DOCSLIB.ORG

The SOS and Rpos Regulons Contribute to Bacterial Cell Robustness to Genotoxic Stress by Synergistically Regulating DNA-Polymerase Pol II

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The SOS and Rpos Regulons Contribute to Bacterial Cell Robustness to Genotoxic Stress by Synergistically Regulating DNA-Polymerase Pol II Genetics: Early Online, published on May 3, 2017 as 10.1534/genetics.116.199471 GENETICS | INVESTIGATION The SOS and RpoS regulons contribute to bacterial cell robustness to genotoxic stress by synergistically regulating DNA-polymerase Pol II Tanja Dapa∗, Sébastien Fleurier∗, Marie-Florence Bredeche∗ and Ivan Matic∗,†,1 ∗INSERM U1001, Université Paris Descartes, Sorbonne Paris Cité, Faculté de Médecine Paris Descartes, 24 rue du Faubourg Saint-Jacques, Paris 75014, France, †Centre National de la Recherche Scientifique, 75016 Paris, France ABSTRACT Mitomycin C (MMC) is a genotoxic agent that induces DNA cross-links, DNA alkylation, and the production of reactive oxygen species (ROS). MMC induces the SOS response and RpoS regulons in Escherichia coli. SOS-encoded functions are required for DNA repair, whereas the RpoS regulon is typically induced by metabolic stresses that slow growth. Thus, induction of the RpoS regulon by MMC may be coincidental, because DNA damage slows growth; alternatively, the RpoS regulon may be an adaptive response contributing to cell survival. In this study, we show that the RpoS regulon is primarily induced by MMC-induced ROS production. We also show that RpoS regulon induction is required for the survival of MMC-treated growing cells. The major contributor to RpoS-dependent resistance to MMC treatment is DNA polymerase Pol II, which is encoded by the polB gene belonging to the SOS regulon. The observation that polB gene expression is controlled by the two major stress response regulons that are required to maximize survival and fitness further emphasizes the key role of this DNA polymerase as an important factor in genome stability. KEYWORDS Escherichia coli; SOS; RpoS; DNA Polymerase II; Mitomycin C LL organisms are continuously exposed to multiple environ- nucleotide excision repair (NER), translesion-synthesis (TLS) A mental stresses throughout their life cycles (Foster 2007). and homologous recombination (HR) (Radman 1975; Little and Moreover, many physiological functions generate toxic com- Mount 1982; Walker et al. 1982). During normal growth, genes pounds, which are potentially harmful to cells (Iuchi and Weiner belonging to the SOS regulon are repressed by the LexA pro- 1996). Consequently, all living organisms possess a plethora tein. The SOS response can be induced by a wide variety of of mechanisms that allow them to respond and counteract the stressors, with one common characteristic: they all result in the deleterious effects of external and internal stressors. The ubiqui- appearance of persistent single-stranded DNA (ssDNA). The tous presence in nature of molecular mechanisms that maintain persistent contact with ssDNA activates the co-protease activity genome integrity strongly suggests that genome stability is one of the RecA protein, which promotes proteolytic auto-cleavage of the most relevant fitness determinants for all living organisms of the repressor, LexA protein, thus activating the SOS response (Friedberg et al. 2005). One of the best-understood systems for (Little and Mount 1982; Walker et al. 1982). When DNA damage the maintenance of genome integrity is the SOS response, which is repaired, persistent ssDNA disappears, and the SOS regulon is widespread among bacteria (Michel 2005). is again repressed. The SOS response in Escherichia coli is a coordinated cellu- Interstrand DNA cross-links are potent inducers of the SOS lar response to DNA damage that involves at least 40 genes, response in bacteria. These DNA lesions are extremely dan- many of which encode proteins with DNA repair functions, e.g., gerous because even a single unrepaired DNA cross-link per genome can be lethal for