Innate Immune Reconstitution in the Humanized Bone

Innate Immune Reconstitution in the Humanized Bone Marrow-Liver-Thymus (HuBLT) Mouse Model Is Essential for Adaptive Immune Responses to HIV-1 Infection and Can Be Enhanced via AAV- Mediated Human Cytokine Delivery

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Garcia Beltran, Wilfredo F. 2018. Innate Immune Reconstitution in the Humanized Bone Marrow-Liver-Thymus (HuBLT) Mouse Model Is Essential for Adaptive Immune Responses to HIV-1 Infection and Can Be Enhanced via AAV-Mediated Human Cytokine Delivery. Doctoral dissertation, Harvard Medical School.

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:36923349

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA

Innate immune reconstitution in the humanized bone marrow-liver-thymus

(HuBLT) mouse model is essential for adaptive immune responses to HIV-1 infection and can be enhanced via AAV-mediated human cytokine delivery

Wilfredo F. Garcia Beltran

Submitted in Partial Fulfillment of the Requirements for the M.D. Degree

with Honors in a Special Field

Harvard Medical School

Boston, Massachusetts

March 2018

Supervisor: Alejandro Balazs, PhD Wilfredo F. Garcia Beltran

Innate immune reconstitution in the humanized bone marrow-liver-thymus

(HuBLT) mouse model is essential for adaptive immune responses to HIV-1

infection and can be enhanced via AAV-mediated human cytokine delivery

SUMMARY

BACKGROUND: Mice harboring a human immune system (a.k.a. “humanized” mice) are a revolutionary small-animal model consisting of a human-to-mouse hematopoietic xenograft that allows for the scientific and clinical study of human immune development and function, therapeutic agents, vaccines, and pathogens. In particular, it has served as an exceptional model of infection with human immunodeficiency virus type 1 (HIV-1), a human-restricted pathogen whose closest animal model is non-human primates infected with simian immunodeficiency virus (SIV). Of the existing humanized mouse models, humanized bone marrow-liver-thymus (HuBLT) mice are considered one of the most advanced, as they uniquely harbor development of human T cells in vivo in an autologous human thymic graft. Several groups have shown that HuBLT mice recapitulate many aspects of acute and chronic HIV-1 infection, and have greatly aided in advancing research focused on areas such as antiretroviral therapy, broadly neutralizing antibodies, viral evolution, and vaccine development. However, HuBLT mice challenged with HIV-1 exhibit variability in human immune responses across and within groups of engrafted mice, hindering our ability to confidently detect HIV-1– specific responses or vaccine effects in small cohorts of mice. To understand the phenomena underlying this variability, we comprehensively analyzed T-cell

iii

development, diversity, and priming in HuBLT mice to identify any model-intrinsic defects that could be corrected.

METHODS AND RESULTS: Through the use of TCR sequencing, flow cytometric analyses, and cellular immunological assays, we found that while T-cell diversity generation, thymic development, and subset frequencies were grossly intact, there was a major defect in T-cell priming and function. This defect correlated with poor innate immune reconstitution in HuBLT mice. We found that while almost all HuBLT mice reconstituted well with CD4+ and CD8+ T cells, only the few mice that reconstituted a substantial amount of monocytes (≥1% CD14+ cells of human CD45+ cells) had robust

CD4+ and CD8+ T-cell responses and responded appropriately during acute HIV-1 infection, as determined by CD4+ T-cell decline and CD8+ T-cell activation, expansion, and differentiation. This suggested that T-cell priming in the HuBLT mice was exquisitely sensitive to the presence and frequency of innate immune cells (e.g. monocytes) that serve as antigen-presenting cells. Thus, deficient innate immune reconstitution was found to be a key contributor to the variability of anti-HIV-1 immune responses seen in HuBLT mice studies.

Given that sub-optimal innate immune reconstitution was the major barrier to proper immune response priming in HuBLT mice, we sought to correct this. Several studies have postulated that lack of cross-reactivity between human and mouse cytokines and growth factors involved in hematopoiesis hinder myelopoiesis more than lymphopoiesis in humanized mouse models. Investigators have made efforts to overcome this by exogenous administration, hydrodynamic transfection, or genetic engineering of mouse strains to supply these human factors. As these cytokine-enhancement modalities are

expensive, cumbersome, and/or time-intensive, we developed an in-vivo transduction strategy using adeno-associated virus (AAV) vectors. We generated a library of AAVs encoding a multitude of different human cytokines (AAV-hCYTs) that can be delivered in a single administration to humanized mice (singly or in cocktails) to provide tunable, long-lasting expression of any protein(s) of interest, which we refer to as ‘AAV-mediated cytokine enhancement’ (ACE). This allowed us to test different human cytokines at specific doses and assess their effect on the engraftment and functionality of different human immune cell subsets, which we characterized by flow cytometric analysis of peripheral blood and tissues (i.e. spleen) as well as multiplexed ELISAs (i.e. Luminex) of human cytokines in mouse plasma.

Single AAV-hCYTs in HuBLT mice showed that permanent perturbations of the human immune system were possible. For example, IL-15 expanded NK cells; IL-2 increased

+ + – Tregs (CD4 CD25 CD127 T cells) and NK cells; and GM-CSF increased the frequency

+ – of classical (CD14 CD16 ) monocytes, Tregs, and memory T-cell subsets, which were paralleled by increases in corresponding plasma cytokines (e.g. CCL2, IL-10, and

CCL4). Given these results, we generated HuBLT mice expressing cocktails of AAV- hCYTs. While some cocktails were resulted in morbidity due to immune over-activation and cytokine storm, others showed remarkable improvements in innate immune reconstitution and adaptive immune function. For example, mice expressing AAV- delivered SCF, GM-CSF, and IL-3 had increased frequencies of myeloid-origin innate immune cells (CD11c+ cells) in peripheral blood, which was associated with increased frequencies of memory T-cell subsets and Tregs. These mice also exhibited increased plasma levels of IgG1 and IgG3 (~50-fold and ~2.8-fold more, respectively), indicating a

positive effect on B-cell function. In addition, HIV-1 infection of these mice showed more consistent and uniform viremia kinetics. These data thus show ACE can overcome model-intrinsic limitations and improve human engraftment and immune responses in

HuBLT mice.

CONCLUSION: While further efforts to generate personalized AAV cocktails for manipulation of human immune reconstitution and function in HuBLT mice are ongoing, it is clear that AAV-mediated delivery of human cytokines are an efficient way to generate a more optimal humanized mouse model. Given its flexibility, tunability, and portability, we believe the ACE platform can aid in exploring different facets of in-vivo human immunology and anti-viral immune responses in ways that were not previously possible.

TABLE OF CONTENTS

SUMMARY ...... iii

TABLE OF CONTENTS ...... vii

ACKNOWLEDGEMENTS ...... x

FIGURES, TABLES, AND ILLUSTRATIONS ...... xii

ABBREVIATIONS ...... xiv

INTRODUCTION ...... 15

Animal models of HIV-1 infection ...... 15

Humanized mouse models...... 17

HuBLT mouse model ...... 18

Study aims ...... 20

METHODS ...... 21

Generation and use of HuBLT mice ...... 21

Flow cytometric analysis of leukocytes from peripheral blood and tissue ...... 21

TCR-CDR3β sequencing ...... 23

Histology ...... 24

AAV human cytokine library generation ...... 24

Plasma cytokine and immunoglobulin quantification ...... 26

Leukocyte stimulations for functional assessment ...... 26

vii

RESULTS – PART 1: COMPREHENSIVE ASSESSMENT OF T CELLS IN HuBLT

MICE ...... 27

T-cell development is intact...... 27

Thymopoiesis ...... 27

Repertoire diversity ...... 29

T-cell subsets ...... 31

T-cell function is defective ...... 33

Impaired T-cell responses to HIV-1 infection correlate to deficient and variable innate

immune reconstitution ...... 36

HuBLT mice sufficiently reconstituted with myeloid innate immune cells exhibit robust

T-cell responses to HIV-1 infection ...... 38

RESULTS – PART 2: ENHANCEMENT OF HuBLT MICE VIA AAV-MEDIATED HUMAN

CYTOKINE DELIVERY ...... 42

AAV-delivered human cytokine genes are stably expressed in a dose-dependent

manner ...... 42

Individual AAV-hCYTs cause permanent alterations to the human immune system .. 46

AAV-hCYT cocktail of SCF, IL-3, and GM-CSF induces myeloid expansion and

enhances adaptive immune function ...... 58

DISCUSSION ...... 62

Innate immunity is critical to eliciting adaptive immunity ...... 63

Human-mouse incompatibilities ...... 64

viii

Non-AAV-based efforts to enhance engraftment in humanized mice ...... 65

AAV-mediated transduction offers a tunable, portable, and flexible platform for

manipulating the human immune system in HuBLT mice ...... 67

Future applications of ACE HuBLT mice ...... 68

REFERENCES ...... 70

ACKNOWLEDGEMENTS

This work was an extensively collaborative project that began in 2012 and undertook many phases that overlapped the laboratories of Marcus Altfeld, MD, PhD;

Todd Allen, PhD; the late Andrew Tager, MD, PhD, who is sorely missed; and Alejandro

Balazs, PhD, all of whom served as wonderful mentors and who without this project would not be possible.

Nonetheless, the two individuals that most heavily invested time, effort, resources, and mind power into this project were Alejandro Balazs, Assistant Professor at Harvard Medical School, and Vladimir (“Vlad”) Vrbanac, Co-Director of the Human

Immune System Mouse Program. Vlad, who is trained as a veterinarian and has adept surgical skills, is the creator of HuBLT mice in the Ragon Institute of MGH, MIT, and

Harvard. To the best of my knowledge, he produces the largest batches of HuBLT mice in the world. I thank him for his priceless contributions to this project since it first started, and I am also very fond of our friendship. Dr. Balazs, who skillfully developed an AAV- based gene therapy platform that I believe is and will continue transforming basic science and clinical research with wide-ranging applications, was a phenomenal collaborator that generously offered his “game-changing” AAV platform as a means to manipulate humanized mice and has now become a wonderful mentor at a professional and personal level.

Furthermore, I also owe great gratitude to Dr. Todd Allen, who mentored me informally during my PhD and provided invaluable input and resources that allowed this project to be possible. I am also thankful to Colby Maldini, a technician in who operated at the level of a peer graduate student and with whom I “teamed up” to comprehensively

analyze T cells in HuBLT mice. Daniel Claiborne, a post-doctoral fellow, has carried out superhuman efforts to reconfirm the findings of this study in large cohorts of mice, and I am always grateful for our thought-provoking scientific discussions and friendship. Also special thanks to Karen Powers for teaching me 454 pyrosequencing and performing virus sequencing, Marshall Karpell for many productive discussions and experiments together, Pedro Lamothe for fun collaborative projects applying the techniques developed in this study in other settings, and Maud Deruaz for sharing her over- abundant expertise on humanized mouse model immunology.

A very special thanks to Christopher Bullock for producing and purifying all AAV constructs used in this study. His dedication and precision is greatly appreciated.

This work would not be possible without funding sources. I and/or the projects described were supported by the National Institute of General Medical Sciences

(T32GM007753), the National Institute of Health (P01-AI104715, F31AI116366), and the Ragon Institute of MGH, MIT and Harvard. The content in this body of work is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of General Medical Sciences or the National Institutes of Health.

I would also like to thank all tissue donors. It is a great honor to be carrying out this work, which has the potential to one day contribute to the health and lives of countless patients in the future.

And last, but by no means least, I would like to thank my family and friends for supporting me in everything I do, and God for blessing me with these individuals and giving me the privilege to work in what I love.

FIGURES, TABLES, AND ILLUSTRATIONS

Illustration 1: Immune response to HIV-1.

Illustration 2: Humanization strategies in immunodeficient mice.

Illustration 3: T-cell development and function in HuBLT mice.

Table 1: Flow cytometry antibodies used for comprehensive phenotypic assessment of human leukocytes.

Figure 1: Thymic organoids in HuBLT mice support thymopoiesis.

Figure 2: HuBLT mice T-cell diversity is comparable, if not greater, than that of adult humans. Figure 3: CD4/CD8 ratios are high in HuBLT mice.

Figure 4: Naïve and memory T-cell frequencies in HuBLT mice are comparable to that of human peripheral blood.

Illustration 4: Differences in T-cell stimulation methods.

Figure 5: T-cell responsiveness is impaired but correlates with innate immune reconstitution.

Figure 6: Deficient innate immune reconstitution in HuBLT mice abrogates CD8+ T-cell response to HIV-1 infection.

Table 2: Reference values for frequencies of immune cell subsets in human blood.

Figure 7: HuBLT mice with adequate innate immune reconstitution possess several innate antigen-presenting cell subsets.

Figure 8: HuBLT mice with adequate innate immune reconstitution exhibit robust CD8+ T-cell responses.

Figure 9: AAV8 constructs express mainly in the mouse liver in NSG mice.

Figure 10: Current AAV-hCYT library.

Figure 11: AAV-hCYTs express stably and in a dose-response pattern in NSG mice.

Figure 12: AAV-IL-7 expands T cells and increases their functionality.

xii

Figure 13: AAV-IL-2 expands Tregs and NK cells.

Figure 14: AAV-IL-15SA expands NK cells.

Figure 15: AAV-IL-21 expands TFH and stem-like CD8+ T cells.

Figure 16: GM-CSF expands classical monocytes and induces T-cell differentiation.

Figure 17: AAV-IL-3 expands classical monocytes.

Figure 18: SCF expands NK cells.

Figure 19: AAV-hCYT cocktail of SCF, GM-CSF, and IL-3 enhances human immune engraftment and function in HuBLT mice.

Table 3: Cross-reactivity of human and mouse cytokines and their receptors.

Figure 20: NSG-SGM3 HuBLT mice have poor long-term survival.

xiii

ABBREVIATIONS

TCR = T-cell receptor

CDR3 = complementarity determining region 3

HLA = human leukocyte antigen

HuBLT = humanized bone marrow-liver-thymus

ACE = AAV-mediated cytokine enhancemented/enhanced

AAV = adeno-associated virus

AAV-hCYT = AAV-encoded human cytokine

HIV-1 = human immunodeficiency virus type 1

AIDS = acquired immunodeficiency syndrome

NK = natural killer

IL = interleukin

GM-CSF = granulocyte-monocyte colony stimulating factor

M-CSF = monocyte colony stimulating factor

SCF = stem-cell factor

TPO = thrombopoietin

FLT3L = FMS-like tyrosine kinase 3 ligand

EPO = erythropoietin cDC = conventional dendritic cell pDC = plasmacytoid dendritic cell

PMA = phorbol 12-myristate 13-acetate iono = ionomycin

xiv

INTRODUCTION

Animal models of HIV-1 infection

HIV-1 first arose in Africa as a cross-species transmission event from simian immunodefiency virus (SIV) in the 1930s 1. Today, it affects approximately 36.7 million adults and children worldwide, and in 2016 alone led to 1.8 million new infections and

1.0 million deaths related to acquired immunodeficiency syndrome (AIDS) 2. Amidst our efforts to combat HIV/AIDS, however, a great deal has been learned about the immune system and how this virus has been able to cripple it. While HIV virology research has revealed the HIV life cycle, elucidated virion structure, and allowed the development of anti-retroviral drugs, HIV immunology research has largely focused on vaccine development and characterizing cellular and humoral immune responses throughout infection.

