Houde Andree Anne Phd 2015.Pdf

Université de Sherbrooke

PROGRAMMATION MÉTABOLIQUE FŒTALE : ÉTUDE DE L ’IMPACT DE L ’EXPOSITION AU DIABÈTE GESTATIONNEL SUR LE MÉTHYLOME DU NOUVEAU -NÉ

Par Andrée-Anne Houde Programme de Biochimie

Thèse présentée à la Faculté de médecine et des sciences de la santé en vue de l’obtention du grade de Philosophiae Doctor (Ph.D.) en biochimie

Sherbrooke, Québec, Canada Mai, 2015

Membres du jury d’évaluation Guylain Boissonneault – Président de jury Luigi Bouchard – Directeur de recherche Aris Aziz – Évaluateur externe au programme Jacquetta Trasler – Évaluatrice externe à l’Université

À Emma, Victor, Samuel et à mes futurs enfants, Que vos passions vous poussent à dépasser vos limites et à aller au bout de vos rêves et de vos ambitions…

RÉSUMÉ

Programmation métabolique fœtale : étude de l’impact de l’exposition au diabète gestationnel sur le méthylome du nouveau-né

Par Andrée-Anne Houde Programme de Biochimie

Thèse présentée à la Faculté de médecine et des sciences de la santé en vue de l’obtention du diplôme de philosophiae doctor (Ph.D.) en biochimie, Faculté de médecine et des sciences de la santé, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4

L’obésité est un enjeu de société de première importance; elle est un facteur de risque de plusieurs maladies et engendre d’importantes dépenses en santé. Outre l’alimentation, la sédentarité et les prédispositions génétiques, il semble que l’environnement fœtal soit un facteur déterminant dans le développement de l’obésité. En effet, il a été démontré que les nouveau-nés exposés à un environnement intra-utérin défavorable ont un risque accru de développer, à l’adolescence et à l’âge adulte, l’obésité ainsi que les désordres métaboliques qui y sont associés. Le diabète gestationnel (DG) est l’une des complications de santé maternelle les plus fréquentes et est associé à un risque accru à long terme pour la santé métabolique de l’enfant. Malgré les nombreuses données probantes épidémiologiques concernant le phénomène de la programmation fœtale associée au DG, les mécanismes moléculaires impliqués ont été très peu étudiés. Il est cependant de plus en plus évident que l’épigénétique soit l’un de ces mécanismes. Cette thèse a pour objectif d’identifier les changements de méthylation de l’ADN, la modification épigénétique la plus stable et la plus connue, chez les nouveau-nés exposés in utero au DG. Dans un premier temps, la méthylation de l’ADN de 44 échantillons de placenta et de sang de cordon a été analysée à l’échelle du génome. Cette approche a permis de démontrer que les gènes épigénétiquement modifiés suite à une exposition au DG sont majoritairement retrouvés dans les voies biologiques associées aux maladies métaboliques. Des analyses dans une cohorte indépendante (n=80) ont confirmé l’effet de la glycémie maternelle sur la méthylation de l’ADN des gènes BRD2 , LRP1B et CACNA1D impliqués dans la régulation du métabolisme des lipides et du glucose et du système rénine-angiotensine respectivement. Dans un second temps, l’approche par gènes candidats a démontré que l’exposition au DG est associée à la méthylation de l’ADN de gènes du métabolisme des lipides (LPL et ABCA1 ) du placenta. L’analyse de la méthylation de la LEP et de l’ ADIPOQ dans le sang et les tissus adipeux de sujets sévèrement obèses a permis d’identifier des sites de méthylation pouvant potentiellement être utilisés dans le sang comme marqueur de susceptibilité à l’obésité. L’ensemble des résultats de cette thèse démontrent que le DG modifie le profil épigénétique de gènes impliqués dans les voies biologiques des maladies métaboliques (métabolisme énergétique et des lipides) et supportent l’importance de la méthylation de l’ADN dans la programmation de la santé métabolique du nouveau-né ayant été exposé in utero au DG.

Mots clés : méthylation de l’ADN, placenta, sang de cordon, épigénétique, leptine, adiponectine, tissus adipeux, sang SUMMARY

Fetal metabolic programming: the impact of gestational diabetes mellitus exposure on newborn’s epigenetic signature

By Andrée-Anne Houde Biochemistry Program

Thesis presented at the Faculty of medicine and health sciences for the obtention of Doctor degree diploma Philosophiae Doctor (Ph.D.) in biochemistry, Faculty of medicine and health sciences, Université de Sherbrooke, Sherbrooke, Québec, Canada, J1H 5N4

Obesity has reached epidemic proportions worldwide in both adult and childhood populations and is now recognized as a major public health issue. Obesity is associated with higher incidence of cardiometabolic complications including type 2 diabetes (T2D), dyslipidemia and hypertension as well as with increased health care costs. The fetal environment now appears, with genetics and the environment, as one cause of the obesity epidemic. Indeed, according to the fetal programming hypothesis, newborns exposed to a detrimental fetal environment are more susceptible to develop obesity, T2D and other related chronic disorders when they become teenagers or adults. Many studies have associated gestational diabetes mellitus (GDM) exposure with these long-term metabolic health risks for the newborn. Although, numerous studies show epidemiological evidence to support the fetal programming hypothesis, only a few studies have been undertaken to understand the underlying molecular mechanisms. However, several studies now suggest that epigenetics may be involved. The objective of this thesis is to study changes in DNA methylation, the more stable and studied epigenetic system, in newborns that have been exposed to GDM in utero . First, a genome-wide DNA methylation analysis (BeadChip) was performed in a sample set of 44 placenta and cord blood samples to identify genes and metabolic pathways dysregulated by GDM. This approach showed that genes epigenetically affected by GDM are predominantly involved in metabolic diseases. The associations between maternal glycemia and DNA methylation levels were confirmed, in an independent birth cohort, for BRD2 , LRP1B and CACNA1D gene loci involved in the regulation of lipid and glucose metabolism and the renin-angiotensin system respectively. Then, using a candidate gene approach we reported that DNA methylation levels at gene loci involved in lipid metabolism (LPL and ABCA1 ) are modified in the placenta following exposure to GDM. Furthermore, analyses of LEP and ADIPOQ DNA methylation levels in blood and adipose tissues of severely obese men and women allowed the identification of CpG sites that might be used in blood as a marker of obesity susceptibility. Altogether the results of this thesis show that GDM affects the epigenetic signature of genes involved in metabolic disease pathways (energy and lipid metabolism) and support the role of DNA methylation in metabolic health programming of the newborn exposed to GDM.

Keywords : DNA methylation, placenta, cord blood, epigenetic, leptin, adiponectin, adipose tissue, blood TABLE DES MATIERES

Résumé ...... iii

Summary ...... iv

Table des matières ...... v

Liste des figures ...... viii

Liste des tableaux ...... xi

Liste des abréviations ...... xiv

Chapitre 1 - Introduction ...... 1 1.1 L’obésité ...... 1 1.1.1 Portrait de l’obésité au Canada ...... 2 1.1.2 Les principales causes de l’obésité ...... 3 1.1.2.1 Les facteurs génétiques ...... 3 1.1.2.2 Les facteurs environnementaux ...... 4 1.2 La programmation fœtale : de Barker à aujourd’hui ...... 6 1.3 Le diabète gestationnel ...... 11 1.3.1 La prévalence et les facteurs de risque du diabète gestationnel ...... 11 1.3.2 Le dépistage et les critères diagnostiques du diabète gestationnel ...... 11 1.3.3 La physiopathologie du diabète gestationnel ...... 14 1.3.4 Les conséquences du diabète gestationnel pour la santé de la mère ...... 17 1.3.5 Le diabète gestationnel et la programmation fœtale ...... 18 1.4 L’épigénétique ...... 24 1.4.1 La définition de l’épigénétique ...... 24 1.4.2 Les principaux mécanismes épigénétiques...... 26 1.4.2.1 Les modifications des histones ...... 26 1.4.2.2 Les ARN non codants ...... 27 1.4.2.3 La méthylation de l’ADN ...... 29 1.4.2.3.1 Mécanismes de méthylation de l’ADN ...... 29 1.4.2.3.2 Mécanismes de déméthylation de l’ADN ...... 31 1.4.2.3.3 Le méthylome et son rôle dans la régulation de l’expression génique ...... 32 1.5 La méthylation de l’ADN pendant le développement embryonnaire ...... 35 1.5.1 Différentiation cellulaire et reprogrammation du méthylome chez le zygote et dans les cellules germinales primordiales ...... 35 vi

1.5.2 L’empreinte parentale ...... 38 1.5.3 L’inactivation du chromosome X ...... 39 1.6 La méthylation de l’ADN dans la programmation métabolique fœtale ...... 40 1.6.1 Les modèles animaux ...... 40 1.6.2 Les études épidémiologiques ...... 42 1.6.2.1 Approche à l’échelle du génome ...... 42 1.6.2.2 Approche par gènes candidats ...... 46 1.7 Les facteurs contribuant à la variabilité des niveaux de méthylation ...... 49 1.7.1 L’environnement post-natal ...... 49 1.7.2 La génétique ...... 50 1.8 La sélection du tissu pour l’analyse de la méthylation dans le contexte de la programmation fœtale ...... 53 1.9 Problématique ...... 56 1.9.1 Hypothèse ...... 56 1.9.2 Objectifs ...... 57

Chapitre 2 - Gestational diabetes mellitus epigenetically affects genes predominantly involved in metabolic disease ...... 58

Chapitre 3 - LRP1B , BRD2 and CACNA1D : New candidate genes in fetal metabolic programming of newborns exposed to maternal hyperglycemia ...... 87

Chapitre 4 - Placental lipoprotein lipase DNA methylation levels are associated with gestational diabetes mellitus and maternal and cord blood lipid profiles ...... 118

Chapitre 5 - Adaptations of placental and cord blood ABCA1 DNA methylation profile to maternal metabolic status ...... 147

Chapitre 6 - Fetal epigenetic programming of adipokines ...... 184

Chapitre 7 - Cross-tissue comparisons of leptin and adiponectin DNA methylation profiles ...... 202

Chapitre 8 - Leptin and adiponectin DNA methylation levels in adipose tissues and blood cells are associated with BMI, waist girth and LDL-cholesterol levels in severely obese men and women ...... 232

Chapitre 9 - Discussion ...... 266 9.1 Analyse du méthylome du placenta et du sang de cordon suite à l’exposition au diabète gestationnel ...... 267 9.1.1 Le résumé des résultats de notre étude épigénomique ...... 267

vii

9.1.2 La validation des résultats de notre étude épigénomique ...... 271 9.1.3 Les limites de notre étude épigénomique ...... 274 9.1.3.1 L’hétérogénéité cellulaire...... 274 9.1.3.2 Les variables biologiques ...... 276 9.1.3.2 Les variants génétiques ...... 278 9.2 Modifications épigénétiques des gènes du métabolisme des lipides suite à l’exposition au diabète gestationnel ...... 280 9.3 Associations entre les modifications épigénétiques observées chez les nouveau-nés exposés au diabète gestationnel et les indicateurs de santé et de croissance fœtale ...... 287 9.4 État actuel des connaissances concernant l’identification des gènes épigénétiquement impliqués dans la programmation métabolique fœtale associée au diabète gestationnel ...... 290 9.4.1 La spécificité cellulaire de la méthylation de l’ADN des gènes LEP et ADIPOQ .. 293 9.4.2 Les associations entre la méthylation des gènes LEP et ADIPOQ et des facteurs de risques cardiométaboliques chez l’adulte ...... 296

Chapitre 10 - Conclusion ...... 300

Remerciements ...... 301

Liste des références ...... 303

Annexe 1 ...... 345

Annexe 2 ...... 349

Annexe 3 ...... 352

Annexe 4 ...... 353

Annexe 5 ...... 354

Annexe 6 ...... 359

Annexe 7 ...... 361

Annexe 8 ...... 362

LISTE DES FIGURES

Figure 1.1- Réponse adaptative du fœtus et les risques de maladies à long-terme ...... 7

Figure 1.2- Risque relatif d’être atteint d’une maladie métabolique en fonction du poids à la naissance ...... 9

Figure 1.3- Adaptations physiques et mécanismes physiopathologiques associés à une grossesse normoglycémique et au diabète gestationnel ...... 16

Figure 1.4- Le cycle intergénérationnel de l’obésité perpétué par le diabète gestationnel ... 21

Figure 1.5- La méthylation de l'ADN ...... 30

Figure 1.6- La déméthylation de l'ADN ...... 32

Figure 1.7- La méthylation de l'ADN et la régulation de l'expression des gènes ...... 34

Figure 1.8- Reprogrammation du méthylome dans le cycle de vie des mammifères ...... 37

Figure 2.1- Overview of the analytical strategy used to identify genes and metabolic pathways showing epigenetic dysregulation in response to GDM exposure ..... 66

Figure 2.2- Ingenuity Pathway Analysis: Top-ranked common disease and disorder pathways that were epigenetically affected by GDM ...... 67

Figure 2.3- Ingenuity Pathway Analysis: Top-ranked diseases and disorders associated to each of the common disease and disorder pathways epigenetically affected by GDM ...... 68

Figure 3.1- Association plots between maternal glucose levels 2h post-OGTT and DNA methylation levels in placenta of NGT (black circle) and GDM (black cross) women ...... 100

Figure 3.2- Association plots between maternal glucose levels 2h post-OGTT and DNA methylation levels in cord blood of NGT (black circle) and GDM (black cross) women ...... 101

Figure 3.3- Location of CpGs, transcription factor binding sites and highly conserved regions within BRD2 gene locus, adapted from UCSC genome browser tracks ...... 104

Figure 4.1- Schematic representation of the LPL gene locus CpG island and localization of the 3 loci epigenotyped ...... 131

Figure 4.2- DNA methylation levels at placental LPL loci according to maternal glucose tolerance status ...... 132

Figure 4.3- Pearson correlations between LPL gene CpG2 (A) and CpG3 (B) DNA methylation and mRNA levels in placenta (n=126) ...... 135

Figure 5.1- ABCA1 CpG island proximal promoter region and localization of the 4 loci epigenotyped in maternal and fetal placenta, as well as in maternal and cord blood samples ...... 155

Figure 5.2- Pearson correlation coefficients between CpGs at ABCA1 -A locus in maternal (A) and cord (B) blood ...... 156

Figure 5.3- Placental ABCA1 -CpG5 and -CpG6 DNA methylation levels according to maternal and newborn metabolic profile ...... 158

Figure 5.4- DNA methylation levels at ABCA1 -CpG6 on the maternal side of the placenta according to glucose tolerance status and HDL-C levels ...... 159

Figure 5.5- Cord blood ABCA1-A locus DNA methylation levels according to maternal and newborn characteristic s ...... 162

Figure 5.6- Functional impact of the ABCA1 DNA methylation level variability ...... 163

Figure 5.7- Maternal and fetal metabolic variables associated with placental and cord blood ABCA1 DNA methylation variations ...... 167

Figure 6.1- Correlation between leptin gene promoter (A) or adiponectin CpG island E2 (B) DNA methylation levels and 2 h post-OGTT glycemia ...... 190

Figure 6.2- Average methylation levels of CpG sites within leptin and adiponectin gene loci in the placenta and cord blood ...... 193

Figure 7.1- CpG island within LEP gene proximal promoter region ...... 209

Figure 7.2- Pearson correlation coefficients between CpGs at LEP proximal promoter locus in blood (A), subcutaneous (B) and visceral (C) adipose tissues ...... 210

Figure 7.3- DNA methylation levels at LEP gene promoter (A) and ADIPOQ CpG island E (B) CpG sites in blood (white), subcutaneous (black) and visceral (grey) adipose tissues (n=73) ...... 211

Figure 7.5- CpG islands analysed within the ADIPOQ gene locus ...... 218

Figure 7.6- Spearman correlation coefficients between CpGs at ADIPOQ locus in blood (A), subcutaneous (B) and visceral (C) adipose tissues ...... 219

Figure 7.7- Average DNA methylation profile by CpG site for LEP gene promoter locus (A) and ADIPOQ CpG island E gene locus (B) in blood (white circles), subcutaneous (black circles) and visceral (grey circles) adipose tissues (n=73) ...... 221

Figure 8.1- LEP and ADIPOQ DNA methylation levels according to body mass index (BMI) in severely obese patients ...... 247

Figure 8.2- ADIPOQ DNA methylation levels according to waist circumference in severely obese patients ...... 247

Figure 9.1- Effet du traitement du DG sur le méthylome du placenta et du sang de cordon ...... 273

Figure 9.2- Fonction des protéines des gènes candidats de la programmation métabolique fœtale impliqués dans le transport materno-fœtal des lipides ...... 286

Figure 9.3- Interrogations et plan de travail visant l’identification de marqueurs épigénétiques de la susceptibilité à l’obésité et aux complications cardiométaboliques ...... 292

LISTE DES TABLEAUX

Tableau 1.1- Classes d’obésité et le risque de comorbidités associé à l’IMC selon les critères de l’OMS...... 2

Tableau 1.2- Stratégie de dépistage du diabète gestationnel selon les associations ...... 13

Tableau 1.3- Les principales modifications des histones associées à la transcription ...... 27

Tableau 2.1- Maternal and newborn characteristics ...... 65

Tableau 2.2- Ingenuity Pathway Analysis. Top-ranked common disease and disorder pathways that were epigenetically affected by GDM ...... 69

Tableau 3.1- PCR and pyrosequencing primers for amplification and pyrosequencing of the 15 CpGs analysed in the Gen3G birth cohort...... 97

Tableau 3.2- Comparison of the characteristics of mothers and newborns according to glucose tolerance status ...... 99

Tableau 3.3- Mann-Whitney U comparisons of DNA methylation levels (%) in placenta and cord blood samples not exposed to GDM (NGT, n=60) or exposed to GDM (n=20) in the Gen3G birth cohort ...... 102

Tableau 4.1- Characteristics of women and newborn according to glucose tolerance status ...... 129

Tableau 4.2- Pearson correlation coefficient between placental LPL DNA methylation and maternal metabolic profile ...... 134

Tableau 5.1- Maternal and newborn characteristics according to glucose tolerance status ...... 154

Tableau 5.2- Multivariable linear regression analyses of ABCA1 DNA methylation levels predictors in placenta and cord blood ...... 160

Tableau 5.3- PCR and pyrosequencing primers for ABCA1 gene CpG island locus amplification ...... 173

xii

Tableau 6.1- Spearman correlation coefficient between CpG sites methylation of leptin gene promoter and adiponectin gene loci C1 and E2 in maternal and fetal sides of placenta ...... 194

Tableau 6.2- Spearman correlation coefficient between cord blood CpG sites methylation for adiponectin gene loci C1 and E2 and maternal and fetal sides of placenta ... 195

Tableau 7.1- Characteristics of subjects according to sex ...... 208

Tableau 7.2- Pearson correlation coefficients between DNA methylation levels at LEP gene promoter CpG sites in blood, subcutaneous (SAT) and visceral adipose (VAT) tissue ...... 213

Tableau 7.3- Pearson correlation coefficients between DNA methylation and mRNA levels at LEP gene promoter CpG sites in subcutaneous (SAT) and visceral adipose (VAT) tissues according to rs2167270 genotype and adjusted for sex ...... 215

Tableau 7.4- Comparison of DNA methylation levels (%) at LEP proximal promoter CpG sites and LEP mRNA levels (AU) in SAT and VAT according to rs2167270 genotype ...... 216

Tableau 7.5- Spearman rank correlation coefficients between DNA methylation levels at ADIPOQ CpG island E loci in blood, subcutaneous (SAT) and visceral adipose (VAT) tissues ...... 219

Tableau 7.6- Pearson correlation coefficients between DNA methylation and mRNA levels at ADIPOQ CpG island E in subcutaneous (SAT) and visceral adipose (VAT) tissue s ...... 220

Tableau 7.7- PCR and pyrosequencing primers for LEP gene proximal promoter CpG island amplification and pyrosequencing ...... 223

Tableau 8.1- PCR and pyrosequencing primers for LEP gene proximal promoter CpG island amplification and pyrosequencing ...... 242

Tableau 8.2- PCR and pyrosequencing primers for ADIPOQ gene CpG islands amplification and pyrosequencing ...... 243

Tableau 8.3- Characteristics of the subjects studied (n=73) ...... 245

xiii

Tableau 8.4- Pearson correlation coefficients between LEP and ADIPOQ DNA methylation and mRNA levels in blood, subcutaneous (SAT) and visceral adipose tissue (VAT) and anthropometric variables (n=73) ...... 248

Tableau 8.5- Pearson correlation coefficients between fasting LDL-C levels and both LEP and ADIPOQ DNA methylation and mRNA levels in subcutaneous (SAT) and visceral adipose tissues (VAT) (n=73) ...... 251

Tableau 8.6- Pearson correlation coefficients between LEP and ADIPOQ DNA methylation and mRNA levels in blood, subcutaneous (SAT) and visceral adipose tissue (VAT) and cardiometabolic risk factors (n=73) ...... 252

Tableau 8.7- Pearson correlation coefficients between LDL-C levels , LEP mRNA and LEP gene CpG17 DNA methylation levels in subcutaneous adipose tissue (SAT) according to the rs2167270 genotype ...... 254

Tableau 9.1- Les 5 gènes démontrant les différences de méthylation les plus significatives entre les échantillons de placenta ou de sang de cordon exposés au DG et à un environnement in utero normoglycémique dans la cohorte E-21...... 270

Tableau 9.2- Nombre de sites CpG affectés par l’exposition au DG dans le placenta et le sang de cordon avant et après la correction pour le décompte cellulaire...... 276

LISTE DES ABRÉVIATIONS

5-hmC 5-hydroxyméthylcytosine ABCA1 ATP-binding cassette transporte A1 ABCG1 ATP-binding cassette transporte G1 ADA American diabetes association ADIPOQ Adiponectine AGL Acide gras libre AOCG American college of obstetricians and gynecologists ARNi ARN interférents ARNnc ARN non codant ARNpi ARN interagissant avec Piwi Avy Agouti viable yellow gene BER Base excision repair BRD2 Bromodomain-Containing 2 CACNA1D Calcium Channel, Voltage-Dependent, L Type, Alpha 1D Subunit CCM Complication cardiométabolique CDA Canadian diabetes association CGI Ilôt CpG c-HDL Cholestérol des lipoprotéines de haute densité c-LDL Cholestérol des lipoprotéines de basse densité CpG Dinucléotide CpG CT/c-HDL Ratio de cholestérol total sur cholestérol des lipoprotéines de haute densité DG Diabète gestationnel DMR Differentially methylated region DNMT Méthyltransférase de l’ADN DT2 Diabète de type 2 FABP Protéine de liaison des acides gras FATP Protéine de transport des acides gras xv

GLUT Transporteur de glucose GWAS Genome wide association studies HAPO Hyperglycemia and adverse pregnancy outcome HGPO Hyperglycémie provoquée par voie orale IADPSG International association of diabetes and pregnancy study groups ICE Imprinting control element IGF Insulin-like growth factor IMC Indice de masse corporelle LDLR Récepteur des lipoprotéines de faible densité LEP Leptine LEPR Gène codant pour le récepteur de la leptine LIPG Gène codant pour la lipase endothéliale LPL Lipoprotéine lipase LRP1B Low-Density Lipoprotein Receptor-Related 1B LRP1P Low-Density Lipoprotein Receptor-Related MC4R Récepteur de type 4 de la mélanocortine MCV Maladie cardiovasculaire meQTL DNA methylation quantitative trait loci miARN microARN NDDG National diabetes data group NPY Neuropeptide Y OMS Organisation mondiale de la santé PLTP Protéine de transfert des phospholipides POMC Pro-opiomélanocortine SAM S-adénosyl-L-méthionine SNP Single-nucleotide polymorphism SRB1 Scavenger receptor class B, type 1 STZ Streptozotocine TET Ten eleven translocation TG Triglycéride TNG Tolérance normale au glucose

xvi tsDMR Tissue-specific differentially methylated regions VLDL Lipoprotéines de très faible densité VLDLR Récepteur des lipoprotéines de très faible densité

CHAPITRE 1 - INTRODUCTION

1.1 L’obésité

L’obésité est actuellement l’enjeu de santé mondial le plus important, devançant maintenant la dénutrition (James, 2008). Le nombre de femmes et d’hommes adultes en surpoids ou obèses est aujourd’hui estimé au double de ce qu’il était dans les 1980 et ce autant dans les pays industrialisés quand dans ceux en voie de développement (Ahima, 2011). Cette fulgurante augmentation de surpoids et d’obésité est responsable de l’accroissement de la prévalence de nombreuses comorbidités incluant le diabète de type 2 (DT2), les dyslipidémies, les maladies cardiovasculaires (MCV) et certains type de cancers (Must et al ., 1999; Calle et Kaaks, 2004; Poirier et al ., 2006; Bays et al ., 2013). Par conséquent, l’obésité représente un lourd fardeau économique pour les systèmes de santé et est aujourd'hui reconnue comme l’un des premiers facteurs de risque de décès au monde (Swinburn, 2011). Elle est d’ailleurs qualifiée d’épidémie par l’organisation mondiale de la santé (OMS) depuis 1997 (James, 2008).

L’obésité est définie comme une accumulation anormale ou excessive de tissu adipeux pouvant nuire à la santé (Persson et Bondke Persson, 2013). Plusieurs mesures anthropométriques sont utilisées pour évaluer le degré d’obésité : la circonférence de la taille, l’indice de masse corporelle (IMC) (la masse (en kg) divisé par la taille (en m) au carré (kg/m 2)), le rapport entre la circonférence de la taille sur celle des hanches et le pourcentage de gras corporel. La circonférence de la taille, marqueur de l’adiposité viscérale, est la variable qui prédit le mieux les risques de complications cardiométaboliques (CCM) associées à l’obésité (Poirier et Després, 2003). Par contre, l’IMC, l’unité de mesure la plus facilement accessible, est celle qui est utilisée internationalement par l’OMS afin de déterminer le degré d’obésité et les risques associés pour la santé (WHO, 2000). Selon les recommandations de l’OMS, un IMC entre 25,0 et 29,9 kg/m 2 est associé au surpoids. L’obésité, quant à elle, est caractérisée par une IMC de plus de 30 kg/m 2. Le tableau 1.1 présente les différentes classes d’obésité et le risque de comorbidité associé à chacune d’entre elles. 2

Tableau 1.1- Classes d’obésité et le risque de comorbidités associé à l’IMC selon les critères de l’OMS Classes d’obésité Poids Poids Obèse Obèse Obèse Surpoids insuffisant Normal Classe I Classe II Classe III IMC (kg/m 2) ≤ 18,5 18,5 -24,9 25,0 -29,9 30,0 -34,9 35,0 -39,9 ≥40,0 Risque de Faible Moyen Accru Modéré Élevé Très élevé comorbidité IMC, indice de masse corporelle

Tiré et modifié de World Health Organization, WHO (2000) dans Obesity: preventing and managing the global epidemic. Report of a WHO consultation. World Health Organization Technical Report Series 894 : page 10.

1.1.1 Portrait de l’obésité au Canada

La population canadienne est aussi largement touchée par l’épidémie d’obésité. Depuis les trois dernières décennies, la prévalence de l’obésité a triplé chez les adultes canadiens passant de 6,1 à 18,0% (Twells et al ., 2014). Selon les prédictions, le nombre d’adultes en surpoids ou obèses augmentera encore au cours des 5 prochaines années et ce dans l’ensemble des provinces du Canada (Twells et al ., 2014). Les coûts de santé engendrés par le surpoids, l’obésité et ses comorbidités sont présentement estimés à près 4,3 milliards de dollars par année et une augmentation est anticipée dans les années à venir (Katzmarzyk et Janssen, 2004 ).

Les statistiques sur l’obésité infantile canadienne sont également très inquiétantes. Dans une enquête menée récemment par l’UNICEF auprès de 29 pays industrialisés, le Canada se situe au 3 e rang des pays avec les taux d’obésités infantiles les plus élevés derrière les États-Unis et la Grèce (UNICEF, 2013). Le nombre de canadiens âgés de 2 à 17 ans souffrant d’un excès poids ou d’obésité est maintenant évalué à 29%, soit le triple de ce qui avait été rapporté en 1975 (Shields et Tjepkema, 2006). Cet accroissement d’obésité est la cause de l’apparition, chez les enfants, de désordres métaboliques (DT2, dyslipidémie, hypertension artérielle) qui étaient auparavant restreints à la population adulte (Deckelbaum et Williams, 2001; Nathan et Moran, 2008). Par ailleurs, il est reconnu qu’environ 2/3 des enfants et adolescents obèses le resteront toute leur vie (Singh et al ., 2008). De ce fait, si la tendance se maintient, il est anticipé que près de 70% de la population canadienne âgée de

40 ans sera obèse en 2040 (Le Petit et Berthelot, 2006). Devant cette situation alarmante et afin de freiner l’augmentation de l’obésité, il est impératif de mieux comprendre ses causes. Les facteurs génétiques et environnementaux de même que l’interaction entre ces deux facteurs constituent les principales causes de l’épidémie d’obésité.

1.1.2 Les principales causes de l’obésité

1.1.2.1 Les facteurs génétiques

Des études familiales et sur des jumeaux ont permis de mettre en évidence qu’il existe une composante génétique à l’obésité. L’héritabilité de l’obésité, tel qu’estimée par ces études, varie de 6 à 85% selon les variables anthropométriques analysées (Comuzzie et al lisson, 1998; Barsh et al ., 2000; Yang et al ., 2007). Les variants génétiques qui sont associés au phénotype de l’obésité peuvent être divisés en deux catégories : 1) les variants rares associés aux formes sévères et monogéniques de l’obésité et 2) les variants communs associés à la forme fréquente et polygénique de l’obésité.

Les formes monogéniques de l’obésité, causées par des variants génétiques rares, sont très sévères et font leur apparition à un âge très précoce, soit entre un et deux ans. Ce type d’obésité représente moins de 5% des cas d’obésité (Ranadive et Vaisse, 2008). Plus d’une vingtaine de mutations causales de la forme monogénique de l’obésité ont jusqu’à présent été identifiées. La plupart de ces mutations modifies la séquence de gènes codant pour des protéines impliquées dans la régulation hypothalamique du métabolisme énergétique (Farooqi et O’Rahilly, 2004; Hochberg et Hochberg, 2010). Parmi celles-ci, des mutations des gènes de la leptine ( LEP ), du récepteur de la leptine (LEPR ), du récepteur de type 4 de la mélanocortine ( MC4R ), et de la pro-opiomélanocortine ( POMC ), impliqués dans le contrôle de la satiété et de la prise alimentaire, ont notamment été associées à l’hyperphagie et à des formes très sévères de l’obésité dès la petite enfance (Ranadive et Vaisse, 2008; Dubern et Clément, 2012; Valette et al ., 2013).

Les variants génétiques communs associés à la forme polygénique de l’obésité ont pour la majorité été identifiés par des études d’association pangénomique ( genome wide

4 association studies (GWAS)). Les GWAS, en analysant jusqu’à un million de SNP (single nucleotide polymorphism ) communs couvrant l’ensemble du génome, ont permis l’identification de plus de 50 variants associés à différentes mesures anthropométriques de l’obésité, soit : l’IMC, la circonférence de la taille, le ratio de la circonférence de la taille sur celle des hanches et le pourcentage de gras corporel (Heid et al ., 2010; Day et Loos, 2011; Herrera et al ., 2011). Par contre, ces SNP expliquent moins de 2% de la variabilité phénotypique de l’obésité (Waalen, 2014). Ainsi, il semble que d’autres facteurs contribuent à l’héritabilité de l’obésité. Des études ont suggéré que certains variants rares ainsi que l’interaction entre plusieurs variants génétiques rares ou communs, permettraient d’expliquer une fraction du phénotype de l’obésité (Yang et al ., 2007; McCarthy et al ., 2008; Manolio et al ., 2009). En outre, l’interaction entre les gènes et les facteurs environnementaux obésogènes permettrait d’expliquer une partie importante de l’héritabilité manquante de l’obésité (Agus-Collins et Bouchard, 2008; Ahmad et al ., 2013; Chaput et al ., 2014).

1.1.2.2 Les facteurs environnementaux

Les facteurs environnementaux contribuant à l’augmentation de la prévalence de l’obésité sont nombreux. Plusieurs s’entendent pour dire que le mode vie de notre société occidentale, caractérisé par une alimentation riche en gras et en sucre ainsi que par la sédentarité, est en partie responsable de l’épidémie d’obésité (WHO, 2000). Plus récemment, il a été démontré que des composés organiques dérivés des plastiques et des pesticides (bisphénol-A et tributylétain) peuvent modifier les mécanismes moléculaires impliqués dans la différenciation adipocytaire (Grun, 2010; Holtcamp, 2012). Ces toxines environnementales pourraient donc également jouer un rôle important dans le développement de l’obésité.

Au-delà des facteurs obésogènes précédemment énumérés, l’environnement auquel le fœtus est exposé pendant son développement apparaît maintenant comme un facteur déterminant dans le développement de l’obésité. En effet, de nombreuses études ont démontré que les nouveau-nés ayant été exposés à un environnement fœtal défavorable présentent un risque accru de développer, à l’adolescence et à l’âge adulte, l’obésité et les désordres métaboliques qui y sont associés. Ce phénomène appelé programmation métabolique fœtale est le thème central de cette thèse qui a pour objectif d’identifier des

5 modifications épigénétiques impliquées dans la programmation métabolique des nouveau- nés exposés in utero au diabète gestationnel (DG). Les deux prochaines sections de ce chapitre introduiront la programmation métabolique fœtale et plus spécifiquement, celle associée à l’exposition au DG. Par la suite, les mécanismes épigénétiques de même que les évidences permettant d’associer la méthylation de l’ADN (la modification épigénétique la plus étudiée) à la programmation métabolique fœtale seront abordés. Les chapitres 2 à 5, constitués de manuscrits publiés ou soumis, présenteront l’impact du DG sur la méthylation de l’ADN du nouveau-né (placenta et sang de cordon) selon deux approches, soit l’approche à l’échelle du génome et celle par gènes candidats. Les chapitres 6 à 8 présenteront les résultats d’une étude exploratoire qui visait à mieux comprendre le profil de la méthylation de deux gènes candidats de la programation métabolique foteale, les gènes LEP et de l’adiponectine ( ADIPOQ ), dans différents tissus et d’évaluer le potentiel de ces deux gènes comme marqueurs épigénétiques de la susceptibilité à l’obésité en clinique. Le chapitre 9 conclura cette thèse en discutant des résultats obtenus ainsi que des enjeux et perspectives associés à l’étude des mécanismes épigénétiques impliqués dans la programmation métabolique fœtale.

1.2 La programmation fœtale : de Barker à aujourd’hui

Les études à l’origine de la théorie de la programmation fœtale ont été conduites par le Professeur David J.P. Barker à la fin des années 1980. Le Pr Barker et son équipe se sont intéressés à la santé métabolique et aux causes de décès de plus de 16 000 adultes britanniques nés entre les années 1911 et 1930. Les premiers résultats publiés par ces derniers démontrent que les sujets avec un faible poids à la naissance ont un taux de décès de causes cardiovasculaires beaucoup plus élevé que ceux avec un poids plus élevé (Barker et al ., 1989; Barker et al ., 1993a; Osmond et al ., 1993). Dans une seconde série de publications, l’équipe du Pr Barker rapporte de fortes corrélations négatives entre le poids à la naissance et le risque d’être atteint d’hypertension, DT2 et de MCV à l’âge adulte (Barker et al ., 1993b; Law et al ., 1993; Phipps et al ., 1993). Suite à ces travaux, le Pr Barker propose que la diminution de la vitesse de croissance fœtale, marquée entre autre par un faible poids à la naissance, augmente le risque d’être atteint d’obésité ou d’une maladie métabolique plus tard dans la vie (Barker, 1995). En 1995, le British Medical Journal nomme cette hypothèse l’ « hypothèse de Barker » en l’honneur de son instigateur (Paneth et Susser, 1995).

Se basant sur cette hypothèse, plusieurs équipes de recherche se sont penchées sur l’étude de la croissance fœtale et du poids à la naissance comme facteur prédicatif de la susceptibilité aux maladies métaboliques à l’âge adulte. Les premiers résultats du Pr Barker furent validés par de nombreuses études épidémiologiques, dont celles de la Dutch Hunger Famine . La Dutch Hunger Famine a eu lieu pendant la seconde guerre mondiale alors que l’occupation du territoire néerlandais par les allemands entraîne une grève des réseaux ferroviaires et la mise en place d’un système rationnement alimentaire. En raison de ce rationnement, tous les habitants de la région nord des Pays-Bas, incluant les femmes enceintes, ont vu leur apport calorique quotidien limité de 1800 calories à moins de 1000 calories à partir de décembre 1944 jusqu’à aussi peu que 580 kcal par jour en février 1945 (Roseboom et al ., 2006). Ce tragique évènement a permis d’étudier les conséquences à long- terme de la restriction alimentaire maternelle à différents stades du développement fœtale sur plus de 2400 nouveau-nés. Cette étude démontre que l’exposition in utero à la famine pendant la seconde moitié de la grossesse est associée à un poids plus faible à la naissance et à une diminution de la tolérance au glucose à l’âge adulte, et ce indépendamment du poids à

7 la naissance (Ravelli et al ., 1998). De leur côté, les sujets exposés à la famine au début du développement embryonnaire ont un poids à la naissance normal, mais sont plus à risque d’être obèse, d’avoir un profil lipidique athérogénique et de souffrir de MCV à l’âge adulte (Ravelli et al ., 1999; Roseboom et al ., 2000a; Roseboom et al ., 2000b). Les études sur la Dutch Hunger Famine ont grandement contribué à l’avancement des connaissances sur la programmation fœtale en démontrant que la période du développement durant laquelle le fœtus est exposé à un environnement défavorable a un impact sur sa santé à long-terme. De plus, ces études sont les premières à prouver que l’exposition à un environnement fœtal sous- optimal peut programmer la santé métabolique indépendamment du poids à la naissance. Suite à ces résultats, le Pr Barker a proposé l’hypothèse du phénotype d’épargne ( Thrifty Phenotype ) selon laquelle le fœtus modifie son métabolisme pour s’adapter aux stimuli environnementaux in utero. Ces modifications assureraient un développement fœtal optimal lorsque les ressources alimentaires sont insuffisantes, tout en permettant une programmation métabolique favorisant la survie en situation de dénutrition. Cette programmation serait par contre mal-adaptée à un environnement post-natal où les ressources alimentaires sont abondantes et augmenterait donc la susceptibilité du nouveau-né de développer une maladie chronique (Figure 1.1) (Hales et Barker, 2001).

Figure 1.1- Réponse adaptative du fœtus et les risques de maladies à long-terme La combinaison de l’environnement in utero et post-natal peut être adaptative ou maladaptative et augmenter ou diminuer le risque d’être atteint de maladies chroniques. Pendant le développement, le fœtus s’adapte aux signaux de la mère afin d’augmenter ses chances de survie. Toutefois, si les signaux post-nataux diffèrent de ceux auxquels il a été exposé in utero, cette adaptation devient désavantageuse et le rend plus susceptible de souffrir d’obésité et de complications cardiométaboliques (CCM) .

Adaptée de : Boekelheide K et al . (2012) Predicting Later-Life Outcomes of Early-Life Exposures. Environmental Health Perspectives 120 (10):1353-1361

Dans notre société où le nombre de femmes obèses en âge de procréer est en constante augmentation, un grand intérêt s’est développé pour l’étude de la programmation fœtale dans un contexte d’obésité maternelle, de gain de poids excessif pendant la grossesse et de DG. Ces trois conditions maternelles sont associées à un transport excessif de nutriments vers le fœtus, à l’augmentation du poids à la naissance et également à un risque accru d’être atteint d’obésité et de CCM à l’âge adulte (Boney et al ., 2005; Kim et al ., 2011; Gallino et Bellver, 2013; O’Reilly et Reynolds, 2013). Un poids élevé à la naissance, tout comme un faible poids, est associé associé au risque d’être atteint d’obésité et de CCM dans le futur. Par conséquent, la relation entre le poids à la naissance et le risque relatif de développer l’obésité ou une CCM à l’âge adulte est représentée par une courbe en U (Figure 1.2) (Baker et al ., 2008; Whincup et al ., 2008).

L’avantage évolutif de l’adaptation de la croissance fœtale en situation de suralimentation est moins bien compris que celui lié à la dénutrition. Ma et ses collaborateurs (2013) ont récemment proposé que la programmation métabolique fœtale observée chez les nouveau-nés exposés in utero à l’obésité maternelle ou au DG soit plutôt contre-évolutive et attribuable à une mal-adaptation du placenta face à des concentrations de nutriments trop élevées. Au cours de l’évolution, les mécanismes de transport des nutriments du placenta se seraient adaptés à la restriction alimentaire, mais en situation de suralimentation ils ne réussiraient pas à limiter l’apport nutritionnel au fœtus. Cette théorie est appuyée par l’hypothèse proposée par Pedersen en 1954. Selon Pedersen, le glucose, présent en concentration excessive chez les mères avec un diabète, est directement transféré vers le fœtus entraînant l’hyperglycémie et l’augmentation de sa production d’insuline (Pedersen, 1954). L’insuline augmente la croissance du fœtus notamment en stimulant l’expression des facteurs de croissance ressemblant à l’insuline (IGFs), l’adipogénèse et la déposition de tissu adipeux (Catalano et Hauguel-De Mouzon, 2011; Negrato et al ., 2012). Les modèles animaux ont aussi démontré que le transfert excessif de nutriments favorise la production d’insuline, la croissance, la prolifération et l’hypertrophie des adipocytes ainsi que la résistance à la leptine et à l’insuline chez le fœtus (Rkhzay-Jaf et al ., 2012).

Figure 1.2- Risque relatif d’être atteint d’une maladie métabolique en fonction du poids à la naissance Un poids trop faible ou trop élevé à la naissance est associé avec un risque accru de développer de l’obésité, un diabète de type 2 (DT2) ou une maladie cardiovasculaire (MCV). Les facteurs associés à la diminution et à l’augmentation du poids à la naissance sont énumérés dans les parties inférieures gauche et droite de la figure respectivement.

Tirée et modifiée de : Isganaitis E, Patti ME (2011). Adipocyte Development and Experimental Obesity, page 332. Dans: RH Lustig (ed.), Obesity Before Birth: Maternal and Prenatal Influences on the Offspring , (1 ère édition), San Francisco, USA, Springer-Endocrine Updates 30.

De nombreuses conditions maternelles et environnementales pouvant perturber le développement du fœtus sont aujourd’hui associées à la programmation de la santé métabolique du fœtus: l’alcool, l’altitude, l’anémie, la cigarette, le DG, les drogues, le gain de poids excessif pendant la grossesse, la malnutrition, l’obésité maternelle, les polluants organiques persistants et le stress (Figure 1.2) (Boney et al ., 2005; Meyer et Lubo, 2007; Fei et al ., 2007; Kim et al ., 2011; Minnes et al ., 2011; Hamlin, 2012; Galliano et Bellver, 2013; O’Reilly et Reynolds, 2013; Soto et Bahado-Singh, 2013). Il a également été mis en évidence que des facteurs environnementaux périnataux tels que l’allaitement, l’alimentation et le stress joueraient un rôle considérable dans la programmation de la santé métabolique du nouveau-né (Tamashiro et Moran, 2010; Moore et al ., 2011; Koletzko et al ., 2012). Dans le cadre de cette thèse, seule la programmation fœtale associée au DG sera abordée en détail.

1.3 Le diabète gestationnel

1.3.1 La prévalence et les facteurs de risque du diabète gestationnel

Le DG, défini comme une hyperglycémie diagnostiquée pour la première fois lors de la grossesse, est l’une des complications de santé maternelles les plus fréquentes (Thompson et al ., 2013). Puisqu’il n’existe pas de consensus international sur les critères diagnostiques à utiliser pour dépister le DG, les statistiques sur la prévalence du DG sont très variables. Néanmoins, selon la majorité des études, la prévalence du DG serait de 2 à 6 % et elle pourrait atteindre de 10 à 20% dans certaines populations à haut risque, notamment chez les autochtones, les asiatiques et les hispaniques (Galtier, 2010). Outre l’origine ethnique, l’âge maternel, les antécédents familiaux de DT2, les antécédents de DG et de macrosomie ainsi que l’obésité sont des facteurs de risque reconnus du DG (Ben-Haroush et al ., 2004; Galtier, 2010). L’obésité maternelle, un des facteurs de risque le plus important, contribuerait à plus de 20% des cas de DG (Kim et al ., 2010; Kim et al ., 2013). De ce fait, et en raison de l’épidémie d’obésité qui touche les femmes de plus en plus jeunes, la prévalence du DG sera vraisemblablement appelée à augmenter dans les prochaines années. Les nouveaux critères diagnostiques récemment adoptés par l’ International Association of Diabetes and Pregnancy Study Groups (IADPSG), qui seront discutés dans la prochaine section, pourraient également contribuer à améliorer le dépistage du DG et à augmenter le nombre de femmes diagnostiquées et traitées pour le DG.

1.3.2 Le dépistage et les critères diagnostiques du diabète gestationnel

La méthode de dépistage et les critères utilisés pour diagnostiquer le DG sèment, depuis longtemps, la controverse dans la communauté médicale internationale. La méthode la plus couramment utilisée pour dépister le DG est le test d’hyperglycémie provoquée par voie orale (HGPO) entre la 24 e et la 28 e semaine de grossesse (Coustan, 2013). Cette méthode consiste à mesurer la variation de la glycémie des mères suite à l’ingestion d’une boisson sucrée. Les quantités de glucose ingérées par les mères et les temps auxquels les prélèvements sanguins sont faits pour doser la glycémie dépendent de la stratégie de dépistage utilisée (Tableau 1.2) (Cosson, 2010). Avant l’étude HAPO ( Hyperglycemia and Adverse Pregnancy Outcome ) en 2008, les bénéfices, pour la mère et le nouveau-né, associés au dépistage du DG étaient très

12 variables d’une étude à l’autre et en fonction des protocoles et des critères diagnostiques utilisés (Cosson, 2010). Par conséquent, les endocrinologues se sont beaucoup questionnés sur les seuils diagnostiques de glycémie à utiliser de même que sur la nécessité de dépister et de traiter le DG (Dornhorst et Chan, 1998; Buchanan et Kjos, 1999; Khandelwal et al ., 1999).

L’étude HAPO réalisée dans 9 pays sur plus de 23 000 femmes enceintes, avait parmi ses objectifs la standardisation de la méthode de dépistage et des critères diagnostiques du DG. Cette étude a démontré que la glycémie maternelle (à jeun, 1h et 2h post-HGPO entre la 24 e et la 28 e semaine de grossesse) est associée, de façon linéaire, à des complications de grossesse pour la mère et le nouveau-né (Metzger et al ., 2008; HAPO, 2009). Afin de diminuer ces complications, l’IADPSG a recommandé que toutes les femmes enceintes soit dépistées pour le DG et que trois seuils glycémiques consensus (un à jeun, un 1h et un 2h post-HGPO) soient utilisés pour le diagnostic du DG (Tableau 1.2) (Metzger et al ., 2010). Ces recommandations, si elles sont adoptées internationalement, permettront de cibler une plus grande proportion des mères qui sont à risque d’avoir des complications et des issues de grossesse indésirables. Ceci entrainera une augmentation significative du nombre de femmes diagnostiquées avec un DG et devant être traitées. De récentes études ont d’ailleurs déjà rapporté que le nombre de femmes diagnostiquées avec un DG selon les critères de l’IADPSG était deux fois plus élevé que lorsque les critères de l ’American Diabetes Association (ADA), de l’Association Canadienne du Diabète (CDA) ou de l’ American College of Obstetricians and Gynecologists (AOCG) étaient utilisés (Shang et Lin, 2014; Oriot et al ., 2014; Mayo et al ., 2014; Shang et al ., 2014). En 2013, l’ADA a adopté les critères diagnostiques de l’IADPSG. Par contre, ceux-ci ne font pas encore l’unanimité puisque les critères de la CDA, de l’AOCG, et de l’OMS, plus laxistes que ceux de l’IADPSG, sont encore utilisés (Tableau 1.2) (WHO, 1999; ADA, 2013; Thompson et al ., 2013; AOCG, 2013). Dans le cadre de ce projet de recherche, les femmes de la cohorte E- 21 de Chicoutimi ont été diagnostiquées selon les critères de l’OMS tandis que la cohorte de validation, Gen3G de Sherbrooke, selon ceux de l’IADSPG.

Tableau 1.2- Stratégie de dépistage du diabète gestationnel selon les associations Étape Test* Seuils glycémiques pour le diagnostic du DG

ADA 1 HGPO : 75g de glucose À jeun : ≥ 5,1 mmol/L (2013) 1h post-HGPO : ≥ 10,0 mmol/L 2h post-HGPO : ≥ 8,5 mmol/L *Une valeur anormale pour le diagnostic du DG

AOCG 2 Étape 1 Carpenter et NDDG (2013) HGPO : 50g de glucose Coustan (1979) Les seuils du NDDG ou de (1982) Carpenter et Coustan peuvent 1h post-HGPO ≥ 7,8 mmol/L ou ≥ 7,2 mmol/L être utilisés *Si la glycémie est plus élevée que 7,8 ou 7,2 mmol/L, passer à l’étape 2 Étape 2 Carpenter et NDDG HGPO : 100g de glucose Coustan (1989) Les seuils du NDDG ou de (1982) Carpenter et Coustan peuvent À jeun ≥ 5,8 mmol/L ≥ 5,3 mmol/L être utilisés 1h post-HGPO ≥ 10,6 mmol/L ≥ 10,0 mmol/L 2h post-HGPO ≥ 9,2 mmol/L ≥ 8,6 mmol/L 3h post-HGPO ≥ 8,0 mmol/L ≥ 7,8 mmol/L *Deux valeurs anormales du NDDG ou de Carpenter et Coustan pour le diagnostic du DG

IADPSG 1 HGPO : 75g de glucose À jeun : ≥ 5,1 mmol/L (2010) 1h post-HGPO : ≥ 10,0 mmol/L 2h post-HGPO : ≥ 8,5 mmol/L *Une valeur anormale pour le diagnostic du DG

CDA 1 TTG : 50g de glucose TTG: ≥ 11.1 mmol/L (2013) ou ou HGPO : 75g de glucose À jeun : ≥ 5.3 mmol/L 1h post-HGPO : ≥ 10.6 mmol/L 2h post-HGPO : ≥ 9.0 mmol/L *Une valeur anormale pour le diagnostic du DG

OMS 1 HGPO : 75g de glucose À jeun : ≥ 7.0 mmol/L (1999) 2h post-HGPO : ≥ 7.8 mmol/L *Une valeur anormale pour le diagnostic du DG ADA, American Diabetes Association ; AOCG, American College of Obstetricians and Gynecologists ; CDA, Canadian Diabetes Association ; DG, diabète gestationnel; HGPO; hyperglycémie provoquée par voie orale, IADPSG, l’ International Association of Diabetes and Pregnancy Study Groups ; NDDG; National Diabetes Data Group ; OMS, Organisation mondiale de la santé; TTG; test de tolérance au glucose.

*Les tests de dépistage sont faits entre la 24e et la 28 e semaine de la grossesse .

1.3.3 La physiopathologie du diabète gestationnel

La grossesse est marquée par de nombreux changements anatomiques, cardiovasculaires, respiratoires et endocriniens chez la mère. Ces adaptations physiologiques, non- pathologiques, sont essentielles au développement du fœtus et pour préparer la mère à l’accouchement et à l’allaitement (Tan et Tan, 2013). Au début de la seconde moitié de la gestation, une résistance des tissus périphériques à l’insuline s’installe lentement et progresse jusqu’à la fin du troisième trimestre pour atteindre des niveaux similaires à ceux observés chez les patients souffrant de DT2 (Lain et Catalano, 2007). L’insulino-résistance musculaire, hépatique et adipocytaire permet d’augmenter les quantités de glucose, d’acides gras libres et d’acides aminés en circulation afin d’assurer un apport suffisant de ces nutriments pour le fœtus qui entre dans sa phase de croissance la plus importante (Boden, 1996). Bien que les mécanismes soient encore mal compris, il semble que certaines hormones placentaires et maternelles, soient impliquées dans le développement de cet état de résistance à l’insuline (Figure 1.3) (Barbour et al ., 2007; Zavalza-Gomez et al ., 2008; D’ippolito et al ., 2012). Chez la majorité des femmes enceintes, la production d’insuline est augmentée de 200% à 250% pour maintenir l’euglycémie (Catalano et al ., 1999). Par contre, chez certaines femmes, la production d’insuline est insuffisante pour contrer la résistance à l’insuline, entraînant ainsi une hyperglycémie, puis un DG (Figure 1.3).

Deux mécanismes sont impliqués dans la physiopathologie du DG. Dans un premier temps, il est reconnu que la réponse insulinique suite à un stimulus nutritionnel est beaucoup plus faible chez les femmes avec DG que chez les femmes avec une grossesse normoglycémique. Pour un degré d’insulino-résistance similaire, la sécrétion d’insuline des mères avec DG est jusqu’à 50% plus faible que celle des mères normoglycémiques et ce, pendant et après la grossesse (Buchanan, 2001; Homko et al ., 2001; Moleda et al ., 2013). La défaillance des cellules ß-pancréatiques serait responsable de la réduction de la production d’insuline observée chez les femmes avec un DG (Figure 1.3). Les causes exactes de la perte de fonction des cellules ß-pancréatiques demeurent, à ce jour, inconnues. Il est cependant suggéré qu’une exposition prolongée à l’hyperglycémie désensibilise les cellules ß- pancréatiques, induit leur apoptose ainsi que la diminution de la production d’insuline. Ensemble, ces mécanismes alimenteraient le cycle de la résistance à l’insuline (Cerf, 2013).

