Mississippi State University Scholars Junction
Theses and Dissertations Theses and Dissertations
5-1-2010
Bacteria and Fungi Associated with Red Imported Fire Ants Solenopsis Invicta Buren (Hymenoptera: Formicidae) and Mounds in Mississippi, and their Potential Use as Biological Control Agents
Sandra Winia Woolfolk
Follow this and additional works at: https://scholarsjunction.msstate.edu/td
Recommended Citation Woolfolk, Sandra Winia, "Bacteria and Fungi Associated with Red Imported Fire Ants Solenopsis Invicta Buren (Hymenoptera: Formicidae) and Mounds in Mississippi, and their Potential Use as Biological Control Agents" (2010). Theses and Dissertations. 839. https://scholarsjunction.msstate.edu/td/839
This Dissertation - Open Access is brought to you for free and open access by the Theses and Dissertations at Scholars Junction. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of Scholars Junction. For more information, please contact [email protected]. BACTERIA AND FUNGI ASSOCIATED WITH RED IMPORTED FIRE ANTS
SOLENOPSIS INVICTA BUREN (HYMENOPTERA: FORMICIDAE)
AND MOUNDS IN MISSISSIPPI, AND THEIR POTENTIAL
USE AS BIOLOGICAL CONTROL AGENTS
By
Sandra Winia Woolfolk
A Dissertation Submitted to the Faculty of Mississippi State University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Life Sciences in the Department of Entomology and Plant Pathology
Mississippi State, Mississippi
May 2010
Copyright by
Sandra Winia Woolfolk
2010
BACTERIA AND FUNGI ASSOCIATED WITH RED IMPORTED FIRE ANTS
SOLENOPSIS INVICTA BUREN (HYMENOPTERA: FORMICIDAE)
AND MOUNDS IN MISSISSIPPI, AND THEIR POTENTIAL
USE AS BIOLOGICAL CONTROL AGENTS
By
Sandra Winia Woolfolk
Approved:
______Richard E. Baird Gerald T. Baker Professor of Plant Pathology Professor of Entomology (Major Professor) (Committee Member)
______Jack T. Reed Clarence H. Collison Research Professor of Entomology Head and Graduate Coordinator, (Committee Member) Department of Entomology and Plant Pathology (Committee Member)
______Melissa Mixon Interim Dean of the College of Agriculture and Life Science
Name: Sandra Winia Woolfolk
Date of Degree: May 1, 2010
Institution: Mississippi State University
Major Field: Entomology and Plant Pathology (Life Sciences)
Major Professor: Dr. Richard E. Baird
Title of Study: BACTERIA AND FUNGI ASSOCIATED WITH RED IMPORTED FIRE ANTS SOLENOPSIS INVICTA BUREN (HYMENOPTERA: FORMICIDAE) AND MOUNDS IN MISSISSIPPI, AND THEIR POTENTIAL USE AS BIOLOGICAL CONTROL AGENTS
Pages in Study: 255
Candidate for Degree of Doctor of Philosophy
The assemblage of bacteria and fungi associated with red imported fire ants (RIFA) Solenopsis invicta Buren was obtained from Hinds, Leake, and Madison Counties (location) along Natchez Trace Parkway in
Mississippi. The sites were selected due to the limited presence of RIFA within the park and the more natural, undisturbed ecosystem. Active mounds containing soil, plant debris, and RIFA (substrate) were collected in March, July, and November of 2004 (time). Samples were processed according to standard microbiological protocols, and microorganisms identified using morphological, biochemical and molecular methods.
A total of 71 bacteria (2324 isolates) and 50 fungi (1445 isolates) were obtained. The most common bacterium and fungus identified were
Bacillus sp. B76(B)Ydz-zz, and Trichoderma aureoviride strain
IMI 113135. The fungal entomopathogens Paecilomyces lilacinus and
Metarhizium anisopliae var. anisopliae were isolated from mound soil, plant debris, and external tissues of the ants. Patterns of species richness, diversity, and evenness values across substrates were 71, 1.58, and 0.37 for bacteria, and 50, 1.11 and 0.28 for fungi, respectively.
Total coefficient of community values for bacteria were 0.74 – 0.89 and
0.79 – 0.92 for fungi indicating uniform communities. No consistent trends were observed by comparing substrate, location, and sampling date. However, fungi species richness and diversity for ant external tissues were significantly higher than internal tissues of the ant.
Selected bacteria and fungi were evaluated for their biological control and/or antagonistic potential in vitro and in situ. The most promising isolates studied in vitro included Paenibacillus sp. JA-08,
Aspergillus terreus, and Aspergillus sp. HZ-35 with death rates on mound soil surface at 4.4, 5.0, and 4.8. The fungus Metarhizium anisopliae var. anisopliae strain LRC 211 had low death rate (1.8) on mound soil during in vitro trial but showed the greatest biocontrol potential during in situ evaluation. After 14 days in situ evaluation, the living RIFA extracted showed sluggish movement and the fungus was recovered from dead
(48.3%) and living (33.3%) RIFA. Since the in situ trials were conducted only at one location and season, additional tests, including microscopic
documentation of parasitism/pathogenicity, are needed to confirm the results of this study.
DEDICATION
This work is dedicated to my mother, Sri Winaryati Wattimena; my brother, Frederick Alexander Wattimena; my sister, Sophia Isabella
Wattimena-Bangun; my husband, Walter Theodore Maner Woolfolk, and my two children, Grace Elizabeth and Joshua Ezekiel Woolfolk. I also dedicate this research in memory of my late father, Leonardus Jan
Wattimena who inspired me with the love of science and of God’s creation.
ii
ACKNOWLEDGEMENTS
I am indebted to my major professor, Dr. Richard E. Baird,
Department of Entomology and Plant Pathology, Mississippi State
University (EPP-MSU), for his invaluable advice and magnanimity in expending time and effort to guide and assist me throughout the doctoral program and dissertation research project; committee members,
Dr. Gerald T. Baker and Dr. Clarence H. Collison (EPP-MSU), for their guidance and direction during my study; and committee member,
Dr. Jack T. Reed (EPP-MSU) for his advice and guidance with the field- cage study. I am also grateful to the following individuals who contributed to the success of this project: Dr. Clarence E. Watson
(Oklahoma Agricultural Experiment Station, Oklahoma State University) with his assistance in statistical analyses; Dr. Jian Chen (Biological
Control of Pests Research Unit, USDA-ARS, Stoneville, MS) with analysis of venom alkaloids of fire ants; Dr. Sergio T. Pichardo (EPP-MSU) with his assistance in field collection of fire ants and soil mound sterilization,
Dr. David Smith (formerly with the Department of Agricultural and
Biological Engineering, MSU) for providing space and allowing me to conduct a field-cage study on his personal farm property; Chris Jackson
iii and Dung Bao (EPP-MSU) for their assistance with the field-cage study;
Dr. Angus Catchot and his team (EPP-MSU) as well as David Cross (EPP-
MSU) for their assistance in sending samples to Stoneville, MS for venom alkaloids analysis; Dr. Frank Davis (EPP-MSU) for his words of wisdom as well as providing space to rear fire ants and to conduct laboratory study in the Insect Rearing Center of Mississippi State University,
Dr. Shi-En Lu (EPP-MSU) for his advice in the portion of the project related to bacteria; Dr. Sead Sabanadzovic (EPP-MSU) for assistance in molecular techniques; Mary Scruggs (EPP-MSU) for her aid and continuous support during laboratory work; graduate students in
Dr. Baird’s lab: Mark Alexander, Bill Starrett, and David McNeill (EPP-
MSU) for their assistance in fire ant extraction; undergraduate student trainees and intern: Daisy Goodman, Emily Tuck, Becky Baker, Hana
Mujahid, Elia Ana Villarroel and Katie Warner, who assisted me in many aspects of the project; and the National Park Service for allowing me to collect samples from Natchez Trace Parkway area in Mississippi. I can never thank enough the following institutions, agency, organizations, and professional societies who provided funding for research and travel award to present data at various meetings: Mississippi State University
(MSU), USDA-ARS (Specific Cooperative Agreement), MSU Women’s Club,
MSU Graduate Student Association, Sigma Xi (Grants-In-Aid for
Research), American Institute of Biological Sciences, National Pest
iv
Management Association’s Minorities in Pest Management, Pi Chi
Omega, Entomological Society of America, Mississippi Entomological
Association, Mississippi Association of Plant Pathologists and
Nematologists, and Mycological Society of America. Last but not least,
I would like to thank my husband, Walter Woolfolk, and children, Grace and Joshua, for their forgiving heart and putting up with me for being away for many weekends and nights to complete this project.
v TABLE OF CONTENTS
DEDICATION...... ii
ACKNOWLEDGEMENTS ...... iii
LIST OF TABLES ...... ix
LIST OF FIGURES ...... xv
CHAPTER
I. INTRODUCTION AND LITERATURE REVIEW...... 1 Brief history on the introduction of the imported fire ants (IFA) into the United States ...... 1 Occurrence and distribution...... 3 Biology of the imported fire ant (IFA)...... 5 Control practices of the imported fire ant (IFA) with emphasis on biological control...... 8 Identification of bacteria and fungi ...... 14 Research objectives ...... 18
II. MATERIALS AND METHODS...... 20 Survey of bacteria and fungi associated with red imported fire ants (RIFA), mound soils, and plant debris...... 20 Sample collection and preparation...... 20 Characterization of fire ants ...... 22 Enumeration and isolation of microorganisms...... 22 Isolation from plant debris ...... 23 Isolation from mound soils...... 23 Isolation from external body region of RIFA ...... 24 Isolation from the internal body region of RIFA...... 24 Characterization of bacteria and fungi ...... 25 Sample preparation and identification using MIDI system ..... 26 Harvesting ...... 27 Saponification...... 27
vi Methylation...... 29 Extraction...... 30 Base wash ...... 30 Traditional and biochemical tests for bacteria...... 31 Gram reaction and cellular morphology...... 31 Indole Test...... 32 Catalase Test ...... 33 Cytochrome oxidase test ...... 33 Carbon source utilization test ...... 34 Molecular characterization ...... 36 Genomic DNA extraction for bacteria...... 36 Genomic DNA extraction for fungi ...... 40 Polymerase Chain Reaction (PCR) conditions for bacteria .. 41 Polymerase Chain Reaction (PCR) conditions for fungi...... 43 Purification of Polymerase Chain Reaction (PCR) products ...... 44 DNA Sequencing ...... 45 Evaluating selected bacteria and fungi isolated as potential biological control agents for RIFA ...... 48 Laboratory experiment (in vivo study) ...... 48 Field cage experiments (in situ study) ...... 53 Statistical analyses...... 58
III. RESULTS ...... 62 Survey of bacteria and fungi associated with red imported fire ants (RIFA), mound soils, and plant debris...... 62 In vivo and in situ studies of selected bacteria and fungi isolated from red imported fire ants (RIFA) and mounds .... 93 Control by antagonism ...... 93 Control by mortality effects...... 96
IV. DISCUSSION...... 114 Survey of bacteria and fungi associated with red imported fire ants (RIFA), mound soils, and plant debris...... 114 In vivo and in situ studies of selected bacteria and fungi isolated from RIFA and mounds ...... 124
V. SUMMARY ...... 132
LITERATURE CITED ...... 135
vii APPENDIX
A. SUPPORT DATA ON THE SURVEY OF BACTERIA AND FUNGI ASSOCIATED WITH RED IMPORTED FIRE ANTS, MOUND SOILS, AND PLANT DEBRIS...... 157
B. SUPPORT DATA ON THE IN VIVO AND IN SITU STUDIES OF SELECTED BACTERIA AND FUNGI ISOLATED FROM RED IMPORTED FIRE ANTS AND MOUNDS...... 213
viii LIST OF TABLES
1 Biodiversity indicesA measured during this study...... 60
2 Mean percent isolation frequencies of bacterial taxa identified from red imported fire ant mounds from three locations (Hinds, Madison, and Leake Counties) along Natchez Trace Parkway in Mississippi...... 65
3 Mean percent isolation frequencies of fungal taxa identified from red imported fire ant mounds from three locations (Hinds, Madison, and Leake Counties) along Natchez Trace Parkway in Mississippi...... 71
4 Species richness of all bacterial taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi...... 80
5 Species richness of all fungal taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi...... 80
6 Species richness of all bacterial taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi...... 81
7 Species richness of all fungal taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi...... 81
8 Species diversity of all bacterial taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi...... 83
ix 9 Species diversity of all fungal taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi...... 84
10 Species diversity of all bacterial taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi...... 84
11 Species diversity of all fungal taxa isolated from red imported fire ants and mounds by substrate-location along Natchez Trace Parkway in Mississippi...... 85
12 Species evenness of all bacterial taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi...... 87
13 Species evenness of all fungal taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi...... 87
14 Species evenness of all bacterial taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi...... 88
15 Species evenness of all fungal taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi...... 88
16 Coefficient of community of all bacterial taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi...... 91
17 Coefficient of community of all fungal taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi...... 92
18 Coefficient of community of all bacterial and fungal taxa isolated from red imported fire ants and mounds by location/substrates interaction along Natchez Trace Parkway in Mississippi...... 92 x 19 Comparison of coefficient of community of all bacterial and fungal taxa isolated from red imported fire ants and mounds by location/AE-AIA tissues interaction collected along Natchez Trace Parkway in Mississippi...... 93
20 Mean resultsA from the in vivo experiment studies of three tester bacteria and fungi showing the greatest potential for control of red imported fire ants...... 99
21 MeanA number, weights and percentage of dead red imported fire ants (RIFA) from mound soils containing selected bacterial isolates in situ...... 105
22 MeanA and total numbers of red imported fire ants (RIFA) from mound soils containing selected bacterial isolates in situ...... 106
23 MeanA number, weights and percentage of dead red imported fire ants (RIFA) from mound soils containing selected fungal isolates in situ...... 107
24 MeanA and total numbers of red imported fire ants (RIFA) from mound soils containing selected fungal isolates in situ. . 109
25 MeanA number and percentage of bacterial taxa isolated and/or recovered from red imported fire ants (RIFA) in situB...... 110
26 MeanA number and percentage of fungal taxa isolated and/or recovered from red imported fire ants (RIFA) in situB...... 112
27 Biochemical and morphological characteristicsA of bacteria isolated from red imported fire ants (RIFA), mound soils, and plant debris along Natchez Trace Parkway in Mississippi...... 158
28 Carbohydrate utilization profilesA of Gram negative bacteria isolated from red imported fire ants (RIFA), mound soils, and plant debris along Natchez Trace Parkway in Mississippi...... 162
29 Carbohydrate utilization profilesA of Gram positive bacteria isolated from red imported fire ants (RIFA), mound soils, and plant debris along Natchez Trace Parkway in Mississippi...... 175 xi
30 Comparison of fatty acid methyl esters (FAME) analyses and molecular identification of bacteria isolated from red imported fire ants (RIFA), mound soils, and plant debris along Natchez Trace Parkway in Mississippi...... 189
31 Mean number occurrences of all bacteria isolated from red imported fire ant (RIFA) mounds by locations along Natchez Trace Parkway in Mississippi...... 201
32 Mean number occurrences of all bacteria isolated from red imported fire ant (RIFA) mounds by sampling dates along Natchez Trace Parkway in Mississippi...... 201
33 Mean number occurrences of all bacteria isolated from external and internal body regions of red imported fire ant (RIFA) by sampling dates along Natchez Trace Parkway in Mississippi...... 202
34 Mean number occurrences of all fungi isolated from red imported fire ant (RIFA) mounds by locations along Natchez Trace Parkway in Mississippi...... 202
35 Mean number occurrences of all fungi isolated from red imported fire ant (RIFA) mounds by sampling dates along Natchez Trace Parkway in Mississippi...... 203
36 Mean number occurrences of all fungi isolated from external and internal body regions of red imported fire ant (RIFA) by sampling dates along Natchez Trace Parkway in Mississippi...... 203
37 Species richness of all bacterial taxa isolated from red imported fire ants and mounds by location-tissue along Natchez Trace Parkway in Mississippi...... 204
38 Species richness of all fungal taxa isolated from red imported fire ants and mounds by location-tissue along Natchez Trace Parkway in Mississippi...... 204
39 Species diversity of all bacterial taxa isolated from external and internal body regions of red imported fire ants and mounds by location-tissue along Natchez Trace Parkway in Mississippi...... 205
xii 40 Species diversity of all fungal taxa isolated from external and internal body regions of red imported fire ants and mounds by location-tissue along Natchez Trace Parkway in Mississippi...... 205
41 Species evenness of all bacterial taxa isolated from external and internal body regions of red imported fire ants and mounds by location-tissue along Natchez Trace Parkway in Mississippi...... 206
42 Species evenness of all fungal taxa isolated from external and internal body regions of red imported fire ants and mounds by location-tissue along Natchez Trace Parkway in Mississippi...... 206
43 Death rates (DR) of red imported fire ants (RIFA) for selective medium containing tester bacterial isolates and for the surface of mound soils across all evaluation trials...... 214
44 Foraging rates (FR) of red imported fire ants (RIFA) for selective medium containing tester bacterial isolates and for the RIFA diet across all evaluation trials...... 217
45 Mean percent diet consumption and remaining by red imported fire ants (RIFA) for selective medium containing tester bacterial isolates across all evaluation trials...... 220
46 Death rates (DR) of red imported fire ants (RIFA) for selective medium containing tester fungal isolates and for the surface of mound soils across all evaluation trials...... 223
47 Foraging rates (FR) of red imported fire ants (RIFA) for selective medium containing tester fungal isolates and for the RIFA diet across all evaluation trials...... 227
48 Mean percent diet consumption and remaining by red imported fire ants (RIFA) for selective medium containing tester fungal isolates across all evaluation trials...... 231
49 Death rates (DR) of red imported fire ants (RIFA) for selective medium containing tester bacterial isolates and for the surface of mound soils within evaluation trials...... 235
xiii 50 Foraging rates (FR) of red imported fire ants (RIFA) for selective medium containing tester bacterial isolates and for the RIFA diet within evaluation trials...... 238
51 Mean percent diet consumption and remaining by red imported fire ants (RIFA) for selective medium containing tester bacterial isolates within evaluation trials...... 241
52 Death rates (DR) of red imported fire ants (RIFA) for selective medium containing tester fungal isolates and for the surface of mound soils within evaluation trials...... 244
53 Foraging rates (FR) of red imported fire ants (RIFA) for selective medium containing tester fungal isolates and for the RIFA diet within evaluation trials...... 248
54 Mean percent diet consumption and remaining by red imported fire ants (RIFA) for the selective medium containing tester fungal isolates within evaluation trials. 252
xiv LIST OF FIGURES
1 The quarantine map of imported fire ant infestations in the United States (Source: USDA)...... 3
2 A summary of the extract preparation activities using MIDI System...... 28
3 Quadrant streak technique for culturing bacterial cells on agar plates...... 29
4 Carbon sources in GN MicroPlate...... 37
5 Carbon sources in GP MicroPlate...... 38
6 Overall percent isolation frequencies of bacteria from red imported fire ant mounds by genera isolated from Hinds, Madison, and Leake Counties along Natchez Trace Parkway in Mississippi...... 76
7 Overall percent isolation frequencies of fungi from red imported fire ant mounds by genera isolated from Hinds, Madison, and Leake Counties along Natchez Trace Parkway in Mississippi...... 77
8 Red imported fire ant workers carried plant debris from the mound soils onto the culture plate to construct a bridge as a means to reach their food source...... 95
9 Red imported fire ants were found dead one day after attempting feeding on their food source...... 96
10 Species richness of bacterial taxa isolated from red imported fire ants and mounds by interaction of substrate- sampling date along Natchez Trace Parkway in Mississippi...... 207
xv 11 Species richness of fungal taxa isolated from red imported fire ants and mounds by interaction of substrate-sampling date along Natchez Trace Parkway in Mississippi...... 208
12 Species diversity of bacterial taxa isolated from red imported fire ants and mounds by interaction of substrate- sampling date along Natchez Trace Parkway in Mississippi...... 209
13 Species diversity of fungal taxa isolated from red imported fire ants and mounds by interaction of substrate-sampling date along Natchez Trace Parkway in Mississippi...... 210
14 Species evenness of bacterial taxa isolated from red imported fire ants and mounds by interaction of substrate- sampling date along Natchez Trace Parkway in Mississippi...... 211
15 Species evenness of fungal taxa isolated from red imported fire ants and mounds by interaction of substrate-sampling date along Natchez Trace Parkway in Mississippi...... 212
xvi
CHAPTER I
INTRODUCTION AND LITERATURE REVIEW
Brief history on the introduction of the imported fire ants (IFA)
into the United States
The imported fire ants (IFA), Solenopsis spp. are a difficult insect pest to control and have become one of the major pests throughout southeastern United States (Vinson and Sorensen 1986). They are aggressive and effective at foraging, mobilize rapidly, and sting relentlessly when their mounds are disturbed (Gilbert 1998, Vinson
1994). They are extremely resilient and able to adapt to both flooding and drought conditions. The IFA was first introduced into the United
States in 1918 or 1919 surrounding the port of Mobile, Alabama (Green
1967). This introduction resulted in the arrival of black imported fire ants (BIFA), Solenopsis richteri Forel, which came from the Parana and
Uruguay Rivers in Argentina and Uruguay (Vinson and Sorensen 1986).