The interplay between HIV-1 and the human immune response is one of constant battle and rapid micro-evolution 3. The virus employs an armamentarium of immune evasion strategies, including coordinate expression of immunevasins that subvert innate and adaptive immune function and its extraordinary ability to rapidly mutate and escape immune recognition by T cells, antibodies, and natural killer (NK) cells (see Illustration

1, published in 4). Consequently, host immune responses to HIV-1 are fervently studied in hopes of identifying key protective factors that can be harnessed for a vaccine or cure. A great deal has been learned from studies in humans, but these are hindered by our limited ability to capture individuals in acute infection, account for host genetic and environmental variability, and carry out invasive investigations of disease pathogenesis.

Non-human primates are species of close phylogenetic relationship with humans that

offer the opportunity to study infections with similar viruses that closely mimic HIV-1

infection in humans, namely, SIV and recombinant SHIV (reviewed in 5,6). This has

allowed for in-depth investigations into pathophysiology of disease and interventional

studies. However, non-human primate studies are very expensive, are also complicated Illustrationby host genetic diversity1 , and examine the pathogenesis of SIV/SHIV strains, which are ultimately different viruses from HIV-1. This has propelled the development of small-

animal models that are less expensive and exhibit significantly less genetic variability.

Of these, the most widely studied for HIV-1 is the humanized mouse model.

Illustration 1: Immune response to HIV-1 (published in 4).

Humanized mouse models

Several humanized mouse models—here referring to what are otherwise known as “human immune system” (HIS) mice—have been developed, mostly stemming from the introduction of profoundly immunodeficient mouse strains capable of achieving high levels of engraftment with human cells. One widely used strain is the non-obese diabetic (NOD) bearing Prkdcscid and common gamma chain null (Il2rgnull) mutations, otherwise known as NOD-scid-Il2rgnull (NSG) mice 7. These lack T cells, B cells, NK cells, and other innate lymphoid cells due to defective V(D)J recombination (which requires Prkdc) and knockout of the common gamma chaina, thus preventing T cell, antibody, and NK cell-mediated xenorejection. The NOD mouse strain also has an intrinsic mutation in signal-regulatory protein α (SIRPα)b that binds with exceptionally high-affinity to human CD47 8, further preventing human cell rejection by phagocytic cells. These characteristics bestow upon NSG mice an extraordinary ability to engraft with human cells of various origins.

Remarkably, NSG mice can be engrafted with human immune cells from a variety of sources, the main ones being (i) adult human peripheral blood leukocytes

(HuPBL), (ii) human cord blood or adult hematopoietic stem cells (HuHSC), or (iii) fetal liver-derived hematopoietic stem cells along with fetal thymic and liver tissue implanted under the mouse renal capsule, otherwise known as bone marrow-liver-thymus (BLT or

HuBLT) mice (see Illustration 2, adapted from [9). HuPBL mice have the advantage of rapid human engraftment with multiple mature human cell types, but are plagued by

a The common gamma chain (γc) is a subunit of the IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21 receptors b SIRPα is an inhibitory receptor expressed on macrophages that engages the widely expressed membrane protein CD47 to transmit a “don’t-eat-me” signal and prevent phagocytosis

Illustrationrapidly developing 2 morbidity and mortality due to graft-versus-host disease. HuHSC mice, on the other hand, have long-lasting engraftment with substantially reduced GvHD

due to education of human T-cell in the mouse thymus. This, however, renders human

T cells restricted to mouse MHC, and in principle, “blinds” them to HLA expressed on

autologous human antigen-presenting cells, thus curtailing innate-adaptive (and T cell-B

cell) cross-talk. Nevertheless, this barrier is overcome with the development of a

humanized mouse that can support T-cell development in an autologous human

thymus.

Immunodeficient mouse (e.g. NSG) Fetal liver HSC

Illustration 2: Humanization strategies in immunodeficient mice. The major models of humanization null of the immune system use immunodeficient mice, such as the NOD-scid-Il2rg (NSG) strain, that are injected with human hematopoietic cells of various sources. The main sources of these cells are (i) adult peripheral blood leukocytes (PBL), which result in short-term engraftment with mature cells; (ii) hematopoietic stem cells (HSC) purified from cord blood, bone marrow, or mobilized in adult blood, which produces long-term engraftment; or (iii) hematopoietic stem cells from fetal liver engrafted along with a thymus and liver tissue implant, which generates a ‘bone marrow-liver-thymus’ (BLT) humanized mouse that has long-term engraftment with endogenous de-novo T-cell generation. (adapted from 9)

HuBLT mouse model

Among all humanized mouse models, the HuBLT mouse model has the unique

property of housing de novo T-cell development in an autologous human thymic

xenograft. This allows for T cells to become restricted to human leukocyte antigen

(HLA), allowing them to interact with autologous human antigen-presenting cells via their T-cell receptor. This, in principle, allows them to (i) be primed by autologous human monocytes and dendritic cells presenting peptides on HLA, (ii) recognize HLA- presented peptides on human target cells, and (iii) engage with and prime cognate peptide:HLA-presenting B cells to produce antibodies, class switch, and undergo affinity maturation (see Illustration 3). One notable study by Covassin et al. 7 assessed and optimized engraftment parameters in HuBLT NSG mice, setting the framework for how HuBLTIllustration mice are generated 3 today. This model (and other existing humanized mouse models) caused an eruption of several studies regarding HIV-1, including antiretroviral prophylaxis 10 and therapy 11, immune cell engineering 12, broadly neutralizing antibody therapy 13–15, immunotherapies 16, reservoir purging and cure strategies 11,17,18, viral evolution 19,20, transmission 21, and pathogenesis 22–24, and vaccine testing 21. However, these studies are limited by variable reconstitution and immune responses in mice, which calls for further improvements of the model.

thymic CD8 CD4 CD4 development CD4 CD8 CD8 CD4 pre-T cells CD4 CD4 CD4 A CD8

CD4 CD4

DC B

CD34+ stem cells B B TFH Treg B C Teff

(see next page for Illustration 3 caption)

+ Illustration 3: T-cell development and function in HuBLT mice. Transplanted CD34 hematopoietic stem cells differentiate into lymphoid precursors that can migrate to the autologous human thymic graft to undergo thymopoiesis. During this process, developing T cells interact with autologous HLA expressed on + + thymic epithelium (A) to mature properly into CD8 and CD4 T cells. Mature naïve T cells can then emigrate to the periphery, where they can interact with antigen-presenting cells (B) such as monocytes and dendritic cells. This allows them to differentiate and polarize into memory and effectors cells of many classes, including regulatory T (T ) cells and T follicular helper (T ) cells. In turn, T cells can prime B- reg FH FH cell responses to induce antibody production (C), also made possible through interactions with HLA. Thus, T-cell receptor interactions with autologous HLA in A, B, and C, are unique in the HuBLT mouse model and are thought to be critical for proper immune functioning.

Study aims

In this two-part study, we comprehensively analyzed T-cell development, diversity, and function in HuBLT mice to identify barriers that explain deviancies from humans (presented in Results – Part 1), with the ultimate goal of correcting these and improving our ability to reliably see human immune responses, which was done via the development of what we refer to as the ‘AAV-mediated cytokine enhancement’ (ACE) platform (presented in Results – Part 2).

METHODS

Generation and use of HuBLT mice

Female NOD-scid-Il2rgnull (NSG) mice (The Jackson Laboratory) were housed in a pathogen-free facility at Massachusetts General Hospital and reconstituted with human tissue as described 25. Briefly, sub-lethally irradiated mice were transplanted under the kidney capsule with 1-mm3 fragments of human fetal liver and thymus, and injected intravenously with purified CD34+ human fetal liver cells to generated humanized bone marrow-liver-thymus (HuBLT) mice. Human immune cells reconstitution was monitored 13 – 17 weeks post-BLT surgery and considered sufficient if >40% of lymphocytes were human CD45+ of which >30% of were CD3+ and a minimum of >200 CD4+ T cells/μL in peripheral blood. Clinical signs of graft-versus-host disease (GvHD), such as conjunctivitis, blepharitis, alopecia, dermatitis, and weight loss were monitored for each mouse weekly. HuBLT mice showing clinical signs of GvHD at any time during the experiments were closely monitored. For HIV-1 infection experiments, HuBLT mice were injected intraperitoneal with 50,000 TCID50 of HIV-1 JR-

CSF. For AAV injection experiments, AAVs diluted in PBS were administered intravenously by tail vain or retro-orbital injection. All animal experiments have been reviewed and approved by the Institutional Animal Use and Care Committee.

Flow cytometric analysis of leukocytes from peripheral blood and tissue

Peripheral blood was stained with antibodies and then fixed and isolated with BD

FACS Lysing Solution (BD Biosciences) for flow cytometric analysis. Cells were extracted from tissues (e.g. spleen, thymus, liver lobe) by placing tissue in a 70-μm cell strainer (Corning) in a well of a 6-well plate containing ~5 mL of 2% fetal bovine serum

in PBS, and mashing carefully but firmly against the strainer mesh until the tissue is dissociated. The 5-mL single cell suspension then underwent density gradient centrifugation with Histopaque (Sigma-Aldrich) to generate a layer of live mononuclear cells that were collected, washed, and stained with antibodies for flow cytometric analysis. The following Table 1 summarizes the optimal antibodies used for HuBLT mice leukocyte staining:

Marker Fluorophore Antibody Clone Company μL/50 μL PANEL A: Innate cell hCD45 Alexa Fluor 700 HI30 BioLegend 1 CD3 PerCP-Cy5.5 UCHT1 BioLegend 1 CD56 BV605 HCD56 BioLegend 2 CD19 PE-Cy7 SJ25C1 BioLegend 2 CD14 BUV395 MφP9 BD Biosci. 2 CD11c FITC B-ly6 BD Biosci. 2 CD16 BV785 3G8 BioLegend 1 CD1c BV421 L161 BioLegend 2 CD141 PE M80 BioLegend 2 CD123 APC 7G3 BD Biosci. 2 HLA-DR BV510 L243 BioLegend 1 PANEL B: T/NK cell hCD45 Alexa Fluor 700 HI30 BioLegend 1 NKp46 PE 9E2 BioLegend 2 KIR3DL1 FITC DX9 BioLegend 2 CD3 PerCP-Cy5.5 UCHT1 BioLegend 1 CD4 BV785 RPA-T4 BioLegend 1 CD8 APC-Cy7 RPA-T8 BioLegend 1 CD45RA PE-Cy7 HI100 BioLegend 1 CCR7 BV421 150503 BD Biosci. 2 CD38 BV605 HIT2 BioLegend 2 HLA-DR BV510 L243 BioLegend 1 PD-1 APC EH12.2H7 BioLegend 2

PANEL C: TFH/Treg/B cell hCD45 Alexa Fluor 700 HI30 BioLegend 1 CD3 PerCP-Cy5.5 UCHT1 BioLegend 1

CD4 BV785 RPA-T4 BioLegend 1 CD25 APC BC96 BioLegend 2 CD127 BV605 A019D5 BioLegend 2 PD-1 BV421 EH12.2H7 BioLegend 2 CXCR5 PE J252D4 BioLegend 2 CD19 PE-Cy7 SJ25C1 BioLegend 2 CD27 BV510 O323 BioLegend 2 CD21 FITC Bu32 BioLegend 2 IgM APC-Cy7 MHM-88 BioLegend 2

Table 1: Flow cytometry antibodies used for comprehensive phenotypic assessment of human leukocytes.

Antibodies not included in this prior list are ones used for intracellular staining, which are anti-IL-2-BV421, anti-CD107a-PE-Cy7, and anti-IFN-γ-AF647 (BioLegend). Flow cytometry data was acquired on BD LSR Fortessa and analyzed using FlowJo software version 7.6 (Tree Star) and statistical analyses were performed using GraphPad Prism

7 (GraphPad Software) and Microsoft Office Excel.

TCR-CDR3β sequencing

Isolated leukocytes had RNA extracted using an RNeasy Plus Mini Kit (Qiagen) and QIAshredder Kit (Qiagen) following manufacturer’s instructions. 5’ rapid amplification of cDNA ends (5’ RACE) was then performed using a SMARTer RACE cDNA Amplification Kit (Clontech). The cDNA was then amplified with a first round of 5’

RACE PCR using the Advantage-HF 2 Polymerase Mix (Clontech) with a 5’ universal primer mix (provided by the kit) and two gene-specific primers that recognizes all constant regions of TCRβ (5’-TGTGGCCAGGCACACCAGTGTGGCC-3'). A follow-up nested

PCR with a nested universal primer with an adaptor for 454 sequencing (5’-

CCTATCCCCTGTGTGCCTTGGCAGTCTCAGCAAGCAGTGGTATCAACGCAGAG-3') and a nested gene- specific primer that recognized all TCRβ constant regions and contained adaptors for

454 sequencing and a barcode (5’- CCATCTCATCCCTGCGTGTCTCCGACTCAG

(N)10GCTCAAACACAGCGACCTCGGGTGGGA -3', where (N)10 is barcoded region). Gel band extraction for a band of approximately 450 – 500 bp was then performed using Purelink

Quick Gel Extraction Kit (Invitrogen). PCR purification with QIAquick PCR Purification

Kit was performed, and DNA was quantified using QUANTI-IT PicoGreen dsDNA

Reagent Assay (Invitrogen) and fluorometer (Promega). Pooled PCR products were prepared for sequencing on the 454 Genome Sequencer FLX Titanium (Roche) using standard protocols (specifically, Lib L kit) and following manufacturer’s instructions.

Sequence reads were analyzed using the IMGT/HighV-QUEST tool 26.

Histology

Mouse tissues are freshly extracted and placed into 4% paraformaldehyde in

PBS (Affymetrix) for 48 h at 4°C, and then stored in 70% ethanol until being sent to

MGH Histopathology Research Core for embedding in paraffin, sectioning, and immunofluorescent staining. Stained tissue was visualized on a TissueFAXS

(TissueGnostics).

AAV human cytokine library generation

To construct the AAV transfer vector, oligonucleotides encoding the 145-base- pair (bp) AAV2- derived inverted terminal repeat 1 (ITR1) in the ‘flip’ orientation and

ITR2 in the ‘flop’ orientation flanked by unique restriction sites were synthesized

(Integrated DNA Technologies) and annealed before ligation into PBR322 plasmid vector. Subsequently, promoters, transgenes and polyadenylation signals flanked by compatible sites were amplified by PCR and cloned between the ITRs, resulting in a modular AAV transfer vector in which unique combinations of restriction sites flanked

each element. AAV8 was produced and purified from culture supernatants as described

27,28 with some modifications. 293T cells were maintained in DMEM medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin mix (Gibco) and

1% glutamine (Gibco) in 5% CO2 incubator at 37°C. The AAV backbone vector was co- transfected with helper vectors pHELP (Applied Viromics) and pAAV 2/8 SEED

(University of Pennsylvania Vector Core) at a ratio of 0.25:1:2 using BioT transfection reagent (Bioland Scientific). Five AAV virus collections were performed at 36, 48, 72, 96 and 120h after transfection. For each time point, media was filtered through a 0.2-mm filter and fresh media was gently added to the plate. After collection, a 5X PEG solution

(40% polyethylene glycol, 2.5 M NaCl) was added to the supernatant and the virus was precipitated on ice for at least 2 h. Precipitated virus was pelleted at 7,277g for 30min

(Sorvall RC 3B Plus, H-6000A rotor) and re-suspended in 1.37 g/mL cesium chloride.