Le deuxième mécanisme pathologique responsable du DG est la résistance à l’insuline. L’aggravation de la résistance à l’insuline chez les femmes avec un DG fut démontrée pour la première fois par en 1985 par Ryan et son équipe avec la méthode du clamp euglycémique hyperinsulinémique (Ryan et al ., 1985). Cette méthode de référence permet de quantifier l’action de l’insuline sur les flux de glucose dans l’ensemble de l’organisme (DeFronzo et al , 1979). En perfusant des concentrations stables d’insuline, ces derniers ont observé que la quantité de glucose absorbée par les tissus des femmes avec DG était plus basse que chez celles avec une glycémie normale au 3 e trimestre de la grossesse (Ryan et al ., 1985). Les résultats de plusieurs équipes ont ensuite confirmé que les femmes avec un DG étaient plus résistantes à l’insuline en fin de grossesse que les femmes normoglycémiques (Catalano et al ., 1993; Kautzky-Willer et al ., 1997; Catalano et al ., 1999; Homko et al ., 2001). Lorsqu’elles ne sont pas enceintes, les femmes avec un antécédent de DG ont également une résistance à l’insuline plus grande que celles qui n’ont jamais développer cette pathologie (Kautzky-Willer et al ., 1997; Catalano et al ., 1999; Verma et al ., 2002). Ces résultats suggèrent que les femmes qui développent un DG ont une résistance à l’insuline chronique, ce qui pourrait expliquer, du moins en partie, la raison pour laquelle elles sont plus susceptibles d’être atteintes d’un DT2 plus tard dans leur vie. L’altération de la voie de signalisation de l’insuline dans les tissus périphériques (muscle et tissu adipeux) contribuerait également à l’augmentation de la résistance à l’insuline (Figure 1.3) (Friedman et al ., 1999; Shao et al ., 2002; Barbour et al., 2011). De sucroît, les adipokines, reconnus pour leur rôle dans la résistance à l’insuline induite par l’obésité, seraient également impliqués dans l’aggravation de l’insulino-résistance observée chez les mères avec un DG (Figure 1.3). Les concentrations plasmatiques d’adiponectine, de leptine, de facteur de nécrose tumoral alpha (TNF α) et de plusieurs autres adipokines ont d’ailleurs été associées au DG et à des index de résistance à l’insuline pendant la grossesse (Lacroix et al ., 2013a; Lacroix et al ., 2013b.; Guillemette et al ., 2014; Fasshauer et al ., 2014).

En somme, le DG est caractérisé par une hyperglycémie persistante causée par une résistance à l’insuline trop grande pour être contrebalancée par la production d’insuline des cellules ß-pancréatiques dysfonctionnelles (Figure 1.3). Les femmes diagnostiquées avec un DG entre la 24 e et la 28 e semaine de grossesse sont traitées et prises en charge par leur

16 médecin jusqu’à la fin de leur grossesse afin de diminuer les complications à l’accouchement et les effets indésirables sur la santé à court et à long-terme du nouveau-né (présentés dans les deux prochaines sections). La première prescription pour diminuer la glycémie des mères avec un DG consiste à apporter des modifications au régime alimentaire et à intégrer la pratique régulière d’activité physique (Ruchat et Mottola, 2013; Hernandez et al ., 2013). Lorsque ces deux éléments sont insuffisants pour rétablir la glycémie sous le seuil recommandé en deux semaines, le traitement par l’insuline ou par d’autres agents hypoglycémiants ne traversant pas la barrière placentaire (glyburide ou metformine) est recommandé (Thompson et al ., 2013; Durnwald, 2013).

Figure 1.3- Adaptations physiques et mécanismes physiopathologiques associés à une grossesse normoglycémique et au diabète gestationnel Au début du 2 e trimestre de la grossesse, une résistance périphérique à l’insuline s’installe chez la mère. Chez la majorité des mères, les cellules ß-pancréatiques produisent assez d’insuline pour maintenir l’euglycémie. Chez les mères qui développent un diabète gestationnel, les cellules ß- pancréatiques sont défaillantes et la résistance à l’insuline est plus importante que chez les mères normoglycémiques. Par conséquent, les cellules ß-pancréatiques ne réussissent pas à produire assez d’insuline pour contrer la résistance à l’insuline et une hyperglycémie s’ensuit.

1.3.4 Les conséquences du diabète gestationnel pour la santé de la mère

Chez la majorité des femmes diagnostiquées avec un DG, la glycémie redevient normale suite à la naissance du bébé. Toutefois, ces femmes ont un risque accru de développer des complications métaboliques dans les années suivant l’accouchement (Kitzmiller et al ., 2007).

Le DT2 est la complication métabolique la plus étudiée et celle qui est la plus fréquente chez les femmes présentant des antécédents de DG. Chez ces femmes, le risque d’être atteint d’un DT2 est jusqu’à 7 fois plus grand que chez les femmes qui ont eu une grossesse normoglycémique (Bellamy et al ., 2009; Malcolm, 2012). Une étude ontarienne sur le suivi post-partum de plus de 660 000 femmes a estimé que près de 20% des femmes avec des antécédents de DG reçoivent un diagnostic de DT2 dans les 9 années suivant leur accouchement (Feig et al ., 2008).

Les femmes ayant eu une grossesse compliquée par un DG sont également plus susceptibles de développer le syndrome métabolique après l’accouchement. La définition du syndrome métabolique ainsi que les critères diagnostiques sont variables d’un organisme à un autre (Grundy et al ., 2004; Alberti et al ., 2005; Huang, 2009). Cependant, ils s’entendent tous sur le fait que l’obésité, l’hypertension, la résistance à l’insuline et les dyslipidémies sont les principales composantes du syndrome métabolique. Toutes ces complications métaboliques sont plus fréquentes chez les femmes avec des antécédents de DG que chez les femmes ayant eu une grossesse normoglycémique (Roca-Rodriguez et al ., 2012). Conséquemment, le risque de développer un syndrome métabolique est de 1,3 à 4 fois plus élevé chez les mères avec un antécédent de DG que chez celles qui n’en ont pas (Xu et al ., 2014; Noctor et al , 2014; Lauenborg et al ., 2005).

Les composantes du syndrome métabolique sont également des facteurs de risques de la MCV. Ainsi, les femmes avec des antécédents de DG ont donc aussi un risque accru d’avoir une MCV post-partum . Des études d’observations rétrospectives, conduites chez différents groupes ethniques, ont démontré que les femmes avec des antécédents de DG étaient 1,7 à 2,6 fois plus à risque de subir un évènement cardiovasculaire que celles ayant eu une grossesse normoglycémique (Carr et al ., 2006; Shah et al ., 2008; Kessous et al ., 2013;

Archambault et al ., 2014). Le risque de développer des complications cardiovasculaires serait principalement attribuable au DT2. Par conséquent, le risque cardiovasculaires associé au DG chez les femmes qui ne développent pas de DT2 post-partum est, jusqu’à présent, considéré équivalent à celui des femmes qui n’ont pas d’antécédent de DG (Kim, 2010; Archambault et al ., 2014).

Au-delà des facteurs de risques reconnus du DG et du DT2 (l’origine ethnique, l’obésité, l’âge, les antécédents familiaux de DT2 ou de DG, les variants génétiques), l’ampleur de la résistance à l’insuline pendant la grossesse ainsi que la prise de poids postpartum sont associées à une augmentation des risques de complications métaboliques suite à l’accouchement (Kim et al ., 2002; Ben-Haroush et al ., 2004; Kwak et al ., 2013). Des études d’interventions randomisées ont démontré que l’adoption de saines habitudes de vie, la médication et l’allaitement pouvaient améliorer la santé métabolique des femmes tout en prévenant et retardant l’apparition du DT2 et des autres CCM (Ratner et al ., 2008; Feig, 2012; Gunderson et al ., 2012; Chasan-Tabler, 2014; Much et al ., 2014). De ce fait, le suivi médical post-partum des femmes avec un DG apparaît comme étant tout aussi primordial que celui qui est fait pendant la grossesse.

1.3.5 Le diabète gestationnel et la programmation fœtale

Pour le nouveau-né, l’exposition à l’environnement in utero hyperglycémique est associée à l’augmentation de sa croissance fœtale et à un risque accru pour sa santé métabolique à long terme. Pendant la grossesse, le transport du glucose maternel à travers la barrière placentaire se fait selon le gradient de concentration materno-fœtal et via deux transporteurs de glucose (transporteur de glucose de type 1 et 3 (GLUT1) et (GLUT3)) qui sont présents en quantité suffisante pour ne pas limiter le transfert du glucose vers le fœtus (Hay, 2006; Gauster et al ., 2012). Chez les mères avec DG, le fœtus est donc exposé à des concentrations élevées de glucose qu’il doit lui-même métaboliser puisque le placenta est imperméable à l’insuline (Challier et al ., 1986). Afin de métaboliser le glucose et de prévenir l’hyperglycémie, les cellules ß-pancréatiques de fœtus augmentent leur production d’insuline. L’insuline stimule la production de facteurs de croissance IGFs et contribue donc à l’augmentation du dépôt de tissus adipeux chez le fœtus (Pedersen, 1954; Sacks, 2007). Les mécanismes de transport

19 placentaire des lipides et des acides aminés sont également modifiés dans les grossesses compliquées par un DG favorisant le transfert des nutriments vers la circulation fœtale et l’augmentation de la réponse insulinémique du foetus (Jansson et al , 2002; Cetin et al ., 2005; Jansson et al ., 2006; Radaelli et al ., 2009). La corrélation positive entre la glycémie maternelle au 2 e trimestre de la grossesse et les niveaux d’insuline du fœtus est supportée par plusieurs études dont l’étude HAPO (Metzger et al ., 2008; HAPO, 2009; Luo et al ., 2010; Gesteiro et al ., 2011 ). Des associations linéaires entre la glycémie maternelle 2h post-HGPO au 2 e trimestre, le poids et l’adiposité du bébé à la naissance ont aussi été rapportées à maintes reprises (Catalano et al., 2003; Hill et al ., 2005; Metzger et al ., 2008; HAPO, 2009; Farah et al ., 2011). Le DG est donc associé à une augmentation du risque de complications néonatales (macrosomie (poids ≥ 4 kg), hypoglycémie, détresse respiratoire, dystocie, hyperbilirubinémie) et obstétricales lors de l’accouchement (pré-éclampsie, césarienne, accouchement prématuré) (Jensen et al ., 2000; Fadl et al ., 2010; Catalano et al ., 2012; Ovesen et al ., 2014;) (Figure 1.4).

L’effet de l’exposition au DG sur la croissance et les indicateurs de santé métabolique des enfants semble être différent selon l’âge des enfants. En effet, chez les enfants de moins de 2 ans, les indicateurs de santé métaboliques des enfants nés de mères avec ou sans DG sont très similaires (Knight et al ., 2007;Pettitt et al ., 2010; Chatzi et al ., 2011; Retnakaran et al ., 2013). Ceci pourrait notamment être expliqué par un ralentissement de la croissance post-natal ( catch down ) des enfants ayant été exposés au DG (Stenhouse et al ., 2006; Crume et al ., 2011). Chez les enfants exposés au DG in utero, la croissance serait ralentie pendant les premiers 24 mois de vie et suivi d’une période de gain de poids accéléré. De nombreuses études démontrent d’ailleurs qu’à partir de l’âge de 3 ans et jusqu’à l’âge adulte, les enfants ayant été exposés au DG sont plus susceptibles d’être obèse, intolérant au glucose, résistant à l’insuline et hypertendue que les enfants ayant été exposés à un environnement normoglycémique (Tam et al , 2008; Wright et al ., 2009; Vaarasmaki et al ., 2009; Patel et al , 2012; Nehring et al ., 2013; Page et al ., 2014) (Figure 1.4). Il est intéressant de noter que les associations entre l’hyperglycémie maternelle et les CCM sont également observées chez les enfants et adolescents avec un poids normal à la naissance ( ≥ 2,0 kg et ≤ 4,0 kg) (Hillier et al ., 2007). Le DG peut donc programmer la santé métabolique du nouveau-

20 né indépendamment de son poids à la naissance. En outre, même si l’exposition au DG soit suffisante pour programmer la santé métabolique du nouveau-né, il est suggéré que l’exposition à l’obésité maternelle en combinaison avec le DG potentialise les risques de complications métaboliques chez les enfants (Gillman et al ., 2003; Boerschman et al ., 2010;Pirkola et al ., 2010; Catalano et al ., 2012; Kubo et al ., 2014).

Chez les adultes, des études de cohortes rétrospectives démontrent que ceux qui ont été exposés in utero au DG sont deux fois plus à risque d’être obèse et jusqu’à 7,8 fois plus susceptible de développer un pré-diabètes ou un DT2 que ceux qui ont été exposé à un environnement in utero normoglycémique (Clausen et al ., 2008; Clausen et al ., 2009; Kelstrup et al ., 2013). De plus, le risque d’être atteint d’un syndrome métabolique serait jusqu’à 4 fois plus élevé chez les adultes nés de mères avec un DG que chez ceux nés de mère avec une glycémie normale (Clausen et al ., 2009) (Figure 1.4). Tel que mentionné précédemment, l’obésité et le DT2 sont des facteurs de risque du DG. Conséquemment, les femmes en âge de procréer qui ont été exposées in utero au DG sont plus susceptibles d’avoir une grossesse compliquée par un DG et d’engendrer des enfants présentant un risque accru de développer de l’obésité et des CCM; perpétuant ainsi le cycle intergénérationnel de l’obésité (Figure 1.4) (Dabelea et Crume, 2011).

Figure 1.4- Le cycle intergénérationnel de l’obésité perpétué par le diabète gestationnel Le diabète gestationnel est associé au transfert excessif de nutriments vers le fœtus. Afin de métaboliser ces nutriments le fœtus accroit sa production d’insuline, augmentant du même coup sa croissance et l’accrétion de tissus adipeux. À la naissance, les nouveau-nés exposés au DG sont donc plus susceptibles de souffrir d’hyperinsulinémie et d’hypoglycémie. De plus, ils ont un poids de même qu’une adiposité plus élevés à la naissance ce qui augmentent le risque de complications obstétriques. L’exposition in utero au DG accroit le risque d’obésité, de résistance à l’insuline, d’intolérance au glucose et d’hypertension chez les enfants. Ces risques demeurent élevés à l’âge adulte. Ainsi, les femmes en âge de procréer ayant été exposées à un environnement fœtal hyperglycémique sont plus susceptibles d’être atteintes d’un DG et d’engendrer des enfants qui ont un risque accru de développer, à l’âge adulte, l’obésité ainsi que les désordres cardiométaboliques qui y sont associés.

Les complications périnatales associées au DG peuvent être prévenues par le traitement des femmes diagnostiquées avec un DG lors de leur 2 e trimestre de grossesse. Selon des essais cliniques randomisés, le traitement d’une hyperglycémie modérée, avec une diète ou de l’insuline, diminuent de façon considérable les risques de macrosomie, de dystocie et de pré-éclampsie (Landon et al ., 2009; Horvath et al ., 2010; Falavigna et al ., 2012). Par contre, le traitement du DG ne semble pas procurer de bénéfice sur la santé métabolique à long-terme des nouveau-nés. Une étude clinique randomisée incluant 199 mères, a notamment révélé que le traitement de l’hyperglycémie n’a pas d’impact sur l’IMC des enfants de 4 à 5 ans (Gillman et al ., 2010). De surcroît, puisqu’il n’est pas éthiquement et cliniquement acceptable de ne pas traiter les mères diagnostiquées avec un DG, les mères incluent dans les études rétrospectives associant l’exposition in utero au DG à un risque accru pour la santé métabolique des enfants et des adultes ont toutes été traitées avec une diète, de l’insuline ou un agent hypoglycémiant. Ainsi, les complications métaboliques associées au DG, énumérées ci-dessus, seraient vraisemblablement beaucoup plus importantes si les mères n’avaient pas été traitées. Une approche préventive du DG chez les femmes à haut risque, basée sur l’adoption de saines habitudes de vie avant et pendant la grossesse, pourrait s’avérer plus efficace que le traitement du DG pour briser le cycle intergénérationnel de l’obésité perpétué par le DG (Morisset et al ., 2010; Hopkins et Artal, 2013; Ruchat et Mottola, 2013).

Malgré les nombreuses données épidémiologiques probantes concernant la programmation métabolique fœtale suite à l’exposition au DG, les mécanismes impliqués dans ce phénomène sont encore mal compris. Les modèles animaux ont permis de mieux comprendre les mécanismes physiologiques pouvant prédisposer les nouveau-nés exposés in utero au DG à l’obésité et aux CCM associées. Les modèles animaux du DG sont générés chimiquement, chirurgicalement, génétiquement ou de façon nutritionnelle (Pasek et Gannon, 2013). Le modèle animal qui reproduit le plus fidèlement le DG observé chez la femme et le plus utilisé est celui de la rate avec un DG induit par l’administration de streptozotocine (STZ), un agent diabétogène naturel (Pasek et Gannon, 2013). L’injection de STZ au début de la gestation permet de détruire spécifiquement les cellules ß du pancréas entraînant une diminution de leur production d’insuline et l’hyperglycémie (Schnedl et al .,

1994). Le modèle murin de DG induit par la STZ permet d’engendrer des nouveau-nés hyperinsulinémiques et hyperglycémiques qui développent l’obésité, la résistance à l’insuline, l’intolérance au glucose et l’hypertension dans les mois suivants leur naissance (Atkins et al ., 1994; Plagemann et al ., 1999a; Blondeau et al ., 2011; Aref et al , 2013 ). Les études menées avec ce modèle murin ont mené à l’identification de malformations au stade fœtal et post-natal du développement qui seraient impliqués dans la programmation métabolique fœtale associée au DG. La diminution de la sécrétion de neuropeptide Y (NPY) causée par des malformations du noyau arqué et paraventriculaire de l’hypothalamus a notamment été associée à l’hyperphagie, la prise de poids, l’hyperinsulinémie et à l’intolérance au glucose chez les rats adultes ayant été exposés in utero au DG induit par la STZ (Plagemann et al ., 1998; Plagemann et al ., 1999a, Plagemann et al ., 1999b, Thamotharan et al ., 2003). Ces résultats suggèrent que des anomalies des noyaux hypothalamiques, centraux dans la régulation de l’appétit, pourraient contribuer au développement de l’obésité et du DT2 chez les adultes exposés in utero au DG. L’exposition au DG est aussi associée à l’hypertrophie puis à la dégénérescence des cellules ß- pancréatiques du nouveau-né quelques semaines après sa naissance. Ainsi, le dysfonctionnement des cellules ß-pancréatiques apparaît comme l’un des mécanismes pathologiques responsable de la programmation de la résistance à l’insuline et du DT2 (Han et al ., 2007; Aref et al ., 2013). En ce qui concerne l’hypertension observée chez les adultes ayant été exposés au DG pendant leur développement fœtal, elle serait causée par une réduction néphronique et par l’activation du système rénine-angiotensine (Nehiri et al ., 2008; Chen et al ., 2010; Yan et al ., 2014).

L’étude des modèles animaux du DG a permis d’élucider certains des mécanismes physiologiques pouvant contribuer à la programmation métabolique fœtale suite à l’exposition au DG. Néanmoins, les mécanismes moléculaires régulant ces adaptations physiologiques et la programmation de la santé métabolique du nouveau-né demeurent un champ d’étude encore peu exploré. Parmi les mécanismes étudiés, les modifications épigénétiques, plus particulièrement la méthylation de l’ADN, semblent jouer un rôle clé dans la programmation de la santé métabolique du fœtus.

1.4 L’épigénétique

1.4.1 La définition de l’épigénétique

Le terme épigénétique, dérivé du grec epigenesis , fut introduit pour la première fois en 1942 par le réputé biologiste Conrad Waddington. Il désirait alors créer une nouvelle discipline de recherche alliant la génétique et la biologie développementale. À cette époque, Waddington définie l’épigénétique comme « la branche de la biologie qui étudie les relations de cause à effet entre les gènes et leurs produits, faisant apparaître le phénotype » (Jablonka et Lamb, 2002). En créant cette nouvelle discipline, Waddington cherchait à comprendre le phénomène qui explique pourquoi certaines variations génétiques n’engendrent pas de variations phénotypiques et pourquoi certaines variations phénotypiques n’ont pas d’origine génétique (Jablonka et Lamb, 2002). C’est seulement 27 ans plus tard que la méthylation de l’ADN est identifiée comme premier mécanisme moléculaire distinct de la génétique pouvant réguler l’expression des gènes et le phénotype. Griffith et Mahler suggèrent alors que la méthylation de l’ADN régule l’expression des gènes pour assurer la différenciation des cellules en neurones spécialisées, les synapses et la mémoire à long-terme du cerveau (Griffith et Mahler, 1969). Depuis ce temps, l’étude des mécanismes épigénétiques a permis de préciser la définition de Waddington. Ainsi, la définition de l’épigénétique qui fait présentement consensus auprès de la communauté scientifique est la suivante : l’étude des modifications transmissibles et réversibles de l'expression des gènes qui n’altèrent pas la séquence nucléotidique de l’ADN. Selon cette définition, trois importantes caractéristiques différencient les modifications épigénétiques de la génétique traditionnelle :

1) Les modifications épigénétiques, contrairement à la génétique, régulent l’expression des gènes sans modifier la séquence nucléotidique de l’ADN. La régulation de l’expression génique par l’épigénétique se fait notamment en modifiant l’initiation de la transcription, la conformation de la chromatine ainsi que la stabilité de l’ADN et des transcrits d’ARNm (Berger, 2007; Cannell et al ., 2008; Carrera et Treisman, 2008).

2) Les modifications épigénétiques sont stables suite aux divisions cellulaires et pourraient être transmises d’une génération à l’autre. Depuis la fin des années 1980, il est reconnu que les marques épigénétiques des cellules différenciées sont maintenues lors de la

division d’une cellule mère en deux cellules filles (Holliday, 1987). L’héritabilité des modifications épigénétiques a d’ailleurs été longtemps restreinte aux divisions cellulaires mitotiques puisqu’il était accepté que la reprogrammation épigénétique, pendant la gamétogénèse et l’embryogenèse, efface complètement les marques épigénétiques. Néanmoins, il a récemment été suggéré que certaines modifications épigénétiques résistent à cette reprogrammation et pourraient être transmises aux générations subséquentes (Rakyan et al , 2002; Anway et Skinner, 2006; Campos et al ., 2014; Dias et Ressler, 2014).

3) Les modifications épigénétiques sont plastiques et réversibles. Contrairement aux variants génétiques qui sont irréversibles, les marques épigénétiques sont instables et flexibles et peuvent être modifiées par des processus stochastiques et/ou en réponse à des stimuli environnementaux. Le caractère transitoire des marques épigénétiques permet d’adapter l’expression des gènes et le phénotype en fonction de l’environnement auquel elles sont exposées (Jaenisch et Bird, 2003). Certaines marques épigénétiques, établies à des étapes clés du développement embryonnaire, seraient néanmoins irréversibles et pourraient conférer un risque accru à des pathologies (Dolinoy et al ., 2007; Heijmans et al ., 2008; Tobi et al , 2009).

Les mécanismes épigénétiques pouvant entraîner des modifications réversibles et transmissibles de l’expression des gènes et du phénotype, tel que présenté ci-dessus, incluent: la méthylation de l’ADN, les modifications des histones, les ARN non-codants, les protéines polycombes et les prions. Les prochaines sections présenteront les trois mécanismes épigénétiques les plus étudiés et les mieux compris soit : la modification des histones, les ARN non-codants ainsi que la méthylation de l’ADN, le sujet de cette thèse.

1.4.2 Les principaux mécanismes épigénétiques

1.4.2.1 Les modifications des histones

Les histones sont des protéines directement associées à l’ADN qui forment la structure de base de la chromatine et qui permettent la compaction de l’ADN dans le noyau. Deux molécules d’histone de chacune des classes H2A, H2B, H3 et H4 sont nécessaires pour former un complexe octamérique autour duquel l’ADN s’enroule pour former le nucléosome. Les histones de la classe H1, quant à elles, fixent l’ADN autour de chaque nucléosome afin de stabiliser la chromatine et de permettre la formation des chromosomes (Harshman et al ., 2013). Les modifications épigénétiques ont principalement lieu dans la région amino- terminale de la queue des histones qui est très flexible et sensible aux modifications post- traductionnelles. La littérature fait état de plus de 200 différents types de modifications des histones, les principales étant l’acétylation, la méthylation, la phosphorylation et l’ubiquitinylation (Herceg et Murr, 2011). Ces modifications régulent les interactions entre les histones de même que celles entre le nucléosome et l’ADN en recrutant des complexes protéiques ou en modifiant la charge des histones. Ainsi, ces modifications changent la conformation de la chromatine et l’accessibilité de l’ADN à la machinerie transcriptionnelle. Certaines modifications des histones sont associées à la décondensation de la chromatine et à la transcription des gènes. D’autres, en revanche, produisent l’effet inverse et entraînent la condensation de la chromatine et la répression transcriptionnelle (Tableau 1.3) (Li et al ., 2007). Il est suggéré que l’ensemble des modifications des histones forme un « code » qui dicte l’état de la chromatine et la régulation de l’expression des gènes (Jenuwein et al lis, 2001). Par conséquent, l’analyse des modifications des histones permet d’en apprendre d’avantage sur les régions génomiques impliquées dans la régulation de l’expression des gènes et dans certaines pathologies. Les modifications des histones sont d’ailleurs associées au cancer, à des anomalies développementales et à certaines maladies auto-immunes, neurologiques et inflammatoires (Butler et al ., 2012; Quintero-Ronderos et Montoya-Ortiz, 2012).

Tableau 1.3- Les principales modifications des histones associées à la transcription Positions Modifications Histone Acide Aminé Fonction dans la transcription Méthylation H3 K4 Activation K9 Répression/Activation K27 Répression K36 Répression K79 Activation R2 Activation R17 Activation R26 Activation H4 K20 Inhibition R3 Activation Phosphorylation H3 S10 Activation Ubiquitinylation H2B K120/K123 Activation H2A K119 Répression Acétylation H3 K56 Activation H4 K16 Activation Adapté de : Li B, Carey M, Workman JL (2007) The role of chromatin during transcription. Cell 128 (4): 707-719.

1.4.2.2 Les ARN non codants

Les ARN non codants (ARNnc), issus de la transcription de l’ADN, ne sont jamais traduits mais exercent des fonctions biologiques essentielles au sein de la cellule. Les ARNnc sont classés en deux familles en fonction de la longueur de leur transcrits soit: les ARNnc courts (20 à 30 nucléotides) et les ARNnc longs (> 200 nucléotides).

La famille des ARNnc courts est composée des microARN (miARN), des ARN interférents (ARNi) et des ARN interagissant avec Piwi (ARNpi). Ces trois catégories d’ARNnc courts à double brin se distinguent en partie par leur mode de biogenèse et leur mode d’action sur les ARNm cibles (Shrey et al ., 2009). Les miARN, découverts en 1993, sont sans aucun doute les ARNnc courts les mieux compris. Les miARN répriment la traduction de leurs ARNm cibles en s’appariant parfaitement ou partiellement avec ceux-ci (Bartel, 2004). De plus en plus de données démontrent que chaque miARN peut se lier à plus d’une centaine de transcrits d’ARNm et ainsi réguler un réseau important de gènes et de voies métaboliques. Par conséquent, l’altération du profil d’expression des miARN serait causale de plusieurs pathologies dont les MCV, les maladies auto-immunes et les cancers

(Katoh, 2014; Lee et al ., 2014). Il est également reconnu que les miARN contrôlent le processus de méthylation de l’ADN et jouent un rôle crucial dans la différenciation cellulaire et dans la mise en place de l’empreinte génomique parentale (Collins et al , 2011). L’étude des ARNi et des ARNpi est actuellement limitée à la levure à fission, au nématode, à la drosophile, aux plantes et à la souris. Ces modèles expérimentaux ont permis de démontrer que les ARNi et les ARNpi participent à la régulation de l’expression des éléments transposables du génome (Collins et al , 2011). Bien que les subtilités des mécanismes de régulation post-transcriptionnelle de ces deux ARNnc courts ne soient pas encore complètement élucidés, les ARNpi apparaissent essentiels pour la gamétogénèse, l’embryogénèse, la détermination du sexe et la maintenance des cellules souches (Watanabe et Lin, 2014). Les fonctions biologiques auxquelles participent les ARNi demeurent, quant à elles, encore très mal comprises (Piatek et Werner, 2014).

Les transcrits d’ARNnc longs se dénombrent par dizaine de milliers chez l’humain et l’étude de ceux-ci est actuellement en plein essor. Les ARNnc longs ont une structure très similaire à elle des transcrits d’ARNm mais n’encodent pas de protéines. De ce fait et en raison de leur faible niveau d’expression, les ARNnc longs ont longtemps été considérés comme du « bruit transcriptionnel ». Cependant, il est désormais reconnu que les ARNnc longs sont indispensables à de nombreuses fonctions biologiques. Ils sont notamment impliqués dans la régulation transcriptionnelle et post-transcriptionnelle de l’expression des gènes et dans la réparation des dommanges de l’ADN (Collins et al , 2011). Les mécanismes par lesquels les ARNnc longs modulent l’expression des gènes sont nombreux et incluent la modification de la conformation de la chromatine, l’épissage alternatif ainsi que la régulation de l’activité des facteurs de transcription et des miARN (Chen et Carmichael, 2010; Zhang et al ., 2014). Des études ont récemment démontré que l’expression des ARNnc longs est hautement spécifique aux tissus, suggérant un rôle clé dans la différenciation cellulaire et le développement embryonnaire (Fatica et Bozonni, 2014). Des évidences confirment également l’implication des ARNnc longs dans l’inactivation d’un chromosome X chez la femme et la mise en place de l’empreinte génomique parentale (Fatica et Bozonni, 2014).

L’étude des ARNnc, auparavant qualifiés « d’ADN poubelle », est encore à un stade embryonnaire. L’engouement des scientifiques pour cette nouvelle discipline et les avancées technologiques en séquençage permettront de mieux comprendre les mécanismes de régulation des ARNnc et de mieux définir leur part de responsabilité dans les pathologies auxquelles ils ont déjà été associés : les MCV, les maladies immunitaires, métaboliques, neurodégénératives et les cancers.

1.4.2.3 La méthylation de l’ADN

La méthylation de l’ADN fut la première modification épigénétique identifiée. Elle est donc, jusqu’à présent, celle qui a été la plus étudiée et celle qui est la mieux comprise. Le rôle de la méthylation de l’ADN dans la régulation de l’expression des gènes fut initialement proposé par des résultats publiés dans deux manuscrits distincts en 1975, soit ceux de Riggs et de Holliday et Pugh. À cette époque, les deux équipes suggèrent que la méthylation enzymatique des cytosines de l’ADN, stable suite aux divisions cellulaires mitotiques, module l’expression des gènes et que ce mécanisme permettrait d’activer ou de réprimer l’expression de gènes spécifiques à des moments précis du développement embryonnaire (Riggs, 1975; Holliday et Pugh, 1975). Il est aujourd’hui reconnu que la méthylation de l’ADN est fondamentale pour la différenciation cellulaire et d’autres fonctions biologiques essentielles à la survie embryonnaire et au développement du fœtus (l’empreinte parentale et l’inactivation d’un chromosome X chez la femme) qui seront discutées dans la section 1.5 de cette thèse.

1.4.2.3.1 Mécanismes de méthylation de l’ADN La présence de groupement méthyle en position C5 de l’anneau pyrimidine des cytosines fut observée pour la première fois en 1925 par Johnson et Coghill (Johnson et Coghill, 1925). Les cytosines méthylées sont maintenant reconnues comme la 5 e base de l’ADN (Lister et Ecker, 2009). L’ajout d’un groupement méthyle peut avoir lieu sur les cytosines situées en amont d’une guanine (dinucléotides CpG) ou dans un contexte non-CpG c’est-à-dire : CpA, CpC ou CpT (Lister et al ., 2009). Néanmoins, la méthylation des cytosines de l’ADN dans un contexte CpG est de loin la plus fréquente et celle qui est la mieux comprise. Chez les

30 vertébrés, il est reconnu que la méthylation des sites CpG dépend du donneur universel de groupements méthyles, la S-adénosyl-L-méthionine (SAM), et est catalysée par les méthyltransférases de l’ADN (DNMT) (Figure 1.5). Trois familles de DNMT ont jusqu’à maintenant été identifiées: les DNMT1, DNMT2 et DNMT3. La DNMT1 fut la première DNMT identifiée et elle est aussi la plus abondante dans les cellules. Cette dernière a une affinité intrinsèque pour les cytosines hémiméthylées et, située au niveau de la fourche de réplication de l’ADN, elle assure le transfert des patrons de méthylation de l’ADN au cours des divisions cellulaires (Bestor, 2000). La famille des DNMT3 est composée de la DNMT3a, DNMT3b et DNMT3L. Les DNMT3a et DNMT3b sont responsables de la méthylation de novo de l’ADN et sont cruciales pour la différenciation cellulaire et le développement embryonnaire (Bestor, 2000). Chez la souris, l’atténuation de ces deux gènes entraîne la mort au jour embryonnaire 11.5 ainsi que plusieurs malformations (Okano et al ., 1999). De son côté, la DNMT3L n’a pas d’activité catalytique mais sa coopération avec les deux autres enzymes de la famille des DNMT3 stimulerait leur activité et serait nécessaire pour établir les patrons de méthylation des gènes à empreintes parentales pendant le développement embryonnaire (Kaneda et al ., 2004; Subramaniam et al ., 2014). La protéine DNMT2 possède un domaine C-terminal catalytique très similaire à celui des DNMT1 et DNMT3. Cependant de récentes études ont démontré que cette DNMT serait impliquée dans la méthylation de l’ARN plutôt que dans celle de l’ADN (Goll et al ., 2006; Defossez, 2013).

Figure 1.5- La méthylation de l’ADN Les groupements méthyles qui sont transférés sur les cytosines ( C) proviennent de la S-adénosyl-L- méthionine (SAM), donneur universel de groupements méthyles. En présence de SAM, les méthyltransférases de l’ADN (DNMT) catalysent le transfert d’un groupement méthyle vers le carbone 5 d’une cytosine pour former la 5-méthylcytosine ( 5 mC ). De son côté, la déméthylation de la SAM entraîne la libération d’une molécule de S-adénosyl-homocystéine (SAH).

1.4.2.3.2 Mécanismes de déméthylation de l’ADN Les mécanismes de déméthylation de l’ADN sont encore mal compris. Il est suggéré que la déméthylation de l’ADN est conduite par deux processus distincts : un passif et un actif. Ce dernier serait contrôlé par différentes enzymes dont les ten-eleven translocation (TET) methylcytosine hydroxylases , les cytosines désaminases de la famille AID/APOBEC ainsi que certaines glycosylases (Figure 1.6). Les TET initieraient le processus de déméthylation actif en oxydant les cytosines méthylées des dinucléotides CpG de l’ADN et en les transformant en 5-hydroxyméthylcytosines (5-hmC) (Piccolo et Fisher, 2014). Cette conversion apparaît essentielle pour la continuation de la déméthylation active qui consisterait en l’oxydation ou la déamination des 5-hmC en vue de leur transformation ultérieure en cytosines non-méthylées via la réparation par excision des bases endommagées (BER) (Seisenberger et al , 2013; Piccolo et Fisher, 2014) (Figure 1.6). Les 5-hmC étaient, jusqu’à tout récemment, considérés comme un produit intermédiaire de la déméthylation de l’ADN avec un rôle imprécis. Il a récemment été proposé que cette modification épigénétique serait une marque stable et distincte de la méthylation de l’ADN (Bachman et al ., 2014). Les 5-hmC seraient principalement retrouvées au niveau des régions promotrices et intragéniques où elles pourraient liées des protéines régulatrice. Ainsi, le patron de distribution des 5-hmC suggère qu’elles seraient possiblement impliquées dans la régulation transcriptionnelle et post-transcriptionnelle de l’expression des gènes. Elles exerceraient donc des fonctions biologiques essentielles incluant la prolifération cellulaire (Mellen et al ., 2012; Iurlaro et al ., 2013; Bachman et al ., 2014).

Le processus passif de la déméthylation l’ADN serait quant à lui engendré par une perturbation de la maintenance de la méthylation de l’ADN par la DNMT1 qui entraînerait la dilution des marques de méthylation au fil des divisions cellulaires (Figure 1.6). La dilution passive des groupements méthyles serait causée soit par l’exclusion nucléaire de la DNMT1 ou par la conversion des cytosines méthylées en 5-hmCpG et autres sous-produits pour lesquelles la DNMT1 a une moins grande affinité de liaison (Seisenberger et al , 2013; Piccolo et Fisher, 2014).

Figure 1.6- La déméthylation de l’ADN La déméthylation de l’ADN se ferait via deux processus soit un processus passif ou actif. La perte passive des groupements méthyles des cytosines serait engendrée par la diminution de la maintenance de la méthylation par la DNMT1 lors de la réplication de l’ADN. La déméthylation active de l’ADN serait initiée par les ten-eleven translocation (TET) methylcytosine hydroxylases qui oxydent les 5- méthylcytosines ( 5 mC ) en 5-hydroxyméthylcytosines ( 5 hmC ). Les 5 hmC seraient ensuite soit désaminées en 5-hydroxyméthyluracil ( 5 hmU ) par les cytosines désaminases de la famille AID/APOBEC ou oxydées de nouveau par les TET en 5-formylcytosine ( 5 fC ) puis en 5- carboxylcytosine ( 5 caC ). Les bases des 5 hMu , 5fC et des 5caC pourraient être excisées par la thymine DNA glycosylase (TDG) ou la strand-selective monofunctional uracil-DNA glycosylase 1 (SMUG1) permettant l’activation de la voie de réparation par excision de base (BER) et la substitution de ces bases par des cytosines non méthylées ( C).

Adapté de: Seisenberger S, Peat JR, Hore TS, Santos F, Dean W, Reik W (2013) Reprogramming DNA methylation in the mammalian life cycle: building and breaking epigenetic barriers. Phil. Trans. R. Soc. Lond. B. Biol. Sci . 368 (1609): 20110330; et de Piccolo FM, Fisher AG (2014) Getting rid of DNA methylation. Trends in Cell Biology . 24 (2) : 136-143

1.4.2.3.3 Le méthylome et son rôle dans la régulation de l’expression génique Au cours des dernières années, l’étude du méthylome a permis de dresser un portrait plus précis de la distribution des dinucléotides CpG dans le génome et de démontrer que leur localisation a un impact considérable sur le mécanisme de régulation de l’expression génique (Jones, 2012; Stirzaker et al ., 2014). Le génome contient plus de 28 millions de sites CpG distribués de façon irrégulière. Globalement, le génome contient peu de CpG (5 fois moins que la fréquence attendue) en raison du taux élevé de mutations spontanées des cytosines

33 méthylées en thymines et du processus de réparation de l’ADN qui s’ensuit (BER). Il existe cependant certaines régions du génome, de 200 paires de bases ou plus, qui abritent une proportion accrue de CpG soit plus de 50%. Ces régions enrichies en CpG portent le nom d’îlots CpG (CGI) (Bird, 1986). La majorité de ces CGI est retrouvée dans les régions promotrices des gènes, particulièrement celles des gènes domestiques ( housekeeping ), et sont habituellement hypométhylés afin de permettre la transcription des gènes (Bird, 2002). La méthylation des CGI entraîne habituellement la répression de la transcription des gènes. En effet, celle-ci empêche la liaison de facteurs de transcription sur l’ADN ou favorise le recrutement de domaines protéiques associés à la répression transcriptionnelle ou à la compaction de la chromatine (Figure 1.7) (Jones et al , 1998; Bird et Wolffe, 1999; Bird 2002). Il est important de souligner que la méthylation de l’ADN des CpG d’un CGI du promoteur n’est donc pas systématiquement associée à la répression transcriptionnelle. Plusieurs études ont rapporté des associations positives entre les niveaux de méthylation et d’expression dans le contexte où les groupements méthyles bloquent la fixation d’inhibiteur transcriptionnel sur l’ADN (Figure 1.7) (Bell et al ., 2011; Guay et al ., 2012a; van Eijk et al ., 2012).

Contrairement au CGI des régions promotrices des gènes, les régions intragéniques avec une densité intermédiaire de CpG sont habituellement méthylées (Larsen et al ., 1992). Le mécanisme exact par lequel la méthylation exonique régule l’expression génique est encore mal défini. De plus en plus de données proposent qu’elle est impliquée dans la régulation de la cinétique d’association du complexe d’épissage nucléaire ( spliceosome ) à l’ADN et dans l’incorporation d’exons alternatifs à l’ARN pré-messager (Figure 1.7) (Shukla et al , 2011; Oberdoerffer, 2012; Maunakea et al ., 2013).

Les régions du génome avec une faible densité de CpG ont été, jusqu’à présent, peu étudiées. Elles comprennent les séquences activatrices ( enhancers ) des promoteurs et des introns ainsi que les régions limitrophes (shore ) situées à 2kb de part et d’autre des CGI. Ces deux composantes génomiques sont très importantes dans la régulation de l’expression des gènes et notamment pour la mise en place du patron d’expression génique spécifique à chaque type cellulaire. La méthylation des séquences activatrices et des rives des CGI est

34 généralement associée à l’inhibition de la transcription des gènes (Hon et al ., 2013; Stirzaker et al ., 2014).

Figure 1.7- La méthylation de l’ADN et la régulation de l’expression des gènes L’absence de méthylation des ilots CpG (CGI) permet aux facteurs de transcription (FT) de se lier à leur séquence consensus sur l’ADN et d’initier la transcription de l’ADN en ARNm ( A). L’ajout de groupements méthyles sur les CpG des CGI du prometteur est associé à la répression de la transcription soit en inhibant la liaison des FT ( B) ou en favorisant la liaison des protéines liant les méthyles (MBP) qui recrutent des domaines protéiques pouvant modifier la structure de la chromatine et/ou empêcher la transcription ( C). D’autre part, la méthylation des CGI du prometteur peut augmenter la transcription des gènes si elle bloque la liaison d’inhibiteur transcriptionnel ( D). Dans les régions exoniques, la méthylation de l’ADN pourrait réguler l’épissage d’exon alternatif. Lorsque les CpG exoniques ne sont pas méthylés, la liaison du FT CTCF est possible et entraîne le ralentissement du complexe d’épissage au niveau de l’exon alternatif et son incorporation dans l'ARNm ( E). Lorsque le site de liaison du FT CTCF est méthylé, la liaison de CTCF est bloquée, le complexe d’épissage ne s’immobilise pas à cet endroit et l’exon alternatif n’est donc pas intégré au transcrit d’ARNm ( F).

1.5 La méthylation de l’ADN pendant le développement embryonnaire

La méthylation de l’ADN est essentielle au développement et la croissance de l’embryon. La perturbation de la méthylation pendant le développement embryonnaire peut donc être fatale ou être à l’origine de certaines pathologies. Les prochaines sections présenteront, brièvement, le rôle de la méthylation de l’ADN dans la différentiation cellulaire, la mise en place de l’empreinte parentale et l’inactivation d’un chromosome X chez la femme, trois processus clés du développement embryonnaire.

1.5.1 Différentiation cellulaire et reprogrammation du méthylome chez le zygote et dans les cellules germinales primordiales

Le corps humain adulte est composé de plusieurs types cellulaires hautement spécialisées qui possèdent toutes le même génome. Les cellules se distinguent donc par leur profil d’expression génique. Les modifications épigénétiques, notamment la méthylation de l’ADN, permettent de réguler l’expression spatio-temporelle des gènes de l’embryon et d’assurer la différentiation de chaque type cellulaire (Hackett et Surani, 2013; Messerschmidt et al ., 2014).

Pendant le développement embryonnaire, le méthylome du zygote est reprogrammé afin de ré-établir la totipotence des cellules embryonnaires. Lors de cette reprogrammation, les marques de méthylation du pronucléus paternel et maternel sont complètement effacées à l’exception de celles des gènes soumis à l’empreinte génomique parentale (section 1.5.2) et de celles de certains rétrotransposons, Des études chez la souris et plus récemment chez l’humain ont démontré que cette déméthylation globale est régulée via les processus actifs et passifs indépendants dans chacun des pronucléus (Santos et al , 2002; Guo et al ., 2014; Smith et al ., 2014). Bien que les mécanismes exacts ne soient pas élucidés, il est suggéré que la déméthylation active et rapide du pronucléus paternel est régulée par les TET et le BER alors que le pronucléus maternel se déméthylerait passivement au fil des divisions cellulaires en l’absence de la DNMT1 (Figure 1.8) (Seisenberger et al , 2013; Reik et Kelsey, 2014). La déméthylation des deux pronuclei est suivi d’une vague de méthylation de novo débutant au stade blastocyste de l’embryon tout juste avant son implantation (Figure 1.8). À partir de ce moment et jusqu’au début de la période post-natale, la méthylation permet la régulation

36 spatio-temporelle de l’expression des gènes et la différenciation progressive des cellules. Les cellules souches embryonnaires de la masse cellulaire interne du blastocyste sont d’abord différenciées en trois feuillets (endoderme, ectoderme et trophectoderme) puis en cellules hautement spécialisées de l’organisme adulte (Hemberger et al ., 2009). L’instauration des patrons de méthylation spécifique à chaque type cellulaire semble être régulée par l’interaction de plusieurs éléments. Ceux-ci incluent: les modifications des histones, les petits ARN, la densité des îlots CpG et la présence de site de liaison pour des facteurs liant l’ADN, incluant les facteurs de transcription (Aravin et Hannon, 2008; Lienert, et al . 2011; Hon et al ., 2013; Luu et al ., 2013). D’autre part, la mise en place en place de marques de méthylation sur les éléments transposables est primordiale pour assurer la répression de leur activité et la stabilité du génome dans chacune des cellules (Beisel et Paro, 2011).

Une deuxième vague de reprogrammation de l’ADN a lieu dans les cellules germinales primordiales précurseur des gamètes. La reprogrammation épigénétique des cellules primordiales n’a pas encore été étudiée chez l’humain. Néanmoins, de nombreuses études chez le modèle murin démontrent que cette reprogrammation est particulièrement importante pour l’effacement de l’empreinte génomique parentale pendant la formation des gamètes ainsi que l’acquisition de nouvelles empreintes reflétant le sexe de l’embryon et son potentiel reproducteur (Seisenberger et al , 2013). Chez la souris mâle et femelle, la perte des marques de méthylation débute au jour E8 et se termine au jour E13.5 alors que les cellules germinales primordiales ont terminé leur migration et colonisé les gonades (Figure 1.8) (Hajkova et al ., 2002). La majorité des marques de méthylation sont effacées pendant cette reprogrammation hormis certaines associées à des éléments transposables (rétrotransposons) qui pourraient être transmisses à travers les générations (Guibert et al ., 2012). Les mécanismes impliqués dans la déméthylation des cellules germinales sont encore méconnus mais incluent probablement certains des processus actifs et passifs de la déméthylation décrits dans la section 1.4.2.3.3. La compréhension du processus de re-méthylation des gamètes est également limitée et basée sur l’étude de la méthylation de novo des gènes soumis à l’empreinte parentale. Ces dernières suggèrent que l’acquisition des marques de méthylation, via les DNMT3a, DNMT3b et DNMT3L, débute entre les jours E14.5 et E16.5 et se termine pendant la phase de la prospermatogonie pour les gamètes mâles. Chez les

37 femelles, elle survient après la naissance pendant la maturation des ovocytes (Davis et al ., 1999; Davis et al ., 2000; Lucifero et al ., 2002; Lucifero et al , 2004) (Figure 1.8).

Figure 1.8- Reprogrammation du méthylome dans le cycle de vie des mammifères La méthylation de l’ADN représente une barrière pour le potentiel développementale et reproducteur des mammifères. Le méthylome est donc reprogrammé à deux reprises pendant le développement embryonnaire afin de restaurer ces potentiels. La première vague de reprogrammation à lieu suite à la fertilisation quand les pronécléus mâle et femelle sont déméthylés, à l’exception des régions différentiellement méthylés (DMR) des gènes soumis à l’empreinte parentale et des retrotransposons. La déméthylation du pronucléus mâle est rapide et tandis que la déméthylation du pronucléus femelle est lente et passive. Le rétablissement des marques de méthylation débute dans la masse cellulaire interne du blastocyste et permet la différentiation de chaque type cellulaire. La deuxième vague de reprogrammation a lieu dans les cellules germinales primordiales et est essentielle pour la mise en place de l’empreinte parentale représentant le sexe de l’embryon et son potentiel reproducteur. Cette vague débute par la déméthylation complète du génome, hormis les rétrotransposons et se termine par la reméthylation des gamètes mâles et femelles et l’établissement des empreintes parentales spécifiques à chacun des sexes.

Adapté de: Saitou M, Kagiwada S, Kurimoto K (2012) Epigenetic reprogramming in mouse preimplantation development and primordial germ cells. Development . 139 (1): 15-31; et de Seisenberger S, Peat JR, Hore TS, Santos F, Dean W, Reik W (2013) Reprogramming DNA methylation in the mammalian life cycle: building and breaking epigenetic barriers. Phil. Trans. R. Soc. Lond. B. Biol. Sci . 368 (1609): 20110330

1.5.2 L’empreinte parentale

La méthylation de l’ADN est reconnue comme l’un des mécanismes régulant l’expression mono-allélique de plusieurs gènes soumis à l’empreinte parentale. Les gènes soumis à l’empreinte parentale sont méthylés de manière différente entre le génome maternel et paternel à des loci appelés « régions différentiellement méthylées » ou DMR (differentially methylated region ). Ces DMR, mises en place pendant la gamétogénèse, permettent d’activer ou de réprimer l’expression d’un gène en fonction de l’origine parentale du chromosome et sont essentielles à la reproduction et la survie embryonnaire (Barlow et Bartolomei, 2014). De surcroît, ces DMR résistent à la reprogrammation du méthylome qui a lieu au stade zygote de l’embryon suggérant qu’elles puissent être transmises des parents à la génération suivante (Ishida et Moore, 2013; Barlow et Bartolomei, 2014). Jusqu’à présent plus d’une centaine de gènes soumis à l’empreinte parentale ont été identifié chez la souris et plus d’une cinquantaine chez l’humain (Barlow et Bartolomei, 2014). Ces gènes sont généralement regroupés au sein de domaines soumis à l’empreinte parentale et sont régulés par des éléments communs appelés imprinting control elements (ICEs) qui comprennent des DMR de même que des gènes codant pour des ARNnc longs et courts incluant les miARN (Barlow et Bartolomei, 2014) .

La majorité des gènes soumis à l’empreinte parentale sont impliqués dans la régulation de la croissance fœtale et placentaire ainsi que dans la régulation des fonctions cognitives et comportementales (Ishida et Moore, 2013). La perturbation de l’empreinte parentale causée par l’augmentation ou la diminution des niveaux de méthylation a été associée à certains types de cancer et plusieurs syndromes incluant le syndrome de Beckwith- Wiedemann, de Prader-Willi, d’Angelman, de Silver-Russel et de Turner (Robertson, 2005; Peters, 2014). De nombreuses études ont également rapporté des associations entre les niveaux de méthylation des gènes soumis à l’empreinte parentale, plus particulièrement (insulin growth factor 2 ) IGF2 /H19 , et la croissance fœtale (poids à la naissance) (Koukoura et al ., 2011; Lim, 2012; St-Pierre et al ., 2012; Bouwland-Both et al ., 2013; Azzi et al ., 2014).

1.5.3 L’inactivation du chromosome X

Chez les mammifères femelles, les gènes de l’un des deux chromosomes X doivent être inactivés afin de doser l’expression des gènes qu’il abrite (le génome mâle ne dispose en effet que d’un seul chromosome X). L’inactivation aléatoire de l’un des chromosomes X est régulée par un ensemble de modifications épigénétiques incluant la méthylation de l’ADN (Chaligné et Heard, 2014). L’ARNnc Xist ( X-inactive specific transcript ), localisé dans de le centre d’inactivation du chromosome X inactivé (Xi), est essentiel pour initier l’inactivation de l’un des deux chromosomes X dans les cellules somatiques femelles. Xist, exprimé exclusivement par l’allèle paternel, couvre entièrement le chromosome Xi. Néanmoins, son rôle dans l’inactivation de ce dernier est encore mal compris (Avner et Heard, 2001). Il est suggéré que Xist est impliqué dans régulation de la structure tridimensionnelle du chromosome via les modifications des histones et le recrutement de complexes protéiques polycombes (Chaligne et Heard, 2014). De son côté, la méthylation de l’ADN est primordiale pour réprimer l’expression des gènes sur le chromosome Xi. En effet, les CGI de la majorité des gènes du Xi sont hyperméthylés et l’altération de leur méthylation est associée à une augmentation de l’expression. La méthylation des gènes du

Xi serait entre autre régulée par la DNMT1 et la protéine SMCHD1 (structural maintenance of chromosomes flexible hinge domain containing 1) (Blewitt et al ., 2008; Gendrel et al .,

2013). Il est reconnu qu’environs 15% des gènes sur le Xi échappent à l’inactivation permettant ainsi l’expression de gènes provenant à la fois du chromosome X maternel et paternel (Carrel et Williard, 2005; Cotton et al ., 2013). L’analyse de la méthylation de ces gènes a permis de démontrer que les gènes résistants à l’inactivation sont spécifiques au tissu et que leur expression est fortement influencées par le génotype (Cotton et al ., 2011; Cotton et al ., 2013; Cotton et al ., 2014). La fonction exacte des gènes échappant à l’inactivation sur le Xi est encore méconnue. Ils apparaissent cependant essentiels pour le développement normal de l’embryon (Chaligne et Heard, 2014). La méthylation de l’ADN semble donc jouer un rôle clé dans le maintien de l’équilibre de l’expression et la fonction des gènes des chromosomes X.