the bacterium (Szybalski and Iyer 1964). Copyright © 2017 by the Genetics Society of America Several exogenous and endogenous DNA damage agents cause doi: 10.1534/genetics.XXX.XXXXXX DNA interstrand cross-links (Ali-Osman et al. 1995; Rudd et al. st Manuscript compiled: Monday 1 May, 2017% 1995; Poklar et al. 1996; Wu et al. 2005; Colis et al. 2008). In E. 1INSERM U1001, Université Paris Descartes, Sorbonne Paris Cité, Faculté de Médecine Paris Descartes, 24 rue du Faubourg Saint-Jacques, Paris 75014, France coli, two known pathways are capable of repairing interstrand Tel: +33 1 4061 5325; Fax: +33 1 4061 5322; Email: [email protected] DNA cross-links. The first pathway, which involves NER, HR Genetics, Vol. XXX, XXXX–XXXX May 2017 1 Copyright 2017. and DNA polymerase I (PolA), has been described to success- but its activation after MMC treatment may also be a specific fully repair psoralen-induced DNA crosslinks (Van et al. 1986; adaptive response that contributes to cell survival under geno- Sladek et al. 1989; Slater and Maurer 1993). The second pathway toxic stress. In this study, we show that the RpoS regulon is involves NER, which acts together with the SOS-regulated DNA primarily induced by MMC-induced ROS production and that polymerase II, and repairs nitrogen mustard (HN2)-induced RpoS regulon induction is required for the survival of growing DNA cross-links (Berardini et al. 1999). cells treated with MMC. Moreover, we show that the expression Mitomycin C (MMC) strongly induces the SOS response in E. of the polB gene, which encodes SOS-regulated polymerase Pol coli. MMC is a mono- and bi-functional alkylating agent and a II, is also co-regulated by RpoS. Our data show that Pol II is a potent cross-linker with a remarkable capacity to generate inter- major contributor to the repair of MMC-induced DNA lesions. strand DNA cross-links by reacting specifically with guanines of This finding further demonstrates the involvement of the RpoS the complementary DNA at CpG sequences Yu and Pan (1993); regulon in the response to genotoxic stress. Therefore, our study Tomasz (1995); Tomasz and Palom (1997). In addition, MMC can shows that the SOS and RpoS regulons synergistically contribute also act as an oxidizing agent, because its reduction by NaBH4 to the robustness of bacterial cells facing genotoxic stressors. or by NADPH, in the presence O2, results in the generation of H2O2 (Tomasz 1976; Doroshow 1986). MMC can oxidize when Materials and Methods it is present in a free state in the cell, or when it is irreversibly Bacterial strains bound to DNA (Tomasz 1976). Consequently, MMC causes a myriad of deleterious effects in eukaryotic and prokaryotic cells, All strains used in this study were derivatives of the Escherichia including inhibition of DNA synthesis, increased mutagenesis, coli K12 MG1655 strain (Table 1). One of the consequences of chromosome breakage, stimulation of genetic recombination SOS induction is SulA-mediated cell filamentation (Gottesman and sister chromatid exchange (Tomasz 1995). Thus, MMC is et al. 1981). Because filamentation impedes precise quantification widely used in cancer therapies as an antitumor drug (Bradner of different MMC-induced phenotypes, we used the MG1655 2001). DsulA strain as a reference strain (RS). Owing to the lack of fila- mentation, the DsulA strain had a higher minimum inhibitory In E. coli, DNA cross-links are repaired by NER, HR and TLS concentration (MIC) than does the wild-type strain MG1655, i.e. systems (Van et al. 1986; Sladek et al. 1989; Slater and Maurer 1.5 µg ml−1 and 0.5 µg ml−1, respectively. All other strains were 1993; Berardini et al. 1999), whereas damage caused by mono- derivatives of the reference strain. The strains were constructed functional alkylation and oxidation is repaired by DNA base by P1vir transduction (Silhavy et al. 1984) of the mutant alle- excision repair (Cunningham et al. 1986; Suvarnapunya et al. les from either the Keio collection or from our own laboratory 2003; Hornback and Roop 