US009 199976B2

(12) United States Patent (10) Patent No.: US 9,199,976 B2 Smythe et al. (45) Date of Patent: Dec. 1, 2015

(54) HAEMATOPOIETIC-PROSTAGLANDIN D2 FOREIGN PATENT DOCUMENTS SYNTHASE INHIBITORS WO WOO3,0598.71 A1 T 2003 (75) Inventors: Mark Leslie Smythe, Bardon (AU); WO WO 2004/OO6922 A1 1, 2004 WO WO 2006/023462 A1 3, 2006 Jack Urquhart Flanagan, Auckland WO WO 2007/041634 A1 4, 2007 (NZ) WO WO 2007/061862 A2 5/2007 WO WO 2007/098352 A2 8, 2007 (73) Assignee: The University of Queensland, WO WO 2007.118137 A1 10/2007 Brisbane (AU) WO WO 2007/1196OO A1 10, 2007 WO WO 2008/045564 * 4, 2008 (*) Notice: Subject to any disclaimer, the term of this WO WO 2008/O78196 A2 7, 2008 patent is extended or adjusted under 35 WO WO 2008, 121670 A1 10, 2008 U.S.C. 154(b) by 42 days. WO WO 2009,077680 A1 6, 2009 WO WO 2009/134668 A2 11/2009 (21) Appl. No.: 13/701,380 WO WO 2010/137738 A1 12/2010 WO WO 2011/O2953T * 3/2011 (22) PCT Filed: Jun. 1, 2011 WO WO 2011/106276 * 9/2011 (86). PCT No.: PCT/AU2O11?0OO684 OTHER PUBLICATIONS S371 (c)(1), Koehler et al., The Singlet-Triplet Exchange Energy in Conjugated (2), (4) Date: Feb. 11, 2013 Polymers, Advanced Functional Materials, vol. 14, No. 1, pp. 11-18, Jan 2004. (87) PCT Pub. No.: WO2011/150457 Hille et al., Optimization of the First Selective Steroid-11 B PCT Pub. Date: Dec. 8, 2011 hydroxylase (CYP11B1) Inhibitors for the Treatment of Cortisol Dependent Diseases, ACS Medicinal Chemistry Letters, vol. 2, No. (65) Prior Publication Data 8, pp. 559-564, Jun. 2011.* Christet al., “Development and Characterization of New Inhibitors of US 2013/O137684 A1 May 30, 2013 the Human and Mouse Hematopoietic Prostaglandin D. Synthases.” Related U.S. Application Data JMed Chem 53(15): 5536-5548, 2010. Patani et al., "Bioisosterism: A Rational Approach in Drug Design.” (60) Provisional application No. 61/350,296, filed on Jun. Chem Rev 96(8): 3147-3176, 1996. 1, 2010. International Preliminary Report on Patentability, PCT/AU2011/ 0.00684, mailed Dec. 4, 2012, 9 pages. (51) Int. Cl. Hohwy et al., “Novel Prostaglandin D Synthase Inhibitors Generated CO7D 409/04 (2006.01) by Fragment-Based Drug Design.” J Med Chem 51: 2178-2186, A6 IK3I/38 (2006.01) 2008. CO7D 409/4 (2006.01) Price et al., “Identification and optimization of a series of substituted CO7D 47L/TO (2006.01) 5-pyridin-2-yl-thiophene-2-hydroxamic acids as potent histone CO7D 413/4 (2006.01) deacetylase (HDAC) inhibitors.” Bioorganic & Medicinal Chemistry (52) U.S. Cl. Letters 17:363-369, 2007. CPC ...... C07D 409/04 (2013.01); A61K3I/381 Van Der Eycken et al., “Synthesis of (E)-5-(2-arylvinyl)-2- (2013.01); C07D 409/14 (2013.01); C07D (hetero)arylpyridines, (E)-2-(2-arylvinyl)-5-methoxycarbonyl 413/14 (2013.01); C07D 471/10 (2013.01) pyridines and (EE)-2,5-bis(2-arylvinyl)pyridines as polarity and pH (58) Field of Classification Search probes.”J Chem Soc, Perkin Trans 2: 928-937, 2002. CPC ...... C07D 409/04; A61K31/381 * cited b USPC ...... 544/92:546/17, 194, 280.4: 514/230.5, cited by examiner 514/278, 318,336 See application file for complete search history. Primary Examiner — Deepak Rao (56) References Cited (74) Attorney, Agent, or Firm — Seed IP Law Group PLLC U.S. PATENT DOCUMENTS (57) ABSTRACT 5,521, 173 A 5, 1996 Venkatesan et al. 2003.5,883,105 O195192 A1A * 10,3/1999 2003 AnthonyHaviv et al...... 514,277 The present invention generally relates to compounds that 2004/0242615 A1 12/2004 Yamamori et al...... s14277 inhibit haematopoietic-prostaglandin D. synthase 2006/0258.672 A1 11/2006 Barbosa et al. (H-PGDS), to compositions containing them and to their use

38.s: A. ck 2.38. St.apdelaine A. ettal al...... 514,233.2 in treating or preventing conditions and diseases associated 2008.0167342 A1 ck T/2008 Strobel et al...... 5 14/3 18 with H PGDS, Such aS allergies and inflammation. 2010, OO16360 A1 1/2010 Haydar et al. 2010.00 16598 A1 1/2010 Valacchi et al...... 546,194 2010/0298.298 A1 11/2010 Clauss et al. 11 Claims, 4 Drawing Sheets U.S. Patent Dec. 1, 2015 Sheet 1 of 4 US 9,199,976 B2

A

1500 S 3 1000 S CO O- 500

O LPS - - -- Compound - 3 B 150

g OO 2 O O 3 5O

O g353828 & 2 882 O a- -2 -3 Compound (uM)

Figure 1 U.S. Patent Dec. 1, 2015 Sheet 2 of 4 US 9,199,976 B2

A Compound 1 Compound 2 Compound 3 1500 500 3000 S St OOO OOO 2000 c C. 500 5OO OOO

O "it is is Yy r

B 2500 2500 E2000 2OOO 3.1500 500 COO 5OO O C 300 E g 200 ti. c . OO s s O is D 6000 SOOO Ss 4000 4000 6000 3. w 4OOO 9 2000 2000 x fix 2OOO O O O PS a -- s ------p - - - - - a ------Vehicle + + i + + + 4 + ------w w ------Cornpound s - to 2 sig g to 9 g 9 is

Figure 2 U.S. Patent Dec. 1, 2015 Sheet 3 of 4 US 9,199,976 B2

A 1500 Compound 1 3.e 1OOO S SP 500

O 1500 Compound 2 E 1000 3. S. S2 5OO

O 1500 Compound 3

S 1000 St

C3 500

O A2387 - + - + + + + + + + Vehicle - - + + + + + + + + Compound t- c. 9 s 3 B 200

S 150 of OO 5 O g 50 O 4x 3 & 2 8 & 2 g 82 8 1 2 3 Compound (M) Figure 3 U.S. Patent US 9,199,976 B2

3 Indo methacin Compound (M)

Figure 4 US 9,199,976 B2 1. 2 HAEMATOPOETC-PROSTAGLANDN D2 positions containing them and in methods for their prepara SYNTHASE INHIBITORS tion and use, as described hereinafter. Some compounds of the present invention advantageously FIELD OF THE INVENTION exhibit selectivity for H-PGDS over cyclooxygenases and other prostaglandin synthases. The present invention generally relates to compounds that inhibit haematopoietic-prostaglandin D. Synthase BRIEF DESCRIPTION OF THE FIGURES (H-PGDS), to compositions containing them and to their use in treating or preventing conditions and diseases associated FIG. 1 shows results of H-PGDS inhibitory activity of 10 compound 3 in mouse primary bone marrow-derived mac with H-PGDS, such as allergies and inflammation. rophages (BMM). FIG. 2 depicts results from experiments to characterise BACKGROUND OF THE INVENTION compound 3 PGD2 inhibition selectivity in mouse primary Bibliographical details of various publications referred to bone marrow-derived macrophages (BMM). 15 FIG. 3 shows results from experiments to characterise in this specification are collected at the end of the description. compound 3 PGD2 inhibition in human megakaryocytes. The reference in this specification to any prior publication FIG. 4 shows results from experiments to characterise (or information derived from it), or to any matter which is COX1 and COX2 inhibition by compound 3. known, is not, and should not be taken as an acknowledgment or admission or any form of Suggestion that that prior publi DETAILED DESCRIPTION OF THE INVENTION cation (or information derived from it) or known matterforms part of the common general knowledge in the field of endeav Throughout this specification and the claims which follow, our to which this specification relates. unless the context requires otherwise, the word “comprise’, Many non-steroidal anti-inflammatory drugs, such as aspi and variations such as "comprises' and "comprising, will be rin and ibuprofen, act by inhibiting cyclooxygenase, which in 25 understood to imply the inclusion of a stated integer or step or turn affects production of various prostaglandins including group of integers or steps but not the exclusion of any other prostaglandin H2 (PGH), prostaglandin D (PGD), prostag integer or step or group of integers or steps. landin E. (PGE), prostaglandin F (PGF), prostacyclin In one aspect of the invention, there is provided a method of (PGI) and thromboxane (TX) A. treating or preventing a haematopoietic-prostaglandin D. As each prostaglandin has different biological activities, 30 synthase associated disease or condition, comprising admin cyclooxygenase inhibition may impact on a number of bio istering to a subject an effective amount of a compound of logical processes with adverse effects. For example, this has formula (I) or a pharmaceutically acceptable salt thereof: been known to include gastric toxicity and cardiovascular complications associated with prostacyclin loss. Conse quently, targeting the production of particular prostaglandins 35 Formula (I) downstream of cyclooxygenase provides a much more spe R2 cific biological effect that avoids such complications. PGD is a major pro-inflammatory mediator of the allergic response and is known to have roles in body temperature regulation, sleep-wake regulation, relaxation of Smooth 40 Y muscle, tactile pain response, bronchoconstriction, and RI inflammation. It is readily detected in nasal and bronchial lavage fluids of patients with asthma, allergic rhinitis, atopic dermatitis, and allergic conjunctivitis. PGD triggers a range wherein 45 Y is —N— or —CH-; of biological effects consistent with a pathological role in X is NH O—, S—, N -CH O asthma and allergy, including airways eosinophilia, obstruc CH-N : tion, hypersensitivity and mucus hypersecretion. Compounds R" is optionally substituted thienyl or optionally substi that inhibit PGD production are therefore attractive targets tuted thiazolyl: for drug development. R’ is selected from –C(=O) NR'R'', —C(=S)– PGD is active in both the central nervous system and 50 NRR, CH, CHRR, CH=CRR, peripheral tissues. Production of PGD is performed by two C=CR7, -CH OR7, C(=O) OR7, -CH genetically distinct PGD, synthase (PGDS) enzymes: brain NRR, CH, C(OH)RR, CH(OH) C(OH) type-PODS (L-PGDS) and haematopoietic-PGDS RR, C(=O) NH NR'R'', C(=O) NH (H-PGDS). L-PGDS expression in mammals appears to be OR7, P(=O)(OH) NRR, NH C(=O) mostly restricted to the central nervous system, testis and 55 heart. In contrast, PGD synthesis in peripheral tissues is NR'R'', O C(=O) NRR, CH(CF) NRR, likely to be through H-PGDS. and Targeting the inhibition of PGD synthesis may allow mediation of pro-inflammatory responses without the side effects of cyclooxygenase inhibition. There is therefore a 60 need for small molecules that inhibit H-PGDS. R6. SUMMARY OF THE INVENTION