The second introduction was thought to occur in the 1930s which introduced the red imported fire ants (RIFA), Solenopsis invicta Buren,
into the United States, also through the Mobile area (Buren et al. 1974,
1
Lofgren et al. 1975, Lofgren 1986a). The RIFA, a much more aggressive species than BIFA, appeared to have come from headwaters of the
Paraguay River located in Northern Argentina, Paraguay, and Southern
Brazil (Vinson and Sorensen 1986); they moved slowly north through
Georgia to North Carolina and west to Southern region of Mississippi to
Texas (Green 1967, Vinson and Sorensen 1986). The rapid spread of the
IFA in the United States after their introduction was due to a lack of natural enemies and competitors that limit their population growth in their natural range (South America) (Whitcomb 1980). The IFA presently inhabit more than 129.5 million hectares in 14 states including Texas,
California, New Mexico, and Puerto Rico (Calcott and Collins 1996, Code of Federal Regulations 2001, Lofgren 1986a, Mott 2005). The current quarantine map of the IFA infestations in the United States is shown in
Figure 1. The IFA has continued to spread across the country and currently occupies most of the southeastern United States (Calcott and
Collins 1996). In 1939, the IFA first entered Mississippi through George,
Green, and Jackson Counties. By late 1950s, 50% of the counties were inhabited by IFA, and by 1980s, all 82 counties in Mississippi had some level of IFA infestation (Collins 1982).
2
Figure 1 The quarantine map of imported fire ant infestations in the United States (Source: USDA).
Occurrence and distribution
There are currently four species of fire ants in Mississippi, two native species and two imported (IFA) species as previously discussed. In addition, a hybrid ant that is a cross between the two IFA is also found
(Vander Meer and Lofgren 1985). Solenopsis geminata (Fabricius)
(tropical fire ant) is a native ant species. Their distribution ranges from
Texas to South Carolina and Florida and to the south and to Costa Rica.
3
Although this species usually infests only the coastal regions of the Gulf
States, it can spread inland as far as 241.5 km (Anonymous 2000).
Solenopsis xyloni McCook (southern fire ant), another native species, is distributed from North Carolina to the northwest corner of Florida and west to California. Solenopsis richteri (BIFA), which once inhabited most
areas of the state, is now limited to northeast Mississippi and northwest
Alabama with some scattered colonies along the Mississippi and
Tennessee border. Solenopsis invicta (RIFA) is distributed from North
Carolina, South Carolina, and Florida west to Arkansas and Texas.
Presently all Mississippi regions are considered to be infested with this
species (Jarratt and Harris 2001), particularly south of a geographic area
that runs somewhere between Macon and West Point (Anonymous 2000).
It is thought that the RIFA will displace both the BIFA and hybrid fire ant
(HIFA) in Mississippi and may become the only fire ant species in the
state (Anonymous 2000, Streett et al. 2006). The HIFA, a cross between
BIFA and RIFA, is distributed in the area where the ranges of both species merge with one another. They are commonly present in northeast Mississippi and northwest Alabama (Jarratt and Harris 2001,
Streett et al. 2006). Recent survey in Mississippi revealed that HIFA inhabit the Tombigbee National Forest and Natchez Trace Parkway and
16 other state parks in Mississippi, and BIFA occupy the Black Belt
Prairie and Black Belt grazed pasture (Brown et al. 2003, MacGown et al.
4
2007). Due to IFA inhabitants, many school yards, parks and campgrounds are no longer safe place for family outings (Anonymous
2007, Nester and Hurley 2006), and maintenance of golf courses, athletic fields and race tracks have also become much more costly (Anonymous
2007, Anonymous 2008a, Drees 2002, Dorough 2005).
Biology of the imported fire ant (IFA)
Two main methods that cause the spread of the IFA are natural movement and man-assisted movement (Lockley 1996, Vinson and
Sorensen 1986). The natural movement of IFA occurs when colonies are established by newly-mated queens following a mating flight. The natural movement may also happen when the IFA colonies are disturbed or when competition with other ants occurs. The man-assisted movement may happen through the movement of nursery stock, construction equipment, hay bales, and agriculture equipment
(Anonymous 2000, Green 1967, Vinson and Sorensen 1986).
As social insects, the IFA live in colonies. The colonies of IFA consist of immature ants (brood) and adults (Lofgren and Vander Meer
1986, Smith and Vogt 2000, Taber 2000). The brood is comprised of eggs, larvae, and pupae. There are different types or castes of IFA adults within IFA colonies. The castes include winged males, winged females
(unmated queens), workers of different size, and one or more mated
5 queens. In the spring and summer, the winged (alate) males and females fly from their nests to mate in flight. Upon landing, mated females find a suitable nesting site and then shed their wings. The mated males, on the other hand, die after mating. Thousands of male and female alates can be produced every year; however, approximately 10% of the females survive to produce a new colony. Once a new colony is established, a single queen is capable of laying more than 2,000 eggs daily. It takes
20-45 days, depending on temperature, for eggs to develop into adult workers. Workers live as long as 9 months at 24 ºC but their average life span is generally between 1 and 6 months. A single-queen colony can have 250,000 workers. In some states there are up to 10 colonies per acre and each colony can produce 5,000 offspring annually (Green 1967,
Lofgren et al. 1964, Smith and Vogt 2000).
The IFA are opportunistic feeders and omnivorous (Lofgren et al.
1975, Lofgren 1986b, Vinson 1994). Their diet includes proteins (for example, living and dead insects, meat) (Lofgren et al. 1975, Lofgren
1986b, Smith and Vogt 2000), various types of plants (Lofgren 1986b,
Vinson 1994), carbohydrates including honeydew from homopteran insects or other invertebrates, plant exudates, sugars (Adams 1986,
Wojcik 1986, Smith and Vogt 2000), and lipids such as grease, lard, oil from seeds (Green 1967, Lofgren et al. 1964, Smith and Vogt 2000).
6
Adult IFA require carbohydrates and/or lipids to sustain themselves
throughout the year (Smith and Vogt 2000).
The IFA cause problems in agricultural settings as well as affect
humans and animals. The IFA have caused million of dollars loss in
agricultural products such as hay, soybean, and cattle (Lofgren 1986b,
Thompson et al. 1995, Lard et al. 2002). The United States Food and
Drug Administration (FDA) estimates that more than US$5 billion is spent annually on medical treatment, damage, and control in RIFA- infested areas. Further, the ants cause approximately US$750 million in damage to agricultural assets, including crop loss as well as veterinary bills and livestock loss (McDonald 2006). In rural habitats, IFA have a major impact on ground nesting animals including soil-inhabiting arthropods, reptiles, birds, and mammals (Lockley 1996, Vinson 1994,
Wojcik et al. 2001). Allen et al. (1995) reported that the populations of
field mice, oviparous snakes, turtles and other vertebrates decreased at
least two-fold when the IFA are allowed to establish colonies within
a given area. The reduction or elimination of a group of species from an
ecosystem has repercussions throughout the local food web (Lockley
1996). In addition to animals and agricultural products, the IFA also
affect human. DeShazo and Williams (1995) reported that 30-60 % of
people who live in the IFA-infested area are stung every year; 1% of these
people may require a physician’s aid due to the anaphylaxis caused by
7
IFA stings. The IFA have impact on the biodiversity in many areas
(Vinson 1994, Wojcik et al. 2001) and was also reported that they influenced texture and fertility of soils (Green et al. 1998, Green et al.
1999).
Control practices of the imported fire ant (IFA) with emphasis on
biological control
The most common control practice for IFA is chemical insecticides
using two-step control methods (Anonymous 2008a, Vail et al. 2005),
which use a broadcast application with baits followed by individual
mound treatment. These control methods have rapid effect on IFA;
however, generally they are only temporary, are not economical for large
areas and can have negative impact to other organisms including
beneficials (Williams et al. 2003). Because of this, there have been
growing interests in utilizing biological control agents to reduce and even
control IFA populations in the United States (Porter et al. 1995a, 1995b).
Porter et al. (1997) reported that the average densities of IFA in the
United States are more than five times higher than in their natural area in South America. The main reasons for these differences may be due to the presence of biological factors such as predators, parasites, pathogens, and competitors in South America but not in the United
States. Other factors such as climate, habitat, and cultural practices do
8
not explain intercontinental differences (Williams et al. 2003). Currently
several potential biological control agents are under study by scientists
throughout southern United States. Most of these biological control
agents are of South-America origin (Oi and Williams 2002, Pereira et al.
2002, Williams et al. 2003). Some examples include parasitic insects
and insect pathogens as described below.
The ant Solenopsis daguerrei (Santschi) (Patterson et al. 1993,
Williams et al. 2003) is a social parasitic ant and a natural enemy of IFA.
These parasitic ants produce only queens and males, and attack the IFA colonies by attaching themselves to the IFA queen (Bruch 1930). It was reported that this parasitic ant inhibits the egg production of IFA queen and cause the IFA colony to collapse and die (Silveira-Guido et al. 1962,
1963, 1964, 1965, 1967, 1968, 1973). Calcaterra et al. (1999) reported that large populations of this parasitic ant in the IFA colony reduced the populations of IFA workers. Their presence also caused detrimental effects to the IFA colony growth, ratio of male and female reproductives in the colony, and the number of IFA queens in polygyne colonies
(Calcaterra et al. 1999, 2000a, 2000b).
Phorid flies Pseudacteon spp. are a promising group for biological control of IFA. Scientists have reported a success of laboratory mass rearing and field release of Pseudacteon tricuspis Borgmeier and
Pseudacteon curvatus Borgmeier in the United States (Porter et al. 1997,
9
Graham et al. 2003). These flies are highly specific in their host preferences (Porter et al. 1995a, 1995b, Porter and Alonso 1999, Porter and Briano 2000), are widely distributed across climate, geographical region, and season (Fowler et al. 1995, Porter 1998), and influence the
IFA behavior (Porter et al. 1995a, 1995b). Phorid flies attack individual
IFA workers, stop IFA foraging, and shift the local competitive balance to other ant species (Orr et al. 1995, Porter et al. 1995b). The larvae of phorid flies pupate in the IFA’s head capsule and then decapitate the
IFA.
In addition to the parasitic insects, several insect pathogens are currently under study as potential biological control agents. The microsporidium, Thelohania solanapsae Knell, Allen, and Hazard, is an intracellular obligate pathogen (Jouvenaz 1986, Knell et al. 1977,
Patterson et al. 1993), and is the most common natural enemy of the fire ants in Argentina (Briano et al. 1995). This pathogen is vertically transmitted (transovarial transmission) from the queen to its progeny
(Briano et al. 1996, Tanada and Kaya 1993). Laboratory studies indicated that monogyne and polygyne colonies of RIFA that had been infected with T. solanapsae reduced the brood by 85-100 % after
22-52 weeks and increased the mortality of queens (Williams and Oi
1998, Oi and Williams 2002). Briano et al. (1995) reported that the application of T. solanapsae had decreased the density of BIFA in
10
Argentina by 83 % after 4 years. Another protozoan disease, caused by
Mattesia sp., was recently found in Florida and may have significant
impact on IFA (Pereira et al. 2002). The disease was named yellow-head disease (YHD) because it causes an atypical yellow-orange color of the heads of infected IFA (Williams et al. 2003).
Entomopathogenic nematodes in the genus Steinernema have been
investigated by several researchers. Poole (1976) discovered in
laboratory assays that larvae of IFA are relatively susceptible to
Steinernema carpocapsae (Weiser) Wouts, Mracek, Gerdin, and Bedding,
whereas IFA adults are less susceptible. Miller et al. (1988) obtained
minimal control with this nematode in a series of field trials in Florida
and Texas.
The potential of entomopathogenic fungi as biological control
agents of IFA have also been investigated. The two most common ones
are Beauveria bassiana (Balsamo) Vuillemin and Metarhizium anisopliae
(Metschnikoff) Sorokin. A mortality rate of 90% was observed when BIFA
was exposed to B. bassiana (Broome 1974, Broome et al. 1976). Stimac
et al. (1993) conducted an investigation on the effects of a Brazilian
strain of this fungus to the IFA colonies and discovered that B. bassiana
provided some control of the treated colonies. Beauveria bassiana has
also been formulated as baits and tested against IFA (Barr and Drees
2003, Barr et al. 2003, Patterson et al. 1993, Williams et al. 2003). The
11
IFA were observed retrieving the bait and generally increase the level of fungal infection to the IFA (Williams et al. 2003) but there was a case where B. bassiana treatment caused little mortality to workers, brood, or queens (Barr and Drees 2003). Beauveria bassiana has also been developed as a commercial biopesticide by several companies including
SafeScience (Boston, MA) and Troy Biosciences (Phoenix, AZ) (Williams et al. 2003). In tests with another entomopathogenic fungus, Sanches-Peña
(1992) reported that M. anisopliae caused 100% mortality of 15 IFA queens after 5 days.
Prior to 2003, only little effort was put into studying bacteria and viruses as biological control agents of IFA (Williams et al. 2003).
However, in the past four years, there have been more studies to explore the roles of bacteria and viruses as symbionts and/or potential entomopathogens. Using plasmid vector pZeoDsRed, Medina et al.
(2006) genetically modified three bacterial strains isolated from RIFA midgut and successfully reintroduced them into RIFA colonies. They were able to demonstrate that nurses contributed to the spread of the engineered bacteria within the colony by feeding the meconium to the naive larvae. Further studies were conducted to determine whether the engineered bacteria could be utilized in the control effort of fire ants
(Coates et al. 2002). Two positive-strand RNA viruses were recently found to infect ants in the Solenopsis genus only. The virus was named
12
Solenopsis invicta virus-1 (SINV-1) and Solenopsis invicta virus-2 (SINV-
2), and both are assigned to the family of Dicistroviridae (Hashimoto and
Valles 2008, Valles et al. 2007, Valles et al. 2008a, Valles et al. 2008b,
Valles and Strong 2005).
With respect to biological control, a possibility of using antagonistic mechanism that are commonly utilized in plant pathology to manage RIFA is also considered. Three different mechanisms of antagonism (Ownley and Windham 2004) include the following:
1) antibiosis, it is the inhibition or destruction of an organism caused by a metabolite produced by another organism, 2) competition, it is the result of two or more organisms attempting to utilize the same food source or the same niche or habitat, and 3) parasitism, it is the feeding of an organism on another organism.
While searching for potential microbial control agents, surveys of microorganisms were also occasionally conducted (Beckham et al. 1982,
Jouvenaz et al. 1977, Zettler et al. 2002) in the United States. The two most recent surveys of bacteria and fungi associated with IFA were conducted in Louisiana and Mississippi. In Louisiana, bacteria from the fourth-instar larvae of RIFA guts were surveyed using culture- independent technique based on the 16S rDNA sequences. The most predominant bacterial clones were from the phylum Proteobacteria and the family Enterobacteriaceae (Lee 2007, Lee et al. 2008). Recently,
13
Baird et al. (2007) conducted a survey of associated culture-dependent bacteria and fungi of BIFA/HIFA mounds to compare the diversity and density of the microorganisms on BIFA/HIFA, soils, and plant debris within mounds in selected regions of northeast Mississippi. A total of
5724 isolates comprised of 58 bacterial and 35 fungal taxa were collected from the study. This study provided baseline data of microorganisms associated with BIFA/HIFA particularly in north Mississippi area. As
RIFA is slowly displacing BIFA and HIFA in the northern part of
Mississippi (Streett et al. 2006), additional baseline data of microorganisms associated with RIFA is needed. The type of research that involves a novel approach to IFA biological control, including isolation and identification of microorganisms from RIFA, their mounds, and plant debris within the mounds, is needed to provide additional options for a long-term sustainable control of IFA.