Resuspended virus was split evenly into two Quick-Seal tubes (Beckman) and ultra- centrifuged at 329,738 × g at 20°C for 24 h. Fractions of were collected in a 96-well flat- bottom tissue culture plate, and a refractometer was used to quantify the refractive index of each fraction. Wells exhibiting refractive indexes between 1.3755 and 1.3655 were combined and diluted to a final volume of 15 mL using Test Formulation Buffer 2

(TFB2, 100mM sodium citrate, 10mM Tris, pH 8). Virus was loaded onto 100 kDa

MWCO centrifugal filters (Millipore) and subjected to centrifugation at 500 × g at 4°C for three washed with addition of TFB2. Final retentate volume was between 500 – 1000 μL total, which was aliquoted and stored at –80°C.

Plasma cytokine and immunoglobulin quantification

Plasma cytokines were quantified using the Milliplex MAP Human

Cytokine/Chemokine Magnetic Bead Panel (Millipore) on a BioPlex 3D Suspension

Array System (BioRad) following manufacturer’s instructions. Plasma immunoglobulin were quantified in a similar manner using a Milliplex MAP Human Isotyping Magnetic

Bead Panel (Millipore).

Leukocyte stimulations for functional assessment

Isolated leukocytes were stimulated for 4 – 6 h with phorbol 12-myristate 13- acetate (PMA) (12.5 ng/mL) and ionocymin (0.335 μM) (Cell Stimulation Cocktail used at 0.25X; eBioscience) or anti-CD3/28 Dynabeads (Life Technologies) at a bead-to-cell ratio of approximately 2-to-1. These were done in the presence of brefeldin A

(BioLegend) and monensin (BD Biosciences) at the manufacturers recommended concentrations.

RESULTS – PART 1: COMPREHENSIVE ASSESSMENT OF T CELLS IN

HuBLT MICE

T-cell development is intact

Thymopoiesis

One unique property of HuBLT mice that sets them apart from other humanized mouse models is that it houses de novo T-cell development in an autologous human thymic graft. This, in principle, allows for T cells to become restricted to human leukocyte antigen (HLA), allowing them to interact with autologous human antigen presenting cells via their T-cell receptor (TCR). In order to characterize thymic development, thymocytes were extracted from thymic organoids and stained with markers of T-cell development for flow cytometric analysis (based on 29). These included CD1d, a marker of pre-T cells that is lost upon maturation, and terminal deoxynucleotide transferase (TdT), a nuclear enzyme that participates in and is virtually only expressed during V(D)J recombination. Flow cytometric analyses of thymocytes showed the characteristic abundance of double-positive (i.e. CD4+CD8+) T cells expressing both CD1a and TdT, as well as the presence of mature CD4+ and CD8+ T cells that lack CD1a and TdT expression (Figure 1a). Analyses of several thymic organoids and splenic T cells from several mice from different tissue donors demonstrated consistency in the presence of T-cell development in the thymic organoid, but not in the spleen (Figure 1b). Immunohistology of thymic organoids showed characteristic organization of thymic cortex and medulla containing thymic B cells surrounding Hassel’s corpuscles (Figure 1c). Thus, thymopoiesis is intact in HuBLT mice.

27 Figure 1

Spleen

Thymic

organoid

CD3 TdT CD4

CD1a CD1a CD8 b c 100 CD1a TdT CD3 CD20 + +

) 80 CD1a TdT

% (

+ 

y CD1a TdT

c 60

e u

q 40

r F 20

0 Thymocytes Splenic T cells

Figure 1: Thymic organoids in HuBLT mice support thymopoiesis. Thymocytes and splenocytes were extracted mechanically from fresh thymic organoids and spleens, respectively, from HuBLT mice, and the frequencies of precursor T cells (CD1a+TdT–), T cells undergoing TCR recombination (CD1a+TdT–), and mature T cells (CD1a–TdT–) were assessed via flow cytometry. Representative flow plots (a) and aggregated data from HuBLT mice (n = 6) (b) are presented. (c) A representative immunofluorescence histology image of a thymic organoid with anti-CD3 (red) and anti-CD20 (orange) is shown.

Repertoire diversity

Given existing literature suggesting that fetal T-cell repertoires are limited in diversity 30, we aimed to determine the diversity of T cells via TCR sequencing in HuBLT mice. Prior studies have demonstrated that the complementarity-determining region 3 of the TCRβ chain (CDR3β) best captures the full diversity of a polyclonal T-cell population as compared to sequencing of TCRα 31,32. Thus, we developed a deep sequencing protocol that unbiasedly amplified and sequenced TCRβ transcripts from bulk T cells.

To prevent biased amplification of TCRβ transcript bearing specific Vβ regions, we used

5’ rapid amplification of cDNA ends (5’ RACE) technology to forgo use of pooled Vβ region primers (the most commonly used strategy in other studies 33). This allowed us to use a single 5’ adaptor primer and a single 3’ TCRβ constant region primer

(recognizable by all β constant region segments) for unbiased PCR amplification. 454 pyrosequencing was then used to obtain sequences of >500 bp in length, capturing full

TCRβ transcripts without the need for assembly. Results demonstrated that TCRβ diversity was comparable, if not greater, than that found in adult human peripheral blood

(Figure 2a). In addition, CDR3β lengths in HuBLT mice showed a Gaussian-like normal distribution (Figure 2b), which is thought to arise from randomly generated indels in the

CDR3 region during V(D)J recombination 34 and is characteristic of “naïve” immune systems. On the other hand, adult human T cells showed a bimodal distribution of

CDR3β length (Figure 2b) with a slight skewing towards longer CDR3β lengths, indicative of oligoclonal expansion of specific T cells secondary to immune challenges

34. From this, we concluded that T-cell repertoires in HuBLT mice are diverse and likely able to recognize a wide array of antigens.

29 Figure 2

a HuBLT mouse Adult human

9*01 9*02 7-9*01 9*01 7-8*01 7-9*03 7-7*01 7-9*02 7-6*01 7-9*01 7-3*01 7-8*01 7-2*01 7-3*02 6-6*01 7-2*01 6-5*01 6-6*01 6-4*01 6-2*01 6-5*01 6-1*01 6-4*01 5-6*01 6-2*01 5-5*02 6-1*01 5-4*01 5-6*01 5-1*01 5-5*02 4-3*01 5-1*01 4-2*01 4-3*01

e 4-1*01

4-1*01 e n

3-1*01 n 3-1*01 e

30*01 e 30*02

29-1*01 29-1*01 B

28*01 B 27*01 V

27*01 V 25-1*01 R

25-1*01 R 24-1*01 T 24-1*01 T 21-1*01 21-1*01 20-1*05 20-1*05 20-1*02 20-1*02 20-1*01 20-1*01 2*01 2*01 19*01 19*01 15*01 18*01 14*01 15*02 13*01 14*01 12-4*01 12-5*01 12-3*01 12-4*01 11-3*01 12-3*01 11-2*01 11-3*01 10-3*02 11-2*03 10-3*01 11-2*01 10-2*01 10-3*01 10-1*02 10-2*01 0 2 4 6 8 10 12 14 0 2 4 6 8 10 12 14 Frequency (%) Frequency (%) b TCR-CDR3 junction length TCR-CDR3 "uniqueness" 25 100 HuBLT mouse HuBLT mouse

20 Adult80 human Adult human

)

(

y 15 60

u q

q 10 40

r F F 5 20

0 0 8 10 12 14 16 18 20 22 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Length (a.a.) Amount of times present (clonal expansion)

Figure 2: HuBLT mice T-cell diversity is comparable, if not greater, than that of adult humans. TCRβ deep sequencing was performed on leukocytes from adult human peripheral blood and a HuBLT mouse spleen. Sequence reads obtained from each sample (~800 for each) were analyzed for TRBV gene usage and CDR3β sequence, amino-acid length, and “uniqueness”. In a, the frequency of sequences for adult human (left panel) and HuBLT mouse (right panel) samples grouped by TRBV usage are presented as a histogram (normalized to the total number of sequence reads obtained); each CDR3β clone is individually color coded so clonal expansions can be visualized. In b, a histogram of CDR3β junction length (left panel) and a histogram of CDR3β “uniqueness” (right panel) of adult human (red) and HuBLT mouse (blue) samples are presented.

T-cell subsets

Further enquiring the extent of T-cell development and differentiation, we aimed to assess the frequency of CD8+ versus CD4+ and naïve versus memory T cells. Flow cytometric analysis of the peripheral blood of HuBLT mice generated from different tissue donors demonstrated that CD4+ T cells are often the most abundant human cells in peripheral blood of HuBLT micec, and virtually always outnumber CD8+ T cells, with

CD4/CD8 ratios averaging approximately 4-5 and ranging from 2 to 10 depending on donor tissue (Figure 3). Interestingly, this reflects the peripheral blood of early gestational age fetuses (the source of our BLT tissue), which also have lymphocytic predominance and high CD4/CD8 ratios of approximately 4 to 5 30. Phenotypic analysis of naïve and memory T-cell subsets was performed by staining for CD45RAd and

e CCR7 . Peripheral blood T cells of HuBLT mice displayed variations of naïve (Tnaïve;

+ + – + CD45RA CCR7 ), central memory (TCM; CD45RA CCR7 ), effector memory (TEM;

– – CD45RA CCR7 ), and effector memory re-expressing CD45RA (TEMRA;

CD45RA+CCR7–) T-cell subsets within the limits of healthy adult human peripheral blood (Figure 4). However, there was a significant correlation between age of HuBLT mice and frequency of Tnaïve cells, with young HuBLT mice (i.e. early in engraftment) bearing an overrepresentation of Tnaïve cells (data not shown), a finding observed in

c Interestingly, rare batches of HuBLT mice (approximately one out of every twenty) have a B-cell lineage predominance, with B-cell frequencies as high as 80% of all human leukocytes. The causes of this is unclear, but it is suspected to be related to tissue donor quality or possible viral infections causing B-cell lymphoproliferation. d CD45RA is an isoform (i.e. splice variant) of the hematopoietic lineage-specific tyrosine phosphatase CD45 that is expressed in naïve T cells but is lost upon activation and differentiation into memory cells due to alternative splicing into another isoform called CD45RO. e CCR7 is a chemokine receptor that mediates homing to T-cell zones in lymphoid organs and is expressed in naive and central memory T cells. CD62L (a.k.a. L-selectin) is also used interchangeably with CCR7, but marker detection is sensitive to freeze-thaw of human leukocytes, and thus CCR7 was used.

31 Figure 3

human neonates 35. Consequently, we determined that HuBLT mice indeed possess a

wide array of T-cell subsets, although they unsurprisingly exhibit some features of fetal

or neonatal immune systems but with capacity to “mature”.

Donor A Donor B Donor C 15

5 CD4/CD8 ratio CD4/CD8

Figure 4 0 12 14 16 12 14 16 12 14 16 Time post-BLT surgery (weeks)

Figure 3: CD4/CD8 ratios are high in HuBLT mice. HuBLT mice generated from three different donor + + tissues (n = 10, 5, and 5) were analyzed longitudinally to assess CD4 and CD8 T cell frequencies longitudinally after BLT surgery.

CD4+ T cells CD8+ T cells 100

) TEMRA

(

y 60 TEM

c n

e T

u CM

q 40 e r Tnaïve F 20

0 #1 #2 #3 #1 #2 #1 #2 #3 #1 #2 HuBLT adult HuBLT adult human human

Figure 4: Naïve and memory T-cell frequencies in HuBLT mice are comparable to that of human peripheral blood. Peripheral blood leukocytes from HuBLT mice (n = 3) and healthy adult human donors + + – + (n = 2) were assessed for frequencies of naïve (CD45RA CCR7 ), central memory (CD45RA CCR7 ), – – + – effector memory (CD45RA CCR7 ), and effector memory re-expressing CD45RA (CD45RA CCR7 ) in + + CD4 and CD8 T-cell compartments via flow cytometry.

T-cell function is defective

Finding that the development and differentiation of T cells was intact, we sought to assess their function in response to stimuli and immune challenges.

CD4+ T cells are helper T cells that have the intrinsic capacity to produce IL-2, but can be polarized to produce interferon-γ (IFN-γ) by innate antigen-presenting cells during an immune response. CD8+ T cells, on the other hand, are cytotoxic T cells that have the intrinsic capacity to kill target cells via release of cytotoxic granules containing perforin and granzyme onto target cells, a process called ‘degranulation’ (measured by expression of CD107af), but can also produce IFN-γ upon stimulation. In order to assess these functions in HuBLT mice T cells, we stimulated bulk peripheral blood leukocytes with phorbol 12-myristate 13-acetate (PMA) and ionomycin, which mimic diacylglycerol and calcium release, respectively, downstream of TCR signaling (see

Illustration 4, adapted from 36). After treating cells with monensing and brefeldin Ah, we performed surface and intracellular staining and demonstrated that the combination of

PMA and ionomycin potently induced IL-2 production in CD4+ T cells, degranulation of

CD8+ T cells, and IFN-γ production from both (Figure 5a and Figure 5b).

f CD107a is a lysosomal marker expressed on cell surface of cytotoxic cells after release of perforin- and granzyme-containing cytotoxic granules g Monensin is an ionophore that inhibits lysosomal acidification, and thus prevents degradation of the rapidly recycle degranulation marker CD107a. h Brefeldin A inhibits COPII and this inhibits anterograde transport from the endoplasmic reticulum to the Golgi, causing accumulation of secreted proteins such as cytokines.

33 Illustration 4

a b

+ – iono PMA

Illustration 4: Differences in T-cell stimulation methods. (a) Stimulation of T cells with phorbol 12- myristate 13-acetate (PMA) and ionomycin (iono) triggers massive intracellular signaling that bypasses surface receptor regulation. (b) Cross-linking of CD3 and CD28 via anti-CD3/28 DynaBeads is a more physiological stimulus that induces receptor signaling that can be regulated by other co-receptors. (adapted from [36])

Considering that the combination of PMA and ionomycin is a non-physiologic

stimulus that bypasses regulation by activating and inhibitory surface receptors, we also

assessed the responsiveness of peripheral blood T cells to anti-CD3/28 DynaBeads,

which crosslink TCR and the co-stimulatory receptor CD28 on T cellsi. This revealed an

exceptionally blunted response by T cells, with only minimal capacity to produce IL-2 in

CD4+ T cells (Figure 5b) or degranulate in CD8+ T cells (Figure 5a). When attempting

to correlate the response magnitude of anti-CD3/28 DynaBead-stimulated T cells to

several biological parameters, we found that there was a substantial positive correlation

between the frequency of stimulated IL-2+ CD4+ T cells and the frequency of monocytes

in peripheral blood (Figure 5c), which also held true for CD107a+ CD8+ T cells (Figure

i CD3 (i.e. TCR) and CD28 crosslinking mimic ‘signal 1’ and ‘signal 2’ that are necessary for T-cell activation

34 Figure 5

5d). This association gave us a strong indication that innate immune reconstitution was

critical for the maintenance of T-cell responsiveness in HuBLT mice in vitro. a b + + + +

80 IFN- IL-2 80 IFN- CD107a

l l

e 60

+ 8

4 40 40

20 20

% %

0 0 PMA+ anti- PMA+ anti- PMA+ anti- PMA+ anti- iono CD3/28 iono CD3/28 iono CD3/28 iono CD3/28 c d Monocytes versus Monocytes versus responsive CD4+ T cells responsive CD8+ T cells

4 ) 30

R2 = 0.83 R2 = 0.38

)

(

l s

3 e

e 20

2 8

D +

C 10

a +

1 7

I D 0 C 0 0 1 2 3 4 0 1 2 3 4 + + CD14 cells (%) CD14 cells (%)

Figure 5: T-cell responsiveness is impaired but correlates with innate immune reconstitution. Peripheral blood leukocytes from HuBLT mice (n = 6) were stimulated with either PMA and ionomycin or anti-CD3/28 DynaBeads in the presence of monensin and brefeldin A. Cells subsequently underwent + surface and intracellular staining for analysis by flow cytometry. (a) The frequency of CD4 T cells + producing IL-2 and/or IFN-γ was measured for each stimulation condition. (b) The frequency of CD8 T + cells degranulating (CD107a ) and/or producing IFN-γ was quantified for each stimulation condition. Although not presented, values for unstimulated cells were negligible. Correlations between monocyte + + + + frequencies (percent of CD14 cells of all hCD45 cells) and the frequencies of responding (IL-2 ) CD4 T + + cells (c) and responding (CD107a ) CD8 T cells (d) were done. Linear regressions (dotted line) are presented with coefficient of determination (R2).

