Ferritin Contributes to Melanoma Progression by Modulating Cell

Human Cancer Biology

Ferritin Contributes to Melanoma Progression by Modulating Cell Growth and Sensitivity to Oxidative Stress Alfonso Baldi,1, 5 Daniela Lombardi,6 Patrizia Russo,1 Emanuele Palescandolo,1 Antonio De Luca,1 Daniele Santini,3 Feliciano Baldi,5 Luigi Rossiello,5 Maria Lucia Dell’Anna,4 Arianna Mastrofrancesco,4 Vittoria Maresca,4 Enrica Flori,4 Pier Giorgio Natali,2 Mauro Picardo,4 and Marco G. Paggi1

Abstract Purpose: Employing an in vitro model system of human melanoma progression, we previously reported ferritin light chain (L-ferrit in ) gene overexpression in the metastatic phenotype. Here, we attempted to characterize the role of ferritin in the biology of human melanoma and in the progression of this disease. Experimental Design: Starting from the LMhuman metastatic melanoma cell line, we engi- neered cell clones in which L-ferritin gene expressionwas down-regulatedby the stableexpression of a specific antisense construct. These cells were then assayed for their growth capabilities, chemoinvasive properties, and sensitivity to oxidative stress. Additionally, ferritin protein content in primary and metastatic human melanomas was determined by immunohistochemistry. Results: Artificial L-ferritin down-regulation in the LMcells strongly inhibited proliferation and chemoinvasion in vitro and cell growth in vivo.Inaddition,L-ferritin down-regulated cells displayed enhanced sensitivity to oxidative stress and to apoptosis. Concurrently, immunohistochemical analysis of a human melanoma tissue array revealed that ferritin expression level in metastatic lesions was significantly higher (P < 0.0001) than in primary melanomas. Further- more, ferritin expression was constantly up-regulated in autologous lymph node melanoma metastases when compared with the respective primary tumors in a cohort of 11patients. Conclusions: These data suggest that high ferritin expression can enhance cell growth and improve resistance to oxidative stress in metastatic melanoma cells by interfering with their cellular antioxidant system. The potential significance of these findings deserves to be validated in a clinical setting.

The hierarchy of the molecular events underlying human the technology of the cDNA arrays has been recently successful melanoma progression is still largely unknown. For this reason, in pointing out genes whose expression is associated with more information is clearly needed regarding genetic changes metastatic potential in melanoma cells (11, 12). Indeed, the triggering melanoma onset and progression (1–3). In the past identification of genes that are differentially regulated when years, several genes have been identified as differentially melanoma cells attain metastatic potential may lead to the expressed during melanocytic tumor progression (4–10), and characterization of patients with high risk of developing metastasis and possibly to the recognition of more specific therapeutic targets. Recently, we took advantage of an in vitro model of 1 Authors’ Affiliations: Laboratory ‘‘C,’’ Department for the Development of melanoma progression consisting of two cell lines: LP, which Therapeutic Programs and 2Laboratory of Immunology, Center for Experimental Research, Regina Elena Cancer Institute; 3Service of Oncology, Campus is derived from a primary human melanoma, and LM, which is BioMedico University; 4San Gallicano Dermatological Institute, Rome, Italy; derived from a supraclavicular lymph node metastasis of the 5Deparment of Biochemistry and Biophysics ‘‘F. Cedrangolo,’’ Section of Anatomic same patient, the latter showing enhanced cell proliferation 6 Pathology, Second University of Naples, Naples, Italy; and Department of and clonogenic capacity (13). By means of cDNA arrays, we Experimental Medicine, University of L’Aquila, L’Aquila, Italy Received 4/1/04; revised 1/11/05; accepted 2/3/05. identified several genes whose expression was modulated in Grant support: Associazione Italiana per la Ricerca sul Cancro grant (M.G. Paggi), our model system and, among these, the gene encoding for Ministero della Salute grants (M.G. Paggi and M. Picardo), General Broker Service, ferritin light chain (L-ferritin) whose expression was found up- International Society for the Study of Comparative Oncology, and Istituto per regulated in the LM cell line (14). l’Ambiente e l’Educazione Schole¤ Futuro grants (ISSCO and Futura-ONLUS) Ferritins are important regulators of the intracellular iron (A.Baldi,F.Baldi,andD.Santini),andAteneoex60%grant(D.Lombardi). The costs of publication of this article were defrayed in part by the payment of page content. Pharmacologically obtained iron depletion induces charges. This article must therefore be hereby marked advertisement in accordance major cellular alterations, including cell cycle arrest and with 18 U.S.C. Section 1734 solely to indicate this fact. apoptosis (15), but at elevated tissue concentrations, iron Requests for reprints: Marco G. Paggi, Laboratory ‘‘C,’’ Department for the results as a potential toxicant (16). Storage of intracellular iron Development of Therapeutic Programs, Regina Elena Cancer Institute, Center for Experimental Research,Via E. Chianesi 53, 00128 Rome, Italy. Phone: 39-06- in the ferritin molecules together with a down-modulation of 5266-2550; Fax: 39-06-5266-2572; E-mail: [email protected]. transferrin receptor are the two key mechanisms through which F 2005 American Association for Cancer Research. the human tissues are shielded from the toxic effects of excess

