Molecular Identification and Nutrient Analysis of the Green Tide Species Ulva Ohnoi M

Home , Gemina, Ulvales, Ulva australis, Ulva clathrata, Ulva compressa, Ulva lactuca

Aquatic Invasions (2016) Volume 11, Issue 3: 225–237 DOI: http://dx.doi.org/10.3391/ai.2016.11.3.01 Open Access

Research Article

Molecular identification and nutrient analysis of the green tide species Ulva ohnoi M. Hiraoka & S. Shimada, 2004 (Ulvophyceae, Chlorophyta), a new report and likely nonnative species in the Gulf of Mexico and Atlantic Florida, USA

James T. Melton III1,*, Ligia Collado-Vides2,3 and Juan M. Lopez-Bautista1 1Department of Biological Sciences, The University of Alabama, Tuscaloosa, AL 35487, USA 2Department of Biological Sciences, Florida International University, Miami, FL 33199, USA 3Southeast Environmental Research Center, Florida International University, Miami, FL 33199, USA *Corresponding author E-mail: [email protected]

Received: 21 September 2015 / Accepted: 31 March 2016 / Published online: 14 May 2016 Handling editor: Philippe Goulletquer

Abstract

Species level identifications of morphologically simple marine algae have undoubtedly caused biodiversity assessments to be an arduous task. The green algal genus Ulva L., 1753, is notorious for morphological plasticity and cryptic speciation. We used two chloroplast-encoded (rbcL and tufA) molecular markers and the nuclear internal transcribed spacer 1 (ITS1) of the ribosomal cistron to detect Ulva ohnoi M. Hiraoka and S. Shimada, 2004, a species known for forming green tides in Japan, as a new record for the Western Atlantic, including the Gulf of Mexico (GoMX) and Atlantic coast of Florida. All rbcL sequences from this investigation were identical to reports for U. ohnoi. The Western Atlantic isolates showed relatively low genetic diversity in tufA and ITS1 sequences, which suggests that this species is not native to the GoMX and Atlantic Florida. Furthermore, we have identified U. ohnoi as the species that formed an ephemeral, localized overgrowth during July of 2013 in Biscayne Bay, Florida, an area with a persistent bloom of two other green algal species, Anadyomene stellata J. V. Lamouroux, 1812, and Anadyomene sp., due to eutrophication from anthropogenic nutrient loading near canals. A tissue nutrient analysis of samples from this overgrowth of Ulva showed that this species has a high affinity for nitrogen, especially ∂15N, which suggests anthropogenic sources of N. Further investigations are needed to assess the geographical ranges of this species in this region as well as the potential invasiveness of this alga in the Western Atlantic. It is highly recommended to monitor the abundance of this species in response to nutrient discharges in Biscayne Bay. Key words: Ulvales, algal bloom, new record, nonindigenous, Western Atlantic, Biscayne Bay

Introduction diversity of many algal species means introductions of these organisms may go unnoticed. To further Accurate biodiversity assessments of marine macro- complicate the issue, an understanding of native phytes are essential for conservation, monitoring, ranges is lacking for many algae. Fortunately, and management of biological introductions and molecular genetics techniques allow for a more invasions. Environments with high shipping traffic complete understanding of the diversity of marine are constantly under pressure of introductions of macrophytes and can help unravel native ranges non-native species through anthropogenic trans- (Geller et al. 2010). portation of, in this case, marine algae through Species of the green algal genus Ulva L., 1753, are vectors such as fouling on ships (Mineur et al. some of the most commonly transported organisms 2008), ballast water (Flagella et al. 2007; Flagella et through various shipping vectors (Flagella et al. al. 2010), and transportation in the aquaculture and 2007; Mineur et al. 2008; Flagella et al. 2010). Ulva aquarium trades (Boudouresque and Verlaque 2002; species can survive severe environmental conditions, Booth et al. 2007; Geller et al. 2010). The simple including over ten months of light deprivation morphology, morphological plasticity, and cryptic (Santelices et al. 2002). Furthermore, some of these

225 J.T. Melton et al. species exhibit invasive traits such as rapid growth, high reproductive potential, vegetative reproduction, and a high affinity to nutrient surplus (Andreakis and Schaffelke 2012). To help determine whether specimens of Ulva are native or nonindigenous species (NIS), previous studies have used the chloroplast-encoded rbcL (Heesch et al. 2009) and tufA (Kirkendale et al. 2013) molecular markers and the nuclear internal transcribed spacer region 1 (ITS1) of the ribosomal cistron (Couceiro et al. 2011). A similar approach was used in this study. Ulva species are found worldwide in marine, brackish, and sometimes freshwater environments. Morphologically, these species can be found as distromatic blades, monostromatic tubes, a mixture of a distromatic blade with tubular margins (Norris 2010), or even monostromatic sheets (Blomster et al. 2002). Currently, there are about 100 accepted species (Guiry and Guiry 2015). Some of these species are indicators of eutrophic conditions and have been known to form HABs (harmful algal blooms) or green tides. Green tides are being documented more frequently worldwide (Ye et al. 2011). These blooms can be ecologically and economically destructive and are mostly formed by members of the class Ulvophyceae, and the majority caused by Ulva species (Ye et al. 2011). Based on molecular data, eight Ulva species are known to form blooms: U. australis Areschoug, 1854 (presented as U. pertusa Kjellman, 1897 in Shimada et al. 2003; Hofmann et al. 2010); Ulva compressa Linnaeus, 1753 (Hofmann et al. 2010; Guidone et al. 2013); Ulva curvata (Kützing) De Toni, 1889 (Malta et al. 1999); U. lactuca L., 1753 (Malta et al. 1999; Hofmann 2010); U. paschima F. Bast, 2014 (Bast et al. 2014); U. prolifera O.F. Müller, 1778 (Leliaert et al. 2009; Hiraoka et al. 2011); U. ohnoi M. Hiraoka & S. Shimada, 2004 (Hiraoka et al. 2004b); and U. rigida C. Agardh, 1823 (Malta et al. 1999; Hofmann 2010; Guidone et al. 2013). Some of the largest green tides caused by Ulva occur in Qingdao, China, beginning infamously during the 2008 Summer Olympics (Leliaert et al. 2009). In 2008, the bloom in the Yellow Sea covered miles of shoreline and delayed sailing events (Liu et al. 2009; Ye et al. 2011). The species was first identified it as a member of the Ulva linza-prolifera-procera clade or LPP-clade based on rbcL and ITS data (Leliaert et al. 2009). Further analysis of the 5S rDNA and cross Figure 1. Ulva ohnoi in Deering Estate, Biscayne Bay, FL, breeding tests revealed that the massive growth was during July 2013. (A) free-floating blades in the intertidal and tangled in mangrove roots and limbs; (B) attached blades near caused by Ulva prolifera (Hiraoka et al. 2011). The mangroves; and (C) free-floating blade measure about 1.0 × 0.5 m. cost of dealing with this algal bloom was Photographs by Ligia Collado-Vides. approximately US$100 million (Wang et al. 2009). A green tide the size of that in Qingdao has not been reported in the Western Atlantic; however, blooms

226 Ulva ohnoi: a new report in the Western Atlantic

Table 1. Primers used in this study.

