-eating” degradative pathway can be induced in cells under stress conditions [210].

Upon induction of autophagy, various damaged and aggregated proteins are sequestered into autophagosomes and these are degraded in lysosomes to release peptides for cellular functions [211]. It is the primary pathway that protects cells from damage caused by these protein aggregates. Proper functioning of this pathway is essential for cellular homeostasis and protein turnover [212]. Defects in the autophagy pathway can lead to cell death caused by the protein aggregates that may become toxic to cells. A number of neurodegenerative disorders are characterized by the presence of protein aggregates which may arise due to defects in their clearance through autophagy [213-

217].

In recent times, the zebrafish model system has gained popularity to analyse autophagy owing to its numerous advantages. Optical clarity, short generation time and the ease with which over-expression or knockdown of genes can be carried out makes it a very

152 efficient tool [218]. Various assays to monitor autophagy have been efficiently carried using zebrafish embryos [202]. Zebrafish embryos owing to their transparency and optical clarity can be directly observed for autophagosomes using high resolution imaging techniques [219]. Other standard techniques to monitor autophagy include LC3 immunoblotting and using lysotracker dyes [220]. LC3, a microtubule-associated protein found in most mammals is one of the commonly used markers of autophagy.

LC3 is an essential gene involved in the processing and binding of autophagosomes to lysosomes in cells [221]. Monitoring autophagy is commonly carried out by determining the LC3II/LC3I isoform ratio in the presence of lysosomal inhibitors [147].

Quite recently, fluorescent chemicals such as MDC (Monodansyl Cadaverine) and

Lysotracker dyes have been used to assess autophagic flux in cells. These dyes can permeate cell membranes and directly bind to autophagosomes or lysosomes. Using fluorescence microscopy, the stained cells can be visualized and counted for the number of autophagosomes [222, 223].

Identifying the zebrafish orthologues of MAP1LC3 genes

Autophagy is a complex pathway involving various genes at different phases of the pathway [48]. Although several genes involved in the pathway have been identified in various mammals, the zebrafish orthologues of these genes are poorly characterised.

Our primary aim was to identify the zebrafish orthologues of the MAP1LC3 gene family. Proteins of the MAP1LC3 gene family are essential during the autophagosome formation and serve as autophagy markers [221]. We have identified the zebrafish orthologues of the MAP1LC3 gene family namely – map1lc3a and map1lc3b using phylogeny and synteny conservation analysis. The retention of these two genes

(map1lc3a and map1lc3b) through evolution strongly suggests that they may have critical roles in autophagy. Both these genes show maternally contributed expression

153 implying that autophagy starts early during embryogenesis and is essential during development. Our results support the idea that autophagy is essential during zebrafish embryogenesis and development. Moreover the presence of zebrafish orthologues of human MAP1LC3 genes indicates that the autophagy pathway may have similar functional roles in both humans and zebrafish and using zebrafish as a model organism to analyse autophagy would be more relevant. Future work would be to understand how these autophagy-related genes are regulated during AD progression.

Autophagy as a response mechanism to counter hypoxia

Oxygen availability is essential for proper functioning of cells. In particular, neurons are in constant need of oxygen supply to perform their physiological functions. Stress, ischemic injury and ageing can lead to hypoxia in neurons, disrupting neuronal activity and making them more prone to damage [224]. Ischemic brain injury decreases blood flow and disrupts ion channels which eventually cause neurons to degenerate due to hypoxia [225, 226]. Hypoxic conditions in brain can promote hyperphosphorylation of tau proteins as well as accumulation of β-amyloid in brains [204, 227]. Cellular stress responses are induced by hypoxia for cell survival and normal functioning. Autophagy is one such survival mechanism that is activated under hypoxic conditions [228]. Aghi et al have shown that hypoxia induced autophagy can be used as a cytoprotective adaptive response in the treatment of glioblastoma [229]. Similarly, Nathalie et al have shown that hypoxia induced autophagy is a pro-survival mechanism initiated through the apoptotic protein BNIP3 [230].

Previously we have shown that the unfolded protein response (UPR) is upregulated under sodium azide treatment (chemical mimicry of hypoxia) in zebrafish embryos

[231]. In continuation we wished to test whether sodium azide has the ability to

154 upregulate autophagy in a similar manner. In our study we used the LC3 immunoblot assay to analyse the induction of autophagy under rapamycin and sodium azide treatment. Immunoblotting for LC3 in the presence of chloroquine, a lysosomal inhibitor showed an increase in the LC3II/LC3I ratio in rapamycin and sodium azide treated 72 hpf larvae supporting that hypoxia induces autophagy in zebrafish larvae.

Results from qPCR assays also showed that rapamycin and sodium azide treatment significantly increased map1lc3a transcript levels but reduced transcript levels of map1lc3b in 72 hpf zebrafish larvae. Our findings support the idea that autophagy may be induced as a counter-response to hypoxia in zebrafish larvae. We observe that both the autophagy pathway and the UPR are upregulated under chemical mimicry of hypoxia by sodium azide treatment. The upregulation of these two pro-survival pathways under hypoxic conditions indicates that these pathways are activated to counter hypoxia and for survival.

Effects of PRESENILIN truncations on autophagy

PRESENILINs form important components of the γ-secretase complex which cleaves several transmembrane proteins like Notch and AβPP [232]. PRESENILINs are essential for γ-secretase activity and AβPP processing [233]. Mutations in the human

PRESENILIN genes have been shown to be responsible for aberrant AβPP processing and other clinical features observed in familial AD brains [234-237]. Moreover,

PRESENILINs are required for autophagy and failure in the autophagy pathway has been implicated in AD pathogenesis [238-240]. They are required for the glycosylation of the V0a1 subunit of v-ATPase which plays a critical role in lysosomal acidification

[241]. PSEN1 gene mutations have been shown to affect the clearance of autophagosomes by disrupting lysosomal acidification in mice [28]. The presence of

PS2V, a naturally occurring truncated isoform of PSEN2 in sporadic AD brains further

155 confirms the critical role of PRESENILIN genes in AD [101]. Sato et al showed that hypoxia can increase the formation of PS2V in human neuroblastoma cells. They also demonstrated that PS2V can increase γ-secretase activity and production of β-amyloid from AβPP [101]. Previously, truncated forms of PRESENILIN proteins have been tested on various assays for Notch signalling and γ-secretase activity [242]. However the role of PS2V-like molecules or truncated forms of PRESENILIN proteins on autophagy is not fully understood.

In previous work PS2V-like molecules derived from zebrafish Presenilin1 and

Presenilin2 (zPsen1∆>4 and zPsen2∆>4 respectively) have been shown to cause differential effects on the unfolded protein response (UPR) and γ-secretase activity

[231]. The unfolded protein response is a pro-survival mechanism which is activated as a response to the accumulation of misfolded proteins in cells [243]. Injection of zPsen1∆>4 truncation alone into zebrafish embryos resulted in the suppression of the

UPR. Evaluating the effects of these constructs (zPsen1∆>4 and zPsen2∆>4) which are structurally similar to the naturally-forming isoform PS2V will widen our understanding of the role of PS2V in autophagy. In our study, neither zPsen1∆>4 nor zPsen2∆>4 showed a significant effect on autophagy in zebrafish larvae. Future work would be to use the LC3 immunoblot assay to test the effects of other presenilin truncations on autophagy.

Screening for drugs that can potentially induce autophagy and have an effect on

β-amyloid clearance

Current drugs used to treat AD only provide symptomatic relief but do not prevent or reverse the disease. Since AD is a complex disorder involving several pathways, there is a need to develop multiple drugs with wide range of action to halt AD progression.

156

Therefore screening of chemicals is essential for the development of better therapeutic drugs. In the past several model organisms have been used for drug screening and for the development of potential drug targets for AD [244, 245]. AD and other neurodegenerative disorders characteristically involve protein aggregation leading to disruption of normal cellular functions and ultimately cell death. Failure in clearance of these peptides due to dysfunction of the autophagy pathway has been implicated in playing a crucial role in AD pathogenesis. Therefore, identifying drugs that can induce autophagy and stimulate β-amyloid clearance is essential for developing potential therapies.

Lublin et al efficiently used a β-amyloid toxicity model of C.elegans to screen potential drug candidates [246]. Cell culture is often used for such high-throughput screening.

However, cultures of cells lack the complexity present in living organisms making such results open to interpretation. In our study we have demonstrated that zebrafish embryos can be efficiently used to screen potential candidates for induction of autophagy. Drugs to be tested can be directly added to the embryos and characterised for their properties. We have tested three drugs (Latrepirdine, Harmol and P7C3) for their ability to induce autophagy in zebrafish larvae.

Latrepirdine can induce autophagy in zebrafish larvae

Latrepirdine is an anti-histamine drug that was tested to see whether it can be used as a treatment for AD [247]. Various studies in the past have shown that Latrepirdine possesses neuroprotective properties [184, 248]. Steele et al demonstrated that

Latrepirdine prevents β-amyloid deposition by inducing autophagy in an Alzheimer mouse model [186]. Similarly, Latrepirdine has been shown to induce autophagy in yeast and mouse models [185, 187]. The mode of action and the pathways triggered by

157

Latrepirdine have remained elusive. Results of our LC3 immunoblot assay and transmission electron microscopy (TEM) have revealed that Latrepirdine at a concentration of 5 µM in DMSO can induce autophagy in 72 hpf zebrafish larvae. The results from our study are consistent with the idea that Latrepirdine can potentially induce autophagy. This has opened up avenues to test and investigate further the properties of this drug with relevance to AD treatment. Also, zebrafish larvae when treated with Latrepirdine did not show any significant morphological changes indicating that the drugs were not toxic. Thus we have demonstrated the use of zebrafish larvae as an excellent tool to test drugs that could be used for AD treatment.

Harmol and P7C3 do not induce autophagy in zebrafish larvae

Since Latrepirdine failed to show significant changes over placebo during Phase III clinical trials, several structural analogues of Latrepirdine have been assessed for neuroprotective properties. Harmol and P7C3 are classes of compounds that have a β- carboline backbone and are structurally similar to Latrepirdine [190]. β-carboline compounds are naturally occurring and possess a broad range of biological activity.

These alkaloids have numerous medicinal benefits and have been used in traditional medicine [249]. Abe et al have shown that harmol can induce autophagy and apoptosis in human glioma cells and exhibits anti-tumour properties [192]. Similarly, P7C3 treatment can restore hippocampal neurogenesis in mouse model of Down’s syndrome

(DS) [250].

In our study, both the Latrepirdine-related drugs (Harmol and P7C3) did not significantly induce autophagy in 72 hpf larvae. However, variability observed in the assay could have led to no significant changes being observed. Although we could demonstrate that Latrepirdine can induce autophagy in zebrafish larvae, we could not

158 demonstrate the same for Latrepirdine-related drugs. Structural differences between

Latrepirdine and Latrepirdine-related drugs (Harmol and P7C3) could be a factor for not observing significant changes in the assay. In addition we have also demonstrated that both the drugs showed no effect on apoptosis in 72 hpf zebrafish larvae. Therefore, further characterisation of Harmol and P7C3 is required to understand the mode of action of these drugs and to validate them as potential therapeutic targets for AD.

Future work would involve testing other structural analogues of Latrepirdine for their ability to induce autophagy in zebrafish larvae. We have also demonstrated that zebrafish embryos serve as an excellent tool to screen potential drugs that can induce autophagy and stimulate β-amyloid clearance.

Developing novel assays to monitor autophagy in zebrafish model system

Monitoring autophagy in zebrafish have been traditionally carried out by counting the number of autophagosomes using electron microscopy, immunoblotting for LC3 an autophagy marker or by using Lysotracker dyes [220]. Recently substrate based reporter assays have been used efficiently to monitor autophagy. Various proteins are degraded in an autophagy dependent manner in cells. Therefore using them as substrates along with reporter probes can enable us to monitor autophagic flow-through in cells [251].

Quantitatively, autophagy can be monitored based on the degradation of these substrates in cells. Ju et al have demonstrated the use of a construct which consists of poly-glutamine repeats attached to a luciferase reporter to monitor autophagy in cells

[252].

Poly-glutamine repeats are implicated in several neurodegenerative disorders such as

Huntington’s disease and spinocerebellar ataxia. These conditions are characterised by the accumulation of poly-glutamine repeats in the brain [253]. Stimulating pathways

159 that can preferentially degrade these aggregated proteins may prove beneficial.

Previously, Brinda et al have demonstrated that poly-glutamine and poly-alanine repeats are degraded through autophagy in the PC12 cell line. Further, they also showed that treatment with rapamycin, an inducer of autophagy, increases the clearance of these repeats [254]. In our study, we used a polyQ80-GFP construct to monitor autophagic flux in zebrafish embryos. We observed an increasing trend of clearance of polyQ80 under rapamycin treatment. When treated with chloroquine, a lysosomal inhibitor, as expected we observed a decreasing trend of polyQ80 clearance. Our results further supports the idea that ployQ80 may follow the autophagy pathway for its degradation.

This assay would be helpful to monitor efficiently the autophagic flux in zebrafish embryos. Future work would be to use this assay to test the effects of truncations of the

PRESENILIN proteins on autophagy. This will help us to understand how the autophagy pathway is regulated during disease progression.