2006). collection. However, MMC treatment does activate other pathways be- Strain TD15 DlexA (lexA(def)) was constructed using the yond the SOS response in E. coli. Transcriptomic analysis has l Red recombination system (Datsenko and Wanner 2000; shown that more than 1000 genes are activated in response to Murphy et al. 2000; Yu et al. 2000) in a DsulA background. The MMC (Khil and Camerini-Otero 2002), many of which have not sequences of the primers used for the lexA(def) mutant were been previously associated with DNA damage. For example, as follows: OTD5: ATGAAAGCGTTAACGGCCAGGCAA- the list of genes activated by MMC includes many members CAAGAGGTGTTTGTGTAGGCTGGAGCTGCTTC; OTD6: of the general stress response network, which is regulated by TTACAGCCAGTCGCCGTTGCGAATAACCCCAACCGC- the alternative RNA polymerase sigma factor RpoS, (sS) (We- CATATGAATATCCTCCTTAG. The lexA(def) construct was ber et al. 2005). This stress response is induced when bacterial subsequently transferred to the reference strain through P1vir growth decreases or when cells are exposed to starvation or to transduction. When needed, the KanR cassette was removed by various stresses, such as antibiotics, osmotic or oxidative stress expressing Flp recombinase from plasmid pCP20 as described in (Bouveret and Battesti 2011; Gutierrez et al. 2013). The induction (Datsenko and Wanner 2000). All strains were verified by PCR. of this regulon results in downregulation of genes required for The complementation plasmid for Pol II (ppolB+) was kindly rapid growth and upregulation of genes involved in protection, provided by the laboratory of Robert Fuchs. The plasmid was repair and maintenance of the cell. Consequently, cells enter a constructed by amplifying the polB gene expressed from its na- multi-resistant state. tive promoter/operator region and cloning into the low copy RpoS regulon induction is subjected to complex regulation, number vector pWKS130 derived from pSC101 (Becherel and which is controlled at all levels of rpoS gene expression, i.e. tran- Fuchs 2001). Liquid cultures were grown in Lysogeny Broth scription, translation and protein stability, as well as through the medium (LB, BD Difco) at 37° with shaking at 150 r.p.m. When control of RNA polymerase (RNAP) activity (Hengge-Aronis needed, the medium was supplemented with the appropriate 1996). Approximately 10% of the E.
Load more

Recommended publications
  • A Review and Appraisal of the DNA Damage Theory of Ageing
    Mutation Research 728 (2011) 12–22 Contents lists available at ScienceDirect Mutation Research/Reviews in Mutation Research jo urnal homepage: www.elsevier.com/locate/reviewsmr Co mmunity address: www.elsevier.com/locate/mutres Review A review and appraisal of the DNA damage theory of ageing a,b a, Alex A. Freitas , Joa˜o Pedro de Magalha˜es * a Integrative Genomics of Ageing Group, Institute of Integrative Biology, University of Liverpool, Biosciences Building, Crown Street, Liverpool, L69 7ZB, UK b School of Computing and Centre for BioMedical Informatics, University of Kent, Canterbury, CT2 7NF, UK A R T I C L E I N F O A B S T R A C T Article history: Given the central role of DNA in life, and how ageing can be seen as the gradual and irreversible Received 10 February 2011 breakdown of living systems, the idea that damage to the DNA is the crucial cause of ageing remains a Received in revised form 2 May 2011 powerful one. DNA damage and mutations of different types clearly accumulate with age in mammalian Accepted 3 May 2011 tissues. Human progeroid syndromes resulting in what appears to be accelerated ageing have been Available online 10 May 2011 linked to defects in DNA repair or processing, suggesting that elevated levels of DNA damage can accelerate physiological decline and the development of age-related diseases not limited to cancer. Keywords: Higher DNA damage may trigger cellular signalling pathways, such as apoptosis, that result in a faster Ageing depletion of stem cells, which in turn contributes to accelerated ageing.