The present invention is predicated in part on the discovery 65 Z is selected from —CH2—, or—NH : that compounds of formula (I) inhibit H-PGDS. This discov R is selected from —CHRR, Coalkyl-R', ery has been reduced to practice in novel compounds, com —C2-alkenyl-R', and —C2-alkynyl-R':

US 9,199,976 B2 7 8 (=O) R'', N(R'), or - C(=O) N(R'); most —C-alkylR''. —CoalkenylR'' and —C-alky especially unsubstituted thienyl: nylR'; more especially —CONH, aryl and each R'' is independently selected from H. —Calkyl, —C-alkylR'; more especially —CONH and aryl; —C2-alkenyl, —C2-alkynyl, —Co-alkylaryl, most especially naphthyl, -CONH2 and phenyl, —Co-alkylheteroaryl, -Co-alkylcycloalkyl, -Co R is selected from —Coalkyl, -C, perfluoroalkyl, alkylcycloalkenyl or —Co-alkylheterocyclyl, espe —C2-galkenyl, —C2-alkynyl, —Co-alkylOH, cially H or —Calkyl: —CoalkylCOH, -Co-alkylCONH, -Co-alky L and Mare both CR': lNH, —Co-alkylSH, —Co-alkylSC-alkyl, R'' and R' are independently selected from hydrogen —CoalkylNHC(=NH)NH2. —Coalkylcycloalkyl, cyano, nitro, halo. —C-alkyl, —Calkenyl, 10 —Co-alkylaryl, -Co-alkylheterocyclyl and —Co —Calkynyl, -C(=O) R'', —C(=O)—O R'', alkylheteroaryl; more especially —Calkyl, —C. - O C(=O) R'', N(R'), and C(=O) N perfluoroalkyl, -Co-alkylOH, -Co-alkylNH2, (R'); especially - C(=O) R'', C(=O)—O —Co-alkylSH, -Co-alkylSC-alkyl, -Co-alkylcy R'', O C(=O) R', N(R'), and C(=O)— cloalkyl, -Co-alkylaryl, -Co-alkylheterocyclyl and N(R'); more especially hydrogen; 15 —Co-alkylheteroaryl; more especially —Calkyl, R’ is hydrogen and L and Mare both CH: —C perfluoroalkyl or —Coalkylaryl; more espe R’ is selected from C(=O) NR'R'', -C(=S)— cially Calkylaryl, aryl, methyl or —CF; most espe NRR, CH-CRR, CH, OR7, C(=O) cially —CH2-phenyl, phenyl, methyl or —CF; OR7, CH, NRR, C(=O) NH NRR, R'' is selected from —C-alkyl, -C, perfluoroalkyl, C(=O) NH OR7, NH C(=O) NRR, —Co-alkylOH, -Co-alkylNH2, —Co-alkylSH, - O C(=O) NRR and -CH(CF) NR'R'', —CoalkylSC-alkyl, -Co-alkylcycloalkyl, -Co especially C(=O) NRR, —CH, OR7, alkylaryl, -Co-alkylheterocyclyl and —Coalkylhet CH NRR, NH C(=O) NRR, eroaryl; more especially —Calkyl, —C perfluoro -CH=CRR and -CH(CF) NR'R'', more espe alkyl or - Co-alkylaryl; more especially Calkylaryl, cially C(=O) NR'R' or CH(CF) NRR, 25 aryl, methyl or —CF; most especially —CH2-phenyl, most especially - C(=O) NR'R'': phenyl, methyl or —CF; R is selected from CHRR, CHR'R'' or R" is selected from hydrogen, alkyl, haloalkyl or perfluo - Coalkyl-R'; especially —CHRR, —CHR'R'' or roalkyl; especially hydrogen; —Calkyl-R'; more especially —CHR'R'' or R'' is selected from hydrogen, —Coalkyl, -Cha —Calkyl-R'; most especially —CHR'R'': 30 loalkyl, -Co-alkylOH, -Co-alkylSH, -Co R" is hydrogen, alkyl, haloalkyl or perfluoroalkyl; espe alkylSC-alkyl, -Co-alkylcycloalkyl; more espe cially hydrogen; cially hydrogen, —Calkyl, —C perfluoroalkyl, RandR' taken together form a heterocyclyl or heteroaryl —Coalkylcycloalkyl: most especially methyl or ring; especially where R and R' form a monocyclic —CF; heterocyclyl or heteroaryl ring which is substituted by a 35 wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalk cycloalkyl, cycloalkenyl, aryl, heterocyclyl or het enyl, aryl, heterocyclyl and heteroaryl are optionally eroaryl group, or where R and R' form a bicyclic het substituted with one or more optional substituents. erocyclyl or heteroaryl ring, or where Rand R' form a In another aspect of the invention there is provided a use of tricyclic spirane heterocyclyl group; more especially R a compound of formula (I), (II) or (III) in the manufacture of and R together form 1,2,3,4-tetrahydroisoquinolinyl, 40 a medicament for the treatment or prevention of a disease or condition associated with inhibition of H-PGDS. Reference herein to “treatment” and “prevention' is to be considered in its broadest context. The term “treatment” does not necessarily imply that a Subject is treated until total recov 45 ery. Similarly, “prevention' does not necessarily mean that the Subject will not eventually contract a disease or condition. Accordingly, “treatment includes amelioration of the Symp of CP toms of a particular disease or condition, or reducing the severity of an existing disease, or condition. “Prevention” which is optionally Substituted at the ring nitrogen with a 50 may be considered as reducing the likelihood of onset of a —SOMe group, or piperidinyl which is substituted with particular disease or condition or preventing or otherwise benzimidazol-2-one or 1,3-benzoxazin-2-one; reducing the risk of developing a particular disease or condi R is selected from CHRR, CHR'R'' or tion. - Coalkyl-R'; especially —CHRR, —CHR'R'' or An effective amount of a compound of formula (I) means —Calkyl-R'; more especially —CHR'R'' or 55 an amount necessary at least partly to attain the desired —Calkyl-R'; most especially —CHR'R'': response, or to delay the onset or inhibit progression or halt R is hydrogen, alkyl or haloalkyl; especially hydrogen; altogether, the onset or progression of a particular disease or RandR taken together form a heterocyclyl or heteroaryl condition being treated. The amount varies depending upon r1ng, the health and physical condition of the individual to be R" is selected from CHRR, CHR'R'' or 60 treated, the taxonomic group of individual to be treated, the - Coalkyl-R'; especially —CHRR, —CHR'R'' or degree of protection desired, the formulation of the compo —Calkyl-R'; more especially —CHR'R'' or sition, the assessment of the medical situation, and other —Calkyl-R'; most especially —CHR'R'': relevant factors. It is expected that the amount will fall in a R is selected from CO.H. —CONH2, cycloalkyl, relatively broad range that can be determined through routine cycloalkenyl, aryl, heterocyclyl, heteroaryl, —C. 65 trials. An effective amount in relation to a human patient, for alkylR', CalkenylR'' and —C-alkynylR': example, may lie in the range of about 0.1 ng per kg of body especially —CONH2, aryl, heterocyclyl, heteroaryl, weight to 1 g per kg of body weight per dosage. In one US 9,199,976 B2 10 embodiment, the dosage is in the range of 1 Jug to 1 g per kg of compound libraries to identify compounds that bind to of body weight per dosage, such as in the range of 1 mg to 1 H-PGDS, assays to determine the biological activity of com g per kg of body weight per dosage. In one embodiment, the pounds that bind to H-PGDS, experiments to develop a phar dosage is in the range of 1 mg to 500 mg per kg of body weight macophore of H-PGDS or experiments to investigate the per dosage. In another embodiment, the dosage is in the range physiology or pharmacology of H-PGDS. of 1 mg to 250 mg per kg of body weight per dosage. In yet The present invention further contemplates a combination another embodiment, the dosage is in the range of 1 mg to 100 of therapies, such as the administration to a Subject of the mg per kg of body weight per dosage. Such as up to 50 mg per compounds of the invention or pharmaceutically acceptable kg of body weight perdosage. In yet another embodiment, the salts or prodrugs thereof, together with other agents or pro dosage is in the range of 1 Jug to 1 mg per kg of body weight 10 cedures which are useful in the treatment or prevention of per dosage. Dosage regimes may be adjusted to provide the diseases and conditions in respect of which inhibition of optimum therapeutic response. For example, several divided H-PGDS is associated with effective treatment. doses may be administered daily, weekly, monthly or other The compounds of formula (I), (II) or (III) or pharmaceu suitable time intervals, or the dose may be proportionally tically acceptable salts or prodrugs thereof may also be reduced as indicated by the exigencies of the situation. 15 administered in combination with other agents or procedures The term “subject' as used herein includes mammals, which are useful in the treatment or prevention of H-PGDS humans, primates, livestock animals (eg. sheep, pigs, cattle, associated diseases or conditions. For example, other agents horses, donkeys), laboratory test animals (eg. mice, rabbits, that may be used with compounds of formula (I), (II) or (III) rats, guinea pigs), companion animals (eg. dogs, cats) and include anti-inflammatories Such as corticosteroids (for captive wild animals (eg. foxes, kangaroos, deer). In some example, fluticasone, budesonide and mometasone), espe embodiments, the Subject is human or a laboratory test ani cially oral or intranasal anti-inflammatories; bronchodilators mal, especially a human. Such as anticholinergics (for example, tiotropium bromide As used herein, “an H-PGDS associated disease or condi and ipratropin) and B agonists (for example, salmeterol, tion' is a disease or condition which benefits from the inhi salbutamol, camoterol, indacaterol and formaterol); methylx bition of H-PGDS. For example, such diseases or conditions 25 anthines such as theophylline; and biologics, such as mono are those in which H-PGDS is inappropriately stimulated or clonal antibodies (for example antibodies against TNFa and overactive. H-PGDS associated diseases or conditions immunoglobulins (eg IgE), including omalizumab). Such include allergies, inflammation, pain, bronchoconstriction, combinations may be useful in the treatment of asthma and muscle necrosis, cancer, arthritis, irritable bowel diseases, chronic obstructive pulmonary disease. irritable bowel syndrome, skin inflammation and irritation, 30 Similarly anti-inflammatories Such as corticosteroids (for and cardiovascular diseases or conditions. In one embodi example, fluticasone, budesonide and mometasone), espe ment, the H-PGDS associated diseases or conditions are cially oral or intranasal anti-inflammatories; anti-histamines, selected from cancer, rheumatoid arthritis, Crohn's disease, Such as H1-receptor antagonists; oral or intranasal deconges ulcerative colitis, painful diabetic neuropathy, postherpetic tants; and allergan immunotherapy using recombinant aller neuralgia, eczema, psoriasis, chronic pain, chronic inflamma 35 gans Such as different types of pollen may be used with tion, neuropathic pain conditions, niacin-induced skin flush compounds of formula (I), (II) and (III), especially for the ing and celiac type disease (for example resulting from lac treatment of allergic rhinitis. tose intolerance), carpal tunnel syndrome, back pain, Other agents that may be used with compounds of formula headache, cancer pain, arthritic pain, chronic post-Surgical (I), (II) and (III) include glucocorticosteroids or dissociated pain, allergic conjunctivitis, atopic dermatitis, neuroinflam 40 agonists of the corticoid receptor, fagonists including long mation, allergic rhinitis, nasal congestion, rhinorrhea, peren acting Bagonists; muscarinic M3 receptor antagonists or nial rhinitis, nasal inflammation, asthma, chronic obstructive anticholinergic agents; histamine receptor antagonists pulmonary disease (COPD), chronic or acute bronchocon including H1 or H3 antagonists; 5-lypoxygenase inhibitors; striction, chronic bronchitis, Small airways obstruction, thromboxane inhibitors; 5-lipoxygenase activating protein emphysema, chronic eosinophilic pneumonia, adult respira 45 (FLAP) antagonists; leukotriene antagonists including tory distress syndrome, airways disease that is associated antagonists of LTB, LTC LTD and LTE, C- and with pulmonary hypertension, acute lung injury, bronchiecta C-adrenoceptor agonist vasoconstrictor sympathomimetic sis, sinusitis, allergic conjunctivitis, atopic dermatitis, and agents for decongestant use; PDE inhibitors including PDE3, airways eosinophilia, obstruction, hypersensitivity or hyper PDE4 and PDE5 inhibitors such as theophylline; sodium secretion. In one embodiment, these diseases or conditions 50 cromoglycate; monoclonal antibodies active against endog include allergies, inflammation and chronic pain conditions. enous inflammatory entities; integrin antagonists; adhesion For example, in one embodiment, the disease or condition is molecule inhibitors such as VLA-4 antagonists; kinin-B - or asthma, allergic conjunctivitis, atopic dermatitis, allergic B-receptor antagonists; immunosuppressive agents, includ rhinitis, neuroinflammation, chronic obstructive pulmonary ing inhibitors of the IgE pathway and cyclosporin; inhibitors disease or airways eosinophilia, obstruction, hypersensitivity 55 of matrix metalloproteases (MMPs) such as MMP9 and or hypersecretion. MMP12; tachykinin NK1, NK2 or NK3 receptor antagonists: In Some embodiments, compounds of the invention advan protease inhibitors such as elastase inhibitors, chymase and tageously display selectivity for H-PGDS over other prostag cathepsin G: adenosine Ata receptor agonists and A2b landin synthases. This advantageously may provide com antagonists; inhibitors of urokinase; compounds that act on pounds that provide fewer side effects than other 60 dopamine receptors such as D2 agonists; modulators of the pharmaceuticals that target prostaglandin production. NFKB pathway such as IKK inhibitors; modulators of cytok In a further aspect of the invention there is provided a ine signalling pathways such as Syk kinase, JAK kinase, p38 method of inhibiting H-PGDS, comprising contacting kinase, SPHK-1 kinase, Rho kinase, EGF-R or MK-2; agents H-PGDS with a compound of formula (I). It should be under that can be classed as mucolytics or anti-tussive, and muco stood that the method in this aspect of the invention relates to 65 kinetics; antibiotics; antivirals; vaccines; chemokines; epi H-PGDS which may be located in vitro or in vivo, especially thelial sodium channel (ENaC) blockers or epithelial sodium in vitro. This method includes, but is not limited to, Screening channel (ENaC) inhibitors; P2Y2 agonists and other nucle