Identification of bacteria and fungi
Identification of bacteria and fungi has traditionally been performed utilizing morphological and cultural characteristics. These traditional microbiological methods involve enrichment culture, cultivation on selective agar media, and a series of biochemical tests on presumptive colonies to identify the microorganisms. Such standard methods are slow and laborious, and often require several days to weeks
14 to perform and to obtain the name of microorganisms (Jones and Bej
1994, Perry and Staley 1997). With the advance of technology, automated identification systems have become common practices in many laboratories. Gas-liquid chromatography (GLC) is used to separate and identify fatty acids (9 to 20 carbons in length) to produce chromatograms for identifying microorganisms without the need for other phenotypic information such as gram reaction and oxidase profiles in bacteria (Forbes et al. 1998). Fatty acid methyl ester (FAME) analysis offers a cost-effective, efficient, rapid, sensitive method to characterize and identify microorganisms, including bacteria (Sasser 1990). The
FAME procedure utilizes a computer software package (Microbial
Identification System; Microbial ID, Inc. (MIDI), Newark, DE) and compares qualitative and quantitative differences of bacterial FAME compositions. The FAME analysis is based on species databases and the analysis is not affected by plasmid loss or gain or rarely influenced by organism mutations (Anonymous 2003b).
Molecular techniques have been widely used in many laboratories in North America for identification of organisms. Molecular identification offers several advantages compared to traditional methods for rapid, reliable detection, and accurate identification of microorganisms (Forbes et al. 1998, Jones and Bej 1994). The advantages include: (1) the ability to detect and identify nonviable organisms that cannot be cultured or are
15
difficult to culture (fastidious microorganisms), (2) more rapid detection
and identification of organisms that grow slowly, (3) animal models or
host tissues are not needed, and (4) shorter times to perform compared
to traditional methods. The most widely used target nucleic acid
amplification method is the polymerase chain reaction (PCR). By this
method, a single copy of a nucleic acid target is multiplied to 107 or more copies within a relatively short period. The PCR involves 30 to 50 repetitive cycles and each cycle consists of the following sequential reactions: denaturation of target nucleic acid, primer annealing to single- stranded target nucleic acid, and extension of primer-target duplex. The target nucleic acid of interest produced by PCR amplification is referred to as amplicon. To detect the PCR products, a labeled probe that is specific for the target sequence within the amplicon is used. These probes serve two purposes: they allow visualization of PCR products and provide specificity by ensuring that the amplicon is the target sequence of interest. Following the detection of PCR products, the portion of the
PCR mixture is subjected to gel electrophoresis, stained with ethidium bromide to visualize the amplicon, and the presence of amplicons (the size of target sequence amplified on the basis of primers selected) of appropriate size is confirmed (Forbes et al. 1998). Examples for DNA regions to amplify include 16S ribosomal RNA (rRNA) genes for bacteria
(Amann et al. 1994, Coplin and Kado 2001), and internal transcribed
16 spacer (ITS) regions 1 and 2 for fungi (Abesha and Caetano-Anollés
2003).
To determine the identity of microorganisms, the next step is DNA sequencing. The DNA sequencing refers to methods used to determine the order of the bases of nucleotides (adenine, guanine, cytosine, and thymine) (Alberts et al. 2007). The methods have become increasingly important not only for basic biological research, but also for applied research such as diagnostic, biotechnology, and/or forensic biology.
Using the knowledge of DNA sequencing, various research projects have been conducted and accomplished the complete DNA sequences of human as well as many animals, plants, and microbial genomes (Alberts et al. 2007, Maxam and Gilbert 1977). Chain-termination method (also known as Sanger method) is the method commonly used in many research laboratories; this method is more efficient, uses fewer toxic chemicals and lower amounts of radioactivity (Sanger et al. 1977, Sanger
1980) in comparison to older methods (for example, Maxam-Gilbert sequencing) (Maxam and Gilbert 1977). The main principle for Sanger sequencing technique is the use of dideoxynucleotide triphosphates
(ddNTPs) as DNA chain terminators. Modified version of Sanger method is the dye-terminator sequencing which utilizes labeling of the chain terminator of ddNTPs (Anonymous 2003a). In this sequencing method, each of the four dideoxynucleotide chain terminators is labeled with
17 fluorescent dyes and each dye has different fluorescent wavelengths and emission (Smith et al. 1986). The method requires reaction mixture of the dye terminator cycle sequencing chemistry which includes a single- stranded DNA template, a DNA polymerase, deoxynucleotides (consisting of a mixture of dATP, dGTP, dCTP, and dTTP), a primer, individual dye conjugated ddNTP's, reaction buffer, and water. The CEQ 8000
Beckman Coulter Genetic Analysis System is an example of the dye- terminator gene sequencer (Beckman Coulter, Fullerton, CA). At the end of sequencing, one should be able to determine the identity of an organism since each DNA sequence comprises the basic blueprint for that organism.
Research objectives
As RIFA is slowly displacing BIFA and HIFA in northern Mississippi
(Streett et al. 2006), baseline data of microorganisms associated with
RIFA is necessary. In addition, the need to identify additional potential biological control or antagonistic agents against IFA (i.e. BIFA, HIFA, and
RIFA) cannot be overemphasized. Therefore, the following study was proposed with the following objectives:
1. To temporally compare the diversity and density of culturable bacteria
and fungi associated with red imported fire ants (RIFA), active mound
18
soils, and plant debris collected from three geographical regions in
Mississippi.
2. To further evaluate the diversity and density between culturable
bacteria and fungi isolated from external and internal body regions of
RIFA.
3. To test selected bacteria and fungi isolated as potential biological
control or antagonistic agents against RIFA in laboratory setting (in
vivo study) and field-cage environment (in situ study).
19
CHAPTER II
MATERIALS AND METHODS
Survey of bacteria and fungi associated with red imported fire ants
(RIFA), mound soils, and plant debris
To address objective 1 and 2, a survey was conducted throughout
Mississippi in 2004. Procedures for this experiment were found below.
Sample collection and preparation
Active mounds containing RIFA, mound soils and plant debris were identified and randomly-selected for collection from three counties along the Natchez Trace Parkway in Mississippi. These were the three counties that had been confirmed to be occupied by RIFA; they were Hinds,
Madison and Leake Counties, MS (Streett et al. 2006). In regard to mound characteristics, based on Soil Survey Reports, the three collecting sites had different soil types. Hinds County site consisted of Loring-
Memphis soils (fine-silty, mixed, thermic Typic Fragiudalfs and fine-silty, mixed, thermic Typic Hapludalfs) (Cole et al. 1979). Samples from
Madison County were obtained from sites that possess Byram-Loring soils (fine-silty, mixed, thermic Typic Fragiudalfs) and Providence-
20
Smithdale soils (a mixture of fine-silty, mixed, thermic Typic Fragiudalfs and fine-loamy, siliceous, thermic Typic Paleudults) (Scott et al. 1984), while samples from Leake County were collected from sites that had soil type Providence-Smithdale soils (a mixture of fine-silty, mixed, active, thermic Oxyaquic Fragiudalfs and fine-loamy, siliceous, subactive, thermic Typic Hapludults) and Smithdale-Providence soils (a mixture of fine-loamy, siliceous, subactive, thermic Typic Hapludults and fine-silty, mixed, active, thermic Oxyaquic Fragiudalfs) (Brass et al. 2009).
Samples were collected three times a year beginning in March, continuing in July, and November in 2004. Five active mounds were sampled at each location by collecting 2000 ml of the lower third portion of an active mound into 3.79 L size Ziploc® bags one or two days after
rain. At this time, the water table within the soil increased and the lower
third portion of the mound contained RIFA and broods at a higher
concentration (Vinson 1994). Ziploc® bags containing the samples were
sealed and placed in an ice cooler. Samples were transported to the
laboratory and stored for a maximum of 24 hours at 4°C where 500 g
subsamples were used for microbiological assessment. In addition to the
soil samples, twenty RIFA were randomly-collected from the same
mounds and preserved by submerging them into 70% ethyl alcohol in
10 ml size glass vials (Triplehorn and Johnson 2004).
21
Characterization of fire ants
The ants were identified morphologically to species using keys provided by Trager (1991) and the Mississippi Entomological Museum
(2003a, 2003b). Additionally, chemical analyses were also used to confirm the identity of the fire ants according to standard procedures
(Deslippe and Guo 2000, Vander Meer and Lofgren 1985). Approximately
100-200 workers were immersed in hexane for a minimum of two days.
The solvent was then removed and placed in 2-ml automatic sampler vials. Samples were analyzed using mass spectrophotometry/gas chromatograph to characterize their venom alkaloids and cuticular hydrocarbons at the Biological Control of Pests Research Unit, USDA-
ARS, Stoneville, MS.
Enumeration and isolation of microorganisms
Trypticase soy agar (TSA; Difco™, Detroit, MI), consisting of 15.0 g pancreatic digest of casein, 5.0 g soybean peptone, 5.0 g sodium chloride, 15.0 g agar, and 1 L distilled water, was used for bacterial isolates. Sabouraud’s dextrose agar yeast (SDAY, Difco™), consisting of
4.0 g potato infusion from solids, 20.0 g dextrose, 15.0 g agar, and 1 L distilled water (Goettel and Inglis 1997), was used for fungal isolates.
From the 500 g sample per mound, plant debris, RIFA and soil were removed and plated onto the two media as described below. The TSA
22 was amended with 50 mg/L Nystatin (Sigma, St. Louis, MO) to inhibit fungi, and SDAY with 300 mg/L Streptomycin sulfate (Sigma) and
100 mg/L chlortetracycline (Sigma) to inhibit bacteria.
Isolation from plant debris
Four pieces of plant debris were randomly selected from each sample bag and sectioned into 1 cm2 segments. Pieces of plant debris
were surface sterilized using sodium hypochlorite (w/v 0.534) for
30 seconds, and then aseptically placed within the plates containing
SDAY and TSA (two pieces per medium). Four replicate plates were used
per mound and medium.
Isolation from mound soils
Homogenates of mound soil were prepared by adding 1 g of soil
from each mound into 9 ml of sterile distilled water to prepare tenfold
dilution series (100, 10-1, 10-2, 10-3, and 10-4) modified from the method
described by Baird et al. (2007). Aliquots of 100 μl per dilution were pipetted and spread onto the surface of the TSA and SDAY. Soil homogenate preparation was repeated four times for each sample bag per medium.
23
Isolation from external body region of RIFA
Prior to plating, RIFA were slowed down or immobilized without killing them. This was done by placing the Ziploc® bag that contains
RIFA, mound soils, and plant debris inside the freezer (-20°C) for
approximately 30 minutes (Oi and Oi 1997). Four RIFA workers were
randomly selected from each sample bag. The RIFA were placed into
each medium (two ants each) by sliding them into the agar to prevent the
escape of RIFA. The experiment was repeated four times for each
medium for a total of eight RIFA per isolation medium. Following plating,
fungal cultures were incubated at 25°C for a minimum of 96 hours and
bacterial cultures incubated at 30°C for 72 hours. All bacteria and fungi
growing from the ant bodies were subcultured on TSA or SDAY to obtain
pure cultures.
Isolation from the internal body region of RIFA
The RIFA were paralyzed using the method as described above.
Each RIFA was submerged in 1% sodium hypochlorite containing 0.01%
Tween-80 (Sigma, St. Louis, MO) for 1 minute, submerged in 1% sodium
thiosulfite to neutralize sodium hypochlorite, and rinsed twice with
sterile distilled water. The RIFA were chilled in sterile 50 mM phosphate
buffer containing 0.01% Tween-80 (buffer-Tween). Each RIFA was placed
in a sterile microcentrifuge tube containing chilled buffer-Tween, ground
24 and homogenized using a Kontes® micropestle (Kontes, Vineland, NJ).
Homogenates were diluted in a tenfold dilution series, and aliquots of
100 μl from each dilution were spread using a sterile polypropylene
spreader onto the media. The experiment was replicated four times for
each medium. Fungal cultures were incubated at 25°C for a minimum of
96 hours and bacterial cultures incubated at 30°C for 72 hours. To
obtain pure cultures, all bacteria and fungi growing from the RIFA
internal body regions were subcultured for up to seven days after initial
plating.
Characterization of bacteria and fungi
Due to the limitation of measuring total isolations of bacteria and
fungi for each sampling date, the previously defined protocols were
modified (Baird et al. 2007, Inglis and Cohen 2004, Woolfolk and Inglis
2004) and used to estimate the number of isolations and biodiversity
indices of bacteria and fungi associated with RIFA. A minimum of ten
randomly-selected fungal colonies and ten bacterial colonies from the
appropriate dilution per treatment were transferred onto small TSA and
SDAY plates (60 X 15 mm; Fisher Scientific, Pittsburgh, PA) for bacteria
and fungi, respectively. The organisms were grown for up to three days
for bacteria and seven days for fungi, and then stored at room
temperature until identified. A minimum of two representatives of each
25 taxon was stored in 10% glycerol at -80°C. Fatty acid methyl ester
(FAME) analysis using gas-liquid chromatography (Microbial
Identification System Inc. [MIDI], Newark, DE) was used to identify bacteria based on the manufacturer’s standard protocol for bacterial community (Haack et al. 1994, Kaufman et al. 1999, Mukwaya and
Welch 1989, Peloquin and Greenberg 2003, Sasser 1990, Tighe et al.
2000). Fungi were initially grouped based on conidiogenesis according to standard mycological references (Barnett and Hunter 1998, Barron 1968,
Domsch et al. 1980, Ellis 1971) or from sexual reproduction when it occurred. To confirm bacterial and fungal identification, sequence data of the partial ribosomal RNA gene were obtained from two representative isolates per taxon group following molecular protocols described by
Woolfolk and Inglis (2004). The complete procedures for identification using MIDI and molecular techniques are described below.
Sample preparation and identification using MIDI system
Identification of bacteria using the MIDI system involved the following five basic steps: (1) harvesting, (2) saponification,
(3) methylation, (4) extraction, and (5) base wash (Figure 2). Trypticase soy broth (Difco™) agar (TSBA) consisting of 17.0 g pancreatic digest of casein, 3.0 g papain digest of soybean meal, 5.0 g sodium chloride, 2.5 g dipotassium phosphate, 2.5 g dextrose, 15.0 g agar, and 1 L distilled
26 water, was used to culture bacterial isolates (Woolfolk and Inglis 2004).
Prior to the five steps, isolated bacteria were streaked on TSBA for
24 ± 2 hours at 30ºC using quadrant streak method (Figure 3).
Harvesting
Following the incubation period, bacteria were harvested from the third quadrant with a sterile 4 mm inoculating loop to obtain approximately one heaping loopful bacterial cells. The third quadrant was chosen because this area of harvesting typically yields the most stable fatty acid compositions. The bacterial cells on the loop were coated onto the bottom of a clean, dry 13 mm x 100 mm screw cap culture tube.
Saponification
One ml of saponification reagent (methanolic base) (Reagent #1) was pipetted into the culture tubes containing bacterial cells. Each tube was then vortexed for 5-10 seconds and heated in the water bath at
95-100ºC for 5 minutes. After 5 minutes, the tubes were cooled slightly, vortexed again for 5-10 seconds, and heated at 95-100ºC for 25 minutes.
After 30 minutes of saponification, the tubes were cooled in a tray of tap water.
27
Figure 2 A summary of the extract preparation activities using MIDI System.
28
Figure 3 Quadrant streak technique for culturing bacterial cells on agar plates.
Methylation
Two ml of methylation reagent (Reagent #2) were added into each tube. Each tube was then vortexed for 5-10 seconds and heated for
10 ± 1 minute in a water bath at 80 ± 1 ºC. The tubes were then cooled to the room temperature by placing them in a tray of tap water.
29
Extraction
Into each tube, 1.25 ml of extraction reagent (Reagent #3) was added. The tubes were placed in a Labquake™ Shaker
(Barnstead/Thermolyne, Dubuque, IA) laboratory rotator and gently mixed end-over for 10 minutes. Using a sterile Pasteur pipette for each sample, the aqueous (lower) phase from each tube was removed.
Base wash
Three ml of base-wash reagent (Reagent #4) was added into each tube. The tubes were placed in Barnstead/Thermolyne Labquake™ tube rotator and gently mixed end-over for 5 minutes. A few drops of saturated ACS grade sodium chloride/water solution were added to the tube to aid in breaking the emulsion. The tube was rotated rapidly by hands between the palms and allowed to settle for a few minutes. Using a sterile Pasteur pipette, approximately 2/3 of the top phase from each tube was removed and transferred into a gas chromatograph (GC) sample vial. Samples were run on the Agilent® 6890 GC automatic liquid
sampler to obtain the fatty acid compositions which was further run
against a library of known species for identification of the unknown
bacteria. When the system identified an unknown sample with a
similarity index (SI) of 0.500 or higher and with a separation of 0.1
between the first and second choice, the identification was considered
30 showing good library comparisons between the unknown and the system library (Kunitzky et al. 2006). Based on MIDI results along with traditional and biochemical tests, bacteria were grouped and further analyzed using molecular techniques.
Traditional and biochemical tests for bacteria
To compare profile of each bacterium isolated, various biochemical tests were performed according to standard bacteriology references
(Euzeby 1997, Holt et al. 1994, Garrity et al. 2001, Brenner et al. 2004,
Jouvenaz et al. 1996) discussed below. One to two isolates of bacteria initially grouped using fatty acid analysis method were randomly selected and they were cultured on TSA for 24 hours at 30ºC for further tests described below.
Gram reaction and cellular morphology
A smear of bacterial cells was prepared by placing a loopful of water and aseptically transferring a small amount of unknown bacterial cells on a clean microscope slide. A small amount of bacterial cells is defined as an adequate amount of cells that can be picked up by touching the sterile loop to the surface of the culture (Anonymous 1998).
The mixture of bacterial cells and water were allowed to air dry and then heat-fixed by passing the slide through flame 5-10 times. The smear was then covered with Gram’s crystal violet solution for one minute and the
31 excess was gently rinsed off with a minimum amount of tap water. The smear was covered with Gram’s iodine solution for one minute and the excess was gently rinsed off with tap water. Ethanol was then used to decolorize the smear by tilting the slide over the sink, allowing the ethanol drips to catch on the edge of the slide briefly before falling off.