Summary and Future perspectives

In summary, we have used zebrafish as a model organism to monitor autophagy and understand its role in AD pathogenesis. We have identified the zebrafish orthologues of the MAP1LC3 gene family involved in autophagy and have also analysed the expression patterns of these genes during embryogenesis and development. Consistent with previous studies, we observe that both rapamycin and sodium azide treatment

(chemical mimicry of hypoxia) can induce autophagy in zebrafish embryos. Our results indicate that autophagy is essential during zebrafish growth and development and is induced as a response to hypoxia in zebrafish larvae. We have also demonstrated that autophagy can be efficiently monitored in zebrafish embryos and adult brain explants using the LC3 immunoblot assay. In addition, the zebrafish model organism can serve as an important tool for the screening of drugs and development of therapeutic targets

160 for AD. We have found that Latrepirdine, a drug previously tested for treatment of AD, induces autophagy in 72 hpf zebrafish larvae. This opens up avenues to test

Latrepiridine and other related drugs for their ability to stimulate β-amyloid clearance.

In the final part of our study, we developed a novel polyQ80-GFP reporter assay to monitor autophagic flux in zebrafish embryos. We used this assay to efficiently monitor autophagic flux in zebrafish embryos. This assay could further be used to test the effects of various truncations of PRESENILIN proteins on autophagy and would provide insights into the role of autophagy in AD progression.

Future work would be to monitor the effects of other PRESENILIN truncations on autophagy using the LC3 immunoblot assay and the polyQ80-GFP assay. This will help us to understand how these truncations alter autophagy relative to other pathways related to AD pathogenesis using zebrafish larvae. Also potential AD-related drug candidates will be screened to see whether they can induce autophagy in zebrafish. This will help us to identify drugs that can stimulate β-amyloid clearance through induction of autophagy. Additional novel assays to monitor autophagy will also be explored and developed using the zebrafish model system.

161

References

162

1. Robakis, N.K., Mechanisms of AD neurodegeneration may be independent of

Abeta and its derivatives. Neurobiol Aging, 2011. 32(3): p. 372-9.

2. Aggarwal, N.T., et al., Mild cognitive impairment in different functional

domains and incident Alzheimer's disease. Journal of neurology, neurosurgery,

and psychiatry, 2005. 76(11): p. 1479-84.

3. Huse, J.T. and R.W. Doms, Closing in on the amyloid cascade: recent insights

into the cell biology of Alzheimer's disease. Mol Neurobiol, 2000. 22(1-3): p.

81-98.

4. Probst, A., et al., Deposition of beta/A4 protein along neuronal plasma

membranes in diffuse senile plaques. Acta Neuropathol, 1991. 83(1): p. 21-9.

5. Ng HK, C.W., The pathology of Alzheimer's disease. Acta Neuropathologica,

2002. 263: p. 248-263.

6. Mitsuishi, Y., et al., Human CRB2 inhibits gamma-secretase cleavage of

amyloid precursor protein by binding to the presenilin complex. J Biol Chem,

2010. 285(20): p. 14920-31.

7. Guo, Q., et al., APP physiological and pathophysiological functions: insights

from animal models. Cell Res, 2011.

8. Schoonenboom, N.S., et al., Amyloid beta 38, 40, and 42 species in

cerebrospinal fluid: more of the same? Annals of neurology, 2005. 58(1): p.

139-42.

9. Kirkitadze, M.D. and A. Kowalska, Molecular mechanisms initiating amyloid

beta-fibril formation in Alzheimer's disease. Acta biochimica Polonica, 2005.

52(2): p. 417-23.

10. Zhang, C. and A.J. Saunders, Therapeutic targeting of the alpha-secretase

pathway to treat Alzheimer's disease. Discov Med, 2007. 7(39): p. 113-7. 163

11. Supnet, C. and I. Bezprozvanny, Presenilins as endoplasmic reticulum calcium

leak channels and Alzheimer's disease pathogenesis. Science China. Life

sciences, 2011. 54(8): p. 744-51.

12. Obulesu, M., R. Somashekhar, and R. Venu, Genetics of Alzheimer's disease: an

insight into presenilins and apolipoprotein E instigated neurodegeneration. Int J

Neurosci, 2011. 121(5): p. 229-36.

13. Area-Gomez, E., et al., Presenilins are enriched in endoplasmic reticulum

membranes associated with mitochondria. The American journal of pathology,

2009. 175(5): p. 1810-6.

14. Schon, E.A. and E. Area-Gomez, Is Alzheimer's disease a disorder of

mitochondria-associated membranes? J Alzheimers Dis, 2010. 20 Suppl 2: p.

S281-92.

15. De Strooper, B., Loss-of-function presenilin mutations in Alzheimer disease.

Talking Point on the role of presenilin mutations in Alzheimer disease. EMBO

reports, 2007. 8(2): p. 141-6.

16. Baulac, S., et al., Functional gamma-secretase complex assembly in

Golgi/trans-Golgi network: interactions among presenilin, nicastrin, Aph1, Pen-

2, and gamma-secretase substrates. Neurobiology of disease, 2003. 14(2): p.

194-204.

17. De Strooper, B., Aph-1, Pen-2, and Nicastrin with Presenilin generate an active

gamma-Secretase complex. Neuron, 2003. 38(1): p. 9-12.

18. Munter, L.M., et al., Aberrant amyloid precursor protein (APP) processing in

hereditary forms of Alzheimer disease caused by APP familial Alzheimer

disease mutations can be rescued by mutations in the APP GxxxG motif. J Biol

Chem, 2010. 285(28): p. 21636-43. 164

19. Kogel, D., et al., The APP intracellular domain (AICD) potentiates ER stress-

induced apoptosis. Neurobiol Aging, 2012. 33(9): p. 2200-9.

20. Landman, N., et al., Presenilin mutations linked to familial Alzheimer's disease

cause an imbalance in phosphatidylinositol 4,5-bisphosphate metabolism.

Proceedings of the National Academy of Sciences of the United States of

America, 2006. 103(51): p. 19524-9.

21. Wakabayashi, T. and B. De Strooper, Presenilins: members of the gamma-

secretase quartets, but part-time soloists too. Physiology (Bethesda), 2008. 23:

p. 194-204.

22. Yang, D.S., J.H. Lee, and R.A. Nixon, Monitoring autophagy in Alzheimer's

disease and related neurodegenerative diseases. Methods in enzymology, 2009.

453: p. 111-44.

23. Kim, K.W., et al., Autophagy upregulation by inhibitors of caspase-3 and

mTOR enhances radiotherapy in a mouse model of lung cancer. Autophagy,

2008. 4(5): p. 659-68.

24. Mortimore, G.E., et al., Autophagy. Sub-cellular biochemistry, 1996. 27: p. 93-

135.

25. Reggiori, F., et al., Selective types of autophagy. Int J Cell Biol, 2012. 2012: p.

156272.

26. Yang, D.S., et al., Therapeutic effects of remediating autophagy failure in a

mouse model of Alzheimer disease by enhancing lysosomal proteolysis.

Autophagy, 2011. 7(7): p. 788-9.

27. Nixon, R.A. and D.S. Yang, Autophagy failure in Alzheimer's disease-locating

the primary defect. Neurobiol Dis, 2011. 43(1): p. 38-45.

165

28. Lee, J.H., et al., Lysosomal proteolysis and autophagy require presenilin 1 and

are disrupted by Alzheimer-related PS1 mutations. Cell, 2010. 141(7): p. 1146-

58.

29. Caccamo, A., et al., Molecular interplay between mammalian target of

rapamycin (mTOR), amyloid-beta, and Tau: effects on cognitive impairments. J

Biol Chem, 2010. 285(17): p. 13107-20.

30. Chui, D.H., et al., Transgenic mice with Alzheimer presenilin 1 mutations show

accelerated neurodegeneration without amyloid plaque formation. Nature

medicine, 1999. 5(5): p. 560-4.

31. Cataldo, A.M., et al., Presenilin mutations in familial Alzheimer disease and

transgenic mouse models accelerate neuronal lysosomal pathology. Journal of

neuropathology and experimental neurology, 2004. 63(8): p. 821-30.

32. Nilsson, P., et al., Abeta secretion and plaque formation depend on autophagy.

Cell Rep, 2013. 5(1): p. 61-9.

33. Boland, B., et al., Autophagy induction and autophagosome clearance in

neurons: relationship to autophagic pathology in Alzheimer's disease. J

Neurosci, 2008. 28(27): p. 6926-37.

34. Okamoto, K., Organellophagy: eliminating cellular building blocks via selective

autophagy. J Cell Biol, 2014. 205(4): p. 435-45.

35. Klionsky, D.J. and S.D. Emr, Autophagy as a regulated pathway of cellular

degradation. Science, 2000. 290(5497): p. 1717-21.

36. Rajawat, Y.S. and I. Bossis, Autophagy in aging and in neurodegenerative

disorders. Hormones, 2008. 7(1): p. 46-61.

37. Armour, S.M., et al., Inhibition of mammalian S6 kinase by resveratrol

suppresses autophagy. Aging, 2009. 1(6): p. 515-28. 166

38. Yorimitsu, T., et al., Tap42-associated protein phosphatase type 2A negatively

regulates induction of autophagy. Autophagy, 2009. 5(5): p. 616-24.

39. Park, I.H., et al., Effect of rifampicin to inhibit rapamycin-induced autophagy

via the suppression of protein phosphatase 2A activity. Immunopharmacology

and immunotoxicology, 2008. 30(4): p. 837-49.

40. Majumder, S., et al., Inducing autophagy by rapamycin before, but not after, the

formation of plaques and tangles ameliorates cognitive deficits. PLoS One,

2011. 6(9): p. e25416.

41. Harrison, D.E., et al., Rapamycin fed late in life extends lifespan in genetically

heterogeneous mice. Nature, 2009. 460(7253): p. 392-5.

42. Lynch-Day, M.A. and D.J. Klionsky, The Cvt pathway as a model for selective

autophagy. FEBS letters, 2010. 584(7): p. 1359-66.

43. Lang, T., et al., Autophagy and the cvt pathway both depend on AUT9. Journal

of bacteriology, 2000. 182(8): p. 2125-33.

44. Goodsell, D.S. and D.J. Klionsky, Artophagy: the art of autophagy--the Cvt

pathway. Autophagy, 2010. 6(1): p. 3-6.

45. Kabeya, Y., et al., Atg17 functions in cooperation with Atg1 and Atg13 in yeast

autophagy. Molecular biology of the cell, 2005. 16(5): p. 2544-53.

46. Kamada, Y., T. Sekito, and Y. Ohsumi, Autophagy in yeast: a TOR-mediated

response to nutrient starvation. Current topics in microbiology and

immunology, 2004. 279: p. 73-84.

47. Nakatogawa, H., et al., Dynamics and diversity in autophagy mechanisms:

lessons from yeast. Nature reviews. Molecular cell biology, 2009. 10(7): p. 458-

67.

167

48. He, C. and D.J. Klionsky, Regulation mechanisms and signaling pathways of

autophagy. Annu Rev Genet, 2009. 43: p. 67-93.

49. Marino, G. and C. Lopez-Otin, Autophagy: molecular mechanisms,

physiological functions and relevance in human pathology. Cellular and

molecular life sciences : CMLS, 2004. 61(12): p. 1439-54.

50. Renna, M., et al., Autophagic substrate clearance requires activity of the

syntaxin-5 SNARE complex. Journal of cell science, 2011. 124(Pt 3): p. 469-82.

51. Aplin, A., et al., Cytoskeletal elements are required for the formation and

maturation of autophagic vacuoles. Journal of cellular physiology, 1992.

152(3): p. 458-66.

52. Kagedal, K., U. Johansson, and K. Ollinger, The lysosomal protease cathepsin

D mediates apoptosis induced by oxidative stress. The FASEB journal : official

publication of the Federation of American Societies for Experimental Biology,

2001. 15(9): p. 1592-4.

53. Fujitani, Y., T. Ueno, and H. Watada, Autophagy in health and disease. 4. The

role of pancreatic beta-cell autophagy in health and diabetes. Am J Physiol Cell

Physiol, 2010. 299(1): p. C1-6.

54. Klionsky, D.J., Autophagy: from phenomenology to molecular understanding in

less than a decade. Nature reviews. Molecular cell biology, 2007. 8(11): p. 931-

7.

55. Moreira, P.I., et al., Autophagy in Alzheimer's disease. Expert review of

neurotherapeutics, 2010. 10(7): p. 1209-18.

56. Nixon, R.A. and D.S. Yang, Autophagy failure in Alzheimer's disease-locating

the primary defect. Neurobiology of disease, 2011. 43(1): p. 38-45.

168

57. Nixon, R.A., et al., Extensive involvement of autophagy in Alzheimer disease:

an immuno-electron microscopy study. Journal of neuropathology and

experimental neurology, 2005. 64(2): p. 113-22.

58. Ohta, K., et al., Autophagy impairment stimulates PS1 expression and gamma-

secretase activity. Autophagy, 2010. 6(3): p. 345-52.