US 9,199,976 B2 15 16 fied number of carbonatoms, for example, —Calkyl which includes alkyl groups having 1, 2, 3, 4, 5 or 6 carbon atoms in a linear or branched arrangement. Examples of Suitable alkyl groups include, but are not limited to, methyl, ethyl, n-propyl. 5 i-propyl. n-butyl, i-butyl, t-butyl, n-pentyl, 2-methylbutyl, 3-methylbutyl, 4-methylbutyl, n-hexyl, 2-methylpentyl, foS for 3-methylpentyl, 4-methylpentyl, 5-methylpentyl, 2-ethylbu tyl, 3-ethylbutyl, heptyl, octyl, nonyl, decyl, undecyl and which is optionally Substituted at the ring nitrogen with a dodecyl. SOMe group, or piperidinyl which is substituted with ben 10 As used herein, the term “alkenyl refers to a straight-chain Zimidazol-2-one or 1,3-benzoxazin-2-one; or branched hydrocarbon group having one or more double R is selected from CHRR, CHR'R'' or bonds between carbon atoms and having 2 to 12 carbon - Coalkyl-R'; especially CHRR. —CHR'R'' or atoms. Where appropriate, the alkenyl group may have a —Calkyl-R'; more especially —CHR'R'' or specified number of carbon atoms. For example, —C-C as —Calkyl-R'; most especially —CHR'R'': 15 in "C-Calkenyl includes groups having 2, 3, 4, 5 or 6 R is hydrogen, alkyl or haloalkyl; especially hydrogen; carbon atoms in a linear or branched arrangement. Examples RandR taken together form a heterocyclyl or heteroaryl of Suitable alkenyl groups include, but are not limited to, r1ng, ethenyl, propenyl, isopropenyl, butenyl, butadienyl, pente R7 is selected from CHRR, CHRR'' and nyl, pentadienyl, hexenyl, hexadienyl, heptenyl, octenyl, non - Coalkyl-R'; especially —CHRR, —CHR'R'' enyl, decenyl, undecenyl and dodecenyl. and Calkyl-R'; more especially —CHR'R'' and As used herein, the term “alkynyl refers to a straight-chain —Calkyl-R'; most especially —CHR'R'': or branched hydrocarbon group having one or more triple R is selected from CO.H. —CONH2, cycloalkyl, bonds between carbon atoms and having 2 to 12 carbon cycloalkenyl, aryl, heterocyclyl, heteroaryl, —C. 25 atoms. Where appropriate, the alkynyl group may have a alkylR', CalkenylR'' and —C-alkynylR': specified number of carbon atoms. For example, —C-C as especially —CONH2, aryl, heterocyclyl, heteroaryl, in "C-Calkynyl' includes groups having 2, 3, 4, 5 or 6 —CalkylR', —CalkenylR" and —C-alky carbon atoms in a linear or branched arrangement. Examples nylR'; more especially —CONH2, aryl and of Suitable alkynyl groups include, but are not limited to, —CalkylR'; more especially —CONH and aryl; 30 ethynyl, propynyl, butynyl, pentynyl, hexynyl, octynyl. nony most especially napthyl, -CONH2 and phenyl, nyl, decynyl, undecynyl and dodecynyl. R is selected from Calkyl, -C-perfluoroalkyl, As used herein, the term "cycloalkyl” refers to a saturated —Calkenyl, —C-alkynyl, —CoalkylOH, cyclic hydrocarbon. The cycloalkyl ring may include a speci —Co-alkylCOH, -Co-alkylCONH2, —Co-alky fied number of carbonatoms. For example, a 3 to 8 membered INH, —CoalkylSH, —CoalkylSC-alkyl, 35 cycloalkyl group includes 3, 4, 5, 6, 7 or 8 carbonatoms. The —Co-alkylNHC(=NH)NH2. —Coalkylcycloalkyl, cycloalkyl group may also comprise two or three rings in —Co-alkylaryl, -Co-alkylheterocyclyl and —Co which at least one ring is a cycloalkyl group. When there are alkylheteroaryl; more especially —Calkyl, —C. two or three rings, each ring is linked to one or more of the perfluoroalkyl, -Co-alkylOH, -Co-alkylNH2, other rings by sharing one or more ring atoms forming a —Co-alkylSH, -Co-alkylSC-alkyl, -Co-alkylcy 40 spirane or fused ring system. The cycloalkyl group also cloalkyl, -Co-alkylaryl, -Co-alkylheterocyclyl and include a carbonyl group attached to a ring carbon atom. —Co-alkylheteroaryl; more especially —Calkyl, Examples of Suitable cycloalkyl groups include, but are not —C perfluoroalkyl or - Co-alkylaryl; more espe limited to, cyclopropyl, cyclobutyl, cyclopentanyl, cyclo cially Calkylaryl, aryl, methyl or —CF; most espe hexanyl, cycloheptanyl, cyclooctanyl, decahydronaphthalyl, cially —CH2-phenyl, phenyl, methyl or —CF; 45 bicyclo[3.1.0 hexanyl, bicyclo4.1.0 heptanyl, bicyclo R'' is selected from —C-galkyl, -C, perfluoroalkyl, 3.1.1 heptanyl, bicyclo2.2.1]heptanyl, adamantanyl and —Co-alkylOH, -Co-alkylNH, -Co-alkylSH, spiranes such as Spiro4.5 decane. —Co-alkylSC-alkyl, -Co-alkylcycloalkyl, -Co As used herein, the term “cycloalkenyl refers to a cyclic alkylaryl, -Co-alkylheterocyclyl and —Coalkylhet hydrocarbon having at least one double bond, which is not eroaryl; more especially —Calkyl, -C-perfluoro 50 aromatic. The cycloalkenyl ring may include a specified num alkyl or - Co-alkylaryl; more especially Calkylaryl, ber of carbon atoms. For example, a 4 to 8 membered aryl, methyl or —CF; most especially —CH2-phenyl, cycloalkenyl group contains at least one double bond and 4, 5, phenyl, methyl or —CF; 6, 7 or 8 carbon atoms. The cycloalkenyl group may also R" is selected from hydrogen, alkyl, haloalkyl or perfluo comprise two or three rings, provided that at least one ring is roalkyl; especially hydrogen; 55 a cycloalkenyl ring. When there are two or three rings, each R'' is selected from hydrogen, —Coalkyl, -Cha ring is linked to one or more of the other rings by sharing one loalkyl, -Co-alkylOH, -Co-alkylSH, -Co or more ring atoms forming a spirane or fused ring system. alkylSC-alkyl, -Co-alkylcycloalkyl; more espe The cycloalkenyl group may also include a carbonyl group cially hydrogen, —Calkyl, -C-perfluoroalkyl, attached to an unsaturated ring carbon atom. Examples of —Co-alkylcycloalkyl; most especially methyl or 60 Suitable cycloalkenyl groups include, but are not limited to —CF; cyclopentenyl, cyclopenta-1,3-dienyl, cyclohexenyl, cyclo wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalk hexen-1,3-dienyl and cyclohexen-1,4-dienyl. enyl, aryl, heterocyclyl and heteroaryl are optionally As used herein, the term “aryl' is intended to mean any substituted with one or more optional substituents. stable, monocyclic, bicyclic or tricyclic carbon ring of up to 7 As used herein, the term “alkyl refers to a straight chain or 65 atoms in each ring, wherein at least one ring is aromatic. branched Saturated hydrocarbon group having 1 to 12 carbon When more than one ring is present, the rings may be fused to atoms. Where appropriate, the alkyl group may have a speci one another. Examples of aryl groups include, but are not US 9,199,976 B2 17 18 limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl. cycloalkyl, cycloalkenyl, aryl, heterocyclyl and heteroaryl biphenyl, binaphthyl, anthracenyl, phenanthrenyl, phenale (including thienyland thiazolyl), whether an individual entity nyl and fluorenyl. or as part of a larger entity, may be optionally Substituted with The term "heterocyclic' or "heterocyclyl as used herein, one or more optional substituents selected from R', R' refers to a cycloalkyl or cycloalkenyl group in which one or O-(CH2) , R-S-(CH2). , hydroxyl(CH2) , more carbon atoms have been replaced by heteroatoms inde HS-(CH) , R' C(=O)-O-(CH.) , R O C pendently selected from N, S and O. For example, between 1 (=O) (CH) , R. C(=O) (CH) , (R')N C and 4 carbon atoms in each ring may be replaced by heteroa (=O)-(CH.) , RS(O), (CH.) , (R').N- toms independently selected from N, S and O. The heterocy (CH2) , cyano, nitro and halo, wherein each R" is inde clic group may be monocyclic, bicyclic or tricyclic in which 10 pendently selected from H. alkyl, alkenyl, alkynyl, at least one ring is heterocyclic. When there are two or three rings, each ring is linked to one or more of the other rings by —(CH),-aryl, -(CH),-heteroaryl, -(CH),-cycloalkyl, sharing one or more ring atoms forming a spirane or fused —(CH),-cycloalkenyl or —(CH), -heterocyclyl; q and i are ring system. The heterocyclyl group may also include a car 0 or an integer from 1 to 6, and is 0 or an integer of 1 or 2. bonyl group attached to an unsaturated ring carbon. Examples 15 Furthermore, the alkyl, alkenyl, alkynyl, aryl, heteroaryl, of suitable heterocyclyl groups include tetrahydrofuranyl, cycloalkyl, cycloalkenyl and heterocyclyl groups within the tetrahydrothiophenyl, pyrrolidinyl, 2-pyrrolidonyl, pyrroli optional substituents may be further optionally substituted nyl, dithiolyl, 1.3-dioxolanyl, pyrazolinyl, imidazolinyl, imi with one or more Substituents selected from cyano, hydroxyl, dazolidinyl, 1,4-dioxanyl, 1,3-dioxanyl, dioxinyl, piperidi nitro, halo, alkyl, haloalkyl, alkenyl, alkynyl or alkoxyl nyl, piperazinyl, morpholinyl, thiomorpholinyl, pyranyl, 1,4- groups. dithiane, 1,3,5-trithiane, quinuclidine and tetrahydropyranyl. In one embodiment, the optional Substituents include The term "heteroaryl as used herein, represents a stable fluoro, chloro, methyl, ethyl, propyl, isopropyl, butyl, tert monocyclic, bicyclic or tricyclic ring of up to 7 atoms in each butyl, hydroxy, methoxy, ethoxy, propoxy, isopropoxy, ring, wherein at least one ring is aromatic and at least one ring hydroxymethyl, trifluoromethyl, trifluoromethoxy, cyano, contains from 1 to 4 heteroatoms selected from the group 25 nitro, acetyl, amino, methylamino, dimethylamino. —CO— consisting of O, N and S. When more than one ring is present NH, —CO.H. —COCH —SOCH, benzimidazol-2-one, the rings may be fused. The heteroaryl group may also include 1,3-benzoxazin-2-one, tetrazole, piperidinyl, piperazinyl, a carbonyl group attached to an unsaturated carbon in the ring 1,4-dihydropyridinyl, dihydropyrimidonyl, phenyl and ben system. Examples of Suitable heteroaryl groups include pyr Zyl in which the phenyl or benzyl ring is optionally substi rolyl, furanyl, thienyl, pyrazolyl, imidazolyl, 1,2,4-triazolyl, 30 tuted with halo, methyl, methoxy, phenyl, tetrazole, piperidi 1,2,3-triazolyl, isoxazolyl, oxazolyl, thiazolyl, isothiazolyl, nyl, piperazinyl, 1,4-dihydropyridinyl O oxadiazolyl, oxatriazolyl pyridinyl, pyridazinyl, pyrimidi dihydropyrimidonyl; especially hydroxy, amino, hydroxym nyl, pyrazinyl, triazinyl, azepinyl, oxepinyl, thiepinyl, diaz ethyl, phenyl, cyano, —CO NH, —COH, -COCH, epinyl, coumaranyl, benzofuranyl, isobenzofuranyl, ben benzimidazol-2-one and 1,3-benzoxazin-2-one. Zothienyl, indolyl, indolinyl, isoindolyl, benzimidazolyl, 35 As used herein, the term “halogen' or “halo' refers to benzisoxazolyl, benzoxazolyl, benzisoxazolyl, benzothiaz fluorine (fluoro), chlorine (chloro), bromine (bromo) and olyl, 1-benzopyranyl, 2-benzopyranyl, benzopyran-2-on-yl, iodine (iodo). benzopyran-1-on-yl, quinolinyl, tetrahydroquinolinyl, iso As used herein, the term “haloalkyl refers to an alkyl quinolinyl, quinazolinyl, cinnolinyl, quinoxalinyl, tetrahyd group (as defined above) in which one or more hydrogen roquinoxalinyl, naphthyridinyl, acridinyl, carbazolyl, Xan 40 atoms are replaced with halogenatoms. “Haloalkyl includes thenyl, phenazinyl, phenothiazinyl, phenoxazinyl, 1,4- perhaloalkyl groups in which all hydrogenatoms are replaced benzodiazepin-2-on-yl, 1.5-benzodiazepin-2-on-yl, 1,4- with halogen atoms. Examples of haloalkyl groups include benzodiazepin-2,5-dion-yl, pyrrolo2.1-c 1.4 fluoromethyl, difluoromethyl, trifluoromethyl, chloromethyl, benzodiazepine-5,11-dion-yl, 1,4-benzothiazepin-5-on-yl, dichloromethyl, trichloromethyl, bromomethyl, dibromom 5,11-dihydro-benzoepyrido3.2-b1,4-diazepin-6-on-yl, 45 ethyl, iodomethyl, diiodomethyl, 1-fluoroethyl, 2-fluoroet chromonyl, pyranocoumarinyl, 3,4-dihydroquinoxalin-2-on hyl, 1,2-difluoroethyl, 1-chloroethyl, 2-chloroethyl, 1.2- yl, quinazolinonyl, quinazolindionyl, imidazoquinoxalinyl, dichloroethyl. Perhaloalkyl groups include perfluoroalkyl 2,3-dihydroSpiro indene-1,4'-piperidine and spiro indoline groups such as trifluoromethyl and pentafluoroethyl and per 3,4'-piperidine. chloroalkyl groups such as trichloromethyl and pentachlo The cycloalkyl, cycloalkenyl, aryl, heterocyclyl or het 50 romethyl. eroaryl group may advantageously be a privileged substruc The compounds of the invention may be in the form of ture or form part of a privileged substructure. Privileged sub pharmaceutically acceptable salts. It will be appreciated how structures are molecular frameworks able to provide ligands ever that non-pharmaceutically acceptable salts also fall for diverse receptors. Examples of privileged substructures within the scope of the invention since these may be useful as include biphenyl, arylpiperidine, arylpiperazine, aryl-1,4-di 55 intermediates in the preparation of pharmaceutically accept hydropyridine, aryl-dihydropyrimidone, 1,4-benzodiazepin able salts or may be useful during storage or transport. Suit 2-one, 1.5-benzodiazepin-2-one, 1,4-benzodiazepin-2,5-di able pharmaceutically acceptable salts include, but are not one, pyrrolo2, 1-c1.4benzodiazepine-5,11-dione, 1,4- limited to, salts of pharmaceutically acceptable inorganic benzothiazepin-5-one, 5,11-dihydro-benzo[e]pyrido 3.2-b acids such as hydrochloric, Sulphuric, phosphoric, nitric, car 1,4-diazepin-6-one, benzopyran, chromone, coumarin, 60 bonic, boric, Sulfamic, and hydrobromic acids, or salts of pyranocoumarin, 3,4-dihydroquinoxalin-2-one, quinazoli pharmaceutically acceptable organic acids such as acetic, none, quinazolindione, imidazoquinoxaline, indole, benzimi propionic, butyric, tartaric, maleic, hydroxymaleic, fumaric, dazole, benzofuran and benzothiophene. Other privileged maleic, citric, lactic, mucic, gluconic, benzoic, succinic, substructures would be known to a person skilled in the art. oxalic, phenylacetic, methaneSulphonic, toluenesulphonic, The privileged substructure may be optionally substituted. 