The drips were observed and when the drips lost the faint touch of blue or purple, the slide was rinsed immediately with a gentle run of tap water. This decolorization step normally took about 5-10 seconds. The final step was to counterstain the cells using Gram’s safranin for one minute. The slide was gently rinsed with tap water and blotted dry. The slide was then examined under the microscope to determine its Gram reaction. Purple or blue cells indicate a Gram positive bacterium and red or pink cells indicate a Gram negative bacterium. While observing Gram reaction under microscope, cellular morphology of each bacterium (e.g. large or small cocci, large or small bacilli, large or small ovoid) was also recorded.
Indole Test
The indole test was performed using BBL™ DrySlide™ Indole (BD
Diagnostic Systems, Sparks, MD). The indole slide, which was stored in
5°C, was adjusted to room temperature before the test and then removed from the pouch. A maximum of 24-hour bacterial cells were picked by
32 touching the sterile loop to the surface of the culture and transferred to the indole slide by smearing the cells onto the reaction area. The reaction area was then examined. A positive reaction (i.e. indole was present) was indicated by the change of color of the reaction area from buff yellow to pink within 30 seconds. There was no change in color for a negative reaction (i.e. the reaction area remained buff yellow).
Catalase Test
The catalase test was performed by transferring a loopful of bacterial cells onto a clean Petri dish. A drop of hydrogen peroxide was added to the cells and the evolution of bubbles was observed for
20-30 seconds. Formation of bubbles indicated a positive reaction; no formation of bubbles indicated a negative reaction (Anonymous 1998).
Cytochrome oxidase test
The cytochrome oxidase test was performed using BBL™
DrySlide™ Oxidase (BD Diagnostic Systems). A colony of 24-hour bacterial cells was picked using a sterile toothpick and the organism was smeared directly onto the reaction area of an oxidase slide. To ensure the proper reaction, the inoculum was spread to 3-4 mm size reaction area. The appearance of dark purple color within 20 seconds was an indication of a positive reaction; no color change was an indication of a negative reaction.
33
Carbon source utilization test
Prior to this test, each bacterial isolate was initially grouped as
Gram positive and Gram negative as described previously. To distinguish the profile of each bacterial isolate on its ability to utilize certain carbon sources, the carbohydrate utilization test was performed by using Biolog MicroPlate™ (Biolog, Hayward, CA) (Barth et al. 1991,
Bochner 1996, Jouvenaz et al. 1996, Klinger et al. 1992, Woolfolk and
Inglis 2004). The test was conducted based on the manufacturer’s protocol as follows.
Gram negative (GN) bacteria. The oxidase test described previously distinguishes GN non enteric (GN-NENT) bacteria, which are oxidase- negative bacteria, from GN enteric (GN-ENT) bacteria, which are oxidase- positive bacteria. The isolates were then streaked onto Biolog universal growth medium plus sheep’s blood (BUG + B); this medium consisted of
57 g of BUG agar, 950 ml distilled water, and 50 ml sterile defibrinated sheep’s blood which was added just prior to dispensing. The streaked plates were incubated for 30°C for GN-NENT or 35-37°C for GN-ENT bacteria for 16-24 hours. Inoculating fluid, consisted of 0.1 g of Phytagel
(Sigma), 4 g of sodium chloride (Fisher Scientific), 0.3 g of Pluronic F-68, and 1 L of distilled water, was aseptically prepared then dispensed into
19 ml post-autoclaving inoculating fluid into 20 x 150 mm size tubes.
After bacteria were incubated for 16-24 h period, bacterial inoculum was
34 prepared by rolling a sterile cotton swab on bacterial culture then dipping the swab into the inoculating fluid tube. For GN-ENT bacteria,
150 μl of 7.6% thioglycolate (Biolog) was added to the inoculum. The cell suspension was then stirred using the swab. Using a turbidimeter, the suspension turbidity was measured until it reached 52% transmittance for GN-NENT bacteria and 63% for GN-ENT bacteria. For gram negative bacteria, the GN MicroPlate, which contains ninety-five carbon sources and one control (Figure 4), was used. The cell suspension was then poured into a multichannel pipette reservoir and 150 μl suspension was delivered into each well of GN MicroPlate until all 96 wells contained the suspension. The microplate was then covered with its lid and incubated for 30°C for GN-NENT or 35-37°C for GN-ENT bacteria for 16-24 hours.
Following the incubation period, the reaction result was read and recorded. The reaction was positive when a well turned purple
(indicating the ability of a microorganism to utilize a given carbon source) and the reaction was negative when there was no change in color
(indicating the inability of a microorganism to utilize a given carbon source).
Gram positive (GP) bacteria. The procedure is the same as mentioned above for GN-ENT bacteria with three exceptions: (1) oxidase test result was not required, (2) the suspension turbidity was measured until it reached 20% transmittance, and (3) the bacterial cell suspension
35 was then pipetted into GP MicroPlate. The GP MicroPlate carbon sources
(Figure 5) are different from those of GN MicroPlate (Figure 4).
Molecular characterization
To confirm the identification of bacteria and fungi isolated from
RIFA, mound soils and plant debris, DNeasy® Blood and Tissue Kit and
DNeasy® Plant Mini Kit (Qiagen) were used for DNA isolation from
bacteria (Lee 2007, Lee et al. 2008) and fungal mycelia (Arenz et al. 2006,
Baird et al. 2006), respectively. The procedures are described below.
Genomic DNA extraction for bacteria
Bacteria from -80°C were cultured on TSA for 16-24 hours at 30ºC.
The next day, bacteria were transferred into brain heart infusion broth
(Difco) in a 15-ml test tube and placed on a shaker (~ 150 rpm) at 30°C
overnight until saturated. Approximately 1.5 ml broth containing
bacteria was placed in microcentrifuge tubes, bacterial cells (a maximum
of 2 x 109 cells) were harvested by centrifugation at 7,500 rpm for 10
minutes, and supernatant was discarded. After cells harvested and
centrifuged, 180 µl enzymatic lysis buffer was added into the pellets. The
enzymatic lysis buffer consisted of 20 mM Tris-Cl at pH 8.0, 2mM
sodium ethylenediaminetetraacetic acid (sodium EDTA),
36 37
Figure 4 Carbon sources in GN MicroPlate. 38
Figure 5 Carbon sources in GP MicroPlate.
® 1.2% Triton X-100, and 20 mg/ml lysozyme which was added
immediately prior to use. Once the lysis buffer was added, samples were
incubated for a minimum of 30 minutes at 37ºC. Twenty five µl
Proteinase K and 200 µl Buffer AL were then added and mixed by
vortexing. Samples were incubated for 30 minutes at 56ºC and 200 µl of
ethanol (96-100%) was added and vortexed. The mixture was transferred
into the DNeasy mini column sitting in a 2-ml collection tube and
centrifuged at 8,000 rpm for 1 minute. The supernatants and collection
tubes for each sample were discarded. The DNeasy mini columns were
placed into new collection tubes, then 500 µl of Buffer AW1 were added,
and samples centrifuged at 8,000 rpm for 1 minute. The supernatants
and collection tubes were discarded again. The DNeasy mini columns
were placed in new collection tubes and 500 µl of Buffer AW2 were
added, and samples centrifuged for 3 minutes at 10,000 rpm to dry the
DNeasy membrane. The supernatants and collection tubes were
discarded. The DNeasy mini columns were then placed in new, clean 1.5
ml microcentrifuge tubes and 200 µl Buffer AE was pipetted directly into
the DNeasy membrane. Samples were incubated at room temperature
for 1 minute and then centrifuged at 8,000 rpm for 1 minute. The
elution step was repeated once.
39
Genomic DNA extraction for fungi
Initially, selected fungi were grown on SDAY plates (100 x 10 mm) for a minimum of 7 days at room temperature. Potato dextrose broth
(PDB, Difco™), consisting of 4.0 g potato starch, 20.0 g dextrose, and 1 L distilled water (final pH of 5.1 ± 0.2), were used to culture fungal isolates.
Five mycelial plugs (2 mm in diameter) of fungi obtained from SDAY plates were placed in flasks and grown in PDB for approximately two weeks at 25ºC with constant agitation on a laboratory shaker at
150-200 rpm. Mycelia were filtered using Whatman® filter paper size
4 through a sterilized Buchner funnel and ground with approximately
50 ml of liquid nitrogen. Samples were placed in 1.5 ml microcentrifuge
tubes and 400 µl of buffer AP1 and 4 µl of RNase A stock solution
(100 mg/ml) were added to a maximum of 20 mg fungus mycelial tissue.
Tubes were capped and vortexed vigorously. The mixture was incubated
for 10 minutes in a water bath at 65ºC with 2-3 times mixing (by
inverting tube) during incubation. Following incubation, 130 µl of Buffer
AP2 was added to the lysate. Samples were mixed, incubated for
5 minutes on ice, and centrifuged for 5 minutes at 14,000 rpm. After
centrifugation, the sample lysate was applied to QIAshredder spin
column (lilac) sitting in a 2 ml collection tube, then centrifuged again for
2 minutes at 14,000 rpm. The flow-through fraction of each sample was
transferred into new 1.5 ml microcentrifuge tubes and 1.5 volumes of
40
Buffer AP3/E were added and mixed by pipetting. Six hundred fifty µl of each sample lysate was applied to the DNeasy mini spin column sitting in a 2 ml collection tube. Each sample lysate was centrifuged for one minute at 8,000 rpm. The supernatants and collection tubes were discarded. DNeasy column was placed in a new collection tube and
500 µl of Buffer AW was added. Sample was centrifuged for 1 minute at
8,000 rpm and supernatants of each sample discarded. Five hundred µl of Buffer AW was added to the DNeasy column and centrifuged for
2 minutes at 14,000 rpm to dry the membrane. The DNeasy column was then transferred to 1.5 ml microcentrifuge tube and 100 µl of preheated
(65ºC) Buffer AE was pipetted directly onto the DNeasy membrane.
Samples were incubated for 5 minutes at room temperature and then centrifuged for 1 minute at 8,000 rpm to elute. This elution step was repeated once.
Polymerase Chain Reaction (PCR) conditions for bacteria
Genomic DNA obtained from bacteria was used for final identification of bacterial taxa through PCR procedures to amplify 16S
® rRNA genes (Amann et al. 1994, Coplin and Kado 2001). GoTaq PCR
Core System I (Promega Corporation, Madison, WI) kit was used as
recommended by the manufacturer. The conditions for amplifications
were as follows: 1 cycle of initial denaturation at 95ºC for 2 minutes,
41
followed by 1 cycle of denaturation at 95°C for 1 minute, 35 cycles of
annealing for 1 minute at 94ºC, and 1 cycle of extension for 1 minute at
72ºC, then ended with an extension cycle of 5 minutes at 72ºC followed
by holding the reactions at 4°C. The PCR mixture consisted of a total
volume of 50 µl containing 5 μl of 25mM MgCl2, 10 μl of 5X Colorless
® GoTaq Flexi buffer, 1 μl of 10 mM deoxyribonucleotide triphosphates
(dNTPs), 2 μl of 5 pmol of 27f (GATCCTGGCTCAGATTGAAC, forward
primer), 2 μl of 5 pmol of 1492r (ACCTTGTTACGACTTCACCC, reverse
® primer) (Lane 1991), 0.25 μl of 5u/μl GoTaq DNA polymerase, 100 ng/μl
of template DNA, and Sigma water. The amount of template DNA and
Sigma water depended upon DNA concentration of each isolate. The
primers described above are universal primers used to amplify the 16S
ribosomal RNA (rRNA) genes for bacteria (Amann et al.. 1994, Coplin and
Kado 2001). The resulting PCR products were electrophoresed in a 1%
® TBE-agarose gel and BioMarker EXT ladder (BioVentures, Murfreesboro,
TN), which contains the following bands: 2000; 1500; 1000; 700; 525;
500; 400; 300; 200; 100 and 50 base pairs, was used to size the
products. The PCR products were then stained with ethidium bromide
and visualized under UV light.
42
Polymerase Chain Reaction (PCR) conditions for fungi
Genomic DNA obtained from fungi was used for final identification of fungal taxa using two different procedures, which were non Fusarium and Fusarium PCR procedures. For non Fusarium procedure, the internal transcribed space (ITS) region primers ITS1F
(CTTGGTCATTTAGAGGAAGTAA, forward primer) (Gardes and Bruns
1993) and ITS4 (TCCTCCGCTTATTGATATGC, reverse primer) (White et al. 1990) were used. The conditions for amplifications (Abesha and
Caetano-Anolles 2003) were 1 cycle at 94ºC for 9 minutes, followed by
35 cycles of 1 minute at 96ºC, 1 minute at 56ºC, and 1 minute at 72ºC, ending with an extension cycle of 7 minutes at 72ºC. For Fusarium procedure, two sets of primers used were β-tubulin (T1, forward primer, and T2, reverse primer) (O’Donnell and Cigelnik 1997) and α-elongation factor (E1, forward primer, and E2, reverse primer) (O’Donnell et al.
1998). The sequences of those primers were as follows:
T1 = AACATGCGTGAGATTGTAAGT (forward primer),
T2 = TAGTGACCCTTGGCCCAGTTG (reverse primer),
E1 = ATGGGTAAGGAGGACAAGAC (forward primer), and
E2 = GGAAGTACCAGTGATCATGTT (reverse primer). The conditions for
β-tubulin amplifications were 1 cycle at 94ºC for 1 minute, followed by
35 cycles of 30 seconds at 94ºC, 45 seconds at 58ºC, and 1 minute at
72ºC. The conditions for α-elongation factor were 1 cycle at 94ºC for
43
1 minute, followed by 35 cycles of 30 seconds at 94ºC, 45 seconds at
54ºC, and 1 minute at 72ºC followed by holding the reactions at 4°C.
The PCR mixture consisted of a total volume of 20 µl containing 2 μl of
10X Gold buffer, 2 μl of 2 mM deoxyribonucleotide triphosphates
(dNTPs), 1.2 μl of 25 mM MgCl2, 2 μl of 3 μM forward primer, 2 μl of 3 μM reverse primer, 1 μl of 1 U Gold Taq DNA polymerase, 4 μl of 0.5 ng DNA product, and 5.8 μl of Sigma water. The resulting PCR products were
® electrophoresed in a 2% TBE-agarose gel and BioMarker Low ladder
(BioVentures, Murfreesboro, TN) was used to size the products. The PCR
products were then stained with ethidium bromide and visualized under
UV light.
Purification of Polymerase Chain Reaction (PCR) products
QIAquick PCR Purification Kit (Qiagen) was used to purify DNA fragments of bacteria and fungi. The procedure is as follows as recommended by manufacturer. For every one volume of PCR sample, five volumes of Buffer PB were added and the samples mixed. To bind the DNA, the mixtures were then applied into QIAquick spin columns sitting in 2 ml collection tubes. Samples were then centrifuged for
30-60 seconds and the flow-through liquid was discarded. After placing the QIAquick columns back into the collection tubes, 0.75 ml Buffer PE was added into the columns to wash the DNA fragments. Following
44
30-60 seconds of sample centrifugation, the flow-through liquid was discarded and the QIAquick columns were placed back into collection tubes. Without adding any buffer, the columns were centrifuged for an additional 1 minute. The QIAquick columns were now placed in clean
1.5 ml microcentrifuge tubes. The DNA was then eluted by adding 50 µl
Buffer EB or H20 to the center of QIAquick membrane and columns were
centrifuged for one minute. Alternatively, for higher concentration of
DNA, 30 µl Buffer EB was added to the center of the QIAquick
membrane, the columns were left to stand for one minute and then
centrifuged. The microcentrifuge tubes containing clean DNA were then
stored in -80°C for sequencing procedure.
DNA Sequencing
The DNA sequencing was carried out by two methods. The first
method was conducted in the Baird Sequencing Laboratory (Dorman
Hall, Department of Entomology and Plant Pathology, Mississippi State
University), and the second method done at MWG Biotech Inc.
(Huntsville, AL). The reactions conducted in Baird Sequencing Lab was
carried out using the CEQ 8000 Dye Terminator Cycle Sequencing
(DTCS) Quick Start Kit P/N 608120 (Beckman Coulter, Fullerton, CA).
The DNA sequencing procedure was carried out according to standard
protocol provided by the manufacturer (Beckman Coulter).
45
The DNA concentrations for sequencing were initially estimated based on the manufacturer’s guidelines (Instruction sheet no. BCI P/N
608118·AA). For fungi, 33 ng per 100 fmol concentration was used. The sequence reaction was prepared in a 0.2 ml thin-wall microcentrifuge tube or microplate well. All reagents were placed on ice and the sequencing reactions were added into the tubes in the following order:
0 – 9.5 μl of Sigma water, 0.5 – 10 μl of DNA template, 2 μl of sequencing primer, and 8 μl DTCS Quick Start Master Mix. The reactions were mixed thoroughly by briefly centrifuging prior to thermal cycling. The thermal cycling program was 30 cycles of 96°C for 20 seconds, 50°C for
20 seconds, and 60°C for 4 minutes followed by holding the reactions at 4°C.
The thermal cycling procedure was followed by ethanol precipitation step. This step was carried out in individual microcentrifuge tubes (size 0.5 ml) with 5 µl of Stop Solution/glycogen mixture, which consisted of 2 µl of 3M sodium acetate pH 5.2, 2 µl of
100mM Na2-EDTA (sodium ethylenediaminetetraacetic acid) pH 8.0, and
1 µl of 20 mg/ml glycogen. After mixing thoroughly, 60 µl of 95% (v/v)
ethanol/dH2O initially stored in -20°C was added. The solution was
immediately centrifuged at 14,000 rpm at 4°C for 15 minutes, and the
supernatant removed using a micropipette. The resulting pellet was
rinsed twice with 200 µl of 70% (v/v) ethanol/dH2O from -20°C. The 46 solution was immediately centrifuged at 14,000 rpm at 4°C for a minimum of 2 minutes after each rinse and the supernatant removed with a micropipette. Each sample was vacuumed dry for 10 minutes and resuspended in 40 µl of the Sample Loading Solution. Resuspended samples were transferred to the appropriate wells of the CEQ sample plate and overlaid with one drop of light mineral oil. The sample plate was loaded into the Beckman Coulter CEQ8000 automated gene sequencer and sequence reaction was separated using the LFR-1 method
(denature: 90° C for 120 sec; inject: 2.0 kV for 15 sec; and separated:
4.2 kV for 85 min in a 50°C capillary). Electropherogram output was inspected visually for sequencing errors on the CEQ8000 Genetic
Analysis Software. The forward and reverse sequences were saved in both .seq and FASTA formats. The contigs of the sequences were constructed using SeqMan of Lasergene version 7.0 software (DNASTAR,
Inc., Madison, WI). The sequence data were then compared to the
GenBank database through BLAST (Basic Local Alignment Search Tool) to determine identities using blastn program. Following completion of the research, all sequences data were deposited in GenBank (National
Center for Biotechnology Information, NCBI).