Gene Direction Primer Sequence (5' to 3') Reference rbcL Forward RH1 ATGTCACCACAAACAGAAACTAAAGC Manhart 1994 Reverse rbc590 TCAAGACCACCTCGTAAACA Hayden and Waaland 2002 Forward rbc571 TGTTTACGAGGTGGTCTTGA Hayden and Waaland 2002 Reverse R1385 AATTCAAATTTAATTTCTTTCC Manhart 1994 tufA Forward tufGF4 GCNGCNGCNCAAATGGAYGG Saunders and Kucera 2010 Reverse GtufAR CCTTCNCGAATMGCRAAWCGC Saunders and Kucera 2010 ITS1 Forward COAT ITS1 TTTGTACACACCGCCCG Coat et al. 1998 Reverse COAT ITS3 GAATTCTGCAATTCACA Coat et al. 1998

of Ulva with free-floating tubular and blade and Atlantic coast of Florida by employing a molecular morphologies have been reported from Lee County, approach using chloroplast (rbcL and tufA) and Florida (Lapointe et al. 2006). In the Northwestern nuclear (ITS1) molecular markers. By using the Atlantic, four cryptic taxa (i.e. U. lactuca L., 1753; molecular data, we also attempted to determine the U. rigida C. Agardh, 1823; U. compressa L., 1753; native or non-indigenous nature of this species in the and U. australis, Areschoug, 1854, presented as U. Western Atlantic. Tissue nutrient content in algae pertusa Kjellman, 1897) were found forming blooms and seagrass has been used as indicators of nutrient in the Great Bay Estuarine System of New availability in coastal waters (Collado-Vides et al. Hampshire and Maine, USA (Hofmann et al. 2010), 2011). Rapidly growing species usually have a high and three of these blade-forming species (U. compressa, affinity for nitrogen (N) making them opportunistic U. lactuca, and U. rigida) were also found blooming species in high N availability systems (Lin and Fong in Narrangansett Bay, Rhode Island, USA (Guidone 2010). High levels of δ 15N have been used as et al. 2013). signature of anthropogenic source of N (Swart et al. The extent and effects of the bloom in Qingdao, 2013). Tissue nutrient concentrations of three dominant China, provided a reason to investigate Ulva macrophyte species in Biscayne Bay samples were incursions in other areas. During the summer of determined and used to evaluate whether excess 2013, a localized, ephemeral overgrowth consisting anthropogenic nutrient inputs enhanced the invasive of an unidentified Ulva species with large, free- potential of the Ulva species. floating blades was found in Deering Estate, Biscayne Bay, Florida, USA. Blades of approximately 1.0 m length by 0.5 m width were covering an area approxi- Materials and methods mately 500 m long by 4–5 m wide in mangrove Sampling habitat (Figure 1). Despite having the lowest water column nutrient concentrations in Florida, parts of Most of the Ulva samples were collected from the Biscayne Bay are subjected to high nutrient loading intertidal zone during spring and summer months from canals that discharge into the bay (Caccia and (2012–2015) in the GoMX (Texas, Alabama, and Boyer 2007; Stalker et al. 2009, Swart et al. 2013). Florida), Atlantic coast of Florida (Biscayne Bay, Since 2005, there has been a persistent algal bloom Indian River Lagoon, and Florida Bay), and Yucatan, of Anadyomene stellata (Wulfen) C. Agardh, 1823, Mexico (MX) (Figure 2; Table S1). Herbarium and Anadyomene sp. that covers approximately 60 vouchers were made for each sample, and a part of km2 of sea grass near the canals, with severe negative each sample was preserved in silica gel for effects on the sea grass beds (Collado-Vides et al. molecular analyses. Herbarium vouchers were 2013). submitted to The University of Alabama Herbarium The goals of this study were to identify the (UNA) and Fairchild Tropical Botanic Garden species that formed the overgrowth in Biscayne Bay (FTBG), and also entered in the online Macroalgal and explore the geographical distribution of the Herbarium Portal (macroalgae.org) where images of species elsewhere in the Gulf of Mexico (GoMX) the specimens were made available.

227 J.T. Melton et al.

Figure 2. Collection sites of Ulva ohnoi in the GoMX and Atlantic Florida (represented by black dots) made in ArcGIS (ESRI 2009). The collection site of the sample collected from Yucatan, MX, was excluded from the map since the exact collection site is unknown.

Table 2. GenBank Accession numbers of sequences of Ulva ohnoi used in this study. Molecular Location Source GenBank Accession Numbers Marker rbcL Hawaiian Islands O’Kelly et al. 2010 GU138241, GU138242, GU138250, GU138260, GU138264, GU138284 Japan Hiraoka et al. 2004b AB116035, AB116036, AB116037, AB116038, AB116039, AB116040 tufA Australia Kirkendale et al. 2013 JN029331, JN029332, JN029333, JN029334, JN029335, JN029330, JN029329, JN029328, Lawton et al. 2013 KF195524, KF195549, KF195522, KF195533, KF195534, KF195523, KF195531, KF195540, KF195541, KF195552, KF195536, KF195539, KF195542, KF195532, KF195550 ITS1 Australia Lawton et al. 2013 KF195496, KF195489, KF195495, KF195504, KF195506, KF195497, KF195514, KF195501, KF195499, KF195488, KF195515 Hawaiian Islands O’Kelly et al. 2010 GU138367, GU138350, GU138346, GU138327, GU138323, GU138312, GU138304, GU138295 Italy Flagella et al. 2010 GU121401 Japan Hiraoka et al. 2004b AB116034, AB116033, AB116032, AB116031, AB116030, AB116029

rbcL and ITS1, 3.625 l PCR water, 2.5 l 5x DNA extraction and sequencing reaction buffer, 0.75 l of 50mM MgCl2, 2 l dNTP’s, This investigation involved molecular analyses of 33 0.5 l of 10mM forward primer, 0.5 l of 10mM distromatic blades. DNA was extracted from samples reverse primer, 0.125 l Mango Taq polymerase, 2.5 desiccated in silica gel using the OMEGA E.Z.N.A. l of 0.5M Betaine, and 1 l of genomic DNA were Plant DNA Extraction Kit (Omega Bio-tek Inc., GA, used for amplification. The PCR conditions of all primer USA). RbcL and ITS1 were amplified by PCR combinations consisted of an initial denaturation at (polymerase chain reaction) with MangoTaq (Bioline 94C for 5 min, followed by 35 cycles of 94C for 1 US Inc., MA, USA) with the primers in Table 1. For min, annealing at 45C for 1 min, extension at 72C