65 benezenesulphonic, salicyclic Sulphanilic, aspartic, glutamic, Unless otherwise defined, the term “optionally substi edetic, Stearic, palmitic, oleic, lauric, pantothenic, tannic, tuted” means, for example, that each alkyl, alkenyl, alkynyl, ascorbic and Valeric acids. US 9,199,976 B2 19 20 Base salts include, but are not limited to, those formed with While it is possible that, for use in therapy, a compound of pharmaceutically acceptable cations, such as Sodium, potas the invention may be administered as a neat chemical, the sium, lithium, calcium, magnesium, ammonium and alky active ingredient is especially presented as a pharmaceutical lammonium. composition. Basic nitrogen-containing groups may be quarternised Thus, in a further aspect of the invention there is provided with Such agents as lower alkyl halide, such as methyl, ethyl, a pharmaceutical composition comprising a compound of propyl, and butyl chlorides, bromides and iodides; dialkyl formula (II) or (III) and at least one pharmaceutically accept sulfates like dimethyl and diethyl sulfate; and others. able carrier. The compounds and salts of the invention may be pre The carrier(s) must be “acceptable' in the sense of being sented in the form of a prodrug. The term “prodrug is used in 10 compatible with the other ingredients of the composition and its broadest sense and encompasses those derivatives that are not deleterious to the recipient thereof. converted in vivo to the compounds of the invention. A pro Pharmaceutical compositions include those suitable for drug may include modifications to one or more of the func oral, rectal, nasal, topical (including buccal and Sub-lingual), tional groups of a compound of the invention. 15 vaginal or parenteral (including intramuscular, Sub-cutane The phrase “a derivative which is capable of being con ous and intravenous) administration or in a form suitable for Verted in Vivo” as used in relation to another functional group administration by inhalation or insufflation. The compounds includes all those functional groups orderivatives which upon of the invention, together with a conventional adjuvant, car administration into a mammal may be converted into the rier, excipient, or diluent, may thus be placed into the form of stated functional group. Those skilled in the art may readily pharmaceutical compositions and unit dosages thereof, and in determine whether a group may be capable of being con such form may be employed as solids, such as tablets or filled Verted in vivo to another functional group using routine enzy capsules, or liquids such as solutions, Suspensions, emul matic or animal studies. sions, elixirs, or capsules filled with the same, all for oral use, It will also be recognised that compounds of the invention in the form of suppositories for rectal administration; or in the may possess asymmetric centres and are therefore capable of 25 form of sterile injectable solutions for parenteral (including existing in more than one stereoisomeric form. The invention Subcutaneous) use. Such pharmaceutical compositions and thus also relates to compounds in Substantially pure isomeric unit dosage forms thereof may comprise conventional ingre form at one or more asymmetric centres eg., greater than dients in conventional proportions, with or without additional about 90% ee, such as about 95% or 97% ee or greater than active compounds or principles, and Such unit dosage forms 99% ee, as well as mixtures, including racemic mixtures, 30 may contain any Suitable effective amount of the active ingre thereof. Such isomers may be prepared by asymmetric syn dient commensurate with the intended daily dosage range to thesis, for example using chiral intermediates, or by chiral be employed. Formulations containing ten (10) milligrams of resolution. active ingredient or, more broadly, 0.1 to two hundred (200) Compounds of formula (I), (II) and (III) possess a het milligrams, per tablet, are accordingly suitable representative eroaryl moiety linked to a thienyl or thiazolyl moiety through 35 unit dosage forms. The compounds of the present invention a single bond. A person skilled in the art would be aware of can be administered in a wide variety of oral and parenteral reactions to link two heteroaryl moieties, for example using dosage forms. It will be obvious to those skilled in the art that the Suzuki reaction. In the Suzuki reaction a heteroaryl the following dosage forms may comprise, as the active com halide, such as a bromide, or heteroaryl triflate is mixed with 40 ponent, either a compound of the invention or a pharmaceu a heteroarylborane in the presence of a palladium catalyst and tically acceptable salt or derivative of the compound of the base to produce a biheteroaryl moiety. Suitable palladium invention. catalysts would be known to a person skilled in the art and For preparing pharmaceutical compositions from the com include tetrakis-(triphenylphosphine)palladium(0). A range pounds of the present invention, pharmaceutically acceptable of bases also may be used, such as caesium fluoride and 45 carriers can be either solid or liquid. Solid form preparations Sodium carbonate. include powders, tablets, pills, capsules, cachets, supposito One or both of the heteroaryl rings employed in the Suzuki ries, and dispersible granules. A Solid carrier can be one or reaction may be further functionalised before, or after the more substances which may also act as diluents, flavouring reaction. In one example, if an ester-substituted heteroaryl agents, solubilizers, lubricants, Suspending agents, binders, bromide is used in the above reaction, then following the 50 preservatives, tablet disintegrating agents, or an encapsulat reaction the ester group may be hydrolysed, and then treated ing material. with various other reagents to form, for example, an amide In powders, the carrier is a finely divided solid which is in bond, a reduced amide, an alkenyl bond, an ester, or an ether. a mixture with the finely divided active component. This step may be used to incorporate functionality at, for In tablets, the active component is mixed with the carrier example, R or to the thienyl moiety orthiazolyl moiety (for 55 having the necessary binding capacity, in Suitable proportions compounds of formula (I)), or R. R' or R' (for compounds and compacted in the shape and size desired. of formula (II) or (III)). The powders and tablets especially contain from five or ten Other methods to prepare compounds of formula (I), (II) to about seventy percent of the active compound. Suitable and (III) would be known to a person skilled in the art. Two carriers are magnesium carbonate, magnesium Stearate, talc, general procedures are outlined below in the Examples. 60 Sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, A person skilled in the art will be aware that during syn methylcellulose, sodium carboxymethylcellulose, a low thesis, of the compounds of the invention, some Substituents melting wax, cocoa butter, and the like. may be reactive under conditions used and must be disguised The term “preparation' is intended to include the formu or protected to prevent unwanted side reactions. Suitable lation of the active compound with encapsulating material as protecting groups for protecting reactive groups from 65 carrier providing a capsule in which the active component, unwanted reactions are provided in Green and Wuts, Protec with or without carriers, is surrounded by a carrier, which is tive Groups in Organic Synthesis. thus in association with it. Similarly, cachets and lozenges are US 9,199,976 B2 21 22 included. Tablets, powders, capsules, pills, cachets, and loZ this may be achieved by the patient administering an appro enges can be used as solid forms Suitable for oral administra priate, predetermined Volume of the Solution or Suspension. tion. In the case of a spray, this may be achieved for example by For preparing Suppositories, a low melting wax, Such as means of a metering atomising, spray pump. To improve nasal admixture of fatty acid glycerides or cocoa butter, is first delivery and retention the compounds according to the inven melted and the active component is dispersed homoge tion may be encapsulated with cyclodextrins, or formulated neously therein, as by stirring. The moltenhomogenous mix with their agents expected to enhance delivery and retention ture is then poured into convenient, sized moulds, allowed to in the nasal mucosa. cool, and thereby to solidify. Administration to the respiratory tract may also be Formulations suitable for vaginal administration may be 10 achieved by means of an aerosol formulation in which the presented as pessaries, tampons, creams, gels, pastes, foams active ingredient is provided in a pressurised pack with a or sprays containing in addition to the active ingredient Such suitable propellant such as a chlorofluorocarbon (CFC) for carriers as are known in the art to be appropriate. example, dichlorodifluoromethane, trichlorofluoromethane, Liquid form preparations include Solutions, Suspensions, or dichlorotetrafluoroethane, carbon dioxide, or other suit and emulsions, for example, water or water-propylene glycol 15 able gas. The aerosol may conveniently also contain a Surfac Solutions. For example, parenteral injection liquid prepara tant such as lecithin. The dose of drug may be controlled by tions can be formulated as Solutions in aqueous polyethylene provision of a metered valve. glycol solution. Alternatively the active ingredients may be provided in the The compounds according to the present invention may form of a dry powder, for example a powder mix of the thus be formulated for parenteral administration (e.g. by compound in a suitable powder base Such as lactose, starch, injection, for example bolus injection or continuous infusion) starch derivatives such as hydroxypropylmethylcellulose and and may be presented in unit dose form in ampoules, pre polyvinylpyrrolidone (PVP). filled Syringes, Small Volume infusion or in multi-dose con Conveniently the powder carrier will form a gel in the nasal tainers with an added preservative. The compositions may cavity. The powder composition may be presented in unit take such forms as Suspensions, Solutions, or emulsions in 25 dose form for example in capsules or cartridges of, e.g., oily or aqueous vehicles, and may contain formulatory agents gelatin, or blister packs from which the powder may be Such as Suspending, stabilising and/or dispersing agents. administered by means of an inhaler. Alternatively, the active ingredient may be in powder form, In compositions intended for administration to the respira obtained by aseptic isolation of sterile solid or by lyophilisa tory tract, including intranasal formulations, the compound tion from solution, for constitution with a suitable vehicle, 30 will generally have a small particle size for example of the e.g. Sterile, pyrogen-free water, before use. order of 1 to 10 microns or less. Such a particle size may be Aqueous solutions suitable for oral use can be prepared by obtained by means known in the art, for example by microni dissolving the active component in water and adding Suitable Zation. colorants, flavours, stabilizing and thickening agents, as When desired, compositions adapted to give Sustained desired. 