The sequencing of remaining fungi and bacteria were conducted at the laboratory of MWG Biotech, Inc., Huntsville, Alabama. The sequence results were then analyzed using the same method described above. An
47
ITS fungal sequence that matches with a sequence in GenBank is considered to be in the same species when 80% coverage or higher showed a minimum of 98% homology (Hughes et al. 2009). For bacteria, in general when 70% coverage or higher within 16S rRNA sequences shares a minimum of 97% of identity, the bacteria are considered as the same species (Claridge 2004, Cohan 2002, Stackebrandt and Goebel
1994).
Evaluating selected bacteria and fungi isolated as potential
biological control agents for RIFA
The methodology of experiments described below will be used to address objective 3. This portion of the research consisted of work with the bacterial and fungal isolates in rearing facilities (in vivo laboratory experiment) and in the field (in situ field cage evaluation).
Laboratory experiment (in vivo study)
Red imported fire ant and mound collection. Active soil mounds including the RIFA were collected as discussed previously (sample collection and preparation). The samples containing RIFA, plant debris, and soil were used as experimental colonies for biological control testing of fungal and bacterial cultures followed procedures by Baird et al. (2007) with modification. A total of 45-60 colonies were established monthly.
These colonies were maintained in Sterilite® plastic boxes
48
(42 x 29 x 15 cm; Sterilite Corporation, Townsend, MA) with Fluon®
(polytetrafluoroethylene; ICI Fluoropolymers, Exton, PA) applied to the inner side to prevent RIFA escapes. The lid of the box was used as a tray with Fluon® applied to the inner edge of the lid to provide additional
protection from escapes. The positions of all boxes on the shelves were
randomly arranged in the rearing room. Soil mounds were sprayed with
tap water placed in Nalgene® hand sprayer (40-50 ml water per box
depending on the necessity) daily to maintain moisture level (~ 70%
saturated). A cotton ball was dipped in 10% sugar (Dixie Crystals®,
Savannah Food and Industries, Inc., Savannah, GA) water and placed in
a 30 ml size insect diet cup (Solo® Cup Company, Urbana, IL). All
colonies (boxes) were provided with sugar water ad libitum to provide
carbohydrate requirements in their diet (Vander Meer et al. 1995) and
one half cube of artificial diet (approximate size of 2.5 x 1.6 x 1.5 cm3) every other day to maintain the colonies. The artificial diet for fire ants consists of 10 small hen’s eggs, 450 g ground beef, 12 g JIF creamy peanut butter (J.M. Smuckers Co., Orrville, OH), 215 g sugar, 3.5 g
® sodium chloride (table salt), 2 ml Poly-Vi-Sol (Mead Johnson, Evansville,
IN), 7 g unflavored gelatin, and 800 ml tap water (Drees and Ellison,
2002). Preparation of the artificial diet is described below. Sugar water
was replaced every other day or when cotton balls were dry, whichever
came first.
49
To allow the new colonies to reestablish themselves in the in vivo setting, RIFA colonies were maintained for approximately one week before starting the biological control experiments. During this time, crickets were used as the main diet to provide protein source requirements (Vander Meer et al. 1995). Preliminary tests have shown that one week is sufficient for colony reestablishment. After one week, the experimental colonies were starved (given water only) for two days before the experimental trials to produce a uniform state of hunger. In addition, to prevent interference on the death rate data, any dead RIFA found on the soil mounds were removed. Colonies were maintained at
25-27ºC temperature and 60% relative humidity with 8-hour light and
16-hour dark cycles. For consistency across 45-60 boxes of RIFA colonies, colonies were replaced monthly with new ones from the field.
Artificial diet preparation. The artificial diet was prepared according to Drees and Ellison (2002) protocol. Tap water, sugar, and gelatin were mixed, cooked on the stove, and cooled to approximately
45-50°C. Ground beef were browned and the fat portion drained. Then
® eggs, salt, and Poly-Vi-Sol were mixed in an electrical blender. The
browned ground beef were then added slowly into the ingredients within
® an electrical blender (Braun PowerMax Jug Blender Model No. MX2050;
Braun GmbH, Kronberg, Germany) and blended at low speed for
2 minutes. The ingredients from the blender were then added to the
50 mixture of sugar and gelatin and cooked until it began to thicken (not boiled). The mixture was removed from heat, poured into ice cube trays, and allowed to cool by placing the trays on an environmental cabinet.
After the diet solidified, the ice cube trays containing ant diet were placed
® in the Ziploc bag and kept at -20°C until ready for use.
Foraging test. To test whether bacteria and/or fungi isolated from mounds had potential antagonism and/or biological control activity on
RIFA colonies, individual isolates of identified bacterial and fungal taxa were grown on TSA and SDAY, respectively. A protocol prepared by
Baird (unpublished data) was used to conduct this study. Fifty percent of the most common and twenty percent of the least common isolated bacteria and fungi from each location and each sampling date were selected for this study. Bacteria were heavily streaked on the TSA plates using a sterile 4 mm inoculating loop and incubated for 3 days at 30ºC.
Fungi were grown on SDAY by placing a mycelial plug (5 mm in diameter) on the medium and incubated for 7 days at 25ºC. A half cube of artificial diet (2.5 x 1.6 x 1.5 cm3) was weighed and placed in the middle of the
bacterial and/or fungal plate. Each plate was placed in the middle of
each box containing the RIFA colonies. Plates containing TSA and SDAY
without a bacterium or a fungus, respectively, plus the artificial diet were
used as controls. A half cube of artificial diet was added every other day;
in the case when there was no diet left on the next day, fresh diet was
51 added. Foraging observations were continued up to four days by observing the rate of RIFA on the diet one hour after fresh diet was added. During the experiment, the diet was the only food source. The remaining part of the diets that were not consumed was left throughout the four-day period. Any dead RIFA observed on the medium were recorded (as discussed below). Each bacterial and fungal plate tested including the control was repeated five times (five colonies per isolate tested). The numbers of RIFA foraging on the diet one hour after new fresh diet was added (measured by rate) were recorded. A rating of
0 equals no RIFA, 1 equals 1-10 RIFA, 2 equals 11-25 RIFA, 3 equals
26-50 RIFA, 4 equals 50-100 RIFA, 5 equals 101-200 RIFA, and 6 equals
>200 RIFA foraging on the diet. Immediately following each experiment, the plates containing bacterial and fungal cultures were removed, diet weights determined, and death rate of RIFA in each experimental box recorded. After determining the death rates for the RIFA in each box, the dead RIFA were removed. A rating of 0 equals no dead RIFA, 1 equals
1-10 dead RIFA, 2 equals 11-25 dead RIFA, 3 equals 26-50 dead RIFA,
4 equals 50-100 dead RIFA, 5 equals 101-200 dead RIFA, and 6 equals
>200 dead RIFA. To confirm Koch Postulates, ten randomly selected dead RIFA per replicate were plated on bacterial/fungal selective medium.
52
Field cage experiments (in situ study)
Active soil mounds including the RIFA were collected as discussed previously (sample collection and preparation). Ten fungal and four bacterial isolates which showed the highest death rates of RIFA in the laboratory evaluation were selected to be evaluated under field cage conditions in a natural environment that had not been affected by chemical pesticides. The fungi and bacteria were mass-produced
(discussed below) and applied in the field cage trials at a farm property of
Dr. David Smith (formerly with the Department of Agricultural and
Biological Engineering, Mississippi State University) located on Blackjack
Road, Starkville, MS. Stimac et al. (1993) procedures with some modifications were followed in conducting this portion of study as described below.
Mass production of bacteria. Initially, selected bacteria were grown on TSA plates (100 x 10 mm) for 2 days at 30ºC. To mass produce bacteria, trypticase soy broth (TSB; Difco™), containing 17.0 g pancreatic digest of casein, 3.0 g papaic digest of soybean meal, 2.5 g sodium chloride, 2.5 g dipotassium phosphate, 2.5 g dextrose, and 1 L distilled water (final pH 7.3 ± 0.2), were used. A loopful of bacterial colonies was transferred into TSB in 500 ml flasks using a 4 mm sterile inoculating loop. Flasks were placed on a laboratory shaker at 200 rpm for three
53 days at room temperature to obtain a minimum concentration of
107 bacterial cells.
Mass production of fungi. Initially, selected fungi were grown on
SDAY plates (100 x 10 mm) for a minimum of 7 days at room temperature. Fungal cultures were then mass produced using a cornmeal-sand (CMS) medium as previously described by Baird et al.
(1996). The CMS medium was prepared by adding 300 g of white sand,
9 g of yellow cornmeal, and 60 ml of distilled water in the 500 ml flask then mixed thoroughly. The mixture was autoclaved twice at 121ºC for one hour allowing a 24-hour time interval between each sterilization.
The CMS medium in each flask was inoculated with 5-10 mycelial plugs
(2 mm) obtained from the leading edges of the mycelial growth from the
SDAY plates. The flasks were placed in room temperature and shaken every day to allow equal growth distribution of fungi. The fungal cultures were incubated for approximately 14 days at 25ºC.
Red imported fire ant collection. Four active mounds were collected for each control and treatment (i.e. bacterial or fungal taxa) from either
Madison, Hinds, or Leake Counties along the Natchez Trace Parkway in
Mississippi. For the experiment, 3000 ml soil from mounds containing
RIFA were collected from the field and placed into 3.79 L size Ziploc® bags. Ziploc® bags containing the samples were sealed, placed in an ice
cooler, and transported to the insect rearing facility at Mississippi State
54
University. Each sample was then immediately placed in Sterilite®
plastic boxes (42 x 29 x 15 cm; Sterilite) as described previously and was
temporarily maintained in the rearing room prior to ant-soil extraction
procedure. The RIFA and their broods were extracted using standard
methods described by Drees and Ellison (2002). To extract the RIFA
colony from the soil, tap water was dripped very slowly into the colony
rearing box using Nalgene® tubing (1.27 cm in diameter). The RIFA that
float on top of the water surface were removed using a slotted spoon and
placed in a temporary holding box (42 x 29 x 15 cm) with the top inner
side coated with Fluon®. Following the removal of RIFA, water was drained and the remaining soils were placed in autoclave bags. The soil was sterilized twice at 215-220°C for 4 hours allowing a 24-hour time interval between each sterilization. The sterile soil was then used as
RIFA nests for field cage trials.
Field cage construction. To minimize escapes, a standard individual field cage was constructed as a 46.99 x 46.04 x 46.99 cm3
cube. The cage frame was made up with aluminum window-screen
frames riveted to each other and to a 22 gauge of sheet metal to form
a floor, as suggested by Reed (2007). Extra fine mesh nylon screening
fabric which allowed light, air, and water to pass through but kept RIFA
confined was attached to the frames with a screening spline (0.41 cm in
diameter). A piano hinge was used as a door hinge and a wire-forming
55 catch was riveted to the frame in a position where the door stayed closed during experiments. One side of the cage was hinged with rivets to form a door and a wire forming a catch was riveted to the frame to keep the door closed. Weather stripping foam was glued around the door and silicon caulk applied along the seams and in any holes.
Field cage experiments. The methodology for this experiment was modified from the procedures described by Stimac et al. (1993). Each black pot containing soil mounds, RIFA and a fungus or a bacterium was placed individually in each cage. Clean plastic pots (10 L size) were surface sterilized with 10% sodium hypochlorite and filled with approximately 2500 ml sterile soil from mounds that do not contain RIFA
(hereafter referred to as RIFA nest). Fluon® was applied to the top 5 cm inner wall of the pots to prevent escape of the RIFA. A PVC tube (3.8 cm in diameter) with a plaster plug at its bottom end was inserted in the center of the pot. This tube was used to add water to the RIFA nest to maintain moisture levels close to the field moisture level (~ 70% saturated). A round, clear plastic tray (diameter 33.02 cm) coated with
Fluon® was placed at the bottom of each pot to give additional protection
from escapes and to provide a place for RIFA to deposit refuse and
cadavers. Approximately 5 g of RIFA were used to set up each colony in
each pot. Before treatment with either fungus or bacterium, the RIFA
nest surface was stirred to a depth of ~ 5 cm. For each bacterial
56 treatment, 20 ml of TSB containing bacteria was evenly poured across the soil surface. For each fungus treatment, 20 g of fungi-CMS mixture produced by methods previously described were evenly distributed over the soil surface in the RIFA experimental pots. Immediately following treatment, the soil surface was stirred again to ensure that TSB and soil, or fungi-CMS and soil were mixed evenly. Control colonies received similar treatment except for the application of TSB without bacterium and CMS without fungus.
The evaluation was conducted for a total of fourteen days per treatment. Fifteen living and dead RIFA were randomly collected from soil surface or plastic tray of each pot on the day four after treatment.
For bacterial treatment, the ants were surface sterilized with 70% ethyl alcohol for one minute and rinsed with sterile distilled water. Each ant was placed in an individual microcentrofuge tube containing 1000 μl of sterile buffer-Tween, ground and homogenized using a Kontes®
micropestle (Kontes, Vineland, NJ). Homogenates were diluted in tenfold
dilution series, and aliquots of 100 μl from each dilution were spread
using a sterile polypropylene spreader onto a TSA plate. The plate with
dilution yielding 30-300 colonies was processed further to determine the
colonization potential by tested bacterium. To determine whether
bacterium introduced was the same as bacterium isolated (to confirm
Koch Postulates), all bacteria recovered on TSA on the proper dilution
57 were identified using MIDI system as described previously. For fungal treatment, RIFA workers were surface sterilized by submerging them in
1% sodium hypochlorite containing 0.01% Tween-80 (Sigma, St. Louis,
MO) for 1 minute, then transferred into 1% sodium thiosulfite to neutralize sodium hypochlorite, rinsed with sterile distilled water, and plated onto SDAY plate to determine the colonization potential by tested fungus. To determine whether fungus introduced was the same as the one isolated (to confirm Koch Postulates), all fungi recovered on SDAY were identified and compared using morphological features.
After fourteen days, all RIFA were removed from the soil by flooding the colonies and collecting them from the water surface and/or extracting them from the soil. Total dead and living RIFA (i.e. survivors) were counted. Fifteen living and dead RIFA were again randomly collected, plated, and processed as mentioned above. Bacterial treatments, fungal treatments and control were compared in terms of the number of dead RIFA, total dead and living RIFA at the end of experiment.
Statistical analyses
Biodiversity indices (Table 1) calculated for fungi and bacteria included species richness (n), Shannon-Weaver species diversity index
(H`), coefficient of community (CC), and species evenness (E) (Price 1997,
58
Stephenson 1989, Stephenson et al. 2004). Relative frequencies of fungal and bacterial occurrence were also calculated. Where warranted, data were further analyzed using one-way analysis of variance (ANOVA) using the general linear models procedure (Proc GLM) of Statistical
Analyses System Software (SAS Institute, Inc., 1999). Fisher’s protected least significant difference test (P<0.05) was performed to compare means.
The laboratory and field cage studies were analyzed as randomized complete block designs using evaluation runs as blocks. Foraging rates of RIFA, dead rates of RIFA, and remaining diet weights from the laboratory experiments as well as total dead and living RIFA from the field cage trials were subjected to ANOVA using PROC GLM. Differences among means were compared among and within evaluation runs using the Fisher’s least significant difference test (t-tests).
59
Table 1 Biodiversity indicesA measured during this study.
Index Equation
Species or n Richness measures the total taxa number of different species or taxa richness present within a community. (n)
Shannon- H’ = - pi ln pi Diversity is a function of both Weaver richness and evenness. It species or where pi is the measures the order or disorder taxa proportion of the within a given community and the diversity total number of order is characterized by the (H’) individuals number of individuals found for represented by each species or taxa in the sample. species or taxon i. A high diversity index may indicate a healthy environment. H’ varies from zero for a community containing a single species or taxon to some maximum value for a community consisting of many species.
Species or H’ Evenness measures the proportion taxa E = ⎯⎯⎯ of individuals among the species or evenness log n taxa; this indicates whether there (E) are dominant populations. It is ranged from zero to one. When E is near zero, it indicates that most individuals in a given community belong to one or a few species or taxa. When E is near one, it indicates that each species or taxon consists of the same number of individuals.
60
Table 1 (continued)
Index Equation
Coefficient 2c CC value is the percentage of total of CC = ⎯⎯⎯ species or taxa that two community a + b communities being compared have (CC) in common. It is ranged from zero where: (no species or taxon is present in a = total number of both communities) to one (all species or taxa in species or taxa are present in both the first community, communities). b = total number of species or taxa in the second community, and c = number of species common to both communities.
A According to Price 1997, Stephenson 1989, and Stephenson et al. 2004.
61 CHAPTER III
RESULTS
Survey of bacteria and fungi associated with red imported fire ants
(RIFA), mound soils, and plant debris
Percent identity to closest sequence matches utilizing the GenBank
database ranged between 92.4% and 100.0% for bacteria, and between
90.3% and 100.0% for fungi. To be considered the same species with the
BLAST (Basic Local Alignment Search Tool) results, sequences with 70%
coverage or higher must share a minimum of 97% of similarity within
16S rRNA sequences for bacteria, and 80% coverage or higher share
a minimum of 98% homology for fungi, as previously stated in Materials
and Methods. A total of 71 bacterial taxa (2324 isolates) (Table 2) and
50 fungal taxa (1445 isolates) (Table 3) were identified from red imported
fire ants (RIFA) external body regions (AE), internal body regions (AI),
mound soil (SM) and plant debris (PD) within the mounds. To illustrate
the percent isolation for bacteria and fungi by genera, the data are
presented in pie charts in Figures 6 and 7. The most common genus for
bacteria was Bacillus with a total of 20 species. The highest percent isolation frequencies for bacteria were Bacillus sp. B76(B)Ydz-zz (29.4%),
62 Achromobacter xylosoxidans isolate IL-03 (9.0%), Bacillus cereus strain
NBRAJATH9 (6.4%), Bacillus sphaericus strain KSC_SF3b (6.3%),
Serratia grimesii strain ZFX-1 (6.3%) and Bacillus sp. CO64 (6.1%).