www.aacrjournals.org3175 Clin Cancer Res 2005;11(9) May 1, 2005 Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. Human Cancer Biology iron ions (17). Ferritins are made of 24 subunits assembled to AGCGGATCCATGAGCTCCCAGATTCGTCAG and (reverse) AGC- form the apoferritin shell. The protein subunits are of two types, GAATTCTTAGTCGTGCTTGAGAGTGAG. The primers used for the light chain and heavy chain, which share extensive homology. antisense-L-ferritin (AS-L-ferritin) construct were (forward) AGC- The heavy chain is predominant in the so-called acidic GAATTCATGAGCTCCCAGATTCGTCAG and (reverse) AGCGGATCCT- TAGTCGTGCTTGAGAGTGAG. isoferritins, prevalently detectable in heart, kidney, and pla- Northern blot analysis. Northern blot analysis was done as centa. The light chain is usually found in the so-called basic described (14) using the human L-ferritin cDNA as a probe. A isoferritins, detected in liver and spleen. Light and heavy chain subsequent hybridization with h-actin was used for normalization. ferritin subunits are encoded by two specific genes that are Quantification of the bands was obtained by the ImageQuant 5.0 under separate transcriptional control. To date, the independent software (Molecular Dynamics, Sunnyvale, CA). function and regulation of light and heavy chain ferritins still Western blot analysis. Western blotting on cell lysates was done as remains an open issue (16, 18, 19). Translation of both ferritin described (29) using a rabbit anti-human ferritin antibody (DAKO, subunits is thought to be activated by iron through interactions Carpinteria, CA) at a working dilution of 1:500. Normalization was with the iron regulatory element motifs present in the promoter done using an anti-HSP70 mouse monoclonal antibody (Oncogene region of the two genes and through cytoplasmic iron sensors Science, Manhasset, NY). Quantification of the bands was obtained by the ImageQuant 5.0 software. called iron regulatory proteins (20). Tissue ferritin expression Transfections. LM cells (7 Â 105) were transfected with 30 Ag changes during development as well as in various pathologic pcDNA3-T7-Tag plasmid as control, with the pcDNA3-T7-L-ferritin-Tag states. In the past years, there has been considerable interest in construct (sense), or with the pcDNA3-T7-AS-L-ferritin-Tag construct, ferritin as an oncofetal protein and as a marker associated with containing the ferritin light chain cDNA sequence in antisense cellular proliferation (19). Findings regarding the relationship orientation, by electroporation as described (30). Under these con- between ferritin and cancer seem, at least in part, conflicting, ditions, 55% transfection efficiency was achieved. After growing electro- which reflects the relative paucity of experiments in this area. porated cells in G418-containing medium (250 Ag/mL) for 14 days, Nevertheless, increased ferritin concentration in tumor versus single clones were isolated and grown. Control clones were propagated at normal tissue has been reported in several malignancies, such as 60% to 70% of confluence. Because L-ferritin down-regulated LM clones colon and breast cancer (21–23) and seminoma (24). underwent apoptosis when kept >3 days in culture, these cells were Melanoma progression is associated with aberrant redox propagated every other day at 40% to 50% of confluence. Proliferation assay. Cells were seeded in a 96-well plate (5 Â 103 regulation leading to a continuous oxidative stress and per well) 12 hours before the experiment. Cell growth was evaluated production of reactive oxygen species (ROS), chemical species using the Cell Proliferation Kit II (Roche Molecular Biochemicals, containing one or more unpaired electrons (25). Indianapolis, IN) following manufacturer’s instructions. This method Due to the considerable novel interest raising on the employs a colorimetric procedure based on the tetrazolium salt mechanisms linking iron metabolism and cancer cells (15, 26), sodium, 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5- we have sought to assess the functional significance of ferritin in carboxanilide inner salt, which is transformed in a formazan dye only the biology of human melanoma, a tumor type characterized by in metabolically active cells. The formazan dye was measured after a peculiar iron metabolism (27, 28). By means of artificial down- 4 hours at a 492 nm wavelength. Values F SD are the average of three regulation of L-ferritin in metastatic human melanoma cells, we experiments done in decuplicate. investigated the possible role of ferritin in the progression of this In vitro invasion assay. The chemoinvasion assay was done as described (31) with some minor modifications. Briefly, cell culture tumor and in its peculiar response to oxidative stress. Addition- inserts incorporating 6.4 mm diameter membranes (8 Am pore size, ally, we determined immunohistochemically ferritin expression Becton Dickinson, Franklin Lakes, NJ) were used. Membranes were level in primary and metastatic melanomas. coated with 10 Ag each of Matrigel basement membrane matrix (Becton Dickinson). Results were expressed as the number of invaded cells on Materials and Methods the lower surface of the membrane. Ten microscope fields per each membrane were counted. Each experiment was done at least five times. Cell lines. The in vitro model system used consisted of two cell Terminal deoxynucleotidyl transferase–mediated dUTP nick end lines derived from a primary cutaneous melanoma (Clark’s level V; labeling assay. Cells were fixed in paraformaldehyde, washed in Breslow 12 mm; LP) or from its supraclavicular lymph node metastasis distilled water, and exposed briefly to 3% H2O2 to inactivate (LM). LP and LM cells were cultured in RPMI 1640 plus 10% FCS in a endogenous peroxidase. The terminal deoxynucleotidyl transferase– 5% CO2 atmosphere. LM cells have enhanced proliferation rate and mediated dUTP nick end labeling (TUNEL) reaction was done using f clonogenic capacity (13). After 10 in vitro passages, LP cells showed a the peroxidase-based Apoptag kit (Intergene, Purchase, NY). The different, more malignant, phenotype.7 TUNEL-positive cells were revealed by diaminobenzidine and H2O2 To maintain cells in fatty acid precursor–supplemented culture according to the manufacturer’s instructions. Finally, stained cells were conditions, linoleic acid was added to the medium at the final slightly counterstained with hematoxylin. TUNEL-positive cells were À5 concentration of 7 Â 10 mol/L from a stock solution in absolute considered as apoptotic. ethanol. An equal volume of absolute ethanol was added to the Induction and evaluation of apoptosis. Cells were grown up to 70% medium of control cells. Bovine serum albumin at the final confluence; then, apoptosis was induced by the addition of H2O2 (at the concentration of 0.02% was added as a fatty acid carrier to both final concentrations of 25, 50, 100, and 200 Amol/L) or the anti-Fas control and treated cells. Cells were exposed to fatty acids precursors antibody CH11 (Upstate Biotechnology, Lake Placid, NY; at the final for 6 days before analysis. concentrations of 15, 30, 60, and 120 ng/mL). Cells were assayed after cDNA constructs. The human L-ferritin (Genbank accession no. 60 minutes. Cell cycle analysis was done by flow cytometry using the M11147) cDNA was cloned in sense or antisense orientation in the CycleTest Plus DNA Reagent kit (Becton Dickinson) following pcDNA3-T7-Tag vector (Invitrogen, Carlsbad, CA) between BamHI and manufacturer’s instructions. Cells were analyzed by a FACSCalibur EcoRI sites. The primers used for the L-ferritin construct were (forward) flow cytometer (Becton Dickinson; 1 Â 104 events per sample). To estimate apoptosis, the acquired data were elaborated with the CellQuest version 3.3 software and analyzed with the ModFit LT 7 C. Leonetti, personal communication. version 3.0 software.

Clin Cancer Res 2005;11(9) May 1, 2005 3176 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. Ferritin in Human Melanoma Progression