1.6 La méthylation de l’ADN dans la programmation métabolique fœtale

Le caractère dynamique des marques la méthylation de l’ADN pendant le développement embryonnaire les rend particulièrement vulnérables aux stimuli environnementaux in utero . De nombreuses études, chez les animaux et les humains, ont d’ailleurs mis en évidence que la méthylation de l’ADN du nouveau-né pouvait être altérée par l’environnement intra utérin auquel il avait été exposé. Il est aussi reconnu que ces adaptations épigénétiques peuvent potentiellement modifier, de façon permanente, le phénotype du nouveau-né. La méthylation de l’ADN apparaît donc comme l’un des mécanismes moléculaires permettant d’expliquer, du moins en partie, le lien entre l’exposition à un environnement fœtal défavorable et les risques pour la santé cardiométabolique à long terme du nouveau-né.

1.6.1 Les modèles animaux

Les souris Agouti ont été les premières utilisées afin de démontrer l’impact de la nutrition maternelle sur la méthylation de l’ADN et le phénotype du nouveau-né. La couleur du pelage des souris Agouti est déterminée par le gène « agouti viable yellow (Avy ) » dont l’expression est régulée par la méthylation de l’ADN. L’hypométhylation d’un élément transposable (rétrotransposon) en amont du site d’initiation de la transcription du gène Avy est associée à l’expression d’ Avy ainsi qu’à la couleur jaune du pelage. À l’inverse, un pelage de couleur brune est observé lorsque ce site est hyperméthylé et l’expression d’ Avy réprimée (Duhl et al ., 1994). Le gène Avy code pour la protéine Agouti, un facteur paracrine présentant, entre autre, la fonction d’antagoniste de Mc4r (Lu et al ., 1994). Mc4r est un récepteur des mélanocortines dont le déficit est à l’origine d’un phénotype d’obésité sévère (Huszar et al ., 1997). Par conséquent, les souris Agouti au pelage jaune, même si elle possèdent le même génome que celles au pelage brun, sont plus sujettes à l’obésité, au DT2 et au cancer (Miltenberger et al ., 1997). Ces souris ont permis de démontrer que la supplémentation en donneur de groupe méthyle (acide folique, vitamine B12, bétaïne et choline) pendant la gestation modifie les niveaux de méthylation du rétrotransposon en amont de Avy , l’expression de Avy , la couleur du pelage des souriceaux de même que leur degré d’obésité (Wolff et al ., 1998; Waterland et Jirtle, 2003). D’autre part, il est suggéré que les marques

41 de méthylation du locus Avy sont transmissibles d’une génération à l’autre (Morgan et al ., 1999).

Les rongeurs exposés in utero à environnement maternel restreint en calorie/protéine ou enrichie en calorie/gras ont aussi été abondamment utilisés dans les dernières années afin d’identifier des gènes épigénétiquement modifiés par l’exposition à un environnement intra utérin défavorable et impliqués dans la programmation métabolique fœtale. Ces rongeurs constituent un excellent modèle de la programmation métabolique fœtale puisqu’ils développent, quelques jours après leur naissance, de l’obésité, un diabète, des dyslipidémies et de l’hypertension (Bertram et Hanson, 2011). L’étude des rongeurs exposés à la malnutrition maternelle induite a permis d’identifier des gènes clés du métabolisme énergétique ( Adipoq , Igf2/H19 , Lep, Ppar α et Pomc ) pour lesquels la méthylation de l’ADN est perturbée dans des tissus métaboliquement actifs (foie, hypothalamus, muscle et tissus adipeux) (Lillycrop et al ., 2005; Lillycrop et al ., 2008; Plagemann et al ., 2009, Gong et al ., 2010; Jousse et al ., 2011; Khalyfa et al ., 2013). La méthylation de la majorité de ces gènes a été associée à des variables anthropométriques et à des facteurs de risques cardiométaboliques des nouveau-nés et/ou des rongeurs adultes confirmant leur importance dans la programmation métabolique fœtale (Plagemann et al ., 2009; Jousse et al ., 2011; Khalyfa et al ., 2013). De surcroît, ces modèles murins ont permis de démontrer que la méthylation de certains gènes est stable de la naissance à l’âge adulte (Lillycrop et al ., 2008).

Les modèles animaux ont, jusqu’à présent, été peu utilisés dans l’étude de la programmation fœtale associée au DG. Le modèle de souris avec un DG induit par l’administration de STZ a permis de démontrer que l’hyperglycémie maternelle pouvait altérer les niveaux de méthylation de certains gènes soumis à l’empreinte parental du fœtus (Igf2 /H19 ) et du placenta ( Peg3 et H19 )(Shao et al , 2008; Ge et al ., 2013). Ces modifications épigénétiques sont associées au développement anormal de l’embryon et pourraient potentiellement contribuer au phénomène de la programmation métabolique fœtale. Les mécanismes responsables des modifications des niveaux de méthylation du fœtus et du placenta exposés à l’hyperglycémie maternelle demeurent inexplorés dans les modèles animaux. Par contre, des études in vitro suggèrent que l’hyperglycémie peut moduler la

42 méthylation de l’ADN via son action sur les DNMT et les TET, plus particulièrement TET3 (Chiang et al ., 2009; Zhang et al ., 2014). Ces résultats devront toutefois être validés in vivo .

1.6.2 Les études épidémiologiques

La première étude épidémiologique suggérant que la méthylation de l’ADN puisse être impliquée dans le phénomène de la programmation fœtale fut conduite par Heijmans et son équipe et publiée en 2008. Cet article rapporte que la méthylation du gène IGF2 dans le sang d’adultes ayant été exposés in utero à la Dutch Hunger Famine est, 60 ans plus tard, inférieure à celle de leurs frères et sœurs du même sexe qui n’ont pas été exposés à cette famine (Heijmans et al ., 2008). L’équipe de Heijmans démontre ensuite, en utilisant la même cohorte, que certains gènes associés à la croissance fœtale et au métabolisme énergétique (ABCA1 , GNASAS , IL10 , LEP et MEG3 ) présentent aussi des différences de méthylation de l’ADN . De plus, ils soulignent que certaines de ces modifications épigénétiques sont influencées par le sexe et par le moment pendant lequel l’exposition in utero à la dénutrition est survenue (début vs . fin de la grossesse) (Tobi et al ., 2009). Depuis la publication de ces deux études, quelques équipes analysent la méthylation des gènes à la naissance (placenta et sang de cordon) dans le but d’identifier des gènes pouvant être épigénétiquement modifiés par l’environnement in utero et pouvant prédire le risque d’obésité et de CCM chez le nouveau-né. Deux approches sont utilisées afin d’identifier les gènes associés à la programmation fœtale soit l’approche à l’échelle du génome et l’approche par gènes candidats. Ces deux approches ont été appliquées dans le cadre de cette thèse.

1.6.2.1-Approche à l’échelle du génome

L’approche à l’échelle du génome consiste à analyser la méthylation de sites CpG à travers le génome afin d’identifier ceux qui sont associés à la croissance fœtale (poids à la naissance) ou à l’exposition à un environnement in utero défavorable et possiblement associé à un risque accru d’obésité et de CCM pour le nouveau-né. Cette approche permet d’identifier des gènes et aussi des voies biologiques qui sont possiblement impliqués dans la programmation métabolique fœtale. Bien que plusieurs méthodes soient maintenant disponibles pour analyser le méthylome des échantillons biologiques, la méthode la moins onéreuse et la plus

43 fréquemment utilisée est celle des micropuces. Les micropuces Infinium 27K et 450K d’Illumina permettent de quantifier les niveaux de méthylation de 27 578 et 485 492 sites CpG distribués à travers le génome respectivement.

L’analyse du méthylome d’échantillons de placenta et de sang de cordon avec les micropuces d’Illumina a notamment permis d’identifier de nombreux épipolymorphismes associés au poids à la naissance des nouveau-nés. Une première étude portant sur l’analyse du méthylome de 206 échantillons de placenta a identifié 22 loci pour lesquels les niveaux de méthylation sont associés à la croissance fœtale. Le profil de méthylation de ces 22 loci permet de distinguer les nouveau-nés avec une petite taille pour leur âge gestationnel ou un retard de croissance intra-utérin de ceux avec un poids normal à la naissance (Banister et al ., 2011). Dans une autre étude, l’équipe de Turan rapporte que la méthylation de 23 gènes du placenta et du sang de cordon peut expliquer de 70 à 87% de la variance du poids à la naissance. Parmi ces 23 gènes, 6 gènes ( ANGPT4 , APOE , CDK2 , GRB10 , OSBPL5 et REG1B ) avaient été précédemment associé à des indices de croissance de la souris et/ou de l’humain (Turan et al ., 2012). Dernièrement l’analyse de 1 046 échantillons de sang de cordon a mené à l’identification de 19 CpG localisés dans 9 gènes dont les niveaux de méthylation sont significativement corrélés avec le poids à la naissance suite à la correction de Bonferonni pour comparaisons multiples ( p = 1 x 10 -7) (Engel et al ., 2014). Quelques années plus tôt, l’étude d’Adkins rapportait des associations nominalement significatives entre la méthylation de l’ADN du sang de cordon et le poids à la naissance au niveau de 1 184 CpG (2x10 -4 > p ≤ 0.05)(n= 201) (Adkins et al ., 2012). Dans ces deux dernières études, les gènes les plus significativement associés avec le poids à la naissance participent notamment à la régulation de l’adipogénèse ( ARID5B ) et de la fonction des cellules ß-pancréatiques (GPR40 et AQP12A ) (Engel et al ., 2014; Adkins et al ., 2012). L’ensemble de ces résultats suggère que des modifications épigénétiques du placenta et du sang cordon à la naissance reflètent l’état de la croissance et le développement du fœtus et peuvent potentiellement avoir un impact sur la santé métabolique à long terme du nouveau-né.

Les études à l’échelle du génome portant sur l’impact des conditions maternelles et environnementales sur le méthylome du placenta et du sang de cordon sont moins abondantes

44 que celles portant sur le poids à la naissance. Les modifications épigénomiques du nouveau- né suite à l’exposition in utero à la cigarette sont, jusqu’à présent, celles qui ont été le plus étudiées. L’analyse du méthylome du placenta et du sang de cordon a permis d’identifier plusieurs gènes épigénétiquement modifiés par l’exposition in utero à la cigarette notamment CYP1A1, AHRR et GFI1 . Les niveaux de méthylation de ces trois gènes ont été associés à l’exposition in utero à la cigarette par au moins trois études différentes confirmant leur importance dans la programmation fœtale associée à la cigarette (Joubert et al ., 2012; Novakovic et al ., 2014; Lee et al ., 2014). De plus, il a été démontré que les différences de méthylation observées entre les nouveau-nés exposés ou non à la cigarette persistent jusqu’à l’adolescence pour ces 3 gènes (Lee et al ., 2014). Par conséquent, il apparaît raisonnable de postuler que l’environnement maternel induit des modifications épigénétiques chez le nouveau-né qui peuvent demeurer stable pendant le développement post-natal et qui pourraient possiblement engendrer certaines pathologies.

L’effet de la condition métabolique des mères (obésité et DG) sur le méthylome du nouveau-né a jusqu’à maintenant été peu investigué. Une étude récente réalisée dans le sang de cordon de 308 nouveau-nés de mères afro-américaines et haïtiennes fait état de 20 CpG différentiellement méthylés ( p ≤ 10 -4) selon l’IMC pré-grossesse des mères. La majorité de ces CpG sont localisés au niveau de loci contrôlant la réponse immunitaire, l’inflammation et le métabolisme des lipides (Liu et al ., 2014). L’impact du DG sur le méthylome du nouveau-né a été investigué dans trois contextes différents, en plus de nos études. L’équipe de Quilter a comparé le méthylome du sang de cordon des nouveau-nés avec une croissance fœtale et post-natale (0 à 1 an) régulière (groupe control (n=40)) à celui des nouveau-nés exposés au DG (n=16) (diagnostiqué selon les critères de l’OMS) et avec une croissance in utero restreinte (n=40); deux conditions associées à un risque accru d’obésité et de CCM à long terme. Parmi les 27 578 CpG analysés, Quilter rapporte que 45 CpG, situés dans 43 gènes, sont différentiellement méthylés entre les nouveau-nés du groupe control et ceux du groupe exposé au DG. Ces résultats ont été confirmés dans une cohorte indépendante pour 6 de ces 43 gènes ( GSTM5 , MEOX1 , OR2L13 , MGC3207 , FLJ45964 et INSL4 ). Par ailleurs, plusieurs gènes épigénétiquement modifiés par l’exposition au DG sont aussi modifiés chez les nouveau-nés avec une croissance fœtale restreinte et sont associés à l’obésité et au

45 métabolisme des carbohydrates. Ainsi, les modifications épigénétiques de ces gènes pourraient potentiellement être un mécanisme commun de la programmation métabolique fœtale associée au DG et à la croissance fœtale restreinte (Quilter et al ., 2014).

En ce qui concerne l’équipe d’El Hajj, leur analyse du méthylome du placenta et du sang de cordon des nouveau-nés exposés au (n=186) ou non-exposés au DG (n=85) (critères diagnostique de l’IADPSG) n’a pas permis d’identifier de gènes démontrant une différence de méthylation significative à l’échelle du génome entre les deux groupes. Toutefois, cette étude démontre que les gènes épigénétiquement modifiés par l’exposition au DG sont majoritairement retrouvés dans les voies biologiques impliquées dans les cancers, les maladies respiratoires, métaboliques et cardiovasculaires (El Hajj et al ., 2014).

Plus récemment, Petropoulos et ses collaborateurs ont comparé le méthylome du placenta des humains et murins exposés au DG afin d’identifier les gènes épigénétiquement modifiés par l’exposition au DG chez les deux espèces. Bien que le modèle de rat utilisé soit diabétique avant le début de la gestation et ne soit pas une représentation parfaite du DG, cette étude démontre pour la première fois que 47 sites CpG différentiellement méthylés dans les échantillons de placenta exposés ou non exposés au DG sont communs chez ces deux espèces (Petropoulos et al ., 2014). Cette équipe a aussi démontré que certaines des différences de méthylation observées dans le placenta des rats exposés et non exposés au DG sont aussi présentes dans le foie des rats 30 jours suivant la naissance. Les gènes épigénétiquement modifiés par le DG dans la placenta des femmes et des rats sont principalement retrouvés dans les voies biologiques du système endocrinien (résistance à l’insuline, diabètes mellitus ), des maladies métaboliques ainsi que du métabolismes des glucides et des lipides (Petropoulos et al ., 2014).

L’ensemble des données provenant des études de méthylation à l’échelle du génome a donc permis d’identifier plusieurs nouveaux gènes candidats potentiellement impliqués dans la programmation métabolique fœtale. Les analyses de voies biologiques réalisées en parallèle soutiennent l’hypothèse qu’une croissance fœtale sous-optimale et/ou l’exposition

46 in utero à un environnement défavorable peuvent prédisposer le nouveau-né aux maladies chroniques et que la méthylation de l’ADN joue un rôle important dans ce phénomène.

1.6.2.2- Approche par gènes candidats

Dans le contexte de la programmation fœtale, l’approche par gènes candidats consiste à analyser la méthylation de gènes dont la fonction pourrait jouer un rôle dans le développement de l’obésité et des CCM associées. Les gènes soumis à l’empreinte parentale de même que ceux impliquées dans la régulation du métabolisme énergétique et des lipides ont notamment été étudiés comme gènes candidats de la programmation fœtale (Fowden et al ., 2006; Junien et Nathanielsz, 2007; Godfrey et al , 2011; Cooper et al ., 2012; Veenendaal et al ., 2012; Vidal et al ., 2013; Reynolds et al ., 2013). La section suivante présentera uniquement les gènes candidats dont la méthylation a précédemment été associée à l’exposition in utero au DG.

Notre équipe fut la première à s’intéresser à l’étude de la méthylation de l’ADN de gènes candidats en réponse à l’exposition in utero au DG. Les premiers gènes étudiés par notre équipe sont LEP et ADIPOQ , deux excellents gènes candidats de la programmation métabolique fœtale. En effet, ces deux gènes codent pour des protéines, la leptine et l’adiponectine, sécrétées par le tissu adipeux et reconnues pour leurs fonctions dans le métabolisme énergétique et la résistance à l’insuline (Havel, 2002). La leptine agit comme signal de satiété et a un rôle central dans la régulation de la prise alimentaire. Les concentrations de leptine circulante sont corrélées positivement avec le degré d’adiposité et chez les personnes obèses, les concentrations de leptine sont anormalement élevées puisque celles-ci développent une résistance à la leptine (Havel, 2004). Contrairement à la leptine, les concentrations plasmatiques d’adiponectine, sont réduites chez les obèses. L’adiponectine exerce des effets insulino-sensibilisateur, anti-inflammatoire et anti- athérogénique (Havel, 2004). Nous avons démontré que les niveaux de méthylation de la LEP et de l’ ADIPOQ du placenta sont négativement corrélés avec la glycémie maternelle 2h post-HGPO au 2 e trimestre de la grossesse (Bouchard et al ., 2010; Bouchard et al ., 2012). D’autres études ont ensuite confirmé que la méthylation du gène LEP au niveau du placenta et du sang de cordon pouvait être perturbée par une exposition à des conditions maternelles

47 défavorables incluant le DG, l’obésité pré-grossesse et la pré-éclampsie (Lesseur et al ., 2013; Hogg et al ., 2013; Lesseur et al ., 2014). En outre, Tobi et al . avaient déjà proposé que la dérégulation épigénétique de LEP puisse être impliquée dans le programmation fœtale en démontrant que les niveaux de méthylation de LEP sont plus élevés dans le sang des hommes ayant été exposés in utero à la Dutch Hunger Famine comparativement à ceux qui n’y avaient pas été (Tobi et al ., 2009). Une étude rapportant des associations entre la méthylation de LEP dans les cellules sanguines circulantes, le poids à la naissance et l’IMC des enfants à 17 mois supportent aussi le rôle de LEP dans la programmation fœtale (Obermann-Borst et al , 2013). De surcroît, les résultats d’une récente étude qui a observé une diminution de la méthylation de LEP et ADIPOQ dans le sang des adolescents obèses et résistants à l’insuline appuient l’hypothèse selon laquelle le profil épigénétique de ces adipokines, possiblement programmés in utero , pourrait être impliqué dans la pathogenèse de l’obésité et des CCM associées (Garcia-Cardona et al , 2014).

Dans un deuxième temps, notre équipe a investigué l’impact de l’hyperglycémie maternelle sur les niveaux de méthylation du système IGF du placenta. L’exposition à l’hyperglycémie maternelle (2h post-HGPO au 2 e trimestre de la grossesse) a été associée à la diminution des niveaux de méthylation des gènes IGF1R et IGFBP3 du placenta. Ces deux gènes sont impliqués dans la croissance et le développement fœto-placentaire de même que dans la régulation du métabolisme énergétique. De ce fait, la perturbation des niveaux de méthylation de ces gènes pourrait, vraisemblablement, participer à la programmation de l’obésité et des CCM chez le nouveau-né (Desgagne et al ., 2014).

L’équipe de El Hajj s’est quant à elle penchée sur l’étude de la méthylation de 14 gènes candidats dans le placenta et le sang de cordon afin d’expliquer le lien entre l’exposition in utero au DG et le risque accru de maladies chroniques à long terme. Parmi les 14 gènes étudiés, des différences de méthylation au niveau des gènes MEST et NR3C1 ont été observées entre les échantillons de placenta et de sang de cordon exposés ou non- exposés au DG (El Hajj et al ., 2013). Dans le sang des adultes, la méthylation de MEST , un gène soumis à l’empreinte parentale, est également corrélé avec l’IMC, la circonférence de

48 la taille et le phénotype de l’obésité soutenant son rôle dans la programmation métabolique fœtale (El Hajj et al ., 2013; Carless et al ., 2013).

Dernièrement, l’exposition au DG, diagnostiqué selon les critères diagnostiques de l’IADPSG, a été associée à l’augmentation de la méthylation de trois sites CpG situés dans la DMR du gène GNAS (Chen et al ., 2013). GNAS régule notamment l’expression de Gs alpha qui est soumise à l’empreinte parentale et qui est associés au développement de l’obésité (Chen et al ., 2013). Ainsi, il apparaît biologiqment plausible que la programmation in utero de la méthylation de GNAS puisse aussi être impliquée dans le développement futur de l’obésité et des CCM observé chez les enfants et les adultes nés de mères avec un DG.

L’analyse de la méthylation de l’ADN du placenta et du sang de cordon, que ce soit par l’approche à l’échelle du génome ou par gène candidat, a permis d’identifier des gènes possiblement impliqués dans le programmation métabolique fœtale associée au DG. Des études réalisées auprès des enfants et des adultes ont aussi démontré que la méthylation de l’ADN est associée à l’obésité, au DT2, aux dyslipidémies et aux MCV (Yang et al ., 2012; Guay et al ., 2012a; Guay et al ., 2012b;Guay et al ., 2013; Zhang et al ., 2013; Gomez-Uriz et al ., 2014; Dick et al ., 2014; Nilsson et al ., 2014; Sharma et al ., 2014; Whayne, 2014). Toutefois, il n’a pas encore été déterminé si les marques de méthylation associées à ces pathologies ont été à l’origine établies pendant le développement embryonnaire. Étant donné que la méthylation de l’ADN peut être influencée par des facteurs environnementaux postnatals (section 1.7.2), des études longitudinales seront nécessaires afin de vérifier si les marques épigénétiques observées à la naissance sont stables dans le temps et associées avec le risque de développer l’obésité et des CCM dans le futur. D’autre part, les études énumérées ci-dessus, comme la majorité des études épigénétiques, ont analysé la méthylation de l’ADN dans des tissus accessibles soit le placenta, le sang de cordon et le sang des enfants et des adultes. Par contre, la méthylation de l’ADN est spécifique à chaque type cellulaire, la validité de l’utilisation du placenta et du sang pour prédire le profil de méthylation des tissus métaboliquement actifs reste à prouver. La sélection du tissu à analyser est un enjeu important des études épigénétiques en épidémiologie et sera discutée dans la section 1.8.

1.7 Les facteurs contribuant à la variabilité des niveaux de méthylation

1.7.1 L’environnement post-natal

Tel que décrit précédemment, la signature épigénétiques établie in utero pourrait perdurer de jusqu’à l’âge adulte et être responsable de certaines pathologies. Des études longitudinales ont d’ailleurs démontré que le profil de méthylation de plusieurs gènes est très stable dans le temps (Talens et al ., 2010; Murphy et al ., 2012; Wang et al ., 2012; Clarke-Harris et al ., 2014; Flanagan et al ., 2014). Selon une étude pangénomique de Feinberg et ses collaborateurs, plus de la moitié des quatre millions de CpG analysés dans les cellules sanguines arborent des marques de méthylation stables sur une période de 10 à 20 ans (Feinberg et al . 2010). Toutefois, les niveaux de méthylation de la seconde moitié des sites CpG analysés seraient dynamiques et pourraient par conséquent être modulés par des processus stochastiques, les facteurs environnementaux post-natals, les habitudes de vie et le vieillissement (Figure 1.9). Il a notamment été rapporté que la méthylation de l’ADN est modifiée par l’exposition, l’inhalation ou l’ingestion de substances toxiques contenues dans l’air ambiant, la cigarette, les drogues et l’alcool (Baccarelli et al ., 2009; Breitling et al ., 2011; Nielsen et al ., 2012; Zeilinger et al ., 2013; Elliott et al ., 2014; Kruman et Fowler, 2014; Carmona et al ., 2014). Des modifications des niveaux de méthylation de l’ADN ont également été observées chez les individus exposés au stress ou à un environnement socio-économique défavorable (la violence physique ou psychologique, la pauvreté, de faible niveau d’éducation) (Borghol et al ., 2012; Labonte et al ., 2012; Mcguinness et al , 2012; Suderman et al ., 2014; Hing et al ., 2014). D’autre part, certaines habitudes de vie, c’est-à-dire le régimes alimentaire (gras, acide folique, calories) et la pratique d’activité physique, sont associées à la variabilité des niveaux de méthylation du muscle, du tissu adipeux et/ou du sang (Milagro et al ., 2012; Jacobsen et al ., 2012; Abel et Rissman, 2013; Ronn et Ling, 2013; Voisin et al ., 2014a; Do Amaral et al ., 2014; Voisin et al ., 2014b; Robson-Ansley et al ., 2014).

Il est aussi reconnu que les marques de méthylation de l’ADN de certains gènes sont influencées par le temps. En effet, l’analyse de l’ADN de paires jumeaux monozygotes a permis de démontrer que le méthylome est très similaire à la naissance et devient de plus en plus différent avec l’âge (Fraga et al ., 2005 : Talens et al ., 2012). Ce phénomène appelé «dérive épigénétique» est causé par l’accumulation des marques de méthylation induites par

50 le hasard et par l’exposition à divers stimuli environnementaux (Teschendorff et al ., 2013). Les niveaux de méthylation des épimutations plastiques dans le temps peuvent notamment permettent d’estimer l’âge biologique des organes d’un individu et de prédire les risques qu’il a de développer des maladies incluant le cancer et l’obésité (Horvarth et al ., 2013 ; Horvarth et al ., 2014; Kim et al ., 2014; Langevin et al ., 2014).

1.7.2 La génétique

La génétique constitue une autre facteur pouvant moduler les niveaux de méthylation de l’ADN des individus (Figure 1.9). Dans un premier temps, les variations génétiques (SNP, mutations, insertions ou délétions) peuvent modifier l’épigenome si celles-ci se retrouvent dans les gènes régulant les processus de méthylation et de déméthylation de l’ADN (les DNMT et les TET) (Potter et al ., 2013. Haggarty et al ., 2013). Les niveaux de méthylation de l’ADN sont aussi directement influencés par la présence d’un SNP qui mène à l’introduction ou l’élimination d’un site CpG (Dayeh et al ., 2013). De plus, il a été rapporté, à maintes reprises, que des variants génétiques situés jusqu’à 1 Mb des sites CpG sont associés à la méthylation de certains sites CpG (Sun, 2014). Ces variants génétiques sont nommés meQTL (DNA methylation quantitative trait loci ). Plusieurs meQTL ont été identifiés dans divers tissus en jumelant les résultats d’analyse de méthylation à l’échelle du génome avec les GWAS (Gibbs et al ., 2010; Bell et al ., 2011; Gertz et al ., 2011; Grundberg et al ., 2013). Selon les résultats de ces études, la majorité des meQTL sont localisés en cis des sites CpG et à une distance variant de 100 kb à 1 Mb (Sun et al ., 2014). Les mécanismes impliqués dans la régulation des niveaux de méthylation par les meQTL sont encore mal compris. Il est suggéré que les meQTL diminuent l’affinité de liaison des facteurs de transcription sur l’ADN (Banovich et al ., 2014). Les facteurs de transcription jouent un rôle déterminant dans la méthylation de l’ADN en recrutant ou en inhibant le recrutement des DNMT et des TET au niveau de sites précis sur l’ADN (Blatter et Farnham, 2013). Par conséquent, la présence de SNP sur les sites de liaison des facteurs de transcription peut altérer les niveaux de méthylation des CpG localisés plus ou moins loin du site polymorphique.

Les meQTL peuvent avoir un impact fonctionnel sur l’expression des gènes via la modification des niveaux de méthylation des CpG. Une a aussi récemment suggèré que le génotype des meQTL peuvent modifier l’expression d’un gène qui affecte par la suite la méthylation d’un site d’un CpG (Gutierrez-Arcelus et al ., 2013). Ces mécanismes de régulation de l’expression génique pourraient différer selon les tissus et le type cellulaires analysés (Gutierrez-Arcelus et al ., 2013; Grundberg et al ., 2013; Smith et al ., 2014). En outre, le génotype des meQTL semblent interagir avec les facteurs environnementaux in utero dans la régulation de la méthylation de l’ADN de certains sites CpG. Ces deux facteurs pourraient expliquer jusqu’à 75% de la variabilité des niveaux de méthylation des nouveau- nés alors que le génotype explirait à lui seul jusqu’à 25% (Teh et al ., 2014). À la lumière de ces résultats, l’analyse des SNP en parallèle avec la méthylation de l’ADN et les facteurs environnementaux, apparaît nécessaire afin de mieux comprendre l’interaction entre ces facteurs et leur fonction respective dans l’expression des gènes et du phénotype.

Figure 1.9- Représentation des interactions entre les facteurs environnementaux, la génétique et la méthylation de l’ADN entraînant le phénotype de l’obésité et des complications cardiométaboliques Les facteurs environnementaux et génétiques peuvent altérer les processus métaboliques et mener au développement de l’obésité et des maladies métaboliques qui y sont associées. Le phénotype de l’obésité serait aussi en partie engendré par l’interaction entre ces deux facteurs et la méthylation de l’ADN. Bien que la méthylation de l’ADN ait été associée à l’obésité et aux complications cardiométaboliques, la directionnalité de cette relation doit être clarifiée par des études longitudinales.

Adapté de : van Vliet-Ostaptchouk JV, Snieder H, Lagou V (2012) Gene-Lifestyle Interactions in Obesity. Current Nutrition Reports . 26 (1): 184-196.

1.8 La sélection du tissu pour l’analyse de la méthylation dans le contexte de la programmation fœtale

Afin d’identifier les gènes épigénétiquement modifiés par l’environnement in utero , l’ADN du placenta ou du sang de cordon des nouveau-nés est habituelle utilisé. Ainsi, le profil de méthylation des gènes observé dans ces deux tissus d’origine fœtale pourrait aussi être représentatif, dans une certaine mesure, de la méthylation des gènes dans les autres tissus métaboliquement actifs mais inaccessibles. Des études chez le rat ont d’ailleurs démontré que la variabilité de méthylation observé dans le placenta et le sang de cordon étaient présentes dans des tissus internes métaboliquement actifs tel que le foie (Burdge et al ., 2007; Petropoulos et al ., 2014).

L’analyse de la méthylation du placenta peut aussi nous renseigner sur la fonction placentaire de même que sur la croissance et le développement du fœtus. Il est reconnu que les marques de méthylation du placenta sont très dynamiques pendant la grossesse et qu’elles sont essentielles au développement et à la fonction placentaire (Novakovic et Saffery, 2012). Les adaptations épigénétiques du placenta, sensibles aux stimuli environnementaux maternel et fœtal, assureraient le développement optimal du fœtus et sa survie (Banister et al ., 2011; Novakovic et al ., 2011; Sandovici et al ., 2012). Néanmoins, il semble que certaines de ces adaptations puissent altérer la croissance du fœtus et le développement des organes et programmer sa santé métabolique (Sandovici et al ., 2012). Par conséquent, les niveaux de méthylation du placenta, pourraient à eux seuls être utilisés pour refléter la fonction placentaire et possiblement pour prédire la susceptibilité du nouveau-né à développer de l’obésité ou CCM à long-terme.

Le profil de méthylation de l’ADN est, par définition, spécifique à chaque tissu. Ceci représente un défi de taille pour l’analyse de la méthylation de l’ADN dans le contexte de la programmation métabolique fœtale chez l’humain puisque l’accès à des tissus métaboliquement actifs est restreint. La méthylation de l’ADN des tissus accessibles comme les cellules du sang, même si elle n’est pas nécessairement causale, peut potentiellement être utilisée comme marqueur de la susceptibilité aux maladies métaboliques. En outre, la méthylation des tissus périphériques comme celles du sang de cordon, du placenta, du sang

54 et des cellules buccales pourrait être utilisé comme indicateurs indirects de la méthylation des tissus internes métaboliquement actifs. Plusieurs études ont d’ailleurs démontré que la méthylation de certains loci est corrélée entre certains tissus périphériques et internes (Byun et al ., 2009; Talens et al ., 2010; Davies et al ., 2012; Herzog et al ., 2013; Varley et al ., 2013; Slieker et al., 2013; Lokk et al ., 2014). Slieker et ses collaborateurs ont notamment démontré, à l’aide de la micropuce 450K d’Illumina, que la méthylation du sang était corrélée (r ≥ 0,80) avec celle du foie, du muscle skelettique, du tissu adipeux sous-cutané et omental pour 5 532, 2 446, 3 909 et 10 905 CpG respectivement (Slieker et al ., 2013). De plus, il est suggéré que les régions du méthylome démontrant de la variabilité inter-individuelle ou celles répondant aux stimuli environnementaux pourraient être corrélées entre différents tissus, notamment entre le sang et des tissus inaccessibles comme le cerveau (Davies et al ., 2012; Mill et Heijmans, 2013). Dans le même ordre d’idée, une équipe d’Harvard a récemment démontré que la variabilité de méthylation spécifique à chaque locus est très similaire entre différents tissus et qu’une approches statistiques pourrait être utilisée pour prédire les niveaux de méthylation des tissus inaccessibles à partir de tissus accessibles (Ma et al ., 2014). En outre, une étude menée chez la souris a identifié certaines régions du génome avec un profil de méthylation similaire entre les tissus adultes provenant du même feuillet embryonnaire (ectoderme, mésoderme et endoderme) ( tissue-specific differentially methylated regions (tsDMR) (Hon et al ., 2013). Ces résultats suggèrent que les marques de méthylation établies pendant le développement embryonnaire peuvent perdurer jusqu’à l’âge adulte et potentiellement jouer un rôle dans le développement des maladies chroniques. Ils ouvrent également la porte à l’utilisation de tissus accessibles provenant de feuillets embryonnaires distincts (sang (mésoderme), frottis buccal (ectoderme) et fèces (endoderme) pour prédire les niveaux de méthylation des tissus inaccessibles de même origine embryonnaire (Mill et Heijmans, 2013).

Les études énumérées précédemment ont permis d’améliorer notre compréhension de la spécificité tissulaire des patrons de méthylation. Toutefois, des études longitudinales supplémentaires demeurent nécessaires afin d’évaluer la stabilité des patrons de méthylations dans chaque tissu à travers le temps car le vieillissement est associé à des modifications

épigénétiques spécifiques à chaque tissu (Schneider et al ., 2010; Thompson et al ., 2010; Horvath, 2013).

1.9 Problématique

L’obésité est un enjeu de santé de première importance pour notre société. En plus d’être la cause principale de plusieurs comorbidités, l’obésité engendre d’importantes dépenses pour notre système de santé. Selon les dernières prévisions, il est anticipé que près de 70% de la population canadienne âgée de 40 ans et plus sera en surpoids ou obèse en 2040. Afin de freiner l’augmentation de la prévalence d’obésité, il est impératif d’en comprendre les causes. Les facteurs héréditaires et environnementaux sont reconnus pour leur implication dans l’étiologie de l’obésité et des CCM qui y sont associés. De nombreuses données épidémiologiques probantes supportent maintenant l’hypothèse de la programmation métabolique fœtale qui propose que l’environnement fœtal a un impact sur la santé à long terme de l’enfant et qu’il augmente le risque qu’il a de développer des maladies métaboliques chroniques incluant l’obésité. Notre équipe de recherche s’intéresse plus particulièrement au DG, une condition de santé maternelle touchant près de 10% des femmes enceintes canadiennes et qui est un excellent modèle pour l’étude de la programmation métabolique fœtale. Le DG est associé à un environnement fœtal hyperglycémique et à un risque accru pour la santé métabolique de l’enfant. Les mécanismes moléculaires pouvant expliquer la programmation métabolique fœtale ont jusqu’à présent été peu étudiés et demeurent essentiellement incompris. Néanmoins, il apparaît de plus en plus évident que l’épigénétique puisse être impliquée dans ce phénomène. L’étude du rôle des mécanismes épigénétiques est donc essentielle afin d’améliorer notre compréhension de l’étiologie de l’obésité et de maladies métaboliques. Ceci nous permettra de mettre en place les mesures nécessaires pour contrer les risques d’obésité, à court et à long terme, chez les enfants.

1.9.1 Hypothèse

Cette thèse de doctorat repose sur l’hypothèse que les adaptations épigénétiques, plus particulièrement celles de la méthylation de l’ADN, sont impliquées dans la programmation métabolique fœtale associée au DG. Nous proposons que l’exposition in utero au DG altère la méthylation des gènes du placenta et du sang de cordon du nouveau-né impliqués dans la régulation du métabolisme énergétique et ultimement dans le développement de l’obésité et de ses complications. Ces modifications épigénétiques permettraient d’établir, en partie, le

57 lien moléculaire entre l’exposition à un environnement défavorable et le risque accru du nouveau-né de développer de l’obésité et des CCM à long terme.

1.9.2 Objectifs

Objectif spécifique #1 Cette thèse a comme premier objectif d’identifier des gènes qui présentent des modifications épigénétiques dans le placenta et/ou le sang de cordon du nouveau-né suite à l’exposition in utero au DG. Deux approches ont été utilisées pour identifier ces gènes soit : l’approche à l’échelle du génome et l’approche par gènes candidats.

Objectif spécifique #2 Dans un deuxième temps, cette thèse vise à déterminer si les adaptations épigénétiques du nouveau-né, en réponse à l’exposition in utero au DG, sont associées à des indicateurs de santé et de croissance fœtale.

Objectif spécifique #3 Le dernier objectif de cette thèse est d’explorer la spécificité cellulaire des marques de méthylation en utilisant comme modèle deux gènes candidats de la programmation métabolique fœtale, LEP et ADIPOQ . Nous avons donc comparé les niveaux de méthylation des gènes LEP et ADIPOQ dans le sang et le tissu adipeux sous-cutané et viscéral d’individus sévèrement obèses dans le but d’atteindre les deux sous-objectifs ci-dessous.

1) Sous-objectif #1 : Identifier des marques de méthylation qui démontrent des similarités entre le sang et les tissus adipeux et qui pourraient potentiellement être utilisées en clinique.

2) Sous-objectif #2 : Explorer les associations entre ces variations épigénétiques et des facteurs de risque cardiométabolique de sujets sévèrement obèses afin d’évaluer leur rôle dans la pathologie de l’obésité et des CCM et leur potentiel comme marqueur de la susceptibilité à l’obésité et aux CCM chez le nouveau-né.

CHAPITRE 2 - ARTICLE 1

Gestational diabetes mellitus epigenetically affects genes predominantly involved in metabolic disease

Auteurs de l’article : Andrée-Anne Houde*, Stéphanie-May Ruchat*, Grégory Voisin, Julie St-Pierre, Patrice Perron, Jean-Patrice Baillargeon, Daniel Gaudet, Marie-France Hivert, Diane Brisson et Luigi Bouchard. * Ces auteurs ont contribué également à l’article

Statut de l’article : Publié dans la revue Epigenetics

Ruchat SM *, Houde AA *, Voisin G, St-Pierre J, Perron P, Baillargeon JP, Gaudet D, Hivert MF, Brisson D, Bouchard L. 2013. Gestational diabetes mellitus epigenetically affects genes predominantly involved in metabolic disease. Epigenetics. 8(9): 935-43.

Avant-propos : L’étude présentée dans cet article, écrit en collaboration avec Stéphanie-May Ruchat, avait pour objectif de déterminer l’impact de l’exposition au DG sur la méthylation de l’ADN du placenta et du sang et du cordon à l’aide de micropuces couvrant plus de 450 000 gènes à l’échelle du génome. Je suis première co-auteure de cet article, j’ai contribué aux analyses statistiques des micropuces et de voies métaboliques, à l’interprétation des résultats ainsi qu’à la rédaction de l’article.

RÉSUMÉ Les nouveau-nés exposés au diabète gestationnel (DG) in utero présentent un risque accru de développer, à l’adolescence et à l’âge adulte, l’obésité, le diabète ainsi que les désordres métaboliques qui y sont associés. Un nombre grandissant d’études suggèrent que l’épigénétique est impliquée dans ce phénomène de programmation fœtale. Par conséquent, nous avons émis l’hypothèse que l’exposition au DG peut modifier le méthylome du nouveau-né. Des échantillons de placenta et de sang de cordon ont été prélevés chez 44 nouveau-nés parmi lesquels 30 avaient été exposés in utero au DG. Les mères de ces nouveua-nés ont été recrutées au 1 er trimestre de leur grossesse et suivies jusqu’à l’accouchement. Le DG a été diagnostiqué entre la 24 e et la 28 e semaine de la grossesse par un test d’hyperglycémie orale provoquée (HGOP ; 75 g). La méthylation de l’ADN des échantillons de placenta et de sang de cordon a été quantifiée sur plus de 485 000 sites CpG avec la micropuce Infinium HumanMethylation450. Subséquemment, le logiciel Ingenuity Pathway Analysis (IPA) a été utilisé pour identifier les voies métaboliques épigénétiquement modifiées par le DG. Nos résultats ont démontré que 3271 et 3758 gènes présentaient des différences de méthylation potentielles ( p ≤ 0,05) entre les échantillons de placenta et de sang cordon exposés et non exposés au DG, respectivement (aucun gène n’a atteint le seuil de significativité pangénomique; p ≥ 1,0 × 10 -6). Parmi les gènes présentant les plus grandes différences de méthylation entre les deux grouspes expérimentaux, dans le placenta et le sang de cordon, plus de 25 % (n=1029) étaient communs aux deux tissus. Les différences de méthylation moyennes entre les échantillons exposés et non-exposés au DG étaient de 5,7 ± 3,2% et de 3,4 ± 1,9% dans le placenta et le sang de cordon respectivement. Les gènes épigénétiquement modifiés par une exposition au DG étaient principalement retrouvés dans des voies biologiques associées aux maladies métaboliques (jusqu’à 115 gènes; 1,9 × 10 -13 < p < 4,0 × 10 -03 ; incluant le diabète mellitus p = 4.3 × 10 -11 ). Parmi les gènes différentiellement méthylés suite à l’exposition au DG, 326 gènes du placenta et 117 gènes du sang de cordon étaient également associés au poids à la naissance. En conclusion, nos résultats suggèrent que le DG modifie le profil épigénétique de gènes principalement impliqués dans les voies biologiques des maladies métaboliques et que certaines de ces modifications peuvent altérer la croissance et le développement du fœtus. De plus, ils supportent l’importance de la méthylation de l’ADN dans la programmation métabolique fœtale.

Gestational Diabetes Mellitus Epigenetically Affects Genes Predominantly Involved in Metabolic Diseases

Ruchat SM* 1,2 , Houde AA* 1,2 , Voisin G 3, St-Pierre J 2,4 , Perron P 2,5 , Baillargeon JP 5, Gaudet D 2,6 , Hivert MF 5,7 , Brisson D 2, 6 , Bouchard L1,2 * These authors contributed equally to this work.

1. Department of Biochemistry, Université de Sherbrooke, Sherbrooke, QC, Canada; 2. ECOGENE-21 Laboratory and Lipid Clinic, Chicoutimi Hospital, Saguenay, QC, Canada; 3. Genome Quebec Innovation Centre, Montreal, QC, Canada; 4. Department of Pediatrics, Chicoutimi Hospital, Saguenay, QC, Canada; 5. Department of Medicine, Division of Endocrinology, Université de Sherbrooke, Sherbrooke, QC, Canada; 6. Department of Medicine, Université de Montréal, Montreal, Quebec, Canada; 7. General Medicine Division, Massachusetts General Hospital, Boston, MA.

Running title: Gestational diabetes and DNA methylation

Abbreviation list: BMI, body mass index; DPP6, dipeptidyl-peptidase 6; GDM, gestational diabetes mellitus; GWG, gestational weigh gain; IPA, Ingenuity pathway analysis; NGT, normal glucose tolerance; OGTT, oral glucose tolerance test; STC2, stanniocalcin 2; TRIB1, tribbles homolog 1; VIPR1, vasoactive intestinal peptide receptor 1; WHO, World Health Organization.

ABSTRACT Offspring exposed to gestational diabetes mellitus (GDM) have an increased risk for chronic diseases, and one promising mechanism for fetal metabolic programming is epigenetics. Therefore, we postulated that GDM exposure impacts the offspring’s methylome and used an epigenomic approach to explore this hypothesis. Placenta and cord blood samples were obtained from 44 newborns, including 30 exposed to GDM. Women were recruited at first trimester of pregnancy and followed until delivery. GDM was assessed after a 75-g oral glucose tolerance test at 24–28 weeks of pregnancy. DNA methylation was measured at >485,000 CpG sites (Infinium HumanMethylation450 BeadChips). Ingenuity Pathway Analysis was conducted to identify metabolic pathways epigenetically affected by GDM. Our results showed that 3,271 and 3,758 genes in placenta and cord blood, respectively, were potentially differentially methylated between samples exposed or not to GDM (p-values down to 1x10 -06; none reached the genome-wide significance levels), with more than 25% (n=1,029) being common to both tissues. Mean DNA methylation differences between groups were 5.7±3.2% and 3.4±1.9% for placenta and cord blood, respectively. These genes were likely involved in the metabolic diseases pathway (up to 115 genes (11%), p-values for pathways=1.9x10 -13

Key words : epigenetics, epigenome-wide, in utero , maternal hyperglycemia, DNA methylation, fetal metabolic programming.

INTRODUCTION In response to the increasing prevalence of obesity (1) and excess gestational weight gain (2), women are more likely to develop pregnancy complications such as gestational diabetes mellitus (GDM) (3, 4). As a consequence, GDM prevalence is increasing along with increasing rates of obesity (5). The prevalence of GDM ranges from 1% to 20% depending on the population studied and the diagnostic criteria used (6). Epidemiological studies have shown that GDM is associated with several detrimental health consequences among offspring such as an increased risk of macrosomia or large-for-gestational-age at birth (7) and/or developing overweight/obesity later in life (8-10), insulin resistance/type 2 diabetes (11, 12) and other cardiovascular disease risk factors (13). These studies reporting a relationship between the exposition to an altered in utero condition (here GDM) and the risk of developing metabolic disorders support the fetal programming (Barker’s) and the Developmental Origins of Health and Diseases (DOHaD) hypotheses (14, 15). A better understanding of the mechanisms through which GDM exposure translates into the development of these diseases among offspring is urgently needed in order to develop effective prenatal preventive strategies and break the vicious circle that perpetuates obesity and type 2 diabetes across generations.

Accumulating evidence suggests that maternal hyperglycemia and/or resulting fetal hyperinsulinism epigenetically program a predisposition for offspring to develop obesity and type 2 diabetes later in life (16). Epigenetic marks can be subjected to reprogramming in response to both stochastic and environmental stimuli such as the in utero environment (17). In addition, a large number of epigenetic marks are relatively stable over time (18), suggesting that those acquired early in life may have a long-lasting impact on future health. In this respect, we previously showed that maternal hyperglycemia is associated with placental DNA methylation adaptations at the LEP (19) and ADIPOQ (20) genes. Similarly, a recent study reported that DNA methylation levels at the maternally imprinted MEST gene were significantly lower in placenta and cord blood tissues exposed to GDM than in those not exposed to GDM (21). Furthermore, morbidly obese adults had a decreased blood MEST methylation compared with normal-weight adults (21). Taken together, these findings suggest that maternal glucose metabolism dysregulation affects DNA methylation at genes

63 involved in energy and glucose metabolism ( LEP and ADIPOQ ), and fetal and placental growth, somatic differentiation and neurobiological and behavioral functions ( MEST ), which may contribute to the development of obesity.

Accordingly, we hypothesized that DNA methylation levels at a number of additional genes were also affected by an exposure to GDM. As proposed by the fetal programming and DOHaD hypotheses, these genes will likely be involved in metabolic pathways related to obesity and type 2 diabetes development. Previous studies have relied on a candidate gene approach to identify genes epigenetically affected by GDM exposure. In the current study, a genome-wide approach was used for the first time to examine DNA methylation profile differences in placenta and cord blood samples exposed or not to GDM. The primary objective was to identify additional genes and their biological pathways showing epigenetic dysregulation in response to GDM. The secondary objective was to examine whether the differentially methylated genes identified were correlated with birth weight, which is an index of fetal growth and development.

RESULTS Maternal and newborn characteristics of the 44 mother-newborn pairs are shown in Table 2.1. On average, women were slightly overweight at first trimester of pregnancy but were all metabolically healthy. No difference between groups in glucose and lipid profile at first trimester of pregnancy was observed. As expected, the GDM group had higher 2-h post- oral glucose tolerance test (OGTT) glucose levels and, on average, gained less weight during pregnancy than the non-GDM group.

DNA methylation analyses The statistical analyses were restricted to autosomal epialleles, which represent 231,818 and 117,321 loci in placenta and cord blood respectively (Figure 2.1). Placenta samples showed significantly more DNA methylation variability than cord blood samples ( χ2=58,663, p<0.0001). The best p-values obtained were 1.61x10 -06 and 2.0x10 -05 for placenta and cord blood analyses, respectively (Annexe 1). Using an intended relaxed criteria in accordance with the study design and the applied converging analytical strategy (p<0.05), 8,657 loci in the placenta and 7,855 in cord blood were potentially differentially methylated between the GDM and non-GDM groups. These loci were distributed over 3,271 and 3,757 genes, respectively (Figure 2.1). The mean DNA methylation difference between the groups was 5.7±3.2% for placenta genes, with 95% of them showing a mean difference ≥2% and 75% a mean difference ≥3%. Cord blood genes had a mean DNA methylation difference of 3.4±1.9%, with 93% of them showing a mean difference ≥2% and 53% a mean difference ≥3%. The best hits (best p-values) in the placenta and cord blood were respectively DPP6 (dipeptidyl-peptidase 6) (∆β-value=13.0%, p=1.0x10 -06 ) and STC2 (stanniocalcin 2) (∆β- value=7.4%, p=1.0x10 -05 ). However, VIPR1 (vasoactive intestinal peptide receptor 1) in placenta ( ∆β-value=5.6%, p=7.4x10-05) and TRIB1 (tribbles homolog 1) in cord blood ( ∆β- value=5.3%, p=2.0x10 -05 ) were identified as the most promising obesity and T2D candidate genes among the top 5 differentially methylated genes (Annexe 1). When comparing placenta and cord blood results, we found that more than 25% (n=1,029) of the differentially methylated genes (at p<0.05) affected by GDM were common to both tissues (Figure 2.1).

Table 2.1- Maternal and newborn characteristics Variables GDM (n=30) NGT (n=14) n Mean ± SD Range n Mean ± SD Range First trimester Maternal age (years) 30 29.0 ± 3.8 20.0 - 38.0 14 28.6 ± 2.5 25.0 - 34.0 BMI (kg/m 2) 30 25.6 ± 4.1 19.6 - 35.4 14 24.6 ± 3.1 20.2 - 28.6 Fasting glycemia (mmol/L) 30 4.42 ± 0.48 3.40 - 5.40 14 4.41 ± 0.33 4.0 - 5.10 Fasting insulin (mU/L) 30 6.75 ±3.95 1.70 - 16.70 14 6.48 ± 3.09 3.30 - 13.50 Fasting cholesterol (mmol/L) 30 4.73 ± 0.84 3.10 - 8.00 14 4.96 ± 0.91 3.90 - 7.20 Fasting HDL-C (mmol/L) 30 1.62 ± 0.32 1.25 - 2.31 14 1.65 ± 0.21 1.30 - 2.03 Fasting LDL-C (mmol/L) 30 2.48 ± 0.70 1.20 - 5.0 14 2.79 ± 0.89 1.60 - 5.10 Fasting triglycerides (mmol/L) 30 1.36 ± 0.51 0.60 - 2.70 14 1.19 ± 0.45 0.70 - 2.10 Second trimester 2-h post OGTT (mmol/L) 30 8.42 ± 0.59 ** 7.80 - 10.80 14 6.01 ± 1.01 3.80 - 7.70 Third trimester Total gestational weight gain (kg) # 25 8.6 ± 3.4 ** 1.0 - 14.9 14 13.9 ± 2.7 9.0 - 18.0 Newborn Gestational age at birth (weeks) 30 39.2 ± 1.5 36.1 - 41.6 14 39.1 ± 1.2 37.3 - 41.3 Birth weight (kg) 30 3.33 ± 0.50 2.13 - 4.58 14 3.38 ± 0.45 2.53 - 4.01 BMI, body mass index; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein; OGTT, oral glucose tolerance test. First trimester refers to between weeks 11 and 14 of pregnancy; second trimester refers to between weeks 24 and 28 of pregnancy and third trimester refers to between weeks 36 and 37 of pregnancy. # Gestational weight gain between 1 st and 3 rd trimester; ** p<0.0001 (unpaired t-test) .

Figure 2.1- Overview of the analytical strategy used to identify genes and metabolic pathways showing epigenetic dysregulation in response to GDM exposure

Common disease and disorder pathways affected by GDM The top genes ( p<0.01) with potential DNA methylation differences between placenta and cord blood samples exposed or not to GDM were selected to conduct pathway analyses. A mean DNA methylation difference of 7.3±3.8% was observed for placenta genes, with 99.5% of them showing a mean difference ≥2% and 90% a mean difference ≥3%. Cord blood genes had a mean DNA methylation difference of 4.1±2.1%, with 99.5% of them showing a mean difference ≥2% and 79% a mean difference ≥3%. The three top pathways emerging from Ingenuity pathway analyses (IPA) of the placenta were: 1) cardiovascular diseases (91 genes, p-values for pathway=3.3x10 -07

(Figures 2.2 and 2.3) (Table 2.2). Finally, when we restricted the analysis to the differentially methylated genes common to both tissues, IPA identified immunological diseases (134 genes, 1.4x10 -13

Figure 2.2- Ingenuity Pathway Analysis: Top-ranked common disease and disorder pathways that were epigenetically affected by GDM Top-ranked common disease and disorder pathways to which belonged differentially methylated genes in placenta (p<0.01, n=781), cord blood (p<0.01, n=758) and both tissues ( p<0.05, n=1029). #, number of genes involved in each pathway .

Correlations between DNA methylation levels and newborn weight Among the first set of potentially differentially methylated genes identified (at p<0.05), 10% in the placenta (326 out of 3271) and 3% in cord blood (117 out of 3757) were also correlated with newborn weight ( p<0.05; r>0.297 for placenta; r>0.312 for cord blood) (Figure 2.1). The mean DNA methylation difference was of 6.5±3.3% for these placenta genes and 3.6±2.7% for cord blood genes.