59. Checler, F., The multiple paradoxes of presenilins. J Neurochem, 2001. 76(6): p.

1621-7.

60. Fukumori, A., et al., Presenilin-dependent gamma-secretase on plasma

membrane and endosomes is functionally distinct. Biochemistry, 2006. 45(15):

p. 4907-14.

61. Fraser, P.E., et al., Presenilin structure, function and role in Alzheimer disease.

Biochimica et biophysica acta, 2000. 1502(1): p. 1-15.

62. Dewji, N.N., Presenilin structure in mechanisms leading to Alzheimer's disease.

J Alzheimers Dis, 2006. 10(2-3): p. 277-90.

63. Crystal, A.S., et al., Membrane topology of gamma-secretase component PEN-2.

J Biol Chem, 2003. 278(22): p. 20117-23.

64. Wolfe, M.S., Presenilin and gamma-secretase: structure meets function. Journal

of neurochemistry, 2001. 76(6): p. 1615-20.

65. Leimer, U., et al., Zebrafish (Danio rerio) presenilin promotes aberrant amyloid

beta-peptide production and requires a critical aspartate residue for its function

in amyloidogenesis. Biochemistry, 1999. 38(41): p. 13602-9.

66. Steiner, H., et al., A loss of function mutation of presenilin-2 interferes with

amyloid beta-peptide production and notch signaling. The Journal of biological

chemistry, 1999. 274(40): p. 28669-73.

169

67. Fraser, P.E., et al., Presenilin structure, function and role in Alzheimer disease.

Biochim Biophys Acta, 2000. 1502(1): p. 1-15.

68. Wolfe, M.S., et al., Two transmembrane aspartates in presenilin-1 required for

presenilin endoproteolysis and gamma-secretase activity. Nature, 1999.

398(6727): p. 513-7.

69. Capell, A., et al., The proteolytic fragments of the Alzheimer's disease-

associated presenilin-1 form heterodimers and occur as a 100-150-kDa

molecular mass complex. The Journal of biological chemistry, 1998. 273(6): p.

3205-11.

70. Li, Y.M., et al., Photoactivated gamma-secretase inhibitors directed to the

active site covalently label presenilin 1. Nature, 2000. 405(6787): p. 689-94.

71. Levitan, D., et al., Assessment of normal and mutant human presenilin function

in Caenorhabditis elegans. Proceedings of the National Academy of Sciences of

the United States of America, 1996. 93(25): p. 14940-4.

72. De Strooper, B., Loss-of-function presenilin mutations in Alzheimer disease.

Talking Point on the role of presenilin mutations in Alzheimer disease. EMBO

Rep, 2007. 8(2): p. 141-6.

73. Raemaekers, T., C. Esselens, and W. Annaert, Presenilin 1: more than just

gamma-secretase. Biochemical Society transactions, 2005. 33(Pt 4): p. 559-62.

74. Greenough, M.A., et al., Presenilins promote the cellular uptake of copper and

zinc and maintain copper chaperone of SOD1-dependent copper/zinc

superoxide dismutase activity. J Biol Chem, 2011. 286(11): p. 9776-86.

75. Zampese, E., et al., Presenilin 2 modulates endoplasmic reticulum (ER)-

mitochondria interactions and Ca2+ cross-talk. Proc Natl Acad Sci U S A,

2011. 108(7): p. 2777-82. 170

76. Yagi, T., et al., Defective signal transduction in B lymphocytes lacking

presenilin proteins. Proceedings of the National Academy of Sciences of the

United States of America, 2008. 105(3): p. 979-84.

77. Baumeister, R., et al., Human presenilin-1, but not familial Alzheimer's disease

(FAD) mutants, facilitate Caenorhabditis elegans Notch signalling

independently of proteolytic processing. Genes and function, 1997. 1(2): p. 149-

59.

78. Shen, J., et al., Skeletal and CNS defects in Presenilin-1-deficient mice. Cell,

1997. 89(4): p. 629-39.

79. Levitan, D. and I. Greenwald, Facilitation of lin-12-mediated signalling by sel-

12, a Caenorhabditis elegans S182 Alzheimer's disease gene. Nature, 1995.

377(6547): p. 351-4.

80. Kawamura, Y., et al., Inhibitory effect of a presenilin 1 mutation on the Wnt

signalling pathway by enhancement of beta-catenin phosphorylation. European

journal of biochemistry / FEBS, 2001. 268(10): p. 3036-41.

81. Zuckerman, V., et al., Tumour suppression by p53: the importance of apoptosis

and cellular senescence. The Journal of pathology, 2009. 219(1): p. 3-15.

82. Ellis, R.E. and H.R. Horvitz, Two C. elegans genes control the programmed

deaths of specific cells in the pharynx. Development, 1991. 112(2): p. 591-603.

83. Dremina, E.S., et al., Anti-apoptotic protein Bcl-2 interacts with and destabilizes

the sarcoplasmic/endoplasmic reticulum Ca2+-ATPase (SERCA). The

Biochemical journal, 2004. 383(Pt 2): p. 361-70.

84. Miller, D.K., The role of the Caspase family of cysteine proteases in apoptosis.

Seminars in immunology, 1997. 9(1): p. 35-49.

171

85. Keane, R.W., et al., Activation of CPP32 during apoptosis of neurons and

astrocytes. Journal of neuroscience research, 1997. 48(2): p. 168-80.

86. Zhou, J., et al., Presenilin 1 interaction in the brain with a novel member of the

Armadillo family. Neuroreport, 1997. 8(6): p. 1489-94.

87. Wolozin, B., et al., Participation of presenilin 2 in apoptosis: enhanced basal

activity conferred by an Alzheimer mutation. Science, 1996. 274(5293): p. 1710-

3.

88. Sato, S., et al., Splicing mutation of presenilin-1 gene for early-onset familial

Alzheimer's disease. Human mutation, 1998. Suppl 1: p. S91-4.

89. Cruts, M. and C. Van Broeckhoven, Presenilin mutations in Alzheimer's

disease. Human mutation, 1998. 11(3): p. 183-90.

90. Yu, G., et al., Mutation of conserved aspartates affects maturation of both

aspartate mutant and endogenous presenilin 1 and presenilin 2 complexes. The

Journal of biological chemistry, 2000. 275(35): p. 27348-53.

91. Capell, A., et al., Presenilin-1 differentially facilitates endoproteolysis of the

beta-amyloid precursor protein and Notch. Nature cell biology, 2000. 2(4): p.

205-11.

92. Kulic, L., et al., Separation of presenilin function in amyloid beta-peptide

generation and endoproteolysis of Notch. Proceedings of the National Academy

of Sciences of the United States of America, 2000. 97(11): p. 5913-8.

93. Wolfe, M.S., When loss is gain: reduced presenilin proteolytic function leads to

increased Abeta42/Abeta40. Talking Point on the role of presenilin mutations in

Alzheimer disease. EMBO reports, 2007. 8(2): p. 136-40.

94. Song, W., et al., Proteolytic release and nuclear translocation of Notch-1 are

induced by presenilin-1 and impaired by pathogenic presenilin-1 mutations. 172

Proceedings of the National Academy of Sciences of the United States of

America, 1999. 96(12): p. 6959-63.

95. Soriano, S., et al., Presenilin 1 negatively regulates beta-catenin/T cell

factor/lymphoid enhancer factor-1 signaling independently of beta-amyloid

precursor protein and notch processing. The Journal of cell biology, 2001.

152(4): p. 785-94.

96. Baki, L., et al., PS1 activates PI3K thus inhibiting GSK-3 activity and tau

overphosphorylation: effects of FAD mutations. The EMBO journal, 2004.

23(13): p. 2586-96.

97. Tu, H., et al., Presenilins form ER Ca2+ leak channels, a function disrupted by

familial Alzheimer's disease-linked mutations. Cell, 2006. 126(5): p. 981-93.

98. Berezovska, O., et al., Familial Alzheimer's disease presenilin 1 mutations

cause alterations in the conformation of presenilin and interactions with

amyloid precursor protein. The Journal of neuroscience : the official journal of

the Society for Neuroscience, 2005. 25(11): p. 3009-17.

99. Moussavi Nik, S.H., M. Newman, and M. Lardelli, The response of HMGA1 to

changes in oxygen availability is evolutionarily conserved. Exp Cell Res, 2011.

317(11): p. 1503-12.

100. Kwok, J.B., et al., Presenilin-1 mutation L271V results in altered exon 8

splicing and Alzheimer's disease with non-cored plaques and no neuritic

dystrophy. J Biol Chem, 2003. 278(9): p. 6748-54.

101. Sato, N., et al., A novel presenilin-2 splice variant in human Alzheimer's disease

brain tissue. J Neurochem, 1999. 72(6): p. 2498-505.

102. Evin, G., et al., Alternative transcripts of presenilin-1 associated with

frontotemporal dementia. Neuroreport, 2002. 13(5): p. 719-23. 173

103. Nornes, S., et al., Interference with splicing of Presenilin transcripts has potent

dominant negative effects on Presenilin activity. Hum Mol Genet, 2008. 17(3):

p. 402-12.

104. Nixon, R.A., Autophagy in neurodegenerative disease: friend, foe or turncoat?

Trends in neurosciences, 2006. 29(9): p. 528-35.

105. Boland, B., et al., Autophagy induction and autophagosome clearance in

neurons: relationship to autophagic pathology in Alzheimer's disease. The

Journal of neuroscience : the official journal of the Society for Neuroscience,

2008. 28(27): p. 6926-37.

106. Pua, H.H., et al., A critical role for the autophagy gene Atg5 in T cell survival

and proliferation. The Journal of experimental medicine, 2007. 204(1): p. 25-

31.

107. Urbanelli, L., et al., Cathepsin D expression is decreased in Alzheimer's disease

fibroblasts. Neurobiology of aging, 2008. 29(1): p. 12-22.

108. Shimizu, T., et al., Proteolytic degradation of glutamate decarboxylase mediates

disinhibition of hippocampal CA3 pyramidal cells in cathepsin D-deficient mice.

Journal of neurochemistry, 2005. 94(3): p. 680-90.

109. Naslund, J., et al., Characterization of stable complexes involving

apolipoprotein E and the amyloid beta peptide in Alzheimer's disease brain.

Neuron, 1995. 15(1): p. 219-28.

110. van der Hilst, J.C., et al., Cathepsin D activity protects against development of

type AA amyloid fibrils. European journal of clinical investigation, 2009. 39(5):

p. 412-6.

174

111. Schuur, M., et al., Cathepsin D gene and the risk of Alzheimer's disease: a

population-based study and meta-analysis. Neurobiology of aging, 2011. 32(9):

p. 1607-14.

112. Sundelof, J., et al., Higher cathepsin B levels in plasma in Alzheimer's disease

compared to healthy controls. Journal of Alzheimer's disease : JAD, 2010.

22(4): p. 1223-30.

113. Klein, D.M., K.M. Felsenstein, and D.E. Brenneman, Cathepsins B and L

differentially regulate amyloid precursor protein processing. The Journal of

pharmacology and experimental therapeutics, 2009. 328(3): p. 813-21.

114. Sun, B., et al., Cystatin C-cathepsin B axis regulates amyloid beta levels and

associated neuronal deficits in an animal model of Alzheimer's disease. Neuron,

2008. 60(2): p. 247-57.

115. Mueller-Steiner, S., et al., Antiamyloidogenic and neuroprotective functions of

cathepsin B: implications for Alzheimer's disease. Neuron, 2006. 51(6): p. 703-

14.

116. Bendiske, J. and B.A. Bahr, Lysosomal activation is a compensatory response

against protein accumulation and associated synaptopathogenesis--an approach

for slowing Alzheimer disease? Journal of neuropathology and experimental

neurology, 2003. 62(5): p. 451-63.

117. Inoki, K., et al., Signaling by target of rapamycin proteins in cell growth

control. Microbiol Mol Biol Rev, 2005. 69(1): p. 79-100.

118. Zoncu, R., A. Efeyan, and D.M. Sabatini, mTOR: from growth signal

integration to cancer, diabetes and ageing. Nat Rev Mol Cell Biol, 2011. 12(1):

p. 21-35.

175

119. Janus, A., T. Robak, and P. Smolewski, The mammalian target of the rapamycin

(mTOR) kinase pathway: its role in tumourigenesis and targeted antitumour

therapy. Cell Mol Biol Lett, 2005. 10(3): p. 479-98.

120. Maiese, K., et al., mTOR: on target for novel therapeutic strategies in the

nervous system. Trends Mol Med, 2013. 19(1): p. 51-60.

121. Kim, D.H. and D.M. Sabatini, Raptor and mTOR: subunits of a nutrient-

sensitive complex. Curr Top Microbiol Immunol, 2004. 279: p. 259-70.

122. Zaytseva, Y.Y., et al., mTOR inhibitors in cancer therapy. Cancer Lett, 2012.

319(1): p. 1-7.

123. Tsang, C.K., et al., Targeting mammalian target of rapamycin (mTOR) for

health and diseases. Drug Discov Today, 2007. 12(3-4): p. 112-24.

124. Gangloff, Y.G., et al., Disruption of the mouse mTOR gene leads to early

postimplantation lethality and prohibits embryonic stem cell development. Mol

Cell Biol, 2004. 24(21): p. 9508-16.