35 release of the active ingredient may be employed. Aqueous Suspensions suitable for oral use can be made by The pharmaceutical preparations are especially in unit dos dispersing the finely divided active component in water with age forms. In Such form, the preparation is Subdivided into Viscous material. Such as natural or synthetic gums, resins, unit doses containing appropriate quantities of the active methylcellulose, sodium carboxymethylcellulose, or other component. The unit dosage form can be a packaged prepa well known Suspending agents. 40 ration, the package containing discrete quantities of prepara Also included are solid form preparations which are tion, Such as packeted tablets, capsules, and powders in vials intended to be converted, shortly before use, to liquid form or ampoules. Also, the unit dosage form can be a capsule, preparations for oral administration. Such liquid forms tablet, cachet, or lozenge itself, or it can be the appropriate include Solutions, Suspensions, and emulsions. These prepa number of any of these in packaged form. rations may contain, in addition to the active component, 45 In one embodiment, the composition is a liquid or powder colorants, flavours, stabilizers, buffers, artificial and natural for intranasal administration, a tablet or capsule for oral Sweeteners, dispersants, thickeners, solubilizing agents, and administration or a liquid for intravenous administration. the like. The invention will now be described with reference to the For topical administration to the epidermis the compounds following Examples which illustrate some aspects of the according to the invention may be formulated as ointments, 50 present invention. However, it is to be understood that the creams or lotions, or as a transdermal patch. Ointments and particularity of the following description of the invention is creams may, for example, be formulated with an aqueous or not to Supersede the generality of the preceding description of oily base with the addition of suitable thickening and/or gel the invention. ling agents. Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emul 55 EXAMPLES Sifying agents, stabilising agents, dispersing agents, Suspend ing agents, thickening agents, or colouring agents. Synthesis Compositions suitable for topical administration in the mouth include lozenges comprising active agent in a fla Nuclear Magnetic Resonance spectra were recorded at 400 voured base, usually Sucrose and acacia or tragacanth; pas 60 MHz ("H)/100 MHz (C) on a Varian Gemini-400. "H and tilles comprising the active ingredient in an inert base such as 'C chemical shifts (8) are given in parts per million (ppm) gelatin and glycerin or Sucrose and acacia; and mouthwashes using residual protonated solvent (DMSO-de) as an internal comprising the active ingredient in a Suitable liquid carrier. standard. Coupling constants are given in Hertz (Hz). The Solutions or Suspensions are applied directly to the nasal following abbreviations are used: S-singlet, d=doublet, cavity by conventional means, for example with a dropper, 65 t=triplet, m-multiplet, bs—broad signal. Low resolution mass pipette or spray. The formulations may be provided in single spectral data were recorded on a API2000 (TOF MS ES+) or multidose form. In the latter case of a dropper or pipette, instrument (Applied Biosystems). High resolution mass US 9,199,976 B2 23 24 spectral data was obtained on a PE Sciex API QSTAR Pulsar General Procedure B (Solution Based Synthesis) (ES-qTOF) (Perkin Elmer, Waltham, Mass., USA) instru An ester-substituted heteroaryl bromide (1.5 mM) was dis ment using ACP (acyl carrier protein) (65-714) Solved in toluene (7 mL) and in a separate vessel a (C7H7NO. (M--H), 1063.5424) and reserpine thiopheneboronic acid orthiazoleboronic acid (2.0 mM) was dissolved in toluene (7 mL) and ethanol (1.5 mL). 2.0 mL of (CHNO (M+H), 609.2812) as internal references. sodium carbonate (2.5 M) was added to the dissolved ester Resolution for the instrument was set between 10,000 and substituted heteroaryl bromide. The catalyst Pd(PPh3)4 (35 12,000 for all standards. Analytical reversed-phase high per mg, 0.03 mM) was added to the dissolved ester-substituted formance liquid chromoatography (HPLC) was performed on heteroaryl bromide followed by the dissolved thiophene- or a Gemini Cs column (4.6x250 mm) (Phenomenex, Lane thiazole-boronic acid, and the flask was evacuated and refilled Cove, NSW, Australia). Preparative reversed phase HPLC 10 with argon five times. The mixture was stirred at 80°C. for 2 was performed on a Gemini 10u Cs column (22x250 mm) hours. The mixture was filtered through celite with EtOAc (Phenomenex) or Jupiter 10u 300 ACs column (21.2x250 (100 mL). The organic layer was separated, dried over mm) (Phenomenex). Separations were achieved using linear MgSO and the solvent was removed under reduced pressure. gradients of buffer B in A (A=0.1% aqueous TFA: B=90% Preparative HPLC, followed by freeze-drying, gave the pure 15 product as a white Solid material. CHCN, 10% HO, 0.09% TFA) at a flow rate of 1 mL/min The pure fractions were collected and the ester group was (analytical) and 20 mL/min (preparative). hydrolysed with 1 M lithium hydroxide (LiOH) in tetrahy Rink amide resin (SV=0.65 mM/g), 2-(1H-Benzotriazol-1- drofuran (THF) for 16 h. The solvent was removed under yl)-1,1,3,3-tetramethyluronium hexafluorophosphate reduced pressure receiving the compound with a free acid. (HBTU) and all N-Fmoc-amino acids were peptide synthe The functionalized carboxylic acid (1 eq) and amine (2 eq) sis grade purchased from IRIS Biotech (Marktredwitz, Ger were placed in a reaction vessel under nitrogen atmosphere. many). Dichloromethane, diisopropylethylamine, N,N-dim PyBrOP (2 eq) was added neat together with DIEA (2.2 eq) ethylformamide, and trifluoroacetic acid were obtained from and DMF. The mixture was stirred for 24h at room tempera Auspep (Parkville, VIC, Australia). HPLC grade acetonitrile ture. Solvent was removed by evaporation using a GeneVac and methanol were purchased from Labscan (Gliwice, 25 Atlas HT-8 speed evaporation system. Preparative HPLC, Poland). All other reagents and solvents were purchased from followed by freeze-drying of the appropriate fractions, gave Sigma-Aldrich, Alfa Aesar (Lancashire, England), Combi the pure product as a white Solid material. Blocks (San Diego, Calif., USA), Oakwood Products (West, Columbia, S.C., USA), Frontier Scientific (Logan, Utah, Example Compounds 30 USA), Boron Molecular (Noble Park, VIC, Australia) and N-(1-amino-1-oxo-3-phenylpropan-2-yl)-6-(thiophen-2- Trans World Chemicals (Rockville, Md., USA). Abbrevia yl)-nicotinamide (3) was prepared via procedure A, using tions: TFA, trifluoroacetic acid; DCM, dichloromethane; Fmoc-protected-L-phenylalanine (1.3 mM), 6-bromopyri EtOAc, ethyl acetate; EtOH, ethanol; DMSO, dimethylsul dine-3-carboxylic acid (0.975 mM) and 2-thiopheneboronic foxide; DMF, N,N-dimethylformamide: HBTU, O-benzot 35 acid (1.3 mM). Yield (7.5 mg, 6.57%); H NMR (400 MHz, riazol-1-yl-N,N,N',N'-tetramethyluronium hexafluorophos DMSO-d): 8 2.94 (dd, J=10.8 Hz, J-30 Hz, 1H), 3.12 (dd. phate; PyBrOP. benzotriazole-1- J=9.2 Hz, J-30 Hz, 1H), 4.64 (ddd, J–8.4 Hz, J=9.2 Hz, yloxytripyrrolidinophosphonium hexafluorophosphate: J=10.8 Hz, 1H), 7.12 (bs, 1H), 7.13-7.34 (m, 6H), 7.58 (bs, DIEA, N,N-diisopropylethylamine: Pd(PPh), Tetrakis 1H), 7.69 (dd, J=1.2 Hz, J=4.8 Hz, 1H), 7.87 (dd, J=1.2 Hz, (triphenylphosphine)palladium(0): CsP. caesium fluoride: 40 J=3.6 Hz, 1H), 7.97 (d. J=8.1 Hz, 1H), 8.13 (dd, J=2 Hz, J=8.4 CuI, copper(I) iodide; MgSO4, magnesium Sulphate. HZ, 1H), 8.71 (d. J=8.4 Hz, 1H), 8.83 (d.J=0.81H). CNMR General, Procedure a (On-Resin Synthesis) (100 MHz, DMSO-d): & 173.6, 1649, 1542, 149.1, 144.0, Functionalized Rink amide polystyrene resin (0.325 mM, 138.9, 136.6, 130.2, 129.6 (2C), 129.1, 128.5 (2C), 128.1, 0.5 g) was derivatized with Fmoc-AA using in situ neutral 127.1, 126.7, 118.4, 55.1, 37.7. ESI-HRMS calculated for ization/HBTU activation protocols for Fmoc chemistry. After 45 C.H.N.O.S M+H 352.1119. Found: 352.1109. removal of the Fmoc group to provide a primary amine, a N-benzhydryl-6-(thiophen-2-yl)nicotinamide (4) was pre carboxy-substituted heteroaryl bromide was coupled to the pared via procedure B, using methyl 6-bromopicolinate (1.5 primary amine. mM), 2-thiopheneboronic acid (2 mM) and benzhydrylamine The bromoheteroaryl-functionalized resin (0.325 mM) (2 eq). Yield (0.45 mg/0.7%); ESI calculated for was placed in a reaction vessel under nitrogen atmosphere. 50 C.H.N.OS M+H": 370. 1. Found: 371.0. Dimethylether (DME) (5 mL) was degassed and added to the N-benzyl-6-(thiophen-2-yl)nicotinamide (5) was prepared resin, followed by addition of neat Pd(PPh3)4 (81 mg, 0.07 via procedure B, using methyl 6-bromopicolinate (1.5 mM), mM). A solution of a thiopheneboronic acid or thiazolebo 2-thiopheneboronic acid (2 mM) and phenylmethanamine (2 ronic acid (1.3 mM) in degassed EtOH (1 mL) was added to eq). Yield (5.38 mg/9.1%); H NMR (400 MHz, DMSO-d): the resin, and the mixture was agitated for 5 min: CsF (162 55 & 4.50 (d. J=6 Hz, 2H), 7.19 (t, J=9.6 Hz, 1H), 7.22(q, J=17.6 mg, 1.3 mM) was added neat. The mixture was agitated 16 h HZ, 1H), 7.27-7.33 (m, 4H), 7.70 (d. J=4.8 Hz, 1H), 7.89 (d. at 60° C. before excess reagents were removed by filtration, J=3.6 Hz, 1H), 8.01 (d. J=8.4 Hz, 1H), 8.25 (dd, J=1.6 Hz, and the resin was washed with DMF (3x) and DCM (3x) to J=8.4 Hz, 1H), 8.97 (d. J=2.4 Hz, 1H), 9.19 (t, J=11.6 Hz, 1H). yield resin bound compound. ESI calculated for CHNOS M+H: 294.1. Found: The resin was dried for several hours under reduced pres 60 295.1. Sure and placed in a cleavage vessel. The resin was treated (3,4-dihydroisoquolin-2(1H)-yl)(6-(thiophen-2-yl)pyri with a mixture of TFA/HO 92:8 for an hour. TFA was blown din-3-yl)methanone (6) was prepared via procedure B, using off under nitrogen atmosphere and the dry cleaved crude methyl 6-bromopicolinate (1.5 mM), 2-thiopheneboronic product was re-dissolved in a solution of 30% A and 70% B acid (2 mM) and 1,2,3,4-tetrahydroisoquinoline (2 eq). Yield (as defined above) and separated from the resin. Preparative 65 (12.67 mg/22%); H NMR (400 MHz, DMSO-d): 8 2.81 (d. HPLC, followed by freeze-drying, gave the pure product as a J=11.6 Hz, 2H), 3.61 (s, 1H), 3.84 (s, 1H), 4.64 (s, 1H), 4.76 white solid material. (s, 1H), 7.06-7.25 (m, 6H), 7.69 (d. J–4.8 Hz, 1H), 7.88 (d.