    [Show full text]
  • Subcellular Localization in Bacteria: from Envz/Ompr to Transertion
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Summer 2011 Subcellular Localization in Bacteria: From EnvZ/OmpR to Transertion Elizabeth Libby University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Biological and Chemical Physics Commons, and the Microbiology Commons Recommended Citation Libby, Elizabeth, "Subcellular Localization in Bacteria: From EnvZ/OmpR to Transertion" (2011). Publicly Accessible Penn Dissertations. 974. https://repository.upenn.edu/edissertations/974 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/974 For more information, please contact [email protected]. Subcellular Localization in Bacteria: From EnvZ/OmpR to Transertion Abstract The internal structures of the bacterial cell and the associated dynamic changes as a function of physiological state have only recently begun to be characterized. Here we explore two aspects of subcellular localization in E. coli cells: the cytoplasmic distribution of the response regulator OmpR and its regulated chromosomal genes, and the subcellular repositioning of chromosomal loci encoding membrane proteins upon induction. To address these questions by quantitative fluorescence microscopy, we developed a simple system to tag virtually any chromosomal location with arrays of lacO or tetO by extending and modifying existing tools. An unexplained subcellular localization was reported for a functional fluorescent protein fusion to the response regulator OmpR in Escherichia coli. The pronounced regions of increased fluorescence, or foci, are dependent on OmpR phosphorylation, and do not occupy fixed, easily identifiable positions, such as the poles or midcell. Here we show that the foci are due to OmpR-YFP binding specific sites in the chromosome.
    [Show full text]
  • Biological Circuits with Small RNA Switches
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Stealth regulation: biological circuits with small RNA switches Susan Gottesman Laboratory of Molecular Biology, National Cancer Institute, Bethesda, Maryland 20892, USA So you thinkyou finally understand the regulation of temporal RNAs (stRNAs) or microRNAs, and that these your favorite gene? The transcriptional regulators have RNAs are processed by some of the same protein cofac- been identified; the signaling cascades that regulate syn- tors as is RNAi, have put regulatory RNAs in the spot- thesis and activity of the regulators have been found. light in eukaryotes as well. Recent searches have con- Possibly you have found that the regulator is itself un- firmed that flies, worms, plants, and humans all harbor stable, and that instability is necessary for proper regu- significant numbers of small RNAs likely to play regu- lation. Time to lookfor a new project, or retire and rest latory roles. on your laurels? Not so fast—there’s more. It is rapidly Along with the rapid expansion in RNAs doing inter- becoming apparent that another whole level of regula- esting things, has come a proliferation of nomenclature. tion lurks, unsuspected, in both prokaryotic and eukary- Noncoding RNAs (ncRNA) has been used recently, as otic cells, hidden from our notice in part by the tran- the most general term (Storz 2002). Among the noncod- scription-based approaches that we usually use to study ing RNAs, the subclass of relatively small RNAs that gene regulation, and in part because these regulators are frequently act as regulators have been called stRNAs very small targets for mutagenesis and are not easily (small temporal RNAs, eukaryotes) and sRNAs (small found from genome sequences alone.