Impaired T-cell responses to HIV-1 infection correlate to deficient and variable innate immune reconstitution

To assess whether impaired T-cell responsiveness also occurred in vivo, we challenged four HuBLT mice with HIV-1 and longitudinally assessed CD8+ T-cell activation/differentiation and CD4+ T-cell decline in peripheral blood. While all four mice were viremic (data not shown), we observed great variability in CD4+ T-cell decline and

+ + + the frequency of activated (HLA-DR CD38 ) and differentiated (TEM) CD8 T cells

(Figure 6a). Further analyses revealed that the magnitude of CD4+ T-cell depletion and

CD8+ T-cell responses correlated with the baseline frequency of CD14+ cells (Figure

6b). Of note, control uninfected HuBLT mice generated from the same tissue donor did not exhibit any substantial changes in CD8+ T-cell phenotype or CD4+ T-cell frequencies. This data was highly suggesting that the presence of innate immune cells in HuBLT was critical for in-vivo priming of CD8+ T-cell responses, as well as for HIV-1 infection-associated CD4+ T-cell decline that is well known in humans to be the result of innate and adaptive immune activation 37–40.

36 Figure 6

a b Monocytes versus Bulk CD4+ T cells memory CD4+ T cells

80 35



)

) R

% 30

+ 60

(

40  25

% D

( 20 20 D C 2

C R = 0.69

0 15 0 2 4 6 8 0.0 0.5 1.0 1.5 Time post-infection (weeks) + BaselineMonocytes CD14 versus cells (%) Activated CD8+ T cells activated CD8+ T cells 10 10

R2 = 0.58

) )

+ 8

(

l l

l 6 6

D -

- 4

4 +

H C C 2 2

0 0 0 2 4 6 8 0.0 0.5 1.0 1.5 Time post-infection (weeks) BaselineMonocytes CD14 +versus cells (%) + + CD8 TEM cells CD8 TEM cells 40 40 2

) R = 0.65

)



7 7

% 30

e 30

(



A 20 20

D D 10

10 C

% (

0 0 0 2 4 6 8 0.0 0.5 1.0 1.5 Time post-infection (weeks) + Baseline CD14 cells (%)

+ Figure 6: Deficient innate immune reconstitution in HuBLT mice abrogates CD8 T-cell response to HIV-1 infection. HuBLT mice were infected with HIV-1 JR-CSF (n = 4, red circles and lines) or left + uninfected (n = 4, black circles and lines). (a) Longitudinal assessment of CD4 T cells (upper panel), + + + + activated (HLA-DR CD38 ) CD8 T cells (middle panel), and differentiation of CD8 T cells into effector – – memory cells (CD45RA CCR7 ; TEM) (lower panel) were done via flow cytometry; frequencies are + reported versus time (in weeks). (b) Correlations between monocyte frequencies (percent of CD14 cells + – of all hCD45 cells) at baseline (i.e. earliest time point of 10 d) and the frequencies of memory (CD45RA – + + + + + or CCR7 ) CD4 T cells (upper panel), activated (HLA-DR CD38 ) CD8 T cells (middle panel), and CD8

TEM cells (lower panel) at 8 weeks post-infection were done. Linear regressions (dotted line) are presented with coefficient of determination (R2).

HuBLT mice sufficiently reconstituted with myeloid innate immune cells exhibit robust T-cell responses to HIV-1 infection

In order to assess immune responses in mice adequately engrafted with myeloid innate immune cells, we pre-screened well-engrafted mice and measured T-cell responses to HIV-1 infection. Humans naturally have more myeloid cells (mainly neutrophils) than lymphocytes in peripheral blood (see Table 2). However, given prior results, we created less stringent criteria and defined adequate myeloid innate immune reconstitution as >2.5 % CD14+ cells of all human CD45+ cells in peripheral blood. From a batch of HuBLT mice engrafted with tissue from the same fetal donor, we selected four mice that met criteria, with monocyte (CD14+) frequencies ranging from 4.3 to 6.0

% (Figure 7a and Figure 7b). One HuBLT mouse was sacrificed for flow cytometric assessment of peripheral blood leukocytes and splenocytes, which demonstrated the presence of tissue-resident conventional dendritic cells (cDCs; CD11c+CD14–/dim), with specific subsets identified (i.e. CD141+, CD1c+, and CD16+ cDCs), as well as plasmacytoid DCs (pDCs; CD11c–CD123+)j (Figure 7a and Figure 7b).

Population Adult (%)* Cord/Neonatal (%)* CD4+ T cells (CD3+CD4+) 10.0 (7.4 – 12.7) 10.1 (7.8 – 13.3) CD8+ T cells (CD3+CD8+) 7.0 (4.6 – 7.9) 4.7 (3.2 – 6.2) B cells (CD19+) 2.4 (1.7 – 3.4) 3.1 (2.3 – 4) NK cells (CD56+) 4.1 (3.1 – 5.6) 4.1 (2.9 – 6.0) monocytes (CD14+) 5.3 (4.2 – 6.6) 7.9 (6.6 – 9.3) neutrophils (CD66b+CD16+) 59.1 (50.2 – 66.7) 58.4 (48.9 – 63.7) *Values represent median, and 25th and 75th percentiles in parenthesis

Table 2: Reference values for frequencies of immune cell subsets in human blood (obtained from 35)

j Plasmacytoid dendritic cells—and conventional dendritic cells—can arise from precursors from either the myeloid or lymphoid lineage 89

38 Figure 7

a CD1c+ CD141+ myeloid APCs monocytes cDCs cDCs pDCs

Peripheral Blood

Spleen

CD11c

CD14

CD11c CD11c HLA-DR CD16 CD1c CD141 CD123 b 10

) classical monocytes

+ 5

y inflammatory monocytes

4 c

n 6 D

e patrolling monocytes

h q

+ f

e CD1c cDCs r

o 4

F CD141+ cDCs % ( 2 pDCs

0 HuBLT: #1 #2 #3 #4 #4 Peripheral blood Spleen

Figure 7: HuBLT mice with adequate innate immune reconstitution possess several innate antigen-presenting cell subsets. HuBLT mice (n = 4) were screened from a batch of mice as + possessing >2.5 % CD14 cells of all human leukocytes. (a) Phenotyping of peripheral blood—and spleen in one mouse that was sacrificed—was performed to assess different innate immune subsets, including + – + + dim + + classical (CD14 CD16 ), inflammatory (CD14 CD16 ), and patrolling (CD14 CD16 ) monocytes, CD1c + and CD141 conventional dendritic cells (cDCs), and plasmacytoid dendritic cells (pDCs). Representative flow plots (a) and aggregate data showing frequencing of each population relative to all human leukocytes + (hCD45 ) (b) are shown.

The remaining three HuBLT mice were infected with HIV-1, and peripheral blood

leukocytes were analyzed weekly by flow cytometry to assess for CD4+ and CD8+ T-cell

responses. Using HLA-DR and CD38 co-expression as a marker of antigen-specific

activation (as has been described in humans for HIV-1 41 and other infections 42), we

observed a peak in CD4+ and CD8+ T-cell activation four weeks post infection that was consistent across mice (Figure 8a and Figure 8b). There was also a peak in bulk

+ expansion and differentiation of CD8 T cells into an effector memory (TEM) phenotype at four weeks post infection (Figure 8a). The CD4+ T-cell compartment showed a steady and consistent decline across mice (Figure 8b), which in human has been correlated to innate immune activation 37. Of note, plasma viremia did not exhibit the characteristic biphasic response of “peak” and “set point” seen in human HIV-1 infection

4, indicating that control of viral replication could still not be achieved (Figure 8c).

However, it was apparent that HuBLT mice with adequate innate immune reconstitution responded robustly to HIV-1 infection, with immune responses and progression kinetics more similar to that of humans.

Taken together, only HuBLT mice with adequate innate immune reconstitution exhibited anti-HIV-1 responses mimicking disease progression in humans. Nonetheless,

T-cell responses failed to control viremia to a similar level observed in humans. This prompted us to develop a strategy that boosts innate immune reconstitution in HuBLT mice to enhance and better recapitulate anti-HIV-1 responses and pathophysiology.

40 Figure 8

a b Bulk CD8+ T cells Bulk CD4+ T cells 25 70

) )

+ 60

c c

15 D

8 o

o 10

% ( ( 40 5

0 30 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 Time post-HIV-1 infection (weeks) Time post-HIV-1 infection (weeks)

Activated CD8+ T cells Activated CD4+ T cells

40 5

)

l +

l 4

e 8

e 30

4 8

20 R

C -

C 2

H 10 %

% 1

( (

0 0 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 Time post-HIV-1 infection (weeks) Time post-HIV-1 infection (weeks)

+ c CD8 TEM cells Plasma viremia

80 107

) L ) 6

s 10



7 e

60 s

R c

e 5

i 10

 c

8 4

( A

40 10

f 3 4

o 10

20 l

a %

r 2 (

i 10 V 0 101 0 1 2 3 4 5 6 7 0 1 2 3 4 5 6 7 Time post-HIV-1 infection (weeks) Time post-HIV-1 infection (weeks)

+ Figure 8: HuBLT mice with adequate innate immune reconstitution exhibit robust CD8 T-cell responses. HuBLT with adequate myeloid reconstitution (n = 3) were infected with HIV-1 JR-CSF and + + assessed longitudinally via for cytometry for CD8 T-cell expansion (a, upper panel), CD8 T-cell + + + activation (HLA-DR CD38 ) (a, middle panel), CD8 T-cell differentiation into effector memory (TEM) (a, + + + + lower panel), CD4 T-cell decline (b, upper panel), and CD4 T-cell activation (HLA-DR CD38 ) (b, lower panel). Quantitation of plasma viremia (c) was also performed via qRT-PCR.

RESULTS – PART 2: ENHANCEMENT OF HuBLT MICE VIA AAV-MEDIATED

HUMAN CYTOKINE DELIVERY

AAV-delivered human cytokine genes are stably expressed in a dose-dependent manner

In order to stably express human cytokines and growth factors in a tunable, portable, and flexible manner, we utilized recombinant adeno-associated viruses (AAVs) as an efficient transduction platform. Recombinant AAVs are small, non-pathogenic ssDNA viruses that transduce cells of several species of mammals, but remain episomal, resulting in long-lasting transgene expression largely in the absence of integration 15,43,44. AAV serotype 8 (AAV8) has the ability to stably transduce cells in the liver, skeletal muscle, and other tissuesk 45, and has been successfully used for high- level systemic expression of transgenes 14, including in humans 46. To assess the efficiency and site of expression of AAV8 in comparison to lentiviral (i.e. HIV-1-based) vectors, NSG mice were injected intravenously with AAV8 encoding luciferase (AAV-

Luc) or lentivirus encoding luciferase (Lenti-Luc). In vivo whole body bioluminescence imaging demonstrated that AAV8-Luc transduction was log orders of magnitude more efficient than Lenti-Luc, with the main site of AAV8 transgene expression found to be in the mouse liver (Figure 9).

k Aside from liver and skeletal muscle, AAV8 can also transduce the central nervous system, heart muscles, pancreas, photoreceptor cells, retinal pigment epithelium

42 Figure 9

1 1010 GC 1 1011 GC

Image Image ROI 1=1.6306e+09 ROI 2=5.7656e+08 Min = -1.5756e+06 ROI 1=1.2112e+10ROI 2=1.0892e+08 ROI 3=7.7968e+09 ROI 4=5.7455e+09 Min = -1.3682e+06 ROI 3=5.4525e+08 ROI 4=2.3616e+08 Max = 5.3702e+07 Max = 6.0443e+08 p/sec/cm^2/sr p/sec/cm^2/sr

10 10 10 10

9 9 10 10

8 8 10 10

7 7 10 10

Color Bar Color Bar Min = 5e+06 Min = 5e+06 Max = 1e+10 Max = 1e+10

bkg sub bkg sub flat-fielded flat-fielded cosmic cosmic Click # ABB20090204190317 Click # ABB20090204184001 Thu, Feb 05, 2009 19:3:17 Thu, Feb 05, 2009 18:40:1 Em filter=Open Em filter=Open Bin:HR (4), FOV18.9, f1, 1s Bin:HR (4), FOV18.9, f1, 1s FigureCamera: IVIS 9:23275, AAV8EEV constructs express mainly in theCamera: mouse IVIS 23275, liverEEV in NSG mice. An AAV8 construct 10 encoding luciferase (AAV-Luc) was injected intravenously into several mice at a dose of 10 (left panel) 11 or 10 (right panel) genome copies (GC) per mouse, and subsequently, D-luciferin was injected intraperitoneally and bioluminescence was measured by whole-body, in-vivo imaging.

Correspondingly, we cloned individual human cytokine genes into an optimized

AAV-expressing vector under control of a CAG promoter (Figure 10), and produced

recombinant AAV vectors encoding each of these human cytokines, which we referred

to as ‘AAV-hCYTs’. To determine the dose-response relationship of AAV-hCYTs in NSG

mice, equimolar amounts of individual AAV-hCYTs were mixed and injected

intravenously into groups of mice at several doses (2-fold dilutions): 5.00 × 109, 2.50 ×

109, 1.25 × 109, 6.25 × 108, 3.13 × 108, 1.56 × 108, and 7.81 × 107 genome copies

(GCs) per mouse (assuming a 20-g mouse, adjusting for weight). Several time points

after AAV-hCYT injections, plasma levels of each human cytokine were measured by

multiplexed ELISA (i.e. Luminex). These demonstrated a clear dose-response

relationship unique to almost all tested human cytokines, with full expression achieved

at approximately two weeks post-AAV-hCYT injection (Figure 11). Certain cytokines

Figure 10 (such as BAFF, IL-5, FLT3L, TPO, and IL-6) achieved much higher plasma levels, while

others (such as IL-3, IL-21, IL-15, CXCL13, and IL-4) had lower levels of expression at

the same AAV-hCYT dose. This is most likely resulting from a combination of factors

including AAV-hCYT batch infectivity, transcription/translation processivity, secretion

efficiency, and protein half-life.