Twenty nine species of bacteria were isolated at <1.0% and all other
species isolation frequencies ranged from 1.0% to 6.0%. Fusarium was
the most commonly identified genus for fungi with a total of 14 species
determined. The highest total percent isolation frequencies for fungi
included Trichoderma aureoviride strain IMI 113135 (12.8%), Fusarium
sp. 5/97-45 (8.2%), Fusarium sp. P002 (7.9%), Fusarium sp. E033
(6.7%), Paecilomyces lilacinus (6.5%), and Fusarium oxysporum f. sp.
vasinfectum isolate strain Ag149-I (5.8%). Besides P. lilacinus, another
common entomopathogenic fungus identified during this study was
Metarhizium anisopliae var. anisopliae. Metarhizium anisopliae var.
anisopliae isolate Q2 (2.9%) was isolated from AE tissue, SM and PD.
Contrary to those results, M. anisopliae var. anisopliae strain LRC 211
was only isolated at <1.0%. Sixteen fungal taxa including unknown
species were isolated at <1.0%. All other fungal taxa isolation
frequencies ranged between 1.0% and 5.6%. Statistical analyses were
also conducted to compare interactions among locations, sampling dates
and substrates in mean number occurrences. Results indicated that
there were no consistent trends in the mean number of occurrence of
63 bacterial and fungal taxa based on interactions of the above parameters
(Appendix A Tables 31 - 36).
64 Table 2 Mean percent isolation frequencies of bacterial taxa identified from red imported fire ant mounds from three locations (Hinds, Madison, and Leake Counties) along Natchez Trace Parkway in Mississippi.
Total % by substrateB NCBI % identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Bacterial taxa no.A match externalC internalD soil debris total % Achromobacter marplatensis EU150134 99.6 0.0 2.2 2.8 0.6 1.4 Yabuuchi and Yano emend. Yabuuchi et al. strain B2 Achromobacter sp. Yabuuchi and EU340142 94.0 0.0 0.6 1.1 0.0 <1.0 65 Yano ss3 Achromobacter xylosoxidans (ex DQ989213 99.9 6.7 3.3 19.4 7.8 9.0 Yabuuchi and Ohyama) Yabuuchi and Yano isolate IL-03 Acinetobacter sp. Brisou and AY663435 99.8 0.0 1.1 8.9 0.0 2.5 Prévot Alpha proteobacterium BAL284 AY972871 99.9 0.0 0.6 0.0 0.0 <1.0 Bacillus anthracis Cohn strain DQ232746 99.8 0.6 0.0 0.0 0.6 <1.0 JH18 Bacillus cereus Frankland and EF154158 99.8 0.0 0.0 0.6 0.0 <1.0 Frankland strain IBL01075 Bacillus cereus Frankland and EU661712 99.7 2.2 1.7 15.0 6.7 6.4 Frankland strain NBRAJATH9 Bacillus cereus Frankland and EU647710 99.7 1.1 0.6 8.9 2.8 3.3 Frankland strain REG55 Bacillus sp. Cohn 1 AF519467 95.5 0.0 0.0 0.0 0.6 <1.0 Bacillus sp. Cohn 2 AY737309 96.5 0.0 2.2 13.3 0.6 4.0 Bacillus megaterium de Bary EF428248 99.6 0.6 0.6 11.7 0.0 3.2 strain HDYM-24 Table 2 (continued)
Total % by substrate B NCBI % identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Bacterial taxa no.A match externalC internalD soil debris total % Bacillus sp. Cohn 3 EU430987 94.4 0.0 0.0 0.0 0.6 <1.0 Bacillus pseudomycoides AM747227 99.8 11.7 3.9 0.6 0.6 4.2 Nakamura Bacillus pumilus Meyer and EU624442 99.9 0.6 1.1 10.0 1.7 3.3 Gottheil strain SS-02 Bacillus sp. Cohn 2-29 EU571138 100.0 0.6 0.0 1.7 0.6 <1.0
66 Bacillus sp. Cohn B76(B)Ydz-zz EU070362 99.9 30.6 1.1 61.1 26.1 29.4 Bacillus sp. Cohn BAM161 AB330404 99.9 0.0 0.6 2.2 0.0 <1.0 Bacillus sp. Cohn CO64 DQ643066 99.9 2.2 0.0 15.0 7.2 6.1 Bacillus sp. Cohn MI-32a2 DQ196480 99.6 1.7 4.4 1.7 1.7 2.4 Bacillus sp. Cohn NS-4 EU622630 99.8 0.6 1.7 0.0 0.0 <1.0 Bacillus sp. Cohn 4 AB116123 94.9 0.6 0.0 1.7 1.1 <1.0 Bacillus sphaericus Meyer and DQ870695 99.9 3.3 0.0 10.6 11.1 6.3 Neide strain KSC_SF3b Bacillus subtilis (Ehrenberg) AY917143 99.9 0.0 0.0 1.1 0.6 <1.0 Cohn strain CICC10088 Bacillus sp. Cohn 5 EU647704 92.4 0.0 1.1 10.0 0.0 2.8 Bacterium BR115 EU603509 99.9 0.0 0.0 0.6 0.0 <1.0 Bordetella sp. Moreno-López AM167904 94.0 0.0 1.1 1.7 0.0 <1.0 Brevibacillus laterosporus AY745239 99.8 0.6 1.1 20.0 0.0 5.4 (Laubach) Shida et al. Burkholderia sp. Yabuuchi et al. U96938 91.9 0.0 0.0 2.8 1.1 <1.0 1
Table 2 (continued)
Total % by substrate B NCBI % identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Bacterial taxa no.A match externalC internalD soil debris total % Burkholderia sp. Yabuuchi et al. DQ419951 93.2 0.6 3.9 7.2 1.1 3.2 2 Carnobacterium maltaromaticum EU636013 99.6 0.0 0.0 0.6 0.0 <1.0 (Miller et al.) Mora et al. isolate MF 226 Collimonas sp. De Boer et al. AY281151 99.9 0.6 0.0 0.6 1.1 <1.0
67 CTO 113 Delftia sp. Wen et al. 5.7 EF426439 100.0 0.0 0.0 2.8 0.0 <1.0 Delftia sp. Wen et al. 1 EU707799 96.9 0.0 0.0 0.6 0.0 <1.0 Enterobacter amnigenus Izard et DQ481471 99.9 2.8 7.2 1.1 0.0 2.6 al. strain VTan-10 Enterobacter ludwigii Hoffmann EU557027 99.9 1.1 0.0 1.1 2.8 1.3 et al. strain KU201-3 Enterobacter sp. Hormaeche and EU563349 99.6 0.6 5.0 2.2 0.0 1.9 Edwards C49 Enterobacter sp. Hormaeche and DQ279308 99.8 0.6 0.0 0.0 0.6 <1.0 Edwards TM1_4 Enterococcus faecalis (Andrewes AY958990 99.9 0.0 0.0 1.1 0.0 <1.0 and Horder) Schleifer and Kilpper-Balz strain 4B Jeotgalibacillus halotolerans Yoon AY028925 99.7 0.0 2.2 0.6 0.0 <1.0 et al. Klebsiella oxytoca (Flugge) AJ871857 99.6 2.2 0.6 2.8 0.0 1.4 Lautrop
Table 2 (continued)
Total % by substrate B NCBI % identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Bacterial taxa no.A match externalC internalD soil debris total % Lysinibacillus fusiformis (Priest et AB245423 99.7 15.6 3.9 0.0 2.2 5.0 al.) Ahmed et al. Lysinibacillus fusiformis (Priest et EU168418 99.6 0.0 0.0 1.7 0.6 <1.0 al.) Ahmed et al. strain IBL10B1445 Paenibacillus barcinonensis DQ363432 99.9 0.0 0.0 3.9 1.1 1.3
68 Sánchez et al. Paenibacillus sp. Ash et al. 1 EU071598 97.3 0.0 0.6 2.8 1.7 1.3 Paenibacillus popilliae (Dutky) EU420075 99.6 1.1 0.0 0.6 1.1 <1.0 Pettersson et al. Paenibacillus sp. Ash et al. EU621909 99.8 0.6 0.6 0.6 0.6 <1.0 CCBAU 10748 Paenibacillus sp. Ash et al. Dg- EU497635 98.3 1.1 0.6 1.1 0.6 <1.0 824 Paenibacillus sp. Ash et al. Dg- EU497636 99.9 3.9 1.7 6.7 3.9 4.0 904 Paenibacillus sp. Ash et al. H28- AM162307 99.9 0.6 0.6 8.3 5.6 3.8 08 Paenibacillus sp. Ash et al. JA-08 AM162312 98.0 0.0 0.0 1.7 0.0 <1.0 Paenibacillus sp. Ash et al. L55 DQ196464 100.0 0.6 0.0 2.8 0.6 <1.0 Pandoraea sp. Coenye et al. 1 EF397589 97.3 0.0 0.6 2.2 0.0 <1.0 Pandoraea sp. Coenye et al. 2 EU266819 97.2 0.0 1.1 0.0 0.0 <1.0 Pandoraea sp. Coenye et al. 3 EU306911 93.3 0.0 0.6 0.0 0.0 <1.0 Pantoea sp. Gavini et al. AY227805 81.6 0.0 0.0 1.1 5.0 1.5 Table 2 (continued)
Total % by substrate B NCBI % identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Bacterial taxa no.A match externalC internalD soil debris total % Pseudomonas fluorescens Migula EU430122 99.9 5.0 0.6 10.6 1.1 4.3 strain YC0357 Pseudomonas putida (Trevisan) EU240462 99.5 3.3 2.2 1.1 1.1 1.9 Migula isolate PD39 Pseudomonas sp. Migula 9C_19 AY689072 99.7 8.3 5.0 1.7 5.0 5.0 Pseudomonas sp. Migula 1 EF427863 96.3 0.6 0.0 0.0 0.0 <1.0
69 Pseudomonas sp. Migula KBR-55 AM992007 98.2 0.0 3.3 0.6 3.9 1.9 Pseudomonas sp. Migula AY236959 99.7 7.2 2.8 8.3 5.6 5.8 PCL1171 Serratia grimesii Grimont et al. AY789460 98.2 8.3 12.8 5.0 1.1 6.3 Strain ZFX-1 Serratia marcescens Bizio AB244453 99.9 2.8 1.7 3.3 1.1 2.2 Serratia marcescens Bizio strain EU603510 99.9 4.4 0.0 1.7 0.6 1.7 DAP30 Serratia marcescens Bizio strain EF035134 99.9 5.0 4.4 0.6 1.1 2.8 N4-5 Serratia sp. Bizio 9A_5 AM696755 99.7 2.2 2.2 3.9 0.6 2.1 Serratia sp. Bizio BS18 EU031768 99.4 2.2 3.9 4.4 1.1 2.9 Staphylococcus sp. Rosenbach AM990748 99.9 0.0 1.1 1.1 0.6 <1.0 MOLA524 Staphylococcus sp. Rosenbach R- EU430987 99.8 0.0 0.0 1.1 0.0 <1.0 25657 Stenotrophomonas maltophilia EU543577 99.7 0.0 0.6 0.0 0.0 <1.0 Hugh) Palleroni and Bradbury A The National Center of Biotechnology Institute (NCBI) accession numbers listed are based on the closest match of bacterial taxa in GenBank database. Table 2 (continued)
B Mean percent isolation from each substrate is based on the percent occurrences of bacterial species isolated from three sampling dates (March, July, and November 2004), three locations (Hinds, Madison, and Leake Counties)/sampling date, five active mounds/location/sampling date, and four replicates/mound/location/sampling date: mean percent ÷ 180 (= 5 mounds x 3 locations x 3 sampling dates x 4 replicates) x 100. Overall mean total percentages of total bacterial isolates = (total mean percent isolation from all substrates ÷ 4) x 100. C Ant tissue external = ant tissue external body regions. D Ant tissue internal = ant tissue internal body regions.
70 Table 3 Mean percent isolation frequencies of fungal taxa identified from red imported fire ant mounds from three locations (Hinds, Madison, and Leake Counties) along Natchez Trace Parkway in Mississippi.
% Total % by substrate B NCBI identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Fungal taxa no.A match externalC internalD soil debris total % Articulospora sp. Ingold JS1116 AM176695 100.0 7.2 1.1 10.6 0.0 4.7 Aspergillus flavipes (Bainier & R. AY214443 99.5 7.2 1.7 5.0 6.1 5.0 Sartory) Thom & Church strain UWFP 1022 71 Aspergillus niger Tiegh CBS 513.88 NW001594 100.0 0.0 0.0 2.2 10.0 3.1 contig An03c0110 105 Aspergillus nomius Kurtzman, B.W. EU484317 99.8 0.0 0.6 0.0 0.0 <1.0 Horn & Hesselt isolate PEIPDFF22 Aspergillus nomius Kurtzman, B.W. DQ467992 99.8 0.0 0.0 5.0 0.0 <1.0 Horn & Hesselt strain KS2 Aspergillus sojae Sakag. & K. AY373867 100.0 1.1 0.0 4.4 2.8 2.1 Yamada strain ATCC 14895 Aspergillus sp. P. Micheli ex Haller EF614252 99.8 1.1 0.0 2.8 1.1 1.3 Ar-4jing-1 Aspergillus sp. P. Micheli ex Haller EU301661 100.0 3.9 5.0 10.0 13.9 8.2 HZ-35 Aspergillus terreus Thom AJ413985 100.0 1.1 0.0 6.7 1.7 2.4 Aspergillus tubingensis Mosseray EF621571 99.8 0.0 1.7 8.9 4.4 3.8 strain 3.4342 Aspergillus versicolor (Vuill.) Tirab. AJ937754 100.0 0.0 0.0 1.7 0.0 <1.0 Bionectria ochroleuca (Schwein.) AF106532 100.0 1.1 0.0 3.3 6.1 2.6 Schroers & Samuels strain BBA 68698 Table 3 (continued)
% Total % by substrate B NCBI identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Fungal taxa no.A match externalC internalD soil debris total % Ceratocystis sp. Ellis & Halsted DQ318194 90.3 1.1 0.0 8.9 2.2 3.1 Eupenicillium anatolicum Stolk AF033425 99.3 0.0 0.0 4.4 0.0 1.1 strain NRRL 5820 Fungal endophyte sp. bn23 EU360465 100.0 0.6 2.2 3.9 3.9 2.6 Fusarium culmorum (W.G. Sm.) AY147330 100.0 0.0 0.0 0.6 0.6 <1.0 Sacc. isolate K991
72 Fusarium oxysporum f. sp. phaseoli EF450110 99.5 0.0 0.0 1.1 0.6 <1.0 J.B. Kendr. & W.C. Snyder Fusarium oxysporum f. sp. DQ837680 99.9 0.0 0.0 1.7 1.1 <1.0 vasinfectum W.C. Snyder & H.N. Hansen isolate NRRL25231 Fusarium oxysporum f. sp. AF322075 99.8 5.6 0.0 15.6 3.3 5.8 vasinfectum W.C. Snyder & H.N. Hansen isolate strain Ag149-I Fusarium oxysporum f. sp. AF322076 100.0 3.3 1.1 8.9 5.0 4.6 vasinfectum W.C. Snyder & H.N. Hansen isolate strain Ag149-III Fusarium oxysporum E.F. Sm. & EU364854 99.6 2.2 0.0 2.8 0.6 1.4 Swingle strain F-T.1.7-040427-1 Fusarium reticulatum var. DQ854865 99.7 0.0 0.0 0.6 0.6 <1.0 negundinis (Sherb.) Wollenw. isolate 63/2.6.1 Fusarium solani (Mart.) Sacc. isolate EU326189 99.8 1.1 0.0 7.2 0.0 5.6 XSD-77
Table 3 (continued)
% Total % by substrate B NCBI identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Fungal taxa no.A match externalC internalD soil debris total % Fusarium sp. Link 5/97-45 AJ279478 99.8 5.6 0.0 16.7 25.0 11.8 Fusarium sp. Link E033 AB255352 99.8 2.2 0.0 15.0 9.4 6.7 Fusarium sp. Link JD-109.2 EF152423 99.6 0.0 0.0 3.3 1.7 1.3 Fusarium sp. Link NRRL 43529 EF452965 99.3 0.0 1.1 1.1 2.2 1.1 Fusarium sp. Link P002 EF423517 100.0 3.3 2.2 13.9 12.2 7.9 Fusarium sporotrichioides var. minor AF414973 99.1 0.0 0.0 0.6 7.8 2.1
73 Wollenw. strain BBA 62425 Gibberella moniliformis Wineland EU364864 100.0 0.0 0.0 1.1 1.1 <1.0 strain Fm-X.1.7-030527-31 Kabatiella zeae Narita & Y. Hirats. AJ244253 100.0 0.0 0.0 5.6 0.0 1.4 Lophiostoma sp. Ces. & De Not. EF042107 96.2 0.0 0.0 0.0 0.0 <1.0 Metarhizium anisopliae var. EU307926 99.7 1.7 0.0 5.0 5.0 2.9 anisopliae (Metschn.) Sorokīn isolate Q2 Metarhizium anisopliae var. EU307909 99.8 0.0 0.0 0.6 0.0 <1.0 anisopliae (Metschn.) Sorokīn strain LRC 211 Mortierella alpina Peyronel AJ271629 99.6 9.4 0.0 11.7 0.6 5.4 Neosartorya fischeri (Wehmer) AF176661 99.3 0.0 0.6 2.8 0.0 <1.0 Malloch & Cain Paecilomyces lilacinus (Thom) AB103380 99.8 1.7 0.0 12.2 12.2 6.5 Samson Paraphaeosphaeria sp. O.E. Erikss. AB096264 100.0 1.1 0.0 0.6 2.2 1.0 N119
Table 3 (continued)
% Total % by substrate B NCBI identity Ant Ant Mound Accession to closest tissue tissue Mound plant Overall Fungal taxa no.A match externalC internalD soil debris total % Penicillium adametzioides S. Abe EU497960 99.3 2.8 0.0 0.6 0.0 <1.0 strain L6 Penicillium glabrum (Wehmer) DQ682590 100.0 0.6 1.1 1.7 6.1 2.4 Westling Penicillium granulatum Bainier DQ682590 100.0 0.0 0.0 2.2 0.0 <1.0 isolate 732
74 Penicillium griseofulvum Dierckx EU497956 100.0 0.6 0.0 9.4 2.8 3.2 strain F26 Penicillium miczynskii K.M. Zalessky AY373924 99.5 0.6 0.0 1.1 0.6 <1.0 strain FRR 1077 Penicillium pulvillorum Turfitt strain AF178526 98.0 1.7 0.0 7.2 0.6 2.4 RMF 9124 Pseudallescheria boydii (Shear) AJ888423 99.3 0.6 0.0 10.6 1.7 3.2 McGinnis, A.A. Padhye & Ajello Pseudallescheria boydii (Shear) AJ888423 99.5 0.0 0.0 3.3 1.1 1.1 McGinnis, A.A. Padhye & Ajello strain WM 06.389 Trichoderma aureoviride Rifai strain AF194019 100.0 4.4 3.9 23.9 18.9 12.8 IMI 113135 Trichoderma harzianum Rifai Ir. 561 AY154948 99.8 0.6 0.0 1.7 2.8 1.3 Trichoderma sp. Pers. Ir. 311 AY154939 100.0 1.1 0.0 15.0 2.2 4.6 Zygomycete AM-2008a isolate EU428773 99.8 3.3 0.0 5.0 13.3 5.4 AF016 Unknown n/a n/a 1.1 0.0 1.7 0.6 <1.0 A The National Center of Biotechnology Institute (NCBI) accession numbers listed are based on the closest match of fungal taxa in GenBank database. n/a = not applicable. Table 3 (continued)
B Mean percent isolation from each substrate is based on the percent occurrences of fungal species isolated from three sampling dates (March, July, and November 2004), three locations (Hinds, Madison, and Leake Counties)/sampling date, five active mounds/location/sampling date, and four replicates/mound/location/sampling date: mean percent ÷ 180 (= 5 mounds x 3 locations x 3 sampling dates x 4 replicates) x 100. Overall mean total percentages of total fungal isolates = (total mean percent isolation from all substrates ÷ 4) x 100. C Ant tissue external = ant tissue external body regions. D Ant tissue internal = ant tissue internal body regions.