In vivo analysis of tumor growth inhibition. LM cells (1 Â 106) Immunohistochemistry. Immunohistochemistry on the human stably transfected with pcDNA3-T7-Tag plasmid or with the pcDNA3- malignant melanoma tissue array CK1 slide (SuperBioChips Labora- T7-AS-L-ferritin-Tag construct were injected s.c. into the flanks of male tory, Seoul, South Korea) as well as on 11 primary melanomas and CD1 nu/nu mice (Charles River, Calco, Italy) in a final volume of matched lymph node metastases was done as described previously 350 AL. Eight mice for each experimental point were employed. Tumor (14) using the rabbit anti-human ferritin antibody (A0133) at 1:250 volume was monitored by standard procedures. After 39 days, animals dilution or the monoclonal mouse antibody to human melanoma were sacrificed and tumors were removed and processed for RNA (clone HMB45, DBS, Pleasanton, CA) at 1:50 dilution after a extraction and for histology. 10-minute Pronase treatment (DAKO). 3-Amino-9-ethylcarbazide was Descriptive statistical analysis was used to monitor tumor volume the final chromogen and hematoxylin is the nuclear counterstain. The modifications (expressed as median value and 95% confidential percentage of ferritin-stained cells per field (Â250) at light microscopy interval of tumor volumes). Sheffe test and two-way ANOVA analysis was calculated and compared in different specimens by three separate were used to compare tumor growth (tumor volume) of different observers (A.B., L.R., and F.B.) in a double-blind fashion, choosing cancer clones (multiple comparisons). Ps V 0.05 were regarded as areas almost completely composed by HMB45-positive cells. The score statistically significant in two-tailed tests. SPSS software version 10.00 was as follows: +, up to 5% positive cells per field; ++, 6% to 15% (SPSS, Chicago, IL) was used for statistical analysis. positive cells per field; +++, 16% to 25% positive cells per field; and All procedures involving animals and their care were conducted ++++, >25% positive cells per field. The level of concordance, in conformity with the institutional guidelines in compliance with expressed as the percentage of agreement between the observers, was national (D.L. No. 116, G.U., Suppl. 40, Feb. 18, 1992; Circolare No. 8, 92%. In the remaining specimens, the score was obtained after G.U., July 1994) and international laws (EEC Council Directive 86/ collegial revision and agreement. Spearman’s rank correlation or 609, OJ L 358. 1, Dec 12, 1987; Guide for the Care and Use of Fisher’s exact test was used to assess relationship between ordinal data. Laboratory Animals, U.S. National Research Council, 1996). Ferritin values in the different subset of tumor (primary tumors, Antioxidant enzymatic activities assay. Superoxide dismutase metastases) and in different pathologic stages of disease (tumor-node- (SOD) activity was evaluated as described (32). The results were metastasis) were compared according to Mann-Whitney U test for reported as units/mg of protein. nonparametric independent variables. Ps V 0.05 were regarded as

Catalase activity was determined by the disappearance of H2O2 statistically significant in two-tailed tests. SPSS software was used for (10 mmol/L) measured at 240 nm in PBS (pH 7.4; ref. 33). The results statistical analysis. were reported as units/mg of protein. The LF03 anti-human ferritin light chain monoclonal antibody was Reactive oxygen species detection. ROS production was detected by elicited by human liver ferritin and selected for its specificity to ferritin 2V,7V-dichlorofluorescein diacetate (Fluka AG, Buchs, Switzerland), a light chain (39). The suitability of this antibody for immunohisto- substance oxidizable to fluorescent dichlorofluorescein by several chemical analysis has been described elsewhere (40). The antibody was different ROS and peroxides. Cells were gently detached, washed, and used at a 1:500 dilution and incubated for 1 hour at room temperature. incubated (30 minutes at 37jC, 5% CO2) in the presence of 2.5 Amol/L The immunohistochemical results obtained with the polyclonal 2V,7V-dichlorofluorescein diacetate in PBS plus 5 mmol/L glucose. Flow rabbit anti-human ferritin antibody raised against liver ferritin cytometric analysis was immediately done by a Cytoron Absolute (prevalently L-ferritin) were confirmed in a selected number of (Ortho Diagnostic System, Raritan, NJ) with excitation and emission specimens using the LF03 monoclonal antibody. setting at 488 and 530 nm, respectively. The intracellular ROS were quantified using the median of FL1 channel of fluorescence, which Results matches with the maximal number of cells with the highest fluorescence. Ferritin light chain gene expression in LP and LM cells. Vitamin E analysis. Vitamin E was extracted (34) and measured (35) as described. Results are reported as the mean of two determi- Northern and Western blot analyses (Fig. 1A and B, respec- nations from two different experiments and expressed as ng/mg protein. tively) revealed higher L-ferritin gene and ferritin protein Thiobarbituric acid–reactive substances analysis. The evaluation of expression in the metastatic LM cells when compared with thiobarbituric acid–reactive substances (TBARS) was done as described the LP cells, the ones derived from the primary tumor. (36). The assay reveals mainly malondialdehyde, which forms a Quantitative results are reported in the legend of Fig. 1. This spectrophotometrically detectable adduct with thiobarbituric acid. For result confirmed our previous findings in which, by cDNA TBARS quantitative determination, malondialdehyde standard solu- arrays, we identified the L-ferritin gene as up-regulated in the tions of known concentration were used instead of the cell lysate. We LM cell line (14). In addition, immunohistochemical ferritin did three different determinations in duplicate. TBARS, detected as expression was found from very low to undetectable in pmol/mg of protein, were expressed as percentage variations due to 10 benign nevi. Figure 1C shows a representative staining. intrinsic variability of the detection system itself. Polyunsaturated fatty acid analysis. Lysed cells were extracted twice Effect of L-ferritin down-regulation on proliferative and in chloroform/methanol (2:1) in the presence of butylated hydrox- chemoinvasive properties of LM cells in vitro. These findings ytoluene (100 Ag) as antioxidant. Phospholipid fraction was purified prompted us to investigate the possible role of L-ferritin down- by TLC, and tricosanoic acid ethyl ester (100 Ag) was added as internal modulation in the phenotypic differences observed between standard. The fatty acids of phospholipid fraction were transmethylated LP and LM melanoma cell lines. To this end, we subcloned the with sodium methoxide in methanol and analyzed by a combined gas L-ferritin cDNA in antisense orientation (AS-L-ferritin) into a chromatography-mass spectrometry system (Hewlett-Packard, Palo constitutive expression vector and transfected it into the LM Alto, CA, 5890 II gas chromatography combined with 5989 mass cell line. Isolated individual clones of stable transfectants were spectrometry) on capillary column (FFA-P, 60 m Â 0.32 Am Â grown up to 40% to 50% confluence for 48 hours. Cell lysates 0.25 mm, Hewlett-Packard). Helium was used as carrier gas. Oven were analyzed for ferritin protein expression by Western blot temperature gradient from 80jC to 220jCat10jC/min was used (37). The results were obtained after time integration of the chromatogram using a commercial polyclonal rabbit antibody raised against and final processing of the peak areas and reported as polyunsaturated ferritin isolated from human liver, a tissue in which the light fatty acid (PUFA) Ag/mg of protein. chain of ferritin is prevalent over the heavy chain molecule Protein determination. Protein determination was done according (19). Six of nine selected transfectant clones displayed lower to Bradford (38). levels of ferritin when compared with the LM cells transfected

Fig. 1. Up-regulation of L-ferritin mRNA in the LMcell line. A, Northern blot analysis revealed L-ferritin up-regulation in the highly metastatic LMcell line.Total RNA (10 Ag) from LP and LMcell lines was probed with 32P-labeled full-length L-ferritin cDNA. After normalization by h-actin detection, L-ferritin mRNA content resulted 2.5-fold higher in LMcells. B, Western blot analysis after a 10% SDS-PAGE showed ferritin protein amounts in LP and LMcells. After normalization by HSP70 detection, ferritin protein content resulted 3.3-fold higher in LMcells. C, immunohistochemical detection in a nevus showed a barely detectable amount of ferritin.