125. Salvadori, M., Antineoplastic effects of mammalian target of rapamycine

inhibitors. World J Transplant, 2012. 2(5): p. 74-83.

126. Shah, O.J., Z. Wang, and T. Hunter, Inappropriate activation of the

TSC/Rheb/mTOR/S6K cassette induces IRS1/2 depletion, insulin resistance, and

cell survival deficiencies. Curr Biol, 2004. 14(18): p. 1650-6.

127. McMullen, J.R., et al., Inhibition of mTOR signaling with rapamycin regresses

established cardiac hypertrophy induced by pressure overload. Circulation,

2004. 109(24): p. 3050-5.

128. Maiese, K., et al., Oxidant stress and signal transduction in the nervous system

with the PI 3-K, Akt, and mTOR cascade. Int J Mol Sci, 2012. 13(11): p. 13830-

66. 176

129. Schaeffer, V. and M. Goedert, Stimulation of autophagy is neuroprotective in a

mouse model of human tauopathy. Autophagy, 2012. 8(11): p. 1686-7.

130. Ravikumar, B., et al., Inhibition of mTOR induces autophagy and reduces

toxicity of polyglutamine expansions in fly and mouse models of Huntington

disease. Nat Genet, 2004. 36(6): p. 585-95.

131. Cheng, Y.R., A. Fang, and A.L. Demain, Effect of amino acids on rapamycin

biosynthesis by Streptomyces hygroscopicus. Appl Microbiol Biotechnol, 1995.

43(6): p. 1096-8.

132. Seto, B., Rapamycin and mTOR: a serendipitous discovery and implications for

breast cancer. Clin Transl Med, 2012. 1(1): p. 29.

133. Williams, A., et al., Novel targets for Huntington's disease in an mTOR-

independent autophagy pathway. Nat Chem Biol, 2008. 4(5): p. 295-305.

134. Kim, D.H., et al., mTOR interacts with raptor to form a nutrient-sensitive

complex that signals to the cell growth machinery. Cell, 2002. 110(2): p. 163-

75.

135. Malagelada, C., et al., Rapamycin protects against neuron death in in vitro and

in vivo models of Parkinson's disease. J Neurosci, 2010. 30(3): p. 1166-75.

136. Dehay, B., et al., Pathogenic lysosomal depletion in Parkinson's disease. J

Neurosci, 2010. 30(37): p. 12535-44.

137. Sarbassov, D.D., et al., Prolonged rapamycin treatment inhibits mTORC2

assembly and Akt/PKB. Mol Cell, 2006. 22(2): p. 159-68.

138. Schenone, S., et al., ATP-competitive inhibitors of mTOR: an update. Curr Med

Chem, 2011. 18(20): p. 2995-3014.

177

139. Roper, J., et al., The dual PI3K/mTOR inhibitor NVP-BEZ235 induces tumor

regression in a genetically engineered mouse model of PIK3CA wild-type

colorectal cancer. PLoS One, 2011. 6(9): p. e25132.

140. Benjamin, D., et al., Rapamycin passes the torch: a new generation of mTOR

inhibitors. Nat Rev Drug Discov, 2011. 10(11): p. 868-80.

141. Hong, S.K., et al., Autophagy sensitivity of neuroendocrine lung tumor cells. Int

J Oncol, 2013. 43(6): p. 2031-8.

142. Liu, Q., et al., Discovery of 9-(6-aminopyridin-3-yl)-1-(3-

(trifluoromethyl)phenyl)benzo[h][1,6]naphthyridin-2( 1H)-one (Torin2) as a

potent, selective, and orally available mammalian target of rapamycin (mTOR)

inhibitor for treatment of cancer. J Med Chem, 2011. 54(5): p. 1473-80.

143. Jiang, P. and N. Mizushima, Autophagy and human diseases. Cell Res, 2014.

24(1): p. 69-79.

144. Jing, K. and K. Lim, Why is autophagy important in human diseases? Exp Mol

Med, 2012. 44(2): p. 69-72.

145. Juhasz, G., Interpretation of bafilomycin, pH neutralizing or protease inhibitor

treatments in autophagic flux experiments: novel considerations. Autophagy,

2012. 8(12): p. 1875-6.

146. McLeland, C.B., J. Rodriguez, and S.T. Stern, Autophagy monitoring assay:

qualitative analysis of MAP LC3-I to II conversion by immunoblot. Methods

Mol Biol, 2011. 697: p. 199-206.

147. Klionsky, D.J., et al., Guidelines for the use and interpretation of assays for

monitoring autophagy. Autophagy, 2012. 8(4): p. 445-544.

148. Webb, J.L., B. Ravikumar, and D.C. Rubinsztein, Microtubule disruption

inhibits autophagosome-lysosome fusion: implications for studying the roles of 178

aggresomes in polyglutamine diseases. Int J Biochem Cell Biol, 2004. 36(12): p.

2541-50.

149. Yoshimori, T., et al., Bafilomycin A1, a specific inhibitor of vacuolar-type H(+)-

ATPase, inhibits acidification and protein degradation in lysosomes of cultured

cells. J Biol Chem, 1991. 266(26): p. 17707-12.

150. Nilsson, J.R., Does chloroquine, an antimalarial drug, affect autophagy in

Tetrahymena pyriformis? J Protozool, 1992. 39(1): p. 9-16.

151. Salako, L.A., Pharmacokinetics of antimalarial drugs: their therapeutic and

toxicological implications. Ann Ist Super Sanita, 1985. 21(3): p. 315-25.

152. Steinman, R.M., et al., Endocytosis and the recycling of plasma membrane. J

Cell Biol, 1983. 96(1): p. 1-27.

153. Shintani, T. and D.J. Klionsky, Autophagy in health and disease: a double-

edged sword. Science, 2004. 306(5698): p. 990-5.

154. Shacka, J.J., et al., Bafilomycin A1 inhibits chloroquine-induced death of

cerebellar granule neurons. Mol Pharmacol, 2006. 69(4): p. 1125-36.

155. Egger, M.E., et al., Inhibition of autophagy with chloroquine is effective in

melanoma. J Surg Res, 2013. 184(1): p. 274-81.

156. Park, B.C., et al., Chloroquine-induced nitric oxide increase and cell death is

dependent on cellular GSH depletion in A172 human glioblastoma cells.

Toxicol Lett, 2008. 178(1): p. 52-60.

157. Geng, Y., et al., Chloroquine-induced autophagic vacuole accumulation and

cell death in glioma cells is p53 independent. Neuro Oncol, 2010. 12(5): p. 473-

81.

179

158. Zaidi, A.U., et al., Chloroquine-induced neuronal cell death is p53 and Bcl-2

family-dependent but caspase-independent. J Neuropathol Exp Neurol, 2001.

60(10): p. 937-45.

159. Thorburn, A., Apoptosis and autophagy: regulatory connections between two

supposedly different processes. Apoptosis, 2008. 13(1): p. 1-9.

160. Shacka, J.J., B.J. Klocke, and K.A. Roth, Autophagy, bafilomycin and cell

death: the "a-B-cs" of plecomacrolide-induced neuroprotection. Autophagy,

2006. 2(3): p. 228-30.

161. Werner, G., et al., Metabolic products of microorganisms. 224. Bafilomycins, a

new group of macrolide antibiotics. Production, isolation, chemical structure

and biological activity. J Antibiot (Tokyo), 1984. 37(2): p. 110-7.

162. van Schalkwyk, D.A., et al., Inhibition of Plasmodium falciparum pH regulation

by small molecule indole derivatives results in rapid parasite death. Biochem

Pharmacol, 2010. 79(9): p. 1291-9.

163. Bowman, E.J., et al., The bafilomycin/concanamycin binding site in subunit c of

the V-ATPases from Neurospora crassa and Saccharomyces cerevisiae. J Biol

Chem, 2004. 279(32): p. 33131-8.

164. Bowman, B.J. and E.J. Bowman, Mutations in subunit C of the vacuolar ATPase

confer resistance to bafilomycin and identify a conserved antibiotic binding site.

J Biol Chem, 2002. 277(6): p. 3965-72.

165. Umata, T., et al., The cytotoxic action of diphtheria toxin and its degradation in

intact Vero cells are inhibited by bafilomycin A1, a specific inhibitor of

vacuolar-type H(+)-ATPase. J Biol Chem, 1990. 265(35): p. 21940-5.

180

166. Ohkuma, S., et al., Inhibition of cell growth by bafilomycin A1, a selective

inhibitor of vacuolar H(+)-ATPase. In Vitro Cell Dev Biol Anim, 1993.

29A(11): p. 862-6.

167. Teplova, V.V., et al., Bafilomycin A1 is a potassium ionophore that impairs

mitochondrial functions. J Bioenerg Biomembr, 2007. 39(4): p. 321-9.

168. Hong, J., et al., Nitric oxide production by the vacuolar-type (H+)-ATPase

inhibitors bafilomycin A1 and concanamycin A and its possible role in apoptosis

in RAW 264.7 cells. J Pharmacol Exp Ther, 2006. 319(2): p. 672-81.

169. Klionsky, D.J. and S.D. Emr, Membrane protein sorting: biosynthesis, transport

and processing of yeast vacuolar alkaline phosphatase. EMBO J, 1989. 8(8): p.

2241-50.

170. Yamamoto, A., et al., Bafilomycin A1 prevents maturation of autophagic

vacuoles by inhibiting fusion between autophagosomes and lysosomes in rat

hepatoma cell line, H-4-II-E cells. Cell Struct Funct, 1998. 23(1): p. 33-42.

171. Seglen, P.O. and P.B. Gordon, 3-Methyladenine: specific inhibitor of

autophagic/lysosomal protein degradation in isolated rat hepatocytes. Proc Natl

Acad Sci U S A, 1982. 79(6): p. 1889-92.

172. Gordon, P.B. and P.O. Seglen, 6-substituted purines: a novel class of inhibitors

of endogenous protein degradation in isolated rat hepatocytes. Arch Biochem

Biophys, 1982. 217(1): p. 282-94.

173. Caro, L.H., et al., 3-Methyladenine, an inhibitor of autophagy, has multiple

effects on metabolism. Eur J Biochem, 1988. 175(2): p. 325-9.

174. Seglen, P.O. and P.B. Gordon, Amino acid control of autophagic sequestration

and protein degradation in isolated rat hepatocytes. J Cell Biol, 1984. 99(2): p.

435-44. 181

175. Petiot, A., et al., Distinct classes of phosphatidylinositol 3'-kinases are involved

in signaling pathways that control macroautophagy in HT-29 cells. J Biol

Chem, 2000. 275(2): p. 992-8.

176. Kong, D. and T. Yamori, Phosphatidylinositol 3-kinase inhibitors: promising

drug candidates for cancer therapy. Cancer Sci, 2008. 99(9): p. 1734-40.

177. Wu, Y.T., et al., Dual role of 3-methyladenine in modulation of autophagy via

different temporal patterns of inhibition on class I and III phosphoinositide 3-

kinase. J Biol Chem, 2010. 285(14): p. 10850-61.

178. Bachurin, S., et al., Antihistamine agent Dimebon as a novel neuroprotector and

a cognition enhancer. Ann N Y Acad Sci, 2001. 939: p. 425-35.

179. Lermontova, N.N., et al., Dimebon improves learning in animals with

experimental Alzheimer's disease. Bull Exp Biol Med, 2000. 129(6): p. 544-6.

180. Okun, I., et al., From anti-allergic to anti-Alzheimer's: Molecular pharmacology

of Dimebon. Curr Alzheimer Res, 2010. 7(2): p. 97-112.

181. Zhang, S., et al., Dimebon (latrepirdine) enhances mitochondrial function and

protects neuronal cells from death. J Alzheimers Dis, 2010. 21(2): p. 389-402.

182. Pieper, A.A., et al., Discovery of a proneurogenic, neuroprotective chemical.

Cell, 2010. 142(1): p. 39-51.

183. Perez, S.E., et al., Dimebon alters hippocampal amyloid pathology in 3xTg-AD

mice. Int J Physiol Pathophysiol Pharmacol, 2012. 4(3): p. 115-27.

184. Egea, J., et al., Neuroprotective effect of dimebon against ischemic neuronal

damage. Neuroscience, 2014. 267: p. 11-21.

185. Bharadwaj, P.R., et al., Latrepirdine (dimebon) enhances autophagy and

reduces intracellular GFP-Abeta42 levels in yeast. J Alzheimers Dis, 2012.

32(4): p. 949-67. 182

186. Steele, J.W. and S. Gandy, Latrepirdine (Dimebon(R)), a potential Alzheimer

therapeutic, regulates autophagy and neuropathology in an Alzheimer mouse

model. Autophagy, 2013. 9(4): p. 617-8.

187. Steele, J.W., et al., Acute dosing of latrepirdine (Dimebon), a possible

Alzheimer therapeutic, elevates extracellular amyloid-beta levels in vitro and in

vivo. Mol Neurodegener, 2009. 4: p. 51.

188. Steele, J.W., et al., Latrepirdine improves cognition and arrests progression of

neuropathology in an Alzheimer's mouse model. Mol Psychiatry, 2013. 18(8): p.