Figure 2.3- Ingenuity Pathway Analysis: Top-ranked diseases and disorders associated to each of the common disease and disorder pathways epigenetically affected by GDM Light grey bars, Ingenuity Pathway Analysis (IPA) results obtained with differentially methylated genes in placenta (p<0.01, n=781); black bars, IPA results obtained with differentially methylated genes in cord blood (p<0.01, n=758); grey bars, IPA results obtained with differentially methylated genes that were common to both tissues (p<0.05, n=1029). (n), number of genes involved in each disease/disorder.

Table 2.2- Ingenuity Pathway Analysis. Top-ranked common disease and disorder pathways that were epigenetically affected by GDM Placenta (n=781) Cord blood (n=758) Disease/ disorder pathways # genes p-values Disease/ disorder pathways # genes p-values 1. Cardiovascular diseases 91 (12%) 3.25x10 -07 to 4.37x10 -03 1. Gastrointestinal diseases 94 (12%) 1.14x10 -07 to 4.14x10 -03 Hypertension 32 3.25x10 -07 Diabetes mellitus 64 1.14x10 -07 Coronary disease 30 8.26x10 -07 Type 1 diabetes 28 1.03x10 -05 Heart disease 69 5.04x10 -06 Crohn’s disease 19 4.63x10 -05 2. Metabolic diseases 88 (11%) 9.75x10 -06 to 4.37x10 -03 2. Metabolic diseases 70 (9%) 1.14x10 -07 to 4.14x10 -03 Glucose metabolism disorder 72 9.75x10 -06 Diabetes mellitus 64 1.14x10 -07 Diabetes mellitus 57 4.37x10 -05 Type 1 diabetes 28 1.03x10 -05 Grave’s syndrome 5 8.46x10 -05 Glucose metabolism disorder 70 1.37x10 -05 3. Psychological disorders 72 (9%) 2.47x10 -05 to 4.18x10 -03 3. Endocrine system disorders 64 (8%) 1.14x10 -07 to 4.60x10 -03 Schizoaffective disorder 13 2.47x10 -05 Diabetes mellitus 64 1.14x10 -07 Bipolar disorder 29 4.27x10 -05 Type 1 diabetes 28 1.03x10 -05 Schizophrenia 44 5.64x10 -05 Insulin resistance 3 1.66x10 -03 Common between placenta and cord blood (n=1,029) Disease/ disorder pathways # genes p-values 1. Immunological diseases 134 (13%) 1.44x10 -13 to 4.36x10 -03 Systemic autoimmune disease 119 1.44x10 -13 Type 1 diabetes 51 1.89x10 -13 Rheumatoid arthritis 87 2.00x10 -09 2. Metabolic diseases 115 (11%) 1.89x10 -13 to 3.99x10 - 03 Type 1 diabetes 51 1.89x10 -13 Diabetes mellitus 93 4.25x10 -11 Glucose metabolism disorder 106 3.04x10 -09 3. Endocrine system disorders 104 (10%) 1.89x10 -13 to 3.99x10 -03 Type 1 diabetes 51 1.89x10 -13 Diabetes mellitus 93 4.25x10 -11 Type 2 diabetes 33 1.29x10 -04

DISCUSSION To the best of our knowledge, this is the first study reporting the impact of GDM exposure on offspring DNA methylation levels across the genome using the 450K platform. Our primary goal was to better understand the impact of GDM at the epigenome-wide level by identifying genes and their pathways epigenetically affected by GDM. Our secondary goal was to examine whether the differentially methylated genes identified were correlated with birth weight. The most important finding of this study is that GDM epigenetically affects genes that are predominantly involved in metabolic diseases pathway (including glucose- related disorders), in line with the hypothesis that GDM exposure increases the risk of metabolic disorders through epigenetic modifications. Furthermore, several of the potentially differentially methylated genes identified were also correlated with newborn weight. Importantly, these results were obtained in the context of mild maternal hyperglycemia. Indeed, although women included in this study were diagnosed with GDM based on the World Health Organization (WHO) criteria (22), only two fulfilled the Canadian Diabetes Association more severe criteria for GDM diagnosis (4). Our results therefore suggest that even a slight deterioration in the in utero environment, reflected here by a modest hyperglycemia, may induce epigenetic adaptations that have the potential to influence the long-term risk for obesity and type 2 diabetes in the offspring. Our findings emphasize the need to develop better preconceptional and early pregnancy health care programs aiming at preventing maternal hyperglycemia and eventually the associated epigenetic modifications that may determine the future health of the child.

Interestingly, we found that more than 25% of the differentially methylated genes were common to both placenta and cord blood. Whether these epigenetic marks reflect biological phenomena occurring in other tissues remains to be determined. At this time, it is still unclear in what proportion the DNA methylation profile correlates between different cell types. However, experimental work with rats suggests that methylation changes induced by the maternal diet can be similar in cord blood and liver (23). Recently, data on humans showed that DNA methylation appears to be independent of tissue of origin for some genomic regions, especially those containing imprinted genes or metastable epialleles (24, 26), whereas other regions have a clear tissue-specific dependence (25, 26). These results

71 therefore suggest that DNA methylation marks affected by in utero challenges may correlate, at least partially, between different cell types. Importantly, these epigenetic marks acquired early in life may have a long-lasting impact on future health, as reported by a recent study showing that some epigenetic marks in buccal cells were stable from birth to 1 year of age (26). Furthermore, studies have shown that cord blood methylation levels were associated with obesity-related phenotypes in childhood (27, 28); these results suggest that epigenetic marks might reflect biological phenomena occurring in other tissues involved in growth and energy metabolism, such as the adipose tissue or the hypothalamus.

Common diseases and disorders pathway analyses were performed to determine the overall biological relevance of the identified differentially methylated genes in placenta or cord blood. More than 75% of the genes selected to conduct these analyses had a mean DNA methylation difference ≥3%, which is expected to be of biological significance. Indeed, a difference in methylation levels of 3.4% at the H19 DMR gene at birth predicted overweight/obesity in children at one year of age (29). Pathway analyses revealed that those genes were related to cardiovascular, gastrointestinal and metabolic diseases, to mention only a few. The metabolic diseases pathway (including glucose metabolism-related disorders) was the most promising as it was among the two top-ranked pathways in both placenta and cord blood, as well as among the differentially methylated genes common to both tissues.

As suggested by pathway analysis results, a number of the identified epivariations affect glucose metabolism candidate genes. Among them, VIPR1 in placenta and TRIB1 in cord blood are very promising candidate genes. VIPR1 encodes a receptor for vasoactive intestinal peptides (VIP). VIP stimulate insulin secretion in a glucose-dependent manner as well as glucagon secretion (30). Vipr1 knockout mice have been generated; they show growth retardation, increased metabolic rate, increased insulin sensitivity and a reduced body fat mass, suggesting that VIPR1 plays a role in energy metabolism, lipid metabolism and regulation of body weight (30). VIPR1 is also expressed in cells of the immune system, and it has been shown to play a role in controlling inflammation (31), a central feature of obesity and type 2 diabetes. Animal studies reported that the administration of a VIPR1 agonist ameliorated streptozotocin-induced type 1 diabetes (by increasing the insulin-secreting

72 activity of islets) and protected mice against oxidative stress and inflammation associated with diabetes (32). Tribbles-1 (TRIB1) is a novel gene that appears to be particularly important for the regulation of the lipid/energy homeostasis. Several genome-wide association studies have reported an association between TRIB1 SNPs and plasma lipid concentrations (triglycerides, HDL-c and cholesterol) (33-36). In mice, TRIB1 gene deficiency has been associated with an impaired cytokine expression in white adipocytes and resistance to high-fat diet-induced obesity (37).

We also examined whether the differentially methylated genes identified in our study were correlated with newborn weight. We found a correlation between DNA methylation levels and newborn weight for only 10% and 3% of the genes significantly affected by GDM exposure in placenta and cord blood respectively. These genes showed a mean DNA methylation difference of 6.5±3.3% (placenta genes) and 3.6±2.7% (cord blood genes), which is again expected to be of biological significance (29). Among the differentially methylated genes that were the most significantly correlated with newborn weight (p<0.01), Msh homeobox 1( MSX1 ) was the only one which was previously found to be associated with birth weight or fetal growth (38) (Annexe 2). It is worth noting that GDM-induced DNA methylation changes will very likely affect the infants’ risk of developing obesity and type 2 diabetes later in life without affecting their birth weight. Supporting this hypothesis, two recent studies found strong associations between cord blood DNA methylation levels and obesity-related phenotypes measured at age 9 years, whereas cord blood DNA methylation levels at the same genes were not associated with newborn weight (27, 28). These findings suggest that some of the epipolymorphisms observed may have a modest effect on fetal growth, but may have a more pronounced effect on the phenotype during postnatal and childhood development and lifelong development of metabolic disorders.

We found that a number of genes were potentially epigenetically affected by GDM exposure in the placenta and cord blood. However, we cannot exclude the possibility that other factors may have influenced the observed changes in the DNA methylation pattern. Women in the GDM group gained less weight than those in the non-GDM group throughout pregnancy, reflecting the clinical management by a dietary approach. It is therefore likely

73 that some of the associations observed between DNA methylation levels and GDM were influenced by gestational weight gain (GWG). This possibility was verified but, given the small sample size and the exclusion of five women in the GDM group for whom GWG was missing, these analyses were performed only on the most significant loci ( p<0.001, Annexe 1). The results suggest that GWG contributed only modestly to these associations as only 16% and 10% of the associations in the placenta and cord blood respectively were lost after adjusting for GWG. Our results may also have been influenced by the treatment the GDM mothers received (diet vs. diet+insulin). However, due to the small sample size, we were unable to test this hypothesis. Nevertheless, no DNA methylation difference between the diet (n=88) and diet+insulin (n=98) treatment groups was found in the El Hajj et al . study (21). This also suggests that GDM treatments have only a marginal effect on the DNA methylation profile, although it does not exclude that other loci might be affected. In the current study, we also report that some differentially methylated genes between placenta and cord blood exposed or not to GDM were also correlated with newborn weight (after adjustment for newborn gestational age and sex). Other factors are known to be associated with newborn weight, such as maternal BMI (39) and GWG (40). However, the correlations remained largely unchanged after further adjustments for these factors.

Our study has a number of strengths. Among them, the longitudinal follow-up of the women is critical. It allows first to correctly identify women who developed GDM, avoiding misclassification of those who may have undiagnosed diabetes before pregnancy; second, to more precisely match groups; and third, to take into account the metabolic changes throughout pregnancy (potential confounding factors). Furthermore, this study was conducted in a homogeneous population from European descent, which is a strength in genetic and epigenetic studies, although the results might not be applicable to other populations and should therefore be validated. Also, because of the needed extensive clinical follow-up of women throughout pregnancy and the cost of such an epigenome-wide study, it has not been possible to increase the number of samples analyzed. The resulting limited statistical power precluded making any strong conclusions at the individual gene level. It should also be noted that there are limitations associated with the use of pathway analysis software, such as IPA. These tools have been designed for general extraction of information

74 from biological texts. However, this “text-mining” approach is limited by the robustness of its algorithm, with the possibility of generating inaccurate information. Lastly, it is difficult to exclude the possibility that minor differences in cell counts may exist between placenta and cord blood samples exposed or not to GDM. Unfortunately, cell counts were not available in the current study. However, Talens RP et al . (41) previously reported that the majority of inter-individual variation in DNA methylation is not affected (or only marginally) by cellular composition. Consequently and because many loci were identified in both placenta and cord blood, it is unlikely that differences in cell composition had large effects on the current results. Despite these limitations, the study design and proposed analytical strategy as well as the converging results between placenta and cord blood tissues all contribute to increase our confidence in the results. Furthermore, this study remains the large st ever performed on this topic, and recruitment is still ongoing. This will allow us eventually to confirm and validate these results, as well as investigate their functional impact on gene expression. Indeed, neither gene expression nor evidence of chromatin structure changes was investigated in the current study. These research angles will be pursued in follow-up studies.

In summary, this is the first epigenome-wide study investigating the effects of GDM on the newborn epigenome and whether fetal growth and development might be affected by these epigenetic adaptations. Our results suggest that GDM has epigenetic effects at genes that are preferentially involved in metabolic diseases, including diabetes, probably through both beta-cell function and energy/adiposity regulation. In addition, we showed that some of the GDM-exposed dysregulated genes are also involved in fetal growth and development, which may explain, at least partially, the well-known association between GDM and macrosomia. Our data therefore provide supportive evidence that DNA methylation is involved in fetal metabolic programming.

RESEARCH DESIGN AND METHODS Women with a singleton pregnancy were recruited in the Saguenay area from a founder population of French-Canadian origin (self-reported). They were all followed from 1st trimester of pregnancy to delivery, with three visits (12-14 weeks, 24-28 weeks and 36-37 weeks of gestation) at the research center. Women were excluded from the study if they were ≥40 years old, had pre-gestational diabetes or other disorders known to affect glucose metabolism (polycystic ovarian syndrome, uncontrolled thyroid disorders and renal insufficiency), or a positive history of alcohol and/or drug abuse during the current pregnancy. The Chicoutimi Hospital Ethics Committee approved the project. All women provided written informed consent before their inclusion in the study, in accordance with the Declaration of Helsinki.

At each visit, anthropometric variables were measured using standardized procedures (42), and blood samples were collected after a 12-h fast. Blood glucose, insulin and lipid measurements were made on fresh serum samples at the Chicoutimi Hospital Clinical Laboratory. Plasma glucose, cholesterol and triglyceride levels were evaluated using a Beckman analyzer (model CX7; Beckman), and insulin measurements were performed using a radioimmunoassay method (Advia Centaur; Simens). Glucose tolerance was assessed using a 75-g OGTT performed at 24 - 28 weeks of gestation. Women with a 2-h post-OGTT glucose level ≥7.8 mmol/L were classified as having GDM based on the 1999 WHO criteria (22) and were treated with diet only or with diet and insulin to achieve glycemic control based on clinical guidelines. Clinical information about the newborn was collected at birth from medical files and included gestational age, weight, length and sex of the newborn.

This study included 44 women. Thirty women classified as having GDM (22) (16 treated with diet only and 14 with diet and insulin) were available in our cohort and were therefore selected. Among the remaining cohort, 14 NGT women were randomly selected to avoid differences between groups in glucose and lipid profile at first trimester of pregnancy.

Placenta and cord blood sampling Placenta and cord blood samples were taken within minutes of delivery (on average <15 min) and kept in RNALater (Qiagen) at -80°C until nucleic acid extraction. Placenta biopsies were collected from the fetal side, consisting of the intervillous tissues and chorionic villi. Placenta samples were available for 44 subjects and cord blood samples were collected for 40 of the same newborns. There was no significant difference between maternal and newborn characteristics for cord blood and placenta BeadChips analyses, although 4 samples were missing in the former dataset.

DNA methylation analyses DNA was purified from placenta biopsies using the All Prep DNA/RNA/Protein Mini Kit (Qiagen) and from cord-blood samples using the Gentra Puregen Cell Kit (Qiagen). The methylation levels of >485,000 individual cytosines across the genome were measured using the Infinium HumanMethylation450 BeadChips (Illumina, Inc.). This microarray uses multiplex genotyping assays on bisulfite treated genomic DNA. Briefly, for each CpG site to be interrogated, a probe specific to each “allele” (methylated vs. unmethylated cytosines) is designed. Then, a single-base extension of the probes incorporates a labeled ddNTP. The level of methylation for each locus is determined by calculating the ratio of the fluorescent signals from the methylated (cytosine) vs. unmethylated (uracil) sites. Each probe signal is then used to compute a beta value ( β), which is a quantitative measure of DNA methylation ranging from 0 (no cytosine methylation) to 1 (complete cytosine methylation). Quality controls were conducted according to the manufacturer’s recommendations. The quality control steps included: DNP and Biotin staining, bisulfite conversion (Annexe 3), extension, hybridation, target removal, negative and non-polymorphic controls. The whole-genome DNA methylation analyses were performed at the McGill University and Genome Quebec Innovation Center.

Differential DNA methylation analyses were performed using the R software (version 2.12) and bioconductor packages (version 2.10). To identify differentially methylated CpG sites between samples exposed or not to GDM, the difference in mean methylation levels between the two groups was analyzed using an unpaired Wilcoxon test. Although the

HumanMethylation450 BeadChip array accuracy has already been confirmed (43), 16 CpG dinucleotides in placenta and 3 in cord blood samples were validated using bisulfite DNA pyrosequencing. These CpGs were selected for validation in the context of this and ongoing follow-up studies. DNA methylation levels obtained with both methods were highly correlated (r ≥0.88; p<0.001, Annexe 4), supporting an appropriate overall efficiency, sensitivity, and specificity without remarkable deviations from the optimal performance.

Beadchips and statistical analysis: the applied strategy It was anticipated that the sample size might be at limit to achieve the requested statistical power for such a genome-wide analysis (False Discovery Rate (FDR) or Bonferroni) if aiming to identify individual loci. Accordingly, post-hoc power analysis revealed a 31% power (with an alpha=0.05, two-sided). We therefore decided to focus our attention on pathway analyses to reduce the chance of false positives. The following analytical strategy based on converging results obtained from placenta and cord blood analyses (same newborns) was planned to circumvent this potential limitation. The supportive idea is that converging results will be more likely to be true positives and will thus increase the confidence in the results.

First, placenta and cord blood tissues from the same newborn were analyzed, thus increasing the effective sample size that was at first limited. Second, the converging analytical strategy was also applied to a step-by-step statistical approach. We first excluded the following loci from the statistical analyses: 1) loci on sex chromosomes (X and Y; highly complex due to differences between males and females and X-inactivation by DNA methylation in women); 2) loci with a β-value (% DNA methylation) <0.10 and >0.90, considered unmethylated and fully methylated respectively in either the GDM or non-GDM group; and 3) loci with low variability (standard deviation (SD) <3%) in either the GDM or non-GDM group. Therefore, the number of statistical tests was reduced by limiting the analysis to autosomal epialleles (alleles on non-sex chromosomes that are variably methylated, despite similar DNA sequences, because of epigenetic modifications established during early development that are thought to be particularly vulnerable to environmental influences). An unpaired Wilcoxon test was then used to identify loci showing DNA

78 methylation differences between placenta and cord blood samples exposed or not to GDM. The significance level was set to p<0.05 (intended relaxed criteria in accordance with the study design and the applied converging analytical strategy) to identify a first set of differentially methylated genes. This first set was used to evaluate the potential overall effects GDM may have had on the newborn epigenetic profile and the extent to which common genes were differentially methylated between placenta and cord blood. Further analyses were performed to test whether DNA methylation levels of these genes were correlated with the newborn birth weight. Indeed, birth weight is a phenotype considered to integrate the impact of the fetal environment, is strongly influenced by maternal glycemia, and has been associated with a risk of adult chronic diseases at both end of the spectrum. Pearson’s correlation coefficients were calculated. Correlation analyses were adjusted for newborn gestational age and sex.

Pathway analysis helps to add structure to the very large amount of data generated by microarrays. This type of analysis allows to determine whether differentially methylated genes belong to predefined networks more than by chance alone. Gene ontology enrichment was performed using the Ingenuity Pathway Analysis (IPA) software (Ingenuity System). IPA compares a provided list of genes (differentially methylated genes in this case) to a reference list of genes included in various biological pathways. It provides a p-value based on a hypergeometric test identifying over-represented gene ontology categories.

Three consecutive IPA were performed. The first two analyses included placenta or cord blood genes showing DNA methylation differences between the GDM and non-GDM groups at p<0.01. A more stringent gene selection criterion was used ( p<0.01 instead of p<0.05) to prevent over-representing genes that were modestly differentially methylated. The third analysis included differentially methylated genes that were common to both tissues. A less stringent p-value (p<0.05) was used to select common genes because a selective criterion (i.e. shared epigenetic signature across the two tissues) had already been applied before this analysis. To identify the most promising GDM-affected common disease and disorder pathways, we concentrated on the three top-ranked pathways as well as the three top-ranked diseases and disorders associated to each pathway.

Unpaired Student t-tests were used to assess the statistical differences in maternal and newborn characteristics between the GDM and non-GDM groups. Variables not normally distributed (first trimester fasting cholesterol and LDL-C levels, and second trimester 2-h post-OGTT glucose levels) were log-transformed. Significance level was set at p<0.05 (two- sided). Statistical analyses were performed using the SAS software (version 9.1.3).

AUTHORS CONTRIBUTIONS SMR and AAH performed the data analysis and interpretation and wrote the manuscript. GV performed the data analysis and revised the manuscript. JSP, JPB, DG revised the manuscript. MFH contributed to discussions and revised the manuscript. PP and DB participated in the conception of the study design and revised the manuscript. LB conceived the study design, participated in the data interpretation, contributed to discussions and revised the manuscript.

ACKNOWLEDGMENTS This project was supported by ECOGENE-21, the Canadian Institutes of Health Research (CIHR team in community genetics (grant #CTP-82941)), the CIHR and Fonds de la Recherche du Québec - Santé (FRQS). SMR is recipient of a postdoctoral fellowship from the Canadian Diabetes Association. AAH is a recipient of a scholarship from Diabète Québec, the Faculty of Medicine and Health Sciences, Université de Sherbrooke and the FRQS. LB and MFH are junior research scholars from the FRQS. MFH is also supported by a Canadian Diabetes Association clinical scientist award. LB, MFH, PP and JPB are members of the FRQS-funded Centre de recherche clinique Étienne-Le Bel (affiliated to Centre Hospitalier de l’Université de Sherbrooke).

We warmly acknowledge the contribution of Sébastien Claveau (MSc), ECOGENE- 21 Laboratory; Nadia Mior, ECOGENE-21 Laboratory; Jeannine Landry (RN), ECOGENE- 21 Clinical Research Center; and Chantale Aubut (RN), ECOGENE-21 Clinical Research Center for their dedicated work in this study. We also express our gratitude to Céline Bélanger, Chicoutimi Hospital, for her thoughtful revision of the manuscript.

CONFLICT OF INTEREST None

REFERENCES 1. Chu SY, Kim SY, Bish CL. Prepregnancy obesity prevalence in the United States, 2004-2005. Matern Child Health J. 2009;13(5):614-20.

2. Chu SY, Callaghan WM, Bish CL, D'Angelo D. Gestational weight gain by body mass index among US women delivering live births, 2004-2005: fueling future obesity. Am J Obstet Gynecol. 2009;200(3):271 e1-7.

3. Gibson KS, Waters TP, Catalano PM. Maternal weight gain in women who develop gestational diabetes mellitus. Obstet Gynecol. 2012;119(3):560-5. Epub 2012/02/23.

4. CDA. Canadian Diabetes Association : 2008 Clinical Practice Guidelines for the Prevention and Management of Diabetes in Canada. Canadian Journal of Diabetes. 2008;32:S1-S201.

5. Finkelstein EA, Khavjou OA, Thompson H, Trogdon JG, Pan L, Sherry B, et al . Obesity and severe obesity forecasts through 2030. Am J Prev Med. 2012;42(6):563- 70. Epub 2012/05/23.

6. ADA. Diagnosis and Classification of Diabetes Mellitus. Diabetes Care. 2011;34(Suppl 1):S62-9.

7. Wendland EM, Torloni MR, Falavigna M, Trujillo J, Dode MA, Campos MA, et al . Gestational diabetes and pregnancy outcomes - a systematic review of the World Health Organization (WHO) and the International Association of Diabetes in Pregnancy Study Groups (IADPSG) diagnostic criteria. BMC Pregnancy Childbirth. 2012;12:23. Epub 2012/04/03.

8. Lawlor DA, Lichtenstein P, Langstrom N. Association of maternal diabetes mellitus in pregnancy with offspring adiposity into early adulthood: sibling study in a prospective cohort of 280,866 men from 248,293 families. Circulation. 2011;123(3):258-65. Epub 2011/01/12.

9. Crume TL, Ogden L, West NA, Vehik KS, Scherzinger A, Daniels S, et al . Association of exposure to diabetes in utero with adiposity and fat distribution in a multiethnic

population of youth: the Exploring Perinatal Outcomes among Children (EPOCH) Study. Diabetologia. 2011;54(1):87-92. Epub 2010/10/19.

10. Silverman BL, Rizzo TA, Cho NH, Metzger BE. Long-term effects of the intrauterine environment. The Northwestern University Diabetes in Pregnancy Center. Diabetes Care. 1998;21 Suppl 2(2):B142-9.

11. Bunt JC, Tataranni PA, Salbe AD. Intrauterine exposure to diabetes is a determinant of hemoglobin A(1)c and systolic blood pressure in pima Indian children. J Clin Endocrinol Metab. 2005;90(6):3225-9. Epub 2005/03/31.

12. Dabelea D, Mayer-Davis EJ, Lamichhane AP, D'Agostino RB, Jr., Liese AD, Vehik KS, et al . Association of intrauterine exposure to maternal diabetes and obesity with type 2 diabetes in youth: the SEARCH Case-Control Study. Diabetes Care. 2008;31(7):1422-6.

13. West NA, Crume TL, Maligie MA, Dabelea D. Cardiovascular risk factors in children exposed to maternal diabetes in utero. Diabetologia. 2011;54(3):504-7. Epub 2010/12/15.

14. Hales CN, Barker DJ. Type 2 (non-insulin-dependent) diabetes mellitus: the thrifty phenotype hypothesis. Diabetologia. 1992;35(7):595-601.

15. Gluckman PD, Cutfield W, Hofman P, Hanson MA. The fetal, neonatal, and infant environments-the long-term consequences for disease risk. Early Hum Dev. 2005;81(1):51-9. Epub 2005/02/15.

16. Plagemann A. Maternal diabetes and perinatal programming. Early Hum Dev. 2011;87(11):743-7. Epub 2011/09/29.

17. Jaenisch R, Bird A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nature genetics. 2003;33 Suppl:245-54. Epub 2003/03/01.

18. Wong CC, Caspi A, Williams B, Craig IW, Houts R, Ambler A, et al . A longitudinal study of epigenetic variation in twins. Epigenetics. 2010;5(6):516-26. Epub 2010/05/28.

19. Bouchard L, Thibault S, Guay SP, Santure M, Monpetit A, St-Pierre J, et al . Leptin gene epigenetic adaptation to impaired glucose metabolism during pregnancy. Diabetes care. 2010;33(11):2436-41. Epub 2010/08/21.

20. Bouchard L, Hivert M-F, Guay S-P, St-Pierre J, Perrron P, Brisson D. Placental Adiponectin Gene DNA Methylation Levels Are Associated with Mothers’ Blood Glucose Concentration. Diabetes 2012 61(5):1272-80.

21. El Hajj N, Pliushch G, Schneider E, Dittrich M, Muller T, Korenkov M, et al . Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus. Diabetes. 2013;62(4):1320-8. Epub 2012/12/05.

22. WHO, editor. Definition, diagnosis and classification of diabetes mellitus and its complications: Report of a WHO Consultation. Part 1: Diagnosis and Classification of Diabetes Mellitus. Geneva: World Health Org.; 1999.

23. Burdge GC, Hanson MA, Slater-Jefferies JL, Lillycrop KA. Epigenetic regulation of transcription: a mechanism for inducing variations in phenotype (fetal programming) by differences in nutrition during early life? Br J Nutr. 2007;97(6):1036-46. Epub 2007/03/27.

24. Waterland RA, Kellermayer R, Laritsky E, Rayco-Solon P, Harris RA, Travisano M, et al . Season of conception in rural gambia affects DNA methylation at putative human metastable epialleles. Plos genetics. 2010;6(12):e1001252. Epub 2011/01/05.

25. Ollikainen M, Smith KR, Joo EJ, Ng HK, Andronikos R, Novakovic B, et al . DNA methylation analysis of multiple tissues from newborn twins reveals both genetic and intrauterine components to variation in the human neonatal epigenome. Hum Mol Genet. 2010;19(21):4176-88. Epub 2010/08/12.

26. Murphy SK, Huang Z, Hoyo C. Differentially methylated regions of imprinted genes in prenatal, perinatal and postnatal human tissues. Plos One. 2012;7(7):e40924. Epub 2012/07/19.

27. Relton CL, Groom A, St Pourcain B, Sayers AE, Swan DC, Embleton ND, et al . DNA methylation patterns in cord blood DNA and body size in childhood. Plos One. 2012;7(3):e31821. Epub 2012/03/21.

28. Godfrey KM, Sheppard A, Gluckman PD, Lillycrop KA, Burdge GC, mclean C, et al . Epigenetic gene promoter methylation at birth is associated with child's later adiposity. Diabetes. 2011;60(5):1528-34. Epub 2011/04/08.

29. Perkins E, Murphy SK, Murtha AP, Schildkraut J, Jirtle RL, Demark-Wahnefried W, et al . Insulin-like growth factor 2/H19 methylation at birth and risk of overweight and obesity in children. J Pediatr. 2012;161(1):31-9. Epub 2012/02/22.

30. Moody TW, Ito T, Osefo N, Jensen RT. VIP and PACAP: recent insights into their functions/roles in physiology and disease from molecular and genetic studies. Curr Opin Endocrinol Diabetes Obes. 2011;18(1):61-7. Epub 2010/12/16.

31. Delgado M, Robledo G, Rueda B, Varela N, O'Valle F, Hernandez-Cortes P, et al . Genetic association of vasoactive intestinal peptide receptor with rheumatoid arthritis: altered expression and signal in immune cells. Arthritis and rheumatism. 2008;58(4):1010-9. Epub 2008/04/03.

32. Yu R, Zhang H, Huang L, Liu X, Chen J. Anti-hyperglycemic, antioxidant and anti- inflammatory effects of VIP and a VPAC1 agonist on streptozotocin-induced diabetic mice. Peptides. 2011;32(2):216-22. Epub 2010/12/07.

33. Edmondson AC, Braund PS, Stylianou IM, Khera AV, Nelson CP, Wolfe ML, et al . Dense genotyping of candidate gene loci identifies variants associated with high- density lipoprotein cholesterol. Circulation Cardiovascular genetics. 2011;4(2):145-55. Epub 2011/02/10.

34. Kathiresan S, Melander O, Guiducci C, Surti A, Burtt NP, Rieder MJ, et al . Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. Nat Genet. 2008;40(2):189-97. Epub 2008/01/15.

35. Kraja AT, Vaidya D, Pankow JS, Goodarzi MO, Assimes TL, Kullo IJ, et al . A bivariate genome-wide approach to metabolic syndrome: STAMPEED consortium. Diabetes. 2011;60(4):1329-39. Epub 2011/03/10.

36. Varbo A, Benn M, Tybjaerg-Hansen A, Grande P, Nordestgaard BG. TRIB1 and GCKR polymorphisms, lipid levels, and risk of ischemic heart disease in the general population. Arteriosclerosis, thrombosis, and vascular biology. 2011;31(2):451-7. Epub 2010/11/13.

37. Ostertag A, Jones A, Rose AJ, Liebert M, Kleinsorg S, Reimann A, et al . Control of adipose tissue inflammation through TRB1. Diabetes. 2010;59(8):1991-2000. Epub 2010/06/05.

38. Turan N, Ghalwash MF, Katari S, Coutifaris C, Obradovic Z, Sapienza C. DNA methylation differences at growth related genes correlate with birth weight: a molecular signature linked to developmental origins of adult disease? BMC medical genomics. 2012;5:10. Epub 2012/04/14.

39. Yu Z, Han S, Zhu J, Sun X, Ji C, Guo X. Pre-pregnancy body mass index in relation to infant birth weight and offspring overweight/obesity: a systematic review and meta- analysis. Plos One. 2013;8(4):e61627. Epub 2013/04/25.

40. Ludwig DS, Currie J. The association between pregnancy weight gain and birthweight: a within-family comparison. Lancet. 2010;376(9745):984-90.

41. Talens RP, Boomsma DI, Tobi EW, Kremer D, Jukema JW, Willemsen G, et al . Variation, patterns, and temporal stability of DNA methylation: considerations for epigenetic epidemiology. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 2010;24(9):3135-44. Epub 2010/04/14.

42. Lohman TG, Roche AF, Martorell R, editors. Anthropometric standardization reference manual. Champaign, IL, Human Kinetics Books1988.

43. Bibikova M, Barnes B, Tsan C, Ho V, Klotzle B, Le JM, et al . High density DNA methylation array with single cpg site resolution. Genomics. 2011;98(4):288-95. Epub 2011/08/16.

CHAPITRE 3 - ARTICLE 2

LRP1B , BRD2 and CACNA1D : New candidate genes in fetal metabolic programming of newborns exposed to maternal hyperglycemia

Auteurs de l’article : Andrée-Anne Houde *, Stéphanie-May Ruchat *, Catherine Allard, Julie St-Pierre, Patrice Perron, Jean-Patrice Baillargeon, Daniel Gaudet, Diane Brisson, Marie- France Hivert, et Luigi Bouchard. *Ces auteurs ont égalemment contribué à l’article

Statut de l’article : Soumis

Avant-propos : Cet article est la suite de la précédente étude dans laquelle nous avons déterminé l’impact du diabète gestationnel sur la méthylation de l’ADN du placenta et du sang de cordon à l’échelle pangénomique. Dans l’étude qui suit, Stéphanie-May Ruchat et moi avons validé, dans une cohorte indépendante, l’effet de l’hyperglycémie maternelle sur la méthylation des 10 gènes les plus prometteurs de notre précédente étude. En tant que première co-auteure, j’ai effectué les analyses des niveaux de méthylation et d’ARNm pour les échantillons de sang de cordon, j’ai participé aux analyses statistiques, à l’interprétation des résultats ainsi qu’à la rédaction de l’article.

RÉSUMÉ Objectif : Le but de cette étude est de déterminer les associations entre l’hyperglycémie maternelle et la méthylation de l’ADN de 10 gènes candidats associés au métabolisme énergétique. Méthodes : Les loci ont été sélectionnés parmi 115 gènes identifiés par notre récent EWAS sur le diabète gestationnel (DG) dans la cohorte E-21. La méthylation de l’ADN a été quantifiée par pyroséquençage de l’ADN traité au bisulfite de sodium sur 80 échantillons de placenta et de sang de cordon (20 exposés au DG) provenant de la cohorte Gen3G, une cohorte de naissance indépendante. Résultats : Les résultats de la cohorte Gen3G confirment ceux de la cohorte E-21 pour 5 des 15 sites CpG analysés. Chez les mères ayant une tolérance normale au glucose, la glycémie est négativement corrélée avec les niveaux de méthylation de l’ADN des gènes LRP1B et BRD2 dans le placenta ainsi qu’avec ceux des gènes LRP1B , BRD2 et CACNA1D dans le sang de cordon. Conclusion: Nos résultats suggèrent que la méthylation des gènes LRP1B , BRD2 et CACNA1D est modifiée par des variations de glycémie maternelle. De plus, ils supportent le rôle de la méthylation dans la programmation métabolique fœtale associée au DG.

LRP1B , BRD2 and CACNA1D : New candidate genes in fetal metabolic programming of newborns exposed to maternal hyperglycemia

Andrée-Anne Houde * 1,2 ; Stephanie-May Ruchat * 1,2 ; Catherine Allard 3; Jean-Patrice Baillargeon 3; Julie St-Pierre 2,4,5 ; Patrice Perron 2,3 ; Daniel Gaudet 2,6 ; Diane Brisson 2,6 ; Marie-France Hivert 3,7,8 ; and Luigi Bouchard 1,2 * These authors contributed equally to this work

1. Department of Biochemistry, Université de Sherbrooke, Sherbrooke, Qc, Canada; 2. ECOGENE-21 and Clinical Research Center and Lipid Clinic, Chicoutimi Hospital, Saguenay, Qc, Canada; 3. Department of Medicine, Division of Endocrinology, Université de Sherbrooke, Sherbrooke, Qc, Canada; 4. Department of Pediatrics, Chicoutimi Hospital, Saguenay, Qc, Canada; 5. Department of Health Sciences, Université du Québec à Chicoutimi, Saguenay, Qc, Canada; 6. Department of Medicine, Université de Montréal, Montréal, Qc, Canada; 7. Department of Population Medicine, Harvard Pilgrim Health Care Institute, Boston, MA, USA; and 8. General Medicine Division, Massachusetts General Hospital, Boston, MA, USA.

SUMMARY Aim: To assess the associations between maternal hyperglycemia and DNA methylation levels at ten genes related to energy metabolism. Methods: The gene loci were selected from an EWAS on gestational diabetes mellitus (GDM) we have previously performed. DNA methylation levels were quantified by bisulfite pyrosequencing in 80 placenta and cord blood samples (20 exposed to GDM) obtained from Gen3G, an independent birth cohort. Results: We confirmed the associations between maternal glycemia and DNA methylation levels for 5 out of the 15 CpG sites analysed. In NGT women, maternal glycemia was negatively correlated with DNA methylation levels at LRP1B and BRD2 gene loci in placenta and at LRP1B , BRD2 and CACNA1D gene loci in cord blood. Conclusion: Our results suggest that LRP1B , BRD2 and CACNA1D gene loci are epigenetically affected by variations in maternal glycemia. Moreover, they provide further evidence supporting the role of DNA methylation in fetal metabolic programming.

Keywords: Epigenetics, DNA methylation, Placenta, Cord blood, Gestational diabetes

INTRODUCTION Gestational diabetes mellitus (GDM) is the most common pregnancy complication, with a prevalence ranging from 2 to 20% depending on ethnic background and the diagnostic criteria applied [1]. GDM is defined as impaired glucose tolerance first recognized during pregnancy and arises when pancreatic ß-cells cannot produce sufficient insulin to compensate for pregnancy-induced insulin resistance. Consequently, blood glucose levels rise, resulting in hyperglycemia and GDM [2]. In accordance with the Developmental Origin of Health and Disease (DOHaD) hypothesis, in utero exposure to maternal hyperglycemia has been associated with fetal overgrowth and newborn excessive birth weight as well as obesity and obesity-related metabolic complications during childhood, adolescence or adulthood [3-6]. However, the molecular mechanisms underlying the metabolic health programming of newborn exposed to variations in maternal glycemia have not been clearly defined so far. This issue needs to be addressed as the number of children exposed to increased maternal glycemia will likely increase in the near future along with the obesity epidemic now affecting a rising number of women of childbearing age.

In the last few years, we and others have reported evidence supporting the role of epigenetics in fetal metabolic programming of the newborn exposed to maternal hyperglycemia [7-14]. DNA methylation is the most stable and studied epigenetic marks in the context of fetal programming. During embryonic development, DNA methylation marks are reprogrammed and have thus been shown to be particularly sensitive to in utero environment insults, including maternal metabolic challenges [15]. Interestingly, the DNA methylation status of several genes appears to be relatively stable over mitosis, suggesting that the epigenetic signature acquired in the womb might have long-term adverse consequences on gene expression, thus on cellular and tissue phenotypes [16-18].

Using an epigenome-wide approach in the E-21 birth cohort [14], we have recently identified a number of gene loci that were potentially differentially methylated in placenta and/or cord blood samples exposed and not exposed to GDM. Interestingly, 115 of these loci, common to both placenta and cord blood, harbored genes related to metabolic diseases pathway (identified by Ingenuity Pathway Analyses (IPA) software) including diabetes

92 mellitus and glucose metabolism disorders. These results suggested that the epigenetic adaptations to maternal hyperglycemia are not randomly distributed across the epigenome, but target more specifically genes involved in the regulation of metabolic diseases. More recently, Finer et al . reported similar results [19]. Our epigenome-wide association study (EWAS) was the first to support that epigenomic research might be helpful in identifying genes involved in fetal metabolic programming in response to GDM. However, these results need to be confirmed as none of the lead signals reached statistical significance after accounting for the number of probes tested (Infinium HumanMethylation450K beadchips >485 000 probes). The aim of the current study was thus to assess in Gen3G, an independent birth cohort, some of the most promising associations we recently reported in our EWAS. We have selected the 10 most promising genes out of the 115 involved in the metabolic diseases pathway.

PATIENTS & METHODS Gen3G birth cohort Sample and clinical data The Gen3G birth cohort consists of singleton pregnant women of the Sherbrooke area (QC, Canada) who were recruited during their first trimester of pregnancy. Women were excluded from this study if they were diagnosed with pre-gestational type 1 or 2 diabetes or other major disorders known to affect glucose metabolism, or presented a history of alcohol and/or drug abuse during the current pregnancy. All participants gave a written informed consent before their inclusion in the Gen3G birth cohort, and all clinical data were de-identified. This project was approved by the Centre hospitalier universitaire de Sherbrooke (CHUS) ethics committee and was conducted in accordance with the Declaration of Helsinki.

Women were met during the first trimester (5-13 weeks, study entry) and the second trimester (24-29 weeks) of pregnancy at the CHUS. At study entry, demographic characteristics and personal/familial medical history were collected. Anthropometric variables, body composition and blood pressure were measured in the first and the second trimester using the standardized procedures [20]. In the first trimester, non-fasting blood samples were obtained to measure glycosylated hemoglobin (Hb A1c ). Venous blood samples were also drawn 1h after a non-fasting 50-g glucose challenge test (50-g GCT) to assess plasma glucose levels. In the second trimester, each participant performed a 75-g oral glucose tolerance test (OGTT) under fasting state ( ≥8 hours). GDM was diagnosed according to the International Association of Diabetes and Pregnancy Study Groups (IADPSG) guidelines (fasting glucose ≥ 5.1 mmol/L; or 1h glucose ≥ 10.0 mmol/L; or 2h glucose ≥ 8.5 mmol/L) [21]. Fasting insulin and glucose were used to calculate the homeostatic model assessment for insulin resistance (HOMA-IR = fasting glucose (mmol/L) × fasting insulin (mU/L) / 22.5) [22]. At delivery, clinical information was collected from medical files and included maternal body weight at last prenatal visit, newborn gestational age, sex and anthropometric measures. Birth weight z-scores were assessed with the Fenton pre-term growth charts [23].

Eighty women and their respective newborns were selected for this study. Twenty women with GDM (12 treated with diet only and 8 with diet and insulin) and for whom both

94 placenta and cord blood samples were available were firstly selected (cases). Then, three normal glucose tolerant women (NGT, controls) per case were matched for age (± 3 years) and body mass index (BMI) (± 0.7 kg/m 2) at first trimester of pregnancy. The set of data collected is complete for the 80 women, except for fasting insulin levels measured at the second trimester that were missing for one NGT woman.

Biochemical analysis Plasma glucose concentrations were measured by the glucose hexokinase method (Roche Diagnostics). Fasting total cholesterol, high-density lipoprotein-cholesterol (HDL-C), and triglycerides were measured by colorimetric methods (Johnson & Johnson Clinical Diagnostics). Then, low density lipoprotein-cholesterol (LDL-C) levels were estimated using the Friedewald formula [24]. Glycosylated hemoglobin (Hb A1c ) was measured by high- performance liquid chromatography (HPLC) (VARIANT; Biorad). Insulin concentrations were measured using multiplexed particle-based flow cytometric assay; Milliplex map kits were purchased from Millipore.

Placenta and cord blood sampling Placenta and cord blood were sampled according to the same standardized procedure as previously described for the E-21 birth cohort used in our EWAS [14]. Briefly, samples were collected by well-trained clinicians (MD) within minutes of delivery and placenta expulsion. Placenta biopsies were taken on the fetal side near the insertion point of the umbilical cord and consisted of the intervillous tissues and chorionic villi. The biopsies were washed in PBS 1X to remove cord/maternal blood, dissected to remove conjunctive tissues and kept in RNAlater (Qiagen) at -80°C. Aliquots of cord blood samples were stored at -80°C in cryovials and PAXGene blood RNA Tubes (Qiagen) until nucleic acid extraction.

Nucleic acid extraction DNA and RNA were purified from placenta biopsies using the All Prep DNA/RNA/Protein Mini Kit (Qiagen). DNA and RNA were purified from cord blood samples with the Gentra Puregene Blood Kit (Qiagen) and PAXgene Blood RNA Kit (PreAnalytiX) respectively. RNA quality was assessed with Agilent 2100 Bioanalyzer RNA Nano Chips (Agilent

Technologies, Santa Clara, CA). Sixty-five placenta RNA samples (GDM=17; NGT=48) and 58 cord blood RNA samples (GDM=11; NGT=47) showed good quality (RNA integrity number (RIN) ≥ 7.0) and were used for subsequent mRNA analyses. RIN ranged from 7.4 to 10.0 (mean: 8.6 ± 0.6) for placenta and from 7.1 to 9.9 (mean: 9.0 ± 0.6) for cord blood.

DNA methylation analysis As previously mentioned, the EWAS we have recently conducted in the E-21 birth cohort identified 115 genes that showed DNA methylation differences ( P-values ≤ 0.05) in both placenta and cord blood samples in response to GDM exposure and were related to metabolic diseases pathways (Annexe 5) [14]. Among these 115 genes, we have selected the 10 most promising genes. For the genes for which we identified more than one CpG, we selected the CpG with the lowest P-value (Annexe 6). Although from the same 10 genes, different CpG sites were selected in the placenta and cord blood (Annexe 5). Consequently, DNA methylation levels were assessed at 10 distinct CpG sites in placenta and cord blood samples in the Gen3G birth cohort.

Pyrosequencing technology was used to quantify DNA methylation levels at the targeted CpGs. Pyrosequencing assays combine sodium bisulfite DNA conversion chemistry (EpiTech Bisulfite Kits; Qiagen), polymerase chain reaction (PCR) amplification (Pyromark PCR Kit; Qiagen) and sequencing by synthesis assay (Pyromark Gold Q24 Reagents; Qiagen). Sodium bisulfite preferentially deaminates unmethylated cytosine residues to thymines (after PCR amplification), whereas methylcytosines remain unmodified. Each of the pyrosequencing runs performed included a negative PCR control and a sequencing primer control as well as sodium bisulfite conversion controls. Additionally, a pyrosequencing quality control (peak height, deviation from reference sequence pattern and unexpected peak height) was assessed for each sample using the Pyromark Q24 Analysis Software (v1.0.10.134). PCR primers were designed to cover the 20 CpG sites selected for replication. PyroMark Assay Design software v2.0.1.15 was used to design the primers. Five CpGs were excluded because the design of specific pyrosequencing assays was restricted by: highly polymorphic regions ( HLA-DQB1 in both placenta and cord blood), SNPs (C/T and G/A) at the targeted CpG sites (cg26729380 ( TNF ) and cg19285525 ( RBMS1 ) in placenta) and high

96 complexity regions (stretch of thymines after bisulfite conversion, cg10673915 ( RBMS1 ) in the cord blood). The PCR and pyrosequencing primers used for DNA methylation analysis of the other 15 CpG sites are described in Table 3.1.

Gene expression analysis mRNA levels were quantified in the Gen3G birth cohort for genes for which the results were replicated ( BRD2 , LRP1B and CACNA1D ). Complementary DNA (cDNA) was generated from total RNA using a random primer hexamer provided with the High Capacity cDNA Archive kit (Life Technologies, #4368814). Equal amounts of cDNA were run in duplicate and amplified in a 20 µl reaction containing 10 µL of 2X Universal PCR Master Mix (Life Technologies, #4366072). Primers and Taqman probes were designed to cover exon boundaries (Life Technologies , BRD2 : Hs01121984_m1, LRP1B : Hs01069153_m1, CACNA1D : Hs01073321_m1). Each placenta sample was calibrated to the YWHAZ housekeeping gene (endogenous control; YWHAZ : Hs00237047_m1), and each cord blood sample was calibrated to the GAPDH housekeeping gene (endogenous control; GAPDH : Hs99999905_m1). Relative quantification estimations were performed using an Applied Biosystems 7500 Real Time PCR System as recommended by the manufacturer.

BRD2 /YWHAZ and LRP1B/YWHAZ Ct ratio (1/x) values were used for expression analyses in placenta and BRD2 /GAPDH, LRP1B/GAPDH and CACNA1D/GAPDH Ct ratio (1/x) values were used in cord blood.

USCS genome browser and a PubMed literature search were used to identify consensus sequences of transcription factor binding sites at gene loci for which DNA methylation levels were found to be significantly correlated with mRNA levels [25].

Table 3.1- PCR and pyrosequencing primers for amplification and pyrosequencing of the 15 CpGs analysed in the Gen3G birth cohort PLACENTA CORD BLOOD Genes Probe ID PCR and pyrosequencing primers Probe ID PCR and pyrosequencing primers F:5’-AGTGGGGATGGGGAAAGA-3’ F:5’-TAGATTTAAGAAGGTGGGATTTAGATAG-3’ BRD2 cg08491668 R :5’-CCCCCCTAACAAAAAAATAACAACCCT-3’ cg11439393 R:5’-TACATTCCCTTCCCCAAAAAACCTAT-3’ Seq:5’-TTTAGGTTTTGGTTGTGTA-3’ Seq:5’-GTATATTAAAAATATTAATAAAAGG-3’ F:5’-GGATGGAGTAGTTTTTGGTTAGT-3’ F :5’-GGGTGTTTTAGAAGTGTTGAATTT-3’ CACNA1D cg10409919 R :5’-ACAAATCTCCCAAACACCTAC-3’ cg13414750 R:5’-ACAAAACAATAAATAACCAACCAAAATAAT-3’ Seq :5’ -CATATCAAACTTCTCCCT -3’ Seq :5’ -TGGGGATTAATGGATTTTAAGGGT -3’ F:5’-GAGGGTAGGGTAAGAGTAAAGG-3’ F:5’-GGGTGTATTTTATTATTTTTTGGAGGTATT-3’ DLGAP2 cg05951364 R:5’-CCATATCAATCACCAATTTATAAACTCAC-3’ cg11192059 R:5’-AAAAAAATCCCTTTCCATCACAAAAAACTT-3’ Seq:5’-GTGGTTTAGAGTTAGGTTGTAA-3’ Seq:5’-ATTTAAGTGGAAGGTGTTATA-3’ F:5’-GGGTTTTGGAGGAGTAGTATTAG-3’ cg27115973 F:5’-GGTTAAAATTTGAGGTTGGGTTAGA-3’ KCNQ1 cg20828897 R:5’-AAAAAACATCTAAACCCTAAACAAATCTAC-3’ R:5’-AATAACAATCAAAACACCAAAACCTATC-3’ Seq: 5’ -ATGTAGTTTAGGGGTTT -3’ Seq: 5’ -AACTTCCACACCTAC -3’ F:5’-GGATTTTTTAGTTTGTTAGGGTTTAGG-3’ F:5’-GGAATTTTTTTAAACAAAFCAAATAACC-3’ LRP1B cg19355806 R:5’-ATACCTTCACTCCCAACTAAACTATCAT-3’ cg26413307 R:5’-TCTCACCCTAAACAAATCAAATAACC-3’ Seq: 5’ -AACTAAAAAATACCTTCC -3’ Seq: 5’ -AGATAAATAGTTTTAAAATTTTG -3’ F:5’-GGTTGGGTTTGAAGAAATTTAGGATGT-3’ F:5’-GGTTGGGTTTGAAGAAATTTAGGATGT-3’ PDE4D cg03154690 R:5’-CCAAACTAACATTTTACCCTAAATCTA-3’ cg06895913 R:5’-CCCCAATTTCCAAACTAACATTTTACCCTA-3’ Seq: 5’ -TTTACCCTAAATCTAAAATTAAT -3’ Seq: 5’ -TTTACCCTAAATCTAAAAATTAAT -3’ F:5’-TGAGGGGTAGTTTTAGTGGTTGG-3’ TNF cg26729380 - cg20477259 R:5’-CTCTAATAACACCACCAACTAATTATC-3’ Seq:5’-GGTAGTTTTAGTGGTTGAA-3’ F:5’-AGAATAGTTTTATGAGGTTAGTTTAGAGA-3’ F: 5’-GTGTGTAGGGTGATGAGTAGT-3’ TNFRSF1B cg09081517 R: 5’-TCTTCCCACCCTCAAATAATCT-3’ cg22677556 R: 5’-CAAAAACAATACCCCCTTCACAAAACTT-3’ Seq: 5’-GGTTTGGTTTTAGAGTTTAAATA-3’ Seq: 5’-GGGTGATATTGAGTTTTTTTTA-3’ The CpGs were located in the top 8 genes that were epigenetically affected by GDM in both placenta and cord blood samples and found to be involved in the metabolic diseases pathway in the E-21 birth cohort. F; Forward. R; Reverse. Seq; Sequencing These primers were designed from bisulfite converted sequence using Pyromark Assay Design software (version 2.0.1.15; Qiagen).

Statistical analyses Statistical analyses were performed using non-parametric tests as numerous variables were not normally distributed (assessed using the Kolmogorov-Smirnov test). Residual-based linear regression analysis was used to adjust DNA methylation for the following confounding variables: maternal BMI at first trimester, previous history of GDM and newborn’s sex and gestational age. Spearman rank correlation coefficients were used to investigate the association between DNA methylation residual score and variables of interest (fasting glucose, HOMA-IR, glycaemia 2h post-OGTT at 2 nd trimester). The association between DNA methylation and mRNA expression levels a BRD2 and CACNA1D gene loci were also assessed with Spearman rank correlation coefficients. DNA methylation levels residual for the 15 CpG sites, maternal and newborn characteristics were compared between women with and without GDM using Mann-Whitney U test or the Pearson χ2 test for categorical variable. Results were considered statistically significant when P-values were <0.05 (two-sided). All statistical analyses were performed with the IBM SPSS Statistics 20 software (release 20.0.0, SPSS, Chicago, Il, USA).

RESULTS The characteristics of the 80 mother and newborn pairs according to maternal glucose status (NGT vs GDM) are shown in Table 3.2. At first trimester of pregnancy, NGT and GDM women presented similar characteristics: median age was 30.3 years old and median BMI was in the overweight range (>25 kg/m 2). As expected, GDM women had significantly higher levels of fasting glucose as well as higher glucose levels 2h post-OGTT at second trimester of pregnancy.