    [Show full text]
  • Fur Is the Master Regulator of the Extraintestinal Pathogenic
    Downloaded from RESEARCH ARTICLE crossmark Fur Is the Master Regulator of the Extraintestinal Pathogenic mbio.asm.org Escherichia coli Response to Serum on August 3, 2015 - Published by Sagi Huja,a Yaara Oren,a Dvora Biran,a Susann Meyer,b Ulrich Dobrindt,c Joerg Bernhard,b Doerte Becher,b Michael Hecker,b Rotem Sorek,d Eliora Z. Rona,e Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israela; Institute for Microbiology, Ernst-Moritz-Arndt-Universität, Greifswald, Germanyb; Institute of Hygiene, Westfälische Wilhelms-Universität, Münster, Germanyc; Department of Molecular Genetics Weizmann Institute of Science, Rehovot, Israeld; MIGAL, Galilee Research Center, Kiriat Shmona, Israele ABSTRACT Drug-resistant extraintestinal pathogenic Escherichia coli (ExPEC) strains are the major cause of colisepticemia (coli- bacillosis), a condition that has become an increasing public health problem in recent years. ExPEC strains are characterized by high resistance to serum, which is otherwise highly toxic to most bacteria. To understand how these bacteria survive and grow in serum, we performed system-wide analyses of their response to serum, making a clear distinction between the responses to nu- tritional immunity and innate immunity. Thus, mild heat inactivation of serum destroys the immune complement and abolishes mbio.asm.org the bactericidal effect of serum (inactive serum), making it possible to examine nutritional immunity. We used a combination of deep RNA sequencing and proteomics in order to characterize ExPEC genes whose expression is affected by the nutritional stress of serum and by the immune complement. The major change in gene expression induced by serum—active and inactive—in- volved metabolic genes.
    [Show full text]
  • Journal of Microbiological Methods a Proteome-Wide Screen to Identify Transcription Factors Interacting with the Vibrio Cholerae
    Journal of Microbiological Methods 165 (2019) 105702 Contents lists available at ScienceDirect Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth Note A proteome-wide screen to identify transcription factors interacting with the Vibrio cholerae rpoS promoter T ⁎ ⁎ Julio C. Ayala1, Jorge A. Benitez , Anisia J. Silva Morehouse School of Medicine, Department of Microbiology, Biochemistry and Immunology, 720 Westview Dr., SW, Atlanta, GA 30310, USA ABSTRACT We describe a proteomic approach to identify transcription factors binding to a target promoter. The method's usefulness was tested by identifying proteins binding to the Vibrio cholerae rpoS promoter in response to cell density. Proteins identified in this screen included the nucleoid-associated protein Fis and the quorum sensing regulator HapR. Isolation of regulatory mutants has played a major role in increasing with agitation at 37 °C to stationary phase. Culture media were sup- our understanding of the regulation of gene expression (Shuman and plemented with ampicillin (Amp, 100 μg/mL), kanamycin (Km, 25 μg/ Silhavy, 2003). There are cases, however, in which the above approach mL), polymyxin B (PolB, 100 units/mL) or L-arabinose (0.2%) as re- can encounter significant obstacles. For instance, the methods used to quired. Chromosomal deletions of fis and/or hapR were created in strain genetically manipulate model organisms are not always equally effec- C7258ΔlacZ by allelic exchange as described previously (Wang et al., tive in less studied microorganisms; some regulatory mutations can be 2011; Wang et al., 2012; Wang et al., 2014). Briefly, genomic DNA highly pleiotropic, often be deleterious, unstable and difficult to select.
    [Show full text]
  • Genome-Wide Transcriptional Response to Varying Rpos Levels
    RESEARCH ARTICLE crossm Genome-Wide Transcriptional Response Downloaded from to Varying RpoS Levels in Escherichia coli K-12 Garrett T. Wong,a* Richard P. Bonocora,b Alicia N. Schep,a* Suzannah M. Beeler,a* Anna J. Lee Fong,a* Lauren M. Shull,a* Lakshmi E. Batachari,a Moira Dillon,a Ciaran Evans,c* Carla J. Becker,a Eliot C. Bush,a Johanna Hardin,c http://jb.asm.org/ Joseph T. Wade,b,d Daniel M. Stoebela Department of Biology, Harvey Mudd College, Claremont, California, USAa; Wadsworth Center, New York State Department of Health, Albany, New York, USAb; Department of Mathematics, Pomona College, Claremont, California, USAc; Department of Biomedical Sciences, School of Public Health, University at Albany, SUNY, Albany, New York, USAd ABSTRACT The alternative sigma factor RpoS is a central regulator of many stress on April 17, 2017 by CALIFORNIA INSTITUTE OF TECHNOLOGY responses in Escherichia coli. The level of functional RpoS differs depending on the Received 21 October 2016 Accepted 12 stress. The effect of these differing concentrations of RpoS on global transcriptional January 2017 Accepted manuscript posted online 23 responses remains unclear. We investigated the effect of RpoS concentration on the January 2017 transcriptome during stationary phase in rich media. We found that 23% of genes in Citation Wong GT, Bonocora RP, Schep AN, the E. coli genome are regulated by RpoS, and we identified many RpoS-transcribed Beeler SM, Lee Fong AJ, Shull LM, Batachari LE, genes and promoters. We observed three distinct classes of response to RpoS by Dillon M, Evans C, Becker CJ, Bush EC, Hardin J, Wade JT, Stoebel DM.