with the control vector (Fig. 2A). All these clones actually Fig. 2. L-ferritin down-regulated LMclones and their in vitro growth and invasive displayed a ferritin amount lower than the amount detectable properties. A, Western blot analysis after a 12% SDS-PAGE. LMcells transfected with the empty vector (control) or with the AS-L-ferritin cDNA (clones 1-6) were in the LP cell line itself. Ferritin, when in lower amount, was assayed for ferritin expression. HSP70 detection was used for normalization. Each detected as a doublet in 12% acrylamide gels possibly due to a lane was loaded with 30 Ag protein. After normalization by HSP70 detection, ferritin partial cross-reaction with H-ferritin. Quantitative results are protein content in control LMcells resulted 10.1-,13.8-, 4.8-, 10.1-, 3.7-, and 8. 8-fold higher than in AS-L-ferritin LMclones 1, 2, 3, 4, 5, and 6, respectively. reported in the legend of Fig. 2. Among the selected clones, we B, proliferation assay: in vitro effects of L-ferritin down-modulation in LMcells chose those with the lowest ferritin protein expression (control, clones 2, 4, and 6). Proliferation rate was expressed as the amount of (i.e., clones 2, 4, and 6). These clones were tested for their formazan detected spectrophotometrically after 4 hours. C, chemoinvasion assay: in vitro effects of L-ferritin down-modulation in LMcells (control, clones 2, 4, and 6). proliferative and chemoinvasive properties. L-ferritin down- Invasiveness was expressed as the number of invaded cells on the lower surface of regulation resulted in a major decrease in the proliferative the coated membrane. activity of the LM cells (Fig. 2B). Sense L-ferritin-transfected LM cells did not display significant changes neither in ferritin amount expression by Western blot nor in proliferation rate investigating the higher apoptotic rate of L-ferritin down- (data not shown). Furthermore, L-ferritin down-regulation regulated cells, we did cell cycle analysis by flow cytometry of strongly inhibited the ability of LM cells to invade an in vitro – either control or AS-L-ferritin stable LM transfectants after constituted extracellular matrix (Fig. 2C). incubation in the presence of either H2O2 (25) or the anti-Fas Effect of L-ferritin down-regulation on apoptosis of LM cells monoclonal antibody CH11 (41–44). Both these stimuli in vitro. TUNEL analysis, done on cells cultured for >48 produced a remarkable increase in apoptotic events in AS-L- hours, provided the first indication that apoptosis was more ferritin stable LM transfectants rather than in control LM cells evident in L-ferritin down-regulated LM cells stably expressing (Fig. 3B and C), demonstrating that ferritin down-regulation AS-L-ferritin rather than in LM control transfectants (56.0 F significantly lowered the threshold of apoptosis in LM human 13% versus 11.9 F 4%; Fig. 3A). With the aim of further melanoma cells.

Clin Cancer Res 2005;11(9) May 1, 2005 3178 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. Ferritin in Human Melanoma Progression

L-ferritin down-regulated LM clones 2 and 4 at day 22 (P = 0.039 and 0.045, respectively)], whereas control cells versus AS-L-ferritin LM clone 6 reached a borderline statistical significance at day 34 (P = 0.08). L-ferritin down-modulation is associated with the development of an oxidative stress. To investigate whether L-ferritin down- regulation could impair the antioxidant defense system, thus causing lipoperoxidative effects and cell damage, we evaluated lipophilic and enzymatic antioxidants PUFA and TBARS content in AS-L-ferritin-transfected and control-transfected LM cells. In L-ferritin down-regulated LM cells, SOD activity was significantly higher (12.71 F 2.46 versus 4.54 F 1.21 units/mg protein), whereas catalase activity resulted significantly lower (6.61 F 1.52 versus 16.21 F 3.09 units/mg protein) when compared with control LM cells (P < 0.005). Consequently, the SOD/catalase ratio was higher in L-ferritin down-regulated LM cells (1.92) with respect to control cells (0.28), thus facilitating H2O2 accumulation in the former. The amounts of total PUFAs were 0.11 F 0.032 and 0.39 F 0.066 Ag/mg of protein in L-ferritin down-regulated LM cells and control cells, respectively (P < 0.005). TBARS, expressed as percentage variations, were significantly higher (41 F 18%) in L-ferritin down-regulated LM cells than in control cells (P < 0.001). Moreover, vitamin E levels were found higher in L-ferritin down-regulated LM cells than in control cells (7.64 F 1.22 and 5.84 F 0.86 ng/mg of protein, respectively; P < 0.01) as a possible compensatory mechanism to counteract oxidative stress (35, 45). All these data are summarized in Table 1. The intracellular ROS level, however, as evaluated by the 2V,7V-dichlorofluorescein diacetate fluorescence, was not significantly increased in L-ferritin down-regulated LM cells with respect to controls (2V,7V-dichlorofluorescein diacetate fluorescence median of 134 and 130, respectively). To counteract the effects of fatty acid precursor depletion, a phenomenon generally occurring in cultured cells (46), in a separated set of experiments, we supplemented the culture medium of both control LM and L-ferritin down-regulated LM cells with the fatty acid precursor linoleic acid (added as specified in Materials and Methods). Cells were then assayed Fig. 3. Susceptibility to apoptosis of L-ferritin down-regulated LMcells. A, TUNEL for TBARS and PUFA content and for proliferative capabilities. analysis in control and in L-ferritin down-regulated LMcells; cells with dark The data obtained from two different determinations, each nuclei were considered as apoptotic. B, induction of apoptosis in control and in done in triplicate, indicated that linoleic acid–supplemented L-ferritin down-regulated LMcells ( AS-L-ferr.)byH2O2 at the concentrations indicated. C, induction of apoptosis in control and in L-ferritin down-regulated LM cells showed increased TBARS content, which was more cells by addition of the CH11anti-Fas monoclonal antibody at the concentrations pronounced in L-ferritin down-regulated LM than in control indicated. Columns , mean from four to six independent assays; bars, SD. *, P < 0.05, LM cells (20.4% and 50.5%, respectively). As far as PUFAs significant; **, P < 0.001, highly significant, calculated by the Student’s t test. D9,12 These results apply to the AS-L-ferritin stable transfectant LMclone 2; the behavior are concerned, we evaluated linoleic (C18:2 )and of clones 4 and 6 was essentially overlapping. arachidonic acid (C20:4D5,8,11,14), which are the most relevant cell membrane unsaturated components. In cells Effect of L-ferritin down-regulation on tumorigenicity of LM supplemented with linoleic acid, we found a more pro- cells in vivo. L-ferritin down-regulated LM clones as well as nounced increase in control LM cells than in L-ferritin down- control cells were injected into the flanks of nude mice, and regulated LM cells (8.27- and 4.92-fold, respectively). In turn, tumor volumes were measured thrice weekly. Tumors originat- arachidonic acid, a key target of lipoperoxidative damage, was ed from the L-ferritin down-regulated LM clones grew found considerably more reduced in L-ferritin down-regulated significantly slower than controls, with clones 2 and 4 showing LM than in control LM cells (8.83- and 3.55-fold reduction, the strongest growth inhibition (Fig. 4A). Both Northern respectively). blot and immunohistochemistry confirmed the decrease in Furthermore, linoleic acid supplementation produced a L-ferritin gene and protein expression in the xenograft explants 48.26% decrease in control LM cells and a 38.17% decrease derived by L-ferritin down-regulated LM cells (Fig. 4B and C, in L-ferritin down-regulated LM cells, which were already respectively). The extent of tumor growth inhibition reached growth inhibited by the expression of the AS-L-ferritin statistical significance at different times [i.e., control cells versus construct (Fig. 5).