75
4
2
7 1 8
12
21 16
17 20
1 = Achromobacter: 10.8 2 = Acinetobacter: 2.5 3 = Alpha proteobacterium: 0.6 4 = Bacillus: 45.1 5 = Bacterium BR115: 0.1 6 = Bordetella: 0.7 7 = Brevibacillus: 5.4 8 = Burkholderia: 4.2 9 = Carnobacterium: 0.1 10 = Collimonas: 0.6 11 = Delftia: 0.8 12 = Enterobacter: 6.1 13 = Enterococcus: 0.3 14 = Jeotgalibacillus: 0.7 15 = Klebsiella: 1.4 16 = Lysinibacillus: 5.6 17 = Paenibacillus: 13.9 18 = Pandoraea: 1.3 19 = Pantoea: 1.5 20 = Pseudomonas: 19.0 21 = Serratia: 18.0 22 = Staphylococcus: 1.0 23 = Stenotrophomonas: 0.1
Figure 6 Overall percent isolation frequencies of bacteria from red imported fire ant mounds by genera isolated from Hinds, Madison, and Leake Counties along Natchez Trace Parkway in Mississippi.
Number after genus indicates percent isolation.
76 D
E
C
H
B A T
S L M A = Unknown: 0.8 O Q B = Articulospora: 4.7 C = Aspergillus: 26.8 D = Bionectria: 2.6 E = Ceratocystis: 3.1 F = Eupenicillium: 1.1 G = Fungal endophyte: 2.6 H = Fusarium: 50.0 I = Gibberella: 0.6 J = Kabatiella: 1.4 K = Lophiostoma: 0.1 L = Metarhizium: 3.0 M = Mortierella: 5.4 N = Neosartorya: 0.8 O = Paecilomyces: 6.5 P = Paraphaeosphaeria: 1.0 Q = Penicillium: 10.0 R = Pseudallescheria: 4.3 S = Trichoderma: 18.7 T = Zygomycete: 5.4
Figure 7 Overall percent isolation frequencies of fungi from red imported fire ant mounds by genera isolated from Hinds, Madison, and Leake Counties along Natchez Trace Parkway in Mississippi.
Number after genus indicates percent isolation.
77 Overall bacterial and fungal species richness values (n) were 71 and 50, respectively. This result indicates there were more species of bacteria isolated during the survey than fungi. The richness values for bacteria (Table 4) and fungi (Table 5) were presented by comparing locations, substrates, and sampling dates. Analyses by substrate, location, and sampling date, showed that the highest species richness values for bacteria were from SM at 61, Hinds at 60, and in March at 65, respectively. There was significant difference across sampling dates and the richness value for ant tissues (n = 56) was significantly different from
PD (n = 45) but no difference from SM (n = 61). Slightly different from bacteria, the richness values for fungi were significantly different among all substrates but the values were similar among the three locations.
The value was significantly higher in November (n = 47) than in March
(n = 41) and July (n = 39). When richness values for bacteria isolation between ant tissue external body regions (AE) and ant tissue internal body regions (AI) were compared, the values were similar (n = 43 for AE and n= 40 for AI). In comparison, fungal isolation richness values for AE tissues (n = 32) were significantly higher than AI tissues (n = 13). This value is more than twice as much as for external body regions of ants than internally.
The richness values were also compared by observing interactions among locations, tissue types and sampling dates. For bacteria, when
78 comparing species richness using interactions between locations and substrate types, no significant differences were observed between locations and one particular tissue type (Table 6). For example, there were no significant differences among Hinds-SM (n = 46), Leake-SM
(n = 44), and Madison-SM (n = 42) in species richness values.
An exception was that Madison-PD had a significantly lower richness values (n = 17) than Leake-PD (n = 24) and Hinds-PD (n = 29). However, when comparing substrate types within a given location (for example,
Hinds-PD and Hinds-SM), no obvious trends were noted. For fungi, when locations and one particular substrate type were compared (Table
7), no significant differences were observed. However, different trends were noted when substrate types within a given location were compared:
Hinds-SM (n = 39), Hinds-PD (n =27), and Hinds-ant tissue (n=19) were significantly different among each other. These result showed that there were more fungal species isolated from SM in Hinds (39) followed with PD in Hinds (27) and ant tissues in Hinds (19). This trend was also true for
Madison-SM (n = 37), Madison-PD (n =30), and Madison-ant tissue
(n = 27) where richness values were significantly different from each other.
79 Table 4 Species richness of all bacterial taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi.
SubstrateA nB Location n Sampling date n SM 61 a Hinds 60 a March 65 a PD 45 b Leake 57 ab July 56 b Ant tissue 56 a Madison 52 b November 40 c LSD (P≤0.05) 5 LSD (P≤0.05) 5.4 LSD (P≤0.05) 5 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B n = species richness. Within-column values with the same letter are not significantly different (P>0.05).
Table 5 Species richness of all fungal taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi.
SubstrateA nB Location n Sampling date n SM 50 a Hinds 46 a March 41 b PD 41 b Leake 42 a July 39 b Ant tissue 36 c Madison 45 a November 47 a LSD (P≤0.05) 4 LSD (P≤0.05) 5 LSD (P≤0.05) 5 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B n = species richness. Within-column values with the same letter are not significantly different (P>0.05).
80 Table 6 Species richness of all bacterial taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi.
n LSD Location SMA PD Ant tissue (P≤0.05) Hinds 46B a (A) 29 a (B) 45 a (A) 10C Leake 44 a (A) 24 a (B) 32 a (B) 10 Madison 42 a (A) 17 b (B) 36 a (A) 6 LSD (P≤0.05) 10C 7 9 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B n = species richness. Within-column values with the same lowercase letter are not significantly different (P>0.05). Across-row mean values with the same uppercase letter are not significantly different (P>0.05). C Means were compared according to Fisher’s protected least significant difference test (t-test) (P>0.05).
Table 7 Species richness of all fungal taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi.
n LSD Location SMA PD Ant tissue (P≤0.05) Hinds 39B a (A) 27 a (B) 19 a (C) 7C Leake 35 a (A) 30 a (B) 22 a (B) 7 Madison 37 a (A) 30 a (B) 27 a (C) 6 LSD (P≤0.05) 7C 7 8 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B n = species richness. Within-column values with the same lowercase letter are not significantly different (P>0.05). Across-row mean values with the same uppercase letter are not significantly different (P>0.05). C Means were compared according to Fisher’s protected least significant difference test (t-test) (P>0.05).
In addition to species richness, species diversity values for bacteria
and fungi were also compared as previously described for richness values
(Table 8 and 9). Overall bacterial and fungal species diversity (H’) were
1.58 and 1.11, respectively. Unlike species richness, the trend for
81 species diversity for bacteria was slightly different. Comparisons by substrate, location, and sampling date showed the highest diversity values were from ant tissue (H’ = 3.27), from Leake (H’ = 3.43), and in
July (H’ = 3.46). The values indicated that the proportion of the total numbers of different species and the relative importance of individual species are higher in these three communities within each category
(substrate, location, and sampling date). By substrate, the diversity value from ant tissue (H’ = 3.27) was significantly higher than from SM
(H’ = 3.10) and PD (H’ = 3.02). Across three locations, the diversity value was significantly lower in Madison (H’ = 3.18) than in Hinds (H’ = 3.41) and Leake (H’ = 3.43). By sampling date, the value was significantly higher in July at 3.46 than in March and in November at 3.25 and 3.23, respectively. When diversity values between AE and AI tissues were compared, AI value was significantly greater than AE at 3.17 and 2.89, respectively, for bacteria. Unlike bacteria, the diversity value for fungi for
AI was significantly lower than AE tissue at 2.18 and 3.04, respectively.
Species diversity values were also calculated to see whether there were interactions among locations, substrate types and sampling dates.
Using interactions between locations and substrate types, similar to what was found with the richness values; no significant differences were noted between locations and one given substrate type for bacteria (Table 10).
For example, there were no significant differences among Hinds-SM,
82 Leake-SM, and Madison-SM at 2.94, 3.06, and 2.88, respectively. Two exceptions were that Madison-PD (H’ = 2.20) had significantly lower values than Hinds-PD (H’ = 2.81) and Leake-PD (H’ = 2.81), and the
Leake-ant tissue (H’ = 2.90) value was also significantly lower than
Madison-ant tissue (H’ = 3.08) and Hinds-ant tissue (H’ = 3.19) interactions. The values showed that the proportion of the total numbers of different species and the relative importance of individual species in
Madison-PD were significantly lower compared to Hinds-PD and Leake-
PD. This is also true for Leake-ant tissue interaction where the values were significantly lower in comparison to Madison-ant tissue and Hinds- ant tissue interactions.
Table 8 Species diversity of all bacterial taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi.
SubstrateA H’ B Location H’ Sampling date H’ SM 3.10 b Hinds 3.41 a March 3.25 b PD 3.02 b Leake 3.43 a July 3.46 a Ant tissue 3.27 a Madison 3.18 b November 3.23 b A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B H’ = species diversity. Within-column values with the same letter are not significantly different (P>0.05).
83 Table 9 Species diversity of all fungal taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi.
SubstrateA H’ B Location H’ Sampling date H’ SM 3.43 a Hinds 3.31 b March 3.26 a PD 3.13 b Leake 3.27 b July 3.20 a Ant tissue 3.10 b Madison 3.41 a November 3.25 a A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B H’ = species diversity. Within-column values with the same letter are not significantly different (P>0.05).
Table 10 Species diversity of all bacterial taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi.
H’ LSD Location SMA PD Ant tissue (P≤0.05) Hinds 2.94B a (AB) 2.81 a (B) 3.19 a (A) 0.30C Leake 3.06 a (A) 2.81 a (A) 2.90 ab (A) 0.30 Madison 2.88 a (A) 2.20 b (B) 3.08 a (A) 0.43 LSD (P≤0.05) 0.31C 0.45 0.25 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B H’ = species diversity. Within-column values with the same lowercase letter are not significantly different (P>0.05). Across-row mean values with the same uppercase letter are not significantly different (P>0.05). C Means were compared according to Fisher’s protected least significant difference test (t-test) (P>0.05).
84 Table 11 Species diversity of all fungal taxa isolated from red imported fire ants and mounds by substrate-location along Natchez Trace Parkway in Mississippi.
H’ LSD Location SMA PD Ant tissue (P≤0.05) Hinds 3.14B a (A) 2.82 a (A) 2.55 a (C) 0.24C Leake 3.09 a (A) 2.97 a (AB) 2.69 a (B) 0.39 Madison 3.28 a (A) 3.00 a (B) 2.88 a (B) 0.22 LSD (P≤0.05) 0.20C 0.23 0.40 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B H’ = species diversity. Within-column values with the same lowercase letter are not significantly different (P>0.05). Across-row mean values with the same uppercase letter are not significantly different (P>0.05). C Means were compared according to Fisher’s protected least significant difference test (t-test) (P>0.05).
No specific trends were noted when observing comparisons between substrate types and one particular location except that no significant differences in diversity values were found among Leake-SM
(H’ = 3.06), Leake-PD (H’ = 2.81), and Leake-ant tissue (H’ = 2.90) interactions. For fungi, no significant differences were observed when interactions between locations and a given substrate type were compared
(Table 11). Contrary to the results above, as was found with richness values, various trends were shown when one location and substrate types were compared. For example, the diversity value of Hinds-ant tissue (H’ = 2.55) was significantly lower than the value of Hinds-SM and
Hinds-PD interactions at 3.14 and 2.82, respectively, but Hinds-SM and
Hinds-PD values were similar.
85 In addition to the species richness and species diversity, evenness values were also calculated using the same comparison as described previously. Total bacterial and fungal species evenness (E) were 0.37 and 0.28, respectively. Since these values are near 0, they indicate that most of the individuals in both bacteria and fungi belong to one or a few species. For bacteria (Table 12), by substrate, location, and sampling date, the highest evenness values were from ant tissue (E = 0.82), from
Leake County (E = 0.85), and during the month of July (E = 0.88), respectively. By substrate, the evenness values were significantly different among each other. Evenness value from Madison (E = 0.80) was significantly lower from Hinds (E = 0.83) and Leake (E = 0.85) Counties.
Also, based on sampling date, the value in March (E = 0.76) was significantly lower compared to the value in July (E = 0.86) and in
November (E = 0.88). Unlike bacteria, evenness values for fungi
(Table 13) were similar among all substrates with the highest value from
SM at 0.88. By location, Madison County (E = 0.90) value was significantly greater than Hinds but not different from Leake (E = 0.88)
Counties. By sampling date, March (E = 0.88) had the greatest values and was significantly greater than November (E = 0.84) but not different from July (E = 0.87). When the evenness values were compared between
AE and AI tissues, bacteria had significantly higher values in AI tissues at 0.84 than AE tissues at 0.78 but no significant differences were found
86 between AI (E = 0.85) and AE (E = 0.88) tissues for fungi. Since the values were close to each other, results above indicate that each community consisted of approximately the same numbers of species of bacteria or fungi.
Table 12 Species evenness of all bacterial taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi.
SubstrateA E B Location E Sampling date E SM 0.75 c Hinds 0.83 a March 0.76 b PD 0.79 b Leake 0.85 a July 0.86 a Ant tissue 0.82 a Madison 0.80 b November 0.88 a A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B E = species evenness. Within-column values with the same letter are not significantly different (P>0.05).
Table 13 Species evenness of all fungal taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi.
SubstrateA E B Location E Sampling date E SM 0.88 a Hinds 0.86 b March 0.88 a PD 0.84 a Leake 0.88 ab July 0.87 ab Ant tissue 0.86 a Madison 0.90 a November 0.84 b A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B H’ = species diversity. Within-column values with the same letter are not significantly different (P>0.05).
87 Table 14 Species evenness of all bacterial taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi.
E LSD Location SMA PD Ant tissue (P≤0.05) Hinds 0.77B a (B) 0.84 a (A) 0.84 a (A) 0.05C Leake 0.81 a (B) 0.88 a (A) 0.84 a (AB) 0.05 Madison 0.77 a (B) 0.79 a (B) 0.86 a (A) 0.10 LSD (P≤0.05) 0.06C 0.09 0.04 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B E = species evenness. Within-column values with the same lowercase letter are not significantly different (P>0.05). Across-row mean values with the same uppercase letter are not significantly different (P>0.05). C Means were compared according to Fisher’s protected least significant difference test (t-test) (P>0.05).
Table 15 Species evenness of all fungal taxa isolated from red imported fire ants and mounds by location-substrate along Natchez Trace Parkway in Mississippi.
E LSD Location SMA PD Ant tissue (P≤0.05) Hinds 0.86B b (B) 0.86 a (B) 0.87 a (A) 0.04C Leake 0.87 ab (A) 0.87 a (A) 0.87 a (A) 0.07 Madison 0.91 a (A) 0.88 a (A) 0.87 a (A) 0.04 LSD (P≤0.05) 0.04C 0.03 0.07 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B E = species evenness. Within-column values with the same lowercase letter are not significantly different (P>0.05). Across-row mean values with the same uppercase letter are not significantly different (P>0.05). C Means were compared according to Fisher’s protected least significant difference test (t-test) (P>0.05).
As was previously described, interactions among locations,
substrate types and sampling dates were compared statistically. Using
interactions between locations and substrate types, no significant
differences were noted between locations and one particular type of
88 substrate (Table 14) for bacteria. For example, there were no significant differences among Hinds-PD (E = 0.84), Leake-PD (E = 0.88), and
Madison-PD (E = 0.79) in evenness values. These results also indicate that there was high evenness in each of the interactions above. However, when comparing substrate types within a given location (for example,
Leake-PD and Leake-ant tissue), random significant differences were observed but with no obvious trends. It was also noted that the evenness values for SM were constantly lower compared to the values for
PD and ant tissue within one given location. For fungi, comparison between locations and one particular substrate types (Table 15) showed no differences in all comparisons with an exception that the evenness value for Hinds-SM (E = 0.86) was significantly lower than the value of
Madison-SM (E = 0.91). When a given location and substrate types were compared, no significant differences were also noted. An exception was the value of Hinds-ant tissue interaction was significantly higher at 0.87 than the values for Hinds-PD and Hinds-SM at 0.86 for both. In addition, evenness values for fungi from ants for all locations were equal
(E = 0.87). These interaction results indicated that there were high level of evenness in both bacteria and fungi in a given community.
Coefficient community (CC) values for bacteria and fungi were
calculated based on substrate, location, and sampling date data (Tables
16 and 17), and/or interactions among those parameters (Table 18). The
89 CC values ranged from 0.74 – 0.89 (Table 16) for bacteria and from 0.79
– 0.92 (Table 17) for fungi. By substrates, the highest CC value was from
SM-ant tissue at 0.82 for bacteria and from SM-PD at 0.87 for fungi.
Additional comparison within ant community from AE-AI tissues (data not presented in a table format) showed lower values for bacteria at 0.67 and for fungi at 0.36 than other substrate comparisons (Tables 16 and
17). By locations, the highest CC values were from Hinds-Madison for both bacteria at 0.89 and fungi at 0.92. By sampling dates, the highest value for bacteria was from March-July at 0.84 but for fungi, March-
November and July-November shared the highest CC values at 0.86.