ITR CAG human cytokine gene WPRE SV40pA ITR

HSC Myeloid Interleukins Others IGFBP2 EPO IL-2 hGH ANGLP5 TPO IL-3 FGF7 VEGF SCF IL-4 FGF10 FGF2 IL-3 IL-5 TSLP GDNF GM-CSF IL-6 CXCL13 ARTN M-CSF IL-7 BAFF NRTN G-CSF IL-8 PSPN FLT3L IL-12α IL-12β IL-15 IL-15Rα IL-18 IL-21

Figure 10: Current AAV-hCYT library. Human cytokine, chemokine, and growth factor genes are individually cloned into a recombinant AAV vector. We conceptually clustered them together into the categories presented. Abbreviations are as follows: ITR, inverted terminal repeat; CAG, cytomegalovirus early enhancer element, the promoter, first exon, and first intron of chicken β-actin gene, and the splice acceptor of the rabbit β-globin gene; WPRE, Woodchuck hepatitis virus posttranscriptional regulatory element; SV40pA, SV40 polyadenylation sequence.

44 Figure 11

SCF GM-CSF IL-3 M-CSF 3000 2500 1000 2000

2000 800 1500 2000 1500 600 1000 1000 400 1000 500 500 200

0 0 0 0 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6

FLT3L TPO BAFF CXCL13 15000 5000 10000 250

4000 8000 200 10000 3000 6000 150

/mL) 2000 4000 100

5000 pg 1000 2000 50

0 0 0 0 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6

IL-2 IL-4 IL-5 IL-6 2000 150 104 104

1500 3 3 100 10 10

1000 102 102 50

500 101 101 Plasma concentration ( concentration Plasma 0 0 100 100 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6

IL-7 IL-12p70 IL-15 IL-21 1500 2000 500 800

400 1500 600 1000 300 1000 400 200 500 500 200 100

0 0 0 0 0 2 4 6 0 2 4 6 0 2 4 6 0 2 4 6 Time post-AAV injection (weeks)

Figure 11: AAV-hCYTs express stably and in a dose-response pattern in NSG mice. A panel of AAV-hCYTs were combined at equimolar amounts and delivered into NSG mice (n = 5 per group) at the 9 9 9 8 following doses (2-fold dilutions): 5.00 × 10 (red), 2.50 × 10 (orange), 1.25 × 10 (yellow), 6.25 × 10 8 8 7 (green), 3.13 × 10 (aqua), 1.56 × 10 (blue), and 7.81 × 10 (violet) genome copies (GCs) per mouse (assuming a 20-g mouse, adjusting for weight); control mice (black) were also included. Plasma concentrations of each cytokine (indicated in each panel) in were measured longitudinally via multiplexed ELISA (i.e. Luminex). Given difference in dose-reponse relationships, some cytokine concentrations are presented in a linear scale and others on a log10 scale. When presented, hatched gray regions represent values outside the standard range of the assay.

Individual AAV-hCYTs cause permanent alterations to the human immune system

Given that cytokines have pleiotropic effects that can initiate other immune pathways and additional cytokine production, we explored the effects of individual cytokines on the human immune system of engrafted HuBLT mice. Pairs of HuBLT mice were injected with select individual AAV-hCYTs—IL-2, IL-3, IL-7, IL-15, IL-21, GM-CSF, and SCF—at three doses (i.e. 109 (low), 1010 (medium), or 1011 (high) GCs per mouse) and compared to a large cohort of un-manipulated control HuBLT mice engrafted with the same tissue donors. We then assessed for changes in human immune cell frequencies/phenotypes and plasma human cytokine levels at three and six weeks after

AAV-hCYT injection, comparing to unaltered HuBLT mice engrafted with tissue from the same fetal donors. Although some findings are more descriptive due to two mice per group, whenever possible, mice injected with a high and medium dose of a single AAV- hCYT were grouped together for statistical analyses. Comprehensive flow cytometric assessment of human immune cell subsets was done by staining of peripheral blood

(and splenocytes at the last time point) with three antibody panelsl (see Methods).

These antibody panels allowed us to identify the following human immune cell populations:

Cell Subset Phenotype markers Human leukocytes CD45+ Monocytes (total) CD14+ classical CD14+CD16– inflammatory CD14+CD16+ patrolling CD14dimCD16–

l Of note, antibody staining of human leukocytes in BLT mice is notoriously difficult in comparison to adult human peripheral blood leukocytes because many markers are more dimly expressed, including lineage markers (e.g. CD56, CD19, CD14, CD8, CD4, and CD3, in decreasing order of staining difficulty). Thus, the antibody panels used represent marker:antibody clone:fluorophore combinations that were optimized via testing of multiple panels

Cell Subset Phenotype markers Conventional dendritic cells (total) HLA-DR+CD11c+ (CD14–) CD141+ cDCs HLA-DR+CD11c+CD141+ CD1c+ cDCs HLA-DR+CD11c+CD1c+ CD16+ cDCs HLA-DR+CD11c+CD16+ Plasmacytoid dendritic cells HLA-DR+CD123+CD11c– Natural killer cells (total) CD56+/dim or NKp46+ (KIR3DL1+ or –) “immature” (‘brights’) CD56+CD16– “intermediate” 47 CD56+CD16+ “mature” (‘dims’) CD56dimCD16– T cells CD3+ CD8+ T cells CD3+CD8+ naïve CD3+CD8+CD45RA+CCR7+ TCM CD3+CD8+CD45RA–CCR7+ TEM CD3+CD8+CD45RA–CCR7– TEMRA CD3+CD8+CD45RA+CCR7– activated CD3+CD8+HLA-DR+ and/or CD38+ exhausted CD3+CD8+PD-1+ stem-like 48,49 CD3+CD8+CXCR5+PD-1+ CD4+ T cells CD3+CD4+ naïve CD3+CD4+CD45RA+CCR7+ TCM CD3+CD4+CD45RA–CCR7+ TEM CD3+CD4+CD45RA–CCR7– TEMRA CD3+CD4+CD45RA+CCR7– activated CD3+CD4+HLA-DR+ and/or CD38+ exhausted CD3+CD4+PD-1+

Treg CD3+CD4+CD25+CD127low TFH CD3+CD4+CXCR5+PD-1+ B cells (total) CD19+ naive CD19+IgM+CD27– non-class-switched memory CD19+IgM+CD27+ class-switched memory CD19+IgM–CD27+ “dysfunctional” CD19+CD21– or CXCR5–

This experiment revealed several key findings that underscored the biology of each of these cytokines. Several AAV-hCYTs encoding highly inflammatory cytokines (IL-2, IL-

7, IL-15SA, IL-21, and IL-3) resulted in rapid development of morbidity at high doses

(1011 GC/mouse), most likely due to immune over-activation and ‘cytokine storm’m.

Nonetheless, all AAV-hCYTs demonstrated pleiotropic effects on the human immune

m Cytokine storm is a loosely used term, but here is defined as a fatal immune reaction consisting of positive feedback loops that form between cytokines and white blood cells, leading to highly elevated levels of several cytokines.

system that either recapitulated previous work in humanized mice, or confirmed findings from mouse, in-vitro, and/or patient-based studies.

For example, IL-7, a growth factor that is critical for T-cell development and homeostasis 50, resulted in a >2-fold expansion of T cells (Figure 12a). This effect was more pronounced in naïve T cells (Figure 12b), which are known to express higher levels of IL-7 receptor 51,52. In additional, plasma levels of IFN-γ, IL-10, MIP-1β, GM-

CSF, FLT3L, and soluble CD40L increased in AAV-IL-7 HuBLT mice (Figure 12c), suggesting a boost in T-cell functionality that can enhance innate immune function.

48 Figure 12

a b T cells T cells 100 * control AAV-IL-7

cells +

40 CD3

(% of total cells) totalof (% CD45RA 0 control AAV- CCR7 IL-7 c IFNIFN--γ ILIL-10-10 MIPMIP-1-1β 1000 200 150

800 150 100 600 100 400 50 50

/mL) 200 pg 0 0 0 week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 control AAV- control AAV- control AAV- IL-7 IL-7 IL-7 GM-CSF FLT3L sCD40L 600 GM-CSF 400 FLT3L 600 sCD40L

300

400 400 Plasma concentration ( concentration Plasma 200

200 200 100

0 0 0 week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 control AAV- control AAV- control AAV- IL-7 IL-7 IL-7

Figure 12: AAV-IL-7 expands T cells and increases their functionality. HuBLT mice were injected 10 with AAV-IL-7 (10 GC/mouse; n = 2) and compared to control HuBLT mice (n = 12). (a) The frequency + of T cells (CD3 cells) relative to all cells (i.e. flow events) was measured at 3 weeks post-injection via flow cytometry. (b) Flow plot of CD45RA and CCR7 staining of T cells in a representative control HuBLT + + mouse and an AAV-IL-7 HuBLT mouse. The frequency of naïve (CD45RA CCR7 ) T cells is reported. (c) Quantitation of the indicated cytokines in the plasma of control (n = 5) and AAV-IL-7 (n = 2) HuBLT mice was performed at 0, 3, and 6 weeks post-injection via multiplexed ELISA (i.e. Luminex); ticks on y-axis with grayed region represent measured values for plasma of a healthy human donor (lower tick) an HIV- 1–infected patient (upper tick), for comparison. For a, one-way analysis of variance (ANOVA) with Kruskal-Wallis comparisons test was performed; for b and c, Mann-Whitney test was used; * and ** denote p < 0.05 and < 0.01, respectively.

On the other hand, IL-2, a growth and differentiation factor for T cells, NK cells,

50 Figureand other 13 cell types , resulted in increased Treg frequencies (Figure 13a). This has been described in humans treated with IL-2 53,54, and is thought to occur due to

preferential consumption of IL-2 by Tregs via expression of the high-affinity IL-2 receptor

α chain (IL-2Rα, also known as CD25). Accordingly, plasma levels of IL-10 (Figure

13c), a major regulatory cytokine produced by Tregs, and IL-5, a TH2 cytokine, also

increased in AAV-IL-2 HuBLT mice. Furthermore, IL-2 also increased NK-cell

frequencies (Figure 13b), which expand in response to IL-2 treatment in patients 55.

One recently published study investigating the effects of AAV-IL-2 in HuBLT mice also

56 reported the same effects on Tregs and NK cells , further supporting our findings.

a + b CD4 Treg cells NK cells Peripheral blood Spleen Peripheral blood Spleen

s 30 25

l l

e * * * *

T 20

)

l 5

20 l

4 D

e 15



2 f

5 10

1 o

D 10

( (

+ 5

2 D

C 0 0 control AAV- control AAV- control AAV- control AAV- IL-2 IL-2 IL-2 IL-2

c IL-10 IL-5

300 500

n n

o o

i i t

t 400

a a

r r t

200 t

) )

n n

e L L

e 300

c c

m m

n n

/ /

o o

g g

c c

p p

(

( 200 a

100 a

m m

s s

a a l

l 100

p p 0 0 week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 control AAV- control AAV- IL-2 IL-2

(see next page for Figure 13 caption)

10 Figure 13: AAV-IL-2 expands Tregs and NK cells. HuBLT mice were injected with AAV-IL-2 (10 + n n GC/mouse; = 2) and compared to control HuBLT mice ( = 12). The frequency of (a) CD4 Treg + – + (CD25 CD127 ) cells and (b) NK (CD56 ) cells in peripheral blood and spleen were measured at 6 weeks post-injection via flow cytometry. (c) Quantitation of the indicated cytokines in the plasma of control (n = 5) and AAV-IL-7 (n = 2) HuBLT mice was performed at 0, 3, and 6 weeks post-injection via multiplexed ELISA (i.e. Luminex); ticks on y-axis with grayed region represent measured values for plasma of a healthy human donor (lower tick) an HIV-1–infected patient (upper tick), for comparison. For a and b, Mann-Whitney test was used; * denotes p < 0.05.

Additionally, we tested administration of IL-15, a cytokine that is essential for the function and homeostasis of NK cells and memory CD8+ T cells 57. It has been demonstrated that the dominant form of IL-15 presentation in vivo is trans-presentation mediated by the high-affinity IL-15 receptor α chain (IL-15Rα)n 57. Consequently, IL-15 was expressed in HuBLT mice alongside equimolar amounts of a soluble version of IL-

15Rα in order to form IL-15:IL-15Rα heterodimers (designated IL-15 ‘superagonist’ or

IL-15SA) and mimic trans-presentation. HuBLT mice transduced with AAV-IL-15SA exhibited a dramatic expansion of NK cells in peripheral blood and tissues (i.e. spleen), reaching frequencies of >75% of all human cells (Figure 14a). Interestingly, most NK cells exhibited a CD56+CD16+ or CD56dimCD16+ phenotype, and expressed canonical

NK-cell receptors such as NKp46 and KIR3DL1, indicating proper maturation (Figure

14b). However, given there was clearly a supra-physiological effect of IL-15SA over- expression, we transduced a separate group of three HuBLT mice with a lower effective dose of AAV-IL-15SA. Circulating NK-cell frequencies of ~25% of all human cells were achieved in this group of mice (Figure 14c), indicating that NK-cell frequencies can be titrated with different doses of AAV-IL-15SA.

n Interestingly, the IL-2 and IL-15 receptors share the same β and γ chains: IL-15/IL-2Rβ, and the common γ chain (γc), which is also shared with IL-4, IL-7, IL-9, and IL-21. It used to be thought that IL-2 and IL-15 had similar biological activities due to this receptor subunit sharing, but the binding as soluble versus membrane-bound cytokines and the selective expression of their respective high-affinity α chains makes their in-vivo biological activities quite distinct. 90

51 Figure 14

a NK cells c NK cells 100 Peripheral blood Spleen 40 * *

80 )

) 30

l 5

4 e

e 60

+ C

+ 20

5 f f

5 40

% ( ( 10 20

0 0 control AAV- control AAV- control AAV- IL-15SA IL-15SA IL-15SA b (low) Human leukocytes NK cells

control AAV-IL-15SA control AAV-IL-15SA

CD56 KIR3DL1 CD16 NKp46

10 Figure 14: AAV-IL-15SA expands NK cells. HuBLT mice were injected with AAV-SCF (10 GC/mouse; + n = 2) and compared to control HuBLT mice (n = 12). (a) The frequency of NK cells (CD56 cells) in + peripheral blood and spleen relative to all human leukocytes (hCD45 cells) was measured at 6 weeks +/dim +/– + post-injection via flow cytometry. (b) Representative flow plots of CD56 CD16 human (hCD45 ) leukocytes (left panel) and NKp46 and KIR3DL1 expression in NK cells of control and AAV-IL-15SA HuBLT mice (right panel). (c) A separate experiment with control (n = 3) and AAV-IL-15SA (n = 3) mice injected with a lower effective dose of AAV-IL-15SA was performed to re-assess NK cells frequencies in peripheral blood. For a, Mann-Whitney test was used; * denotes p < 0.05.