www.aacrjournals.org 3179 Clin Cancer Res 2005;11(9) May 1, 2005 Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. Human Cancer Biology

Fig. 4. LMclones stably expressing AS-L-ferritin and their in vivo growth properties. A, in vivo growth rates of the control and L-ferritin down-regulated LMcells(clones2,4,and6).Bars,95% confidential interval. Tumor volumes (median values) were expressed in mm3. B, Northern blot analysis for L-ferritin in xenografts derived from control or L-ferritin down-regulated LMcells (clone 2). After normalization by h-actin detection, L-ferritin mRNA content resulted 1.5-fold lower in L-ferritin down-regulated LMcells. C, immunohistochemical determination of ferritin in xenografts derived from control or L-ferritin down-regulated LMcells (clone 2, top and bottom, respectively).

Immunohistochemical analysis of ferritin expression in human (>25%) was observed. Interestingly, we found higher ferritin melanomas. The expression patterns of ferritin were assessed by expression level in metastatic lesions, which resulted statistically immunohistochemistry done on a tissue array consisting of 50 significant when compared with primary melanomas (P < samples of human melanomas ranging from in situ to metastatic. 0.0001). Moreover, a significant direct correlation was also Ferritin was found always expressed in the cytoplasm. Of found between ferritin expression and T or M status of the interest, strong ferritin staining was also detected in spindle- primary melanomas (P < 0.0001 and P = 0.003, respectively). shaped cells or histiocytes of the stroma surrounding the These data are summarized in Table 2. In addition, ferritin neoplastic tissue. A broad range of ferritin expression ranging expression in 11 human primary melanomas and in the from no staining to a high number of positive cells per field respective autologous lymph node metastases showed, in all these cases, a more abundant ferritin expression in the metastatic lesions (Fig. 6; Table 3). Interestingly, ferritin expression was Ta b l e 1. Pattern of the antioxidants and oxidative dramatically up-regulated also in two cases of metastatic lesion stress variables in control LMcells and L-ferritin to the skin when compared with the respective primary down-regulated LMcells melanoma, as shown in Fig. 5, where the insets (top right) show immunostaining for HMB45 expression in the consecutive L-ferritin tissue section. Control down-regulated LM cells LM cells P SOD (units/mg 4.54 F 1. 21 12 .71 F2.46 <0.005 Ta b l e 2 . Immunohistochemical detection of ferritin in of protein) heterologous primary and metastatic melanomas Catalase (units/mg 16.27 F 3.09 6.62 F 1. 5 0 <0.005 of protein) Spearman’s SOD/catalase ratio 0.28 1.92 N/A rank correlation Vitamin E 5.84 F 0.86 7.64 F 1.22 <0.005 Variable coefficient P (ng/mg of protein) Primary vs metastatic 0.652 <0.0001 PUFAs 0.39 F 0.066 0.1 F0.03 <0.005 T 0.634 <0.0001 (Ag/mg of protein) N0.170NS TBARS 100 141 F18 <0.001 M0.548 0.003 (percentage value)

NOTE: Spearman’s rank correlation between ferritin expression and primary NOTE: Values are the average F SD from three different experiments. Signifi- versus nonrelated metastatic melanomas,T, N, or Mclinical stage of disease, cance testing (P) was done using two-tailed t test. respectively.

Clin Cancer Res 2005;11(9) May 1, 2005 3180 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. Ferritin in Human Melanoma Progression

a cell growth factor by several cancer cells in vitro (59) and is considered responsible for some of the melanoma-induced immunosuppressive effects (60). Melanoma cells often display an increased state of chronic oxidative stress when compared with melanocytes (35, 61). High levels of H2O2 stimulate the activity of several transcriptional factors, including nuclear factor-nB (25, 62), known to enhance survival pathways by inducing gene expression for different growth factors; therefore, melanoma cells, with endogenous high ferritin levels, can be endowed with higher survival and biological aggressiveness (62). Recently, ferritin heavy chain (H-ferritin) has been shown to play a key role in regulating apoptosis during inflammation. In fact, H-ferritin, induced by nuclear factor-nB, is required to prevent sustained c-Jun NH2-terminal kinase cascade activation, thus inhibiting ROS-mediated tumor necrosis factor-a-induction and the consequent apoptosis. In essence, H-ferritin-driven inhibition of c-Jun NH2-terminal kinase signaling depends on suppressing ROS accumulation and is achieved through its ability to sequester iron ions (63). In our experimental model, LM metastatic cells clearly seem to depend on their high intracellular ferritin content as Fig. 5. In vitro growth properties of LMcells after supplementation of the indicated by the reduction of their proliferative and invasive culture medium with linoleic acid. Control and L-ferritin down-regulated LMcells (clone 2) were assayed in standard growth conditions or after supplementation of potential when L-ferritin was experimentally down-regulated. the culture medium with linoleic acid as specified in Materials and Methods. Thus, we can hypothesize that enhanced proliferation of cancer Proliferation rate was expressed as the amount of formazan detected spectrophotometrically after 4 hours. cells is supported by high ferritin level with resulting decrease of the overall oxidative stress and the associated apoptosis. L-ferritin down-modulation in LM cells was also associated Discussion with increased SOD and decreased catalase activities. Chronic pro-oxidant stimuli can induce SOD activity both in vitro and In this study, we show that high levels of L-ferritin are in vivo (64–66), whereas catalase, a heme-containing enzyme, is correlated with the metastatic phenotype in an in vitro model of more susceptible to inactivation by exposure to high doses of melanoma progression. Artificial down-regulation of L-ferritin peroxidizing substances, including its own substrate (H2O2; in LM metastatic melanoma cells is capable in fact of reducing ref. 67). The unbalance between SOD and catalase activities their proliferation rate in vitro and in vivo as well as their invasive predisposes to intracellular H2O2 production because catalase, potential. Furthermore, in these cells, biochemical changes due in association with glutathione peroxidase, is devoted to remove to an oxidative stress and increased apoptotic rate were H2O2 (68). When the production of H2O2 overwhelms catalase observed. Finally, in vivo analysis of human melanomas showed activity, in the presence of free transitional metals, such as iron, that ferritin expression in primary tumors was significantly correlated with T and M status, being also significantly higher in metastatic versus primary melanomas. Ta b l e 3 . Immunohistochemical detection of ferritin in Although the biological role of ferritin in tumor cells is still autologous primary and metastatic melanomas not completely understood, various studies suggest that intracellular ferritin level is a reliable marker of cell prolifera- Case Primary Matched tion (19). Iron deprivation has been shown to significantly no. melanoma metastasis inhibit cell cycle and proliferation in cancer cells (15). In fact, in 1+ +++ iron-deprived human breast cancer cells, down-regulation of 2++++++ cyclin-dependent kinase activities, and decrease in cyclin D/ 3++++++ cyclin-dependent kinase 4 protein levels is found, thus reducing 4+++++++ their proliferative potential (47). In addition, it has been 5+ +++ reported that iron chelators induce apoptosis in tumor cells, 6++++++ indicating a potential role of intracellular iron in the regulation 7+++++ of programmed cell death (15, 48–51). Several studies have 8+ ++ confirmed the expression of ferritin in tumor cells, where high 9+++++ concentrations often correlate with higher degrees of cell 10 + ++ proliferation (16, 21–24, 52–56). It is well known that cancer 11 + ++ patients often exhibit an elevated level of serum ferritin usually correlated with a poor prognosis (16, 19, 57). This is also true in NOTE: +, up to 5% positive cell per field; ++, 6% to 15% positive cells per the case of human melanoma, where increased serum ferritin field; +++, 16% to 25% positive cells per field; ++++, >25% positive cells concentrations are associated with progressive metastatic per field. disease (58). In addition, ferritin is produced and secreted as