    [Show full text]
  • Regulatory Interplay Between Small Rnas and Transcription Termination Factor Rho Lionello Bossi, Nara Figueroa-Bossi, Philippe Bouloc, Marc Boudvillain
    Regulatory interplay between small RNAs and transcription termination factor Rho Lionello Bossi, Nara Figueroa-Bossi, Philippe Bouloc, Marc Boudvillain To cite this version: Lionello Bossi, Nara Figueroa-Bossi, Philippe Bouloc, Marc Boudvillain. Regulatory interplay be- tween small RNAs and transcription termination factor Rho. Biochimica et Biophysica Acta - Gene Regulatory Mechanisms , Elsevier, 2020, pp.194546. 10.1016/j.bbagrm.2020.194546. hal-02533337 HAL Id: hal-02533337 https://hal.archives-ouvertes.fr/hal-02533337 Submitted on 6 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Regulatory interplay between small RNAs and transcription termination factor Rho Lionello Bossia*, Nara Figueroa-Bossia, Philippe Bouloca and Marc Boudvillainb a Université Paris-Saclay, CEA, CNRS, Institute for Integrative Biology of the Cell (I2BC), 91198, Gif-sur-Yvette, France b Centre de Biophysique Moléculaire, CNRS UPR4301, rue Charles Sadron, 45071 Orléans cedex 2, France * Corresponding author: [email protected] Highlights Repression
    [Show full text]
  • Osmosensing by the Bacterial Phoq/Phop Two-Component System
    Osmosensing by the bacterial PhoQ/PhoP two-component system Jing Yuana,b,1, Fan Jina,b, Timo Glattera, and Victor Sourjika,b,1 aMax Planck Institute for Terrestrial Microbiology, 35043 Marburg, Germany; and bLOEWE Center for Synthetic Microbiology (SYNMIKRO), 35043 Marburg, Germany Edited by Susan Gottesman, National Institutes of Health, Bethesda, MD, and approved November 6, 2017 (received for review October 5, 2017) The PhoQ/PhoP two-component system plays an essential role in domain and the cytoplasmic domains (10, 11), with the latter the response of enterobacteria to the environment of their mam- detecting the cytoplasmic pH change. The PhoQ TM domain is a malian hosts. It is known to sense several stimuli that are poten- dimer of two TM helices that form a four-helix bundle (12). tially associated with the host, including extracellular magnesium Upon activation of the sensory domain, the periplasmic ends of limitation, low pH, and the presence of cationic antimicrobial the two TM1 helices move closer to each other and push the two peptides. Here, we show that the PhoQ/PhoP two-component TM2 helices farther apart, accompanied by a TM2 rotation, systems of Escherichia coli and Salmonella can also perceive an which requires the solvation of a semichannel in the four-helix osmotic upshift, another key stimulus to which bacteria become bundle (12). Asn202, located near the center of the TM2 helix exposed within the host. In contrast to most previously estab- and proximal to this semichannel, affects the solvation of the lished stimuli of PhoQ, the detection of osmotic upshift does not cavity, and mutations of Asn202 to a nonpolar residue lock PhoQ require its periplasmic sensor domain.