228 Ulva ohnoi: a new report in the Western Atlantic for 2 min, followed by a final extension of 5 min at nature of U. ohnoi in the GoMX and Atlantic Florida 72C. The tufA marker was amplified following would remain questionable until more samples and/or Saunders and Kucera (2010). The resulting PCR more molecular markers suitable for population products were visualized by gel electrophoresis. genetics can be tested. Bands at the appropriate length were cut from the gel and extracted with the OMEGA gel extraction Nutrient analysis kit (Omega Bio-tek Inc., Georgia, USA). After measuring the concentration of DNA with a NanoDrop Three macrophyte species were collected at Deering ND-1000 Spectrophotometer (Thermo Fisher Estate, Biscayne Bay, FL, USA, to compare their Scientific, Waltham, MA, USA), DNA products with concentration of nitrogen (N) and phosphorous (P); concentrations of approximately 7 ng/l or greater further, δ 15N was estimated to detect the potential were sent to AGTC at the University of Kentucky anthropogenic signature of the incorporated nitrogen (UK) to be sequenced on a Sanger platform. by the macrophytes. The seagrass Thalassia testudinum K. D. Koenig, 1805, the dominant species Molecular analyses in the area (Lirman et al. 2014), Anadyomene stellata, a persistent blooming species in the area Sequences were edited and assembled in Geneious R7 (Collado-Vides et al. 2013), and Ulva ohnoi, an (Kearse et al. 2012). A total of 23, 26, and 20 ephemeral but blooming species in the area (this sequences of rbcL, tufA, and ITS1, respectively, study), were analyzed. Samples in triplicate for each from the GoMX and Atlantic Florida were used species were collected by hand and stored in a cooler along with sequences from previously published with ice until processed. In the laboratory, each sequences. GenBank Accession numbers of samples sample was examined for epiphytes and invertebrates, from this study can be found in Table S1. GenBank cleaned, dried at 60 °C for 48 h, ground using a Accession numbers of previously published Ulva Fritsch Analysette 3 Spartan grinder, and stored in ohnoi sequences can be found in Table 2, and other 10 ml vials. Elemental P tissue content was measured GenBank Accession numbers, including out-groups, by the dry-oxidation-acid hydrolysis extraction can be found in Table S2. Alignments were made with followed by a colorimetric analysis of phosphate MUSCLE (Edgar 2004) implemented in Geneious. A concentration method in the Seagrass Laboratory at maximum likelihood (ML) analysis was performed Florida International University, and expressed as on each dataset separately with MEGA6 using a elemental P% dry weight (P%DW) (Fourqurean et al. 1992). Estimation of 14N and 15N was performed GTR + G model of evolution and 1000 bootstrap using the Thermo Delta C EA-IRMS (elemental replicates (Tamura et al. 2013). TCS haplotype analyzer isotope ratio mass spectrometry) system in networks (Clement et al. 2002) for tufA and ITS1 the Nutrient Analysis Laboratory at Florida were made using POPART (Leigh and Bryant 2015). International University (Fourqurean et al. 2005). The EA combusted the organic material and reduced Nonindigenous species (NIS) investigation the formed gases into N2, which were then measured in a continuous flow mode in the IRMS. The Sequences of Ulva ohnoi from the GoMX and isotopic ratios, or relative abundance of the heavier Atlantic coast of Florida were compared to the isotope 15N to 14N per sample (R), are reported in the global genetic diversity of this species to assess the delta standard notation (‰) native or nonindigenous nature of this species. We considered three previously used different options 15 3 for results of this part of the study (as in Heesch et δ N = [(Rsample – Rreference) –1] × 10 al. 2009; Couceiro et al. 2011; Kirkendale et al. 15 14 2013): 1) If the genetic diversity was greater in the where R is the ratio of N/ N, and the reference is GoMX and Atlantic coast of Florida than the global atmospheric nitrogen (Air N2) (Peterson and Fry 1987). pool, then U. ohnoi from our study area would be considered as a source pool for the global diversity; Statistical analysis 2) If the genetic diversity was greater in the global pool, then U. ohnoi would be considered as All data were tested for homogeneity of variance nonnative to the GoMX and Atlantic Florida; 3) If using the Levene’s test. If homogeneity of variance there was no difference in the genetic diversity in the was met, an analysis of variance (ANOVA) was global pool compared to the GoMX and Atlantic applied if more than two species were compared, and Florida samples, then the native or nonindigenous significant differences between species were detected

229 J.T. Melton et al.

Figure 3. Variation in forms of Ulva ohnoi collected from the Gulf of Mexico and Atlantic coast of Florida. The scale bars represent 2 cm. Specimens (TM collection numbers) were archived at The University of Alabama Herbarium (UNA) and Fairchild Tropical Botanic Garden (FTBG). The main forms were specimens with: (A) an attached blade with a few marginal reticulations or perforations (TM391); (B) a perforated, free-floating blade (TM291); (C) blades forming a small rosette (TM306); and (D) an attached blade without reticulations or perforations (TM293). Photographs by James T. Melton III.

230 Ulva ohnoi: a new report in the Western Atlantic

Figure 4. Maximum likelihood phylogenetic tree run with 1000 bootstraps based on 1310 bp of the chloroplast-encoded rbcL molecular marker. Other samples with rbcL sequences 100% identical to the Ulva ohnoi sequences from the Gulf of Mexico and Atlantic Florida not included in the phylogenetic tree include the following collection numbers: TM210, TM145, TM150, TM162, TM182, TM184, TM308, TM316, TM325, TM348, TM366, TM387B, TM391, TM392, TM393, TM232, TM253, TM297.

using a posthoc Tukey test. A t-test was applied to (Figure 3). Overgrowths of this species were present compare means between the two species when in Deering Estate, Biscayne Bay, FL, in Florida Bay, homogeneity of variance was met. Three values for FL, and near Brazos Santiago Pass, South Padre each species were recorded for P%DW. Only two Island, TX. values were obtained for the N%DW and δ15N‰ The rbcL alignment consisted of 1310 bp, and the analysis of Thalassia testudinum; therefore, no ML phylogenetic tree (Figure 4) showed a mono- statistical analysis was performed for this species. phyletic clade formed by sequences from this Three values for Anadyomene stellata and Ulva ohnoi research and previously published sequences of Ulva were recorded for N% DW and δ15N‰. ohnoi. The rbcL sequence from the sample of the overgrowth from Biscayne Bay, FL, and 22 other rbcL sequences of samples from the GoMX and Results Atlantic Florida were identical to all previously Molecular identification published rbcL sequences of U. ohnoi from Japan (six sequences; Hiraoka et al. 2004b) and the All DNA sequences of rbcL, tufA, and ITS1 corres- Hawaiian Islands (six sequences; O’Kelly et al. 2010). ponded to sequences of Ulva ohnoi M. Hiraoka & S. This included the rbcL sequence of the type specimen Shimada, 2004. The specimens of U. ohnoi showed from Japan (AB116040). The genetic distances of a range of morphologies of free-floating and attached the rbcL sequences used in this investigation are blades, i.e., rosettes, perforated and reticulated blades provided as supplemental material (Table S3).

231 J.T. Melton et al.

Haplotype 1 (10 sequences): TM210 AL (GoMX) TM145 FL (GoMX) TM266 TX (GoMX) KF195532 Australia Haplotype 3 (3 sequences): JN029328 Australia

Haplotype 2 (33 sequences): TM184 FL (GoMX) TM285 TX (GoMX) MX2 Mexico (GoMX) TM393 FL (Atlantic) JN029329 Australia

Figure 5. A TCS haplotype network of 46 sequences of tufA (773 bp) from Ulva ohnoi samples from the GoMX and Atlantic Florida (23 sequences represented by the collection number) and Australia (23 sequences). The size of the black circle is representative of the number of sequences for each haplotype, and a hash mark represents one change in a base pair. The other sequences for each of the three haplotypes are as follows: haplotype 1 – TM182, TM209, TM253, TM232, TM80, KF195550; haplotype 2 – TM316, TM291, TM293, TM294, TM279, TM197, TM366, TM297, TM348, TM306, TM192, JN029331, JN029332, JN029333, JN029334, JN029335, KF195524, KF195549, KF195522, KF195533, KF195534, KF195523, KF195531, KF195540, KF195541, KF195552, KF195536, KF195539; haplotype 3 – JN029330, KF195542. The sample from Florida Bay was left out of this analysis since the haplotype could not be determined due to length of the sequence.