Table 3.2 - Comparison of the characteristics of mothers and newborns according to glucose tolerance status. NGT (n=60) GDM (n=20) Median IQR Median IQR P Personal prior history of GDM n=11 (18.3%) n=7 (35.0%) 0.12 1st trimester of pregnancy (5 -13 weeks) Age (years) 30.5 8.0 30.5 6.0 0.91 BMI (kg/m 2) 25.7 11.2 26.4 12.0 0.42 HbA1c (%) 5.30 0.30 5.50 0.50 0.07 2nd trimester of pregnancy (24 -29 weeks) Fasting glucose (mmol/L) 4.20 0.50 4.60 0.90 0.004 HOMA -IR 1.61 0.97 1.90 2.39 0.29 2h post -OGTT glucose (mmol/L) 6.00 2.30 8.50 1.50 <0.001 3rd trimester of pregnancy/childbirth Gestational weight gain (kg) a 12.3 7.8 11.4 8.5 0.38 Newborn Sex Male n=32 (53.3%) n=6 (30.0%) 0.07 Female n=28 (46.7%) n=14 (70.0%) Birth weight z -score 0.00 1.14 0.22 1.17 0.69 NGT, normal glucose tolerance; GDM, gestational diabetes mellitus; IQR, interquartile range; BMI, body mass index; HbA1c, glycosylated hemoglobin; HOMA-IR, homeostasis model assessment- estimated insulin resistance; OGTT, oral glucose tolerance test. aMaternal weight gain between first trimester of pregnancy and within 11 weeks before childbirth.

Correlation between DNA methylation levels and maternal glucose metabolism at second trimester We have first assessed the correlation between maternal glucose levels 2h post-OGTT (used to diagnose GDM), glucose-related metabolic variables at second trimester of pregnancy (fasting glucose levels, HOMA-IR) and DNA methylation levels at the 15 CpG sites analysed, concentrating on NGT women only (n=60). The rationale underlying this analytical strategy as compared to the case-control design we have applied in our previous EWAS was

100 that maternal hyperglycemia, below the diagnostic threshold for GDM, was found to be linearly correlated with newborn health outcomes including birth weight, adiposity and fetal insulin production [26]. Moreover, GDM diagnostic criteria, which were different between Gen3G (IADPSG [21]) and E-21 (WHO guidelines [27]) birth cohorts, might have biased the results along with the treatment for GDM.

We report correlations between maternal glycemia 2h post-OGTT and DNA methylation levels for 5 out of the 15 CpGs tested (33%) (Figures 3.1 and 3.2). Higher maternal glucose levels were associated with lower DNA methylation levels at BRD2 and LRP1B gene loci in both the placenta ( BRD2 -cg08491668: r=-0.305; P=0.02 and LRP1B- cg19355806; r=-0.296; P=0.02) (Figure 3.1-Panels A and B) and cord blood (BRD2- cg11439393: r=-0.230; P=0.08 and LRP1B-cg26413307: r=-0.335; P=0.01) (Figure 3.2- Panels A and C). In addition, DNA methylation levels at CACNA1D (cg13413750) in cord blood were negatively correlated with maternal glucose levels 2h post-OGTT (r=-0.272; P=0.04) (Figure 3.2-Panel B). No other association was observed between maternal glucose metabolism and DNA methylation levels.

Figure 3.1- Association plots between maternal glucose levels 2h post-OGTT and DNA methylation levels in placenta of NGT women. Higher maternal glucose levels 2h post-OGTT were associated with lower DNA methylation levels at (A) BRD2 (cg08491668) and (B) LRP1B (cg19355806) gene loci in placenta. aSpearman correlation coefficients adjusted for history of gestational diabetes, maternal body mass index at 1 st trimester, newborn sex and gestational age.

101

Figure 3.2- Association plots between maternal glucose levels 2h post-OGTT and DNA methylation levels in cord blood of NGT women. Higher maternal glucose levels 2h post-OGTT were associated with lower DNA methylation levels at (A) BRD2 (cg11439393), (B) CACNA1D (cg10409919) and (C) LRP1B (cg26413307) gene loci in cord blood. aSpearman correlation coefficients adjusted for history of gestational diabetes, maternal body mass index at 1 st trimester, newborn sex and gestational age.

Association between GDM and DNA methylation levels Nevertheless, we have also compared DNA methylation levels between placenta and cord blood samples exposed or not exposed to GDM. In placenta samples exposed to GDM, we found higher DNA methylation levels at cg05951364 in DLGAP2 (92.0 ± 9.1% vs. 83.4 ± 12.7%; P=0.007) (Table 3.3). We did not observed significant DNA methylation differences between the groups at any other loci.

102

Table 3.3 - Mann-Whitney U comparisons of DNA methylation levels (%) in placenta and cord blood samples not exposed to GDM (NGT, n=60) or exposed to GDM (n=20) in the Gen3G birth cohort. PLACENTA CORD BLOOD NGT GDM NGT GDM Genes Probe ID Median IQR Median IQR P* Probe ID Median IQR Median IQR P* BRD2 cg08491668 57.2 11.1 58.3 10.9 0.17 cg11439393 15.1 3.7 15.0 5.2 0.64 CACNA1D cg10409919 36.0 14.4 38.5 14.6 0.66 cg13414750 72.8 6.7 72.8 4.9 0.94 DLGAP2 cg05951364 86.6 16.5 94.0 10.2 0.007 cg11192059 92.0 3.7 90.2 4.5 0.19 KCNQ1 cg20828897 64.6 10.0 64.2 9.2 0.42 cg27115973 54.8 5.4 54.0 5.7 0.89 LRP1B cg19355808 53.9 18.2 56.4 16.8 0.90 cg26413307 62.7 8.3 62.9 9.4 0.26 PDE4D cg03154690 23.4 12.7 24.3 11.4 0.77 cg06895913 7.7 2.0 8.3 3.6 0.22 TNF cg26729380 - - - - - cg20477259 48.2 7.7 53.3 6.8 0.07 TNFRSF1B cg09081517 55.4 9.0 56.1 7.7 0.55 cg22677556 49.3 4.8 48.8 6.5 0.44 IQR, interquartile range *P-value adjusted for history of gestational diabetes mellitus, maternal body mass index at first trimester, newborn’s sex and gestational age at birth.

103

Associations between DNA methylation and mRNA levels

Finally, we assessed the potential functional impact of DNA methylation marks identified in the current study. First, LRP1B transcripts were undetectable in both the placenta and cord blood. In cord blood, a trend of a positive correlation was observed between BRD2 DNA methylation and mRNA levels (n=58, r=0.235; P=0.08). This correlation might be specific to newborn girls (n=29; r=0.477; P=0.009) since no correlation was observed in boys (n=29; r=-0.025; P=0.90).

Interestingly, BRD2 cg11439393 probe set is located within intron 2 and 1,108 bp downstream a CpG island. Four other CpGs that were associated with maternal glycemia in cord blood in our previous EWAS [14] (Figure 3.3, Annexe 6) are closed to cg11439393. DNA methylations levels at these 5 CpGs are highly correlated (r ≥0.725; P<0.001). Interestingly, these CpGs are found in a region that is highly conserved across placental mammals as well as near potential binding sites for transcriptional factors such as CEBP , OLF1 and IRF7 (Figure 3.3).

104

Figure 3.3- Location of CpGs, transcription factor binding sites and highly conserved regions within BRD2 gene locus, adapted from UCSC genome browser tracks Track A- BRD2 intron 2 to intron 3 region. Track B- Localisation of the second CpG island within BRD2 gene locus. Track C-Identification CpG sites that were found to be associated with maternal hyperglycemia (black: CpG epigenotyped in Gen3G and E-21 birth cohorts; white: CpG epigenotyped in E-21 birth cohort only. Track D- Localisation of transcription factor binding sites. Track E- Conservation track for mammals. UCSC genome browser was accessed on August 27 2014 [28].

105

DISCUSSION The current study is a first attempt to confirm in an independent cohort the associations between maternal hyperglycemia and DNA methylation levels reported in previous EWAS. The major findings we herein report are associations between maternal glycemia and DNA methylation levels for 5 out of the 15 CpGs analysed in samples from NGT women only, which is more than what would be expected by chance alone. We observed that DNA methylation levels at BRD2 and LRP1B gene loci in both placenta and cord blood and at CACNA1D gene locus in cord blood are negatively correlated with maternal glucose levels 2h post-OGTT at the second trimester of pregnancy. These results are in accordance with our EWAS reporting lower DNA methylation levels at these three gene loci in placenta and cord blood samples exposed to GDM in comparison to those exposed to normoglycemia [14]. More importantly, our findings suggest that the newborn’s epigenome is sensitive to maternal glycemia even when glucose levels are below the diagnostic threshold for GDM. Likewise, it has been shown that a modest increase in maternal glucose levels within the normal or GDM range of glycemia is associated with higher birth weight and adiposity, as well as with an increased incidence of obesity and cardiometabolic complications in children, adolescents and adults [26, 28-30]. The results of the current study thus support that a small increase in maternal glycemia remaining within the normal range might have deleterious effects on the offspring short- and long-term metabolic health. This in utero metabolic programming could be partly mediated by DNA methylation modifications.

Indeed, the three genes we have identified are important candidates for obesity and cardiometabolic diseases. BRD2 encodes the bromodomain-containing protein 2 (BRD2), which regulates the transcription and splicing of more than 1500 genes [31]. In mice and in vitro models, disruption of Brd2 promotes adipogenic differentiation and adipose tissue expansion [32]. DNA methylation was recently shown to be involved in BRD2 gene expression regulation and differentiation of 3T3-L1 cells into adipocytes [33]. In mice, the disruption of Brd2 has been associated with a metabolically healthy obesity phenotype: obesity with hyperadiponectinemia, improved glucose tolerance and reduced inflammatory response [34]. The pancreatic expression of Cacna1d, a voltage-dependent calcium channel ,

106 was found to be decreased in intra-uterine growth restricted sheep and correlated with glucose-stimulated disposition in the adult sheep [35]. Genetic variants in CACNA1D were also associated with hypertension and primary aldosteronism [36, 37]. Finally, LRP1B encodes the low-density lipoprotein receptor-related protein 1B that mediates cellular cholesterol uptake [38]. Lrp1b was recently identified as a determinant of cholesterol concentrations in low-density lipoproteins in rats [39]. Furthermore, polymorphisms in the LRP1B gene were found to be associated with insulin resistance, uncontrolled emotional eating and child BMI [40-42]. The biological functions of these three genes are thus highly supportive of their implication in metabolic health programming of the newborn exposed to variations in maternal glycemia.

We have also reported a correlation between BRD2 DNA methylation and mRNA levels in cord blood, which could be specific to girls only keeping in mind that this is a sub- group analysis. Sex-specific associations between DNA methylation, mRNA levels and the phenotypic variables have been reported in several studies, suggesting that DNA methylation contributes to phenotypic sexual dimorphism [43, 44]. Although DNA methylation levels at other gene loci were not correlated with mRNA levels in the placenta or cord blood, these epigenetic modifications might have a functional impact in other tissues such as the adipose tissue, the skeletal muscle or the brain, where they could trigger newborns’ long-term susceptibility to obesity or cardiometabolic complications. In agreement with this, we have previously reported that placental DNA methylation changes at LPL and ABCA1 gene loci have tissue-specific impacts on gene expression regulation [9, 10, 45, 46]. Further studies are needed to determine whether DNA methylation variations observed at BRD2 , CACNA1D and LRP1B gene loci in the placenta and cord blood mirror those of other tissues and correlate with their mRNA levels.

Our study has several strengths. First, the longitudinal follow-up of the women from first trimester of pregnancy to delivery allowed us to accurately identify women who developed GDM during pregnancy and therefore avoid their misclassification with women who might have been diabetic pre-pregnancy. Second, our study design permitted the inclusion of confounding variables in our statistical models. The sample size is fairly large

107 compared to other studies but correlations/differences of smaller effect size might have been missed. One limitation of the current study is that we were not able to quantify DNA methylation levels using pyrosequencing at CpG sites within HLA-DQB1 and RBMS1 gene loci in the placenta and cord blood, as well as within TNF in the placenta. These genes have been associated with insulin resistance and the onset of type 2 diabetes and are thus of great interest in the context of fetal metabolic programming. Other technical approaches such as Sequenom Epityper system could potentially be used to assess DNA methylation levels at these 5 CpG sites and the many others we have not reassessed in the current study. Although we tested 15 CpGs, the sample size and effect size did not allow multiple testing adjustments. Considering that the CpGs were selected from a previous EWAS and the relatively good confirmation success we have obtained (5 out of 15 tested or 33%), it is unlikely that all these results are false positives. Finally, further functional and longitudinal studies are required to determine whether any of these epigenetic marks are stable over time and associated with the development of obesity and obesity-related cardiometabolic complications in these newborns.

CONCLUSIONS In conclusion, we report associations between maternal glycemia and DNA methylation levels at 5 loci we have identified as among our strongest candidates based on a previous EWAS of GDM cases-controls. Our results suggest that BRD2 , CACNA1D and LRP1B are epigenetically programmed by modest increases in maternal glucose levels. Moreover, as these three genes are associated with the development of obesity or cardiometabolic complications, DNA methylation modifications at these loci might influence the long-term metabolic health of the newborn. The results of the current study thus provide additional evidence supporting the role of DNA methylation in fetal metabolic programming.

108

FUTURE PERSPECTIVE The current study, along with several other ones, is highly supportive of the role of epigenetic modifications in fetal metabolic health programming of the newborn exposed to suboptimal in utero environment including maternal hyperglycemia. Nevertheless, whether the epigenetic modifications observed at birth are stable over time and associated with the future development of obesity and cardiometabolic complications is unknown. Longitudinal studies are thus needed to assess the stability of these epigenetic marks and their association with metabolic health indicators (such as body fat percentage, blood glucose, and lipid profile) in child, adolescent and adult populations. If such associations were observed, epigenetic marks might, in the long run, be used as clinical markers of obesity susceptibility at birth.

SUMMARY POINTS Background In utero exposure to maternal hyperglycemia is associated with an increased long-term susceptibility to obesity and metabolic diseases. Epidemiologic evidence and animal models suggest that DNA methylation modifications are involved in this fetal metabolic programming. DNA methylation marks are sensitive to environmental stimuli during embryonic development. DNA methylation status of several genes appears to be stable and might have long-term adverse consequences on gene expression and cellular phenotype Associations between maternal glycemia and DNA methylation levels in placenta and cord blood In a recent EWAS, we have identified 115 genes involved in the metabolic diseases pathway differentially methylated in placenta and/or cord blood samples exposed and not exposed to GDM. In the current study, we confirmed, in an independent birth cohort, that maternal glycemia is negatively correlated with DNA methylation levels at LRP1B and BRD2 gene loci in placenta and at LRP1B, BRD2 and CACNA1D gene loci in cord blood.

109

Associations between DNA methylation and mRNA levels In cord blood of newborn girls, BRD2 DNA methylation levels are positively correlated with BRD2 mRNA levels. Conclusion Our results suggest that BRD2 , CACNA1D and LRP1B are epigenetically programmed by maternal glycemia. DNA methylation perturbations at these three candidate genes, known to be involved in metabolic diseases, might influence the long-term metabolic health of the newborn.

110

ACKNOWLEDGMENTS The authors acknowledge the Blood Sampling Clinic in Pregnancy at Centre Hospitalier Universitaire de Sherbrooke (CHUS), which supports research activities integrated to the Blood Sampling in Pregnancy Clinic; the CHUS laboratory for performing blood glucose and lipid profiles analyses; and the contribution of the clinical research nurses (M. Gérard, CHUS; G. Proulx, CHUS; S. Hayes, CHUS; and M.-J. Gosselin, CHUS) and research assistants (C. Rousseau, CHUS; P. Brassard, CHUS; J. Ménard, CHUS; M.C. Battista, CHUS and S. Claveau, ECOGENE-21 laboratory) and graduate students (L. Guillemette, M. Lacroix, J. Patenaude) for their dedicated work in this study. The authors also express their gratitude to Céline Bélanger, Chicoutimi Hospital, for her thoughtful language revision of the manuscript.

FINANCIAL & COMPETING INTERESTS DISCLOSURE This project was supported by ECOGENE-21 Clinical research center, the Canadian Institutes of Health Research (CIHR), the Fonds de Recherche du Québec en Santé (FRQS) and Diabète Québec. L.B. is a junior research scholar from the Fonds de la Recherche en Santé du Québec (FRQS). M.F.H. was a FRSQ Research Scholar and was awarded Clinical Scientist award by the Canadian Diabetes Association (CDA); she is now supported by American Heart Association (AHA) and American Diabetes Association (ADA) awards. L.B. and M.F.H. are members of the FRQS-funded Centre de recherche Clinique Étienne-Le Bel (affiliated with Centre Hospitalier Universitaire de Sherbrooke (CHUS)). A.A.H. is the recipient of doctoral training award from the FRQS and the Faculté de Médecine et des Sciences de la Santé de l’Université de Sherbrooke. S.M.R. has received a postdoctoral fellowship from the CDA. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed.

No writing assistance was utilized in the production of this manuscript.

111

ETHICAL CONDUCT OF RESEARCH The authors state that they have obtained appropriate institutional review board approval and have followed the principles outlines in the Declaration of Helsinki for all human experimental investigations. In addition, informed consent has been obtained from the participants involved in the current study.

112

REFERENCES

1. Galtier F: Definition, epidemiology, risk factors . Diabetes & metabolism 36(6 Pt 2), 628-651 (2010).

2. Catalano PM: Trying to understand gestational diabetes . Diabetic medicine : a journal of the British Diabetic Association 31(3), 273-281 (2014).

3. Clausen TD, Mathiesen ER, Hansen T et al.: High prevalence of type 2 diabetes and pre-diabetes in adult offspring of women with gestational diabetes mellitus or type 1 diabetes: the role of intrauterine hyperglycemia . Diabetes care 31(2), 340-346 (2008).

4. Hillier TA, Pedula KL, Schmidt MM, Mullen JA, Charles MA, Pettitt DJ: Childhood obesity and metabolic imprinting: the ongoing effects of maternal hyperglycemia . Diabetes care 30(9), 2287-2292 (2007).

5. Clausen TD, Mathiesen ER, Hansen T et al.: Overweight and the metabolic syndrome in adult offspring of women with diet-treated gestational diabetes mellitus or type 1 diabetes . The Journal of clinical endocrinology and metabolism 94(7), 2464-2470 (2009).

6. Hill JC, Krishnaveni GV, Annamma I, Leary SD, Fall CH: Glucose tolerance in pregnancy in South India: relationships to neonatal anthropometry . Acta obstetricia et gynecologica Scandinavica 84(2), 159-165 (2005).

7. Hyperglycemia and Adverse Pregnancy Outcome (HAPO) Study: associations with neonatal anthropometrics . Diabetes 58(2), 453-459 (2009).

8. Metzger BE, Lowe LP, Dyer AR et al.: Hyperglycemia and adverse pregnancy outcomes . The New England journal of medicine 358(19), 1991-2002 (2008).

9. Deierlein AL, Siega-Riz AM, Chantala K, Herring AH: The association between maternal glucose concentration and child BMI at age 3 years . Diabetes care 34(2), 480- 484 (2011).

113

10. Walsh JM, Mahony R, Byrne J, Foley M, Mcauliffe FM: The association of maternal and fetal glucose homeostasis with fetal adiposity and birthweight . European journal of obstetrics, gynecology, and reproductive biology 159(2), 338-341 (2011).

11. Bouchard L, Hivert MF, Guay SP, St-Pierre J, Perron P, Brisson D: Placental adiponectin gene DNA methylation levels are associated with mothers' blood glucose concentration . Diabetes 61(5), 1272-1280 (2012).

12. Bouchard L, Thibault S, Guay SP et al.: Leptin gene epigenetic adaptation to impaired glucose metabolism during pregnancy . Diabetes care 33(11), 2436-2441 (2010).

13. Houde AA, Guay SP, Desgagne V et al.: Adaptations of placental and cord blood ABCA1 DNA methylation profile to maternal metabolic status . Epigenetics : official journal of the DNA Methylation Society 8(12), 1289-1302 (2013).

14. Houde AA, St-Pierre J, Hivert MF et al.: Placental lipoprotein lipase DNA methylation levels are associated with gestational diabetes mellitus and maternal and cord blood lipid profiles . Journal of developmental origins of health and disease 5(2), 132-141 (2014).

15. El Hajj N, Pliushch G, Schneider E et al.: Metabolic programming of MEST DNA methylation by intrauterine exposure to gestational diabetes mellitus . Diabetes 62(4), 1320-1328 (2013).

16. Desgagne V, Hivert MF, St-Pierre J et al.: Epigenetic dysregulation of the IGF system in placenta of newborns exposed to maternal impaired glucose tolerance . Epigenomics 6(2), 193-207 (2014).

17. Petropoulos S, Guillemin C, Ergaz Z et al.: Gestational Diabetes Alters Offspring DNA Methylation Profiles in Human and Rat: Identification of Key Pathways involved in Endocrine System Disorders, Insulin Signaling, Diabetes Signaling and IL-K Signaling . Endocrinology , en20141643 (2014).

114

18. Ruchat SM, Houde AA, Voisin G et al.: Gestational diabetes mellitus epigenetically affects genes predominantly involved in metabolic diseases . Epigenetics : official journal of the DNA Methylation Society 8(9), 935-943 (2013).

19. Henikoff S, Matzke MA: Exploring and explaining epigenetic effects . Trends in genetics : TIG 13(8), 293-295 (1997).

20. Bird A: DNA methylation patterns and epigenetic memory . Genes & development 16(1), 6-21 (2002).

21. Bestor TH: The DNA methyltransferases of mammals . Human molecular genetics 9(16), 2395-2402 (2000).

22. Hanson M, Godfrey KM, Lillycrop KA, Burdge GC, Gluckman PD: Developmental plasticity and developmental origins of non-communicable disease: theoretical considerations and epigenetic mechanisms . Progress in biophysics and molecular biology 106(1), 272-280 (2011).

23. Feinberg AP, Irizarry RA, Fradin D et al.: Personalized epigenomic signatures that are stable over time and covary with body mass index . Science translational medicine 2(49), 49ra67 (2010).

24. Flanagan JM, Brook MN, Orr N et al.: Temporal stability and determinants of white blood cell DNA methylation in the Breakthrough Generations Study . Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology , (2014).

25. Clarke-Harris R, Wilkin TJ, Hosking J et al.: PGC1alpha promoter methylation in blood at 5-7 years predicts adiposity from 9 to 14 years (EarlyBird 50) . Diabetes 63(7), 2528-2537 (2014).

26. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC: Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man . Diabetologia 28(7), 412-419 (1985).

115

27. Friedewald WT, Levy RI, Fredrickson DS: Estimation of the concentration of low- density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge . Clinical chemistry 18(6), 499-502 (1972).

28. Kent WJ, Sugnet CW, Furey TS et al.: The human genome browser at UCSC . Genome research 12(6), 996-1006 (2002).

29. WHO-1999 World Health Organization. Definition, Diagnosis and Classification of Diabetes Mellitus and its Complications. Part 1: Diagnosis and Classification of Diabetes Mellitus. WHO/NCD/NCS/99.2 ed. Geneva: World Health Organization ; (1999).

30. Metzger BE, Gabbe SG, Persson B et al.: International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy . Diabetes care 33(3), 676-682 (2010).

31. Hnilicova J, Hozeifi S, Stejskalova E et al.: The C-terminal domain of Brd2 is important for chromatin interaction and regulation of transcription and alternative splicing . Molecular biology of the cell 24(22), 3557-3568 (2013).

32. Wang F, Liu H, Blanton WP, Belkina A, Lebrasseur NK, Denis GV: Brd2 disruption in mice causes severe obesity without Type 2 diabetes . The Biochemical journal 425(1), 71-83 (2010).

33. Wang F, Deeney JT, Denis GV: Brd2 gene disruption causes "metabolically healthy" obesity: epigenetic and chromatin-based mechanisms that uncouple obesity from type 2 diabetes . Vitamins and hormones 91, 49-75 (2013).

34. Gatford KL, Mohammad SN, Harland ML et al.: Impaired beta-cell function and inadequate compensatory increases in beta-cell mass after intrauterine growth restriction in sheep . Endocrinology 149(10), 5118-5127 (2008).

35. Fischer E, Beuschlein F: Novel genes in primary aldosteronism . Current opinion in endocrinology, diabetes, and obesity 21(3), 154-158 (2014).

116

36. Lu X, Wang L, Lin X et al.: Genome-wide association study in Chinese identifies novel loci for blood pressure and hypertension . Human molecular genetics 24(3), 865-874 (2015).

37. Li Y, Knisely JM, Lu W et al.: Low density lipoprotein (LDL) receptor-related protein 1B impairs urokinase receptor regeneration on the cell surface and inhibits cell migration . The Journal of biological chemistry 277(44), 42366-42371 (2002).

38. Hodulova M, Sedova L, Krenova D et al.: Genomic determinants of triglyceride and cholesterol distribution into lipoprotein fractions in the rat . PloS one 9(10), e109983 (2014).

39. Burgdorf KS, Gjesing AP, Grarup N et al.: Association studies of novel obesity-related gene variants with quantitative metabolic phenotypes in a population-based sample of 6,039 Danish individuals . Diabetologia 55(1), 105-113 (2012).

40. Cornelis MC, Rimm EB, Curhan GC et al.: Obesity susceptibility loci and uncontrolled eating, emotional eating and cognitive restraint behaviors in men and women . Obesity (Silver Spring) 22(5), E135-141 (2014).

41. Namjou B, Keddache M, Marsolo K et al.: EMR-linked GWAS study: investigation of variation landscape of loci for body mass index in children . Frontiers in genetics 4, 268 (2013).

42. Laguna-Barraza R, Bermejo-Alvarez P, Ramos-Ibeas P et al.: Sex-specific embryonic origin of postnatal phenotypic variability . Reproduction, fertility, and development 25(1), 38-47 (2012).

43. Gabory A, Attig L, Junien C: Sexual dimorphism in environmental epigenetic programming . Molecular and cellular endocrinology 304(1-2), 8-18 (2009).

44. Guay SP, Brisson D, Lamarche B et al.: DNA methylation variations at CETP and LPL gene promoter loci: new molecular biomarkers associated with blood lipid profile variability . Atherosclerosis 228(2), 413-420 (2013).

117

45. Guay SP, Brisson D, Munger J, Lamarche B, Gaudet D, Bouchard L: ABCA1 gene promoter DNA methylation is associated with HDL particle profile and coronary artery disease in familial hypercholesterolemia . Epigenetics : official journal of the DNA Methylation Society 7(5), 464-472 (2012).

CHAPITRE 4 - ARTICLE 3

Placental lipoprotein lipase DNA methylation levels are associated with gestational diabetes mellitus and maternal and cord blood lipid profiles

Auteurs de l’article : Andrée-Anne Houde, Julie St-Pierre, Marie-France Hivert, Jean- Patrice Baillargeon, Patrice Perron, Daniel Gaudet, Diane Brisson et Luigi Bouchard.

Statut de l’article : Publié dans la revue Journal of Developmental Origins of Health and Disease

Houde A.A., St-Pierre J., Hivert M.F., Baillargeon J.P., Perron P., Gaudet D., Brisson D. et Bouchard L. 2014. Placental lipoprotein lipase DNA methylation levels are associated with gestational diabetes mellitus and maternal and cord blood lipid profiles. Journal of Developmental Origins of Health and Disease . 5(2): 132-41.

Avant-propos : Cet article est le premier pour lequel nous avons utilisé l’approche par gène candidat afin d’identifier des gènes épigénétiquement modifiés suite à l’exposition au DG. Dans cet article, nous avons étudiés les niveaux de méthylation du gène de la lipoprotéine lipase (LPL ) placentaire. Ce gène encode pour une protéine impliquée dans le transport materno-fœtal des lipides. En tant que première auteure de cet article, j’ai effectué les analyses des niveaux de méthylation de LPL , les analyses statistiques, l’interprétation des données et la rédaction de l’article.

119

RÉSUMÉ La lipoprotéine lipase (LPL) placentaire joue un rôle cruciale dans le transfert materno- fœtal des lipides. L’expression du gène LPL et son activité enzymatique sont perturbées dans le placenta des mères ayant une grossesse compliquée par un DG ou un retard de croissance intra-utérin. Par conséquent, nous avons émis l’hypothèse que la méthylation de LPL, dans le placenta, est altérée par le profil métabolique maternel et pourrait contribuer à la programmation métabolique fœtale. L’objectif de cette étude est donc de déterminer si la méthylation de LPL du placenta est associée au DG ainsi qu’au profil lipidique de la mère et du nouveau-né. Des biopsies de placenta ont été prélevées lors de l’accouchement de 126 mères incluant 27 mères diagnostiquées avec DG suite à un test d’hyperglycémie de provoquée par voie orale (HGPO : 75 g de glucose) entre la 24 e et 28 e semaine de la grossesse. Les niveaux de méthylation et d’expression de LPL ont été quantifiés par pyroséquençage de l’ADN traité au bisulfite de sodium et par PCR quantitatif en temps réel respectivement. Les sites CpG situés dans les ilots CpG de la région promotrice proximale (CpG1) et de l’intron 1 (CpG2 et CpG3) de LPL démontraient des niveaux de méthylation plus bas dans les placentas exposés au DG en comparaison avec ceux provenant des mères ayant eu une grossesse normoglycémique. Les niveaux de méthylation des CpG1 et CpG3 du gène LPL sont aussi négativement corrélés avec la glycémie maternelle (2h post-HGPO; r = -0,22; p = 0.02) et les niveaux de cholestérol- HDL maternels (troisième trimestre de la grossesse; r = -0,20; p = 0.03). De plus, nous avons rapporté des corrélations entre la méthylation du CpG2 de LPL et le profil lipidique du sang de cordon. Dans le placenta, la méthylation au niveau de l’ilot CpG de l’intron 1 de LPL permet d’expliquer jusqu’à 26% (r ≤ -0,51; p < 0,001) de la variabilité des niveaux d’expression de LPL . L’ensemble de nos résultats suggèrent que les épipolymorphismes de LPL dans le placenta ont un impact fonctionnel distinct selon le site CpG sur lequel il se trouve et qu’ils pourraient être impliqués dans la programmation de la santé métabolique du nouveau-né.

120

Placental Lipoprotein Lipase DNA Methylation Levels Are Associated with Gestational Diabetes Mellitus and Maternal and Cord Blood Lipid profiles

A.A. Houde 1,2 , J. St-Pierre 2,3 , M.F. Hivert 4,5 , J.P. Baillargeon 4, P. Perron 2,4 , D.Gaudet 2,6 , D. Brisson 2,6 and L. Bouchard 1,2 .

1. Department of biochemistry, Université de Sherbrooke, Sherbrooke, Qc, Canada; 2. ECOGENE-21 and Clinical Research Center and Lipid Clinic, Chicoutimi Hospital, Saguenay, Qc, Canada; 3. Department of Pediatric, CSSS de Chicoutimi, Saguenay, Qc, Canada; 4. Department of Medicine, Division of Endocrinology, Université de Sherbrooke, Sherbrooke, Qc, Canada.; 5. General Medicine Division, Massachusetts General Hospital, Boston, MA . and 6. Department of Medicine, Université de Montréal, Montréal, Qc, Canada

Short Title: LPL DNA methylation and maternal metabolic profile

121

ABSTRACT Placental lipoprotein lipase (LPL) is crucial for placental lipid transfer. Impaired LPL gene expression and activity were reported in pregnancies complicated by gestational diabetes mellitus (GDM) and intra-uterine growth restriction. We hypothesized that placental LPL DNA methylation is altered by maternal metabolic status and could contribute to fetal programming. The objective of this study was thus to assess whether placental LPL DNA methylation is associated with GDM and both maternal and newborn lipid profiles. Placenta biopsies were sampled at delivery from 126 women including 27 women with GDM diagnosed following a post 75g-oral glucose tolerance test (OGTT) between weeks 24-28 of gestation. Placental LPL DNA methylation and expression levels were determined using bisulfite pyrosequencing and quantitative real-time PCR respectively. DNA methylation levels within LPL proximal promoter region (CpG1) and intron 1 CpG island (CpGs 2 and 3) were lower in placenta of women with GDM. DNA methylation levels at LPL -CpG1 and CpG3 were also negatively correlated with maternal glucose (2-h post OGTT; r=-0.22; p=0.02) and HDL-cholesterol levels (third trimester of pregnancy; r=-0.20; p=0.03) respectively. Moreover, we report correlation between LPL-CpG2 DNA methylation and cord blood lipid profile. DNA methylation levels within intron 1 CpG island explained up to 26% (r ≤-0.51; p<0.001) of placental LPL mRNA expression variance. Overall, we showed that maternal metabolic profile is associated with placental LPL DNA methylation dysregulation. Our results suggest that site-specific LPL epipolymorphisms in the placenta are possibly functional and could potentially be involved in determining the future metabolic health of the newborn.

Key words: Fetal programming, HDL-c

122

INTRODUCTION Fetal lipid metabolism is crucial for growth and development and highly dependent on maternal lipid supply. The fetus, unable to synthesize sufficient amounts of essential fatty acids (EFA), relies on maternal triglyceride-rich lipoproteins and non-esterified fatty acids (NEFA) as sources of free fatty acids (FFA) 1. While NEFA are directly transferred to the fetus through diffusion or via placenta fatty acid binding proteins 2, triglycerides (TG) from lipoproteins first need to be hydrolyzed into FFA by placental lipases. Endothelial lipase (LIPG) and lipoprotein lipase (LPL) both contribute to most of the transfer of FFA from maternal lipoproteins to the fetus 3. The LIPG is a phospholipase with a low triglyceride lipase activity, which mainly hydrolyzes phospholipids from high-density lipoproteins (HDL). In contrast, the placental LPL is a TG lipase and mainly hydrolyses maternal lipoproteins enriched in TG such as chylomicrons and very low-density lipoproteins (VLDL) 4. Impaired placental LPL gene expression and activity were previously associated with gestational conditions characterized by a suboptimal in-utero environment and fetal development. Gestational diabetes mellitus (GDM) was associated with lower LPL mRNA levels whereas higher LPL mRNA levels were observed in cases of intra-uterine growth restriction (IUGR) 5- 7. This suggests that disturbances of placental LPL impair materno-fetal lipid transfer, fetal fat accretion, growth and development 8. Fetal conditions previously associated with increased long-term risk for obesity and metabolic disorders in the newborn 9, 10 .

In line with these observations, we propose that maternal metabolic status could impair placenta’s LPL DNA methylation profile possibly contributing to fetal metabolic programming. DNA methylation is the most stable and studied epigenetic mark. The addition of a methyl group at position 5’ of the pyrimidine ring of the cytosines upstream of a guanine (dinucleotide CpG) is catalyzed by DNA methyltransferases 11 . DNA methylation regulates transcriptional activity and is generally associated with gene expression repression 12 . The methylation of cytosines is sensitive to environmental stimuli including the intra-uterine environment 13, 14 . The placenta methylome has been shown to adapt to the intra-uterine environment to support adequate fetal development and seems to be involved in the regulation of gene expression, placentation, fetal growth and birth weight 15, 16 . Likewise, we

123 have previously reported alterations in DNA methylation profiles of leptin and adiponectin genes in placenta of newborn exposed, in-utero , to maternal hyperglycemia 17, 18 .

This study was conducted to verify whether placental LPL DNA methylation levels are associated with GDM and both maternal and cord blood lipid profile. In addition, we have investigated whether placental LPL gene DNA methylation was correlated with its expression levels. Considering the importance of LPL in materno-fetal lipid metabolism, changes in placental LPL gene expression through DNA methylation variation could impair fetal lipid supply, affect fetal growth and development, and potentially be involved in fetal metabolic programming.

124

METHOD One hundred twenty-six (126) Caucasian pregnant women were recruited in the Saguenay region. Women aged over 40 years old as well as those that had a positive history of drug or alcohol abuses during the current pregnancy, pre-gestational type 1 or 2 diabetes, polycystic ovary syndrome (PCOS), hypercholesterolemia, morbid obesity (Body mass index (BMI) >40) or those who gave birth prematurely (gestational age < 37 weeks) were excluded. The Chicoutimi Hospital Ethics Committee approved the project. All subjects provided a written informed consent before their inclusion in the study, and all clinical data were de-identified nominalized. This project was conducted in accordance with the Declaration of Helsinki.

Participants were followed at weeks 10-14 as well as at weeks 24-28 and 36-39. At each visit, anthropometric parameters were measured and recorded by a research nurse according to standard procedures 19 . Blood samples were collected at each trimester following a 12-hour overnight fast. At delivery, placenta biopsies and cord blood samples were collected. All glucose and insulin concentrations were assessed on fresh serum samples at the Chicoutimi Hospital Clinical Laboratory. Insulin measurements were performed using a radioimmunoassay method (Advia Centaur, Simmens). Maternal blood glucose along with total cholesterol (TC) and TG levels were determined using the enzymatic method on a Beckman analyzer (model CX7; Beckman, Fullerton, CA). VLDL and low-density lipoproteins (LDL) in plasma were precipitated with heparin and MnCl 2 to isolate HDL particles for cholesterol (HDL-c) measurement. Then, plasma LDL-c concentrations were estimated using the Friedewald formula 20 . GDM was diagnosed according to WHO criteria: glycaemia ≥ 7.8 mmol/L following the 2-hour post 75g-oral glucose tolerance test (OGTT) between the 24 th and 28 th weeks of gestation. The 126 women were tested between weeks 22.4 and 28.9 (average=25.7 ± 1 weeks) of gestation. Insulin resistance levels were assessed using HOMA-IR (fasting glucose (mmol/L) * fasting insulin (mU/L)/22.5) at the second trimester of pregnancy 21 . Clinical information about the newborn was collected at birth from medical files and included gestational age, sex of the newborn and anthropometric measurements. The gestational age was calculated at the first visit from the date of the last menstrual period and was corrected afterwards, as required, based on the date from the ultrasound scans. Cord blood lipid and glucose levels were assessed as described for the

125 mother. In addition, cord blood C-peptide levels, measured by ELISA, were used as a marker of the newborn’ insulin-secretory activity 22 . Because the lipid measurements (HDL-c, TG, TC) were not available for all women, the number of samples (n) provided in Table 4.2 are lower than 126. The lipid profile was available for 92 newborns out of 126.

Placenta tissue sampling Placenta tissues were sampled by well-trained clinicians (MD) within a few minutes after delivery and placental expulsion. Two biopsies of 0.5 cm 3 were taken on the fetal side of the placenta near the insertion point of the umbilical cord. The biopsies consisted of the chorionic plate with the chorionic villi. Placental biopsies were washed in PBS 1X (137 mM NaCl, 2.7 mM KCl, 10 mM NaH 2PO 4, 1.8 mM KH 2PO 4, pH 7.4) to remove cord/maternal blood, dissected to remove conjunctive tissues and kept in RNALater (Qiagen, Valencia, CA) at - 80°C until nucleic acid extraction.

DNA and RNA were purified from placenta biopsies using the All Prep DNA/RNA/Protein Mini Kit (Qiagen). RNA quality was assessed with Agilent 2100 Bioanalyzer RNA Nano Chips (Agilent Technologies, Santa Clara, CA). On average, the RNA was considered of good quality (mean RNA integrity number 8.00 ± 0.70).

DNA methylation analysis at the LPL gene locus Based on a first epigenome-wide DNA methylation association study (EWAS) (Illumina’s HumanMethylation450 BeadChips (Illumina, Inc., San Diego)) conducted with 30 placenta samples of mother diagnosed with GDM and 14 from controls 23 , we identified three loci flanking the first exon of the LPL gene that showed DNA methylation variability and potential differences between groups. These three CpGs were retained for DNA methylation analyses in the current study (total n=126). Cytosine methylation was quantified using sodium bisulfite (NaBis) pyrosequencing (Pyromark Q24, Qiagen-Biotage) 24 . Combined with the NaBis DNA treatment, pyrosequencing is a quantitative real-time sequencing technology that allows measuring DNA methylation levels (%) for each cytosine of the covered region. NaBis treatment of DNA (EpiTect Bisulfite Kit, Qiagen) specifically converts unmethylated cytosine into uracil, while the methylated cytosines are protected from

126 this transition. Once treated, NaBis-DNA is amplified (Pyromark PCR kit, Qiagen) and pyrosequenced. PCR and sequencing primers for analysis of the LPL CpGs were designed with Pyromark Assay Design (version 2.0.1.15; Qiagen) to cover the three CpGs found to be differentially methylated from our ongoing EWAS of GDM cases-controls (cg16125291, cg08918749 and cg16420199). The designed primers, after bisulfite conversion of DNA, were as follow: LPLCpG1F: 5’-AAGTATAAGTTGGGAYGTAATGTGTG-3’, LPLCpG1R: 5’-CCAAAAAAAAAAAATTTAACTATTAAATTAC-3’ (177 bp), and LPLCpG1seq: 5’-GTGTGTTTTTTTATTTTTATATTGA-3’; LPLCpG2F: 5’-GGAGGGGTTTTGGAATGAAAG-3’, LPLCpG2R: 5’ TTCCCCAAAAAAAACCACAATCRACCC-3’(113 bp), and LPLCpG2seq : 5’-GGTTTTGGAATGAAAGG-3’ and; LPLCpG3F: 5’-GTTTTGGGGGTTGAGGTT-3’, LPLCpG3R: 5’-AATTAAACAAACTACCTCCATTAC-3’ (202 bp) , and LPLCpG3seq: 5’-CTAAAACATTCTCATTTAAC-3’.

LPL expression analysis cDNA was generated from total RNA using a random primer hexamer provided with the High Capacity cDNA Archive Kit from Applied Biosystems (Foster City, CA). Equal amounts of cDNA were run in duplicate and amplified in a 20µL reaction containing 10µL of Universal PCR Master Mix (Applied Biosystems). Primers and Taqman probes were obtained from Applied Biosystems ( LPL : Hs00173425_m1; Applied Biosystems). The YWHAZ housekeeping gene (endogenous control; YWHAZ : Hs00237047_m1) was amplified in parallel. LPL and YWHAZ amplifications were performed using an Applied Biosystems 7500 Real Time PCR System, as recommended by the manufacturer (Applied Biosystems). The expression of LPL gene was normalized to the expression of the YWHAZ reference gene. The YWHAZ gene has been shown to be suitable for gene expression normalization in placenta 25-27 . Placental LPL expression was compared between NGT and DG women using the 2 -ΔΔ Ct method 28 and YWHAZ /LPL Ct ratio were used for correlation analysis.

127

Statistical analyses DNA methylation levels of CpGs at the LPL gene locus and maternal and newborn characteristics were compared between groups of women with or without GDM using the unpaired Student t-Test or Pearson’s chi-squared test for categorical variable (history of GDM). Kolmogorov-Smirnov test was applied to verify data distribution. The following variables were not normally distributed and were thus log transformed: maternal fasting insulin, LDL-c at first trimester and TG at each trimesters as well as cord blood TG, HDL-c and LDL-c. Pearson’s correlation coefficient was used to assess the relationship between LPL DNA methylation and dependent variables (mRNA expression, maternal metabolic data, birth and placental weight and cord blood lipid profile). The statistical models were adjusted for the following confounders when applicable: age and BMI of the mother at first trimester of pregnancy, history of gestational diabetes, gestational age at delivery, method of childbirth (vaginal vs. Caesarean section), newborn’s sex and birth weight. The results remained unchanged after adjusting for parity. Furthermore, as maternal TG concentrations were significantly correlated with maternal HDL-c and 2-hour post-OGTT glucose concentrations, the statistical models were also adjusted for TG when applicable.

Stepwise multivariate linear regression was used to identify predictors of the variance of placental LPL DNA methylation levels. The input-independent variables were: maternal characteristics (age, BMI and TG at first trimester of pregnancy, glucose 2h post-OGTT and HDL-c at second trimester of pregnancy, HDL-C at third trimester of pregnancy, history of gestational diabetes), gestational age at delivery and method of childbirth. All the variables with p<0.05 were retained in the regression model . Results with p-values ≤0.05 (two-sided) were considered statistically significant. All analyses were performed with SPSS version 20.

128

RESULTS Characteristics of mothers according to their glucose tolerance status as well as newborns’ gestational age and birth weight are shown in Table 4.1. At first trimester of pregnancy, women were on average 29 years old, slightly overweight and had normal fasting glucose concentrations and lipid profile. Of the 126 women recruited, 27 had GDM, whereas 99 were normoglycemic (NGT). Among the women with GDM, 16 were treated with a diet only whereas 11 received a diet and insulin treatment. Overall, blood glucose 2-hour post-OGTT covered a wide range of values (from 3.80 to 10.80 mmol/L). Mothers with GDM had a lower gestational weight gain.

Average birth weight was within the normal weight range in both NGT and GDM groups. Nevertheless, according to Olsen et al .29 intrauterine growth curves, two babies were found to be small for gestational age (SGA) whereas five babies were large for gestational age (LGA). Among these seven babies, one LGA was born to GDM mothers. Interestingly, newborn exposed to GDM had significantly higher levels of cord blood C-peptide, hence suggesting that they had been exposed to higher glucose concentrations.

DNA methylation analysis of the placental LPL gene Placental DNA methylation was measured at 3 CpGs located within the LPL gene locus first identified using an EWAS strategy (Figure 4.1). The first CpG ( LPL -CpG1) was located in its proximal promoter region, 46 base pairs (bp) upstream from the first exon (Figure 4.1). The two other CpGs, CpG2 and CpG3, were located 405 and 925 bp downstream from the first exon, within the LPL intron 1 CpG island. DNA methylation level at LPL -CpG1 locus was not found to be correlated with the methylation levels at CpG2 and CpG3 (r<0.08). Nevertheless, LPL DNA methylation levels at CpG2 and CpG3 sites were found partially correlated with each other (r=0.32; p<0.001).

129

Table 4.1- Characteristics of women and newborn according to glucose tolerance status GDM NGT (n=27) (n=99) Women History of GDM 9 (33.3%) 4 (4.0%) ** Parity 0 9 (33.3%) 54 (54.5%) † 1 14 (51.9%) 28 (28.3%) † 2 4 (14.8%) 17 (17.2%) †

Mean ± SD Min-Max Mean ± SD Min-Max 1st trimester of pregnancy Age (years) 29.1 ± 3.6 20-36 28.8 ± 3.9 21-39 BMI (kg/m 2) 25.7 ± 3.9 19.6-35.4 24.6 ± 4.7 16.6-39.7 Fasting glucose (mmol/L) 4.48 ± 0.44 3.60-5.30 4.41 ± 0.34 3.80-5.20 Fasting insulin (mU/L) a 5.69 ± 4.33 1.70-16.70 5.10 ± 3.67 1.00-17.60 Triglycerides (mmol/L) a 1.16 ± 0.51 0.60-2.70 1.00 ± 0.45 c 0.40-2.70 Total cholesterol (mmol/L) 4.55 ± 0.60 3.10-6.00 4.67 ± 0.79 3.10-7.20 HDL-c (mmol/L) 1.60 ± 0.31 1.19-2.31 1.56 ± 0.32 0.81-2.42 LDL-c (mmol/L) a 2.31± 0.52 1.20-3.30 2.46 ± 0.69 1.30-5.10

2nd trimester of pregnancy Fasting glucose (mmol/L) 4.52 ± 0.41 3.70-5.60 4.28 ± 0.39 ** 3.60-5.70 Fasting insulin (mmol/L) a 9.19 ± 6.13 2.60-27.60 7.03 ± 5.30 † 1.40-38.90 2-h post-OGTT glucose (mmol/L) 8.40 ± 0.61 7.80-10.80 6.22 ± 0.81 ** 3.80-7.70 HOMA-IR a 1.86 ± 1.35 0.43-5.89 1.33 ± 1.04 * 0.25-7.09 Triglycerides (mmol/L) a 1.88 ± 0.72 0.90-3.70 1.72 ± 0.64 1.00-4.60 Total cholesterol (mmol/L) 5.90 ± 0.75 4.70-7.70 6.26 ± 1.12 4.10-10.20 HDL-c (mmol/L) 1.75 ± 0.29 1.36-2.44 1.80 ± 0.41 0.96-2.74 LDL-c (mmol/L) 3.24 ± 0.76 1.80-4.50 3.62 ± 1.00 1.80-7.00

130

3rd trimester of pregnancy Fasting glucose (mmol/L) a 4.19 ± 0.44 3.20-5.00 4.29 ± 0.63 3.60-8.30 Fasting insulin (mmol/L) a 7.60 ± 5.22 2.00-24.70 9.86 ± 7.68 * 3.80-42.20 HOMA-IR a 1.44 ± 1.08 0.32-4.83 1.85 ± 1.73 † 0.73-9.75 Triglycerides (mmol/L) a 2.58 ± 0.97 1.50-6.10 2.62 ± 0.86 1.10-5.20 Total cholesterol (mmol/L) 6.63 ± 1.10 5.10-8.90 6.82 ± 1.28 4.10-10.80 HDL-c (mmol/L) 1.74 ± 0.27 1.25-2.24 1.73 ± 0.42 0.89-2.80 LDL-c (mmol/L) 3.61 ± 0.97 2.10-5.70 3.85 ± 1.13 1.70-7.40 Weight gain between 1 st and 3 rd trimester 13.8 ± 5.2 4.0-25.0 19.5 ± 6.8 ** 2.0-34.0 (% of initial weight)

Newborn Gestational age (weeks) 39.7 ± 1.2 37.4-41.6 39.4 ± 1.1 37.3-41.6 Birth weight (kg) 3.45 ± 0.45 2.6-4.6 3.45 ± 0.40 2.0-4.3 Triglycerides (mmol/L) a 0.43 ± 0.23 0.22-0.94 0.40 ± 0.23 0.23-1.82 Total cholesterol (mmol/L) 1.63 ± 0.29 1.20-2.25 1.69 ± 0.41 0.85-2.89 HDL-c (mmol/L) 0.61 ± 0.21 0.33-1.06 0.61 ± 0.20 0.26-1.27 LDL-c (mmol/L) 0.80 ± 0.19 0.53-1.14 0.87 ± 0.28 0.39-1.90 C-Peptide (pmol/L) 171.3 ± 86.0 14.8-338.0 125.3 ± 66.8 * 1.0-353.9 aGeometric mean (value obtained after log10 transformation of the variable); ** p ≤ 0.01 ;* p≤ 0.05; † p ≤ 0.10

131

Figure 4.1- Schematic representation of the LPL gene locus CpG island and localization of the 3 loci epigenotyped CpG1 is located within the LPL proximal promoter region whereas CpG2 and CpG3 are located downstream from the first exon within the LPL intron 1 CpG island. Transcription factor binding sites were identified using the UCSC Genome Browser (NM_131127)[1] software, accessed September 12, 2012.

Average DNA methylation at LPL gene locus was between 34.7 and 39.8% (Figure 4.1). Overall, LPL DNA methylation levels were lower in placenta exposed to GDM compared to those not exposed (Figure 4.2). DNA methylation differences remained unchanged for CpG2and CpG3 after adjusting the statistical models for age, BMI and TG at first trimester of pregnancy and history of gestational diabetes, gestational age at delivery and method of childbirth. Furthermore, DNA methylation differences between the GDM and NGT mothers remained unchanged at the 3 CpGs when the obese women (BMI>30 kg/m 2 (n=13)) were removed from the analysis or when the statistical models were adjusted for maternal weight gain between the first and third trimester of pregnancy. The largest DNA methylation difference between groups (9.3%) was found with CpG2 ( p=0.04) (Figure 4.2).

132

Figure 4.2- DNA methylation levels at placental LPL loci according to maternal glucose tolerance status Mean DNA methylation levels at placental LPL gene CpG1, CpG2 and CpG3 loci in mothers with gestational diabetes mellitus (GDM (n=27)) (black) and with normal glucose tolerance (NGT (n=99)) (white). Error bars represent the standard error of the mean (SEM) (n=126). Mean DNA methylation levels were compared with the Student t-Test and adjusted for confounding variables.

Correlations between LPL DNA methylation levels and maternal metabolic profile To further confirm the initial EWAS findings (that maternal hyperglycemia is negatively associated with LPL DNA methylation), the correlation between placental LPL DNA methylation and maternal glucose levels was tested. We observed that CpG1 and CpG3 DNA methylation levels were negatively correlated with maternal 2-h post-OGTT glucose concentrations (r=-0.26; p=0.003) (r=-0.18; p=0.05) (Table 4.2). The latter correlation was slightly affected by additional corrections for maternal TG levels at first trimester of pregnancy, gestational age at delivery and method of childbirth and did not remain significant (r=-0.14; p=0.13). Nevertheless, the correlation between LPL CpG1 DNA methylation levels and maternal 2-h post-OGTT glucose concentrations remained significant after consideration of all potential confounding variables (r=-0.22; p=0.02) and exclusion of the 13 obese

133 mothers. Finding a correlation between LPL DNA methylation and 2-h post-OGTT glucose concentrations thus confirms the initial association results.

As LPL is a key player in TG and lipoprotein metabolism, we also tested for correlations between placental DNA methylation at the LPL gene locus and maternal TG, HDL-C and LDL-C concentrations. We found that CpG3 methylation levels were negatively correlated with concentrations of maternal HDL-c at third trimester of pregnancy (r=-0.20; p=0.03). A trend for correlation was also observed between CpG3 DNA methylation levels and HDL-c at second trimester of pregnancy (r=-0.15; p=0.10) (Table 4.2). These correlations remained unchanged after adjusting for all the potential confounding variables or when obese women were excluded from the analysis. Maternal TG and LDL-c concentrations were not correlated with placental LPL DNA methylation.

Overall, stepwise multivariate linear regression analysis showed that maternal glucose concentrations (2-h post-OGTT) (ß=-0.236; p=0.01) and HDL-c levels (third 2 trimester of pregnancy) (ß=-0.182; p=0.05) could explain up to 7.0% ( R adj =0.070; p=0.006) of placental DNA methylation variance at LPL -CpG3 locus.