Fig. 6. Expression pattern of ferritin in human melanomas and autologous lymph node and cutaneous metastases. Low ferritin expression in a primary human melanoma (A) and high ferritin expression in the autologous lymph node metastasis (A1) and autologous cutaneous metastasis (A2).Very low ferritin expression in a primary human melanoma (B) and high ferritin expression in the autologous lymph node metastasis (B1)andautologous cutaneousmetastasis(B2). Original magnification for all the panels, Â250. Insets , immunostaining for HMB45 antigen in the respective consecutive tissue section.The melanomas represented as ‘‘A’’and ‘‘B’’correspond to cases 1and 7, respectively, reported inTable 3.

Fenton reaction is promoted, generating extremely reactive To the best of our knowledge, this is the first study showing hydroxyl radical (69, 70). In fact, alteration of SOD and catalase that ferritin may be a growth regulatory element of the molecular activities in LM ferritin down-modulated cells was associated pathway controlling proliferation and invasiveness of mela- with peroxidation of the cell membrane unsaturated lipid and noma cells. Furthermore, we show that metastatic melanomas apoptosis. In addition, after linoleic acid supplementation, the express higher ferritin levels, which may account for the elevated increase of linoleic acid content in the cell membrane was more serum levels of ferritin in melanoma patients with progressive evident in control than in L-ferritin down-regulated transfected metastatic disease. Recently, comparative analysis of human cells, suggesting that, in the latter, linoleate could be quickly Serial Analysis of Gene Expression libraries from primary and consumed by the lipoperoxidative damage. The pronounced metastatic melanomas and other malignances has identified decrease in arachidonic acid level and TBARS accumulation L-ferritin as one of the genes whose expression best distin- strongly suggest a higher susceptibility to lipid peroxidation as guishes the melanoma libraries from the other ones (73). well. It has been proposed that during melanomagenesis the The attempt we made to up-regulate L-ferritin expression in intrinsic antioxidant control of melanocytes is lost, and LM cells via transfection of the L-ferritin cDNA in ‘‘sense’’ inappropriate redox-sensitive transcription factors activation orientation resulted in the generation of clones unable to express occurs, contributing to the establishment of an antiapoptotic any detectable increase in ferritin content; moreover, these cells phenotype and possibly concurring in determining the did not show any significantly altered proliferative activity. This resistance of melanoma cells to chemotherapeutic agents can be possibly ascribed to threshold or saturation effects. (50). As the transformed melanocyte population expands, In association with the lipid peroxidation process, we restrictions due to the high redox cycling can generate a observed an increase in vitamin E concentration as an effort to selective growth advantage for tumor cells expressing high counteract cell membrane alterations. Comparable alterations levels of ferritin, which contributes to lower the toxic effects of have been described in cultured melanocytes from pheomelanic excess intracellular iron ions. In conclusion, this generates a patients, which are more susceptible to proapoptotic stimuli phenotype more resistant to apoptosis. (71). Similar events can possibly occur in L-ferritin down- In view that the in vivo analysis has shown a significant regulated LM cells as well, thus increasing their sensitivity to the increase of ferritin amount in melanoma metastases, further cytotoxic effect of proapoptotic chemotherapeutic drugs. In fact, studies are required to determine whether ferritin up-regulation we observed a significantly higher rate of spontaneous or is a common and biologically critical event during melanoma induced apoptosis in L-ferritin down-regulated LM cells than in progression. The present findings may be relevant in generating control. All these events are essentially in agreement with the therapeutic protocols that include modulation of intracellular increased production of Fenton-generated hydroxyl radicals. As iron content in cancer cells. an alternative explanation, ROS-induced genomic damage could favor the selection of a phenotype particularly resistant Acknowledgments to apoptosis. These hypotheses are not mutually exclusive. A synergistic effect between ferritin down-modulation and We thank Dr. C. Leonetti for providing the LP and LMcell lines, Prof. P. Arosio for the LF03 anti-human ferritin light chain monoclonal antibody, and Drs. B.Vincenzi the effect of chemotherapeutic anticancer agents able to raise and A. Abbate for the statistical analysis. This work is dedicated to the memory of the intracellular iron content (72) could be envisaged as Tullio Battista who gave his invaluable contribution during the early phases of this candidates for clinical testing. project.

References 1. Newton Bishop JA. Molecular pathology of mela- 3. Nyormoi O, Bar-Eli M. Transcriptional regulation of differentially expressed messenger RNAs in human noma. Cancer Metastasis Rev 1997;16:141 ^ 54. metastasis-related genes in human melanoma. Clin melanoma cell lines with different metastatic capacity 2. Welch DR, Goldberg SF. Molecular mechanisms con- Exp Metastasis 2003;20:251 ^ 63. by messenger RNA differential display. Cancer Res trolling human melanoma progression and metastasis. 4. van Groningen JJ, Bloemers HP, Swart GW. Identi- 19 9 5;55 : 6237 ^ 4 3. Pathobiology 1997;65:311^ 30. fication of melanoma inhibitory activity and other 5. Hashimoto Y, Shindo-Okada N, Tani M, Takeuchi K,

Clin Cancer Res 2005;11(9) May 1,2005 3182 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. Ferritin in Human Melanoma Progression