Haplotype 5 (6 sequences): TM210 AL (GoMX) TM162 FL (GoMX) TM232 TX (GoMX) KF195496 Australia

Haplotype 3 (36 sequences): BiscayneBay1 FL (Atlantic) TM197 FL (GoMX) TM279 TX (GoMX) Haplotype 1 (1 sequence): AB116034 Japan KF195504 Australia GU138367 Hawaiian Islands GU121401 Naples, Italy KF195495 Australia

Haplotype 2 (2 sequences): KF195506 Australia

Haplotype 4 (2 sequences): KF195489 Australia

Figure 6. A TCS haplotype network of 47 sequences of ITS1 (178 bp) from Ulva ohnoi samples from the Gulf of Mexico and Atlantic Florida (19 sequences represented by the collection number), Japan (6 sequences), the Hawaiian Islands (8 sequences), Australia (12 sequences), and Naples, Italy (1 sequence). The size of the black circle is representative of the number of sequences for each haplotype, and a hash mark represents one change in a base pair. The other sequences for each of the five haplotypes are as follows: haplotype 1 – only one representative; haplotype 2 – KF195505; haplotype 3 – TM387B, TM184, TM392, TM285, TM393, TM348, TM366, TM192, TM316, TM325, TM391, TM281, TM308, AB116033, AB116032, AB116031, AB116030, AB116029, GU138350, GU138346, GU138327, GU138323, GU138312, GU138304, GU138295, KF195497, KF195514, KF195501, KF195499; haplotype 4 – KF195488; haplotype 5 – TM182, KF195515.

232 Ulva ohnoi: a new report in the Western Atlantic

A total of 26 tufA sequences of Ulva ohnoi were recovered from samples from the GoMX (21 Table 3. Nutrient tissue content (P%DW: percentage of elemental sequences) and Atlantic Florida (five sequences). In phosphorus dry weight; N%DW: percentage of elemental nitrogen addition to 23 sequences from previous research in dry weight; and δ15N: 15N/14N in a delta standard notation) of three species of subaquatic vegetation (Anadyomene stellata, Ulva Australia, a 773 bp alignment was formed. The tufA ohnoi, and Thalassia testudinum) collected at Deering Estate, molecular marker was slightly more variable in Biscayne Bay, FL. For P%DW, means sharing the same sequence divergence than rbcL. Three Australian superscript did not differ significantly (Tukeys test, P > 0.05). haplotypes were represented by KF195532 (haplotype 1), JN029329 (haplotype 2), and JN029328 (haplotype A. stellata Min Max Mean 3) (Figure 5). Two haplotypes were present in the P%DW 0.01 0.02 0.02a GoMX and Atlantic Florida sequences. The two haplo- N%DW 1.71 2.04 1.83 types from this study were identical to the haplotypes δ15N‰ 7.56 8.09 7.8 represented by KF195532 (haplotype 1) and JN029329 (haplotype 2). Haplotype 2 only varied by a single base U. ohnoi Min Max Mean pair from haplotype 1 and haplotype 3, while haplo- P%DW 0.11 0.16 0.13b type 1 and 3 differed by two base pairs from each N%DW 1.39 2.32 1.93 other. A phylogenetic tree of the tufA sequences and δ15N‰ 11.45 15.08 13.15 their genetic distances are provided as supplemental material (Figure S1 and Table S4, respectively). T. testudinum Min Max Mean An alignment of 47 sequences of ITS1 (178 bp) P%DW 0.13 0.18 0.16b of Ulva ohnoi from the GoMX and Atlantic Florida N%DW 2.46 2.55 2.51 (20 sequences) and previous research (Japan: six, δ15N‰ 0.83 5.31 3.07 Hawaiian Islands: eight, Australia: 12, Italy: one) was used for phylogenetic inference (Figure S2) and to form a haplotype network (Figure 6). This molecular marker was the most variable in this investigation. A total of five haplotypes of ITS1 were recorded for Thalassia testudinum. A t-test were found from previous research. All five of these (df = 4) was applied for U. ohnoi and A. stellata. No haplotypes were found in 12 sequences from significant difference was found for mean N%DW Australia, which were represented by KF195504 (p > 0.743) between the two species; however, δ15N‰ (haplotype 1), KF195506 (haplotype 2), KF195495 was significantly higher in U. ohnoi (p < 0.007). (haplotype 3), KF195489 (haplotype 4), and The average values for T. testudinum were higher for KF195496 (haplotype 5). All sequences from Japan N%DW and lower for δ15N‰ compared to the (six sequences) and the Hawaiian Islands (eight values of the other two species; however, these sequences) were exact matches to haplotype 3 from differences were not statistically tested due to the Australia. Two haplotypes were present in the small number of samples of T. testudinum (Table 3). samples from the GoMX and Atlantic Florida. These two haplotypes were exact matches to the haplotypes represented by KF195495 (haplotype 3) and Discussion KF195496 (haplotype 5). Haplotype 3 was present in the GoMX and Atlantic Florida, and haplotype 5 Our study reports Ulva ohnoi M. Hiraoka & S. was only found in samples from the northern GoMX. Shimada, 2004, in the Gulf of Mexico and Atlantic Genetic distances of these samples are provided as coast of Florida for the first time. This species was supplemental material (Table S5). not previously reported in recent species checklists for this area (Dawes and Mathieson 2008; Littler et Nutrient analysis al. 2008; Fredericq et al. 2009; Wynne 2011), or local surveys in Biscayne Bay (Biber and Irlandi 2006; Significant differences were found for P%DW Collado-Vides et al. 2011). U. ohnoi was common on between species (ANOVA, F2,6 = 43.75, p< 0.001) jetties and in bays and lagoons throughout most of with significantly lower values for Anadyomene the GoMX and Atlantic coast of Florida. The new stellata compared to the other two species. The range of this species now includes Mexico, Texas, means values for Thalassia testudinum and Ulva Alabama, and Florida. Overgrowths of this species ohnoi did not differ significantly (Table 3). were noted in Deering Estate, Biscayne Bay, FL, near Three values of N and δ 15N‰ were obtained for Brazos Santiago Pass, South Padre Island, TX, and Ulva ohnoi and Anadyomene stellata, and two values in Florida Bay, FL.