889-97.

189. Steele, J.W., et al., Latrepirdine stimulates autophagy and reduces

accumulation of alpha-synuclein in cells and in mouse brain. Mol Psychiatry,

2013. 18(8): p. 882-8.

190. Bharadwaj, P.R., et al., Latrepirdine: molecular mechanisms underlying

potential therapeutic roles in Alzheimer's and other neurodegenerative diseases.

Transl Psychiatry, 2013. 3: p. e332.

191. Pimpinella, G. and M. Palmery, Interaction of beta-carbolines with central

dopaminergic transmission in mice: structure-activity relationships. Neurosci

Lett, 1995. 189(2): p. 121-4.

192. Abe, A. and H. Kokuba, Harmol induces autophagy and subsequent apoptosis

in U251MG human glioma cells through the downregulation of survivin. Oncol

Rep, 2013. 29(4): p. 1333-42.

193. Abe, A., et al., The beta-carboline alkaloid harmol induces cell death via

autophagy but not apoptosis in human non-small cell lung cancer A549 cells.

Biol Pharm Bull, 2011. 34(8): p. 1264-72.

183

194. De Jesus-Cortes, H., et al., Neuroprotective efficacy of aminopropyl carbazoles

in a mouse model of Parkinson disease. Proc Natl Acad Sci U S A, 2012.

109(42): p. 17010-5.

195. Tesla, R., et al., Neuroprotective efficacy of aminopropyl carbazoles in a mouse

model of amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A, 2012.

109(42): p. 17016-21.

196. Dooley, K. and L.I. Zon, Zebrafish: a model system for the study of human

disease. Current opinion in genetics & development, 2000. 10(3): p. 252-6.

197. He, C. and D.J. Klionsky, Analyzing autophagy in zebrafish. Autophagy, 2010.

6(5).

198. Newman, M., I.F. Musgrave, and M. Lardelli, Alzheimer disease:

amyloidogenesis, the presenilins and animal models. Biochim Biophys Acta,

2007. 1772(3): p. 285-97.

199. Musa, A., H. Lehrach, and V.A. Russo, Distinct expression patterns of two

zebrafish homologues of the human APP gene during embryonic development.

Development genes and evolution, 2001. 211(11): p. 563-7.

200. Newman, M., et al., A zebrafish melanophore model of amyloid beta toxicity.

Zebrafish, 2010. 7(2): p. 155-9.

201. Dowling, J.J., et al., Zebrafish MTMR14 is required for excitation-contraction

coupling, developmental motor function and the regulation of autophagy.

Human molecular genetics, 2010. 19(13): p. 2668-81.

202. He, C., et al., Assaying autophagic activity in transgenic GFP-Lc3 and GFP-

Gabarap zebrafish embryos. Autophagy, 2009. 5(4): p. 520-6.

203. Eddins, D., et al., Nicotine effects on learning in zebrafish: the role of

dopaminergic systems. Psychopharmacology, 2009. 202(1-3): p. 103-9. 184

204. Gao, L., et al., Hypoxia increases Abeta-induced tau phosphorylation by calpain

and promotes behavioral consequences in AD transgenic mice. J Mol Neurosci,

2013. 51(1): p. 138-47.

205. Hauptmann, S., et al., Mitochondrial dysfunction: an early event in Alzheimer

pathology accumulates with age in AD transgenic mice. Neurobiol Aging, 2009.

30(10): p. 1574-86.

206. Mecocci, P., et al., Oxidative stress and dementia: new perspectives in AD

pathogenesis. Aging (Milano), 1997. 9(4 Suppl): p. 51-2.

207. Villemagne, V.L. and C.L. Masters, Alzheimer disease: the landscape of ageing-

-insights from AD imaging markers. Nat Rev Neurol, 2014. 10(12): p. 678-9.

208. Villeneuve, S., et al., Vascular risk and Abeta interact to reduce cortical

thickness in AD vulnerable brain regions. Neurology, 2014. 83(1): p. 40-7.

209. Yang, D.S., J.H. Lee, and R.A. Nixon, Monitoring autophagy in Alzheimer's

disease and related neurodegenerative diseases. Methods Enzymol, 2009. 453:

p. 111-44.

210. Ogata, M., et al., Autophagy is activated for cell survival after endoplasmic

reticulum stress. Mol Cell Biol, 2006. 26(24): p. 9220-31.

211. Gozuacik, D. and A. Kimchi, Autophagy as a cell death and tumor suppressor

mechanism. Oncogene, 2004. 23(16): p. 2891-906.

212. Heymann, D., Autophagy: A protective mechanism in response to stress and

inflammation. Curr Opin Investig Drugs, 2006. 7(5): p. 443-50.

213. Banerjee, R., M.F. Beal, and B. Thomas, Autophagy in neurodegenerative

disorders: pathogenic roles and therapeutic implications. Trends Neurosci,

2010. 33(12): p. 541-9.

185

214. Ghavami, S., et al., Autophagy and apoptosis dysfunction in neurodegenerative

disorders. Prog Neurobiol, 2014. 112: p. 24-49.

215. Xilouri, M. and L. Stefanis, Autophagy in the central nervous system:

implications for neurodegenerative disorders. CNS Neurol Disord Drug

Targets, 2010. 9(6): p. 701-19.

216. Wolfe, D.M., et al., Autophagy failure in Alzheimer's disease and the role of

defective lysosomal acidification. Eur J Neurosci, 2013. 37(12): p. 1949-61.

217. Rajawat, Y.S. and I. Bossis, Autophagy in aging and in neurodegenerative

disorders. Hormones (Athens), 2008. 7(1): p. 46-61.

218. Spitsbergen, J.M. and M.L. Kent, The state of the art of the zebrafish model for

toxicology and toxicologic pathology research--advantages and current

limitations. Toxicol Pathol, 2003. 31 Suppl: p. 62-87.

219. Hosseini, R., et al., Correlative light and electron microscopy imaging of

autophagy in a zebrafish infection model. Autophagy, 2014. 10(10): p. 1844-57.

220. He, C. and D.J. Klionsky, Analyzing autophagy in zebrafish. Autophagy, 2010.

6(5): p. 642-4.

221. Tanida, I., T. Ueno, and E. Kominami, LC3 and Autophagy. Methods Mol Biol,

2008. 445: p. 77-88.

222. Chikte, S., N. Panchal, and G. Warnes, Use of LysoTracker dyes: a flow

cytometric study of autophagy. Cytometry A, 2014. 85(2): p. 169-78.

223. Vazquez, C.L. and M.I. Colombo, Assays to assess autophagy induction and

fusion of autophagic vacuoles with a degradative compartment, using

monodansylcadaverine (MDC) and DQ-BSA. Methods Enzymol, 2009. 452: p.

85-95.

186

224. Siesjo, B.K., Mechanisms of ischemic brain damage. Crit Care Med, 1988.

16(10): p. 954-63.

225. Bickler, P.E. and B.M. Hansen, Causes of calcium accumulation in rat cortical

brain slices during hypoxia and ischemia: role of ion channels and membrane

damage. Brain Res, 1994. 665(2): p. 269-76.

226. Kristian, T. and B.K. Siesjo, Calcium in ischemic cell death. Stroke, 1998.

29(3): p. 705-18.

227. Zhang, C.E., et al., Hypoxia-induced tau phosphorylation and memory deficit in

rats. Neurodegener Dis, 2014. 14(3): p. 107-16.

228. Bellot, G., et al., Hypoxia-induced autophagy is mediated through hypoxia-

inducible factor induction of BNIP3 and BNIP3L via their BH3 domains. Mol

Cell Biol, 2009. 29(10): p. 2570-81.

229. Hu, Y.L., et al., Hypoxia-induced autophagy promotes tumor cell survival and

adaptation to antiangiogenic treatment in glioblastoma. Cancer Res, 2012.

72(7): p. 1773-83.

230. Mazure, N.M. and J. Pouyssegur, Hypoxia-induced autophagy: cell death or cell

survival? Curr Opin Cell Biol, 2010. 22(2): p. 177-80.

231. Moussavi Nik, S.H., et al., Alzheimer's disease-related peptide PS2V plays

ancient, conserved roles in suppression of the unfolded protein response under

hypoxia and stimulation of gamma-secretase activity. Hum Mol Genet, 2015.

232. Baulac, S., et al., Functional gamma-secretase complex assembly in

Golgi/trans-Golgi network: interactions among presenilin, nicastrin, Aph1, Pen-

2, and gamma-secretase substrates. Neurobiol Dis, 2003. 14(2): p. 194-204.

187

233. Sastre, M., et al., Presenilin-dependent gamma-secretase processing of beta-

amyloid precursor protein at a site corresponding to the S3 cleavage of Notch.

EMBO Rep, 2001. 2(9): p. 835-41.

234. Honda, T., et al., Familial Alzheimer's disease-associated mutations block

translocation of full-length presenilin 1 to the nuclear envelope. Neurosci Res,

2000. 37(2): p. 101-11.

235. Kim, S.D. and J. Kim, Sequence analyses of presenilin mutations linked to

familial Alzheimer's disease. Cell Stress Chaperones, 2008. 13(4): p. 401-12.

236. Murayama, O., et al., Enhancement of amyloid beta 42 secretion by 28 different

presenilin 1 mutations of familial Alzheimer's disease. Neurosci Lett, 1999.

265(1): p. 61-3.

237. Sudoh, S., et al., Presenilin 1 mutations linked to familial Alzheimer's disease

increase the intracellular levels of amyloid beta-protein 1-42 and its N-

terminally truncated variant(s) which are generated at distinct sites. J

Neurochem, 1998. 71(4): p. 1535-43.

238. Smolarkiewicz, M., T. Skrzypczak, and P. Wojtaszek, The very many faces of

presenilins and the gamma-secretase complex. Protoplasma, 2013. 250(5): p.

997-1011.

239. Mohuczy, D., K. Qian, and M.I. Phillips, Presenilins in the heart: presenilin-2

expression is increased by low glucose and by hypoxia in cardiac cells. Regul

Pept, 2002. 110(1): p. 1-7.

240. Area-Gomez, E., et al., Presenilins are enriched in endoplasmic reticulum

membranes associated with mitochondria. Am J Pathol, 2009. 175(5): p. 1810-

6.

188

241. Neely, K.M. and K.N. Green, Presenilins mediate efficient proteolysis via the

autophagosome-lysosome system. Autophagy, 2011. 7(6): p. 664-5.

242. Newman, M., et al., Differential, dominant activation and inhibition of Notch

signalling and APP cleavage by truncations of PSEN1 in human disease. Hum

Mol Genet, 2014. 23(3): p. 602-17.

243. Malhotra, J.D. and R.J. Kaufman, The endoplasmic reticulum and the unfolded

protein response. Semin Cell Dev Biol, 2007. 18(6): p. 716-31.

244. Dobeli, H., Rapid drug screening for Alzheimer's. Nat Biotechnol, 1997. 15(3):

p. 223-4.

245. Trinchese, F., et al., Cell cultures from animal models of Alzheimer's disease as

a tool for faster screening and testing of drug efficacy. J Mol Neurosci, 2004.

24(1): p. 15-21.

246. Lublin, A.L. and C.D. Link, Alzheimer's disease drug discovery: in vivo

screening using Caenorhabditis elegans as a model for beta-amyloid peptide-

induced toxicity. Drug Discov Today Technol, 2013. 10(1): p. e115-9.

247. Matveeva, I.A., [Action of dimebon on histamine receptors]. Farmakol

Toksikol, 1983. 46(4): p. 27-9.

248. Shelkovnikova, T.A., et al., [Study into molecular targets of a neuroprotective

compound dimebon using a transgenic mice line]. Biomed Khim, 2014. 60(3):

p. 354-63.

249. Moloudizargari, M., et al., Pharmacological and therapeutic effects of Peganum

harmala and its main alkaloids. Pharmacogn Rev, 2013. 7(14): p. 199-212.

250. Latchney, S.E., et al., Chronic P7C3 treatment restores hippocampal

neurogenesis. Neurosci Lett, 2015. 591C: p. 86-92.

189

251. Farkas, T., M. Hoyer-Hansen, and M. Jaattela, Identification of novel autophagy

regulators by a luciferase-based assay for the kinetics of autophagic flux.

Autophagy, 2009. 5(7): p. 1018-25.

252. Ju, J.S., et al., Quantitation of selective autophagic protein aggregate

degradation in vitro and in vivo using luciferase reporters. Autophagy, 2009.

5(4): p. 511-9.

253. Riley, B.E. and H.T. Orr, Polyglutamine neurodegenerative diseases and

regulation of transcription: assembling the puzzle. Genes Dev, 2006. 20(16): p.

2183-92.

254. Ravikumar, B., R. Duden, and D.C. Rubinsztein, Aggregate-prone proteins with

polyglutamine and polyalanine expansions are degraded by autophagy. Hum

Mol Genet, 2002. 11(9): p. 1107-17.