Toma H,Yokota J. Identification of genes differentially from the soluble form of the transferrin homologue, 51. Cen D, Gonzalez RI, Buckmeier JA, Kahlon RS, expressed in association with metastatic potential of melanotransferrin. Redox Rep 2002;7:279 ^ 82. Tohidian NB, Meyskens FL Jr. Disulfiram induces ap- K-1735 murine melanoma by messenger RNA differen- 29. Baldi A, De Luca A, Claudio PP, et al. The Rb2/p130 optosis in human melanoma cells: a redox-related tial display. Cancer Res 1996;56:5266 ^ 71. gene product is a nuclear protein whosephosphorylation process. Mol CancerTher 2002;1:197 ^ 204. 6. Simon HG, Risse B, Jost M, Oppenheimer S, Kari C, is cellcycle regulated. JCell Biochem1995;59:402^8. 52. Rossiello R, Carriero MV, Giordano GG. Distribution Rodeck U. Identification of differentially expressed 30. Lombardi D, Palescandolo E, Giordano A, Paggi of ferritin, transferrin and lactoferrin in breast carci- messenger RNAs in human melanocytes and melano- MG. Interplay between the antimetastatic nm23 and noma tissue. J Clin Pathol 1984;37:51 ^ 5. ma cells. Cancer Res 1996;56:3112^ 7. the retinoblastoma-related Rb2/p130 genes in pro- 53. Fleming S. Immunocytochemicallocalization of ferritin 7. Ishiguro T, Nakajima M, Naito M, Muto T, Tsuruo T. moting neuronal differentiation of PC12 cells. Cell in the kidney and renal tumours. Eur Urol1987;13:407 ^ 11. Identification of genes differentially expressed in B16 Death Differ 2001;8:470 ^ 6. 54. Carter RL, Hall JM, Corbett RP.Immunohistochem- murine melanoma sublines with different metastatic 31. Albini A, Iwamoto Y, Kleinman HK, et al. A rapid ical staining for ferritin in neuroblastomas.Histopathol- potentials. Cancer Res 1996;56:875 ^ 9. in vitro assay for quantitating the invasive potential of ogy1991;18:465 ^ 8. 8. Duncan LM, Deeds J, Hunter J, et al. Down- tumor cells. Cancer Res 1987;47:3239 ^ 45. 55. YangHB,HsuPI,LeeJC,ChanSH,LinXZ,Chow regulation of the novel gene melastatin correlates with 32. Spitz DR, Oberley LW. An assay for superoxide dis- NH. Adenoma-carcinoma sequence: a reappraisal potential for melanoma metastasis. Cancer Res 1998; mutase activity in mammalian tissue homogenates. with immunohistochemical expression of ferritin. 58:1515^20. Anal Biochem 1989;179:8 ^ 18. J Surg Oncol 1995;60:35 ^ 40. 9. Zendman AJ, Cornelissen IM,Weidle UH, Ruiter DJ, 33. Clairborne A. Catalase activity. In: Greenwald RA, 56.WeberA, Engers R, Nockemann S, Gohr LL, Zur HA, van Muijen GN. TM7XN1, a novel human EGF-TM7- editor. Handbook of methods for oxygen radical re- Gabbert HE. Differentially expressed genes in associa- like cDNA, detected with mRNA differential display search. Boca Raton (FL): CRC; 1985. p. 283 ^ 4. tion with in vitro invasiveness of human epithelioid using human melanoma cell lines with different meta- 34. Burton GW, Webb A, Ingold KU. A mild, rapid, and sarcoma. Mol Pathol 2001;54:324 ^ 30. static potential. FEBS Lett 1999;446:292 ^8. efficient method of lipid extraction for use in determin- 57. Hazard JT, Drysdale JW. Ferritinaemia in cancer. 10. Huang F, Adelman J, Jiang HP, Goldstein NI, Fisher ing vitamin E/lipid ratios. Lipids 1985;20:29 ^ 39. Nature 1977;265:755 ^ 6. PB. Identification and temporal expression pattern of 35. Picardo M, Grammatico P, Roccella F, et al. Imbal- 58. Luger TA, Linkesch W, Knobler R, Kokoschka EM. genes modulated during irreversible growth arrest ance in the antioxidant pool in melanoma cells and Serial determination of serum ferritin levels in patients and terminal differentiation in human melanoma cells. normal melanocytes from patients with melanoma. with malignant melanoma. Oncology1983;40:263 ^ 7. Oncogene 1999;18:3546 ^ 52. J Invest Dermatol 1996;107:322^ 6. 59. Kikyo N, Suda M, Kikyo N, et al. Purification and 11. Clark EA, GolubTR, Lander ES, Hynes RO. Genomic 36. Jentzsch AM, Bachmann H, Furst P, Biesalski HK. characterization of a cell growth factor from a human analysis of metastasis reveals an essential role for Improved analysis of malondialdehyde in human body leukemia cell line: immunological identity with ferritin. RhoC. Nature 2000;406:532^5. fluids. Free Radic Biol Med 1996;20:251 ^ 6. Cancer Res 1994;54:268 ^ 71. 12. Bittner M, Meltzer P, ChenY, et al. Molecular classi- 37. Passi S, Morrone A, De Luca C, Picardo M, Ippolito 60. Gray CP, Franco AV, Arosio P, Hersey P. Immuno- fication of cutaneous malignant melanoma by gene F. Blood levels of vitamin E, polyunsaturated fatty suppressive effects of melanoma-derived heavy-chain expression profiling. Nature 2000;406:536 ^ 40. acids of phospholipids, lipoperoxides and glutathione ferritin are dependent on stimulation of IL-10 produc- 13. Leonetti C, BiroccioA, CandiloroA, et al. Increase of peroxidase in patients affected with seborrheic der- tion. Int J Cancer 2001;92:843 ^ 50. cisplatin sensitivity by c-myc antisense oligodeoxynu- matitis. J Dermatol Sci 1991;2:171 ^ 8. 61. Chedekel MR. Photochemistry and photobiology of cleotides in a human metastatic melanoma inherently 38. Bradford MM. A rapid and sensitive method for the epidermal melanins. Photochem Photobiol 1982;35: resistant to cisplatin. Clin Cancer Res1999;5:2588^95. quantitation of microgram quantities of protein utiliz- 881^5. 14. Baldi A, BattistaT, De Luca A, et al. Identification of ing the principle of protein-dye binding. Anal Biochem 62. Meyskens FL Jr, Buckmeier JA, McNulty SE, genes down-regulated during melanoma progression: 1976;72:248 ^ 54. Tohidian NB. Activation of nuclear factor-nBin a cDNA array study. Exp Dermatol 2003;12:213^ 8. 39. Luzzago A, Arosio P, Iacobello C, et al. Immuno- human metastatic melanoma cells and the effect of 15. Le NT, Richardson DR. The role of iron in cell cycle chemical characterization of human liver and heart fer- oxidative stress. Clin Cancer Res 1999;5:1197 ^ 202. progression and the proliferation of neoplastic cells. ritins with monoclonal antibodies. Biochim Biophys 63. Pham CG, Bubici C, Zazzeroni F, et al. Ferritin heavy Biochim Biophys Acta 2002;1603:31 ^ 46. Acta 1986;872:61 ^ 71. chain upregulation by NF-nB inhibits TNFa-induced 16. Torti FM, Torti SV. Regulation of ferritin genes and 40. Francanzani AL, Fargion S, Romano R, et al. Im- apoptosis by suppressing reactive oxygen species. protein. Blood 2002;99:3505 ^ 16. munohistochemical evidence for a lack of ferritin in Cell 2004;119:529^ 42. 