Most of these results showed values near to 1.0 indicating that most species were common to both communities being compared. One exception was the AE-AI tissues for fungi at the value of 0.36 indicating fewer species were common to both communities.
Location/substrates interaction (Table 18) results showed that overall CC values for bacteria were lower in comparison to fungi. The CC values for Leake and Madison Counties were always greater for fungi than bacteria, but Hinds County/substrates interaction CC values had a reverse trend.
Ant microorganism CC values from each location/AE-AI tissues were also compared (Table 19). The CC values were contradictory between bacteria and fungi where the highest value for bacteria was 0.86
90 from Madison County/AE-AI interaction. This indicates that most species were common to both Madison County and AE-AI tissues isolations. In addition, this value was numerically greater than any values previously described within the location/substrate interaction, for example, Madison/SM-ant tissue at 0.72 (Table 18). Contrary to the previous results, the CC values for fungi were numerically lower than previous values within the location/substrate interaction described above (for example, Madison/SM-Ant tissue at 0.75) with the lowest value in Hinds County/AE-AI interaction at 0.10. This low value shows that only a few (one species only in this case, complete data not presented) fungal species were commonly isolated from both Hinds
County and AE-AI tissues.
Table 16 Coefficient of community of all bacterial taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi.
Sampling SubstratesA CCB LocationsC CC datesD CC SM–PD 0.75 H–L 0.82 Mar–July 0.84
SM–Ant tissue 0.82 H–M 0.89 Mar–Nov 0.74
PD–Ant tissue 0.75 L–M 0.75 July–Nov 0.77
A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant tissue from the mound. B CC = coefficient of community. C H = Hinds County, L = Leake County, M = Madison County. D Mar = March, Nov = November.
91 Table 17 Coefficient of community of all fungal taxa isolated from red imported fire ants and mounds by substrate, by location, and by sampling date along Natchez Trace Parkway in Mississippi.
Sampling SubstratesA CCB LocationsC CC datesD CC SM–PD 0.87 H–L 0.91 Mar–July 0.85
SM–Ant tissue 0.79 H–M 0.92 Mar–Nov 0.86
PD–Ant tissue 0.81 L–M 0.85 July–Nov 0.86
A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant from the mound. B CC = coefficient of community. C H = Hinds County, L = Leake County, M = Madison County. D Mar = March, Nov = November.
Table 18 Coefficient of community of all bacterial and fungal taxa isolated from red imported fire ants and mounds by location/substrates interaction along Natchez Trace Parkway in Mississippi.
Location SubstratesA CCB for bacteria CC for fungi Hinds SM–PD 0.69 0.64 Hinds SM–Ant tissue 0.68 0.55 Hinds PD–Ant tissue 0.62 0.48
Leake SM–PD 0.50 0.77 Leake SM–Ant tissue 0.61 0.67 Leake PD–Ant tissue 0.57 0.62
Madison SM–PD 0.51 0.75 Madison SM–Ant tissue 0.72 0.75 Madison PD–Ant tissue 0.42 0.67 A SM, PD, and ant tissue are substrate types from which bacteria and fungi were isolated. SM = mound soil, PD = mound plant debris, ant tissue = red imported fire ant tissue from the mound. B CC = coefficient of community.
92 Table 19 Comparison of coefficient of community of all bacterial and fungal taxa isolated from red imported fire ants and mounds by location/AE-AIA tissues interaction collected along Natchez Trace Parkway in Mississippi.
Location CCB for bacteria CC for fungi Hinds 0.47 0.10 Leake 0.44 0.37 Madison 0.86 0.14 A AE = external body regions of red imported fire ants (RIFA) tissue, AI = internal body regions of RIFA tissue. B CC = coefficient of community.
In vivo and in situ studies of selected bacteria and fungi isolated
from red imported fire ants (RIFA) and mounds
Bacteria and fungi from RIFA and mounds were evaluated for
biological control and/or antagonistic potential in vivo in laboratory.
During the in vivo study, a total of 65 and 86 isolates of bacteria and
fungi, respectively, were tested. Using Petri plate inoculum, the results
from the in vivo study showed either the organisms were antagonistic or caused mortality to the RIFA.
Control by antagonism
In general, after the tester organisms containing the diet were
placed into the artificial colony, the RIFA workers reacted almost
immediately. They would always approach the food source and attempt
to pass through the tester organisms to obtain the diet and then carried
the food back to the colony. This behavior was mainly caused by tester
93 bacteria. Four tester bacteria appeared to exhibit these antagonistic effects: Bacillus sp. 3, Paenibacillus pabuli, Collimonas sp. CTO 113, and
Burkholderia sp. 2 (isolate 10). Instead of immediately foraging the diet, the worker ants encircled the edge of the bacterial plates without feeding, and returned to their nest. This observation occurred for approximately
15 – 30 minutes or even longer, but no specific data were collected between planned observation intervals. Within 30 minutes, the workers returned to the plates carrying either soils, small pieces of plant debris or dead ants (natural death) and placed these directly on the bacteria as a bridge to the diet and to avoid direct contact (Figure 8). The bridges that the ants formed were approximately 0.65 – 2.0 cm thickness and 5.0 cm length from the plate edge to the diet. Then the ants walked on top of the barrier and returned to the nest with the diet.
Another antagonistic response was also observed where the ants approached the diet with no difficulty. However, approximately one hour later many ants struggled to return to the nest; the ants became very sluggish and were not able to exit the plate. They were found dead on the plates the following day. This ant behavior was mainly caused by fungi of the following taxa: Penicillium granulatum and Penicillium pulvillorum (Figure 9).
94
a
b
Figure 8 Red imported fire ant workers carried plant debris from the mound soils onto the culture plate to construct a bridge as a means to reach their food source.
a = food source, b = red imported fire ant.
95
a b
Figure 9 Red imported fire ants were found dead one day after attempting feeding on their food source.
a = food source, b = dead red imported fire ants.
Control by mortality effects
Eight most promising bacterial and fungal isolates studied in vivo were Enterobacter ludwigii strain KU201-3, Paenibacillus sp. JA-08,
Serratia marcescens strain DAP30, Burkholderia sp. 2 (isolate 43),
Aspergillus sojae strain ATCC 14895 (isolate 69), Aspergillus terreus
96 (isolate 81), Aspergillus tubingensis strain 3.4342 (isolate 82), and
Aspergillus sp. HZ-35 (isolate 153) (Table 20). These results were based on the death rates (DR) of RIFA, foraging rates (FR) of RIFA on the diet, and diet consumption. The DR values ranged from 0.0 to 5.0 and FR from 0.3 to 1.7. This indicates that there was greater putative control at
5.0 and no control at 0.0. The higher FR rate for RIFA indicates that there were more foraging activities by RIFA on the artificial diet and/or selective medium containing the tester organism. The percentages of diet consumption ranged from 51% to 72%; there were no specific trends indicating that higher diet consumption coincided with higher foraging rates. In general, it was noted that the higher DR for mound soils was reflected in the lower FR with a few exceptions. For example, DR for mound soils for Burkholderia sp. 2 (isolate 43) was rated as 4.0, and FR values for the selective medium and FR for the diet were 0.7 and 0.7, respectively. The DR for mound soils for A. terreus was 5.0, and FR for the medium and FR for the diet were 0.6 and 0.8, respectively.
Additional results (data not presented) can be highlighted included the DR values were numerically greater for the mound soils than the values for the selective media. However, it was observed that the value for medium containing Achromobacter sp. (Appendix B Table 49) was numerically higher at 1.4 than for mound soils at 1.2; this DR value was also the highest for that particular trial. One of entomopathogenic fungi
97 evaluated during this study, Metarhizium anisopliae var. anisopliae isolate LRC211 (isolate 115), showed smaller FR values that was not necessarily reflected in the higher DR value. The DR values for the selective medium and mound soils were 0.4 and 1.8, respectively; FR values for medium and diet were both at 0.3. Another common insect fungal pathogen, Paecilomyces lilacinus showed no RIFA death on agar
(DR = 0) but RIFA death was observed on the surface of mound soils
(DR = 3.2) in vivo. To confirm Koch Postulates, the randomly selected dead ants (10 per replicate) were plated on the growth medium; results showed that both fungi were recovered (data not presented). Complete list of bacteria and fungi evaluated in vivo can be found in Appendix B
(Tables 43 – 54).
98 Table 20 Mean resultsA from the in vivo experiment studies of three tester bacteria and fungi showing the greatest potential for control of red imported fire ants.
Mean DRB for Mean DR Mean FRB mediumC with for for medium Mean Mean % Mean % Trial tester mound with tester FR for diet (g)D diet (g)D no. Taxa organism soils organism diet consumed uneaten Bacteria 4 Enterobacter ludwigii strain 0.0 a 3.6 a 0.3 a 0.6 ab 51.0 49.0 a KU201-3 Control 0.0 a 2.0 a 0.3 a 0.8 ab 44.0 56.0 a
99 5 Paenibacillus sp. JA-08 1.4 ab 4.4 a 2.0 a 1.3 a 44.0 56.0 a Burkholderia sp. 2 (isolate 43) 0.8 ab 4.0 abc 1.9 a 0.9 ab 49.0 51.0 a Control 0.4 ab 4.2 ab 1.9 a 1.2 ab 42.0 58.0 a
6 Serratia marcescens strain 0.0 c 4.0 a 0.2 cd 0.3 a 46.0 54.0 ab DAP30 Control 0.0 c 3.0 abc 0.3 bcd 0.4 a 54.0 46.0 b
Fungi 1 Aspergillus sojae strain 1.6 a 3.8 a 1.0 c 0.7 c 72.0 28.0 a ATCC 14895 (isolate 69) Control 0.2 b 1.2 b 2.1 a 2.6 a 90.0 10.0 ab
2 Aspergillus terreus (isolate 1.8 a 5.0 ab 0.6 d 0.8 b 65.0 35.0 a 81) Aspergillus tubingensis strain 0.2 ab 4.6 ab 1.6 bcd 1.7 ab 63.0 37.0 a 3.4342 (isolate 82) Control 0.0 b 3.6 b 2.8 a 1.7 ab 62.0 38.0 a
Table 20 (continued)
Mean DRB for Mean DR Mean FRB mediumC with for for medium Mean % Mean % Trial tester mound with tester Mean FR diet (g)D diet (g)D no. Taxa organism soils organism for diet consumed uneaten 9 Aspergillus sp. HZ-35 (isolate 1.8 a 4.8 a 1.5 ab 0.8 a 60.0 40.0 a 153) Control 0.2 c 3.8 a 1.2 ab 0.5 a 61.0 39.0 a
A Numbers (rates, diet consumption, and diet remaining) were analyzed within each evaluation trial where each sampling trial consisted of between 45 and 60 Sterilite boxes (each box contained RIFA and mound soils).
100 B DR = death rate, and FR = foraging rate, were based on the visible dead ants observed on the surface of mound soils placed in individual Sterilite box. The following rating was used: Rate 0 = 0 dead ant, rate 1 = 1-10 dead ants, rate 3 = 26-50 dead ants, rate 4 = 50-100 dead ants, rate 5 = 101-200 dead ants, and rate 6 >200 dead ants. One replicate represents one individual Sterilite box and mean was average of 5 replicates. Within-column values with the same lowercase letter are not significantly different according to Fisher’s protected (LSD) test (P>0.05). C Medium is defined as a selective agar medium prepared for culturing bacteria or fungi as tester isolates containing necessary food sources. D Diet was prepared according to Drees and Ellison (2002).
For the in situ field cage study, the potential control and/or
antagonistic activities of four selected bacteria and ten fungi from RIFA
were evaluated within a standard individual cage per tester organism
under natural environmental conditions where no pesticides were
applied.
For bacteria, there were no significant differences between control
and Bacillus anthracis strain JH18 in all parameters during the first
evaluation trial (Table 21). No consistent trends were noted for the
second evaluation date. Mean number of dead ants for Staphylococcus
sp. R-25657 (182.8) was numerically higher than the control (158.0) and
other tester bacteria Bordetella sp. (26.0) and Paenibacillus pabuli (12.8)
during the field cage trial. Between the two evaluation trials, the mean
number of dead ants for B. anthracis strain JH18 (378.0) was the
greatest numerically. An exception for B. anthracis strain JH18 was,
during the 14 day evaluation period, the number of living ants extracted
from the mound soils pot containing the bacterium was significantly
higher (480.0) than control (174.3) within its trial (Table 22). When the
randomly-selected RIFA were plated on selective medium, 5.9% of the
same bacterium recovered from B. anthracis strain JH18 pot and the rest
94.1% were other bacteria (Table 25). Contrary to these results, only
0.8% of Bordetella sp. was recovered and other tester bacteria were not recovered after 14 days. These results showed that B. anthracis strain
102 JH18 may have provided some control in comparison to other bacteria
evaluated in the field cage environment.
For fungi, the three greatest mean numbers of dead ants were
collected from the mound soil pots containing Paecilomyces lilacinus
(301.8), Gibberella moniliformis strain Fm-X.1.7-030527-31 (228.5), and
Aspergillus HZ-35 (224.3) (Table 23). After 14 days, the highest mean total numbers of ants (dead and alive) were from mound soil pots containing P. lilacinus (621.0) and Metarhizium anisopliae var. anisopliae strain LRC 211 (614.5) (Table 24), but these were not different from the control. In general, no consistent trends were observed over the three evaluation trials. An exception was noted in that there were no significant differences for the mean number of dead ants collected on
Day 4 in all three trials. When randomly-selected RIFA were plated in the selective fungal medium, the data varied. For example, two tester fungi were recovered at 40% or higher on both Day 4 and Day 14; those fungi were G. moniliformis strain Fm-X.1.7-030527-31 (recovered at
53.7% on Day 4 and 40.0% on Day 14) and Fusarium sp. E033
(recovered at 42.6% on Day 4 and 66.7% on Day 14). The fungal entomopathogen P. lilacinus was recovered from dead RIFA at 53.7% for
Day 4 and 40.0% for Day 14 (Table 26). A different result was noted for
RIFA extracted from the mound soils containing M. anisopliae var. anisopliae strain LRC 211. The living RIFA extracted after 14 days
103 showed non aggressive or sluggish movement. Therefore, both living and dead RIFA were plated in the selective medium on Day 14. The fungus was not recovered on Day 4 but isolated on Day 14 at 48.3% from the dead RIFA and 33.3% from living ants. These results indicated the fungi may have provided some control potential against RIFA within a field cage environment. Some fungi seemed to take longer to affect RIFA such as killing the ants and causing sluggish movement. As a confirmation of
Koch Postulates, the randomly selected dead ants (15 per replicate) were plated on the growth medium. Numbers and percentages of tester bacteria and fungi isolated and/or recovered during this study are shown in Tables 25 – 26. Based on the results described above, between bacteria and fungi for the in situ field cage evaluation, several fungi appeared to show more biological control and/or antagonistic potential compared to bacteria.
104 Table 21 MeanA number, weights and percentage of dead red imported fire ants (RIFA) from mound soils containing selected bacterial isolates in situ.
Day 4 Day 14 TotalB %C Trial No. of Weight No. of Weight No. of Weight No. of Weight no. Bacterial taxa ants (g) ants (g) ants (g) ants (g) 1 Bacillus anthracis 0.0 aD 0.1 a 378.0 a 0.6 a 378.0 a 0.7 a 0.4 a 0.4 a strain JH18 Control 25.3 a 0.0 a 275.8 a 0.4 a 301.0 a 0.4 a 0.6 a 0.6 a
2 Bordetella sp. 0.0 b 0.0 b 26.0 b 0.1 a 26.0 bc 0.1 b 0.4 ab 0.4 a Paenibacillus pabuli 0.0 b 0.0 b 12.8 b 0.1 a 12.8 c 0.1 b 0.2 b 0.3 a 105 Staphylococcus sp. 0.0 b 0.0 b 182.8 a 0.1 a 182.8 a 0.1 ab 0.8 a 0.8 a R-25657 Control 15.5 a 0.1 a 142.5 ab 0.2 a 158.0 ab 0.3 a 0.3 b 0.3 a A All numbers were analyzed within each evaluation trial; mean was average of 4 replicated pots containing mound soils and RIFA. Fifteen dead RIFA were randomly collected from the surface or plastic tray of mound soils in pot on day 4 (D4) and plated on the selective medium. At the end of evaluation day 14 (D14), all living and dead RIFA were removed from the soil. Fifteen dead RIFA from D14 were also randomly collected then plated on the selective bacterial medium. B Mean total dead ants = (total number of dead ants from D4 and D14) ÷ 4. Mean total weight of dead ants = (total weight of dead ants from D4 and D14) ÷ 4. C Mean percent dead ants = [(mean total dead ants) ÷ (mean total number of dead ants + mean total number of living ants at D14)] x 100%. Mean percent dead weight = [(mean total weight of dead ants) ÷ (mean total weight of dead ants + mean total weight of living ants at D14)] x 100%. D Within-column values with the same lowercase letter are not significantly different according to Fisher’s protected (LSD) test (P>0.05).
Table 22 MeanA and total numbers of red imported fire ants (RIFA) from mound soils containing selected bacterial isolates in situ.
Day 14 TotalB Trial No. of no. Bacterial taxa living ants Weight (g) No. of ants Weight (g) 1 Bacillus anthracis strain JH18 480.0 aC 0.8 a 858.0 1.4 Control 174.3 b 0.3 b 475.3 0.7
2 Bordetella sp. 54.8 b 0.1 b 80.8 0.2 Paenibacillus pabuli 276.0 ab 0.5 ab 288.8 0.5 Staphylococcus sp. R-25657 39.3 b 0.1 b 222.0 0.2 106 Control 420.8 a 0.7 a 578.8 1.0 A All numbers were analyzed within each evaluation trial; mean was average of 4 replicated pots containing mound soils and RIFA. At the end of evaluation day 14 (D14), in addition to dead RIFA, the living RIFA were removed from the soil. Fifteen living RIFA from D14 were randomly collected then plated on the selective bacterial medium. B Mean total ants = (total number of all dead and living ants) ÷ 4. Mean total weight of ants = (total weight of all dead and living ants) ÷ 4. Total dead ants are presented in Table 20. C Within-column values with the same lowercase letter are not significantly different according to Fisher’s protected (LSD) test (P>0.05).
Table 23 MeanA number, weights, and percentage of dead red imported fire ants (RIFA) from mound so