190

Appendix

Research Paper 6

Hypoxia alters expression of zebrafish microtubule-

associated protein (mapta, maptb) gene transcripts

191

Moussavi Nik et al. BMC Research Notes 2014, 7:767 http://www.biomedcentral.com/1756-0500/7/767

RESEARCH ARTICLE Open Access Hypoxia alters expression of Zebrafish Microtubule-associated protein Tau (mapta, maptb) gene transcripts Seyyed Hani Moussavi Nik1,6*, Morgan Newman1,6, Swamynathan Ganesan1,6, Mengqi Chen2, Ralph Martins2,3,4, Giuseppe Verdile2,3,4,5 and Michael Lardelli1,6

Abstract Background: Microtubule-associated protein tau (MAPT) is abundant in neurons and functions in assembly and stabilization of microtubules to maintain cytoskeletal structure. Human MAPT transcripts undergo alternative splicing to produce 3R and 4R isoforms normally present at approximately equal levels in the adult brain. Imbalance of the 3R-4R isoform ratio can affect microtubule binding and assembly and may promote tau hyperphosphorylation and neurofibrillary tangle formation as seen in neurodegenerative diseases such as frontotemporal dementia (FTD) and Alzheimer’s disease (AD). Conditions involving hypoxia such as cerebral ischemia and stroke can promote similar tau pathology but whether hypoxic conditions cause changes in MAPT isoform formation has not been widely explored. We previously identified two paralogues (co-orthologues) of MAPT in zebrafish, mapta and maptb. Results: In this study we assess the splicing of transcripts of these genes in adult zebrafish brain under hypoxic conditions. We find hypoxia causes increases in particular mapta and maptb transcript isoforms, particularly the 6R and 4R isoforms of mapta and maptb respectively. Expression of the zebrafish orthologue of human TRA2B, tra2b, that encodes a protein binding to MAPT transcripts and regulating splicing, was reduced under hypoxic conditions, similar to observations in AD brain. Conclusion: Overall, our findings indicate that hypoxia can alter splicing of zebrafish MAPT co-orthologues promoting formation of longer transcripts and possibly generating Mapt proteins more prone to hyperphosphorylation. This supports the use of zebrafish to provide insight into the mechanisms regulating MAPT transcript splicing under conditions that promote neuronal dysfunction and degeneration. Keywords: Microtubule-associated protein tau (MAPT), Alternative splicing, Alzheimer’sdisease,Hypoxia,Zebrafish

Background inclusion or exclusion of two regions of sequence near the The MICROTUBULE-ASSOCIATED PROTEIN TAU N-terminus and the possession of either three (3R) or four (MAPT) gene encodes the soluble tau protein that is (4R) repeat regions, (corresponding to the microtubule- abundant in neurons and functions to assemble and binding domains), towards the C-terminus of tau [2]. The stabilize microtubules to maintain cytoskeletal structure 3R isoform is generated from mRNAs lacking exon 10, [1]. As a result of alternative splicing of MAPT transcripts, while mRNAs containing exon 10 encode 4R tau. These six tau protein isoforms ranging from 352 to 441 amino isoforms are normally present at approximately equal acid residues in length are generated and expressed in levels in the adult human brain [3]. Changes in this the human brain. The isoforms differ by the regulated isoform ratio and post-translational modifications of the 3R and 4R isoforms affect microtubule binding and * Correspondence: [email protected] assembly [4,5]. 1Discipline of Genetics, School of Molecular and Biomedical Sciences, The Dysregulation of tau splicing is often observed in University of Adelaide, SA 5005 Adelaide, Australia neurodegenerative diseases with aberrant tau deposition, 6Zebrafish Genetics Laboratory, School of Molecular and, Biomedical Sciences, The University of Adelaide, Adelaide SA 5005, Australia including frontotemporal dementia (FTD), Pick disease Full list of author information is available at the end of the article

© 2014 Moussavi Nik et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Moussavi Nik et al. BMC Research Notes 2014, 7:767 Page 2 of 9 http://www.biomedcentral.com/1756-0500/7/767

(PiD), progressive supranuclear palsy (PSP) [6] and developing central nervous system [23]. (Teleosts appear Alzheimer’s disease (AD) [7]. Mutations reported in FTD to have undergone an additional round of genome dupli- cause aberrant exon 10 splicing, resulting in altered 4R/3R cation since their separation from the tetrapod lineage tau ratios [8,9]. In PSP, aggregates of 4R tau predominate, followed by loss of many of the duplicated genes [18]). whereas 3R isoforms are found in excess in Pick bodies Similar to human MAPT, a complex pattern of alternative in the majority of cases of PiD [10,11]. In AD brains, in- splicing of the mapta and maptb transcripts occurs. creases in 4R tau isoforms have been reported resulting Zebrafish mapta gives rise to transcripts encoding 4R-6R in altered 4R/3R tau ratios [12]. Neurofibrillary tangles isoforms, whereas maptb is predominantly expressed as a (NFTs), a major pathological hallmark of the AD brain, 3R isoform [23] (Figure 1) and is also alternatively spliced can result from the phosphorylation of 3R tau, 4R tau or to form a “big tau” isoform. In mammals “big tau” is both [13,14]. Thus, any alternations in the levels of these expressed in the peripheral nervous system and other isoforms could promote tangle formation and disease tissues [24-26] while in zebrafish we observed “big tau” progression. It should be noted that changes in tau expression (at 24 hours post fertilization, hpf) in the protein isoform ratios could result both from changes trigeminal ganglion and dorsal spinal cord neurons (pos- in the alternative splicing of transcripts and differential sibly dorsal sensory neurons) [23]. However, whether hyp- changes in the stability of their protein products. oxic conditions lead to changes in tau isoform expression Conditions such as cerebral ischemia and stroke that has not been widely explored in zebrafish. In the work result in hypoxic conditions in affected brain areas can described in this paper we extend our examination of promote tau hyperphosphorylation and formation of NFTs. expression of the zebrafish tau co-orthologues to study Acute hypoxic conditions have been shown to activate their response to actual hypoxia in adult fish brains and kinases that phosphorylate tau resulting in accumula- to chemical mimicry of hypoxia in explanted adult fish tion of phosphorylated tau in neurons [15]. In a rodent brains. We observe increases in the overall levels of both stroke model, hyperphosphorylated tau accumulated in mapta and maptb transcripts due to specific increases in neurons of the cerebral cortex in areas where ischemic the levels of mapta 6R and maptb 4R transcript isoforms. damage was prominent. This was associated with the up- This is consistent with dramatically decreased levels of regulation of the tau phosphorylating enzyme CdK5, and transcripts of the zebrafish orthologue of the human the consequent promotion of the formation of filaments TRA2B gene that codes for a splicing factor regulating similar to those present in human neurodegenerative alternative splicing of MAPT transcripts in human cells tauopathies [16]. It stands to reason that increases in tau [12]. We also observe an apparent increase under hyp- isoforms may also contribute to this process by increasing oxia in the levels of shorter transcripts of maptb relative the availability of the tau substrate to phosphorylating to “big tau” transcripts of this gene. Overall, our find- enzymes. ings indicate that hypoxia can alter splicing of zebrafish The zebrafish, Danio rerio, is an emerging model or- MAPT co-orthologues promoting formation of longer ganism for the study of neurodegenerative disease [17]. transcripts and possibly generating Mapt proteins more Zebrafish embryos represent normal collections of cells prone to hyperphosphorylation. This supports the use in which complex and subtle manipulations of gene of zebrafish to provide insight into the mechanisms activity can be performed to facilitate analyses of genes regulating MAPT transcript splicing under conditions involved in human disease. The zebrafish genome is that promote neuronal dysfunction and degeneration. extensively annotated and regions of conservation of chromosomal synteny between humans and zebrafish Results have been defined [18]. In many cases zebrafish genes To determine whether hypoxic conditions regulate alter- are identifiable that are clear orthologues of human genes. native splicing in MAPT co-orthologues in zebrafish, levels For example, the AD-relevant PRESENILIN genes (PSEN1 of mapta and maptb transcripts were assessed in adult and PSEN2) have zebrafish orthologues of psen1 [19] zebrafish brains under conditions of actual hypoxia or in and psen2 [20] respectively. Tau phosphorylation and explanted adult brains subjected to chemical mimicry of subsequent toxicity has been reported in zebrafish over- hypoxia caused by NaN3. expressing the FTD associated human tau mutation, In studies of hypoxia it is common to use chemical P301L [21,22]. However this model does not reflect the agents that can mimic (partially) hypoxic conditions pathology of other dementias such as AD where factors (also known as “chemical hypoxia”). Agents commonly that regulate levels of wild-type tau isoforms promote used are cobalt chloride (CoCl2), nickel chloride (NiCl2) hyper-phosphorylation and neurodegeneration. and NaN3. Azides, including NaN3,haveanactiononthe We have previously identified two paralogues (co-ortho- respiratory chain very similar to that of cyanide. We have logues) of MAPT in zebrafish, denoted mapta and maptb previously shown that exposure to aqueous solutions of and have shown that both genes are expressed in the NaN3 can induce hypoxia-like responses in zebrafish [27]. Moussavi Nik et al. BMC Research Notes 2014, 7:767 Page 3 of 9 http://www.biomedcentral.com/1756-0500/7/767

Figure 1 Splicing isoforms of mapta and maptb mRNA transcripts. Grey and white boxes indicate exons subject to alternative splicing. The black lines below exons indicate those encoding tubulin-binding motifs. Arrows indicate the approximate binding sites of primers used in qPCR analyses of splicing isoforms. (A) Exon structure of mapta.isoforms (B) Exon structure of maptb isoforms. Moussavi Nik et al. BMC Research Notes 2014, 7:767 Page 4 of 9 http://www.biomedcentral.com/1756-0500/7/767

Exposure of adult fish to hypoxia or exposure of explanted levels presumably indicating reduction in the splice- adult brains to chemical mimicry of hypoxia increases the regulating activity of Tra2b protein. We then examined overall expression of tau transcripts in zebrafish brains. whether the zebrafish mapta and maptb genes possess This was shown by qPCR measurement involving amplifi- potential Tra2b binding sites within exons encoding cation of exonic sequence included in all transcripts of tubulin-binding repeats and subject to alternative splicing. mapta or maptb (i.e. exon 6 of both genes – see Figure 2A Using the online software, ESE finder (http://genes.mit. and 2B). We also observed that the pattern of tau tran- edu/burgelab/rescue-ese/) [30], zebrafish sequences for script splicing differs between hypoxia-exposed brains and mapta exon 8 and maptb exon 9 were examined for puta- controls. In terms of contributing isoforms, expression of tive tra2b binding sites. We found multiple exonic splicing the mapta 6R isoform was significantly increased, while enhancers (ESEs) but, for each gene, only one appeared expression of the mapta 4R isoform showed a significant significantly similar to the human TRA2B-binding site decrease under hypoxia (Figure 2A). We also observed a (Figure 3). significantly increased level of expression of maptb 4R transcripts, while expression of maptb 3R transcripts also Discussion showed a significant decrease under hypoxia (Figure 2B). The human MAPT gene is located on chromosome 17 An increase in expression of maptb 4R but not 3R corre- and contains 16 exons. Alternative splicing of the primary sponds to an overall increase in the 4R/3R ratio of tau transcript leads to a family of mRNAs, encoding different transcripts (Figure 2B). protein isoforms. In adult human brain, six isoforms are In rats (and humans) Mapt exon 4a contains a large expressed, produced by alternative splicing of exons 2, 3, open reading frame. Inclusion of this exonic sequence in and 10. Tau isoforms in the CNS contain either three or MAPT mRNAs allows translation of “big tau” protein. four copies of a tandem repeat containing tubulin-binding Exon 3 of zebrafish maptb appears to be equivalent to sequences (encoded by exon 10), referred to as 3R and rat exon 4a in size although no sequence homology is 4R-tau [24]. Optional inclusion of exon 2, or exons 2 and observed. Like rat MAPT exon 4a, zebrafish maptb exon 3, gives rise to N-terminal inclusions of 29 or 58 amino 3 is subject to alternative splicing [23]. Therefore, we acid residues respectively [24]. performed qPCR to test whether this alternative spli- In this study we provide evidence that exposure to cing event is also influenced by hypoxic conditions. actual hypoxia and to chemical mimicry of hypoxia We observed that exclusion of exon 3 (here denoted as leads to overall increases in tau transcript levels and, maptb −3) from zebrafish maptb transcriptsissignifi- simultaneously, marked relative changes in the alterna- cantly increased under hypoxia and chemical mimicry tive splicing of tau transcripts in adult zebrafish brains. of hypoxia when compared with inclusion of exon 3 Our results revealed that exposure to acute levels of (here denoted as maptb +3)(Figure2C). actual hypoxia or chemical mimicry of hypoxia shifts In humans, differential splicing of MAPT transcripts in the production of the predominantly expressed 3R response to hypoxia can occur due to decreased binding transcript isoform of maptb towards formation of the of TRA2 protein to RNA [28]. The TRA2 gene is dupli- 4R isoform, thus altering the 3R to 4R ratio. The precise cated in vertebrates, resulting in two TRA2 proteins with regulation of the ratio of expression of 3R relative to 4R aprpoximately 63% amino acid residue identity in humans MAPT isoforms in human brain has been proposed to be [29]. These proteins are denoted TRA2A encoded by the critical for maintaining normal brain function [31]. The TRA2A gene and TRA2B protein encoded by the gene disruption of this balance has been found to be correlated TRA2B (also known as SFRS10). Nuclear magnetic res- with tauopathies [8,32]. We also observed a significant onance (NMR) analyses have recently shown that the increase in expression of the 6R transcript isoform of optimal core RNA target sequence for binding TRA2B zebrafish mapta relative to the mapta 4R transcript. protein is AGAA. Conrad et al. [12] observed AD-specific As far as the behavior in alternative splicing of exons changes in TRA2B expression, suggesting a potential coding for tubulin-binding domain sequences is concerned, mechanism for altered tau in AD. Suh et al. [28] also ob- our data are in agreement with those of Conrad et al.[12] served a decrease in mouse Tra2b expression leading to a and Ichihara et al. showing that, in AD brains, the expres- decrease in exon 10 exclusion and 3R-tau expression in sion level of exon 10 is altered [33]. cortical neurons after transient occlusion of the middle Imbalance of the 4R-3R tau isoform ratio has been ob- cerebral artery in mice. To examine whether this behavior served in tauopathies such as FTDP-17 [8], PSP [10], and is conserved for the zebrafish mapta and maptb genes we PiD [34]. An altered 4R-3R tau isoform ratio has also been first observed whether hypoxia alters expression of the reported in the spinal cord after sciatic nerve axotomy TRA2B orthologous gene, tra2b, in zebrafish brains. As [35]. Suh et al. [28] reported that cerebral ischemia shown in Figure 2D both actual hypoxia and chemical changes the ratio of 4R-3R tau mRNAs and protein levels mimicry of hypoxia lead to decreased tra2b transcript as well as causing tau hyperphosphorylation. Changes in Moussavi Nik et al. BMC Research Notes 2014, 7:767 Page 5 of 9 http://www.biomedcentral.com/1756-0500/7/767