233 J.T. Melton et al.

Ulva ohnoi was first reported blooming in Tosa Vides 2006; Geller et al. 2010). It is well documented Bay, Japan, as “Ulva sp.” (Ohno 1988). In 2004 that species of Ulva are able to metabolize different Ulva ohnoi was described from this site based on a sources of N from the environment (Teichberg et al. molecular study of rbcL and ITS1-5.8S-ITS2, a 2007) resulting in the formation of large green tides morphological analysis, and cross breeding tests, (Buapet et al. 2008), and can increase their growth which showed that this species is reproductively rate rapidly as nutrients become available (Pérez- isolated from two of its closest relatives, Ulva fasciata Mayorga et al. 2011). Therefore, Ulva species have a Delile, 1813, and Ulva reticulata Forsskål, 1775, high potential for introduction and invasiveness if and also is distinct from the closely related asexual they arrive to altered environments with high species Ulva spinulosa Okamura & Segawa, 1936 availability of nutrients. In this study from Biscayne (Hiraoka et al. 2004a,b). Subsequent work has also Bay, U. ohnoi showed a high affinity for nutrients, detected U. ohnoi in other localities around Japan particularly for 15N, compared with the seagrass (Kawai et al. 2007; Yabe et al. 2009), South Korea Thalassia testudinum, and more importantly, higher (Wang et al. 2010), Australia (Kirkendale et al. than the bloom-forming green alga Anadyomene stellata. 2013; Lawton et al. 2013), and the Hawaiian Islands Due to their high affinity for N, Ulva species have (O’Kelly et al. 2010). This species has also been been used as indicators of nutrient pollution in identified in ballast water from ships in the Medi- coastal waters (Teichberg et al. 2010; Orlandi et al. terranean Sea; however, colonization by this species 2014). Areas affected by anthropogenic nutrient has not been detected in this area (Flagella et al. 2010). input can have δ15N%o values as high as 14.4%o in Since the genetic diversity of tufA and ITS1 was Boston Harbor, MA, USA, near the sewage effluent greater in the global pool than in the GoMX and from treatment facilities (Tucker et al. 1999), 15%o Atlantic Florida isolates, the hypothesis that Ulva at Narragansett Bay, RI, USA (Pruell et al. 2006), ohnoi is nonnative in the GoMX and Atlantic 13%o in areas affected by sewage and groundwater Florida was supported. Additionally, the phylogenetic discharges in east central Florida (Barile 2004), and trees based on tufA and ITS1 showed that earlier 10%o from areas that were highly affected by diverging haplotypes of U. ohnoi were not present in nutrient discharges on the Ivory Coast (Granger et the GoMX and Atlantic Florida, which provides al. 2012). Thus, the high δ15N (up to 15%o) of Ulva further evidence that this species is non-native. ohnoi in this study indicates heavy nutrient enrichment Performing molecular work on historical herbarium of Biscayne Bay, which likely is facilitating the rapid vouchers that have previously been collected from growth of this species. this area would provide insights into how long this The ecological and economic effects that green species has been present. The sample collected from tides can have on coastal ecosystems are well Yucatan, Mexico, in 1999 and the broad distribution documented (Valiela et al. 1997; Teichberg et al. throughout the GoMX and most of Atlantic Florida 2010; Wang et al. 2009). The occurrences of green indicates the introduction of U. ohnoi to the GoMX coenocytic algal blooms, such as Codium isthmo- and Atlantic Florida is not recent. It would not be cladum Vickers, 1905, and Caulerpa brachypus f. surprising if U. ohnoi was widely introduced to the parvifolia (Harvey) A.B. Cribb, 1958, have been Western Atlantic by a shipping vector given that this reported in the Caribbean and south Florida coral species has been documented to be transported in reef systems linked with increase in nutrient ballast water (Flagella et al. 2007; Flagella et al. availability with several ecological costs (Lapointe 2010). Further studies are needed to investigate the 1997; Lapointe et al. 2005; Lapointe and Bedford distribution of this species in the Western Atlantic. 2010). On a local basis, the single cell layer blade Ulva species are notorious for their ability to form Anadyomene spp. bloom in Biscayne Bay has already green tides (Largo et al. 2004; Leliaert et al. 2009). negatively affected seagrass beds due to coverage of The green tides of Ulva ohnoi in Japan, reported as up to 75% for more than 10 years making this bloom Ulva sp. 1 in Hiraoka et al. (2004a), that occurred a major threat to this bay (Collado-Vides et al. during the summer months in bays in Kochi and 2013). The presence of Ulva ohnoi, a simple two- Hakata reached their greatest biomass in mid-August. cell layer blade, could add stress to the fragile The localized overgrowth in Biscayne Bay, FL, seagrass ecosystems of the bay. Furthermore, the occurred during July 2013. Rapid and massive growth, overgrowths of U. ohnoi near Brazos Santiago Pass, the ability to asexually reproduce (including by TX, in 2013 and more recently the overgrowth of in fragmentation), and opportunistic usage of resources Florida Bay, FL, highlight this species’ capacity to are some characteristics of an invasive species bloom and the need to be monitored, especially if it (Andreakis and Schaffelke 2012; Ruesink and Collado- becomes invasive.