Correlations between LPL DNA methylation levels and offspring characteristics To further evaluate the impacts of LPL DNA methylation profile on materno-fetal transport we tested the association between LPL DNA methylation levels and offspring developmental characteristics and lipid profile. Methylation levels at the LPL -CpG2 locus in the placenta was found to be negatively correlated with cord blood HDL-c levels (r=-0.24; p=0.03), and TC/HDL-c ratio (r=0.22; p=0.04) and tended to be correlated with TG concentrations (r=0.19; p=0.08) after adjusting for newborn’s sex, gestational age and method of childbirth. The strength of these three correlations was increased after adjustment for birth weight (r=- 0.27; p=0.01; r=0.27; p=0.01 and r=0.25; p=0.02 for HDL-c, TC/HDL-c and TG respectively) and remained similar after correction for maternal BMI at first trimester of pregnancy, gestational weight gain and maternal metabolic variables throughout pregnancy.

134

Table 4.2- Pearson correlation coefficient between placental LPL DNA methylation and maternal metabolic profile 1st trimester of 2nd trimester of pregnancy 3rd trimester of pregnancy pregnancy

Triglycerides (mmol/L) 2-h post-OGTT glucose HDL-c (mmol/L) HDL-c (mmol/L) (n=126) (mmol/L) (n=126) (n=120) (n=120) I II I III I III I III CpG1 methylation (%) -0.16† -0.14 -0.26 ** -0.22* 0.03 -0.02 0.06 -0.01 CpG2 methylation (%) -0.14 -0.12 -0.12 -0.05 -0.04 -0.06 -0.12 -0.1 3 CpG3 methylation (%) -0.04 -0.03 -0.18 * -0.1 4 -0.15 † -0.1 7† -0.20 * -0.20 * mRNA levels (AU) 0.19 * 0.1 6† -0.17 † 0.10 -0.05 0.01 0.07 0.11 I- Adjusted values for age, BMI at first trimester and history of gestational diabetes II- Adjusted values for age, BMI at first trimester, maternal glucose 2-h post OGTT at second trimester, history of gestational diabetes, gestational age at delivery and method of childbirth. III- Adjusted values for age, BMI and TG at first trimester, history of gestational diabetes, gestational age at delivery and method of childbirth ** p ≤ 0.01 ;*p≤ 0.05; †p ≤ 0.10

135

Correlation between placental LPL DNA methylation and mRNA expression levels To assess the impacts of DNA methylation on placental LPL gene expression, LPL mRNA levels were quantified. Placental LPL mRNA levels, expressed as arbitrary units and normalized to YWHAZ mRNA levels, were found to be 1.6 fold higher in placenta of women with GDM (1.04±0.012 AU) compare to NGT (1.02±0.006 AU) ( p=0.04) according to the 2-ΔΔ Ct method 28 . We also found that LPL DNA methylation levels at CpG2 and CpG3, both located within the intronic CpG island, were negatively correlated with placental LPL gene expression (Figure 4.3). Nevertheless, DNA methylation at CpG1, located directly within the LPL gene promoter, was not correlated with LPL gene expression regulation (r=-0.08; p=0.38) (data not shown).

LPL mRNA levels were correlated with TG levels at first trimester of pregnancy (r=0.19; p=0.04) and tended to be associated with maternal glucose 2-h post- OGTT (r=0.17; p=0.06) (Table 4.2). These correlations were no longer statistically significant after adjustment for TG levels at first trimester of pregnancy and other potential confounding variables (r=0.16; p=0.09) and maternal 2-h post-OGTT glucose levels (r=0.10; p=0.18).

Figure 4.3- Pearson correlations between LPL gene CpG2 (A) and CpG3 (B) DNA methylation and mRNA levels in placenta (n=126)

136

DISCUSSION In the current study, we documented the epigenetic variability at LPL gene locus in placenta samples exposed or not to GDM. Previous studies have highlighted dysregulations in LPL expression and activity in the placenta of women with pregnancy complications such as obesity 30 , GDM 5 and IUGR 6, 31 . Nevertheless, this is the first study reporting associations between LPL DNA methylation levels and changes in maternal glucose and lipid profiles.

At first, we showed that CpG dinucleotides within LPL gene proximal promoter and intron 1 loci were significantly less methylated in the placenta of mothers with GDM in comparison to NGT mothers. Besides, a correlation was observed between maternal 2-h post- OGTT glucose concentration and LPL DNA methylation in both IGT and NGT. These observations suggest that the association between maternal glucose and changes in newborn’s epigenome holds even at concentrations within the normal range. Recent studies have also reported that a slight increase in maternal glucose, below the GDM or IGT diagnosis threshold, is associated with fetal overgrowth and excess adiposity in children 32, 33 . Therefore, changes within the normal range in maternal glucose concentrations appear to be important in the fetal lipid metabolism regulation. Our and other studies suggest that these effects of maternal hyperglycemia on the newborn might be caused by epigenetic variations 17, 18, 23, 34, 35 .

Interestingly, other maternal conditions such as circulating lipids have also been shown to be detrimental for fetal development and lipid metabolism, and this, independently of maternal hyperglycemia 36-38 . In the present study, we report that increased maternal HDL- c levels at third trimesters of pregnancy were associated with decreased cytosine methylation levels at LPL gene. HDL-C levels were found to be neither different between women with and without GDM nor correlated with maternal glucose levels at any trimester during pregnancy. This suggests that the association between LPL DNA methylation and maternal HDL-C levels is independent of the maternal GDM status. The exact role of the maternal metabolism in regulating the placental epigenome is still not well defined. Glucose concentrations have been associated with serum homocysteine levels in diabetic patient 39 and DNA methyltransferase activity in cultured hepatocytes 40 . Furthermore, persistent DNA

137 methylation at key metabolic genes was observed in Schwan cell culture following chronic exposure to glucose 41 . On the other hand, it was recently reported that circulating HDL particles carry microRNAs 42 . As microRNAs can alter DNA methyltransferase activity 43 , HDL-c regulation of DNA methylation is another likely mechanisms. However, additional investigations will need to be carried on to determine how maternal glucose and HDL-c can impair the placental epigenome. Besides, although unlikely, we cannot exclude that LPL - CpG3 DNA methylation levels on the fetal side of the placenta can be causal of maternal HDL-c concentration changes at third trimester.

We also observed higher LPL mRNA levels in placenta of mothers with GDM in comparison to those with NGT. Our results differ from Radaelli et al .5, which report decreased LPL mRNA expression in placenta of women with GDM. This apparent discrepancy may be due to different methods (microarray vs. RT-PCR) and placental tissues used to quantify LPL expression, to the GDM diagnosis criteria and/or because women from Radaelli’s study were not followed up during pregnancy or in too low numbers (GDM: n=9 and NGT: n=5). Moreover, placental LPL mRNA expression was correlated with LPL DNA methylation levels at the two CpG sites within the CpG island (CpG2 and CpG3), suggesting that the epivariations observed may impair LPL gene transcription. Interestingly, consensus sequences for estrogen response element (ERE) and PPAR γ binding sites were identified near the LPL CpG2 locus (Figure 4.1). Transcriptional regulation of LPL expression by estrogen, and PPAR γ has been previously reported in adipose tissue, skeletal muscle and heart 44, 45 . Additionally, ERE in intron 1 of LPL gene has been shown to regulate LPL expression in mice heart 46 . Therefore, epivariations at or near CpG2 could potentially regulate LPL mRNA expression through DNA methylation-related impairment of DNA binding activity of these transcriptional factors. Although LPL regulation is very complex; it includes tissue-specific transcriptional and posttranscriptional regulation points and posttranslational modifications, we are the first to report that placental LPL mRNA expression (up to 26% of the variance) can be explained by DNA methylation changes within its first intron CpG island. The importance of DNA methylation changes within the LPL gene proximal promoter region is unclear in the placenta but may be particularly important in other tissues. We have recently reported a significant negative correlation between LPL proximal

138 promoter (including CpG1) DNA methylation levels and mRNA levels in visceral adipose tissue (VAT) 47 . Interestingly, LPL promoter DNA methylation levels in VAT were also found to be associated with HDL-c levels 47 . This is suggesting that LPL gene expression regulation by DNA methylation is tissue-specific and could potentially regulate lipid metabolism. Therefore, placental LPL epipolymorphisms could also be reflected in other tissues such as adipose tissue and thus more largely contribute to the metabolic health programming of the newborn. Further studies are needed to determine whether the placental LPL epigenetic variations are reflected in other tissues of the newborn.

In the placenta, we found that LPL -CpG2 DNA methylation levels are associated with cord blood HDL-c and TG levels. This suggests that LPL DNA methylation might be involved in the regulation of the placental lipid transfer to the fetus. Moreover, LPL -CpG2 DNA methylation is associated with GDM status and cord blood atherogenic lipid profile. This may contribute to explain why newborn exposed in utero to GDM are at higher risk for cardiovascular diseases later in life 48, 49 . Nevertheless, the cord blood lipid profile is not different between NGT and GDM and LPL-CpG2 DNA methylation levels only explained a small proportion of the newborn lipid profile, suggesting that other regulatory mechanisms involved in materno-fetal lipid transfer (e.g. LIPG , ATP-binding cassette transporter A1 and G1 ( ABCA1 and ABCG1) ) may compensate for the loss of function of LPL. This is supported by the correlation between ABCA1 DNA methylation levels and both maternal metabolic and cord blood lipid profiles recently reported by our group 35 .

DNA methylation levels at the LPL-CpG3 locus, 520 bp downstream CpG2, were alternatively correlated with maternal HDL-c, suggesting that LPL DNA methylation is tightly controlled in a site-specific manner. Individual site-specific DNA methylation was previously observed by Weaver et al .50 who have found that DNA methylation at CpGs localized 6 bp apart (hundreds of pair bases in the current study) within the proximal promoter region of the glucocorticoid receptor gene in the murine hippocampus have independent functions. Nevertheless, the mechanisms involved in the regulation of site- specific methylation are still unknown and will need to be addressed in future studies.

139

The longitudinal follow-up of women from first trimester of pregnancy to delivery is among the strength of this study. It allowed us to accurately identify mothers developing IGT during pregnancy and avoid their misclassification with women who were diabetic prepregnancy. Moreover, the study design, along with our fairly large sample size, have allowed us to consider potential confounding factors in our statistical models. Nevertheless, as placenta samples were analyzed at birth, the causality between LPL epigenetic variations and maternal and cord blood metabolic variables need to be confirmed along with the functional impact of LPL DNA methylation levels on LPL protein levels and activity. LPL DNA methylation levels will also need to be assessed in these children in a few years to determine whether the epipolymorphisms observed in the placenta at birth are still associated with blood lipid profile throughout infancy and childhood.

In conclusion, we have shown that placental LPL gene DNA methylation profile is associated with GDM and maternal HDL-c levels in a site-specific manner. The epivariations observed in placental LPL intronic CpG island were found to be correlated with placental LPL mRNA levels and with the cord blood lipid profile. Consequently, we hypothesized that variations in DNA methylation levels at specific LPL CpG locus might disturb the placental lipid transfer and newborn lipid metabolism thereby potentially contributing to the later onset of obesity and associated metabolic disorder in child or adulthood. This study also provides new insights on the epigenetics regulation of fetal metabolic programming and suggests that other genes may respond to variations in maternal metabolic profile such as maternal glucose and lipid profiles.

140

ACKNOWLEDGMENTS The authors acknowledge the contribution of Sébastien Claveau, MSc; Nadia Mior; Jeanine Landry, RN and Chantal Aubut, RN from ECOGENE-21 Clinical Research Center for their dedicated work in this study. The authors also express their gratitude to Céline Bélanger, Chicoutimi Hospital, for her thoughtful language revision of the manuscript. AAH is a recipient of a scholarship from FRQ-S. L.B. and MF.H. are junior research scholars from the Fonds de la recherche en santé du Québec (FRSQ). MF.H. is also supported by a Canadian Diabetes Association clinical scientist award. L.B., MF.H., P.P. and JP.B. are members of the FRSQ-funded Centre de recherche clinique Étienne-Le Bel (affiliated to Centre Hospitalier de l’Université de Sherbrooke).

CONFLICTS OF INTEREST None

ETHICAL STANDARDS The authors assert that all procedures contributing to this work comply with the ethical standards of the relevant national guidelines on human experimentation and the Helsinki Declaration of 1975, as revised in 2008, and has been approved by the Chicoutimi Hospital Ethics Committee.

141

REFERENCES

1. Woollett LA. Fetal lipid metabolism. Frontiers in bioscience : a journal and virtual library 2001; 6:D536-45.

2. Gil-Sanchez A, Koletzko B, Larque E. Current understanding of placental fatty acid transport. Current opinion in clinical nutrition and metabolic care 2012; 15:265-72.

3. Larque E, Demmelmair H, Gil-Sanchez A, Prieto-Sanchez MT, Blanco JE, Pagan A, et al . Placental transfer of fatty acids and fetal implications. The American journal of clinical nutrition 2011; 94:1908S-13S.

4. McCoy MG, Sun GS, Marchadier D, Maugeais C, Glick JM, Rader DJ. Characterization of the lipolytic activity of endothelial lipase. Journal of lipid research 2002; 43:921-9.

5. Radaelli T, Lepercq J, Varastehpour A, Basu S, Catalano PM, Hauguel-De Mouzon S. Differential regulation of genes for fetoplacental lipid pathways in pregnancy with gestational and type 1 diabetes mellitus. American journal of obstetrics and gynecology 2009; 201:209 e1- e10.

6. Tabano S, Alvino G, Antonazzo P, Grati FR, Miozzo M, Cetin I. Placental LPL gene expression is increased in severe intrauterine growth-restricted pregnancies. Pediatric research 2006; 59:250-3.

7. Gauster M, Hiden U, Blaschitz A, Frank S, Lang U, Alvino G, et al . Dysregulation of placental endothelial lipase and lipoprotein lipase in intrauterine growth-restricted pregnancies. The Journal of clinical endocrinology and metabolism 2007; 92:2256-63.

8. Magnusson-Olsson AL, Hamark B, Ericsson A, Wennergren M, Jansson T, Powell TL. Gestational and hormonal regulation of human placental lipoprotein lipase. Journal of lipid research 2006; 47:2551-61.

9. Chernausek SD. Update: consequences of abnormal fetal growth. The Journal of clinical endocrinology and metabolism 2012; 97:689-95.

142

10. Barker DJ. Adult consequences of fetal growth restriction. Clinical obstetrics and gynecology 2006; 49:270-83.

11. Bestor TH. The DNA methyltransferases of mammals. Human molecular genetics 2000; 9:2395-402.

12. Bird AP, Wolffe AP. Methylation-induced repression--belts, braces, and chromatin. Cell 1999; 99:451-4.

13. Tobi EW, Lumey LH, Talens RP, Kremer D, Putter H, Stein AD, et al . DNA methylation differences after exposure to prenatal famine are common and timing- and sex-specific. Human molecular genetics 2009; 18:4046-53.

14. Heijmans BT, Tobi EW, Lumey LH, Slagboom PE. The epigenome: archive of the prenatal environment. Epigenetics : official journal of the DNA Methylation Society 2009; 4:526-31.

15. Yuen RK, Avila L, Penaherrera MS, von Dadelszen P, Lefebvre L, Kobor MS, et al . Human placental-specific epipolymorphism and its association with adverse pregnancy outcomes. PloS one 2009; 4:e7389.

16. Turan N, Ghalwash MF, Katari S, Coutifaris C, Obradovic Z, Sapienza C. DNA methylation differences at growth related genes correlate with birth weight: a molecular signature linked to developmental origins of adult disease? BMC medical genomics 2012; 5:10.

17. Bouchard L, Thibault S, Guay SP, Santure M, Monpetit A, St-Pierre J, et al . Leptin gene epigenetic adaptation to impaired glucose metabolism during pregnancy. Diabetes care 2010; 33:2436-41.

18. Bouchard L, Hivert MF, Guay SP, St-Pierre J, Perron P, Brisson D. Placental adiponectin gene DNA methylation levels are associated with mothers' blood glucose concentration. Diabetes 2012; 61:1272-80.

143

19. Lohman TG RAaMR. Anthropometric Standardization Reference Manual. Champaign, IL: Human Kinetics Books, 1988.

20. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low- density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clinical chemistry 1972; 18:499-502.

21. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 1985; 28:412-9.

22. Heding LG. Radioimmunological determination of human C-peptide in serum. Diabetologia 1975; 11:541-8.

23. Ruchat SM, Houde AA, Voisin G, St-Pierre J, Perron P, Baillargeon JP, et al . Gestational diabetes mellitus epigenetically affects genes predominantly involved in metabolic diseases. Epigenetics : official journal of the DNA Methylation Society 2013; 8.

24. Dejeux E, El abdalaoui H, Gut IG, Tost J. Identification and quantification of differentially methylated loci by the pyrosequencing technology. Methods Mol Biol 2009; 507:189-205.

25. Meller M, Vadachkoria S, Luthy DA, Williams MA. Evaluation of housekeeping genes in placental comparative expression studies. Placenta 2005; 26:601-7.

26. Murthi P, Fitzpatrick E, Borg AJ, Donath S, Brennecke SP, Kalionis B. GAPDH, 18S rRNA and YWHAZ are suitable endogenous reference genes for relative gene expression studies in placental tissues from human idiopathic fetal growth restriction. Placenta 2008; 29:798-801.

27. Drewlo S, Levytska K, Kingdom J. Revisiting the housekeeping genes of human placental development and insufficiency syndromes. Placenta 2012; 33:952-4.

144

28. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25:402-8.

29. Olsen IE, Groveman SA, Lawson ML, Clark RH, Zemel BS. New intrauterine growth curves based on United States data. Pediatrics 2010; 125:e214-24.

30. Dube E, Gravel A, Martin C, Desparois G, Moussa I, Ethier-Chiasson M, et al . Modulation of fatty acid transport and metabolism by maternal obesity in the human full-term placenta. Biology of reproduction 2012; 87:14, 1-1.

31. Magnusson AL, Waterman IJ, Wennergren M, Jansson T, Powell TL. Triglyceride hydrolase activities and expression of fatty acid binding proteins in the human placenta in pregnancies complicated by intrauterine growth restriction and diabetes. The Journal of clinical endocrinology and metabolism 2004; 89:4607-14.

32. Walsh JM, Mahony R, Byrne J, Foley M, McAuliffe FM. The association of maternal and fetal glucose homeostasis with fetal adiposity and birthweight. European journal of obstetrics, gynecology, and reproductive biology 2011; 159:338-41.

33. Deierlein AL, Siega-Riz AM, Chantala K, Herring AH. The association between maternal glucose concentration and child BMI at age 3 years. Diabetes care 2011; 34:480-4.

34. El Hajj N, Pliushch G, Schneider E, Dittrich M, Muller T, Korenkov M, et al . Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus. Diabetes 2013; 62:1320-8.

35. Houde AA, Guay SP, Desgagne V, Hivert MF, Baillargeon JP, St-Pierre J, et al . Adaptations of placental and cord blood ABCA1 DNA methylation profile to maternal metabolic status. Epigenetics : official journal of the DNA Methylation Society 2013; 8.

36. Kitajima M, Oka S, Yasuhi I, Fukuda M, Rii Y, Ishimaru T. Maternal serum triglyceride at 24--32 weeks' gestation and newborn weight in nondiabetic women with positive diabetic screens. Obstetrics and gynecology 2001; 97:776-80.

145

37. Di Cianni G, Miccoli R, Volpe L, Lencioni C, Ghio A, Giovannitti MG, et al . Maternal triglyceride levels and newborn weight in pregnant women with normal glucose tolerance. Diabetic medicine : a journal of the British Diabetic Association 2005; 22:21-5.

38. Zeljkovic A, Vekic J, Spasic S, Jelic-Ivanovic Z, Spasojevic-Kalimanovska V, Gojkovic T, et al . Changes in LDL and HDL Subclasses in Normal Pregnancy and Associations with Birth Weight, Birth Length and Head Circumference. Maternal and child health journal 2012.

39. Mazza A, Bossone E, Mazza F, Distante A. Reduced serum homocysteine levels in type 2 diabetes. Nutrition, metabolism, and cardiovascular diseases : NMCD 2005; 15:118-24.

40. Chiang EP, Wang YC, Chen WW, Tang FY. Effects of insulin and glucose on cellular metabolic fluxes in homocysteine transsulfuration, remethylation, S- adenosylmethionine synthesis, and global deoxyribonucleic acid methylation. The Journal of clinical endocrinology and metabolism 2009; 94:1017-25.

41. Kim ES, Isoda F, Kurland I, Mobbs CV. Glucose-Induced Metabolic Memory in Schwann Cells: Prevention by PPAR Agonists. Endocrinology 2013.

42. Vickers KC, Palmisano BT, Shoucri BM, Shamburek RD, Remaley AT. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nature cell biology 2011; 13:423-33.

43. Denis H, Ndlovu MN, Fuks F. Regulation of mammalian DNA methyltransferases: a route to new mechanisms. EMBO reports 2011; 12:647-56.

44. Schoonjans K, Peinado-Onsurbe J, Lefebvre AM, Heyman RA, Briggs M, Deeb S, et al . PPARalpha and PPARgamma activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. The EMBO journal 1996; 15:5336-48.

146

45. Wang H, Eckel RH. Lipoprotein lipase: from gene to obesity. American journal of physiology Endocrinology and metabolism 2009; 297:E271-88.

46. Liu D, Deschamps A, Korach KS, Murphy E. Estrogen-enhanced gene expression of lipoprotein lipase in heart is antagonized by progesterone. Endocrinology 2008; 149:711-6.

47. Guay SP, Brisson D, Lamarche B, Marceau P, Vohl MC, Gaudet D, et al . DNA methylation variations at CETP and LPL gene promoter loci: New molecular biomarkers associated with blood lipid profile variability. Atherosclerosis 2013.

48. Ma RC, Chan JC, Tam WH, Hanson MA, Gluckman PD. Gestational Diabetes, Maternal Obesity, and the NCD Burden. Clinical obstetrics and gynecology 2013; 56:633-41

49. Marco LJ, McCloskey K, Vuillermin PJ, Burgner D, Said J, Ponsonby AL. Cardiovascular disease risk in the offspring of diabetic women: the impact of the intrauterine environment. Experimental diabetes research 2012; 2012:565160.

50. Weaver IC, Cervoni N, Champagne FA, D'Alessio AC, Sharma S, Seckl JR, et al . Epigenetic programming by maternal behavior. Nature neuroscience 2004; 7:847-54.

51. Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, et al . The human genome browser at UCSC. Genome research 2002; 12:996-1006.

CHAPITRE 5 - ARTICLE 4

Adaptations of placental and cord blood ABCA1 DNA methylation profile to maternal metabolic status

Auteurs de l’article : Andrée-Anne Houde, Simon-Pierre Guay, Véronique Desgagné, Marie-France Hivert, Jean-Patrice Baillargeon, Julie St-Pierre, Patrice Perron, Daniel Gaudet, Diane Brisson et Luigi Bouchard.

Statut de l’article : Publié dans la revue Epigenetics

Houde A.A. *, Guay S.P. *, Desgagné V., Hivert M.F., Baillargeon J.P., St-Pierre J., Perron P., Gaudet D., Brisson D. et Bouchard L. 2013. Adaptations of placental and cord blood ABCA1 DNA methylation profile to maternal metabolic status . Epigenetics . 8(12):1289-302. *Ces auteurs ont également contribué à cet article.

Avant-propos : Cet article est le deuxième pour lequel nous avons utilisé l’approche par gène candidat. Dans cet article nous nous sommes intéressés au gène ABCA1 , impliqué dans le transport du cholestérol et pour lequel les niveaux de méthylation dans le sang avaient été associés aux maladies cardiovasculaires. Nous avons étudié les niveaux de méthylation d’ ABCA1 dans le placenta, le sang de la mère et le sang de cordon et nous avons observé des associations entre le profil métabolique de la mère et la méthylation d’ ABCA1 dans le placenta et le sang de cordon. Je suis première co-auteure de cet article avec Simon-Pierre Guay. J’ai participé au design de l’étude, aux analyses des niveaux de méthylation d’ ABCA1 , aux analyses statistiques, à l’interprétation des données ainsi qu’à la rédaction du manuscrit.

148

RÉSUMÉ : L’exposition à un environnement in utero défavorable a été associée à des modifications épigénétiques chez le nouveau-né ainsi qu’à une augmentation de la susceptibilité aux maladies cardiovasculaires (MCV). Des associations ont précédemment été rapportées entre la méthylation du gène de l’ ATP-binding casette transporte A1 (ABCA1 ) et l’incidence des MCV. Cependant, il n’a pas encore été déterminé si celle-ci est sensible aux perturbations environnementales maternelles lors du développement fœtal. Cette étude a été menée afin de déterminer les associations entre le profil métabolique maternel et la méthylation d’ ABCA1 dans le placenta et le sang de cordon. Des échantillons de placenta et de sang de cordon ont été prélevés lors de l’accouchement de 100 femmes incluant 26 femmes diagnostiquées avec une intolérance au glucose suite à un test d’HGPO (75 g de glucose) entre la 24 e et 28 e semaine de la grossesse. La méthylation d’ ABCA1 et ses niveaux relatifs d’expression ont été quantifiés par pyroséquençage de l’ADN traité au bisulfite de sodium et par PCR quantitatif en temps réel respectivement. Nous avons rapporté que les niveaux de méthylation du gène ABCA1 , du côté maternel du placenta, sont corrélés avec les concentrations maternelles de cholestérol-HDL (c-HDL) (r < -0,21; P < 0,04) et de glucose 2h post-HGPO (r = 0,25; P < 0,02). Du côté fœtal du placenta, la variabilité de méthylation d’ ABCA1 est associée aux niveaux de triglycérides du sang de cordon (r = -0,28; P = 0,01). La variabilité de méthylation d’ ABCA1 des deux côté du placenta est aussi corrélée avec les niveaux de transcrits d’ ABCA1 (r < -0,35; P = 0,05). Contrairement au placenta, la méthylation d’ ABCA1 du sang de cordon est négativement corrélée avec la glycémie maternelle 2h post-HGPO (r = -0,26; P < 0,02). En conclusion, les épivariations observées dans le placenta et le sang de cordon pourraient vraisemblablement contribuées à l’optimisation du transfert materno-fœtal du cholestérol. Ces adaptations épigénétiques pourraient également prédisposer le nouveau-né aux dyslipidémies et aux MCV.

149

ADAPTATIONS OF PLACENTAL AND CORD BLOOD ABCA1 DNA METHYLATION PROFILE TO MATERNAL METABOLIC STATUS

Houde AA § 1,2 ; Guay SP § 1,2 ; Desgagné V 1,2 ; Hivert MF 3,4 ; Baillargeon JP 3; St-Pierre J 2,5,6 ; Perron P 2,3 ; Gaudet D 2,7 , Brisson D 2,7 ; Bouchard L 1,2 .

1. Department of Biochemistry, Université de Sherbrooke, Sherbrooke, QC, Canada; 2. ECOGENE-21 and Lipid Clinic, Chicoutimi Hospital, Saguenay, QC, Canada; 3. Department of Medicine, Université de Sherbrooke, Sherbrooke, QC, Canada; 4. General Medicine Division, Massachusetts General Hospital, Boston, MA, USA; 5. Department of Pediatrics, Chicoutimi Hospital, Saguenay, Qc, Canada and 6. Department of Health Sciences, Université du Québec à Chicoutimi, Saguenay, Quebec, Canada; and 7. Department of Medicine, Université de Montréal, Montréal, QC, Canada. § These authors contributed equally to this work.

150

ABSTRACT In utero environmental perturbations have been associated with epigenetic changes in the offspring and a lifelong susceptibility to cardiovascular diseases (CVD). DNA methylation at the ATP-binding cassette transporter A1 (ABCA1 ) gene was previously associated with CVD, but whether these epigenetic marks respond to changes in the maternal environment is unknown. This study was undertaken to assess the associations between the maternal metabolic profile and ABCA1 DNA methylation levels in placenta and cord blood. Placenta and cord blood samples were obtained at delivery from 100 women including 26 with impaired glucose tolerance (IGT) diagnosed following a 75g-oral glucose tolerance test (OGTT) between week 24 and 28 of gestation. ABCA1 DNA methylation and mRNA levels were measured using bisulfite pyrosequencing and quantitative real-time PCR respectively. We report that ABCA1 DNA methylation levels on the maternal side of the placenta are correlated with maternal HDL-C levels (r<-0.21; p<0.04) and glucose levels 2h post-OGTT (r=0.25; p=0.02). On the fetal side of the placenta, ABCA1 DNA methylation levels are associated with cord blood triglyceride levels (r=-0.28; p=0.01). ABCA1 DNA methylation variability on both sides of the placenta are also associated with ABCA1 mRNA levels (r<- 0.35; p=0.05). As opposed to placenta, cord blood DNA methylation levels are negatively correlated with maternal glucose 2h post-OGTT (r=-0.26; p=0.02). In conclusion, the epivariations observed in placenta and cord blood likely contribute to an optimal materno- fetal cholesterol transfer. These in utero epigenetics adaptations may also potentially trigger the long-term susceptibility of the newborn to dyslipidemia and CVD.

Key Word List: Gestational diabetes, high-density lipoprotein cholesterol, fetal programming, lipid metabolism, epigenetics

151

INTRODUCTION Pregnancy is associated with a number of metabolic adaptations that support a normal fetal growth. These adaptations include maternal weight gain, changes in blood lipid profile and insulin resistance.1 If the pancreatic β-cells cannot face the increased demand of superimposed gestational insulin resistance, pregnant women develop gestational diabetes mellitus (GDM). GDM, defined as impaired glucose tolerance with first recognition during pregnancy, is the most frequent metabolic perturbation observed in pregnant women with a prevalence ranging from 2 to 20% according to the population studied and diagnostic criteria used.2 Fetal exposure to GDM is associated with a long-term increased risk for obesity, type 2 diabetes (T2D) and cardiovascular disease (CVD).3-5 This concept of fetal programming of adult metabolic diseases (originating from Barker’s hypothesis 6) is well supported by several studies and thus now widely accepted. However, the molecular mechanisms involved have not been clearly defined so far. Nevertheless, recent studies have suggested that epigenetic modifications might explain, to some extent, the link between suboptimal fetal conditions and long-term risks for cardio-metabolic disorders in the newborn.7

Epigenetics refers to DNA modifications independent of the primary sequence that are involved in gene transcription regulation.8 DNA methylation is the most stable and studied epigenetic modification and is generally associated with a repression of gene expression.9 The addition of a methyl group is catalyzed by the DNA methyltransferases and occurs at position 5’ of the pyrimidine ring of the cytosine upstream of a guanine (CpG dinucleotide).10 Cytosine methylation in a CpG context has been shown to be associated to environmental stimuli including the hyperglycemic intra-uterine environment. 11-13 This is now supported by an in vitro study showing that a chronic exposure to hyperglycemia induces persistent DNA methylation and gene expression profile alterations of key metabolic genes.14

Epigenetic adaptations of the placenta and newborn appear to be important for the regulation of placental functions, fetal growth and development. They have been associated with risk factors (birth weight, child body mass index (BMI) and adiposity) known to trigger an increased long-term susceptibility to metabolic disorders.15-19 The newborn epigenetic

152 signature acquired in the womb also appears to be persistent throughout adult life in animal models and in human epidemiological studies.20-22

Previously, a study carried on by Tobi et al .22 has reported that DNA methylation levels at the ATP-binding cassette transporter A1 (ABCA1) gene locus are higher in leukocytes of adults exposed prenatally to the ending World War 2 Dutch famine, suggesting that the ABCA1 DNA methylation profile might be sensitive to in utero adverse environmental exposure. ABCA1 transfers cholesterol from cells to apolipoproteins A-1 (apo- A1) thus contributing to the formation of nascent high-density lipoproteins (HDL).23 In human placenta, ABCA1 is further along highly expressed in endothelial cells of fetal capillaries and in the syncytiotrophoblast cells on the maternal side of the placenta where it regulates materno-fetal cholesterol transport.24, 25 ABCA1 is thus a crucial regulator of the lipoprotein metabolism. Recently, our group reported that ABCA1 epipolymorphisms were associated with HDL particle profile as well as history of coronary artery disease in adults with familial hypercholesterolemia.26 Hence, ABCA1 DNA methylation profile appears to be sensitive to in utero environment and might have long-term functional impact on lipid profile and the onset of CVD. We have thus hypothesized that the newborn ABCA1 DNA methylation profile could be disturbed by the maternal metabolic status. Accordingly, the main objective of the current study was to determine the associations between the maternal glucose status and lipid profile and ABCA1 DNA methylation profile in placenta and cord blood.

153

RESULTS Table 5.1 shows the characteristics of mothers and their newborns according to the maternal glucose tolerance status. Women were on average 29 years old, were slightly overweight and had normal fasting glucose concentrations and lipid profile. Of the 100 women recruited, 26 had IGT, whereas 74 were normoglycemic (NGT). Among the women with IGT, 13 were recommended to follow a diet and 12 were treated with insulin in addition to the diet (treatment was unknown for one woman). Parity was higher in women with IGT compared to NGT women ( p=0.02). Women with IGT gained less weight on average than NGT women during pregnancy. ABCA1 DNA methylation levels were found to be significantly lower in the blood of IGT mothers than with NGT mothers ( p=0.04). Cord blood ABCA1 DNA methylation levels also tended to be lower in newborn exposed to IGT ( p=0.06) (Table 5.1). Moreover, newborns from the IGT and NGT groups had similar gestational age, birth weight and cord blood lipid profile. Interestingly, child born to mother with IGT had significantly higher cord blood c-peptide levels than those born to NGT.

ABCA1 genomic context and DNA methylation analyses Overall, 22 CpG dinucleotides within four regions of the ABCA1 gene promoter CpG island were first epigenotyped in ten placenta samples (maternal and fetal sides), maternal blood at first trimester and cord blood samples (Figure 5.1). The CpG sites that were found to be unmethylated (<10.0%) or fully methylated ( >90.0%) were excluded from the current study as they showed low variability and were unlikely to explain the phenotypic variability. Hence, ABCA1 loci B, C and D, mostly unmethylated (<10%) and almost invariable in all four tissues, were not further analyzed. ABCA1 -A locus (8 CpGs), located just upstream the first exon, was the only region showing interindividual variability in DNA methylation levels across all tissues and was consequently analyzed in the remaining samples.

154

Table 5.1- Maternal and newborn characteristics according to glucose tolerance status NGT (n=74) IGT (n=26) Mean ± SD Range Mean ± SD Range Maternal Characteristics Personal history of gestational diabetes 2 (2.7%) - 8 (30.8%) ** - Gravidity 0 35 (47.3%) - 9 (34.6%) - 1 20 (27.0%) - 7 (26.9%) - 2 16 (21.6%) - 8 (30.8%) - 3 3 (4.1%) - 2 (7.7%) - Parity 0 43 (58.1%) - 9 (34.6%) * - 1 18 (24.3%) - 14 (53.8%) * - 2 13 (17.6%) - 3 (11.5%) * - Mode of delivery C-section 13 (18.1%) - 3 (12.0%) - Vaginal 59 (81.9%) - 22 (88.0%) - (n=72) (n=25) 1st trimester Age (years) 28.8 ± 3.9 22.0 -39.0 29.1 ± 4.0 20.0 -38.0 BMI (kg/m 2) 25.4 ± 5.4 16.6-43.0 25.6 ± 3.7 19.6-32.5 Waist circumference (cm) 90.1 ± 14.6 62.0-137.0 87.5 ± 8.4 68.0-102.0 Fasting glucose (mmol/L) 4.46 ± 0.32 3.80-5.20 4.43 ± 0.50 3.40-5.40 Fasting insulin (mU/L) a 5.88 ± 4.39 1.70-23.90 5.89 ± 3.95 2.30-16.70 HOMA-IR a 1.16 ± 0.92 0.34-4.78 1.15 ± 0.75 0.46-2.97 Total cholesterol (mmol/L) 4.73 ± 0.77 3.30-7.20 4.75 ± 0.90 3.10-8.00 HDL-C (mmol/L) 1.56 ± 0.28 1.00-2.35 1.62 ± 0.34 1.25-2.31 LDL-C (mmol/L) 2.53 ± 0.74 1.20-5.00 2.62 ± 0.72 1.30-5.10 TG (mmol/L) a 1.07 ±. 0.48 0.40-3.00 1.24 ± 0.50 0.60-2.70

2nd trimester 2h-post-OGTT glucose concentration (mmol/L) 6.16 ± 0.90 3.80-7.70 8.43 ± 0.61 ** 7.80-10.80

Weight gain between 1 st and 3 rd trimester 18.8 ± 7.0 1.6-34.1 13.5 ± 5.9 ** 1.5-25.3 (% of initial weight) (n=73) (n=22)

Newborn characteristics Sex Male 34 (47.2%) - 13 (50.0%) - Female 38 (52.8%) - 13 (50.0%) - (n=72) (n=26) Gestational age (weeks) 39.3 ± 1.2 36.0-41.6 39.1 ± 1.5 36.1-41.6 Birth weight (kg) 3.45 ± 0.46 2.00-4.27 3.33 ± 0.53 2.13-4.58 Placenta weight (g) 590 ± 123 360-992 584 ± 115 370-883 (n=66) (n=25) Fetal-placental weight ratio 5.97 ± 0.84 3.74-7.82 5.78± 0.83 3.46-7.50 (n=66) (n=25) Cord blood total cholesterol (mmol/L) 1.63±0.36 0.93-2.89 1.64±0.37 1.2-2.54 (n=64) (n=23) a Geometric mean and p-value obtained after log 10 -transformation of the variable Means are different between NGT and IGT ( ** p ≤ 0.01 ;* p≤ 0.05; † p ≤ 0.10)

155

Figure 5.1- ABCA1 CpG island proximal promoter region and localization of the 4 loci epigenotyped in maternal and fetal placenta, as well as in maternal and cord blood samples The ABCA1 -A locus shows DNA methylation variability in both fetal and maternal sides of the placenta (especially at CpG5 and CpG6), as well as in maternal and cord blood samples.

156

DNA methylation levels of maternal blood samples at the ABCA1-A locus were highly correlated between CpG sites 3 to 8 (r=0.80 to 0.97; p<0.001), whereas CpG sites 1 and 2 were less strongly correlated with the 6 others (r=0.58 to 0.87; p<0.001) (Figure 5.2). In cord blood samples, DNA methylation levels of the 8 CpGs analyzed were found to be highly correlated with each other (r=0.83 to 0.97; p<0.001) (Figure 5.2). Mean DNA methylation level values of the 8 CpGs epigenotyped were thus computed in maternal and cord blood samples and used for further analyses as previously described by Guay et al.26 and Tobi et al.22 .

Figure 5.2- Pearson correlation coefficients between CpGs at ABCA1 -A locus in maternal (A) and cord (B) blood

Mean ABCA1 DNA methylation levels were higher in maternal blood as compared to cord blood (31.9±7.3% vs. 18.0±5.7%, p<0.001). Interestingly, mean ABCA1 DNA methylation levels were found to be well correlated between maternal blood and cord blood samples (r=0.50; p<0.001). Maternal blood ABCA1 DNA methylation levels explained up to 20.0% (R 2) of the DNA methylation variability at ABCA1 locus in cord blood.

On average, ABCA1 -A locus DNA methylation was found to be lower than 10% in maternal (8.8 ±2.6%) and fetal (9.7±2.7%) placenta samples. Nevertheless, mean ABCA1 - CpG5 and ABCA1 -CpG6 DNA methylation levels were between 14.7% and 15.9% on average with good variability (s.d.>3%) (Figure 5.1). CpG sites 1 to 4, 7 and 8 were excluded

157 from the analysis as they were considered unmethylated (DNA methylation <10%) and showed low variability (s.d.<3%) (Figure 5.1). As they were only modestly correlated with each other (r ≤0.62), ABCA1 -CpG5 and ABCA1 -CpG6 were investigated separately in both maternal and fetal side of the placenta. DNA methylation levels at ABCA1 -CpG5 and CpG6 in maternal and cord blood were not associated to DNA methylation levels in either the maternal (r<|0.12|; p>0.29) or fetal side of the placenta (r<|0.10|; p>0.31).

Placental ABCA1 DNA methylation levels according to the maternal and newborn metabolic profiles We first assessed whether the maternal metabolic profile might be associated with placental ABCA1 DNA methylation variability. On the maternal side of the placenta, we observed that higher maternal HDL-C concentrations at first trimester of pregnancy were associated with decreased DNA methylation levels at both ABCA1 -CpG5 (r=-0.21; p=0.04) and ABCA1 - CpG6 (r=-0.24; p=0.02) (Figure 5.3, Panel A and B). Consistently, the maternal placental ABCA1-CpG6 locus was found to be differentially methylated according to maternal HDL- C level tertiles at first trimester (right section of Figure 5.4, p=0.05). Indeed, mothers with the highest HDL-C levels (>1.67 mmol/L, n=35) had 2.3% lower DNA methylation levels than women with the lowest concentrations (<1.44 mmol/L, n=33).

Moreover, we observed a positive correlation between maternal placenta ABCA1-CpG5 DNA methylation levels and maternal glucose 2h post-OGTT levels (r=0.24; p=0.02) (Figure 5.3, Panel C). On both sides of the placenta, ABCA1 DNA methylation levels were found to be similar in the IGT and NGT groups (Table 5.1). Nevertheless, DNA methylation levels at ABCA1-CpG6 were significantly different amongst IGT women according to HDL-C level tertiles at first trimester (left section of Figure 5.4; p=0.04). In women with IGT and high HDL-C levels (>1.67 mmol/L, n=9), ABCA1-CpG6 was found to be hypomethylated when compared with the two lower tertiles of HDL-C (Figure 5.3). For women with NGT, no significant difference in DNA methylation was observed among the HDL-C levels tertiles (middle section of the Figure 5.4). Of interest, an interaction effect was observed between maternal glucose status and HDL-C levels on DNA methylation levels at ABCA1 -CpG6 ( p=0.04) (Figure 5.4). A trend for interaction on DNA methylation levels at

158

ABCA1 -CpG5 was also observed between these two factors (p=0.07), even though no significant DNA methylation difference was observed between groups (HDL-C levels and glucose tolerance status) for this CpG on the maternal side of placenta (data not shown). Results remained unchanged after consideration for potential confounding factors (age, BMI, TG at first trimester of pregnancy, history of GDM and weight gain between first and third trimester).

Figure 5.3. Placental ABCA1 -CpG5 and -CpG6 DNA methylation levels according to maternal and newborn metabolic profile Higher maternal HDL-C levels at first trimester of pregnancy (Panel A and B) and lower maternal glucose concentrations 2h post-OGTT (Panel C) were both associated with lower ABCA1 DNA methylation levels in the maternal side of the placenta. Panel D shows the negative correlation between ABCA1 -CpG5 DNA methylation levels in the fetal side of placenta and cord blood triglyceride levels. aIncluded age, BMI, TG at first trimester and history of gestational diabetes as covariates. bAdjusted for gestational age and newborn sex. cCorrelation coefficient and p-value obtained after log10-transformation of the cord blood triglyceride levels.

159

Figure 5.4. DNA methylation levels at ABCA1 -CpG6 on the maternal side of the placenta according to glucose tolerance status and HDL-C levels Women with impaired glucose tolerance (IGT) and low HDL-C levels (<1.44 mmol/L) had the highest ABCA1 -CpG6 DNA methylation levels. Maternal glucose status and HDL-C levels interact to increase ABCA1 DNA methylation on maternal side of placenta ( p=0.04). aP-values obtained in the Bonferroni post-hoc analysis by comparing low (<1.44 mmol/L) and medium (1.44-1.67 mmol/L) levels of HDL-C to levels > 1.67 mmol/L in IGT group. bP-value obtained in the Bonferroni post-hoc analysis by comparing HDL-C levels <1.44 mmol/L to levels > 1.67 mmol/L in the entire cohort (n=100). cANCOVA adjusted for age and BMI at first trimester and history of GDM.

On the fetal side of the placenta, the maternal metabolic profile did not contribute significantly to ABCA1 DNA methylation level variability. Nevertheless, DNA methylation at fetal placental ABCA1 -CpG5 was significantly correlated with cord blood TG concentrations (r=-0.28; p=0.01) (Figure 5.3, Panel D), whereas a trend for association was also observed with cord blood HDL-C levels (r=0.19; p=0.09) when newborn sex and gestational age were taken into account. All the associations remained similar after statistical adjustments for maternal age, BMI at first trimester, history of GDM and weight gain between first and third trimester. DNA methylation levels on the maternal and fetal side of

160 the placenta were not found to be associated with other maternal or fetal metabolic variables (Annexes 7 and 8).

According to the results of the stepwise multivariable linear regression analyses of placental ABCA1 DNA methylation level predictors, maternal and fetal characteristics explained respectively up to 11.4% and 5.9% of the ABCA1 DNA methylation variability observed in the maternal or fetal side of placenta (Table 5.2). These results remained unchanged when the forward and backward multivariable linear regression models were applied (data not shown).

Table 5.2- Multivariable linear regression analyses of ABCA1 DNA methylation levels predictors in placenta and cord blood Fetal side of Maternal side of placenta Cord blood placenta ABCA1 - ABCA1 - ABCA1 - Mean ABCA1 Predictors CpG5 CpG6 CpG5 DNA methylation (n=96) (n=96) (n=79) (n=71) 1st trimester β=-0.26 β=-0.29 NS NS HDL-C level (mmol/L) p=0.008 p=0.005

1st trimester β=-0.17 NS NS NS TG level (mmol/L) † p=0.09 2nd trimester β=0.26 β=0.17 β=-0.17 2h-post-OGTT NS p=0.008 p=0.08 p=0.10 glucose level (mmol/L) Cord blood β=-0.27 NS NS NS TG level (mmol/L) p=0.02

Fetal-placental weight β=0.26 NS NS NS ratio p=0.008 Maternal blood β=0.42 ABCA1 DNA NS NS NS p<0.001 methylation level R2 (%) 13.3 10.8 7.1 38.0 2 R adj (%) 11.4 8.8 5.9 34.0 p=0.001 p=0.005 p=0.02 p<0.001 The input-independent variables tested were maternal characteristics (age, BMI, fasting triglyceridemia, HDL-C, 2h post-OGTT glucose, and blood ABCA1 DNA methylation levels) and fetal characteristics (gestational age, sex, fetal-placental weight ratio, cord blood HDL-C and TG levels) † Results obtained after log 10 -transformation of the TG level. NS = p>0.1

161

Correlations between cord blood ABCA1 DNA methylation levels, maternal characteristics and newborn metabolic profiles Next, we investigated whether maternal and newborn characteristics might be associated with cord blood ABCA1 DNA methylation level variability. First, the maternal glucose metabolism at second trimester of pregnancy was found to be associated with the DNA methylation profile of the cord blood ABCA1 -A locus. Indeed, we observed a negative correlation between cord blood ABCA1-A DNA methylation levels and maternal glucose concentrations (2h post-OGTT) (Figure 5.5), as well as an association with fasting TG at first trimester (r=-0.24; p=0.03) when all maternal potential confounders variables were included in the statistical model. Moreover, higher cord blood ABCA1 -A DNA methylation levels were significantly associated with higher placenta weight (r=0.29; p=0.01) and lower fetal- placental weight ratio (r=-0.25, p=0.03; Figure 5.5) at term when both gestational age and newborn’s sex were considered. These correlations remained unchanged after the inclusion of the following variables: maternal age, BMI, blood ABCA1 DNA methylation, TG at first trimester, glucose levels 2h post-OGTT at second trimester and weight gain between first and third trimester. No additional correlation was observed between cord blood ABCA1 DNA methylation levels, maternal and newborn characteristics (Annexe 7 and 8). Overall, the combination of maternal and fetal characteristics might explain up to 34.0% of the cord blood ABCA1 DNA methylation variability (Table 5.2).

162

Figure 5.5. Cord blood ABCA1-A locus DNA methylation levels according to maternal and newborn characteristics Pearson’s correlations between cord blood mean ABCA1 DNA methylation levels and: A) 2h post- OGTT maternal glucose concentrations, and B) placental efficiency (estimated by fetal-placental weight ratio). aAdjusted for newborn’s sex and gestational age, as well as maternal age, BMI, TG at first trimester and history of gestational diabetes.

Correlation between ABCA1 DNA methylation and mRNA levels on the maternal and fetal side of the placenta To assess the functional impact of the ABCA1 DNA methylation level variability, ABCA1 mRNA levels were quantified in maternal and fetal placenta. Relative ABCA1 gene expression was found to be negatively correlated with ABCA1 -CpG6 DNA methylation levels on the maternal (r=-0.35; p=0.05) and fetal side of the placenta (r=-0.36; p=0.05) (Figure 5.6). Moreover, a trend for association was observed between DNA methylation at ABCA1 -CpG5 and ABCA1 gene expression in fetal placenta (r=-0.35; p=0.06). Of note, potential binding sites for transcription factors such as AP-2, AP-4, ETS1, SRY and STAT were found closed to ABCA1 -CpG5 and CpG6, within or near ABCA1 -A locus.26

163

Figure 5.6- Functional impact of the ABCA1 DNA methylation level variability Pearson’s correlations between ABCA1 -CpG6 locus DNA methylation and mRNA levels on (A) the maternal side and (B) the fetal side of the placenta.

164

DISCUSSION Previous studies suggested that in utero environment perturbations, such as maternal dyslipidemia and hyperglycemia, contribute to the development of adult chronic diseases (obesity, diabetes, CVD) 5, 27 , possibly through epigenetic adaptations in the placenta and offspring.11, 12, 28 Leukocyte DNA methylation variability at ABCA1 gene locus was previously associated to prenatal famine exposure, blood lipid profile and CVD.22, 26 These results suggest that ABCA1 ’s epigenetic profile is sensitive to the in utero environment and that methylation at this locus could explain, to some extent, the link between suboptimal maternal conditions and the metabolic health programming of the newborn. In the current study, we showed that higher ABCA1 DNA methylation levels on the maternal side of the placenta were associated with lower maternal HDL-C levels and higher maternal glucose concentrations 2h post-OGTT at first trimester and second trimester of pregnancy respectively (Figure 5.7).

In our cohort, IGT women gave birth to children with higher cord blood c-peptide levels even if they gained less weight throughout their pregnancy possibly because of their required clinical follow-up. 29, 30 These results suggest that child born to IGT mother have higher insulin production and confirm that they were exposed to higher maternal glucose concentrations in utero. Hyperglycemic in-utero environment has already been associated with impaired fetal and placental metabolism and epigenomic changes . Indeed, several epidemiological studies have associated maternal glucose with fetal overgrowth, excess adiposity in childhood and long-term susceptibility of offspring to obesity and metabolic disorders.5, 31, 32 Moreover, a recent in vitro study has reported that chronic exposure to hyperglycemia leads to persistent DNA methylation modifications of key metabolic genes in Schwann cells. 14 Likewise, associations between maternal hyperglycemia exposure and placental DNA methylation variations at LEP , ADIPOQ and MEST gene loci have been previously reported by our group and El Hajj et al.11-13 The maternal lipid profile (HDL-C, total cholesterol and TG), in pregnancies complicated or not by IGT, was also shown to be a determinant of birth weight and lifelong susceptibility to cardio-metabolic disorders.33-35 Our results support these observations and suggest that the effects of maternal lipid and glucose

165 changes could partly be mediated through epigenetic modifications at specific loci, such as ABCA1 and other genes.

The exact role of ABCA1 is not clearly defined on the maternal side of the placenta. Indeed, ABCA1 appears to regulate both the placental cholesterol uptake and cholesterol efflux toward maternal circulation. 36, 37 We showed that mothers with low HDL-C and high glucose at first and second trimester of pregnancy respectively had higher ABCA1 DNA methylation levels and a concomitant reduction in ABCA1 expression in the placenta. This interaction might be attributed to an overall less favourable metabolic profile, often characterized by the combination of low HDL-C and high glucose levels. Moreover, the reduction of placental ABCA1 mRNA has already been reported in obese and normal weight subjects with IGT and suggested to impair placental cholesterol-uptake and transport. 38 Although ABCA1 DNA methylation levels on the maternal side of the placenta were not associated with birth weight or the cord blood lipid profile, this suggests that other key players of the placental cholesterol metabolism may compensate for the loss of function of ABCA1 (e.g., ATP-binding cassette G1 (ABCG1) or scavenger receptor class B member 1 (SRB1)). Furthermore, we cannot exclude that the ABCA1 DNA methylation epivariations we observed on the maternal side of the placenta may also contribute to the maternal HDL- C level variability.

The role of ABCA1 in the endothelial cells of the fetal placenta is more clearly defined.39 Indeed, Stefulj et al.39 have reported that ABCA1 regulates the cholesterol efflux from the placenta to apo-A1 and apo-E for HDL biogenesis and subsequent release into fetal circulation. In the current study, ABCA1 DNA methylation levels on the fetal side of the placenta were not associated with maternal metabolic profile, but they were associated with cord blood lipid profile (Figure 5.7). Increased ABCA1 DNA methylation levels and the expected decreased expression were observed when cord blood HDL-C concentrations were higher and TG levels were lower. Interestingly, ABCA1 DNA methylation on the maternal side of the placenta was not associated with newborn weight or cord blood lipid profile. As the fetus can synthesize de novo cholesterol, the existence of fetal stimuli to prevent excess cholesterol delivery from the placenta has been proposed.40 Our results support this

166 hypothesis and suggest that cord blood lipid concentrations could prevent excess cholesterol transfer from the fetal side of the placenta to fetal circulation through epigenetic modifications at the ABCA1 gene locus. The ABCA1 epigenetic profile on the fetal side of the placenta may be more susceptible to fetal lipid level adaptations than the maternal side since it appears to be one of the most important regulators of placental-fetal cholesterol transfer and likely of newborn cholesterol homeostasis. However, the cord blood lipid profile only explains a modest fraction of ABCA1 DNA methylation variability in the fetal side of the placenta suggesting that other factors might affect this epipolymorphism and the cholesterol transfer.