IL-21 is another pleiotropic cytokine with many influences on lymphocyte function

58, but in particular, plays a critical role in germinal center formation and generation of

59 TFH cells . HuBLT mice had an exuberant response to AAV-IL-21 and rapidly

developed morbidity, owing to cytokine storm that was measurable by elevations of

several plasma cytokines (Figure 15a). However, spleen analyses carried out before

52 Figure 15

+ sacrificing the animals revealed a substantial expansion of CD4 TFH cells and stem-like

CD8+ T cells, characterized by co-expression of CXCR5 and PD-1 (Figure 15b). This

was not seen in any other spleen of control or other AAV-hCYT HuBLT mice. This result

is interestingly in light of a report showing that, different from mouse TFH cells, human

60 TFH cells are not generated via IL-21 (but rather IL-12) in vitro . Thus, our finding

highlights the important of in-vivo models of human T-cell differentiation and function. a b IL-6 MCP-1

150 800 CD4+ T cells CD8+ T cells

n n

o o

i i

t t a

a 600

r r t

t 100

) )

n n

e L e L

c c

m m

n n /

/ 400

o o

g g

c c

p p

( ( a

a 50

m m s

s 200 a

a control

l l

p p 0 0 week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 control AAV- control AAV- IL-10 IL-21 MIP-1 IL-21

400 150

t a

300 a

r t

t 100

)

e L

e L c

c AAV-

n /

200 /

(

( IL-21 a

a 50

m s

100 s

p p

0 0 CXCR5 week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 control AAV- control AAV- PD-1 IL-21 IL-21

+ Figure 15: AAV-IL-21 expands TFH and stem-like CD8 T cells. HuBLT mice were injected with AAV-IL- 10 21 (10 GC/mouse; n = 2) and compared to control HuBLT mice. (a) Quantitation of the indicated cytokines in the plasma of control (n = 5) and AAV-IL-21 (n = 2) HuBLT mice was performed at 0, 3, and 6 weeks post-injection via multiplexed ELISA (i.e. Luminex); ticks on y-axis with grayed region represent measured values for plasma of a healthy (lower tick) and HIV-1–infected (upper tick) donor. AAV-IL-21 mice died before 6 weeks. (b) Flow cytometric analysis of the spleen of an AAV-IL-21 mouse at 3 weeks + + + post-injection was performed to assess for frequencies of CD4 TFH (CXCR5 PD-1 ) cells (left panels) + + + and stem-like (CXCR5 PD-1 ) CD8 T cells (right panels); the control mouse flow plot is representative of all control HuBLT mice, as well as other AAV-hCYT HuBLT mice tested.

Granulocyte-monocyte colony stimulating factor (GM-CSF) is a growth factor critical for myeloid development that also exhibits chemotactic properties. In HuBLT mice, AAV-mediated GM-CSF expression led to several changes in immune cell parameters. Classical monocyte (CD14+CD16–) frequencies significantly increased

(Figure 16a), which was accompanied by increases in memory CD8+ T cells (Figure

16b) and Tregs (Figure 16c). We also observed a corresponding increase in plasma cytokines, namely, MCP-1 (a monocyte-derived chemokine), MIP-1β (a chemokine produced by cytotoxic lymphocytes), and IL-10. Studies in mice and humans have shown that GM-CSF induces Tregs directly and indirectly by mobilizing myeloid cells and fomenting more crosstalk between T cells and myeloid antigen-presenting cells 61,62, reiterating the importance of myeloid cells in T-cell differentiation and function. Of note,

AAV-GM-CSF had no effect on the frequency of inflammatory (CD14+CD16+) monocytes, which contrasts in-vitro studies that employ the use of GM-CSF to differentiate monocytes into an inflammatory phenotype.

54 Figure 16

a Monocyte subsets

10 CD14+CD16 CD14+CD16+ CD14dimCD16+ *

) 8 +

4 Frequency

(% of hCD45 of (% 2

0 control AAV- control AAV- control AAV- GM-CSF GM-CSF GM-CSF b c + + Memory CD8 T cells CD4 Treg cells 100 * **

– 5 ) 80 – + 4

T cells) T 60 +

orCCR7 3

T cells T

CD127

–

+ +

40 2

CD4 CD25

20 hCD45 of (% 1

(% of CD8 of (% CD45RA 0 0 control AAV- control AAV- GM-CSF GM-CSF d ILIL-10-10 MCPMCP-1-1 MIPMIP-1-1β

80 2000 150

a a

60 1500 a

)

) n

n 100

)

e L

/ /

40 1000 /

/mL)

(

a a

a 50

(

s s

20 500 s

p p 0 0 0

week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 week: 0 3 6 0 3 6 Plasma concentration Plasma control AAV- control AAV- control AAV- GM-CSF GM-CSF GM-CSF

Figure 16: GM-CSF expands classical monocytes and induces T-cell differentiation. HuBLT mice 11 10 were injected with AAV-GM-CSF (either 10 or 10 GC/mouse; n = 4) and compared to control HuBLT + – mice (n = 12). The frequency of (a) classical monocytes (CD14 CD16 ), pro-inflammatory monocytes + + dim + + (CD14 CD16 ), and patrolling monocytes (CD14 CD16 ) relative to all human leukocytes (hCD45 – – + + cells); (b) memory cells (CD45RA or CCR7 ) within the CD8 T cell compartment; and (c) CD4 Treg cells + – (CD25 CD127 ) were measured at 3 weeks post-injection via flow cytometry. (d) Quantitation of the indicated cytokines in the plasma of control (n = 5) and AAV-GM-CSF (n = 4) HuBLT mice was performed at 0, 3, and 6 weeks post-injection via multiplexed ELISA (i.e. Luminex); ticks on y-axis with grayed region represent measured values for plasma of a healthy human donor (lower tick) an HIV-1–infected patient (upper tick), for comparison. For a, one-way analysis of variance (ANOVA) with Kruskal-Wallis comparisons test was performed; for b and c, Mann-Whitney test was used; * and ** denote p < 0.05 and p < 0.01, respectively.

55 Figure 17

Interestingly, IL-3, a myeloid trophic factor, also had a modest but significant

effect on increasing classical monocyte frequencies (Figure 17). Despite its reported

influence on B-cell function 63, however, no other effects were apparent in our assays,

although a more detailed analysis may have revealed changes in the B-cell

compartment.

Monocyte subsets

+  + + dim + 18 CD14 CD16 CD14 CD16 CD14 CD16

16 * )

+ 14

y 4

c 12

D e

C 10

e 8

F 6 % ( 4 2 0 control AAV- control AAV- control AAV- IL-3 IL-3 IL-3

Figure 17: AAV-IL-3 expands classical monocytes. HuBLT mice were injected with AAV-IL-3 (either 11 10 10 or 10 GC/mouse; n = 4) and compared to control HuBLT mice (n = 12). The frequency of classical + – + + monocytes (CD14 CD16 ), pro-inflammatory monocytes (CD14 CD16 ), and patrolling monocytes dim + + (CD14 CD16 ) relative to all human leukocytes (hCD45 cells) were measured at 3 weeks post-injection via flow cytometry. Mann-Whitney test was used; * denotes p < 0.05.

Stem cell factor (SCF) is a growth factor that binds to cKIT, a receptor tyrosine

kinase expressed on hematopoietic stem cells as well as NK cells 64. Accordingly, AAV-

SCF HuBLT mice exhibited a significant expansion of NK cells in peripheral blood and

in the spleen (Figure 18), reflective of the fact that human NK cells express cKIT. Given

this cytokine is not deleterious at high doses and has a modest effect on NK-cell

frequencies, it has the potential to serve as an untapped NK-cell enhancement factor.

56 Figure 18

NK cells 6 Peripheral blood Spleen

* **

)

l 5

l 4

5 f

o D

% (

0 control AAV- control AAV- SCF SCF

11 10 Figure 18: SCF expands NK cells. HuBLT mice were injected with AAV-SCF (either 10 or 10 + GC/mouse; n = 4) and compared to control HuBLT mice (n = 12). The frequency of NK cells (CD56 cells) + in peripheral blood and spleen relative to all human leukocytes (hCD45 cells) was measured at 6 weeks post-injection via flow cytometry. For a and b, Mann-Whitney test was used; * and ** denote p < 0.05 and p < 0.01, respectively.

The major effects of all tested AAV-hCYTs in HuBLT mice observed are

summarized in the following table:

AAV-hCYT Peripheral blood/spleen Plasma hi – IL-2 ↑ Treg cells (CD25 CD127 ), ↑ NK cells ↑ IL-10, IL-5 ↑ FLT3L, GM-CSF, IFN-γ, ↑ T cells (predominantly naïve IL-7 IL-10, IL-6, CXCL10, MCP-1, phenotype [CD45RA+CCR7+]) MIP-1β, sCD40L ↑ NK cells (mainly CD56brightCD16+ with IL-15SA – enhanced KIR3DL1 expression) ↑ CD4+ T and stem-like CD8+ T cells IL-21 FH ↑ IL-10, IL-6, MCP-1, MIP-1β (CXCR5+PD-1+) (in spleen) ↑ classical monocytes (CD14+CD16–), + + GM-CSF ↑ Treg cells, ↑ memory CD8 and CD4 ↑ IL-10, IL-6, MCP-1, MIP-1β T cells IL-3 ↑ classical monocytes (CD14+CD16–) – SCF ↑ NK cells –

AAV-hCYT cocktail of SCF, IL-3, and GM-CSF induces myeloid expansion and enhances adaptive immune function

Given the results with single AAV-hCYTs, we saw the opportunity to generate cocktails of cytokines for delivery into humanized mice. We postulated, however, that these cytokines may have a more regulated and predictable effect if delivered to NSG mice ≥2 weeks before humanization surgery, such that human hematopoiesis and engraftment can occur in the presence of the desired cytokine and growth factor milieu.

As such, we generated three pre-surgery cocktails:

 AAV-hCYT cocktail ‘L’ (AAV-cL) containing high-dose SCF, IL-3, and GM-CSF

 AAV-hCYT cocktail ‘W’ (AAV-cW) containing high-dose SCF, IL-3, GM-CSF, and

FLT3L, as well as low-dose IL-7, IL-15, IL-21

 AAV-hCYT cocktail ‘A’ (AAV-cA) containing high dose SCF, IL-3, and GM-CSF,

as well as low-dose FLT3L, IL-7, IL-15SA, IL-21, IL-2, IL-18, IL-12

Each of these cocktails was injected intravenously into groups of 10 NSG mice several weeks before humanization. During this time, AAV-hCYT cocktails were well tolerated, with no deaths or obvious changes in clinical parameters in mice. However, after humanization surgery, mice in AAV-cA and AAV-cW groups developed profound morbidity and mortality, with AAV-cA HuBLT mice having a more precipitous decline in survival and all HuBLT mice in these groups deceased before 12 weeks post-surgery

(Figure 19a). It was noted at three weeks post-BLT surgery that the few hCD45+ cells in AAV-cA mice were mostly activated (HLA-DR+) T cells (Figure 19b). These most likely arose from the few contaminating T cells present in injected CD34+ cells or thymocytes from the implanted thymus that became over-stimulated in the milieu of

transduced cytokines (e.g. IL-2, IL-7, IL-12, IL-15SA, and IL-21). Interestingly, AAV-cW mice at three weeks post-surgery had increased frequencies of NK cells and monocytes/cDCs (CD11c+ cells) when compared to control, although less B cells

(Figure 19b). Thus, we presumed that early death in AAV-cA and AAV-cW HuBLT mice was due to human cell overstimulation and cytokine storm.

At eight weeks post-surgery, control and AAV-cL HuBLT mice exhibited significant differences in reconstitution. AAV-cL HuBLT mice had significantly more human reconstitution (total leukocytes), T cells, and monocytes/cDCs, but comparable amounts of B cells (Figure 19c). However, AAV-cL HuBLT mice had a much higher frequency of HLA-DR+ T cells (Figure 19c), although this did not correlate with any clinical signs of GvHD or weight loss as compared to control mice.

At 12 weeks post-surgery, differences in human reconstitution were minimal and not significant (Figure 19d). At this time point, however, a more comprehensive flow cytometric analysis with the aforementioned three antibody panels was performed. As compared to control mice, AAV-cL HuBLT mice had significantly higher frequencies of

+ + + + memory (non-naïve) CD4 and CD8 T cells, Tregs, TFH-like cells (CXCR5 CD4 T cells)

65, and monocytes/cDCs (CD11c+ cells) (Figure 19d and Figure 19e). Notably, within

CD11c+ cells, there was an HLA-DR–CD11c+CD123+ subset that was particularly expanded (data not shown), and which some sources refer to as myeloid dendritic cells

66. Given that CD123 is the IL-3 receptor, it is likely that IL-3 expression from the cocktail was preferentially expanding this CD123+ myeloid subset expressing this growth factor receptor. Furthermore, to assess B-cell functionality, immunoglobulin profiling was also performed and this showed a statistically significant increase in IgG1

and IgG3 titers in AAV-cL mice when compared to controls, but no differences in IgM,

IgA, IgG2, or IgG4 (Figure 19f). This increase in IgG1 and IgG3 titers, which are IgG isotypes which exhibit the best FcγR-binding and complement-recruiting profiles, may be a consequence of the increased TFH-like cell frequency observed (Figure 19e).

Overall, we believe these results indicate that AAV-mediated expression of SCF, GM-

CSF, and IL-3 lead to a stable expansion of myeloid cells that promoted T-cell differentiation and functionality (including that of B cells).

Given these results, a subset of control and AAV-cL HuBLT mice were infected with HIV-1 and analyzed weekly for viral loads. While no statistically significant difference were observed for viral loads at any time point, HIV-1–infected AAV-cL

HuBLT mice appeared to most consistently reach a viral set point (i.e. nadir) around five weeks post-infection (Figure 19g). Control mice were more variable with some remaining at peak viremia. This suggests that virus-controlling immunity may have developed in this cohort of ACE HuBLT mice.

Figure 19: AAV-hCYT cocktail of SCF, GM-CSF, and IL-3 enhances human immune engraftment and function in HuBLT mice. HuBLT mice were injected with a three different cocktails of AAV-hCYTs— AAV-cL (n = 10), AAV-cW (n = 9), and AAV-cA (n = 9)—and compared to control HuBLT mice (n = 20). In a, survival analysis after BLT surgery is depicted. Human engraftment of control (empty circles) and AAV- cL (black circles) HuBLT mice was assessed by flow cytometric measurements of activated T cells (HLA- DR+CD3+), non-activated T cells (HLA-DR–CD3+), NK cells (CD56+), myeloid innate immune cells (CD11c+), and B cells (CD19+) at 3 weeks (b), 8 weeks (c), and 12 weeks (d) after BLT surgery. At 12 + – weeks, a more extensive flow cytometric panel permitted the measurement of Treg cells (CD25 CD127 + + + + + CD4 CD3 ) and TFH-like cells (CXCR5 CD4 CD3 ) (e). (f) Quantitation of immunoglobulin isotypes of HuBLT mouse plasma at 13 weeks after BLT surgery was determined via multiplexed ELISA. Normal adult human reference ranges are shaded in gray for each immunoglobulin isotype 67. (g) A random subset of control (n = 8) and AAV-cL (n = 6) HuBLT mice were infected with HIV-1 JR-CSF, and viral loads were measured longitudinally. Throughout all panels, For c, d, e, and f, mean ± S.E.M. are depicted, and Mann-Whitney tests were performed for each; *, **, ***, and **** denote p < 0.05, 0.01, 0.001, and 0.0001, respectively.