Figure 2 (See legend on next page.) Moussavi Nik et al. BMC Research Notes 2014, 7:767 Page 6 of 9 http://www.biomedcentral.com/1756-0500/7/767

(See figure on previous page.) Figure 2 qPCR analyses of the expression of A) Measurement of mapta exon 6 levels gives the combined expression of all mapta transcripts in zebrafish brains. qPCRs to determine relative mapta 6R and 4R isoform levels show increased and decreased expression under hypoxia respectively. B) Measurement of maptb exon 6 levels gives the combined expression of all maptb transcripts in zebrafish brains. qPCRs to determine relative maptb 4R and 3R isoform levels show increased and decreased expression under hypoxia respectively. C) maptb +3 (“big tau”) is decreased relative to maptb −3 under hypoxia. D) tra2b transcript levels under normoxia are higher relative to those under hypoxia or chemical mimicry of hypoxia (sodium azide exposure). Expression ratios for mapta and maptb are shown relative to normoxia (the normoxia expression level is normalized to eef1a1l1). ***P ≤ 0.0001; **P ≤ 0.001; ****P ≤ 0.00001. Error bars represent standard error of the mean. tau isoform ratio and phosphorylation status can cause expressed in adult dorsal root ganglia (DRG) [24,40]. defects in the central nervous system by affecting “Big tau” is encoded by an 8 kb mRNA containing an microtubule dynamics and axonal transport resulting additional exon 4a that is not present in any other tau in neuronal loss [4]. Therefore, it is conceivable that an isoforms. “Big tau” expression is developmentally regu- alteration of tau isoform ratio and increased tau hyper- lated. It is expressed late in fetal life and its expression phosphorylation after brain ischemic insult may contrib- increases postnatally [24]. Its presence has been corre- ute to the prevalence of AD in stroke patients [36,37]. lated with increased neurite stability in adult DRG [40]. Exon 10 of the human MAPT gene, is flanked by a Several studies have investigated “big tau” expression in large intron 9 (13.6 kb) and intron 10 (3.8 kb), and has a non-neuronal tissues in AD patients but did not observe stem-loop structure which spans the 5′ splice sites, which any significant changes [25,26]. Chen et al. [23] described can sequester the 5′ splice site and leads to the use of al- an alternative splicing event involving maptb exon 3, ternative 5′ splice sites [38]. Thus exon 10 can be included which appears to be equivalent to human MAPT exon 4a. or skipped to produce tau proteins with or without exon In our experiments we observed that hypoxia significantly 10, depending on the action of trans-acting or cis-elements increases the level of maptb transcripts from which exon located in exon 10. Hutton M, 1998 [8] The pre-mRNA 3 sequence is excluded but does not appear to change splicing factor Tra2b was shown to promote MAPT exon levels of the “big tau” form of maptb transcripts. However, 10 splicing [39]. Levels of Tra2b protein were found to be we cannot exclude the possibility that this apparent reduced in AD brains [12]. Decreased levels of this spli- increase in maptb expression with decreased exon 3 inclu- cing factor were also observed by Suh et al. [28] in cortical sion may be due to increased expression of the shorter neurons and in mouse cerebral cortex following hypoxic- transcript isoform in cells that do not express big tau, ischemic injury. Thus, decreased Tra2b expression under rather than a change in the ratio of splicing to form hypoxia may contribute to a shift in 4R-3R tau isoform shorter transcript relative to “big tau” transcript within ratio by increasing incorporation of exon 10 into mature cells expressing both transcripts. MAPT mRNA. Consistent with this we detected putative Tra2b-binding sites in exon 8 of mapta and exon 9 of Conclusion maptb. We also saw decreased expression of tra2b mRNA Overall, our findings show that exposure of zebrafish under hypoxic conditions. brains to actual hypoxia or chemical mimicry of hypoxia High molecular weight (HMW) tau isoforms “big can produce changes in the expression ratio of different tau” have been detected in the neurons of the adult rat tau isoforms. These changes are similar to those observed peripheral nervous system (PNS), optic nerve, spinal in a number of neurodegenerative diseases and thus sup- cord, several neuronal cell lines including PC12 and port the use of zebrafish as a model for providing further neuroblastoma N115 [24] and non-neuronal tissues insight into the mechanisms underlying these disease [25,26]. “Big tau” appears to be the only tau isoform processes.

Figure 3 Sequences from human MAPT and zebrafish mapta and maptb were analysed for the presence of possible Tra2B binding sites using the online software ESE finder (http://genes.mit.edu/burgelab/rescue-ese/). Bold, underlined letters are putative Tra2b-binding sites. Moussavi Nik et al. BMC Research Notes 2014, 7:767 Page 7 of 9 http://www.biomedcentral.com/1756-0500/7/767

Methods were exposed to actual hypoxia for 3 hours. Briefly, after Ethics each hypoxia trial, the animals were euthanized by This work was conducted under the auspices of The hypothermic shock and then decapitated to remove the Animal Ethics Committee of The University of Adelaide brain. Total RNA was extracted from samples mentioned and in accordance with EC Directive 86/609/EEC for above using the QIAGEN RNeasy mini kit (QIAGEN, animal experiments and the Uniform Requirements for GmbH, Hilden, Germany) and stored at −80°C for further Manuscripts Submitted to Biomedical Journals. analysis. RNA concentration was determined with a NanoVue™ UV–vis spectrophotometer (GE Healthcare Zebrafish husbandry and experimental procedures Life Sciences, Fairfield, USA). To insure quality of RNA, Danio rerio were bred and maintained at 28°C on a 14 h RNA samples were electrophoresed on 1% TBE agarose light/10 h dark cycle [41]. Adult zebrafish (AB strain) at gels. 700 ng of total RNA were used to synthesize 25 μLof approximately 1 year of age were used for all experiments first-strand cDNA by reverse transcription (SuperScript® (n = 12). Fish for analysis were not selected on the basis of ΙΙΙ First-Strand DNA synthesis kit; Invitrogen, Camarillo, sex. For chemical mimicry of hypoxia adult explant brain USA). tissue was exposed to 100 μM of sodium azide (NaN3, Sigma-Aldrich CHEMIE Gmbh, Steinheim, Germany) in Quantitative real-time PCR for detection DMEM medium for 3 hours. Untreated adult zebrafish The relative standard curve method for quantification was brain explants that were dissected from zebrafish in the used to determine the expression of experimental samples same way as for the treated adult zebrafish brains were compared to a basis sample. For experimental samples, used as in vitro controls. In the experiments conducted target quantity was determined from the standard curve under low oxygen conditions, oxygen was depleted by and then compared to the basis sample to determine fold bubbling nitrogen gas through the medium. Oxygen con- changes in expression. Gene-specific primers were designed centrations were then measured using a dissolved oxygen for amplification of target cDNA and the cDNA from the meter (DO 6+, EUTECH instruments, Singapore). The ubiquitously expressed control gene eef1a1a. The reaction dissolved oxygen level in the actual hypoxia group was mixture consisted of 50 ng/μlofcDNA,18μMofforward measured to be 1.15 ± 0.6 mg/l; whereas the normal ambi- and reverse primers and Power SYBR green master mix ent oxygen level was 6.6 ± 0.45 mg/l [27,42]. Zebrafish PCR solution (Applied Biosystems, Warrington, UK).

Table 1 Gene specific primers used for qPCR Gene/transcript isoform Accession number Sequence Amplicon size eef1a1l1 (F) NM_131263.1 5′-CTGGAGGCCAGCTCAAACAT-3′ 87 bp eef1a1l1 (R) 5′-ATCAAGAAGAGTAGTACCGCTAGC-3′ tra2b (F) NM_201197 5′-GCAGACGACATATTGGTGACC-3′ 155 bp tra2b (R) 5′-TGACTGCTGGTCGTACACAATG-3′ maptb 4R (F) XM_005171601 5′-AAGATCGGCTCCACTGAGAACC-3′ 194 bp maptb 4R (R) 5′-GATCCAACCTTTGACTGGGCTT-3′ maptb 3R (F) XM_005171601 5′-GGGAAGGGGTGGAAATGTC-3′ 140 bp maptb 3R (R) 5′-GATCCAACCTTTGACTGGGCTT-3′ mapta 6R (F) XM_001340530 5′-TCGTCACAAACCAGGTGGAG-3′ 152 bp mapta 6R (R) 5′-GCTCACGGAACGTCAGTTTG-3′ mapta 4R (F) XM_001340530 5′-CGGAGGTGGAAAATTGAGTCAC-3′ 100 bp mapta 4R (F) 5′-CTCCTCCAGGGACACAATTTCT-3′ maptb −3 (F) XM_005171601 5′-GAAGCCAAGGCTGGAGCA-3′ 120 bp maptb −3 (R) 5′-CTGGGGATGCCTGTGACTGA-3′ maptb +3 (F) XM_005171601 5′-CCGGCAACAACATAGCATCTG-3′ 140 bp maptb +3 (R) 5′-CACCGGGAGTGAATGTGGC-3′ mapta Ex.6 (F) XM_001340530 5′-CCTAAATCTCCTGCCAGCAAG-3′ 117 bp mapta Ex.6 (R) 5′-TGTGGGCGAACGGTTCTT-3′ maptb Ex.6 (F) XM_005171601 5′-CAAATCACCTGGCTCGCTG-3′ 114 bp maptb Ex.6(R) 5′-GGTTGGTGTTTGAGGTTCTCAGTG-3′ Moussavi Nik et al. BMC Research Notes 2014, 7:767 Page 8 of 9 http://www.biomedcentral.com/1756-0500/7/767