US 9,199,976 B2 27 28 were harvested by centrifugation at 5000 g for 20 minat 4°C.; Enzyme Assays cell pellets were kept at -70° C. until required. Cells were resuspended in 25 ml of ice-cold phosphate buffered saline The H-PGDS catalyzed conjugation of GSH and 1-chloro (PBS), pH 7.4, containing 1 mMDTT, 0.5% TritonX-100 and 2,4-dinitrobenzene (CDNB) was used as the biochemical EDTA-free protease inhibitor tablets (F. Hoffmann-La assay for enzyme inhibition. Reactions were performed in 96 Roche, Dee Why, NSW, Australia); and incubated with rota well plate format, and product formation was followed at tion for 30 mins at 4°C. Cells were then lysed by sonication A340 nm over a 10 min interval at 25°C. using a POWER at 90-100 W over 3x1 min intervals, while incubated on ice; WAVE XS microplate scanning spectrophotometer (Bio-Tek the lysate clarified by centrifugation at 18000 g for 10 min at Instruments, Winooski, Vt., USA). Reactions were per 40 C. formed in 0.1 M Tris HCl, pH 8.0 containing 2 mM MgCl2, 1 The supernatant was then applied to a GSTPrep FF 16/10 mM CDNB, 2 mM GSH, 2.5 ng/ul purified H-PGDS and column pre-equilibrated with PBS, pH 7.4, and 1 mM DTT, at 0.4 ml/minute using an AKTA explorer 100 (GE Healthcare, 10% (v/v) ethanol in a 200 ul reaction volume. ICso values Rydalmere, NSW, Australia), then washed with 5 column were calculated from rates of conjugation activity determined Volumes of the same buffer at 1 ml/min. Bound H-PGDS was at eight concentration points bracketing the ICso, where com eluted in 5 column volumes of 15 mM reduced glutathione in 15 pound solubility allowed, and were corrected for background 50 mM Tris, pH 9.0, at 0.5 ml/min, and dialysed against 100 activity at the same solvent concentrations. All compounds volumes of 5 mM TrisCl, pH 8.0. The protein was concen were made up in 100% DMSO and diluted with 0.1 M Tris trated to 20 mg/ml, as determined by the method of Bradford HCl, pH 8.0 with 2 mM MgCl2. Is and ICs values were (Bradford, 1976) using an Amicon Ultra-4 centrifugal filter determined at a final DMSO composition of no greater than device (Millipore, North Ryde, NSW, Australia) following 4% V/V for all compounds. Non-linear regression analysis and manufacturers recommendations. Glycerol was added to a ICso calculations were performed using GraphPad Prism ver final concentration of 10% (v/v) prior to storage at -20°C. sion 4.0c. The results are shown in Table 1. TABLE 1 R2