(see next page for Figure 19)

60 Figure 19

a b Human engraftment (week 3) 100 25 control AAV-cL AAV-cW AAV-cA 80 control CD3+HLA-DR+

) 20 s

% AAV-cL

l l

( + -

60 CD3 HLA-DR l

AAV-cW c

l 15

v + i a CD56

AAV-cA t

v r

40 o

t u

+ f

S 10 CD11c

20 + % CD19 5 - 0 Lin 0 2 4 6 8 10 0 Time post-BLT surgery (weeks) (individual HuBLT mice)

c Human engraftment Activated T cells Human engraftment (week 8) (week 8) (week 8) + + + 60 **** 30 CD3 CD19 CD11c 80 ****

ns ) s

** **** l

)

s c

l 60

e e 40

e 20

t 5

% 40

(

20 10

- %

% 20

(

L H 0 0 0

d CD4+ T cells Human engraftment reg Human engraftment (week 12) (week 12) (week 12) CD3+ CD19+ CD11c+ 80 ns 50 50 ****

ns ns ***

)

l )

40 l 40



e l

60 l

l 30

30 D

C t

5 40

C f

D 20 2

C %

20 % (

% 10

10 (

0 0 0

e + f CD4 TFH-like cells (week 12) Plasma immunoglobulins (week 13) IgG1 IgG2 IgG3 IgG4 IgA IgM 3 *** 105

*** * control n

) 4 AAV-cL s

o 10

e a

r 3

c t

2 10

)

+ c

R 2

m 10

c 

( C

10 a

f 1

s 100

l ( P 10-1 0 g control IgG1 IgG2 IgG3 IgG4AAV-cL IgA IgM 107 107

105 )

*** ) * control

L L

6 4 6 AAV-cL m

10 10 m 10

/ /

s s

e e i

103 i p

105 p 105

o o

c c (

2 (

104 d 104 a

1 a o

10 o

l l

l l a

3 0 a 3 r

10 r 10 i

10 i

V V 10-1 0 1 2 3 4 5 6 7 8 0 1 2 3 4 5 6 7 8 Time post-HIV-1 infection (weeks) Time post-HIV-1 infection (weeks)

DISCUSSION

In this study, we aimed to identify the underlying cause for variable and blunted human immune responses to HIV-1 infection in HuBLT mice. We discovered that while

T-cell development and differentiation was intact, functional responsiveness and priming in the context of an immune challenge (e.g. HIV-1 infection) was defective. Deficient innate immune reconstitution of HuBLT mice was hypothesized to be the cause of blunted T-cell responses. In efforts to correct this defect, we developed a platform to transduce human cytokines and growth factors using a library of AAV-hCYTs to enhance immune cell development, homeostasis, and function. Individual AAV-hCYTs delivered into HuBLT mice had substantial effects on human immune cells, recapitulating several aspects of their known biology. Cocktails of AAV-hCYTs also exhibited pleiotropic effects, with one in particular—containing SCF, GM-CSF, and IL-

3—enhancing innate immune reconstitution and adaptive immune function. Thus, in this study we (i) provide a comprehensive analysis of human T-cell development and function in HuBLT, and (ii) identify a model-intrinsic defect in innate immune reconstitution that hinders immune responses. We also (iii) develop a tunable and portable ‘AAV-mediated cytokine enhancement’ (ACE) platform that can enhance innate immune reconstitution, and (iv) demonstrate improvements in adaptive immune function as a consequence of ACE. We believe these findings will aid investigations aiming to understand HIV-1 pathogenesis and characterize adaptive immune responses to HIV-1 infection.

Innate immunity is critical to eliciting adaptive immunity

The requirement of the innate immune system for priming of adaptive immunity is a well-known immunological concept that was re-emphasized by our comprehensive analysis of T-cell immunology in HuBLT mice. We find that the model achieves the desired endogenous thymic development, TCR repertoire diversity, and generation of T- cell subsets comparable to that of humans. However, functional maintenance and T-cell priming is inadequate due to sub-optimal reconstitution of innate antigen-presenting cells. Accordingly, mice that naturally engraft more adequately with innate immune cells respond more robustly to HIV-1 infection.

Prior experiments in immunocompetent mice established this concept, demonstrating that in-vivo depletion or absence of mouse CD11c+ cells (a specific marker for mouse DCs) thwarts priming of CD8+ T cells 68 and homeostatic maintenance of NK cells 69. It was also shown that mouse inflammatory monocyteso orchestrate CD8+ T and NK-cell activation during microbial infections 70. Both contact- dependent (e.g. TCR-HLA) and soluble factor-mediated (e.g. IL-12, IL-15, IL-18) pathways are known to be required for myeloid priming of other immune cells, and while introduction of soluble factors may bypass the need for innate immune cells in certain cases, such as IL-15 for NK cells, physical presence for contact is indispensable in most contexts. Our study in HuBLT mice makes evident that these same requirements may exist at baseline as well as during an anti-viral immune response.

o Different from humans, mouse inflammatory macrophages are marked by mouse Ly6C and CCR2 expression

Human-mouse incompatibilities

Defective engraftment of innate immune cells has been previously described in humanized mouse models 9,21,71–76. HSC transplant patient and HuBLT mice exhibit similar engraftment dynamics post-transplant, with characteristic myeloid, B-cell, and T- cell “waves” in most settings 77. However, in contrast to HSC transplant patients, our data and previous literature demonstrate that the myeloid wave in HuBLT mice does not persist. The early wave of myeloid cells results from short-term repopulating CD34+ precursor cells committed to the myeloid lineage differentiating into mature cells 77. The lack of long-term myeloid engraftment, however, is unclear and may be due to true

HSCs not being supported in myelopoiesis in HuBLT. The leading theory is that while human lymphopoiesis is supported and intact in mice, human myelopoiesis is defective because of non-cross-reactivity of cytokines and growth factors necessary for myeloid development (summarized in Table 3).

Cross-reactivity (ligand → receptor) Cytokine mouse → human human → mouse SCF ↓ 2.5-fold none IL-3 none none GM-CSF none none M-CSF none full FLT-3L full full G-CSF active full EPO ↓ 2.5-fold active TPO full active IL-2 none active IL-6 none active IL-12 active none IL-17 none full TSLP none none CCL19/21 full ? CXCL13 ↓ 100-fold ? XCL1 full ? CCL2 full ?

Table 3: Cross-reactivity of human and mouse cytokines and their receptors. The cross-reactivity of mouse cytokines to human receptor counterparts and vice versa was summarized from various sources 50. When available, fold difference in activity are reported. ‘Full’ cross-reactivity indicates that approximately 100% activity has been reported. ‘Active’ cross-reactivity indicates that cross-reactivity has been reported, but the degree of activity is unclear. ‘None’ indicates that negligible activity has been reported. (see previous page for Table 3)

This notion has led many investigators to develop strategies at further humanizing the mice and supporting more balanced human engraftment in hopes of optimizing the humanized mouse model for a wider set of applications for study.

Non-AAV-based efforts to enhance engraftment in humanized mice

Prior efforts to increase innate immune reconstitution in humanized mice have been successful at extending applications of humanized mice. For example, Chen et al.

78 delivered DNA plasmids encoding FLT3L and IL-15 into HuHSC NSG mice via hydrodynamic transfectionp and effectively expanded cDCs and NK cells. However, while hydrodynamic transfection is an inexpensive method of in-vivo transfection, it is a procedure associated with significant acute morbidity and mortality and produces only a short burst of protein expression (approximately two weeks). Separately, NSG mice have been genetically modified for transgenic expression of human cytokines and growth factors, with one strain in particular becoming more widely used: the transgenic

SCF, GM-CSF, and IL-3 NSG mouse strain (NSG-SGM3). Studies have demonstrated that NSG-SGM3 have increased and more rapid myeloid and lymphoid engraftment 79–

81. However, NSG-SGM3 mice express each cytokine at a fixed level, and have been

p Hydrodynamic transfection is a technique whereby DNA plasmid diluted in a large volume of saline solution (e.g. 1.8 mL PBS) is injected intravenously over a short amount of time (e.g. 10 – 15 s) into mice to cause membrane disruption of hepatocytes and allow transfection with DNA plasmid

65 Figure 20

noted to have accelerated GvHD and decreased long-term survival, a finding we also

confirmed independently (Figure 20).

100

)

(

a v

i 50

u S NSG NSG-SGM3 0 0 2 4 6 8 10 12 14 16 18 Time post-BLT surgery (weeks)

Figure 20: NSG-SGM3 HuBLT mice have poor long-term survival. NSG (n = 20) and NSG-SGM3 (n = 20) mice underwent BLT surgery (i.e. humanization) and were monitored longitudinally for survival.

One breakthrough technology used to optimize immunodeficient mice for human

engraftment is knock-in of human cytokine/growth factor genes into the native mouse

loci. Immunodeficient (Rag2–/–Il2rgnull) Balb/c is currently the most widely used strain for

this strategy and have been genetically engineered with knock-ins of human M-CSF 82,

IL-3 83, TPO 84, GM-CSF 83, or a combination of these, so called ‘MISTRG’ mice 85.

These allow for remarkable engraftment of myeloid cells after CD34+ cells injection as

well as human tumors. However, the non-cross-reactivity between mouse CD47 and

human SIRPα 8 leads to fatal anemia approximately four weeks after CD34+ cell

injection due to phagocytosis of mouse erythrocytes by the engrafted human

macrophages 85, making long-term studies very difficult. Improvements to these models

are currently underway and show great promise, but will take time to develop given the

laborious nature of mouse genetic engineering.

AAV-mediated transduction offers a tunable, portable, and flexible platform for manipulating the human immune system in HuBLT mice

The development of the ACE platform for rapid and customizable human cytokine and growth factor delivery into HuBLT forgoes the requirement for expensive and repetitive protein injections and liberates constraints to specific mouse strains, offering great advantages that can accelerate the pace of humanized mouse research.

The ability to transduce mice as adults forgoes the long process of genetically engineering specific mouse strains, which takes years of development. The ACE platform can be easily transferred into any mouse background, including newer ones engineered for more optimal human engraftment and increased mouse survival for long- term studies, such as NSG-KitW41/W41 mice 86 and C56BL/6 Rag2–/–Il2rgnullCD47–/– mice

17,87. Also, the ability to titrate human cytokines in our ACE platform is pivotal, as the immune system is perpetually plagued by the Goldilocks principle, whereby too much or too little can disrupt the entire system in a pathological manner. For example, NSG-

SGM3 mice, which express SCF, GM-CSF, and IL-3 under a CMV promotor and achieve plasma levels of 2-4 ng/mL (each), have accelerated GvHD and early death when made into HuBLT mice. On the other hand, our AAV-cL HuBLT mice—which also express SCF, GM-CSF, and IL-3 but at calculated plasma levels of approximately 3, 2, and 0.8 ng/mL, respectively—had survival comparable to control mice. This highlights the important of having fine-tuned control offered by ACE.

Our detailed analyses of AAV-hCYTs delivered either singly or in combinations into HuBLT to achieve specific levels of cytokines in mice demonstrated that the human immune engraftment and function can be enhanced to overcome model-intrinsic

limitations. A similar approach was previously undertaken by Huang et al., who used

AAV9 to deliver an HLA gene into the mouse thymus, as well as human cytokines systemically, to enhance CD8+ T cell immunity to antigenic challenge 88. AAV9 in their study, however, lead to biphasic cytokine expression that extinguished by around four months. Using ACE, we will continue to develop AAV-hCYT cocktails that produce more physiological doses of human cytokines and growth factors, with the goal of creating an optimal model for assessment and manipulation of the human immune response.

Future applications of ACE HuBLT mice

The applications of ACE HuBLT mice in basic and clinical research endeavors are wide-ranging. Indeed, despite the many endeavors to enhance engraftment in humanized mice through introduction of human cytokines, only few have been done in

HuBLT mice, where human T cells are restricted to HLA and able to interact with autologous human antigen-presenting cells. This allows us, in principle, to study the full range of immune responses, where innate-immune crosstalk is critical. Via creation of optimal AAV cocktails, we aim to fully recapitulate the immune pathophysiology of HIV-1 infection, understanding host and viral factors that determine disease progression.

Given that both cell-mediated and humoral immunity are essential for control and in some cases clearance of virtually all known viral infections, ACE HuBLT mice offer a platform for studying these responses and optimizing prophylactic and immunotherapeutic vaccines as well as testing cure strategies.

In addition, this platform can greatly aid immuno-oncology studies on tumor micro-environments, anti-tumor immune responses, and the testing of multiple anti- cancer regimens—including immunotherapy—simultaneously for comparison of

efficacy. Using xenografts of patient-derived tumors in huBLT mice, AAV-hCYTs can serve to expand human myeloid cell subsets that are critical to maintaining tumor microenvironment, while also enhancing potential adaptive immune responses and delivering immunologically active factors.

Furthermore, the ability to expand and manipulate specific human cell populations allows us to further our understanding of human immune development, homeostasis, function, and responses to pathogens and tumors. As a specific case, many adoptive transfer studies are hindered by the inability to sustain transfused immune cells in recipient mice, mostly owing to cytokine deprivation-induced cell death.

This system allows specific cytokine expression to a desired level to maintain persistence of difficult immune cell subsets, such as NK cells (with IL-15), dendritic cells

(with GM-CSF and FLT3L), and CD8+ T cells (with IL-2, IL-7, and/or IL-15). Additionally, mice survival—which is often a major issue for long-term studies—can be improved, such as with the rescue of HuBLT mice from fatal anemia via AAV-delivered erythropoietin (EPO)q. Thus, ACE HuBLT mice open new avenues for feasible and personalized in-vivo studies of the human immune system and pathophysiology of human diseases.

Overall, we believe this study creates a platform that furthers our ability to manipulate the human immune system and can aid researchers exploring different facets of in-vivo human immunology and anti-viral immune responses in ways that were not previously possible.

q Human EPO is active on the mouse Epo receptor, and we have previously demonstrated that mouse erythropoiesis can be indeed stimulated with AAV-EPO (data not shown)

REFERENCES

1. Hillis, D. M. AIDS: Origins of HIV. Science. 288, 1757–1759 (2000).

2. UNAIDS Data 2017. (2017).

3. Keele, B. F. et al. Identification and characterization of transmitted and early founder virus envelopes in primary HIV-1 infection. Proc. Natl. Acad. Sci. U. S. A. 105, 7552–7 (2008).

4. Walker, B. D. & Yu, X. G. Unravelling the mechanisms of durable control of HIV-1. Nat. Rev. Immunol. 13, 487–98 (2013).

5. Hatziioannou, T. & Evans, D. T. Animal models for HIV/AIDS research. Nat. Rev. Microbiol. 10, 852–67 (2012).

6. Policicchio, B. B., Pandrea, I. & Apetrei, C. Animal Models for HIV Cure Research. Front. Immunol. 7, 12 (2016).

7. Covassin, L. et al. Human immune system development and survival of non- obese diabetic (NOD)-scid IL2rγ(null) (NSG) mice engrafted with human thymus and autologous haematopoietic stem cells. Clin. Exp. Immunol. 174, 372–88 (2013).

8. Kwong, L. S., Brown, M. H., Barclay, A. N. & Hatherley, D. Signal-regulatory protein α from the NOD mouse binds human CD47 with an exceptionally high affinity-- implications for engraftment of human cells. Immunology 143, 61–7 (2014).

9. Walsh, N. C. et al. Humanized Mouse Models of Clinical Disease. Annu. Rev. Pathol. 12, 187–215 (2017).

10. Deruaz, M. & Luster, A. D. BLT humanized mice as model to study HIV vaginal transmission. J. Infect. Dis. 208 Suppl, S131-6 (2013).