In a previous study carried on leukocytes, we failed to find a significant association between DNA methylation at the ABCA1 -A gene promoter locus and ABCA1 mRNA levels.26 The results of the current study are the first to suggest that the ABCA1 DNA methylation locus tested in our previous study (Guay et al.26 ) and that of Tobi et al.22 is associated with its gene expression regulation, at least in a tissue-specific manner in placenta. Further analyses in others tissue will be needed to confirm the possible tissue-specific impact of DNA methylation at ABCA1 gene promoter locus.

Cord blood samples were also epigenotyped to determine the relationship between the blood lipid profile and maternal IGT. We first observed that ABCA1 DNA methylation levels were associated with maternal blood leukocyte ABCA1 DNA methylation. Based on correlation analyses, we estimated that the familial resemblance or the multifactorial heritability of leukocyte ABCA1 DNA methylation might be as high as 20%. This is concordant with previous studies, which have lately estimated the whole-blood DNA methylation heritability to 18% at the genome-wide level in twin pairs, and 20% and 15-48% at LEP and FABP3 gene loci respectively in family member comparison studies. 41-43 Furthermore, it suggests that the newborn epigenetic profile at the ABCA1 gene locus is partially inherited and thus likely affected by the environment to which the mother has been exposed throughout her own life (Figure 5.7).

167

Figure 5.7 - Maternal and fetal metabolic variables associated with placental and cord blood ABCA1 DNA methylation variations Maternal (glucose 2h post-OGTT and HDL-C levels) and fetal metabolic profile (cord blood triglyceride levels) are respectively associated with ABCA1 DNA methylation levels in the maternal and fetal side of the placenta. Higher maternal glucose 2h post-OGTT and triglyceride levels are associated with lower cord blood ABCA1 DNA methylation levels, whereas maternal epigenetic profile is positively associated with cord blood ABCA1 DNA methylation.

Although newborns’ methylome is only moderately inherited from the mother, our results also suggest that it may vary according to the intra-uterine environment to which it has been exposed. Indeed, cord blood ABCA1 DNA methylation was found to be negatively correlated with maternal fasting triglyceridemia and glucose levels 2h post-OGTT at first and

168 second trimester of pregnancy respectively (Figure 5.7). Interestingly, the correlation between maternal glucose and ABCA1 DNA methylation levels showed opposite associations in cord blood and on the maternal side of the placenta. Accordingly, newborns’ methylome may differently respond to maternal glucose in order to overcome placental ABCA1 DNA methylation modifications and impaired materno-fetal cholesterol transfer. On the maternal side of the placenta, we observed increased DNA methylation levels at ABCA1 -A locus when maternal glucose concentrations were higher at second trimester. As increased placental ABCA1 DNA methylation levels are associated with decreased mRNA levels, this suggests that high maternal glucose concentrations could reduce materno-fetal cholesterol transfer. Hence, the newborn ABCA1 gene promoter locus might be less methylated in order to increase endogenous HDL-C biogenesis and to overcome the decrease in placental cholesterol transfer. Moreover, the association found between cord blood ABCA1 DNA methylation levels and the fetal-placental weight ratio (a placental efficiency marker representing the feto-placental development occurring throughout pregnancy to meet fetal growth demands 44 ) also suggests that the ABCA1 epigenetic profile of newborns might adapt to or influence placental efficiency to ensure an adequate lipid supply. Therefore, as observed on the fetal side of the placenta, newborns’ ABCA1 DNA methylation profile may also serve as a regulatory mechanism to ensure that a sufficient quantity of endogenous and/or exogenous cholesterol is available to the fetus for its optimal growth and development. Nevertheless, the ABCA1 epigenetic “compensatory” signature acquired in utero , may have lifelong consequences on newborns’ lipid metabolism possibly triggering their susceptibility to obesity, dyslipidemia and CVD.26

Interestingly, Tobi et al.22 have observed that prenatal exposure to ending World War 2-related famine in the Netherlands was associated with increased DNA methylation levels at the ABCA1 gene promoter locus in leukocytes of adults. This reinforces the potential role of ABCA1 epigenetic adaptations to in utero environment as DNA methylation changes seem to be opposing in conditions where nutrients are restricted (famine) or in excess (hyperglycemia); two conditions associated with a long-term increased susceptibility to CVD. 45-49 Moreover, it suggests that dysregulation (hypo or hypermethylation) of the ABCA1 epigenetic profile could impair ABCA1 function and possibly increase the risk of CVD.

169

Indeed, we have previously reported increased ABCA1 DNA methylation levels in patients with a previous history of coronary artery disease.26 Further studies will be needed to assess whether epigenetic perturbations of ABCA1 gene observed in newborns might contribute or not to the development of chronic diseases in children and adults, but the current study and the literature provide good evidence in support of the existence of this relationship.

One strength of this study is the longitudinal follow-up of women from first trimester of pregnancy to delivery. It allowed us to accurately identify mothers developing IGT during pregnancy and avoid their misclassification with women who were diabetic pre-pregnancy. Moreover, the study design, along with our fairly large sample size, have allowed us to consider potential confounding factors in our statistical models. ABCA1 was epigenotyped in four different tissues thus providing insights on tissue-specific regulation. It also gives us the overall picture of the feed-back regulatory mechanisms that might exist at epigenetic levels between these inter-connected tissues. Nevertheless, as placenta and cord blood samples were analyzed cross-sectionnally at birth, the causal variable (placenta or cord blood) in the compensatory mechanisms discussed remains to be identified. Moreover, ABCA1 DNA methylation levels will need to be assessed in these children in a few years to determine methylation stability at this locus and its association with developmental indices and lipid profile throughout infancy and childhood. ABCA1 DNA methylation levels were tested for association with numerous closely related and highly correlated metabolic variables (eg. HOMA-IR, insulin and glucose; or total cholesterol, HDL-C, LDL-C and TG). Bonferroni correction for multiple testing would be likely considered too stringent in this context and would thus potentially generates false negative results. 50 It remains that some of the reported associations are quite significant ( p<0.01) and that this study is the third one putting forward the association between ABCA1 DNA methylation levels and suboptimal in-utero exposure or adverse cardiometabolic outcomes. In addition, as the results observed are associative, further studies (such as the one carried by Kim et al.14 ) will need to assess the functional impact of the maternal metabolic profile on placental and newborn methylome.

The current study reports for the first time that maternal metabolic profile is associated with ABCA1 DNA methylation levels in the maternal side of placenta and cord

170 blood. Our results also suggest that ABCA1 DNA methylation profile changes in response to in utero environment and fetal stimuli to ensure optimal cholesterol delivery to the fetus and then cellular intake. These epigenetic adaptations could potentially trigger a long-term susceptibility of the newborn to obesity, dyslipidemia and CVD. This study also suggests that epigenetic modifications are involved in fetal programming and raises the possibility that other gene loci will respond to maternal conditions and could explained the link between suboptimal in utero environment and metabolic health programming of the newborn. Our results thus emphasize the need for the instigation of better maternal care programs early during pregnancy.

171

MATERIALS AND METHODS Sample and clinical data One hundred women with a singleton pregnancy were selected from a cohort recruited in a founder population of French-Canadian origin from the Saguenay-Lac-Saint-Jean region of Québec (Canada). The women included in this study were aged between 18-40 years, with no personal history of pre-gestational type 1 or 2 diabetes, polycystic ovary syndrome (PCOS) or hypercholesterolemia. Women with a positive history of alcohol and/or drug abuse during the current pregnancy were also excluded. All women provided a written informed consent before their inclusion, and all clinical data were de-identified. This project was approved by the Chicoutimi Hospital Ethics Committee, in accordance with the Declaration of Helsinki.

Women were met at the ECOGENE-21 Clinical Research Center at the first (11-14 weeks), second (24-28 weeks) and third (36-39 weeks) trimester of pregnancy. A registered nurse performed a complete anthropometric and metabolic profiling. Anthropometric variables and blood pressure were measured using standardized procedures. 51 Blood samples were obtained after a 12-h overnight fast from the antecubical vein into vacutainer tubes containing EDTA at each gestational trimester and at the time of delivery (cord blood). Plasma cholesterol, triglyceride (TG) and glucose levels were enzymatically measured using a Beckman analyzer (models DXC and LX20; Fullerton, CA). Total cholesterol was determined in plasma and HDL particles after precipitation of very low-density lipoprotein (VLDL) and low-density lipoprotein (LDL) particles (d>1.006 g/ml) in the infranatant with heparin and MnCl 2. Plasma LDL-cholesterol (LDL-C) levels were estimated using the Friedewald formula. 52 Insulin measurements were performed using a radioimmunoassay method (Advia Centaur, Simmens). Impaired glucose tolerance (IGT) was defined as a 2- hour glucose ≥7.8 mmol/L following a 75-g OGTT performed at 24-28 weeks’ gestation according to the WHO criteria. 53 Insulin resistance levels were assessed using HOMA-IR (fasting glucose (mmol/L) * fasting insulin (mU/L) / 22.5) at the second trimester. 54 Clinical information about the newborn was collected at birth from medical files and included gestational age, sex of the newborn and anthropometric measurements. The gestational age was calculated at the first visit from the date of the last menstrual period and was corrected

172 afterward, as required, based on the date of the ultrasound scans. Cord blood lipid and glucose levels were assessed as described for the mother. In addition, cord blood C-peptide levels, measured by ELISA, were used as a marker of the newborn’ insulin-secretory activity. 55

ABCA1 DNA methylation and mRNA measurements Placenta and cord blood samples were taken within minutes of delivery and placental expulsion (on average <15 min) by well-trained clinicians (MD). Cord blood samples collected were mixed arterial and venous blood . On the fetal side of the placenta, biopsies were taken near the insertion point of the umbilical cord and consisted of the chorionic plate with the chorionic villi. Maternal placenta biopsies were sampled on the opposite side of the placental cord blood insertion point and were composed of the basal plate and the chorionic villi. The biopsies were washed in PBS 1X to remove cord/maternal blood, dissected to remove conjunctive tissues and kept in RNAlater (Qiagen, #76106) at -80°C until nucleic acid extraction. Placental DNA and RNA were purified using the All Prep DNA/RNA/Protein Mini Kit (Qiagen, #80004). DNA was purified from whole blood and cord blood samples with the Gentra Puregen Blood Kit (Qiagen, #158389). Maternal blood samples at first trimester were available for 96 of the 100 mothers, whereas 89 cord blood samples were available for DNA methylation analysis. Placental RNA quality was assessed with Agilent 2100 Bioanalyser RNA Nano Chips (Agilent Technologies, #5067-1511). RNA samples on both the maternal and fetal side of the placenta showed good quality with a mean RNA integrity number (RIN) ranging from 6.9 to 9.3 (mean: 8.1±0.7) and 6.5 to 9.5 (mean: 8.2±0.9) respectively.

We used the gold-standard pyrosequencing technology, an accurate and quantitative sequencing assay, to determine base-specific cytosine methylation levels at four different loci within the CpG island of the ABCA1 gene proximal promoter (Figure 5.1). The epigenotyped regions were the same as those previously described. 26 Pyrosequencing assays combine sodium bisulfite DNA conversion chemistry (EpiTech Bisulfite Kits; Qiagen; #59104), polymerase chain reaction (PCR) amplification (Pyromark PCR Kit; Qiagen; #978703) and sequencing by synthesis assay (Pyromark Gold Q24 Reagents; Qiagen; #978802) of the target sequence. Sodium bisulfite preferentially deaminates unmethylated cytosine residues

173 to thymines (after PCR amplification), whereas methylcytosines remain unmodified. Each of the pyrosequencing runs performed included a negative PCR control and a sequencing primer control as well as sodium bisulfite conversion controls. Additionally, pyrosequencing quality control (peak height, deviation from reference sequence pattern and unexpected peak height) was assessed for each sample using Pyromark Q24 Analysis Software (v1.0.10.134). PCR primers were selected using the PyroMark Assay Design software v2.0.1.15. The PCR and pyrosequencing primers for the amplification of the ABCA1 gene CpG island loci are described in Table 5.3.

Table 5.3- PCR and pyrosequencing primers for ABCA1 gene CpG island locus amplification Amplified PCR and pyrosequencing primers Length (bp) region

F: 5’bio-GGGTGGAGGGTATAGTAGGT-3’ ABCA1 -A R: 5’-AACAAATTCCACTAATACCCTTAACT-3’; 161 bp (8 CpGs) Seq: 5’-AACAAATTCCACTAATACCCTTAACT-3'

F: 5’bio-GGGTGGGGAGAGTTGTAG-3’ ABCA1 -B R: 5’-CCCAAATCAAAACAAACCAACTTCTTA-3’ 163 bp (4 CpGs) Seq: 5’-CCAACTCAAAACCCT-3’

F: 5’bio-TTGATTTGGGAATTGGTTATATGTT-3’ ABCA1 -C R: 5’-AACAAAAACCCAAAACCTCTAATAA-3’ 135 bp (4 CpGs) Seq: 5’-AAAACACCTCCAACT-3’

F: 5’-AATTTGTTGGTTAGGTTGGTT-3’ ABCA1 -D R: 5’bio-AAAAAAAAAAATTAAACACCCCACCTCC-3’ 180 bp (6 CpGs) Seq: 5’-AGTGTTGGGATTATAGG-3’ USF-bio 5’Bio-GTGACGTACTAGCAACG-3’ - USR 5’-TAGCAGGATACGACTATC-3’ F; Forward. R; Reverse. Seq; Sequencing Primers were designed using the PyroMark Assay Desing v2.0.1.15 software (Qiagen). Sequences are shown for the standard format with biotin attached to the specific primer. A non-human universal tail was attached to the 5’ends of both specific primers in order to decrease cost and add flexibility to the pyrosequencing method as previously described (43). Following universal tails were attached to the 5’-ends of the specific primers for the universal primer approach: 5’- GTGACGTACTAGCAACG-3’ (USF) replaced biotin in the biotinylated primer, and 5’- TAGCAGGATACGACTATC-3’ (USR) extended the non-biotinylated primers. Only the universal primer USF was synthesized as a biotinylated primer.

174

ABCA1 mRNA levels were measured in a randomly selected subsample of 31 placental samples from the maternal and fetal sides. One sample from the fetal side was not available for mRNA quantification. Complementary DNA (cDNA) was generated from placental total RNA using a random primer hexamer provided with the High Capacity cDNA Archive kit (Life Technologies, #4368814). Equal amounts of cDNA were run in duplicate and amplified in a 20 µl reaction containing 10 µL of 2X Universal PCR Master Mix (Life Technologies, #4366072). Primers and Taqman probes were designed to cover exon boundaries (Life Technologies , ABCA1 : Hs01059118_m1). Each sample was calibrated to the YWHAZ housekeeping gene (endogenous control; YWHAZ : Hs00237047_m1). 56-58 Relative quantification estimations were performed using an Applied Biosystems 7500 Real

Time PCR System as recommended by the manufacturer. ABCA1 /GAPDH Ct ratio (1/x) values were used in the analyses.

Statistical analyses The normal distribution of all variables was assessed using the Kolmogorov-Smirnov test.

The following variables were found normally distributed after they were log 10 -transformed: fasting triglyceride levels, insulin levels and HOMA-IR. Partial Pearson correlation was used to investigate the association between DNA methylation levels and the main variables of interest: glucose concentrations 2 h post-OGTT, fasting glucose and insulin levels, maternal and cord blood lipid profile, as well as ABCA1 mRNA levels. Categorical variables were compared using a Pearson χ2-statistic, whereas mean differences between groups for continuous variables were compared with a Student t-test (normal glucose tolerant (NGT) vs. IGT) or an ANOVA, followed by the Bonferroni’s post-hoc comparison test (between the three HDL-cholesterol (HDL-C) levels tertiles). The statistical models were controlled for the following potential confounding factors when appropriate: maternal age, BMI, and TG at first trimester and previous history of GDM as well as newborn’s sex and gestational age. Results remained unchanged after consideration for potential confounding factors (age, BMI, TG at first trimester of pregnancy, smoking, gravidity, parity, mode of delivery, newborn sex, history of GDM and weight gain between first and third trimester). Results were considered statistically significant when p-values were <0.05 (two-sided).

175

Stepwise multivariable linear regression was used to identify predictors of the placental and cord blood ABCA1 DNA methylation level variability. The input-independent variables were: maternal characteristics (age, BMI, weight gain between first and third trimester, fasting triglyceridemia and HDL-C at first trimester, 2-h post OGTT glucose at second trimester and blood ABCA1 DNA methylation levels) and fetal characteristics (gestational age, sex, fetal-placental weight ratio, cord blood HDL-C and TG levels). All the variables with a p≤0.10 were included in the regression model. All statistical analyses were performed with the IBM SPSS Statistics 20 software (release 20.0.0, SPSS, Chicago, Il, USA).

176

AUTHORS’ CONTRIBUTIONS A.A.H. and S.P.G. contributed to the study design, performed the data collection, the data analysis/interpretation and wrote the manuscript. V.D. contributed to data collection and revised the manuscript. J. St.-P, M.F.H., J.P.B. and P.P. participated in study design conception and revised the manuscript. D.G. contributed to the study design, supplied research infrastructure and revised the manuscript. D.B. and L.B. conceived the study design, participated to data analysis/interpretation process and revised the manuscript.

ACKNOWLEDGMENTS The authors acknowledge the contribution of Cécilia Légaré, Sébastien Claveau, MSc; Nadia Mior; Jeanine Landry, RN and Chantal Aubut, RN from the ECOGENE-21 Clinical Research Center for their dedicated work in this study. The authors also express their gratitude to Céline Bélanger, Chicoutimi Hospital, for her thoughtful language revision of the manuscript. L.B. and MF.H. are junior research scholars from the Fonds de la recherche du Québec en santé (FRQS). JP.B. is senior research scholars from the FRQS. MF.H. is also supported by a Canadian Diabetes Association clinical scientist award. L.B., MF.H., P.P. and JP.B. are members of the FRQS-funded Centre de recherche clinique Étienne-Le Bel (affiliated to the Centre hospitalier universitaire de Sherbrooke ). During this research, SP.G. was the recipient of a doctoral research award from the Canadian Institutes for Health and Research (CIHR) and AA.H. was a recipient of a FRQS doctoral training award. AA.H. and V.D. were supported by Diabète Québec . This project was supported by ECOGENE-21, the Canadian Institutes of Health Research (CIHR team in community genetics (grant #CTP-82941)), FRSQ and Diabète Québec .

DISCLOSURE OF POTENTIAL CONFLICT OF INTERESTS

None

177

REFERENCES

1. Butte NF. Carbohydrate and lipid metabolism in pregnancy: normal compared with gestational diabetes mellitus. The American journal of clinical nutrition 2000; 71:1256S-61S.

2. Galtier F. Definition, epidemiology, risk factors. Diabetes & metabolism 2010; 36:628- 51.

3. Hillier TA, Pedula KL, Schmidt MM, Mullen JA, Charles MA, Pettitt DJ. Childhood obesity and metabolic imprinting: the ongoing effects of maternal hyperglycemia. Diabetes care 2007; 30:2287-92.

4. Dabelea D, Mayer-Davis EJ, Lamichhane AP, D'Agostino RB, Jr., Liese AD, Vehik KS, et al . Association of intrauterine exposure to maternal diabetes and obesity with type 2 diabetes in youth: the SEARCH Case-Control Study. Diabetes care 2008; 31:1422-6.

5. Clausen TD, Mathiesen ER, Hansen T, Pedersen O, Jensen DM, Lauenborg J, et al . Overweight and the metabolic syndrome in adult offspring of women with diet-treated gestational diabetes mellitus or type 1 diabetes. The Journal of clinical endocrinology and metabolism 2009; 94:2464-70.

6. Barker DJ. Intrauterine programming of adult disease. Molecular medicine today 1995; 1:418-23.

7. Lillycrop KA, Burdge GC. Epigenetic changes in early life and future risk of obesity. Int J Obes (Lond) 2011; 35:72-83.

8. Henikoff S, Matzke MA. Exploring and explaining epigenetic effects. Trends in genetics : TIG 1997; 13:293-5.

9. Bird A. DNA methylation patterns and epigenetic memory. Genes & development 2002; 16:6-21.

178

10. Bestor TH. The DNA methyltransferases of mammals. Human molecular genetics 2000; 9:2395-402.

11. Bouchard L, Hivert MF, Guay SP, St-Pierre J, Perron P, Brisson D. Placental adiponectin gene DNA methylation levels are associated with mothers' blood glucose concentration. Diabetes 2012; 61:1272-80.

12. Bouchard L, Thibault S, Guay SP, Santure M, Monpetit A, St-Pierre J, et al . Leptin gene epigenetic adaptation to impaired glucose metabolism during pregnancy. Diabetes care 2010; 33:2436-41.

13. El Hajj N, Pliushch G, Schneider E, Dittrich M, Muller T, Korenkov M, et al . Metabolic Programming of MEST DNA Methylation by Intrauterine Exposure to Gestational Diabetes Mellitus. Diabetes 2013; 62:1320-8.

14. Kim ES, Isoda F, Kurland I, Mobbs CV. Glucose-Induced Metabolic Memory in Schwann Cells: Prevention by PPAR Agonists. Endocrinology 2013.

15. Turan N, Ghalwash MF, Katari S, Coutifaris C, Obradovic Z, Sapienza C. DNA methylation differences at growth related genes correlate with birth weight: a molecular signature linked to developmental origins of adult disease? BMC medical genomics 2012; 5:10.

16. Yuen RK, Avila L, Penaherrera MS, von Dadelszen P, Lefebvre L, Kobor MS, et al . Human placental-specific epipolymorphism and its association with adverse pregnancy outcomes. PloS one 2009; 4:e7389.

17. Filiberto AC, Maccani MA, Koestler D, Wilhelm-Benartzi C, Avissar-Whiting M, Banister CE, et al . Birthweight is associated with DNA promoter methylation of the glucocorticoid receptor in human placenta. Epigenetics : official journal of the DNA Methylation Society 2011; 6:566-72.

18. Ferreira JC, Choufani S, Grafodatskaya D, Butcher DT, Zhao C, Chitayat D, et al . WNT2 promoter methylation in human placenta is associated with low birthweight

179

percentile in the neonate. Epigenetics : official journal of the DNA Methylation Society 2011; 6:440-9.

19. Godfrey KM, Sheppard A, Gluckman PD, Lillycrop KA, Burdge GC, McLean C, et al . Epigenetic gene promoter methylation at birth is associated with child's later adiposity. Diabetes 2011; 60:1528-34.

20. Seki Y, Williams L, Vuguin PM, Charron MJ. Minireview: Epigenetic programming of diabetes and obesity: animal models. Endocrinology 2012; 153:1031-8.

21. Heijmans BT, Tobi EW, Stein AD, Putter H, Blauw GJ, Susser ES, et al . Persistent epigenetic differences associated with prenatal exposure to famine in humans. Proceedings of the National Academy of Sciences of the United States of America 2008; 105:17046-9.

22. Tobi EW, Lumey LH, Talens RP, Kremer D, Putter H, Stein AD, et al . DNA methylation differences after exposure to prenatal famine are common and timing- and sex-specific. Human molecular genetics 2009; 18:4046-53.

23. Joyce C, Freeman L, Brewer HB, Jr., Santamarina-Fojo S. Study of ABCA1 function in transgenic mice. Arteriosclerosis, thrombosis, and vascular biology 2003; 23:965- 71.

24. Albrecht C, Soumian S, Tetlow N, Patel P, Sullivan MH, Lakasing L, et al . Placental ABCA1 expression is reduced in primary antiphospholipid syndrome compared to pre- eclampsia and controls. Placenta 2007; 28:701-8.

25. Nikitina L, Wenger F, Baumann M, Surbek D, Korner M, Albrecht C. Expression and localization pattern of ABCA1 in diverse human placental primary cells and tissues. Placenta 2011; 32:420-30.

26. Guay SP, Brisson D, Munger J, Lamarche B, Gaudet D, Bouchard L. ABCA1 gene promoter DNA methylation is associated with HDL particle profile and coronary artery disease in familial hypercholesterolemia. Epigenetics : official journal of the DNA Methylation Society 2012; 7:464-72.

180

27. van der Graaf A, Vissers MN, Gaudet D, Brisson D, Sivapalaratnam S, Roseboom TJ, et al . Dyslipidemia of mothers with familial hypercholesterolemia deteriorates lipids in adult offspring. Arteriosclerosis, thrombosis, and vascular biology 2010; 30:2673-7.

28. DeRuiter MC, Alkemade FE, Gittenberger-de Groot AC, Poelmann RE, Havekes LM, van Dijk KW. Maternal transmission of risk for atherosclerosis. Current opinion in lipidology 2008; 19:333-7.

29. Deveer R, Deveer M, Akbaba E, Engin-Ustun Y, Aydogan P, Celikkaya H, et al . The effect of diet on pregnancy outcomes among pregnants with abnormal glucose challenge test. European review for medical and pharmacological sciences 2013; 17:1258-61.

30. Stewart ZA, Wallace EM, Allan CA. Patterns of weight gain in pregnant women with and without gestational diabetes mellitus: an observational study. The Australian & New Zealand journal of obstetrics & gynaecology 2012; 52:433-9.

31. Walsh JM, Mahony R, Byrne J, Foley M, McAuliffe FM. The association of maternal and fetal glucose homeostasis with fetal adiposity and birthweight. European journal of obstetrics, gynecology, and reproductive biology 2011; 159:338-41.

32. Deierlein AL, Siega-Riz AM, Chantala K, Herring AH. The association between maternal glucose concentration and child BMI at age 3 years. Diabetes care 2011; 34:480-4.

33. Clausen T, Burski TK, Oyen N, Godang K, Bollerslev J, Henriksen T. Maternal anthropometric and metabolic factors in the first half of pregnancy and risk of neonatal macrosomia in term pregnancies. A prospective study. European journal of endocrinology / European Federation of Endocrine Societies 2005; 153:887-94.

34. Misra VK, Trudeau S, Perni U. Maternal serum lipids during pregnancy and infant birth weight: the influence of prepregnancy BMI. Obesity (Silver Spring) 2011; 19:1476-81.

181

35. Palinski W, Yamashita T, Freigang S, Napoli C. Developmental programming: maternal hypercholesterolemia and immunity influence susceptibility to atherosclerosis. Nutrition reviews 2007; 65:S182-7.

36. Baardman ME, Kerstjens-Frederikse WS, Berger RM, Bakker MK, Hofstra RM, Plosch T. The role of maternal-fetal cholesterol transport in early fetal life: current insights. Biology of reproduction 2013; 88:24.

37. Aye IL, Waddell BJ, Mark PJ, Keelan JA. Placental ABCA1 and ABCG1 transporters efflux cholesterol and protect trophoblasts from oxysterol induced toxicity. Biochimica et biophysica acta 2010; 1801:1013-24.

38. Dube E, Ethier-Chiasson M, Lafond J. Modulation of cholesterol transport by insulin- treated gestational diabetes mellitus in human full-term placenta. Biology of reproduction 2013; 88:16.

39. Stefulj J, Panzenboeck U, Becker T, Hirschmugl B, Schweinzer C, Lang I, et al . Human endothelial cells of the placental barrier efficiently deliver cholesterol to the fetal circulation via ABCA1 and ABCG1. Circulation research 2009; 104:600-8.

40. Palinski W. Maternal-fetal cholesterol transport in the placenta: good, bad, and target for modulation. Circulation research 2009; 104:569-71.

41. Zhang Y, Kent JW, 2nd, Lee A, Cerjak D, Ali O, Diasio R, et al . Fatty acid binding protein 3 (fabp3) is associated with insulin, lipids and cardiovascular phenotypes of the metabolic syndrome through epigenetic modifications in a northern european family population. BMC medical genomics 2013; 6:9.

42. Bell JT, Tsai PC, Yang TP, Pidsley R, Nisbet J, Glass D, et al . Epigenome-wide scans identify differentially methylated regions for age and age-related phenotypes in a healthy ageing population. PLoS genetics 2012; 8:e1002629.

43. Lesseur C, Armstrong DA, Paquette AG, Koestler DC, Padbury JF, Marsit CJ. Tissue- specific Leptin promoter DNA methylation is associated with maternal and infant perinatal factors. Molecular and cellular endocrinology 2013.

182

44. Fowden AL, Sferruzzi-Perri AN, Coan PM, Constancia M, Burton GJ. Placental efficiency and adaptation: endocrine regulation. The Journal of physiology 2009; 587:3459-72.

45. Yang J, Cummings EA, O'Connell C, Jangaard K. Fetal and neonatal outcomes of diabetic pregnancies. Obstetrics and gynecology 2006; 108:644-50.

46. Bunt JC, Tataranni PA, Salbe AD. Intrauterine exposure to diabetes is a determinant of hemoglobin A(1)c and systolic blood pressure in pima Indian children. The Journal of clinical endocrinology and metabolism 2005; 90:3225-9.

47. Boney CM, Verma A, Tucker R, Vohr BR. Metabolic syndrome in childhood: association with birth weight, maternal obesity, and gestational diabetes mellitus. Pediatrics 2005; 115:e290-6.

48. Roseboom TJ, van der Meulen JH, Osmond C, Barker DJ, Ravelli AC, Schroeder- Tanka JM, et al . Coronary heart disease after prenatal exposure to the Dutch famine, 1944-45. Heart 2000; 84:595-8.

49. Roseboom TJ, van der Meulen JH, Ravelli AC, Osmond C, Barker DJ, Bleker OP. Effects of prenatal exposure to the Dutch famine on adult disease in later life: an overview. Twin research : the official journal of the International Society for Twin Studies 2001; 4:293-8.

50. Hinault C, Van Obberghen E, Mothe-Satney I. Role of amino acids in insulin signaling in adipocytes and their potential to decrease insulin resistance of adipose tissue. The Journal of nutritional biochemistry 2006; 17:374-8.

51. Lohman TG RAaMR. Anthropometric Standardization Reference Manual. Champaign, IL: Human Kinetics Books, 1988.

52. Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low- density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clinical chemistry 1972; 18:499-502.

183

53. Ahima RS. Digging deeper into obesity. The Journal of clinical investigation 2011; 121:2076-9.

54. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia 1985; 28:412-9.

55. Heding LG. Radioimmunological determination of human C-peptide in serum. Diabetologia 1975; 11:541-8.

56. Meller M, Vadachkoria S, Luthy DA, Williams MA. Evaluation of housekeeping genes in placental comparative expression studies. Placenta 2005; 26:601-7.

57. Murthi P, Fitzpatrick E, Borg AJ, Donath S, Brennecke SP, Kalionis B. GAPDH, 18S rRNA and YWHAZ are suitable endogenous reference genes for relative gene expression studies in placental tissues from human idiopathic fetal growth restriction. Placenta 2008; 29:798-801.

58. Drewlo S, Levytska K, Kingdom J. Revisiting the housekeeping genes of human placental development and insufficiency syndromes. Placenta 2012; 33:952-4.

CHAPITRE 6 - ARTICLE 5

Fetal epigenetic programming of adipokines

Auteurs de l’article : Andrée-Anne Houde, Marie-France Hivert et Luigi Bouchard.

Statut de l’article : Publié dans la revue Adipocyte

Houde AA, Hivert MF, Bouchard L. 2013. Fetal epigenetic programming of adipokines. Adipocyte. 2(1): 41-46.

Avant-propos : Cet article est le premier d’une série de trois portant sur l’étude de la méthylation de deux gènes candidats de la programmation métabolique fœtale, les gènes LEP et ADIPOQ . Dans ce bref article, nous présentons les résultats d’études antérieures démontrant l’impact du DG sur la méthylation de LEP et ADIPOQ et nous comparons la méthylation des ces gènes dans la placenta et le sang de cordon. De plus, nous discutons des défis rencontrés dans le cadre de l’étude des mécanismes épigénétiques impliqués dans la programmation fœtale. Je suis première auteure de ce manuscrit, j’ai fait les analyses statistiques et l’interprétation des résultats et j’ai été la principale rédactrice de l’article.

185

RÉSUMÉ : L’épigénétique suscite beaucoup d’intérêt dans les domaines de recherche sur les traits complexes incluant l’obésité et le diabète. Récemment, notre équipe à rapporté que des épipolymorpshimes des gènes leptine ( LEP ) et adiponectine ( ADIPOQ ) au niveau du placenta sont associés avec l’hyperglycémie maternelle pendant la grossesse. Nos résultats suggèrent que le méthylation de l’ADN pourrait partiellement expliquer le lien entre l’exposition à un environnement fœtal défavorable et le risque accru de développer l’obésité et le diabète. Ce rapport discute brièvement de l’importance des modifications épigénétiques des gènes des adipokines dans la programmation métabolique fœtale. Il présente également des résultats préliminaires démontrant des similarités entre les patrons de variations de méthylation dans différents types de tissus et de cellules ainsi que les défis et les perspectives de ce domaine de recherche en pleine émergence.

186

FETAL EPIGENETIC PROGRAMMING OF ADIPOKINES

Andrée-Anne Houde 1,2 , Marie-France Hivert 3,4 and Luigi Bouchard 1,2

1. Department of biochemistry, Université de Sherbrooke, Sherbrooke, Qc, Canada; 2. ECOGENE-21 and Clinical Research Center and Lipid Clinic, Chicoutimi Hospital, Saguenay, Qc, Canada; 3. Department of Medicine, Université de Sherbrooke, Sherbrooke, Qc, Canada; 4. General Medicine Division, Massachusetts General Hospital, Boston, MA. USA.

187

ABSTRACT Epigenetics generates a considerable interest in the fields of research on complex traits, including obesity and diabetes. Recently, we reported a number of epipolymorphisms in the placental leptin and adiponectin genes associated with maternal hyperglycemia during pregnancy. Our results suggest that DNA methylation could partly explain the link between early exposure to a detrimental fetal environment and an increased risk to develop obesity and diabetes later in life. This brief report discusses the potential importance of adipokine epigenetic changes in fetal metabolic programming. Additionally, preliminary data showing similarities between methylation variations of different tissues and cell types will be presented along with the challenges and future perspectives of this emerging field of research.

Keywords: leptin, adiponectin, fetal programming, Barker hypothesis, gestationnal diabetes, placenta, DNA methylation, gene expression

188

Obesity is a recognized risk factor for a number of metabolic disorders including pregnancy complications such as gestational diabetes mellitus (GDM). 1 GDM is defined as glucose intolerance with onset or first recognition during pregnancy. 2 Its prevalence ranges from 2% to 10% and can reach 20% in high-risk populations. 3,4 GDM is the most common form of hyperglycemic disorder during pregnancy, and affected women are at increased risk for developing type 2 diabetes (T2D) later in life. 5 Furthermore, offspring exposed to maternal hyperglycemia during their in utero development have been shown to be more prone to metabolic disorders related to excess weight and insulin resistance, as early as adolescence and young adulthood. 6,7

A few years ago, we undertook a research program aiming at understanding whether a suboptimal intrauterine environment alters the newborn’s methylome signature (the genome DNA methylation program). From an evolutionary standpoint, we can postulate that these epigenetic changes evolved at some point in history in order to match the efficiency of a newborn’s metabolism with the poor postnatal environment that he would have faced. 8 In the 21st century however, metabolic programming to optimize energy storage and fuel efficiency are believed to increase the long-term susceptibility of the newborn to obesity and associated metabolic disorders. Indeed, access to food is no longer a challenge in developed countries as well as in most developing countries.

The risk of developing obesity and its related metabolic disorders after exposure to a suboptimal intrauterine environment was first proposed by David J. Barker. 9 It was supported by a large number of epidemiological studies highlighting the importance of intrauterine life for the metabolic health programming of the newborn. 10,11 However, the underlying molecular mechanisms are still poorly understood. Recently, the hypothesis of epigenetic mechanisms emerged to explain the link between an exposure to an adverse fetal environment and obesity later in life. 12 DNA methylation is the most studied epigenetic mark. It consists in the addition of a methyl group on the fifth carbon of the cytosines within cytosine-guanine dinucleotides (CpGs). 13 This modification is sensitive to environmental stimuli but is also mitotically stable and heritable. 14 Hence, it can be stable over time and passed on to the next generations. 13 DNA methylation is generally associated with gene

189 transcription repression, and so by consequence a low level of methylation (usually in the promoter region of the genes) allows a higher expression of the encoded protein. 15

Keeping in mind this context, we first focused our investigations on the impact of maternal hyperglycemia on epigenetic changes at candidate gene loci involved in energy metabolism regulation. We therefore studied leptin and adiponectin genes DNA methylation levels in placenta biopsies and cord blood samples exposed or not to GDM (hyperglycemic in utero environment). 16,17 We are aware that many other genes are implicated in obesity- related disorders and might be influenced by fetal epigenetic adaptations. However, these well-known adipokines were obvious candidate genes for metabolic disorders because they are secreted by the adipose tissue and involved in energy metabolism and insulin sensibility regulation. 18 Briefly, we have reported that placental DNA methylation profiles of the two adipokines were influenced by exposure to maternal hyperglycemia. 16,17 Interestingly, DNA methylation levels of leptin and adiponectin genes decreased with increased blood glucose concentration (2 h post-OGTT) in the fetal side placenta tissue suggesting that maternal hyperglycemia (insulin does not cross the placental barrier) has similar effects on both genes (Figure 6.1). However, we observed in tissue from the maternal side of the placenta that leptin gene DNA methylation increased with post-prandial hyperglycemia (2 h post-OGTT), whereas the DNA methylation at the adiponectin gene locus decreased with increased insulin resistance (HOMA-IR). These observations is counterintuitive (DNA methylation is associated with gene expression repression as our results suggest), since insulin is known to upregulate leptin transcription and downregulate adiponectin gene expression. 19,20 This apparent contradiction is not easy to explain, but we can hypothesize that DNA methylation changes at these two loci are induced to partially counterbalance the effects of insulin on these genes’ expression regulation. Studies in adipose tissue would clearly be helpful to better understand this phenomenon. Interestingly, associations were also observed between the epipolymorphisms tested in these studies and leptin gene expression or circulating concentration of both adiponectin and leptin. 16,17 These observations suggest that DNA methylation changes at these loci are functional and potentially reflect biological phenomena occurring in other cell types such as adipocytes.

190

Figure 6.1- Correlation between leptin gene promoter (A) or adiponectin CpG island E2 (B) DNA methylation levels and 2 h post-OGTT glycemia Data were corrected for anthropometric confounders (BMI and weight gain between first and third trimester)

191

Placenta is a key regulator of feto-maternal nutrient exchange and develops in parallel of the fetus. Therefore, we expect that our observations on the fetal side of the placenta reflect epigenetic marks in other key fetal tissues involved in energy and growth. It is likely that disturbances of adiponectin and leptin methylome in other tissues involved in energy metabolism regulation (e.g., adipose tissue) may interfere with postnatal growth and development. Although it has yet to be tested, we expect that the reported disturbances of the newborn DNA methylation profile in response to GDM exposure will be fairly stable throughout life. They would thus partly explain the “metabolic programming” hypothesized by Barker. This long-term effect has been suggested previously for the leptin gene in one other study. 14 This study argued that the epigenome signature at birth could have long-term functional impacts on energy metabolism and insulin sensitivity, thus triggering the newborn’s long-term susceptibility to obesity and type 2 diabetes. Our results strengthen the hypothesis that epigenetic variations are part of the process linking hyperglycemic exposure to the long-term risk of metabolic disorders in offspring using adipokines genes as proof of concept. We suspect that DNA methylation levels at many other genes involved in fetal growth, development and energy metabolism, for instance, will also be modulated by an exposure to maternal hyperglycemia. One of the challenges that epigenetics will tackle is precisely to reveal which genes are part of known—or still unknown—pathways involved in GDM-related fetal programming.

Another important challenge in human epigenetic studies is the access to appropriate, informative tissues. In the context of adipokines, the ideal tissues are obviously adipose tissues but this is hardly ethically acceptable for newborns and infants. Currently, we rely on placenta biopsies and cord blood samples to conduct our DNA methylation analyses. Cord blood cells are from fetal origin and somewhat readily accessible. In addition, circulating cord blood cells have been shown to be involved in inflammation regulation (and inflammation is a landmark of obesity). 21 Placenta was also selected because of its central role in energy transfer from the mother to the fetus; it is metabolically very active and is associated with fetal growth and development (key phenomena since birth weight is strongly associated with an increased long-term obesity risk). 22,23 We expect that both cell types will at least partially reflect the DNA methylation profile in other tissues (e.g., adipose tissue). How the DNA methylation profile correlates between cell types has been shown for specific

192 loci but remains mostly unknown; limited data suggest that it may vary depending on tissues and exposure. Interestingly, additional analyses in our samples comparing DNA methylation values of CpG sites in leptin and adiponectin genes across cord blood samples and maternal and fetal placenta biopsies suggest that cytosine methylation variations share some similarities across these tissues. As illustrated, methylation levels seem to vary around a similar mean value at each CpG site of leptin (Figure 6.2-Panel A) and adiponectin (Figure 6.2-Panel B) genes. This was once observed before for leptin, in liver and visceral adipocyte fractions of white adipose tissue, by Marchi et al ., but was not discussed by the authors. 24 At the least, these observations suggest that DNA methylation varies concurrently between tissues around predefined (heritable?) values, which seem independent from one CpG site to another. We hypothesize that the variability in DNA methylation (around those “predefined” points) is induced by stochastic, genetic (gene polymorphisms), environmental as well as metabolic factors (as we have shown). Methylation values of specific CpG sites under normal conditions (“predefined” values) as well as the mechanisms involved in the establishment and regulation of DNA methylation under these conditions are still poorly defined. To increase our understanding of these values and mechanisms could help us assess the impact of genotype, environment and stochastic events on DNA methylation alterations and their role in pathogenesis. 25,26 Further studies will also be needed to determine the potential heritability of the predefined DNA methylation values.

193

Figure 6.2- Average methylation levels of CpG sites within leptin and adiponectin gene loci in the placenta and cord blood Panel A- Average methylation levels for CpG sites analyzed in maternal ( ) and fetal ( ) sides of the placenta for leptin gene promoter (n = 47). In panel B, cord blood ( Δ) (n = 39) and maternal ( ) and fetal ( ) placental tissues (n = 97) average cytosine methylation for adiponectin gene CpG island C1 and E2. Spearman correlation between methylation of CpG sites in maternal and fetal tissues and cord blood: *p ≤ 0.05 and ** p ≤ 0.01. CpG sites were the same as previously described. 16,17

194

The DNA methylation correlation between tissues is incomplete (Tables 6.1 and 6.2). Even more intriguing, despite relatively similar variations around the “predefined” set-point values between fetal and maternal sides, the overall correlation for average methylation levels is fairly low for the leptin promoter region (r s = 0.20; p = 0.17) and is highly variable from one CpG site to another (Spearman correlations from r = 0.12 to 0.54) (Table 6.1). We observed a similar phenomenon in the ADIPOQ where despite obvious similar patterns in the population (Figure 6.2-Pannel B), the individual correlations at each site were fairly low

(correlations between maternal and fetal placenta: ADIPOQ-C1 r s = 0.18; p = 0.07 and

ADIPOQ-E2 r s = 0.14; p = 0.17). The correlation between each CpG sites was lower for the adiponectin gene across cord blood and both placental tissues (r s = 0.02–0.34) (Tables 6.1 and 6.2).

Table 6.1- Spearman correlation coefficient between CpG sites methylation of leptin gene promoter and adiponectin gene loci C1 and E2 in maternal and fetal sides of placenta CpG sites rs p value LEPTIN (n=47) 1-2-3 0.31 0.04 4-5-6 0.12 0.43 7 0.30 0.04 8 0.22 0.13 9-10 0.40 < 0.01 11 0.01 0.96 12 0.19 0.19 13 -14 0.32 0.03 15 0.54 < 0.01 16 -17 0.37 0.01 19 -20 -21 0.44 < 0.01 22 0.23 0.12 23 -24 -25 0.34 0.02 26 -27 -28 0.31 0.04 29 -30 -31 0.25 0.09 1 to 31 (mean) 0.20 0.17 ADIPOQ -C1 (n=97) 1 0.30 < 0.01 2 0.13 0.22 3 0.24 0.02 4 0.27 0.01 1 to 4 (mean) 0.18 0.07 ADIPOQ -E2 (n=97) 1 0.02 0.84 2 0.25 0.02 3 0.06 0.56 4 0.10 0.34 1 to 4 (mean) 0.14 0.17

195

Table 6.2- Spearman correlation coefficient between cord blood CpG sites methylation for adiponectin gene loci C1 and E2 and maternal and fetal sides of placenta Maternal side Fetal side CpG sites rs p value rs p value

ADIPOQ -C1 1 -0.10 0.54 -0.14 0.38 (n=39) 2 -0.02 0.88 -0.34 0.04 3 0.25 0.12 -0.06 0.74 4 N/A * N/A * 1 to 3 (mean) 0.13 0.42 -0.15 0.36

ADIPOQ -E2 1 -0.06 0.71 0.03 0.88 (n=39) 2 -0.05 0.76 -0.08 0.63 3 0.08 0.64 0.02 0.93 4 -0.20 0.23 -0.14 0.40 1 to 4 (mean) 0 0.10 -0.08 0.64 *Values are not available since cord blood was fully methylated (100%) at this CpG site

The relatively limited number of samples and tissues analyzed in current epigenetic studies is also a challenging issue. We believe that epigenetic studies should target to apply standards similar to those of traditional genetic research, using larger samples and including more than one population (or cohort) to confirm the results. To achieve this goal, new affordable epigenotyping strategies will have to be developed as the cost for epigenetic analyses is currently about 20 times more expensive than “standard” genetic analyses for the detection of polymorphisms. Cost is an important issue because it directly limits the number of samples (between 50 and 300 in the largest studies) and tissues (limited to a single tissue in most studies) in available reports. Although the DNA methylation microarray such as the Illumina HumanMethylation450 BeadChips offers a cost-effective but still expensive approach, new technologies such as whole epigenome-sequencing are needed to enable testing of DNA methylation levels across the whole genome and in larger samples (hopefully in many tissues). Such technology will also probably lead to many statistical analyses challenges (such as the burden of multiple testing) similar to those that were tackled when the use of genome-wide association study (GWAS) exploded a few years ago.

Another efficient and cost-effective way to increase our confidence in the results of epigenetic analyses is to expend the analysis strategy to other “omic” sciences. This is precisely the approach that we have favored and currently apply. Accordingly, we measure

196 mRNA and protein levels of the targeted genes when expressed and secreted by the available tissue. Taken together epigenetic, transcriptomic and proteomic results, when converging, are strong arguments in support of the results; they increase our confidence that the observed associations reflect true biologic phenomena. When feasible, this strategy should be applied.

The accumulated evidence now strongly supports an association of detrimental in utero environment with newborns’ epigenetic changes. However, the impacts of these changes on the long-term health of newborns remain to be uncovered. This knowledge is fundamental to prove that epigenetics is involved in fetal metabolic programming (Barker’s hypothesis). Large longitudinal (from birth to adulthood) cohorts with repeated measurement of phenotypes, genotypes and epigenotypes (hopefully in various key tissues such as adipose tissue) is needed to achieve this goal. Such a prospect may appear ambitious, but large longitudinal cohort studies would indeed provide the solid scientific ground to support the role of epigenetics in fetal metabolic programming in addition to arguments to shore up obesity prevention programs to be applied as early as conception. To provide women with an early pregnancy lifestyle intervention would allow to test whether epigenetic changes related to maternal metabolic disorders can be prevented. Finally, such studies would also add to the scientific evidence supporting the importance of epigenetic changes among the early determinants of adult chronic diseases.

At the present time, only a few studies have been performed at the molecular level to support the involvement of epigenetics in newborn metabolic programming. We have shown that maternal glycemia is associated with DNA methylation changes at two adipokine gene loci in the placenta; yet many more obesity-related genes remain to be investigated. According to our results, these adipokine epigenetic adaptations are likely functional and may have impacts on the long-term regulation of newborns’ energy metabolism. Furthermore, our latest findings suggest that DNA methylation of each cytosine within the leptin and adiponectin genes varies concurrently around “predefined” values, a biologic phenomenon virtually unexplored. These results pave the way for the use of tissues that would be more readily available to predict DNA methylation of adipokines in the newborn. Studies will have to be conducted with adipocytes to confirm our observations because adipocytes are at the center-point of the energy metabolism regulation that secretes these

197 same adipokines. Yet a number of challenges remain and will have to be addressed in the next years to see epigenetics meet its promises.

198

DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST No potential conflicts of interest were disclosed.

AUTHORS’ CONTRIBUTIONS A.-A.H. performed the data analysis/interpretation and wrote the manuscript; M.-F.H. and L.B. conceived the study design and revised the manuscript.

ACKNOWLEDGMENTS We also express our gratitude to Céline Bélanger, Chicoutimi Hospital, for her thoughtful language revision of the manuscript. L.B. and M.-F.H. are junior research scholars from the Fonds de la recherche en santé du Québec. M.-F.H. is also supported by a Canadian Diabetes Association clinical scientist award. L.B. and M.-F.H. are members of the FRSQ-funded Centre de recherche clinique Étienne-Le Bel (affiliated with Centre Hospitalier de l’Université de Sherbrooke).

199

REFERENCES

1. Chu SY, Callaghan WM, Kim SY, Schmid CH, Lau J, England LJ, et al . Maternal obesity and risk of gestational diabetes mellitus. Diabetes Care 2007; 30: 2070-6. 2. Choi SH, Zhao ZS, Lee YJ, Kim SK, Kim DJ, Ahn CW, et al . The different mechanisms of insulin sensitizers to prevent type 2 diabetes in OLETF rats. Diabetes Metab Res Rev 2007; 23:411-8. 3. Kim SY, Dietz PM, England L, Morrow B, Callaghan WM. Trends in pre-pregnancy obesity in nine states, 1993-2003. Obesity (Silver Spring) 2007; 15:986-93. 4. Galtier F. Definition, epidemiology, risk factors. Diabetes Metab 2010; 36:628-51. 5. Bellamy L, Casas JP, Hingorani AD, Williams D. Type 2 diabetes mellitus after gestational diabetes: a systematic review and meta-analysis. Lancet 2009; 373:1773-9. 6. Hillier TA, Pedula KL, Schmidt MM, Mullen JA, Charles MA, Pettitt DJ. Childhood obesity and metabolic imprinting: the ongoing effects of maternal hyperglyce-mia. Diabetes Care 2007; 30:2287-92. 7. Dabelea D, Mayer-Davis EJ, Lamichhane AP, D’Agostino RB, Jr., Liese AD, Vehik KS, et al . Association of intrauterine exposure to maternal diabetes and obesity with type 2 diabetes in youth: the SEARCH Case-Control Study. Diabetes Care 2008; 31:1422-6. 8. Heijmans BT, Tobi EW, Stein AD, Putter H, Blauw GJ, Susser ES, et al . Persistent epigenetic differences associated with prenatal exposure to famine in humans. Proc Natl Acad Sci U S A 2008; 105:17046-9. 9. Barker DJ. Intrauterine programming of adult disease. Mol Med Today 1995; 1:418- 23. 10. Hales CN, Barker DJ. The thrifty phenotype hypo-thesis. Br Med Bull 2001; 60:5-20. 11. Tounian P. Programming towards childhood obesity. Ann Nutr Metab 2011; 58(Suppl 2):30-41. 12. Lillycrop KA, Burdge GC. Epigenetic changes in early life and future risk of obesity. Int J Obes (Lond) 2011; 35:72-83. 13. Bird A. DNA methylation patterns and epigenetic memory. Genes Dev 2002; 16:6-21. 14. Tobi EW, Lumey LH, Talens RP, Kremer D, Putter H, Stein AD, et al . DNA methylation differences after exposure to prenatal famine are common and timing- and

200

sex-specific. Hum Mol Genet 2009; 18:4046-53. 15. Turner BM. Defining an epigenetic code. Nat Cell Biol 2007; 9:2-6. 16. Bouchard L, Thibault S, Guay SP, Santure M, Monpetit A, St-Pierre J, et al . Leptin gene epigenetic adaptation to impaired glucose metabolism during pregnancy. Diabetes Care 2010; 33:2436-41. 17. Bouchard L, Hivert MF, Guay SP, St-Pierre J, Perron P, Brisson D. Placental adiponectin gene DNA methylation levels are associated with mothers’ blood glucose concentration. Diabetes 2012; 61:1272-80. 18. Havel PJ. Control of energy homeostasis and insulin action by adipocyte hormones: leptin, acylation stimulating protein, and adiponectin. Curr Opin Lipidol 2002; 13:51- 9. 19. MacDougald OA, Hwang CS, Fan H, Lane MD. Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3-L1 adipocytes. Proc Natl Acad Sci U S A 1995; 92:9034-7. 20. Fasshauer M, Klein J, Neumann S, Eszlinger M, Paschke R. Hormonal regulation of adiponectin gene expression in 3T3-L1 adipocytes. Biochem Biophys Res Commun 2002; 290:1084-9. 21. Trayhurn P, Wood IS. Signalling role of adipose tissue: adipokines and inflammation in obesity. Biochem Soc Trans 2005; 33:1078-81. 22. Curhan GC, Chertow GM, Willett WC, Spiegelman D, Colditz GA, Manson JE, et al . Birth weight and adult hypertension and obesity in women. Circulation 1996; 94:1310- 5. 23. Curhan GC, Willett WC, Rimm EB, Spiegelman D, Ascherio AL, Stampfer MJ. Birth weight and adult hypertension, diabetes mellitus, and obesity in US men. Circulation 1996; 94:3246-50. 24. Marchi M, Lisi S, Curcio M, Barbuti S, Piaggi P, Ceccarini G, et al . Human leptin tissue distribution, but not weight loss-dependent change in expression, is associated with methylation of its promoter. Epigenetics 2011; 6:1198-206. 25. Christensen BC, Houseman EA, Marsit CJ, Zheng S, Wrensch MR, Wiemels JL, et al . Aging and environmental exposures alter tissue-specific DNA methylation dependent upon CpG island context. PLoS Genet 2009; 5:e1000602.