To generate the standard curve cDNA was serially 4McCusker Alzheimer’s Disease Research Foundation, Hollywood Private 5 diluted (100 ng, 50 ng, 25 ng, 12.5 ng). Each sample Hospital, Perth, WA, Australia. School of Biomedical Sciences, Faculty of Health Sciences, Curtin University, Bentley, WA, Australia. 6Zebrafish Genetics and standard curve reaction was performed in triplicate Laboratory, School of Molecular and, Biomedical Sciences, The University of for the control gene and experimental genes. Amplifica- Adelaide, Adelaide SA 5005, Australia. tion conditions were 2 min at 50°C followed by 10 min at – Received: 29 April 2014 Accepted: 14 October 2014 95°C and then 40 45 cycles of 15 s at 95°C and 1 min at Published: 31 October 2014 60°C. Amplification was performed on an ABI 7000 Se- quence Detection System (Applied Biosystems) using 96 well plates. Cycle thresholds obtained from each triplicate References 1. Bowen DM, Smith CB, White P, Davison AN: Neurotransmitter-related were averaged and normalized against the expression of enzymes and indices of hypoxia in senile dementia and other eef1a1l1, which has previously been demonstrated to show abiotrophies. Brain 1976, 99:459–496. unchanged levels of expression under hypoxia in embryos 2. Johnson GV, Jenkins SM: Tau protein in normal and Alzheimer’s disease brain. J Alzheimers Dis 1999, 1:307–328. at 6, 12, 48 and 72 hpf and in adult gills [43]. Each experi- 3. Kosik KS, Crandall JE, Mufson EJ, Neve RL: Tau in situ hybridization in mental sample was then compared to the basis sample to normal and Alzheimer brain: localization in the somatodendritic determine the fold change of expression. The primers compartment. Ann Neurol 1989, 26:352–361. 4. Bunker JM, Wilson L, Jordan MA, Feinstein SC: Modulation of microtubule used for quantitative real-time PCR analysis of relative dynamics by tau in living cells: implications for development and zebrafish mapta/b mRNA levels are shown in Table 1. To neurodegeneration. Mol Biol Cell 2004, 15:2720–2728. reduce possible interference from unspliced RNA and/or 5. Han D, Qureshi HY, Lu Y, Paudel HK: Familial FTDP-17 missense mutations inhibit microtubule assembly-promoting activity of tau by increasing contaminating genomic DNA primers were designed to phosphorylation at Ser202 in vitro. J Biol Chem 2009, 284:13422–13433. bind in cDNA over exon-exon boundaries. All qPCRs 6. Brandt R, Hundelt M, Shahani N: Tau alteration and neuronal were performed according to MIQE guidelines [44]. degeneration in tauopathies: mechanisms and models. Biochim Biophys Acta 2005, 1739:331–354. 7. Yasojima K, McGeer EG, McGeer PL: Tangled areas of Alzheimer brain have Statistical analysis of data upregulated levels of exon 10 containing tau mRNA. Brain Res 1999, Means and standard deviations were calculated for all 831:301–305. 8. Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, Pickering-Brown variables using conventional methods. Two-way ANOVA S, Chakraverty S, Isaacs A, Grover A, Hackett J, Adamson J, Lincoln S, Dickson D, was used to evaluate significant differences between Davies P, Petersen RC, Stevens M, de Graaff E, Wauters E, van Baren J, Hillebrand normoxia and samples from actual hypoxia or chemical M, Joosse M, Kwon JM, Nowotny P, Che LK, Norton J, Morris JC, Reed LA, p- Trojanowski J, Basun H, et al: Association of missense and 5′-splice-site mimicry of hypoxia. Valuesareshowninthefigure mutations in tau with the inherited dementia FTDP-17. Nature 1998, legends, a criterion alpha level of P < 0.05 was used for all 393:702–705. statistical comparisons. All qPCR assays were done in 9. Liu F, Gong CX: Tau exon 10 alternative splicing and tauopathies. Mol Neurodegener 2008, 3:8. three biological replicates with three qPCRs per biological 10. Sergeant N, Wattez A, Delacourte A: Neurofibrillary degeneration in replicate). All the data were analysed using GraphPad progressive supranuclear palsy and corticobasal degeneration: tau Prism version 6.0 (GraphPad Prism, La Jolla, CA). pathologies with exclusively “exon 10” isoforms. J Neurochem 1999, 72:1243–1249. Competing interests 11. de Silva R, Lashley T, Strand C, Shiarli AM, Shi J, Tian J, Bailey KL, Davies P, Bigio The authors declare that they have no competing interests. EH, Arima K, Iseki E, Murayama S, Kretzschmar H, Neumann M, Lippa C, Halliday G, MacKenzie J, Ravid R, Dickson D, Wszolek Z, Iwatsubo T, Pickering-Brown Authors’ contributions SM,HoltonJ,LeesA,ReveszT,MannDM:An immunohistochemical study of SHMN completed experiments, participated in the design of the study and cases of sporadic and inherited frontotemporal lobar degeneration using data analysis and drafted the manuscript. MN participated in the design of 3R- and 4R-specific tau monoclonal antibodies. Acta Neuropathol 2006, the study and revisions of the manuscript. SG completed experiments. MC 111:329–340. participated in revision of the manuscript. RM participated in the revision of 12. Conrad C, Zhu J, Conrad C, Schoenfeld D, Fang Z, Ingelsson M, Stamm S, the manuscript. GV participated in the design of the study and the revision Church G, Hyman BT: Single molecule profiling of tau gene expression in of the manuscript. ML predominantly designed the study and revised the Alzheimer’s disease. J Neurochem 2007, 103:1228–1236. manuscript. All authors read and approved the final manuscript. 13. Espinoza M, de Silva R, Dickson DW, Davies P: Differential incorporation of tau isoforms in Alzheimer’s disease. J Alzheimers Dis 2008, 14:1–16. Acknowledgements 14. Togo T, Akiyama H, Iseki E, Uchikado H, Kondo H, Ikeda K, Tsuchiya K, de This work was supported by funds from the School of Molecular and Silva R, Lees A, Kosaka K: Immunohistochemical study of tau accumulation Biomedical Science at The University of Adelaide and by a Strategic Research in early stages of Alzheimer-type neurofibrillary lesions. Acta Neuropathol Grant from Edith Cowan University. RM and GV are supported by grants 2004, 107:504–508. from the McCusker Alzheimer’s Disease Research Foundation and NHMRC. 15. Chen GJ, Xu J, Lahousse SA, Caggiano NL, de la Monte SM: Transient MC is supported by a scholarship form the West Perth Rotary Club and the hypoxia causes Alzheimer-type molecular and biochemical abnormalities McCusker Alzheimer’s Disease Research Foundation. MV was generously in cortical neurons: potential strategies for neuroprotection. J Alzheimers supported by the family of Lindsay Carthew. Dis 2003, 5:209–228. 16. Wen Y, Yang SH, Liu R, Perez EJ, Brun-Zinkernagel AM, Koulen P, Simpkins Author details JW: Cdk5 is involved in NFT-like tauopathy induced by transient cerebral 1Discipline of Genetics, School of Molecular and Biomedical Sciences, The ischemia in female rats. Biochim Biophys Acta 2007, 1772:473–483. University of Adelaide, SA 5005 Adelaide, Australia. 2Centre of Excellence for 17. Newman M, Verdile G, Martins RN, Lardelli M: Zebrafish as a tool in Alzheimer’s disease Research and Care, School of Medical Sciences, Edith Alzheimer’s disease research. Biochim Biophys Acta 2011, 1812:346–352. Cowan University, Joondalup, WA, Australia. 3School of Psychiatry and 18. Catchen JM, Braasch I, Postlethwait JH: Conserved synteny and the Clinical Neurosciences, University of Western Australia, Crawley, WA, Australia. zebrafish genome. Methods Cell Biol 2011, 104:259–285. Moussavi Nik et al. BMC Research Notes 2014, 7:767 Page 9 of 9 http://www.biomedcentral.com/1756-0500/7/767

19. Leimer U, Lun K, Romig H, Walter J, Grunberg J, Brand M, Haass C: Zebrafish 40. Boyne LJ, Tessler A, Murray M, Fischer I: Distribution of Big tau in the (Danio rerio) presenilin promotes aberrant amyloid beta-peptide production central nervous system of the adult and developing rat. J Comp Neurol and requires a critical aspartate residue for its function in amyloidogenesis. 1995, 358:279–293. Biochemistry 1999, 38:13602–13609. 41. Westerfield M: The zebrafish book. A guide for the laboratory use of zebrafish 20. Groth C, Nornes S, McCarty R, Tamme R, Lardelli M: Identification of a (Danio rerio). 5th edition. University of Oregon Press; 2007. second presenilin gene in zebrafish with similarity to the human 42. Moussavi Nik SH, Croft K, Mori TA, Lardelli M: The comparison of methods Alzheimer’s disease gene presenilin2. Dev Genes Evol 2002, 212:486–490. for measuring oxidative stress in zebrafish brains. Zebrafish 2014, 21. Paquet D, Bhat R, Sydow A, Mandelkow EM, Berg S, Hellberg S, Falting J, 11:248–254. Distel M, Koster RW, Schmid B, Haass C: A zebrafish model of tauopathy 43. Tang R, Dodd A, Lai D, McNabb WC, Love DR: Validation of zebrafish allows in vivo imaging of neuronal cell death and drug evaluation. J Clin (Danio rerio) reference genes for quantitative real-time RT-PCR Invest 2009, 119:1382–1395. normalization. Acta Biochim Biophys Sin (Shanghai) 2007, 39:384–390. 22. Giustiniani J, Chambraud B, Sardin E, Dounane O, Guillemeau K, Nakatani H, 44. Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Paquet D, Kamah A, Landrieu I, Lippens G, Baulieu EE, Tawk M: Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT: The MIQE Immunophilin FKBP52 induces Tau-P301L filamentous assembly in vitro guidelines: minimum information for publication of quantitative and modulates its activity in a model of tauopathy. Proc Natl Acad Sci real-time PCR experiments. Clin Chem 2009, 55:611–622. USA2014, 111:4584–4589. 23. Chen M, Martins RN, Lardelli M: Complex splicing and neural expression of doi:10.1186/1756-0500-7-767 duplicated tau genes in zebrafish embryos. J Alzheimers Dis 2009, 18:305–317. Cite this article as: Moussavi Nik et al.: Hypoxia alters expression of 24. Goedert M, Wischik CM, Crowther RA, Walker JE, Klug A: Cloning and Zebrafish Microtubule-associated protein Tau (mapta, maptb) gene sequencing of the cDNA encoding a core protein of the paired helical transcripts. BMC Research Notes 2014 7:767. filament of Alzheimer disease: identification as the microtubule-associated protein tau. Proc Natl Acad Sci U S A 1988, 85:4051–4055. 25. Hattori H, Matsumoto M, Iwai K, Tsuchiya H, Miyauchi E, Takasaki M, Kamino K, Munehira J, Kimura Y, Kawanishi K, Hoshino T, Murai H, Ogata H, Maruyama H, Yoshida H: The tau protein of oral epithelium increases in Alzheimer’s disease. J Gerontol A Biol Sci Med Sci 2002, 57:M64–M70. 26. Ingelson M, Vanmechelen E, Lannfelt L: Microtubule-associated protein tau in human fibroblasts with the Swedish Alzheimer mutation. Neurosci Lett 1996, 220:9–12. 27. Moussavi Nik SH, Newman M, Lardelli M: The response of HMGA1 to changes in oxygen availability is evolutionarily conserved. Exp Cell Res 2011, 317:1503–1512. 28. Suh J, Im DS, Moon GJ, Ryu KS, de Silva R, Choi IS, Lees AJ, Guenette SY, Tanzi RE, Gwag BJ: Hypoxic ischemia and proteasome dysfunction alter tau isoform ratio by inhibiting exon 10 splicing. JNeurochem2010, 114:160–170. 29. Tacke R, Tohyama M, Ogawa S, Manley JL: Human Tra2 proteins are sequence-specific activators of pre-mRNA splicing. Cell 1998, 93:139–148. 30. Fairbrother WG, Yeh RF, Sharp PA, Burge CB: Predictive identification of exonic splicing enhancers in human genes. Science 2002, 297:1007–1013. 31. Chen S, Townsend K, Goldberg TE, Davies P, Conejero-Goldberg C: MAPT isoforms: differential transcriptional profiles related to 3R and 4R splice variants. J Alzheimers Dis 2010, 22:1313–1329. 32. Spillantini MG, Murrell JR, Goedert M, Farlow MR, Klug A, Ghetti B: Mutation in the tau gene in familial multiple system tauopathy with presenile dementia. Proc Natl Acad Sci U S A 1998, 95:7737–7741. 33. Ichihara K, Uchihara T, Nakamura A, Suzuki Y, Mizutani T: Selective deposition of 4-repeat tau in cerebral infarcts. J Neuropathol Exp Neurol 2009, 68:1029–1036. 34. de Silva R, Lashley T, Gibb G, Hanger D, Hope A, Reid A, Bandopadhyay R, Utton M, Strand C, Jowett T, Khan N, Anderton B, Wood N, Holton J, Revesz T, Lees A: Pathological inclusion bodies in tauopathies contain distinct complements of tau with three or four microtubule-binding repeat domains as demonstrated by new specific monoclonal antibodies. Neuropathol Appl Neurobiol 2003, 29:288–302. 35. Chambers CB, Muma NA: Neuronal gene expression in aluminum-induced neurofibrillary pathology: an in situ hybridization study. Neurotoxicology 1997, 18:77–88. 36. Tatemichi TK, Desmond DW, Mayeux R, Paik M, Stern Y, Sano M, Remien RH, Submit your next manuscript to BioMed Central Williams JB, Mohr JP, Hauser WA, Figueroa M: Dementia after stroke: and take full advantage of: baseline frequency, risks, and clinical features in a hospitalized cohort. Neurology 1992, 42:1185–1193. • Convenient online submission 37. Guglielmotto M, Tamagno E, Danni O: Oxidative stress and hypoxia contribute to Alzheimer’s disease pathogenesis: two sides of the same • Thorough peer review – coin. ScientificWorldJournal 2009, 9:781 791. • No space constraints or color figure charges 38. Eperon LP, Graham IR, Griffiths AD, Eperon IC: Effects of RNA secondary structure on alternative splicing of pre-mRNA: is folding limited to a • Immediate publication on acceptance region behind the transcribing RNA polymerase? Cell 1988, 54:393–401. • Inclusion in PubMed, CAS, Scopus and Google Scholar 39. Kondo S, Yamamoto N, Murakami T, Okumura M, Mayeda A, Imaizumi K: • Research which is freely available for redistribution Tra2 beta, SF2/ASF and SRp30c modulate the function of an exonic splicing enhancer in exon 10 of tau pre-mRNA. Genes Cells 2004, 9:121–130. Submit your manuscript at www.biomedcentral.com/submit