    [Show full text]
  • Sral Srna Interaction Regulates the Terminator by Preventing Premature Transcription Termination of Rho Mrna
    SraL sRNA interaction regulates the terminator by preventing premature transcription termination of rho mRNA Inês Jesus Silvaa,1, Susana Barahonaa,2, Alex Eyraudb,2, David Lalaounab, Nara Figueroa-Bossic, Eric Masséb, and Cecília Maria Arraianoa,1 aInstituto de Tecnologia Química e Biológica António Xavier, Universidade Nova de Lisboa, 2780-157 Oeiras, Portugal; bRNA Group, Department of Biochemistry, Faculty of Medicine and Health Sciences, Université de Sherbrooke, Sherbrooke, QC J1E 4K8, Canada; and cInstitute for Integrative Biology of the Cell (I2BC), Commissariat à l’énergie atomique, CNRS, Université Paris-Sud, Université Paris-Saclay, 91198 Gif-sur-Yvette, France Edited by Tina M. Henkin, The Ohio State University, Columbus, OH, and approved December 28, 2018 (received for review July 5, 2018) Transcription termination is a critical step in the control of gene sequence, leading to changes in translation and/or mRNA degra- expression. One of the major termination mechanisms is mediated dation (9–11). However, distinct mechanisms of action have been by Rho factor that dissociates the complex mRNA-DNA-RNA poly- increasingly reported in the literature (11). For instance, the Sal- merase upon binding with RNA polymerase. Rho promotes termina- monella sRNA ChiX was shown to induce premature transcription tion at the end of operons, but it can also terminate transcription termination within the coding sequence of chiP as a result of its within leader regions, performing regulatory functions and avoiding interaction with 5′-UTR of the operon chiPQ, thus affecting the pervasive transcription. Transcription of rho is autoregulated through expression of both genes of the operon (12). Conversely, it was a Rho-dependent attenuation in the leader region of the transcript.
    [Show full text]
  • A Second DNA Methyltransferase Repair Enzyme in Escherichia Coli (Ada-Alb Operon Deletion/O'-Methylguanine/04-Methylthyne/Suicide Enzyme) G
    Proc. Nati. Acad. Sci. USA Vol. 85, pp. 3039-3043, May 1988 Genetics A second DNA methyltransferase repair enzyme in Escherichia coli (ada-alB operon deletion/O'-methylguanine/04-methylthyne/suicide enzyme) G. WILLIAM REBECK, SUSAN COONS, PATRICK CARROLL, AND LEONA SAMSON* Charles A. Dana Laboratory of Toxicology, Harvard School of Public Health, Boston, MA 02115 Communicated by Elkan R. Blout, December 28, 1987 (receivedfor review November 9, 1987) ABSTRACT The Escherichia coli ada-akB operon en- ada gene encodes a 39-kDa DNA methyltransferase with two codes a 39-kDa protein (Ada) that is a DNA-repair methyl- active sites, one that removes methyl groups from O6- transferase and a 27-kDa protein (AlkB) of unknown function. methylguanine (06-MeGua) or 04-methylthymine (04- By DNA blot hybridization analysis we show that the alkyla- MeThy) and one that removes methyl groups from methyl tion-sensitive E. cofi mutant BS23 [Sedgwick, B. & Lindahl, T. phosphotriester lesions (7, 12-15). The Ada protein is one of (1982) J. Mol. Biol. 154, 169-1751 is a deletion mutant lacking several gene products to be induced as E. coli adapt to the entire ada-aik operon. Despite the absence ofthe ada gene become alkylation-resistant upon exposure to low doses of and its product, the cells contain detectable levels of a DNA- alkylating agents (3, 12, 13). The repair of methyl phospho- repair methyltransferase activity. We conclude that the meth- triester lesions converts the Ada protein into a positive yltransferase in BS23 cells is the product of a gene other than regulator ofthe ada gene, and this adaptive response (16) and ada.