234 Ulva ohnoi: a new report in the Western Atlantic

While Ulva blooms may be considered as a Coat G, Dion P, Noailles M-C, De Reviers B, Fontiane J-M, Berger- nuisance, many Ulva species have been studied as Perrot Y, Loiseaux-De Goer S (1998) Ulva armoricana (Ulvales, Chlorophyta) from the coasts of Brittany (France). II. biofilters (Msuya et al. 2005; Neori et al. 2003; Mata Nuclear rDNA ITS sequence analysis. European Journal of et al. 2010). Ulva ohnoi was specifically identified Phycology 33: 81–86, http://dx.doi.org/10.1080/09670269810001736563 as a strong suitor to be used in the bioremediation of Collado-Vides L, Mazzei V, Thyberg T, Lirman D (2011) aquaculture wastewater in Australia due to its fast Spatiotemporal patterns of macroalgal diversity and abundance at a heavily managed estuary, Biscayne Bay, Florida, USA. growth rates and broad geographical distribution Botanica Marina 54: 377–390, http://dx.doi.org/10.1515/bot.2011.046 (Lawton et al. 2013), and thus, could be an ecologically Collado-Vides L, Avila C, Blair S, Leliaert F, Rodriguez D, Thyberg important species in the Western Atlantic. T, Schneider S, Rojas J, Sweeney P, Drury C, Lirman D (2013) A persistent bloom of Anadyomene Lamouroux species (Anadyomenaceae, Chlorophyta) in Biscayne Bay, Florida. Acknowledgements Aquatic Botany 111: 95–103, http://dx.doi.org/10.1016/j.aquabot. 2013.06.010 Funds for this investigation were provided by The National Science Couceiro L, Cremades J, Barreiro R (2011) Evidence for multiple Foundation through Assembling The Tree of Life for Green Algae introductions of the Pacific green alga Ulva australis Areschoug GRAToL (DEB 1036495) and the Department of Biological Sciences (Ulvales, Chlorophyta) to the Iberian Peninsula. Botanica at The University of Alabama. We express gratitude to the reviewers Marina 54: 391–402, http://dx.doi.org/10.1515/bot.2011.044 for providing helpful feedback in completing this manuscript. A Dawes CJ, Mathieson AC (2008) The seaweeds of Florida. special thanks goes to F. Leliaert, A. Tronholm, D.W. Lam, G. Garcia- Gainesville, Florida: University Press of Florida, pp 30–35 Soto, M. S. DePriest, D. Ward, M. Allen, and N. Sturm for their field Edgar RC (2004) MUSCLE: multiple sequence alignment with high and lab help. We would like to thank F. Gurgel for providing the accuracy and high throughput. Nucleic Acids Research 32: Ulva sample from Yucatan, Mexico. We also want to extend regards 1792–97, http://dx.doi.org/10.1093/nar/gkh340 to the Biscayne Bay Aquatic Preserve for their support monitoring ESRI (Environmental Systems Resource Institute) (2009) ArcMap the bay, and C. Fernandez for the collections from Florida Bay. This 9.2. ESRI, Redlands, California is contribution number 787 from the Southeast Environmental Flagella MM, Verlaque M, Soria A, Bula MC (2007) Macroalgal Research Center at Florida International University. survival in ballast water tanks. Marine Pollution Bulletin 54: 1395–401, http://dx.doi.org/10.1016/j.marpolbul.2007.05.015 Flagella MM, Andreakis N, Hiraoka M, Verlaque M, Buia MC References (2010) Identification of cryptic Ulva species (Chlorophyta, Ulvales) transported in ballast water. Journal of Biological Andreakis N, Schaffelke B (2012) Invasive Marine Seaweeds: Pest Research-Thessaloniki 13: 47–57 or Prize? In: Wiencke C, Bischof K (eds), Seaweed Biology. Fourqurean JW, Zieman JC, Powell GVN (1992) Phosphorus Springer Berlin Heidelberg, pp 235–262, http://dx.doi.org/10.1007/ limitation of primary production in Florida Bay: evidence from 978-3-642-28451-9_12 C:N:P ratios of the dominant seagrass Thalassia testudinum. Barile PJ (2004) Evidence of anthropogenic nitrogen enrichment of Limnology and Oceanography 37: 162–171, http://dx.doi.org/ the littoral waters of east central Florida. Journal of Coastal 10.4319/lo.1992.37.1.0162 Research 20: 1237–1245, http://dx.doi.org/10.2112/04-0212.1 Fourqurean JW, Escorcia SP, Anderson WT, Zieman JC (2005) Bast F, John AA, Bhushan S (2014) Strong Endemism of Bloom- Spatial and seasonal variability in elemental content, δ13C, and Forming Tubular Ulva in Indian West Coast, with Description δ15N of Thalassia testudinum from South Florida and its of Ulva paschima Sp. Nov. (Ulvales, Chlorophyta). PLoS ONE implications for ecosystem studies. Estuaries 28: 447–461 9: e109295, http://dx.doi.org/10.1371/journal.pone.0109295 Fredericq S, Cho TO, Earle SA, Gurgel CF, Krayesky DM, Mateo- Blomster J, Bäck S, Fewer DP, Kiirikki M, Lehvo A, Maggs CA, Cid LE, Mendoza-González, Norris JN, Suárez AM (2009) and Stanhope MJ (2002) Novel Morphology in Enteromorpha Seaweeds of the Gulf of Mexico. In: Felder DL, Camp DK (eds) (Ulvophyceae) Forming Green Tides. American Journal of Gulf of Mexico Origin, Waters, and Biota Volume 1, Botany 89: 1756–1763, http://dx.doi.org/10.3732/ajb.89.11.1756 Biodiversity. Texas A&M University Press, College Station, Biber PD, Irlandi EA (2006) Temporal and spatial dynamics of TX, pp 187–259 macroalgal communities along an anthropogenic salinity Geller JB, Darling JA, Carlton JT (2010) Genetic Perspectives on gradient in Biscayne Bay (Florida, USA). Aquatic Botany 85: Marine Biological Invasions. Annual Review Marine Science 2: 65–77, http://dx.doi.org/10.1016/j.aquabot.2006.02.002 367–93, http://dx.doi.org/10.1146/annurev.marine.010908.163745 Booth D, Provan J, Maggs CA (2007) Molecular approaches to the Granger S, Agboga K, Comoe K, Fields L, Issah A, Koffi MN, study of invasive seaweeds. Botanica Marina 50: 385–396, Kanakoundu JMK, Nixon S, et al. (2012) Determining The http://dx.doi.org/10.1515/bot.2007.043 Origin And Ecology Of A Macroalgae (Ulva clathrata) Bloom Boudouresque CF, Verlaque M (2002) Biological pollution in the Along The Coast Of Western Ghana And Cote d'Ivoire. USAID Mediterranean Sea: invasive versus introduced macrophytes. Integrated Coastal and Fisheries Governance Initiative for the Marine Pollution Bulletin 44: 32–38, http://dx.doi.org/10.1016/S0025- Western Region, Ghana, pp 18 326X(01)00150-3 Buapet P, Hiranpan R, Ritchie RJ, Prathep A (2008) Effect of Guidone M, Thornber C, Wysor B, O'Kelly CJ (2013) Molecular and nutrient inputs on growth, chlorophyll, and tissue nutrient morphological diversity of Narragansett Bay (RI, USA) Ulva concentration of Ulva reticulata from a tropical habitat. (Ulvales, Chlorophyta) populations. Journal of Phycology 49: ScienceAsia 34: 245–252, http://dx.doi.org/10.2306/scienceasia1513- 979–995, http://dx.doi.org/10.1111/jpy.12108 1874.2008.34.245 Guiry MD, Guiry GM (2015) AlgaeBase. World-wide electronic Caccia VG, Boyer J (2007) A nutrient loading budget for Biscayne publication, National University of Ireland, Galway. Bay. Florida Marine Pollution Bulletin 54: 994–1008, http://www.algaebase.org (accessed 15 April 2015) http://dx.doi.org/10.1016/j.marpolbul.2007.02.009 Hayden HS, Waaland JR (2002) Phylogenetic systematics of the Clement M, Snell Q, Walke P, Posada D, Crandall K (2002) TCS: Ulvaceae (Ulvales, Ulvophyceae) using chloroplast and nuclear estimating gene genealogies. In: Proceedings 16th International sequences. Journal of Phycology 38: 1200–1212, http://dx.doi.org/ Parallel and Distributed Processing Symposium, pp 184, 10.1046/j.1529-8817.2002.01167.x http://dx.doi.org/10.1109/ipdps.2002.1016585