N 2N

R1 Compound R2 RI Mass yield so ICso (LIM) 3 NH2 7.5 mg/6.6% 97.0 + 2.4 1.2 - 1.0

O HN 2 S

O 4 ( ) 0.45 mg/0.7% 28.5

2. o

5 5.38 mg/9.1% 99.5 + 0.8 0.597 + 1.2 O NH a S

6 12.67 mg/22% 72.3 + 1.5 na

O N 2 S US 9,199,976 B2 29 30 TABLE 1-continued

R2

N 2N

RI

Compound R2 R Mass yield Iso ICso (IM)

7 0.85 mg/2.1% 91.0 + 0.1 1.97 - 1.2

O N a Ns

8 2.48 mg/5.1% 58.7 + 0.8 na

O s N 2 S

O

9 O 2.78 mg/5.2% 98.3 + 1.1 0.66 + 1.1

OH 2 S

O NH

10 16.26 mg/26.4% 90.4 + 0.5 1.23 - 1.1

O N 2 S N O N^ o ^ N

11 14.04 mg/47.6% 90.4 + 0.7 1.22 + 1.4 X=o O r US 9,199,976 B2 31 32 TABLE 1-continued

R2

N

Compound Mass yield Iso ICso (IM) 12 12.3 mg 14.5% 99.8 O.3 O.O86 - 1.1

13 26.3 mg/43.2% 87.9 - 1.1 3.40 - 1.4

14 14.16 mg/16.6% 834 - 1.5 17 - 1.8

15 0.64 mg/0.7% 19.4 + 1.4

HO

16 0.91 mg/1.8% 89.4 4.7 1.4 + 1.3

17 1.7 mg 3.4% 95.01.1 2.01.1 US 9,199,976 B2 33 34 TABLE 1-continued

R2

Compound Mass yield Iso ICso (IM)

18 1.34 mg/2.9% 5.1 1.1

19 0.42 mg/1% 94.824 3.21.6

0.46 mg/1% 67.9 - 1.6 na

CN

21 0.54 mg/1.1% 97.4 O.8 O.381.1

22 0.46 mg/0.9% 34.6.2.1 na

23 HNHNHNHNHN NH 1.08 mg/2.2% 916 - O.8 1871.1 US 9,199,976 B2 35 36 TABLE 1-continued R2

N

2 N

RI Compound R2 R Mass yield Iso ICso (IM) 24 O 94.6 O.3 O.86 12 HN N O X 2 S

25 96.9 1.O O1812 O NH O 2 S

IC50 values were calculated from triplicate experiments, and are presented as IC50+ Standard Error of the Mean. Isol is percent inhibition at 50 LM, and is presented as the Mean+ Standard Error of triplicate experiments. – indicates that IC50 values could not be retrieved under the assay conditions.