11. Satheesan, S. et al. HIV replication and latency in a humanized NSG mouse model during suppressive oral combinational ART. J. Virol. JVI.02118-17 (2018). doi:10.1128/JVI.02118-17

12. Ringpis, G.-E. E. et al. Engineering HIV-1-resistant T-cells from short-hairpin RNA-expressing hematopoietic stem/progenitor cells in humanized BLT mice. PLoS One 7, e53492 (2012).

13. Sun, M. et al. VRC01 antibody protects against vaginal and rectal transmission of human immunodeficiency virus 1 in hu-BLT mice. Arch. Virol. 161, 2449–55 (2016).

14. Balazs, A. B. et al. Antibody-based protection against HIV infection by vectored

immunoprophylaxis. Nature 481, 81–4 (2011).

15. Brady, J. M., Baltimore, D. & Balazs, A. B. Antibody gene transfer with adeno- associated viral vectors as a method for HIV prevention. Immunol. Rev. 275, 324– 333 (2017).

16. Seung, E. et al. PD-1 blockade in chronically HIV-1-infected humanized mice suppresses viral loads. PLoS One 8, e77780 (2013).

17. Lavender, K. J. et al. An advanced BLT-humanized mouse model for extended HIV-1 cure studies. AIDS 32, 1–10 (2018).

18. Denton, P. W. et al. Generation of HIV latency in humanized BLT mice. J. Virol. 86, 630–4 (2012).

19. Dudek, T. E. et al. Rapid evolution of HIV-1 to functional CD8+ T cell responses in humanized BLT mice. Sci. Transl. Med. 4, 1–12 (2012).

20. Dudek, T. E. & Allen, T. M. HIV-Specific CD8+ T-Cell Immunity in Humanized Bone Marrow–Liver–Thymus Mice. J. Infect. Dis. 208, S150–S154 (2013).

21. Karpel, M. E., Boutwell, C. L. & Allen, T. M. BLT humanized mice as a small animal model of HIV infection. Curr. Opin. Virol. 13, 75–80 (2015).

22. Watkins, R. L. et al. In vivo analysis of highly conserved Nef activities in HIV-1 replication and pathogenesis. Retrovirology 10, 125 (2013).

23. Watkins, R. L., Foster, J. L. & Garcia, J. V. In vivo analysis of Nef’s role in HIV-1 replication, systemic T cell activation and CD4+ T cell loss. Retrovirology 12, 61 (2015).

24. Honeycutt, J. B. et al. Macrophages sustain HIV replication in vivo independently of T cells. J. Clin. Invest. 126, 1353–1366 (2016).

25. Brainard, D. M. et al. Induction of robust cellular and humoral virus-specific adaptive immune responses in human immunodeficiency virus-infected humanized BLT mice. J. Virol. 83, 7305–7321 (2009).

26. Alamyar, E., Giudicelli, V., Li, S., Duroux, P. & Lefranc, M.-P. IMGT/HighV- QUEST: The IGMGT web portal for immunoglobulin (Ig) or antibody and T cell receptor (TC) analyses from NGS high throughout and deep sequencing. Immunome Res 8, 1–15 (2012).

27. Ayuso, E. et al. High AAV vector purity results in serotype- and tissue- independent enhancement of transduction efficiency. Gene Ther. 17, 503–10 (2010).

28. Lock, M. et al. Rapid, simple, and versatile manufacturing of recombinant adeno-

associated viral vectors at scale. Hum. Gene Ther. 21, 1259–71 (2010).

29. McClory, S. et al. Evidence for a step-wise program of T cell development within the human tonsil. J. Clin. Invest. 122, 1403–15 (2012).

30. Zhao, Y., Dai, Z.-P., Lv, P. & Gao, X.-M. Phenotypic and functional analysis of human T lymphocytes in early second- and third-trimester fetuses. Clin. Exp. Immunol. 129, 302–8 (2002).

31. Freeman, J. D. et al. Profiling the T-cell receptor beta-chain repertoire by massively parallel sequencing Profiling the T-cell receptor beta-chain repertoire by massively parallel sequencing. 1817–1824 (2009). doi:10.1101/gr.092924.109

32. Bolotin, D. a. et al. Next generation sequencing for TCR repertoire profiling: platform-specific features and correction algorithms. Eur. J. Immunol. 42, 3073– 83 (2012).

33. Rosati, E. et al. Overview of methodologies for T-cell receptor repertoire analysis. BMC Biotechnol. 17, 1–16 (2017).

34. Schelonka, R. L. et al. T cell receptor repertoire diversity and clonal expansion in human neonates. Pediatr. Res. 43, 396–402 (1998).

35. Prabhu, S. B. et al. Comparison of human neonatal and adult blood leukocyte subset composition phenotypes. PLoS One 11, 1–17 (2016).

36. Krishna, S. & Zhong, X. P. Regulation of lipid signaling by diacylglycerol kinases during T cell development and function. Front. Immunol. 4, 1–14 (2013).

37. Chang, J. J. & Altfeld, M. Innate immune activation in primary HIV-1 infection. J. Infect. Dis. 202 Suppl, S297–S301 (2010).

38. Mogensen TH, Melchjorsen J, Larsen CS & Paludan SR. Innate immune recognition and activation during HIV infection. Retrovirology 7, 54 (2010).

39. Paiardini, M. & Müller-Trutwin, M. HIV-associated chronic immune activation. Immunol. Rev. 254, 78–101 (2013).

40. Younas, M., Psomas, C., Reynes, J. & Corbeau, P. Immune activation in the course of HIV-1 infection: Causes, phenotypes and persistence under therapy. HIV Med. 17, 89–105 (2015).

41. Ndhlovu, Z. M. et al. Magnitude and Kinetics of CD8+ T Cell Activation during Hyperacute HIV Infection Impact Viral Set Point. Immunity 43, 591–604 (2015).

42. Schwenk, R. et al. Ex vivo tetramer staining and cell surface phenotyping for early activation markers CD38 and HLA-DR to enumerate and characterize malaria antigen-specific CD8+T-cells induced in human volunteers immunized with a

Plasmodium falciparum adenovirus-vectored m. Malar. J. 12, 1–9 (2013).

43. Addgene. Adeno•-associated virus (AAV) guide. Available at: https://www.addgene.org/viral-vectors/aav/aav-guide/.

44. Samulski, R. J. & Muzyczka, N. AAV-Mediated Gene Therapy for Research and Therapeutic Purposes. Annu. Rev. Virol. 1, 427–51 (2014).

45. Zincarelli, C., Soltys, S., Rengo, G. & Rabinowitz, J. E. Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection. Mol. Ther. 16, 1073–1080 (2008).

46. Nathwani, A. C. et al. Long-term safety and efficacy of factor IX gene therapy in hemophilia B. N. Engl. J. Med. 371, 1994–2004 (2014).

47. Beziat, V. et al. CD56brightCD16+ NK Cells: A Functional Intermediate Stage of NK Cell Differentiation. J. Immunol. 186, 6753–6761 (2011).

48. Mylvaganam, G. H. et al. Dynamics of SIV-specific CXCR5+ CD8 T cells during chronic SIV infection. Proc. Natl. Acad. Sci. 114, 1976–1981 (2017).

49. Im, S. J. et al. Defining CD8+ T cells that provide the prolierative burst after PD-1 therapy. 537, 417–421 (2016).

50. Fitzgerald, K. A., O’Neill, L. A. J., Gearing, A. J. H. & Callard, R. E. The Cytokine FactsBook and Webfacts. (Academic Press, 2001).

51. Carrette, F. & Surh, C. D. IL-7 signaling and CD127 receptor regulation in the control of T cell homeostasis. Semin Immunol. 24, 209–217 (2012).

52. Berard, M. & Tough, D. F. Qualitative differences between naïve and memory T cells. Immunology 106, 127–138 (2002).

53. Koreth, J. et al. Interleukin-2 and Regulatory T Cells in Graft-versus-Host Disease. N. Engl. J. Med. 365, 2055–66 (2011).

54. Saadoun, D. et al. Regulatory T-cell responses to low-dose interleukin-2 in HCV- induced vasculitis. N. Engl. J. Med. 365, 2067–2077 (2011).

55. Michaëlsson, J. et al. Immune reconstitution of CD56(dim) NK cells in individuals with primary HIV-1 infection treated with interleukin-2. J. Infect. Dis. 197, 117–25 (2008).

56. Durost, P. A. et al. Gene Therapy with an Adeno-Associated Viral Vector Expressing Human Interleukin-2 Alters Immune System Homeostasis in Humanized Mice. Hum. Gene Ther. 0, (2017).

57. Burkett, P. R. et al. Coordinate Expression and Trans Presentation of Interleukin

(IL)-15Rα and IL-15 Supports Natural Killer Cell and Memory CD8 + T Cell Homeostasis. J. Exp. Med. 200, 825–834 (2004).

58. Liu, S. M. & King, C. IL-21-Producing Th Cells in Immunity and Autoimmunity. J. Immunol. 191, 3501–3506 (2013).

59. Spolski, R. & Leonard, W. J. IL-21 and T follicular helper cells. Int. Immunol. 22, 7–12 (2009).

60. Ma, C. S. et al. Early commitment of nave human CD4+ T cells to the T follicular helper (FH) cell lineage is induced by IL-12. Immunol. Cell Biol. 87, 590–600 (2009).

61. Kared, H. et al. Role of GM-CSF in tolerance induction by mobilized hematopoietic progenitors. Blood 112, 2575–2578 (2008).

62. Rowin, J. et al. Granulocyte macrophage colony-stimulating factor treatment of a patient in myasthenic crisis: effects on regulatory T cells. 46, 449–53 (2012).

63. Xia, X., Li, L. & Choi, Y. S. Human recombinant IL-3 is a growth factor for normal B cells. 148, 491–497 (1992).

64. Carson, W. E., Haldar, S., Baiocchi, R. A., Croce, C. M. & Caligiuri, M. A. The c- kit ligand suppresses apoptosis on human natural killer cells through the upregulation of Bcl-2. 91, 7553–7557 (1994).

65. Morita, R. et al. Human blood CXCR5+CD4+ T cells are counterparts of T follicular cells and contain specific subsets that differentially support antibody secretion. Immunity 334, 108–121 (2011).

66. Shi, J. et al. Identification of CD123+ myeloid dendritic cells as an early-stage immature subset with strong tumoristatic potential. Cancer Lett. 270, 19–29 (2008).

67. Schauer, U. et al. IgG Subclass Concentrations in Certified Reference Material 470 and Reference Values for Children and Adults Determined with the Binding Site Reagents. Clin. Chem. 49, 1924–1929 (2003).

68. Jung, S. et al. In vivo depletion of CD11c+ dendritic cells abrogates priming of CD8+ T cells by exogenous cell-associated antigens. Immunity 17, 211–220 (2002).

69. Guimond, M. et al. In vivo role of Flt3 ligand and dendritic cells in NK cell homeostasis. J. Immunol. 184, 2769–75 (2010).

70. Soudja, S. M. H., Ruiz, A. L., Marie, J. C. & Lauvau, G. Inflammatory Monocytes Activate Memory CD8+T and Innate NK Lymphocytes Independent of Cognate Antigen during Microbial Pathogen Invasion. Immunity 37, 549–562 (2012).

71. Shultz, L. D., Ishikawa, F. & Greiner, D. L. Humanized mice in translational biomedical research. Nat. Rev. Immunol. 7, 118–130 (2007).

72. Willinger, T., Rongvaux, A., Strowig, T., Manz, M. G. & Flavell, R. A. Improving human hemato-lymphoid-system mice by cytokine knock-in gene replacement. Trends Immunol. 32, 321–327 (2011).

73. Drake, A. C., Chen, Q. & Chen, J. Engineering humanized mice for improved hematopoietic reconstitution. Cell. Mol. Immunol. 9, 215–224 (2012).

74. Marsden, M. D. & Zack, J. A. Humanized Mouse Models for Human Immunodeficiency Virus Infection. 4, 393–412 (2017).

75. Shultz, L. D., Brehm, M. A., Victor Garcia-Martinez, J. & Greiner, D. L. Humanized mice for immune system investigation: Progress, promise and challenges. Nat. Rev. Immunol. 12, 786–798 (2012).

76. Rongvaux, A. et al. Human hemato-lymphoid system mice: current use and future potential for medicine. Annu. Rev. Immunol. 31, 635–674 (2013).

77. Hogan, C. J., Shpall, E. J. & Keller, G. Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Natl Acad Sci U S A 99, 413–418 (2002).

78. Chen, Q., Khoury, M. & Chen, J. Expression of human cytokines dramatically improves reconstitution of specific human-blood lineage cells in humanized mice. Proc. Natl. Acad. Sci. 106, 21783–21788 (2009).

79. Coughlan, A. M. et al. Myeloid Engraftment in Humanized Mice: Impact of Granulocyte-Colony Stimulating Factor Treatment and Transgenic Mouse Strain. Stem Cells Dev. 25, 530–41 (2016).

80. Jangalwe, S., Shultz, L. D., Mathew, A. & Brehm, M. A. Improved B cell development in humanized NOD-scid IL2Rγnull mice transgenically expressing human stem cell factor, granulocyte-macrophage colony-stimulating factor and interleukin-3. Immunity, Inflamm. Dis. 4, 427–440 (2016).

81. Billerbeck, E. et al. Development of human CD4+FoxP3+ regulatory T cells in human stem cell factor-, granulocyte-macrophage colony-stimulating factor-, and interleukin-3-expressing NOD-SCID IL2Rγ(null) humanized mice. Blood 117, 3076–86 (2011).

82. Rathinam, C. et al. Efficient differentiation and function of human macrophages in humanized CSF-1 mice. Blood 118, 3119–28 (2011).

83. Willinger, T. et al. Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung. Proc. Natl. Acad. Sci. U. S. A. 108, 2390–5 (2011).

84. Rongvaux, A. et al. Human thrombopoietin knockin mice efficiently support human hematopoiesis in vivo. Proc. Natl. Acad. Sci. 108, 2378–2383 (2011).

85. Rongvaux, A. et al. Development and function of human innate immune cells in a humanized mouse model. Nat. Biotechnol. 32, 364–372 (2014).

86. McIntosh, B. E. et al. Nonirradiated NOD,B6.SCID Il2rγ-/- Kit(W41/W41) (NBSGW) mice support multilineage engraftment of human hematopoietic cells. Stem cell reports 4, 171–80 (2015).

87. Lavender, K. J. et al. BLT-humanized C57BL/6 Rag2-/-γc-/-CD47-/- mice are resistant to GVHD and develop B- and T-cell immunity to HIV infection. Blood 122, 4013–20 (2013).

88. Huang, J., Li, X., Coelho-dos-Reis, J. G. a, Wilson, J. M. & Tsuji, M. An AAV vector-mediated gene delivery approach facilitates reconstitution of functional human CD8+ T cells in mice. PLoS One 9, e88205 (2014).

89. Shortman, K., Sathe, P., Vremec, D., Naik, S. & O’Keeffe, M. Plasmacytoid dendritic cell development. Adv. Immunol. 120, 105–26 (2013).

90. Waldmann, T. A. The shared and contrasting roles of IL2 and IL15 in the life and death of normal and neoplastic lymphocytes: implications for cancer therapy. Cancer Immunol. Res. 3, 219–27 (2015).