235 J.T. Melton et al.

Heesch S, Broom JES, Neill KF, Farr TJ, Dalen JL, Nelson WA Lin DT and Fong P (2010) Macroalgal bioindicators (growth, tissue (2009) Ulva, Umbraulva and Gemina: genetic survey of New N, d15N) detect nutrient enrichment from shrimp farm effluent Zealand taxa reveals diversity and introduced species. European entering Opunohu Bay, Moorea, French Polynesia. Marine Journal of Phycology 44: 143–154, http://dx.doi.org/10.1080/096702 Pollution Bulletin 56: 245–249, http://dx.doi.org/10.1016/j.marpolbul. 60802422477 2007.09.031 Hiraoka M, Ohno M, Kawaguchi S, Yoshida G (2004a) Crossing test Lirman D, Thyberg T, Santos R, Schopmeyer S, Drury C, Collado- among floating Ulva thalli forming “green tide” in Japan. Vides L, Bellmund S, Serafy J (2014) SAV Communities of Hydrobiologia 512: 239–245, http://dx.doi.org/10.1023/B:HYDR.0000 Western Biscayne Bay, Miami, Florida, USA: Human and 020332.12641.a2 Natural Drivers of Seagrass and Macroalgae Abundance and Hiraoka M, Shimada S, Uenosono M, Masuda M (2004b) A new Distribution Along a Continuous shoreline. Estuaries and green-tide-forming alga, Ulva ohnoi Hiraoka et Shimada sp. Coasts 37: 1243–1255, http://dx.doi.org/10.1007/s12237-014-9769-6 nov. (Ulvales, Ulvophyceae) from Japan. Phycological Research Littler DS, Littler MM, Hanisak MD (2008) Submersed Plants of the 51: 17–29, http://dx.doi.org/10.1111/j.1440-1835.2004.tb00311.x Indian River Lagoon. A Floristic Inventory & Field Guide. Hiraoka M, Ichihara K, Zhu W, Ma J, Shimada S (2011) Culture and Offshore Graphics Inc., Washington, D.C., pp 179–190 Hybridization Experiments on an Ulva Clade Including the Liu D, Keesing JK, Xing Q, Shi P (2009) World's largest macroalgal Qingdao Strain Blooming in the Yellow Sea. PLoS ONE 6: bloom caused by expansion of seaweed aquaculture in China. e19371, http://dx.doi.org/10.1371/journal.pone.0019371 Marine Pollution Bulletin 58: 888–895, http://dx.doi.org/10.1016/j. Hofmann LC, Nettleton JC, Neefus CD, Mathieson AC (2010) marpolbul.2009.01.013 Cryptic diversity of Ulva (Ulvales, Chlorophyta) in the Great Malta E-J, Draisma SGA, Kamermans P (1999) Free-floating Ulva Bay Estuarine System (Atlantic USA): introduced and indigenous in the southwest Netherlands: species or morphotypes? A distromatic species. European Journal of Phycology 45: 230– morphological, molecular and ecological comparison. European 239, http://dx.doi.org/10.1080/09670261003746201 Journal of Phycology 34: 443–454, http://dx.doi.org/10.1080/095414 Kawai H, Shimada S, Hanyuda T, Suzuki T, Gamagori City Office 49910001718801 (2007) Species Diversity and Seasonal Changes of Dominant Manhart JR (1994) Phylogenetic analysis of green plant rbcL Ulva Species (Ulvales, Ulvophyceae) in Mikawa Bay, Japan, sequences. Molecular Phylogenetics and Evolution 3: 114–127, Deduced form ITS2 rDNA Region Sequences. Algae 22: 221– http://dx.doi.org/10.1006/mpev.1994.1014 Mata L, Schuenhoff A, Stantos R (2010) A direct comparison of the 228, http://dx.doi.org/10.4490/ALGAE.2007.22.3.221 Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, performance of the seaweed biofilters, Asparagopsis armata and Sturrock S, et al. (2012) Geneious Basic: an integrated and Ulva rigida. Journal of Applied Phycology 22: 639–644, http://dx.doi.org/10.1007/s10811-010-9504-z extendable desktop software platform for the organization and Mineur F, Johnson MP, Maggs CA (2008) Macroalgal Introductions analysis of sequence data. Bioinformatics 28: 1647–1649, by Hull Fouling on Recreational Vessels: Seaweeds and Sailors. http://dx.doi.org/10.1093/bioinformatics/bts199 Kirkendale L, Saunders GW, Winberg P (2013) A molecular survey Environmental Management 42: 667–676, http://dx.doi.org/10.1007/ s00267-008-9185-4 of Ulva (Chlorophyta) in temperate Australia reveals enhanced Msuya FE, Kyewalyanga MS, Salum D (2005) The performance of levels of cosmopolitanism. Journal of Phycology 49: 69–82, the seaweed Ulva reticulata as a biofilter in a low-tech, low- http://dx.doi.org/10.1111/jpy.12016 Lapointe BE (1997) Nutrient thresholds for bottom-up control of cost, gravity generated water flow regime in Zanzibar, Tanzania. macroalgal blooms on coral reefs in Jamaica and southeast Aquaculture 254: 284–292, http://dx.doi.org/10.1016/j.aquaculture. 2005.10.044 Florida. Limnology and Oceanography 42: 1119–1131, Neori A, Msuya FE, Shauli L, Schuenhoff A, Kopel F, Shpigel M http://dx.doi.org/10.4319/lo.1997.42.5_part_2.1119 Lapointe BE, Barile PJ, Littler MM, Littler DS (2005) Macroalgal (2003) A novel three-stage seaweed (Ulva lactuca) biofilter blooms on southeast Florida coral reefs: II. Cross-shelf design for integrated mariculture. Journal of Applied Phycology discrimination of nitrogen sources indicates widespread 15: 543–553, http://dx.doi.org/10.1023/B:JAPH.0000004382.89142.2d assimilation of sewage nitrogen. Harmful Algae 4: 1106–1122, Norris JN (2010) Marine Algae of the Northern Gulf of California: http://dx.doi.org/10.1016/j.hal.2005.06.002 Chlorophyta and Phaeophyceae. Smithsonian Institution Lapointe BE, Bedford B, Brand L, Yentsch CS (2006) Phase II Final Scholarly Press, Washington, D.C., 31 pp Report. Harmful Algal Blooms in Coastal Waters of Lee Ohno M (1988) Seasonal changes of the growth of green algae, Ulva County, FL: Bloom Dynamics and Identification of Land-Based sp. in Tosa Bay, southern Japan. Marine Fouling 7: 13–17, Nutrient Sources. http://www.sarasota.wateratlas.usf.edu/upload/documents/ http://dx.doi.org/10.4282/sosj1979.7.13 O'Kelly CJ, Kurihara A, Shipley TC, Sherwood AR (2010) HABs_lee_cty_report.pdf (Accessed 10 July 2015) Lapointe BE, Bedford BJ (2010) The ecology and nutrition of Molecular assessment of Ulva spp. (Ulvophyceae, Chlorophyta) invasive Caulerpa brachypus f. parvifolia blooms on coral reefs in the Hawaiian Islands. Journal of Phycology 46: 728–735, http://dx.doi.org/10.1111/j.1529-8817.2010.00860.x off southeast Florida, USA. Harmful Algae 9: 1–12, Orlandi L, Bentivoglio F, Carlino P, Calizza E, Rossi D, Costantini http://dx.doi.org/10.1016/j.hal.2009.06.001 Largo DB, Sembrano J, Hiraoka M, Ohno M (2004) Taxonomic and ML, Rossi L (2014) d15N variation in Ulva lactuca as a proxy ecological profile of “green tide” species of Ulva (Ulvales, for anthropogenic nitrogen inputs in coastal areas of Gulf of Chlorophyta) in central Philippines. In: Ang PO Jr. (ed), Asian Gaeta (Mediterranean Sea). Marine Pollution Bulletin 84: 76– Pacific Phycology in the 21st Century: Prospects and 82, http://dx.doi.org/10.1016/j.marpolbul.2014.05.036 Pérez-Mayorga DM, Ladah LB, Zertuche-González JA, Leichter JJ, Challenges, pp 247–253, http://dx.doi.org/10.1007/978-94-007-0944-7_32 Lawton RJ, Mata L, de Nys R, Paul NA (2013) Algal Filonov AE, Lavín MF (2011) Nitrogen uptake and growth by Bioremediation of Waste Waters from Land-Based Aquaculture the opportunistic macroalga Ulva lactuca (Linnaeus) during the Using Ulva: Selecting Target Species and Strains. PLoS ONE 8: internal tide. Journal of Experimental Marine Biology and Ecology 406: 108–115, http://dx.doi.org/10.1016/j.jembe.2011.05.028 e77344, http://dx.doi.org/10.1371/journal.pone.0077344 Leigh JW, Bryant D (2015) POPART: full-feature software for Peterson BJ, Fry B (1987) Stable isotopes in ecosystem studies. haplotype network construction. Methods in Ecology and Annual Review of Ecological Systematics 18: 293–320, http://dx.doi.org/10.1146/annurev.es.18.110187.001453 Evolution 6: 1110–1116, http://dx.doi.org/10.1111/2041-210X.12410 Pruell RJ, Taplin BK, Lake JL, Jayaraman S (2006) Nitrogen isotope Leliaert F, Zhang X, Ye N, Malta E-J, Engelen AH, Mineur F, ratios in estuarine biota collected along a nutrient gradient in Verbruggen H, De Clerck O (2009) Identity of the Qingdao Narragansett Bay, Rhode Island, USA. Marine Pollution algal bloom. Phycological Research 57: 147–151, http://dx.doi.org/ Bulletin 52: 612–620, http://dx.doi.org/10.1016/j.marpolbul.2005.10.009 10.1111/j.1440-1835.2009.00532.x