Effects of Selected H-PGDS Inhibitors on the Production of cDNA was synthesised using Superscript III (Invitrogen) and Other Prostaglandins, Prostacyclins and Thromboxanes oligo(dT) primer. Transcript abundance was quantitated A selection of compounds were assessed for their ability to using gene-specific primer pairs and the SYBR green system inhibit inducible PGD production in two inflammation-rel 35 (Applied Biosystems, Foster City, Calif., USA) relative to evant cell models, mouse primary bone marrow-derived mac hypoxanthine guanine phosphoribosyl transferase (HPRT) rophages (BMM) responding to lipopolysaccharide (LPS), levels using the power delta Ct method. Primer efficiencies and the human megakaryocyte cell line, MEG-01S respond for the respective human and mouse H-PGDS and L-PGDS ing to PMA (Phorbol 12-myristate 13-acetate) differentia primer pairs were measured over a cDNA dilution series, and tion, followed by triggering with the calcium ionophore 40 were used to normalize expression, such that comparisons A23 187. could be made of mRNA levels for H-PGDS versus L-PGDS Cell Culture All bone marrow-derived macrophages (BMM) were (for human and mouse). Primer pairs used were Human obtained by culturing bone marrow cells from the femurs of 6 H-PGDS gene, Human L-PGDS gene, Human HPRT gene, to 8 week old C57BL/6 male mice in RPMI 1640 medium 45 Mouse H-pgds gene, Mouse L-pgds gene and Mouse Hprt (Invitrogen Life Technologies, Carlsbad, Calif., USA) gene, as shown in Table 2. supplemented with 10% Fetal calf serum (Invitrogen) 20 U/ml penicillin and 20 ug/ml Streptomycin (Invitrogen), 2 TABLE 2 mML-glutamine (GlutamaX-1, Invitrogen) in the presence of Gene Forward Rewerse 10 U/ml (100 ng/mL) recombinant human CSF-1 (a gift 50 from Chiron, Emeryville, Calif.) on bacteriological plastic al TCACCAGAGCCTAGCAATAG CTGCCCAAGGAAAACATGAC plates for 7 days. The human megakaryocytic cell line MEG H-PGDS CA A. 01S was obtained from the American Type Culture Collec al CCTGACCTCCACCTTCCTCA TCGGTCTCCACCACTGACAC tion. MEG-01S were maintained in the same media as for - PGDS BMM, supplemented with 1 mM Sodium Pyruvate (Invitro 55 gen). al TCAGGCAGTATAATCCAAAG AGTCTGGCTTATATCCAACA Determination of mRNA Expression by Quantitative PCR HPRT ATGGT CTTCC (qPCR) ColSee AAGCACCTCGCCTTCTGAAA CAGTAGAAGTCTGCCCAGGT As PGD is produced by both H-PGDS and the genetically H-pgds TACA.T 60 distinct L-PGDS, quantitative RT-PCR was first used to ColSee CAGAGGGCTGGTCACATGGT AGGCAAAGCTGGAGGGTGTA assess relative mRNA levels as an indicator of enzyme -pgds G expression in these cell lines. RNA was extracted from 3x10° cells and cDNA synthe ColSee GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATC sised as described previously (Irvine, J. Leuk Biol. 2009). Hprt CAA Briefly, RNA was extracted using RNeasy kits (Qiagen, 65 Valencia, Calif., USA), contaminating genomic DNA Results show that H-PGDS is the predominant PGDS removed using RNeasy on-column DNase (Qiagen) and expressed by mouse BMM and human MEG-01S cells. US 9,199,976 B2 37 38 Quantitative RT-PCR data from BMM and MEG-01S cells Prostaglandin Production in LPS-Activated BMMs: Com shows that H-PGDS mRNA was expressed at much higher pound 3 levels (1000x) than L-PGDS in both mouse BMM and human Compound 3 was further characterised along with the MEG-01 S cells. H-PGDS inhibitors 1 (HQL-79) (Aritake, 2006) and 2 (Ho hwy, 2008) in LPS-activated BMM. BMM were treated with LPS over a time course and rela BMM were treated with increasing concentrations (0-100 tive gene expression for H-PGDS and L-PGDS was quanti uM) of compounds 1, 2 and 3 with appropriate vehicle con tated. LPS was shown to induce L-PGDS expression in mac trols (Ethanol for 1, DMSO for 3 and 2) and with LPS for 24 rophages and H-PGDS was also regulated by LPS: h. PGD., (FIG. 2A), PGE (FIG. 2B) prostacyclin derivative Nonetheless, the increase in L-PGDS mRNA expression in 10 6-keto PGF (FIG. 2C) and Thromboxane A derivative response to LPS was very modest in comparison to the high TXB (FIG. 2D) levels in supernatants collected from cells basal expression of H-PGDS in BMM. It was concluded that were quantified by EIA. Data show the average of three H-PGDS is the major PGDS expressed by both human MEG independent experiments plus SEM.* indicates p<0.05; ** 01S cells and mouse BMM, implying that this enzyme is indicates p<0.01: *** indicates p<0.001 (Student's t test) likely to be the dominant source of PGD production in these 15 versus vehicle+LPS. cell types. Compound 3 inhibited PGD production in the sub-micro Prostaglandin Release from Cells and Cell Viability: molar range dose-dependently (FIG. 2A). The ECso esti mated for compound 3 (-0.29 LM) was comparable to that Procedure: Prostaglandin Release from Cells estimated for compound 2 (ECso-0.16 uM), and was ~30 fold BMM were seeded overnight at 2x10 cells/ml in 24 well better than that estimated for 1. The specificities of 3, 2 and 1 plates before treatment with compound at either 10 uM or were then assessed by comparing effects on LPS-inducible 0.1-100 uM for 24 h in the presence or absence of PGE, the hydrated prostacyclin derivative 6-keto PGF and lipopolysaccharide (LPS) from Salmonella Minnesota the thromboxane A derivative TXB2 production from BMM (Sigma-Aldrich) at a final concentration of 10 ng/ml. MEG (FIG. 2B). Compound 1 showed no differential effect in inhi 01S were seeded at 2x10 cells/ml and stimulated with PMA 25 bition of PGD versus PGE, 6-keto PGF, or TXB, while (Phorbol 12-myristate 13-acetate) (Sigma-Aldrich) at a final compound 2 showed only a modest difference. In contrast, concentration of 0.1 uM for 16 h. Compound (0.3-100 uM) compound 3 demonstrated a striking selectivity, significantly was added 30 min prior to stimulation with 5uM Calcium inhibiting PGD levels at 1 uM, whilst PGE, 6-keto PGF Ionophore A23 187 (Sigma-Aldrich) for 30 min. All com and TXB inhibition was only observed above 10 uM. Taken pounds were dissolved in DMSO and diluted in cell culture 30 together, these data demonstrate that compound 3 displays medium such that the final concentration of DMSO did not selectivity and affinity not otherwise observed for other exceed 0.1%. Supernatants were collected and samples were H-PGDS inhibitors. analysed for PGD using Prostaglandin D2 Mox Express EIA PGD, Inhibition in Human Megakaryocytes kits, PGE using Prostaglandin E2 Express EIAkits, the pros PGD2 inhibition in human megakaryocytes by compound tacyclin derivative 6-keto PGF, using the 6-keto Prostaglan 35 3, and known inhibitors 1 and 2, were then characterised. din F. EIA Kit and the Thromboxane A derivative TXB PMA (Phorbol 12-myristate 13-acetate) differentiated MEG using the Thromboxane B Express EIAkit (Cayman Chemi 01S were treated with compounds 1, 2 and 3 across a concen cal) according to the manufacturers instructions. tration range (0-100 uM) for 30 min prior to 30 minute treat Procedure: Cell Viability Assays ment with 5uM Calcium Ionophore A23 187. PGD levels in 40 cell culture supernatants were quantitated by EIA (FIG. 3A). Known inhibitors 1 and 2, along with compound 3, were Data represent the average of three independent experiments used to treat BMM at three doses (10, 30, 100 uM) in the plus SEM. * indicates p<0.05; **indicates p<0.01: *** indi presence of LPS for 24 h and cell viability was measured by cates p-0.001 (Students t test) versus vehicle+Ionophore. MTT assay. BMM were seeded at 1x10 cells/well in 96 well Compounds 2 and 3 inhibited A23 187-inducible PGD plates and treated for 24 h with LPS (10 ng/ml) and com 45 production from PMA-differentiated MEG-01S human pounds at 10, 30 and 100 uM. MEG-01S were PMA differ megakaryocytes dose-dependently, while 1 displayed very entiated overnight before compounds were added for a further modest activity at 100 uM (FIG. 3A). 24 h at 10, 30 and 100 uM. Cell viability was measured by MEG-01S Cell Viability MTT (Sigma-Aldrich) assay as described previously (Irvine, The effect of the compounds on MEG-01S cell viability FASEBJ, 2006). 50 was measured by MTT assay after 24 h treatment across the Prostaglandin D. Production in LPS-Activated BMMs concentration range 0-100LLM of compounds (FIG.3B). Data FIG. 1A shows the results of tests on compound 3 to assess represent the average of 4 independent experiments plus its ability to inhibit PGD production in LPS-activated SEM. BMMs. The compound was tested with 10 uM of compound Again, compound 3 had little effect on MEG-01S cell 55 viability (FIG.3B), as did compounds 1 and 2, Suggesting that and LPS (10 ng/ml) for 24 h. The average PGD production inhibition of PGD production occurred through enzyme from three independent experiments plus SEM is shown. * inhibition. indicates p-0.05 versus LPS treatment alone. (Student’s t COX1 and COX2 Enzyme Assays test). As inhibition of COX1 and/or 2 may also have a negative BMM Cell Viability 60 impact on PGD production in cells, compound 3, along with Compound 3 did not affect BMM viability at 10 uMor 100 known compound 2, was tested against purified COX1 and 2 uM, as assessed by MIT assay (FIG. 1B). Compounds 1 and isoforms at 1, 10 and 100 uM (FIG. 4). Tests were also 2, identified by others as H-PGDS inhibitors (Hohwy, 2008), performed on the well-characterized COX inhibitor, had modest but significant effects on BMM cell viability indomethacin, as a positive control. Data represent the aver (FIG. 1B). In FIG. 1B data show the average of four indepen 65 age of three independent experiments plus SEM. * indicates dent experiments plus SEM. * indicates p<0.05 versus con p-0.05: (One sample t test where the hypothetical mean is trol (one sample t test where the hypothetical mean is 100). 100). US 9,199,976 B2 39 40 COX1 and COX2 enzyme assays were performed using the Results Colorimetric COX (Ovine) Inhibitor Screening Assay kit The observed levels of compound 3 in rat serum after oral (Cayman Chemical) according to the manufacturers instruc dosing is illustrated in Table 3. Compound 3 was orally bio tions. available and present in the serum 8 hours post delivery. No inhibition of either COX isoform was observed for the Compound 3 also showed reduction in PGD activity, 20% at H-PGDS inhibitors, whilst indomethacin significantly inhib the 8 hour time point. ited the activity of both COX1 and COX2 (FIG. 4). This data further supports the selectivity for PGD synthesis inhibition of this series of compounds. TABLE 3 Pharmacokinetics and Rat Target Modulation assay 10 Male adult Sprague Dawley rates (~165 g) received a Concentration Mean (itsem) single oral bolus dose of 40 mg/kg of compound 3 in a 0.5% Time (h) (ngmL) N Concentration (ng mL) methylcellulose/0.1% Tween80 by oral gavage. Rats were O BLOO' 3 O sacrificed when collecting blood and spleen samples just O BLOO' prior to dosing and at 0.5 hours, 2 h, 8 hand 24h (n=3 rats per 15 O BLOO' time point), and the plasma concentration of compound 3 and O.S 177 3 219, 24.8 the spleen PGD concentration was measured at each time O.S 263 point. O.S 218 Procedure: Blood Samples 2 94.8 3 91.89.79 Blood samples were removed and kept cold at approxi 2 73.5 mately 4°C. immediately after collection to minimize deg 2 107 radation and centrifuged as soon as possible at approximately 8 7.3 3 44.3 + 14.0 4000xg for 10 min. The plasma was transferred to a clean, 8 63.9 pre-labelled polypropylene tube and frozen. Samples were 8 51.8 stored at -20°C. as soon as possible after collection to mini 25 24 BLOO 3 O.677 - 0.177 mise degradation of the test item. 24 1.03 Plasma concentrations of 3 were determined using a 24 BLOO screening LC-ms/ms method developed using the following parameters: Entries marked BLOO were Below the Lower Limit of Quantitation. 30 BLOO - treated as 0 in calculating the mean, BLOO - treated as 0.5 ng mL (12 lower limit of quantitation) in calculating the mean, Mobile Phase A: 5% Acetonitrile? water, 0.1% TFA: B: 95% Acetonitrile/water, 0.09% TFA. Flow rate: 400 l/min Gradient: 60% B for 0.5 min, up to REFERENCES 100% B in 1 min and remain at 100% B for a further 0.7 min. 35 Column Phenomenex, Gemini C18, 150 x 2.0 K. Aritake et al., Structural and Functional Characterization mm, 51. Mass Spectrometer 4000 Q TRAP of HQL-79, an Orally Selective Inhibitor of Human Polarity positive Hematopoietic Prostglandin D Synthase, J. Biol. Chem. Transition mz. 353,307 and 352,161 40 2006, 281:15277-15286. M. M. Bradford et al. A rapid and sensitive method for the Samples were analysed alongside plasma standards. Con quantitation of microgram quantities of protein utilizing centration data were determined by back calculation from the principle of protein-dye binding, Anal. Biochem, 1976, standard curve. 72:248-254. Procedure: Spleen Samples 45 Spleens were excised, weighed and Snap frozen in a dry T. W. Green and P. G. M. Wuts, Protective Groups in Organic ice/ethanol bath. Tissues were stored at -80°C. until analysis. Synthesis, John Wiley & Sons, 3 Edition 1999. Spleens were homogenised in a solution containing 10 mM M. Hohwy et al., Novel Prostaglandin D Synthase Inhibitors indomethacin in phosphate buffered saline (PBS) at 1:10 w/v. Generated by Fragment-Based Drug Design, J. Med. Samples were centrifuged at 2500 rpm for 5 min at 4°C. The 50 Chem., 2008, 51:2178-2186. resultant Supernatant was diluted and the measurement of PGD was determined by solid-phase extraction (SPE) using I. R. Jowsey et al., Mammalian class Sigma glutathione cationic solid-phase extraction cartridges. The SPE eluent S-transferases: catalytic properties and tissue-specific was assayed using a screening LC-MS/MS method against expression of human and rat GSH-dependent prostaglan din D2 synthases, Biochem. J., 2001, 359:507-516. aqueous PGD standards, using the following LC-MS/MS 55 parameters: K. M. Irvine et al., A CSF-1 receptor kinase inhibitor targets effector functions and inhibits pro-inflammatory cytokine Mobile Phase A: 10 mMAmmonium acetate, pH 8.5; production from murine macrophage populations, FASEB B: 95% Acetonitrillef water. J, 2006, 20:1921-1923. Flow rate:200 l/min Gradient: Linear from 20% B to 50% B 60 K. M. Irvine et al., Colony-stimulating factor-1 (CSF-1) in 10 min delivers a proatherogenic signal to human macrophages, J. Column Phenomenex, Luna Phenyl-hexyl, 31, 150 x 2.0 mm Leukoc. Biol., 2009, 85:278-288. Mass Spectrometer 4000 Q TRAP Polarity negative The invention claimed is: Transition niz 351,271 65 1. A compound of formula (III) or a pharmaceutically acceptable salt thereof: US 9, 199,976 B2 41 42 R'', N(R'), and C(=O) N(R'), wherein each Formula (III) R'' is independently selected from H. —Calkyl, —C2-alkenyl, —C2-alkynyl. —Co-alkylaryl, —Co-alkylheteroaryl, -Co-alkylcycloalkyl, -Co N alkylcycloalkenyl or -Co-alkylheterocyclyl; and t is 0-2: wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalk l enyl, aryl, heterocyclyl and heteroaryl are optionally substituted with one or more optional substituents. a Ns 10 2. The compound according to claim 1 wherein each R' is independently selected from hydrogen, cyano, nitro, halo, —Coalkyl, -Coalkenyl, -Calkynyl, -C(=O) R''. \= R12 C(=O)-O-R'', O C(=O) R', N(R'), and —C(=O)-N(R'). wherein 15 3. The compound according to claim 1, wherein at least one L and Mare both CR; of L and M is CH. R is C(=O) NRR: 4. The compound according to claim 1, wherein L and M R is CHR'R'': are both CH. R" is selected from hydrogen, hydroxyl, alkyl, haloalkyl, 5. The compound according to claim 1, wherein R' is alkenyl, and alkynyl: hydrogen, cyano, nitro, halo. —Coalkyl, -C2-alkenyl, R is selected from CO.H. —CONH., cycloalkyl, —Calkynyl, -C(=O) R'', C(=O)-O-R'', cycloalkenyl, aryl, heterocyclyl, heteroaryl, -C —O C(=O) R'', N(R'), and –C(=O) N(R'). alkylR', -CalkenylR'' and —CalkynylR': 6. The compound according to claim 5, wherein R' is R" is selected from cycloalkyl, cycloalkenyl, aryl, hetero selected from hydrogen, cyano, nitro, halo, Calkyl, cyclyl and heteroaryl; 25 C(=O) R', -C(=O)-O-R' or O C(O) R'' is selected from —C-alkyl, -Chaloalkyl, R'', where R'' is hydrogen or Calkyl. —C2-galkenyl, -C2-galkynyl, -Co-calkylCH, -Co 7. The compound according to claim 5, wherein R' is alkylCOH, -Co-alkylCONH, -Co-alkylNH, hydrogen. —Co-alkylSH, -Co-alkylSC-alkyl, -Co-alkyl 8. The compound according to claim 1, wherein R is NHC(=NH)NH2. Coalkylcycloalkyl, -Co-alky 30 —CONH2 or optionally substituted aryl. laryl, -Co-alkylheterocyclyl and - Coalkylhet 9. The compound according to claim 1, wherein R'' is eroaryl; —Coalkyl, -C-perfluoroalkyl or -Co-alkylaryl. R" and R' are independently selected from hydrogen, 10. The compound according to claim 1, wherein R is cyano, nitro, halo. —Coalkyl, -Coalkenyl, hydrogen. —C2-alkynyl, -Co-alkylaryl, -Co-alkylheteroaryl. 35 11. A pharmaceutical composition comprising a com —Co-alkylcycloalkyl, —Co-alkylcycloalkenyl, pound according to claim 1 and at least one pharmaceutically —Coalkylheterocyclyl, -O-R'', —C(=O) R'', acceptable carrier. ck ck ci: ci: c