17. Harrison PM, Arosio P. The ferritins: molecular prop- duodenal absorptive epithelial cells in idiopathic he- 64. Rohrdanz E, Schmuck G, Ohler S, Tran-Thi QH, erties, iron storage function and cellular regulation. mochromatosis. Gastroenterology 1989;96:1071 ^ 8. Kahl R. Changes in antioxidant enzyme expression in Biochim Biophys Acta 1996;1275:161 ^ 203. 41. Garrone P, Neidhardt EM, Garcia E, Galibert L, van response to hydrogen peroxide in rat astroglial cells. 18. Boyd D, Vecoli C, Belcher DM, Jain SK, Drysdale Kooten C, Banchereau J. Fas ligation induces apopto- ArchToxicol 2001;75:150 ^ 8. JW. Structural and functional relationships of human sis of CD40-activated human B lymphocytes. J Exp 65. Meewes C, Poswig A, Dissemond J, Brenneisen P, ferritin H and L chains deduced from cDNA clones. Med 1995;182:1265 ^ 73. Scharffetter-Kochanek K. Adaptive antioxidant JBiol Chem 1985;260:11755^61. 42. Nagata S, Golstein P. The Fas death factor. Science defence in human dermal fibroblasts. Br J Dermatol 19. Bomford AB, Munro HN. Ferritin gene expression in 1995;267:1449^56. 2000;143:662 ^ 3. health and malignancy. Pathobiology 1992;60:10 ^ 8. 43. Fulda S, Sieverts H, Friesen C, Herr I, Debatin KM. 66. Meewes C, Brenneisen P, Wenk J, et al. Adaptive 20. Hentze MW, Kuhn LC. Molecular control of verte- The CD95 (APO-1/Fas) system mediates drug- antioxidant response protects dermal fibroblasts from brateironmetabolism:mRNA-basedregulatorycircuits induced apoptosis in neuroblastoma cells. Cancer Res UVA-induced phototoxicity. Free Radic Biol Med operatedby iron, nitric oxide, andoxidative stress. Proc 1997;57:3823 ^ 9. 2001;30:238 ^ 47. Natl Acad Sci US A 1996;93:8175 ^ 82. 44. Ariza ME, Broome-Powell M, Lahti JM, Kidd VJ, 67. ArmeniT, Battino M, Stronati A, et al.Total antioxidant 21.Vaughn CB, Weinstein R, Bond B, et al. Ferritin con- Nelson MA. Fas-induced apoptosis in human malig- capacity andnuclear DNA damage in keratinocytes after tent in human cancerous and noncancerous colonic nant melanoma cell lines is associated with the acti- exposure to H2O2. Biol Chem 2001;382:1697^705. tissue. Cancer Invest 1987;5:7 ^ 10. vation of the p34(cdc2)-related PITSLRE protein 68. Yohn JJ, Norris DA, Yrastorza DG, et al. Disparate 22. Guner G, Kirkali G, Yenisey C, Tore IR. Cytosol and kinases. J Biol Chem 1999;274:28505 ^ 13. antioxidant enzyme activities in cultured human cuta- serum ferritin in breast carcinoma. Cancer Lett 1992; 45. Chow CK.Vitamin E and oxidative stress. Free Radic neous fibroblasts, keratinocytes, and melanocytes. 67:103 ^ 12. Biol Med 1991;11:215^ 32. J Invest Dermatol 1991;97:405 ^ 9. 23. Weinstein RE, Bond BH, Silberberg BK.Tissue ferri- 46. Sheridan AM, Fitzpatrick S, Wang C, Wheeler DC, 69. Gutteridge JM. Biological origin of free radicals, tin concentration in carcinoma of the breast. Cancer Lieberthal W. Lipid peroxidation contributes to hydro- and mechanisms of antioxidant protection. Chem Biol 1982;50:2406^9. gen peroxide induced cytotoxicity in renal epithelial Interact 1994;91:133^40. 24. Cohen C, Shulman G, Budgeon LR. Immunohisto- cells. Kidney Int 1996;49:88 ^ 93. 70. Minotti G, Aust SD.The role of iron in oxygen radical chemical ferritin in testicular seminoma. Cancer 1984; 47. Kulp KS, Green SL,Vulliet PR. Iron deprivation inhibits mediated lipid peroxidation. Chem Biol Interact 1989; 54:2190^4. cyclin-dependent kinase activity and decreases cyclin D/ 71:1 ^ 19. 25. Meyskens FL Jr, McNulty SE, Buckmeier JA, et al. CDK4 proteinlevels inasynchronous MDA-MB-453hu- 71. Maresca V, Roccella M, Roccella F, et al. Increased Aberrant redox regulation in human metastatic mela- manbreastcancer cells. Exp Cell Res 1996;229:60^8. sensitivity to peroxidative agents as a possible patho- noma cells compared to normal melanocytes. Free 48. Hileti D, Panayiotidis P, Hoffbrand AV. Iron chelators genic factor of melanocyte damage in vitiligo. J Invest Radic Biol Med 2001;31:799 ^ 808. induce apoptosis in proliferating cells. Br J Haematol Dermatol 1997;109:310 ^ 3. 26. Kwok JC, Richardson DR. The iron metabolism of 1995;89 :181 ^ 7. 72. Kwok JC, Richardson DR. Anthracyclines induce neoplastic cells: alterations that facilitate proliferation? 49. Leardi A, Caraglia M, Selleri C, et al. Desferioxamine accumulation of iron in ferritin in myocardial and neo- Crit Rev Oncol Hematol 2002;42:65 ^ 78. increases iron depletion and apoptosis induced by ara- plastic cells: inhibition of the ferritin iron mobilization 27. Richardson DR. The role of the membrane-bound C of human myeloid leukaemic cells. Br J Haematol pathway. Mol Pharmacol 2003;63:849 ^ 61. tumour antigen, melanotransferrin (p97), in iron up- 1998;102:746 ^52. 73. WeeraratnaAT,BeckerD,CarrKM,etal.Generation take by the human malignant melanoma cell. Eur J 50. Meyskens FL Jr, Farmer P, Fruehauf JP. Redox reg- and analysis of melanoma SAGE libraries: SAGE advice Biochem 2000;267:1290 ^ 8. ulation in human melanocytes and melanoma. Pigment on the melanoma transcriptome. Oncogene 2004;23: 28. Food MR, Des RR. Iron uptake by melanoma cells Cell Res 2001;14:148 ^ 54. 2264^74.

www.aacrjournals.org 3183 Clin Cancer Res 2005;11(9) May 1, 2005 Downloaded from clincancerres.aacrjournals.org on October 2, 2021. © 2005 American Association for Cancer Research. Ferritin Contributes to Melanoma Progression by Modulating Cell Growth and Sensitivity to Oxidative Stress

Alfonso Baldi, Daniela Lombardi, Patrizia Russo, et al.

Clin Cancer Res 2005;11:3175-3183.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/11/9/3175

Cited articles This article cites 72 articles, 20 of which you can access for free at: http://clincancerres.aacrjournals.org/content/11/9/3175.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/11/9/3175.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/11/9/3175. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.