236 Ulva ohnoi: a new report in the Western Atlantic

Ruesink JL, Collado-Vides L (2006) Modeling the increase and Teichberg M, Fox SE, Olsen YS, Valiela I, Martinettos P, Iribarnes control of Caulerpa taxifolia, an invasive marine macroalga. O, Muto EY, Petti MA, et al. (2010) Eutrophication and Biological Invasions 8: 309–235, http://dx.doi.org/10.1007/s10530-004- macroalgal blooms in temperate and tropical coastal waters: 8060-3 nutrient enrichment experiments with Ulva spp. Global Change Santelices B, Aedo D, Hoffmann A (2002) Banks of microscopic Biology 16: 2624–2637 forms and survival to darkness of propagules and microscopic Tucker J, Sheats N, Giblin AE, Hopkinson CS, Montoya JP (1999) stages of macroalgae. Revista Chilena de Historia Natural 75: Using stable isotopes to trace sewage-derived material through 547–555, http://dx.doi.org/10.4067/S0716-078X2002000300006 Boston Harbor and Massachusetts Bay. Marine Environmental Saunders GW, Kucera H (2010) An evaluation of rbcL, tufA, UPA, Research 48: 353–375, http://dx.doi.org/10.1016/S0141-1136(99)00069-0 LSU and ITS as DNA barcode markers for the marine green Valiela I, McClelland J, Hauxwell J, Behr PJ, Hersh D, Foreman K macroalgae. Cryptogamie, Algologie 31(4): 487–528 (1997) Macroalgal blooms in shallow estuaries: controls and Shimada S, Hiraoka M, Nabata S, Iima M, Masuda M (2003). ecophysiological and ecosystem consequences. Limnology and Molecular phylogenetic analyses of the Japanese Ulva and Oceanography 42: 1105–1118, http://dx.doi.org/10.4319/lo.1997.42.5_p Enteromorpha (Ulvales, Ulvophyceae), with special reference to art_2.1105 the free-floating Ulva. Phycological Research 51: 99–108, Wang J, Li N, Jiang P, Boo SM, Lee WJ, Cui Y, Lin H, Zhao J, et al. http://dx.doi.org/10.1111/j.1440-1835.2003.tb00176.x (2010) Ulva and Enteromorpha (Ulvaceae, Chlorophyta) from Stalker JC, Price RM, Swart PK (2009) Determining spatial and two sides of the Yellow Sea: analysis of nuclear rDNA ITS and temporal inputs of freshwater, including submarine groundwater plastid rbcL sequence data. Chinese Journal of Oceanology and discharge, to a subtropical estuary using geochemical tracers, Limnology 28: 762–768, http://dx.doi.org/10.1007/s00343-010-9069-3 Biscayne Bay, South Florida. Estuaries and Coasts 32: 694– Wang XH, Li L, Bao X, Zhao LD (2009) Economic cost of an algae 708, http://dx.doi.org/10.1007/s12237-009-9155-y bloom cleanup in China's 2008 Olympic Sailing Venue. Swart P, Anderson WT, Altabet MA, Drayer C, Bellmund S (2013) Transactions American Geophysical Union 90: 238, Sources of dissolved inorganic nitrogen in a coastal lagoon http://dx.doi.org/10.1029/2009EO280002 adjacent to a major metropolitan area, Miami Florida (USA). Wynne MJ (2011) A checklist of benthic marine algae of the tropical Applied Geochemistry 38: 134–146, http://dx.doi.org/10.1016/ and subtropical western Atlantic: third revision. Nova Hedwigia j.apgeochem.2013.09.008 Beiheft 140: 68–69 Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) Yabe T, Ishii Y, Amano Y, Koga T, Hayashi S, Nohara S, MEGA6: Molecular Evolutionary Genetics Analysis version Tatsumoto H (2009) Green tide formed by free-floating Ulva 6.0. Molecular Biology and Evolution 30: 2725–2729, spp. at Yatsu tidal flat, Japan. Limnology 10: 239–245, http://dx.doi.org/10.1093/molbev/mst197 http://dx.doi.org/10.1007/s10201-009-0278-4 Teichberg M, Heffner L, Fox S, Valiela I (2007) Nitrate reductase Ye N-h, Zhang X-w, Mao Y-z, Liang C-w, Xu D, Z J, Zhuang Z-m, and glutamine synthetase activity, internal N pools, and growth Wang Q-y (2011) “Green tides” are overwhelming the coastline of Ulva lactuca: responses to long and short-term N supply. of our blue planet: taking the world's largest example. Marine Biology 151: 1249–1259, http://dx.doi.org/10.1007/s00227- Ecological Research 26: 477–485, http://dx.doi.org/10.1007/s11284- 006-0561-4 011-0821-8

Supplementary material The following supplementary material is available for this article: Table S1. Collection site information of Ulva ohnoi with the GenBank Accession numbers and Herbarium numbers (UNA and FTBG). Table S2. GenBank Accession numbers other than Ulva ohnoi used in this study. Table S3. Genetic Distances (bp) of the rbcL alignment (1,310 bp). Table S4. Genetic Distances (bp) of the tufA alignment (773 bp). Table S5. Genetic Distances (bp) of the ITS1 alignment (178 bp). Figure S1. ML tree based on the tufA alignment (773 bp) with 1000 bootstrap replicates. Figure S2. ML tree based on the ITS1 alignment (178bp) with 1000 bootstrap replicates. This material is available as part of online article from: http://www.aquaticinvasions.net/2016/Supplements/AI_2016_Melton_etal_Supplement.xls

237