    [Show full text]
  • Identification and Characterization of Molecular Targets for Disease Management in Tree Fruit Pathogens
    IDENTIFICATION AND CHARACTERIZATION OF MOLECULAR TARGETS FOR DISEASE MANAGEMENT IN TREE FRUIT PATHOGENS By Jingyu Peng A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of Plant Pathology – Doctor of Philosophy 2020 ABSTRACT IDENTIFICATION AND CHARACTERIZATION OF MOLECULAR TARGETS FOR DISEASE MANAGEMENT IN TREE FRUIT PATHOGENS By Jingyu Peng Fire blight, caused by Erwinia amylovora, is a devastating bacterial disease threatening the worldwide production of pome fruit trees, including apple and pear. Within host xylem vessels, E. amylovora cells restrict water flow and cause wilting symptoms through formation of biofilms, that are matrix-enmeshed surface-attached microcolonies of bacterial cells. Biofilm matrix of E. amylovora is primarily composed of several exopolysaccharides (EPSs), including amylovora, levan, and, cellulose. The final step of biofilm development is dispersal, which allows dissemination of a subpopulation of biofilm cells to resume the planktonic mode of growth and consequentially cause systemic infection. In this work, we demonstrate that identified the Hfq-dependent small RNA (sRNA) RprA positively regulates amylovoran production, T3SS, and flagellar-dependent motility, and negatively affects levansucrase activity and cellulose production. We also identified the in vitro and in vivo conditions that activate RprA, and demonstrated that RprA activation leads to decreased formation of biofilms and promotes the dispersal movement of biofilm cells. This work supports the involvement of RprA in the systemic infection of E. amylovora during its pathogenesis. Bacterial toxin-antitoxin (TA) systems are small genetic loci composed of a proteinaceous toxin and a counteracting antitoxin. In this work, we identified and characterized a chromosomally encoded hok/sok-like type I TA system in Erwinia amylovora Ea1189.
    [Show full text]
  • The Response of Escherichia Coli to the Alkylating Agents Chloroacetaldehyde and Styrene Oxide T
    Mutat Res Gen Tox En 840 (2019) 1–10 Contents lists available at ScienceDirect Mutat Res Gen Tox En journal homepage: www.elsevier.com/locate/gentox The response of Escherichia coli to the alkylating agents chloroacetaldehyde and styrene oxide T Mark M. Muentera, Ariel Aikena, Jadesola O. Akanjia, Samir Baiga, Sirine Belloua, Alyssa Carlsona, Charles Conwaya, Courtney M. Cowella, Nicholas A. DeLateura, Alexis Hestera, Christopher Joshia, Caitlin Kramera, Becky S. Leifera, Emma Nasha, Macee H. Qia, Meghan Traversa, Kelly C. Wonga, Man Hub, Na Goub,d, Roger W. Giesec, April Z. Gub,d, ⁎ Penny J. Beuninga, a Department of Chemistry & Chemical Biology, Northeastern University, Boston, MA, 02115 USA b Department of Civil and Environmental Engineering, Northeastern University, Boston, MA, 02115 USA c Department of Pharmaceutical Sciences, Northeastern University, Boston, MA, 02115 USA d School of Civil and Environmental Engineering, Cornell University, Ithaca, NY, 14850, USA ARTICLE INFO ABSTRACT Keywords: DNA damage is ubiquitous and can arise from endogenous or exogenous sources. DNA-damaging alkylating Transcriptional reporters agents are present in environmental toxicants as well as in cancer chemotherapy drugs and are a constant threat, DNA repair which can lead to mutations or cell death. All organisms have multiple DNA repair and DNA damage tolerance DNA damage pathways to resist the potentially negative effects of exposure to alkylating agents. In bacteria, many of the genes SOS response in these pathways are regulated as part of the SOS reponse or the adaptive response. In this work, we probed the cellular responses to the alkylating agents chloroacetaldehyde (CAA), which is a metabolite of 1,2-di- chloroethane used to produce polyvinyl chloride, and styrene oxide (SO), a major metabolite of styrene used in the production of polystyrene and other polymers.
    [Show full text]