201

26. Langevin SM, Houseman EA, Christensen BC, Wiencke JK, Nelson HH, Karagas MR, et al . The influence of aging, environmental exposures and local sequence features on the variation of DNA methylation in blood. Epigenetics 2011; 6:908-19.

CHAPITRE 7 - ARTICLE 6

Cross-tissue comparisons of leptin and adiponectin DNA methylation profiles

Auteurs de l’article : Andrée-Anne Houde, Cécilia Légaré, Frédéric-Simon Hould, Stéfane Lebel, Picard Marceau, André Tchernof, Marie-Claude Vohl, Marie-France Hivert et Luigi Bouchard.

Statut de l’article : Publié dans la revue Adipocyte

Houde AA, Légaré C, Hould FS, Lebel S, Marceau P, Tchernof A, Vohl MC, Hivert MF, Bouchard L. 2014. Cross-tissue comparisons of leptin and adiponectin DNA methylation profiles. Adipocyte. 3(2): 132-40.

Avant-propos : Dans cet article, nous avons comparé les marques de méthylation de LEP et d’ADIPOQ dans le sang et les tissus adipeux sous-cutané et viscéral afin d’explorer la spécificité tissulaire de chacunes d’entre elles. En tant que première auteure, j’ai effectué les analyses des niveaux de méthylation et d’expression, l’analyse et l’interprétation des données ainsi qu’à la rédaction du manuscrit.

203

RÉSUMÉ : Les études épigénétiques analysent généralement la méthylation de l’ADN dans les cellules sanguines. Bien que le sang soit facilement accessible en clinique, l’analyse de tissu métaboliquement actif, tel que le tissue adipeux, s’avèrerait plus informative pour l’étude des maladies métaboliques. La méthylation de l’ADN des cellules sanguines pourrait possiblement être utilisée pour représenter le profil de méthylation des tissus adipeux. Pour ce faire, nous devons d’abord déterminer si le profil de méthylation de l’ADN du sang est corrélé avec celui du tissue adipeux. Dans cette étude, nous rapportons que pour les gènes LEP et ADIPOQ, le patron de variation de la méthylation d’un CpG à un autre est très similaire dans le sang et les tissus adipeux. Nous avons aussi démontré que la méthylation de l’ADN, au niveau de sites CpGs potentiellement biologiquement actifs, est corrélée dans le sang, le tissu adipeux sous-cutané et le tissu adipeux viscéral. La méthylation de ces sites CpG ou de sites CpG voisins est aussi associée au niveau d’expression des gènes LEP et ADIPOQ dans les tissus adipeux. Ces résultats préliminaires sont des plus pertinents pour les études épigénétiques futures en lien avec les maladies métaboliques.

204

CROSS-TISSUE COMPARISONS OF LEPTIN AND ADIPONECTIN DNA METHYLATION PROFILES

Andrée-Anne Houde 1,2 M.Sc., Cécilia Légaré 1,2 ; Frédéric-Simon Hould 3 M.D., Stéfane Lebel 3 M.D., Picard Marceau 3 M.D. Ph.D., André Tchernof 3,4,5 Ph.D., Marie-Claude Vohl 4,5 Ph.D. , Marie-France Hivert 6,7,8 M.D. M.M.Sc., and Luigi Bouchard 1,2 Ph.D. MBA.

1. Department of biochemistry, Université de Sherbrooke, Sherbrooke, Qc, Canada; 2. ECOGENE-21 and Clinical Research Center and Lipid Clinic, Chicoutimi Hospital, Saguenay, Qc, Canada; 3. Department of Surgery, IUCPQ, Quebec, Qc, Canada; 4. INAF, Université Laval, Quebec, Qc, Canada; 5. Axe Endocrinologie et néphrologie, Centre de recherche du CHU de Québec, Quebec, Qc, Canada; 6. Department of Medicine, Division of Endocrinology, Université de Sherbrooke, Sherbrooke, Qc, Canada. 7. Department of Population Medicine, Harvard Pilgrim Health Care Institute, Boston, MA; and 8. General Medicine Division, Massachusetts General Hospital, Boston, MA.

205

ABSTRACT DNA methylation has been mostly studied in circulating blood cells. Although being readily accessible, metabolically active tissues such as adipose tissue would be more informative for the study of metabolic disorders. However, whether or not the blood DNA methylation profile correlates with that of adipose tissue remains unknown. In this study, DNA methylation patterns of variation at LEP and ADIPOQ gene loci were similar between individual CpGs across the different tissues. We also report that DNA methylation levels at biologically relevant CpGs are correlated between blood, subcutaneous and visceral adipose tissue, and that these nearby CpGs are associated with LEP and ADIPOQ gene expression in adipose tissues. These results will be highly relevant for future epigenetic studies in metabolic disorders.

Keywords: Epigenetics, blood, subcutaneous adipose tissue and visceral adipose tissue.

List of abbreviations: ADIPOQ , adiponectin; BMI, body mass index ; C/EBP , CCAAT/Enhancer Binding Protein; HLF , Hepatic Leukemia Factor ; IGT, impaired glucose tolerance; LEP , leptin; MIF-1, Macrophage Migration Inhibitory Factor ; RIN, RNA integrity number; SAT, subcutaneous adipose tissue; TFBS, transcription factor binding site; VAT, visceral adipose tissue.

206

INTRODUCTION The LEP and ADIPOQ genes, encoding for leptin and adiponectin respectively, have drawn much attention in candidate gene studies on obesity and its related metabolic disorders. These adipokines are mainly produced and secreted by adipocytes and are important regulators of energy metabolism and insulin sensitivity. 1, 2 Recent studies suggested that these two adipokines are involved in the fetal metabolic health programing of the newborn through epigenetic adaptations in response to a changing in utero environment. Indeed, we have recently reported correlations between placental DNA methylation levels at the LEP and ADIPOQ gene loci and maternal blood glucose concentrations (2h-post oral glucose tolerance test) at second trimester of pregnancy. 3-5 A high maternal glucose concentration has been previously associated with a long term susceptibility to obesity and related metabolic disorders in the newborn. 6-8 Moreover, Tobi et al.9 have observed higher LEP DNA methylation levels in leukocytes of men exposed prenatally to the ending World War 2 Dutch famine in comparison with unexposed siblings, suggesting that epigenetic marks imprinted during fetal life at the LEP locus could last over 60 years after birth.

DNA methylation marks consist in the addition of a methyl group at position 5’ of the pyrimidine ring of the cytosines upstream of a guanine (dinucleotide CpG) catalyzed by DNA methyltransferases. 10, 11 The establishment of DNA methylation marks during fetal life is crucial for cellular differentiation, X chromosome inactivation, genomic imprinting and normal embryonic development.12, 13 Embryonic DNA methylation marks are mitotically stable thus they can have a long-term functional impact and can be partially transmitted to the next generation. 14-18 Although transcriptional regulation through DNA methylation is tissue-specific 19-21 , it has been suggested that embryonic epigenetic marks set early during cellular differentiation and division are similar in various tissues. 22-24 These similarities could be of importance when access to metabolically active tissues (e.g. adipose tissue) is limited, and especially when studying epigenetically affected genes in the context of in utero or fetal metabolic programming.

The objective of the current study was to compare LEP and ADIPOQ epigenetic profiles in blood, subcutaneous (SAT) and visceral (VAT) adipose tissue samples from the

207 same obese class III 22 subjects in order to characterize tissue-specific DNA methylation at these two adipokine gene loci. The comparison of adipokine DNA methylation levels in blood and adipose tissues will tell us whether or not readily accessible blood cells can reflect the DNA methylation profile of metabolically active tissues and can eventually be used to predict a lifelong susceptibility to obesity and associated metabolic disorders.

208

RESULTS AND DISCUSSION DNA methylation and mRNA level analyses at the LEP gene locus Blood, SAT and VAT were obtained from 73 obese class III 22 subjects with Body Mass Index (BMI) ranging from 40.0-60.0 kg/m 2 (mean: 49.6 ± 6.0 kg/m 2) (sample characteristics in Table 7.1). DNA methylation levels were assessed in blood, SAT and VAT at 21 CpGs out of the 31 that we 3 and Melzner et al.25 have previously epigenotyped in the proximal promoter CpG island of the LEP gene (Figure 7.1).

Table 7.1- Characteristics of subjects according to sex Men Women (n=33) (n=40) Mean ± SD Min-max Mean ± SD Min-max Age (years) 35.2 ± 6.9 21.5 -49.7 34.2 ± 7.3 21.4 -53.8 Height (m) 1.76 ± 0.08 1.59 -1.90 1.62 ± 0.06 ** 1.50 -1.76 Weight (kg) 158.7 ± 21.0 125.8 -200.2 127.5 ± 17.8 ** 90.2 -168.6 BMI (kg/m 2) 51.1 ± 5.3 42.0 -59.5 48.4 ± 6.3 * 40.0 -60.0 Hip circumference (cm) 148.5 ± 14.0 123.0 -173.0 147.0 ± 14.1 126.0 -193.0 Waist circumference (cm) 150.6 ± 13.4 129.0 -180.0 130.0 ±12.8 ** 99.0 -152.0 Waist Hip Ratio 1.02 ± 0.08 0.82 -1.16 0.89 ± 0.09 ** 0.67 -1.17 Fasting Glucose levels (mmol/L) 5.69 ± 1.05 4.20 -8.70 5.36 ± 1.04 4.00 -8.70 BMI, body Mass Index; SAT, subcutaneous adipose tissue; VAT, visceral adipose tissue aGeometric mean ; Values are significantly different between men and women: ** p<0.01 ;*p<0.05

DNA methylation levels at these 21 CpG sites analysed within the LEP gene promoter were found to be highly variable within the region and across the three tissues analysed. On average, the correlation coefficients between DNA methylation levels at these 21 CpG sites were found to be modest to very high in blood (r=0.12 to 0.92), SAT (r=0.01 to 0.82) and VAT (r=0.01 to 0.86) (Figure 7.2).

209

Figure 7.1- CpG island within LEP gene proximal promoter region The LEP exon 1 sequence is in bold type. The CpG sites are numbered according to Bouchard et al . 2010, and the underlined CpG sites were epigenotyped in the current study. DNA methylation levels at each CpG site were compared between blood, subcutaneous (SAT) and visceral (VAT) adipose tissues using the paired sample t-test.

210

Figure 7.2- Pearson correlation coefficients between CpGs at LEP proximal promoter locus in blood (A), subcutaneous (B) and visceral (C) adipose tissues

211

For most of the CpG sites analysed, methylation values were 1.5 to 2.0 times higher in blood than in SAT and VAT (Figure 7.3-Panel A). These results confirm previous findings from Marchi et al .26 and Stoger et al .27 showing that LEP DNA methylation is higher in tissues known to express lower LEP mRNA levels . The highest DNA methylation differences (>10.0%) between blood and adipose tissues at the LEP gene promoter locus were observed at CpG4, CpG11, CpG24, CpG29, CpG30 and CpG31 with CpG11 being the most significant (Figure 7.1).

Figure 7.3 - DNA methylation levels at LEP gene promoter (A) and ADIPOQ CpG island E (B) CpG sites in blood (white), subcutaneous (black) and visceral (grey) adipose tissues (n=73) Error bars represent the standard deviation (SD). Mean DNA methylation levels were compared with the paired sample Student t-test. Bars with different letters indicate means that are significantly different from each other ( p≤ 0.05) after adjustment for multiple testing .

212

Interestingly, CpG4 is found on the Macrophage Migration Inhibitory Factor (MIF-1) transcription factor binding site (TFBS) and CpG11 on or nearby the CCAAT/Enhancer Binding Protein (C/EBP ), Hepatic Leukemia Factor (HLF) and c-MYB TFBS suggesting that these CpG sites may be important for tissue-specific LEP expression regulation (Figure 7.4). The functional significance of CpG11 is also supported by its location within a highly conserved region across all placental mammals (Figure 7.4). This CpG site was previously shown to be strongly differentially methylated between tissues with low (liver) and high (visceral adipocyte) mRNA levels of LEP .26 Moreover, the regulation of LEP gene promoter activity by DNA methylation at C/EBP TFBS has previously been reported. 25 No transcriptional regulatory element was identified at CpG24, CpG29, CpG30 and CpG31 of the LEP gene promoter.

Next, we report that the correlation between DNA methylation levels at each individual CpG site was tissue- and site-specific. After multiple testing corrections, LEP DNA methylation levels at 14 individual CpG sites were found to be significantly correlated between SAT and VAT, whereas 6 and 2 CpGs were significantly correlated between blood and SAT and blood and VAT, respectively (Table 7.2). Interestingly, DNA methylation at CpG11, localised at C/EBP TFBS, was found to be among the most highly correlated between SAT and VAT and between SAT and blood (Table 7.2). For this site, a trend for association was also observed between VAT and blood after multiple testing correction (r=0.327; p=0.10). CpG16 was also found to be highly correlated between the three tissues and CpG17 was correlated between SAT and blood (Table 7.2). These two CpG sites are localised within SP1 TFBS and a highly conserved region of the LEP gene promoter locus (Figure 7.4). SP1 TFBS was shown to be involved in the regulation of LEP gene expression. 25, 28, 29 High correlation coefficients were observed between DNA methylation levels at LEP CpG28 in the three tissues (Table 7.2). Nevertheless, the cytosine at this CpG site was found to be polymorphic (single nucleotide polymorphism (SNP); rs791620; C>A), and the genotype is likely driving the correlations observed. Among all the CpG sites analysed in the current study, CpG11, CpG16 and CpG17 are the most promising as they are located in potentially functional regions and correlated between blood and adipose tissues. Nevertheless, further studies are needed to determine whether these CpGs are associated with

213 the development of obesity in normal weight and obese populations. If such associations are observed, it could eventually raise the possibility of using blood LEP DNA methylation levels at these CpG sites as a surrogate for LEP DNA methylation levels in adipose tissues and as a marker of obesity susceptibility.

Table 7.2 - Pearson correlation coefficients between DNA methylation levels at LEP gene promoter CpG sites in blood, subcutaneous (SAT) and visceral adipose (VAT) tissues Chromosomal CpG sites location a SAT vs. VAT SAT vs. Blood VAT vs. Blood LEP -CpG3 chr7 :127,881,368 0.295 -0.102 0.226 LEP -CpG4 chr7 :127,881,349 0.589 ** 0.116 0.287 LEP -CpG5 chr7 :127,881,343 0.414 ** 0.073 0.195 LEP -CpG6 chr7 :127,881,338 0.435 ** 0.049 0.220 LEP -CpG7 chr7 :127,881,329 0.367 * -0.049 0.189 LEP -CpG11 chr7 :127,881,279 0.575 ** 0.433 ** 0.327 LEP -CpG12 chr7 :127,881,268 0.142 0.160 0.156 LEP -CpG13 chr7 :127,881,259 0.087 0.166 0.132 LEP -CpG14 chr7 :127,881,256 0.134 0.447 ** 0.334 LEP -CpG15 chr7 :127,881,245 0.079 0.213 0.232 LEP -CpG16 chr7 :127,881,235 0.352 * 0.488 ** 0.358 * LEP -CpG17 chr7 :127,881,230 0.284 0.578 ** 0.268 LEP -CpG23 chr7 :127,881,170 0.500 ** 0.339 0.203 LEP -CpG24 chr7 :127,881,168 0.484 ** 0.408 ** 0.217 LEP -CpG25 chr7 :127,881,160 0.202 0.186 0.315 LEP -CpG26 chr7 :127,881,147 0.484 ** 0.311 0.289 LEP -CpG27 chr7 :127,881,144 0.497 ** 0.240 0.232 LEP -CpG28 chr7 :127,881,142 0.773 ** 0.611 ** 0.573 ** LEP -CpG29 chr7 :127,881,130 0.451 ** 0.212 0.205 LEP -CpG30 chr7 :127,881,128 0.490 ** 0.277 0.310 LEP -CpG31 chr7 :127,881,126 0.508 ** 0.200 0.204 LEP -MEAN - 0.571 ** 0.321 0.354 * Statistically significant after corrections for multiple testing: ** p≤ 0.01 and *p≤ 0.05 aUCSC Genome Browser on Human Feb. 2009 (Feb. 2014)

214

Figure 7.4- Location of transcription factor binding sites and highly conserved regions within the CpG island of the LEP gene proximal promoter region in placental mammals, adapted from UCSC genome browser tracks 38 Track A- LEP proximal promoter sequence. Track B- Identification of epigenotyped CpG sites. Track C- Localisation of transcription factor binding sites. Track D- PhastCons conservation track for placental mammals. Track E- Single nucleotide polymorphisms (SNPs) previously identified in the LEP gene promoter. In blue, rs2167270 SNP analysed in the current study. UCSC genome browser was accessed on September 19 2013 .

215

LEP gene expression analysis in SAT and VAT confirmed the functional importance of specific CpG sites in both adipose tissues. Considering that LEP expression is influenced by sex 30, 31 and that associations between LEP DNA methylation and phenotypic variables have been previously reported to be sex-specific 9, 32, 33 , the relationships between LEP DNA methylation and mRNA levels were adjusted for sex. In addition, we observed significant interactions between sex and DNA methylation levels (CpG12 and CpG14) on VAT LEP mRNA levels. In VAT, DNA methylation levels at LEP CpG7, CpG11, CpG13 and CpG26 to CpG30 were found to be positively associated with LEP mRNA levels (Table 7.3).

Table 7.3 - Pearson correlation coefficients between DNA methylation and mRNA levels at LEP gene promoter CpG sites in subcutaneous (SAT) and visceral adipose (VAT) tissues according to rs2167270 genotype and adjusted for sex SAT VAT ALL a GG a GA/AA a ALL a GG a GA/AA a n 73 30 43 73 30 43 LEP -CpG3 -0.079 0.145 -0.215 0.070 0.286 -0.068 LEP -CpG4 -0.093 0.243 -0.294 † 0.201 0.266 0.194 LEP -CpG5 -0.060 0.318 † -0.300 † 0.173 0.294 0.061 LEP -CpG6 -0.051 0.267 -0.239 0.211 † 0.350 † 0.093 LEP -CpG7 -0.076 0.228 -0.249 0.320 * 0.575 ** 0.139 LEP -CpG11 -0.056 0.018 -0.070 0.290 * 0.390 * 0.238 LEP -CpG12 -0.124 0.004 -0.239 0.086 0.281 -0.039 LEP -CpG13 -0.057 0.192 -0.206 0.308 * 0.627 ** 0.125 LEP -CpG14 -0.126 0.324 † -0.497 ** 0.222 † 0.322 † 0.147 LEP -CpG15 -0.065 0.328 † -0.285 † 0.180 0.281 0.097 LEP -CpG16 -0.093 0.031 -0.173 0.125 0.371 * 0.003 LEP -CpG17 -0.172 0.078 -0.367 * 0.103 0.212 0.014 LEP -CpG23 -0.168 0.083 -0.340 * 0.225 † 0.200 0.256 LEP -CpG24 -0.134 0.202 -0.333 * 0.114 0.117 0.116 LEP -CpG25 -0.093 0.329 † -0.345 * 0.193 0.152 0.207 LEP -CpG26 0.048 0.395 * -0.194 0.268 * 0.282 0.264 LEP -CpG27 0.006 0.315 -0.238 0.301 * 0.250 0.352 LEP -CpG28 -0.012 0.069 -0.090 0.265 * 0.351 † 0.180 LEP -CpG29 -0.036 0.203 -0.217 0.252 * 0.175 0.322 LEP -CpG30 -0.094 0.117 -0.233 0.215 * 0.239 0.212 LEP -CpG31 -0.068 0.079 -0.188 0.172 0.317 † 0.102 LEP -MEAN -0.060 0.268 -0.265 † 0.297 * 0.372 * 0.241 aAdjusted for sex Statistically significant: ** p≤ 0.05 after corrections for multiple testing; *p≤ 0.05 and †p ≤ 0.10 without correction for multiple testing

216

These results are not supported by previous studies reporting negative associations between mean LEP promoter DNA methylation and expression in the visceral adipocyte fraction 26 , placenta 3, and adipocyte cell cultures 25 . These contrasting results might be explained by the fact that LEP genetic variations were not taken into account in these studies. Indeed, an exploratory analysis revealed that LEP rs2167270, a variant previously associated with LEP expression 34 , tended to be associated with LEP gene expression in VAT ( p=0.06) and was significantly associated with DNA methylation levels at CpG4 in SAT and at CpG3, CpG4, CpG6 and CpG7 in VAT (Table 7.4)

Table 7.4 - Comparison of DNA methylation levels (%) at LEP proximal promoter CpG sites and LEP mRNA levels (AU) in SAT and VAT according to rs2167270 genotype SAT VAT GG GA/AA a GG GA/AA a

(n=30) (n=43) (n=30) (n=43) Mean ± SD Mean ± SD Mean ± SD Mean ± SD LEP -CpG3 33.5 ± 4.2 35.3 ± 5.7 34.2 ± 3.7 37.0 ± 5.0 ** LEP -CpG4 20.1 ± 3.1 17.2 ± 3.3 ** 20.3 ± 3.3 17.7 ± 2.6 ** LEP -CpG5 17.6 ± 2.9 17.4 ± 3.1 16.8 ± 3.3 17.1 ± 2.5 LEP -CpG6 15.5 ± 2.9 17.1 ± 3.9 † 15.2 ± 2.9 17.3 ± 3.1 ** LEP -CpG7 15.8 ± 2.7 16.9 ± 3.7 14.4 ± 2.3 15.9 ± 2.5 * LEP -CpG11 24.5 ± 3.0 24.4 ± 2.7 24.0 ± 4.3 23.8 ± 3.9 LEP -CpG12 8.7 ± 1.7 8.5 ± 1.4 7.6 ± 1.2 7.6 ± 1.3 LEP -CpG13 9.8 ± 1.4 9.7 ±1.9 6.8 ± 1.0 6.8 ± 1.4 LEP -CpG14 8.4 ± 1.3 8.8 ±1.5 5.9 ± 1.3 6.2 ± 1.1 LEP -CpG15 7.6 ± 1.1 7.8 ± 1.5 6.2 ± 1.0 6.3 ± 0.9 LEP -CpG16 6.3 ± 1.1 6.4 ± 1.4 5.7 ± 1.0 5.7 ± 1.3 LEP -CpG17 10.6 ± 2.0 10.7 ± 2.1 10.0 ± 2.3 9.9 ± 2.0 LEP -CpG23 8.7 ± 1.8 8.8 ± 1.8 9.3 ± 2.1 9.6 ± 1.9 LEP -CpG24 16.9 ± 2.4 16.8 ± 2.9 15.8 ± 3.7 16.0 ± 2.8 LEP -CpG25 17.9 ± 2.3 17.5 ± 3.3 14.3 ± 2.7 14.6 ± 2.5 LEP -CpG26 15.6 ± 2.9 15.9 ± 3.1 14.6 ± 3.3 14.9 ± 2.9 LEP -CpG27 11.2 ± 1.8 10.8 ± 1.9 11.7 ± 2.8 11.6 ± 2.2 LEP -CpG28 8.9 ± 3.5 10.2 ± 2.3 † 9.8 ± 4.1 11.0 ± 2.8 LEP -CpG29 16.0 ± 2.3 15.9 ± 2.7 16.8 ± 3.6 17.6 ± 2.8 LEP -CpG30 17.4 ± 3.0 17.4 ± 3.3 17.7 ± 4.6 17.5 ± 3.3 LEP -CpG31 21.6 ± 3.7 20.7 ± 3.6 22.7 ± 4.1 21.0 ± 3.9 † LEP-Mean 14.9 ± 1.7 15.0 ± 2.1 14.3 ± 2.1 14.5 ± 1.7 LEP mRNA 1.03± 0.04 1.02± 0.05 0.97± 0.03 0.99± 0.03 † levels SAT, subcutaneous adipose tissue; VAT, visceral adipose tissue; AU, Arbitrary Units Values are significantly different between GG and GA/AA genotypes: ** p<0.01 ;*p<0.05; † p<0.10

217

In addition, rs2167270 was found to influence the relationship between LEP DNA methylation and mRNA levels in adipose tissues (Table 7.3). In VAT, positive significant correlation coefficients were found in GG genotypes for CpG11 and nearby CpG sites, while no correlation was observed in GA/AA genotypes (Table 7.3). Interestingly, in SAT a statistical interaction effect was observed between the rs2167270 genotype and LEP DNA methylation levels (CpG5 ( pi=0.03); CpG14 ( pi=0.01); CpG15 ( pi=0.012); and CpG25

(pi=0.009) on LEP mRNA levels. We observed that LEP DNA methylation levels (CpG14, CpG17, CpG23, CpG24 and CpG25) were negatively correlated with LEP mRNA levels in carriers of the A allele, and they tended to be positively correlated in the GG genotype at CpG14 and CpG25. These exploratory analysis results highlight, for the first time, the importance of both genetic and epigenetic variations in the regulation of LEP gene expression. Furthermore, they suggest that LEP gene expression regulation in SAT and VAT is independent and restricted to specific CpG sites. In VAT, CpG sites located close to CpG11; nearby the TATA box element and the C/EBP TFBS appear to be the most important regulator of LEP expression whereas in SAT, CpG sites near SP1 TFBS (CpG16 and CpG17) may be central (Figure 7.4). Further studies are needed to determine the contribution of the other SNPs (rs791620 and rs34104384) in the regulation of LEP gene expression in both types of adipose tissue. In addition, these preliminary genetic results will need to be confirmed in samples of larger size.

DNA methylation and mRNA level analyses at the ADIPOQ gene locus At the ADIPOQ gene locus, DNA methylation levels were assessed in the 73 patients at three polymorphic CpG islands (A, C and E) as previously described (Figure 7.5). 4 DNA methylation levels at ADIPOQ CpG islands A and C were found to be hypomethylated (<10.0%) and hypermethylated (>90.0%), respectively in blood and both SAT and VAT (Figure 7.5). The CpG sites localised in these CpG islands were considered unmethylated and fully methylated and were thus not further analysed.

218

Figure 7.5- CpG islands analysed within the ADIPOQ gene locus CpG island A and C were found to be hypomethylated and hypermethylated respectively and were not analysed. For CpG island E, DNA methylation levels at CpG sites were compared between blood, subcutaneous (SAT) and visceral (VAT) adipose tissues using the Wilcoxon signed-rank test.

219

As observed for the LEP gene locus, mean DNA methylation levels at ADIPOQ -CpGE1, CpGE2 and CpGE3 were also found to be higher in blood (91.2±2.4%) in comparison to SAT (81.2±2.7%) and VAT (82.8±3.3%) (Figure 7.3- Panel B). At the ADIPOQ intron 1 locus, DNA methylation levels at CpGE1 and CpGE3 were highly correlated in SAT (r>0.73; p<0.001) and VAT (r>0.73; p<0.001), whereas in blood, the correlation was modest (r>0.31; p<0.01) (Figure 7.6)..

Figure 7.6- Spearman correlation coefficients between CpGs at ADIPOQ locus in blood (A), subcutaneous (B) and visceral (C) adipose tissues

DNA methylation levels at CpGE2 were the only ones significantly correlated between SAT and VAT after corrections for multiple testing (Table 7.5). CpGE2 DNA methylation was found to be negatively correlated with ADIPOQ mRNA levels in VAT, whereas in SAT, DNA methylation at CpGE3 was associated with ADIPOQ mRNA levels (Table 7.6). No transcriptional regulatory elements were identified at or near ADIPOQ CpG island E.

Table 7.5 - Spearman rank correlation coefficients between DNA methylation levels at ADIPOQ CpG island E loci in blood, subcutaneous (SAT) and visceral adipose (VAT) tissues Chromosomal CpG sites location a SAT vs. VAT SAT vs. Blood VAT vs. Blood ADIPOQ -CpGE1 chr3 :186,562,911 0.241 -0.252 -0.207 ADIPOQ -CpGE2 chr3 :186,562,915 0.411 ** -0.038 0.145 ADIPOQ -CpGE3 chr3 :186,562,950 0.283 -0.019 0.043 ADIPOQ-MEAN - 0.324 -0.174 -0.024 Statistically significant after corrections for multiple testing: ** p≤ 0.01 and *p≤ 0.05 aUCSC Genome Browser on Human Feb. 2009 (Feb. 2014)

220

Table 7.6 - Pearson correlation coefficients between DNA methylation and mRNA levels at ADIPOQ CpG island E in subcutaneous (SAT) and visceral adipose (VAT) tissues CpG sites SAT a VAT a ADIPOQ -CpGE1 -0.164 -0.223 † ADIPOQ -CpGE2 -0.078 -0.256 * ADIPOQ -CpGE3 -0.257 * -0.152 aAdjusted for sex Statistically significant: ** p≤ 0.05 after corrections for multiple testing; *p≤ 0.05 and †p ≤ 0.10 without correction for multiple testing

DNA methylation variations between CpG sites at the LEP and ADIPOQ gene loci We also report that DNA methylation patterns of variation from one CpG site to the following were highly similar between the three tissues at both the LEP and ADIPOQ gene loci (Figure 7.7). These similarities were previously observed by our group in cord blood and placenta samples 5 and by Marchi et al .26 in the liver, visceral adipocyte and stromal vascular fraction of white adipose tissue at the LEP gene locus. Similarities between inter-individual CpG site variations at specific gene loci have also been reported in several other tissues. 24, 35 Following these observations, we previously suggested that DNA methylation levels vary concurrently between tissues around predefined (heritable) values, which seem independent from one CpG site to another. 15 Recently, Brons et al .36 suggested that a detrimental fetal environment might decrease the acute regulation of the epigenome, which in turn might contribute to increase the risk to develop obesity and type 2 diabetes. This likely “predefined” pattern of DNA methylation that we and others have observed might be established early during embryonic development according to the maternal in utero environment and may determine the set point from which stochastic and environmental factors will induce a more or less acute regulation of the epigenome. Since this study was conducted with tissue samples from obese adults, longitudinal and dietary intervention studies will be needed to investigate whether LEP and ADIPOQ tissue-specific epipolymorphisms and associations are present in the newborn and normal weight populations, whether they predict the development of obesity or other metabolic disorders and whether they respond to dietary and exercise interventions.

221

Figure 7.7 - Average DNA methylation profile by CpG site for LEP gene promoter locus (A) and ADIPOQ CpG island E gene locus (B) in blood (white circles), subcutaneous (black circles) and visceral (grey circles) adipose tissues (n=73)

In summary, the current study compared, for the first time, LEP and ADIPOQ DNA methylation levels in blood and adipose tissues. We report that DNA methylation patterns of variation between one CpG to the next at the LEP and ADIPOQ gene loci is highly similar between blood, SAT and VAT, suggesting that a setting point for DNA methylation at each CpG site may exist. In addition, we showed that DNA methylation levels at potentially functional CpG sites are correlated between blood and adipose tissues. DNA methylation levels at or near these CpG sites were also found to be associated with adipokine gene expression levels. Hence, these specific CpGs might prove useful surrogates for DNA methylation measures, especially with SAT biopsies that require a much less invasive procedure than VAT sampling.

222

MATERIALS AND METHODS Patients Blood, SAT and VAT samples were obtained from 33 men and 40 pre-menopaused women (Obese Class III 22 : BMI ≥40 kg/m 2) undergoing biliopancreatic derivation to treat obesity. The 73 patients were free of treatment for dyslipidemia, diabetes and hypertension. The surgical procedures have been previously described.37, 38 Briefly, fasting blood samples were taken on the morning or the day before the surgery. SAT and VAT samples were obtained at the beginning of the intervention. All samples were stored at -80°C until nucleic acid extraction. Anthropometric parameters (body weight, height, waist and hip circumferences), resting blood pressure and fasting plasma insulin, glucose and lipid levels were also measured before surgery according to standardized procedures. 39 All participants provided a written informed consent before their inclusion in the study, and all clinical data were denominalized. This project was performed in collaboration with the Tissue bank for the study of obesity and its complications at the Institut Universitaire de Cardiologie et de Pneumologie de Québec. The project was approved by this institution’s and the Université Laval’s ethics committees and was conducted in accordance with the Declaration of Helsinki.

Nucleic acid extraction DNA was purified from whole blood samples with the Gentra Puregene Blood Kit (Qiagen, Valencia, CA). DNA and RNA from SAT and VAT were extracted as previously described. 40 RNA quality was assessed with Agilent 2100 Bioanalyzer RNA Nano Chips (Agilent Technologies, Santa Clara, CA). Three RNA samples from SAT and VAT had low RNA integrity numbers (RIN<6.0) and were excluded from the analysis. The other RNA samples in SAT and VAT showed a high quality with mean RIN values of 8.0 ± 0.8 and 8.3 ± 0.6 respectively.

223

Bisulfite Kit, Qiagen) specifically converts unmethylated cytosines into uracil, while the methylated cytosines are protected from this transition creating a cytosine/thymine polymorphism. Once treated, NaBis-DNA is amplified (Pyromark PCR kit, Qiagen), and the cytosine and thymine alleles are quantified by pyrosequencing. 41 DNA methylation levels at the LEP gene CpG island proximal promoter region was assessed using the PCR and pyrosequencing primers described in Table 7.7. Specific PCR and pyrosequencing conditions and primer pairs for ADIPOQ DNA methylation analyses were the same as previously described. 4

Table 7.7- PCR and pyrosequencing primers for LEP gene proximal promoter CpG island amplification and pyrosequencing Amplified PCR and pyrosequencing primers Length region (bp) F: 5’-GGGGAGGGTAGGTATGGAG-3’ CpG3 to CpG7 R: 5’-CCCTACATCCCTCCTAACT-3’ 162 bp seq: 5’-GGGTAGGTATGGAGT-3’

F:5’-GAGTTTTTGGAGGGATATTAAGGA-3’ F:5’-CAACTCCCCCCCCCCCCCTCAAAATAA-3’ CpG11 to CpG17 194 bp seq: 5’-GGGAGGTATTTAAGGG-3’

F:5’-ATTTTAGGGAGGTATTTAAGGGTG-3’ R:5’-ACCATTCCTACCAAACTCCATACCTACCC-3’ CpG23 to CpG31 239 bp seq: 5’-GGTAAGTAGTTATTTTGAGGG-3’

F; Forward. R; Reverse. Seq; Sequencing These primers were designed from bisulfite converted sequence using Pyromark Assay Design software (version 2.0.1.15; Qiagen).

Pyrosequencing technology was also used for genotyping a single nucleotide polymorphism (SNP; rs2167270; G>A) within the LEP proximal promoter region (Figure 7.1). The genotype of the 73 patients was determined with the same PCR and sequencing primers as for the methylation analysis of CpG3 to CpG7 (Table 7.7). The pyrogram signals obtained, representing the amount of G and A nucleotides added to the sequence, allowed the quantification of the two alleles and determination of the genotype. 42 The rs2167270 genotype was identical in all three tissues analyzed for the 73 patients. The genotype frequencies (GG: 30 (41.1%); GA: 35 (47.9%) and AA: 8 (11.0%)) were found to be under Hardy-Weinberg equilibrium ( p>0.05). Carriers of the minor A allele (GA/AA) were

224 grouped together for the analysis since the number of homozygous AA was too low to provide adequate statistical power.

Expression analysis and identification of transcription factor binding sites and conserved regions in LEP and ADIPOQ genes mRNA levels in SAT and VAT were quantified by quantitative real-time PCR (qRT-PCR). Complementary DNA (cDNA) was generated from total RNA using a random primer hexamer provided with the High Capacity cDNA Archive Kit from Applied Biosystems (Foster City, CA). Equal amounts of cDNA were run in duplicate and amplified in a 20µL reaction containing 10µL of Universal PCR Master Mix (Applied Biosystems). Primers and Taqman probes were obtained from Applied Biosystems ( LEP : Hs00174877_m1 and ADIPOQ : Hs00605917_m1). The Glyceraldehyde 3-phosphate dehydrogenase (GAPDH: Hs99999905_m1; Applied Biosystems) housekeeping gene was amplified in parallel. LEP, ADIPOQ and GAPDH amplifications were performed using the Applied Biosystems 7500 Real Time PCR System, as recommended by the manufacturer (Applied Biosystems). LEP and ADIPOQ mRNA (Ct) levels were quantified relative to change in GAPDH gene expression (Ct). GAPDH /ADIPOQ and GAPDH/LEP Ct ratios (1/x) were used for the analysis.

UCSC genome browser 43 and a Pubmed literature search were used to identify consensus sequences of TFBS sequence in the LEP gene promoter and ADIPOQ intron 1 DNA sequence. The relationship between LEP and ADIPOQ mRNA regulation and the identified transcription factors was further evaluated with a Pubmed literature review.

Statistical analyses The normal distribution of all variables was assessed using a Kolmogorov-Smirnov test. DNA methylation levels at the ADIPOQ -CpGE1, E2 and E3 loci in blood were not normally distributed. Hence, DNA methylation levels at the ADIPOQ gene locus were compared between blood, SAT and VAT using the Wilcoxon signed-rank test, whereas paired sample t-test was used for LEP gene loci cross-tissue comparisons. In addition, partial Pearson correlation and Spearman correlations were used to determine DNA methylation correlations

225 across the three tissues for the LEP and ADIPOQ gene loci respectively. The associations between adipokines DNA methylation and mRNA levels were also assessed with partial Pearson correlations. Additionally, two-way ANOVA with interaction terms were used to determine the independent variables contributing to LEP mRNA level variance. Student’s t- test was used to compare DNA methylation and mRNA levels between LEP rs2167270GG genotypes (GG vs GA/AA). Anthropometric characteristics were also compared between men and women using the unpaired Student’s t-test, while categorical variables were compared using the chi-square statistic. Because a large number of tests was performed, Bonferroni multiple testing corrections were applied. Results were therefore considered statistically significant when p-values ≤ 4.5x10 -4 (p ≤0.01) and p-values ≤ 2.3x10 -3 (p ≤0.05) (two-sided). All statistical analyses were performed with the IBM SPSS Statistics 20 software (release 20.0.0, SPSS, Chicago, Il, USA).

226

ACKNOWLEDGMENTS The authors acknowledge the contribution of bariatric surgeons (Biron S, Marceau S, Lescelleur O, Biertho L) for tissue collection. The authors also express their gratitude to Céline Bélanger, Chicoutimi Hospital, for her thoughtful language revision of the manuscript. A.T. is the director of a Research Chair in Bariatric and Metabolic Surgery. M.C.V. is the recipient of the Canada Research Chair in Genomics Applied to Nutrition and Health. During this research, AA.H. was a recipient of a FRQS doctoral training award. MF.H. is supported by a Canadian Diabetes Association clinical scientist award. L.B. and MF.H. are junior research scholars from the Fonds de recherche du Québec – Santé (FRQS) and members of the FRQS-funded Centre de recherche clinique Étienne-Le Bel (affiliated to Centre Hospitalier de l’Université de Sherbrooke). This project was supported by the Canadian Institutes of Health Research and the FRQS.

227

REFERENCES

1. Rabe K, Lehrke M, Parhofer KG, Broedl UC. Adipokines and insulin resistance. Mol Med 2008; 14:741-51.

2. Rasouli N, Kern PA. Adipocytokines and the metabolic complications of obesity. The Journal of clinical endocrinology and metabolism 2008; 93:S64-73.

3. Bouchard L, Thibault S, Guay SP, Santure M, Monpetit A, St-Pierre J, et al . Leptin gene epigenetic adaptation to impaired glucose metabolism during pregnancy. Diabetes care 2010; 33:2436-41.

4. Bouchard L, Hivert MF, Guay SP, St-Pierre J, Perron P, Brisson D. Placental adiponectin gene DNA methylation levels are associated with mothers' blood glucose concentration. Diabetes 2012; 61:1272-80.

5. Houde AA, Hivert MF, Bouchard L. Fetal epigenetic programming of adipokines. Adipocyte 2013; 2:41-6.

6. Clausen TD, Mathiesen ER, Hansen T, Pedersen O, Jensen DM, Lauenborg J, et al . Overweight and the metabolic syndrome in adult offspring of women with diet-treated gestational diabetes mellitus or type 1 diabetes. The Journal of clinical endocrinology and metabolism 2009; 94:2464-70.

7. Hillier TA, Pedula KL, Schmidt MM, Mullen JA, Charles MA, Pettitt DJ. Childhood obesity and metabolic imprinting: the ongoing effects of maternal hyperglycemia. Diabetes care 2007; 30:2287-92.

8. Deierlein AL, Siega-Riz AM, Chantala K, Herring AH. The association between maternal glucose concentration and child BMI at age 3 years. Diabetes care 2011; 34:480-4.

9. Tobi EW, Lumey LH, Talens RP, Kremer D, Putter H, Stein AD, et al . DNA methylation differences after exposure to prenatal famine are common and timing- and sex-specific. Human molecular genetics 2009; 18:4046-53.

228

10. Bird A. DNA methylation patterns and epigenetic memory. Genes & development 2002; 16:6-21.

11. Bestor TH. The DNA methyltransferases of mammals. Human molecular genetics 2000; 9:2395-402.

12. Hackett JA, Surani MA. DNA methylation dynamics during the mammalian life cycle. Philosophical transactions of the Royal Society of London Series B, Biological sciences 2013; 368:20110328.

13. Smith ZD, Meissner A. DNA methylation: roles in mammalian development. Nature reviews Genetics 2013; 14:204-20.

14. Kangaspeska S, Stride B, Metivier R, Polycarpou-Schwarz M, Ibberson D, Carmouche RP, et al . Transient cyclical methylation of promoter DNA. Nature 2008; 452:112-5.

15. Houde AA, Guay SP, Desgagne V, Hivert MF, Baillargeon JP, St-Pierre J, et al . Adaptations of placental and cord blood ABCA1 DNA methylation profile to maternal metabolic status. Epigenetics : official journal of the DNA Methylation Society 2013; 8.

16. Bell JT, Tsai PC, Yang TP, Pidsley R, Nisbet J, Glass D, et al . Epigenome-wide scans identify differentially methylated regions for age and age-related phenotypes in a healthy ageing population. PLoS genetics 2012; 8:e1002629.

17. Lesseur C, Armstrong DA, Paquette AG, Koestler DC, Padbury JF, Marsit CJ. Tissue- specific Leptin promoter DNA methylation is associated with maternal and infant perinatal factors. Molecular and cellular endocrinology 2013.

18. Zhang Y, Kent JW, 2nd, Lee A, Cerjak D, Ali O, Diasio R, et al . Fatty acid binding protein 3 (fabp3) is associated with insulin, lipids and cardiovascular phenotypes of the metabolic syndrome through epigenetic modifications in a northern european family population. BMC medical genomics 2013; 6:9.

229

19. Liang P, Song F, Ghosh S, Morien E, Qin M, Mahmood S, et al . Genome-wide survey reveals dynamic widespread tissue-specific changes in DNA methylation during development. BMC genomics 2011; 12:231.

20. Wan J, Oliver VF, Zhu H, Zack DJ, Qian J, Merbs SL. Integrative analysis of tissue- specific methylation and alternative splicing identifies conserved transcription factor binding motifs. Nucleic acids research 2013; 41:8503-14.

21. Yagi S, Hirabayashi K, Sato S, Li W, Takahashi Y, Hirakawa T, et al . DNA methylation profile of tissue-dependent and differentially methylated regions (T- DMRs) in mouse promoter regions demonstrating tissue-specific gene expression. Genome research 2008; 18:1969-78.

22. WHO. Obesity: preventing and managing the global epidemic. Report of a WHO Consultation. WHO Technical Report Series 894. Geneva: World Health Organization, 2000.

23. Heijmans BT, Tobi EW, Lumey LH, Slagboom PE. The epigenome: archive of the prenatal environment. Epigenetics : official journal of the DNA Methylation Society 2009; 4:526-31.

24. Slieker RC, Bos SD, Goeman JJ, Bovee JV, Talens RP, van der Breggen R, et al . Identification and systematic annotation of tissue-specific differentially methylated regions using the Illumina 450k array. Epigenetics & chromatin 2013; 6:26.

25. Melzner I, Scott V, Dorsch K, Fischer P, Wabitsch M, Bruderlein S, et al . Leptin gene expression in human preadipocytes is switched on by maturation-induced demethylation of distinct CpGs in its proximal promoter. The Journal of biological chemistry 2002; 277:45420-7.

26. Marchi M, Lisi S, Curcio M, Barbuti S, Piaggi P, Ceccarini G, et al . Human leptin tissue distribution, but not weight loss-dependent change in expression, is associated with methylation of its promoter. Epigenetics : official journal of the DNA Methylation Society 2011; 6:1198-206.

230

27. Stoger R. In vivo methylation patterns of the leptin promoter in human and mouse. Epigenetics : official journal of the DNA Methylation Society 2006; 1:155-62.

28. Mason MM, He Y, Chen H, Quon MJ, Reitman M. Regulation of leptin promoter function by Sp1, C/EBP, and a novel factor. Endocrinology 1998; 139:1013-22.

29. Wrann CD, Rosen ED. New insights into adipocyte-specific leptin gene expression. Adipocyte 2012; 1:168-72.

30. Montague CT, Prins JB, Sanders L, Digby JE, O'Rahilly S. Depot- and sex-specific differences in human leptin mRNA expression: implications for the control of regional fat distribution. Diabetes 1997; 46:342-7.

31. Kristensen K, Pedersen SB, Fisker S, Norrelund H, Rosenfalck AM, Jorgensen JO, et al . Serum leptin levels and leptin expression in growth hormone (GH)-deficient and healthy adults: influence of GH treatment, gender, and fasting. Metabolism: clinical and experimental 1998; 47:1514-9.

32. Lesseur C, Armstrong DA, Murphy MA, Appleton AA, Koestler DC, Paquette AG, et al . Sex-specific associations between placental leptin promoter DNA methylation and infant neurobehavior. Psychoneuroendocrinology 2014; 40:1-9.

33. Lesseur C, Armstrong DA, Paquette AG, Koestler DC, Padbury JF, Marsit CJ. Tissue- specific Leptin promoter DNA methylation is associated with maternal and infant perinatal factors. Molecular and cellular endocrinology 2013; 381:160-7.

34. Hoffstedt J, Eriksson P, Mottagui-Tabar S, Arner P. A polymorphism in the leptin promoter region (-2548 G/A) influences gene expression and adipose tissue secretion of leptin. Hormone and metabolic research = Hormon- und Stoffwechselforschung = Hormones et metabolisme 2002; 34:355-9.

35. Davies MN, Volta M, Pidsley R, Lunnon K, Dixit A, Lovestone S, et al . Functional annotation of the human brain methylome identifies tissue-specific epigenetic variation across brain and blood. Genome biology 2012; 13:R43.

231

36. Brons C, Jacobsen S, Nilsson E, Ronn T, Jensen CB, Storgaard H, et al . Deoxyribonucleic acid methylation and gene expression of PPARGC1A in human muscle is influenced by high-fat overfeeding in a birth-weight-dependent manner. The Journal of clinical endocrinology and metabolism 2010; 95:3048-56.

37. Marceau P, Hould FS, Simard S, Lebel S, Bourque RA, Potvin M, et al . Biliopancreatic diversion with duodenal switch. World journal of surgery 1998; 22:947-54.

38. Vohl MC, Sladek R, Robitaille J, Gurd S, Marceau P, Richard D, et al . A survey of genes differentially expressed in subcutaneous and visceral adipose tissue in men. Obesity research 2004; 12:1217-22.

39. Robitaille J, Despres JP, Perusse L, Vohl MC. The PPAR-gamma P12A polymorphism modulates the relationship between dietary fat intake and components of the metabolic syndrome: results from the Quebec Family Study. Clinical genetics 2003; 63:109-16.

40. Bouchard L, Faucher G, Tchernof A, Deshaies Y, Lebel S, Hould FS, et al . Comprehensive genetic analysis of the dipeptidyl peptidase-4 gene and cardiovascular disease risk factors in obese individuals. Acta diabetologica 2009; 46:13-21.

41. Dejeux E, El abdalaoui H, Gut IG, Tost J. Identification and quantification of differentially methylated loci by the pyrosequencing technology. Methods Mol Biol 2009; 507:189-205.

42. Royo JL, Galan JJ. Pyrosequencing for SNP genotyping. Methods Mol Biol 2009; 578:123-33.

43. Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, et al . The human genome browser at UCSC. Genome research 2002; 12:996-1006.

CHAPITRE 8 - ARTICLE 7

Leptin and adiponectin DNA methylation levels in adipose tissues and blood cells are associated with BMI, waist girth and LDL-cholesterol levels in severely obese men and women

Auteurs de l’article : Andrée-Anne Houde, Cécilia Légaré, Simon Biron, Odette Lescelleur, Laurent Biertho, Simon Marceau, André Tchernof, Marie-Claude Vohl , Marie-France Hivert, et Luigi Bouchard.

Statut de l’article : Publié dans la revue BMC Medical Genetics

Houde AA, Légaré C, Biron S, Lescelleur O, Biertho L, Marceau S, Tchernof A, Vohl MC, Hivert MF, Bouchard L. 2015. Leptin and adiponectin DNA methylation levels in adipose tissues and blood cells are associated with BMI, waist girth and LDL-cholesterol levels in severely obese men and women. BMC Medical Genetics. 16(1): 29.

Avant-propos : Cet article est le deuxième dans lequel nous avons étudié la méthylation de LEP et d’ ADIPOQ dans le sang et dans les tissus adipeux sous-cutané et viscéral. Dans cette étude exploratoire, nous avons analysé les associations entre la méthylation de ces deux gènes dans les trois différents tissus et certains facteurs de risques cardiométaboliques de sujets sévèrement obèses. En tant que première auteure, j’ai réalisé les analyses des niveaux de méthylation et d’expression, l’analyse et l’interprétation des données ainsi que la rédaction du manuscrit.

233

RÉSUMÉ Contexte: Les gènes LEP et ADIPOQ encodent des adipokines impliquées dans le métabolisme énergétique. Ces deux gènes auraient aussi une fonction importante dans des voies biologiques associant les niveaux d’adiposité à la perturbartion de l’homéostasie du glucose et de l’insuline. Nous avons donc émis l’hypothèse que la méthylation de l’ADN des gènes LEP et ADIPOQ pourrait être impliquée dans la pathologie de l’obésité et des complications cardiométaboliques qui y sont associées.

Objectif: Déterminer si les niveaux de méthylation de LEP et d’ ADIPOQ , analysés dans le tissu adipeux sous-cutané (TASC) et viscéral (TAV), sont associés à des variables anthropométriques et au profil métabolique d’hommes et de femmes sévèrement obèses. Ces analyses ont aussi été conduites dans les cellules sanguines des mêmes individus pour évaluer si elles présentent des similarités.

Sujets et méthodes: Des échantillons appariés de TASC, TAV et de sang ont été prélevés chez 73 sujets sévèrement obèses ayant subi une dérivation biliopancréatique. Les niveaux de méthylation et d’expressiom de LEP et ADIPOQ ont été quantitifiés par pyroséquençage de l’ADN traité au bisulfite de sodium et par PCR quantitatif en temp réel respectivement. Les coefficients de corrélation de Pearson ont été utilisés pour déterminer les associations entre la méthylation de LEP et ADIPOQ , les variables anthopométriques et le profil métabolique.

Résultats: La méthylation d’ ADIPOQ dans le TASC est positivement corrélée avec l’IMC et la circonférence de la taille tandis que la méthylation de LEP dans le sang est négativement corrélé avec l’IMC. Nous avons aussi rapporté que les concentrations plasmatiques de c- LDL à jeun sont positivement corrélées avec les niveaux de méthylation des CpG11 et CpG17 de LEP dans le sang et le TASC de même qu’avec les niveaux de méthylation d’ADIPOQ dans le TASC (CpGE1 and CpGE3) et TAV (CpGE1).

Conclusions: Les résultats de la présente étude confirment que la signature épigénétique de LEP et ADIPOQ est associée à l’obésité. De plus, des associations entre les niveaux de c- LDL et les niveaux de méthylation de LEP et d’ ADIPOQ suggèrent que le c-LDL pourrait participer à la régulation du profil épigénétique de ces deux gènes dans les tissus adipeux.

234

En outre, les mécanismes de régulation des niveaux de méthylation dans les tissus adipeux et le sang pourraient être analogues puisque nous avons aussi rapporté des corrélations entre les niveaux de c-LDL et les niveaux de méthylation de LEP dans le sang,

235

Leptin and adiponectin DNA methylation levels in adipose tissues and blood cells are associated with BMI, waist girth and LDL-cholesterol levels in severely obese men and women

Andrée-Anne Houde 1,2 , Cécilia Légaré 1,2 , Simon Biron 3,4 , Odette Lescelleur 3,4 , Laurent Biertho 3,4 , Simon Marceau 3,4 , André Tchernof 3,5,6 , Marie-Claude Vohl 5,6,7 , Marie-France Hivert 8,9,10 , and Luigi Bouchard 1,2

1. Department of Biochemistry, Université de Sherbrooke, Sherbrooke, QC, Canada; 2. ECOGENE-21 and Clinical Research Center and Lipid Clinic, Chicoutimi Hospital, Saguenay, QC, Canada; 3. Quebec Heart and Lung Institute, Quebec, Canada; 4. Department of Surgery, Laval University, Quebec, Canada; 5. Axe Endocrinologie et Néphrologie, Centre de recherche du CHU de Québec, Quebec, QC, Canada; 6. Department of Food Science and Nutrition, Laval University, Québec, QC, Canada; 7. Institute of Nutrition & Functional Foods, Université Laval, Quebec, QC, Canada; 8. Department of Medicine, Division of Endocrinology, Université de Sherbrooke, Sherbrooke, QC, Canada; 9. Department of Population Medicine; Harvard Pilgrim Health Care Institute; Boston, MA, USA; and 10. General Medicine Division, Massachusetts General Hospital, Boston, MA, USA.

236

ABSTRACT Background Leptin ( LEP ) and adiponectin ( ADIPOQ ) genes encode adipokines that are mainly secreted by adipose tissues, involved in energy balance and suspected to play a role in the pathways linking adiposity to impaired glucose and insulin homeostasis. We have thus hypothesized that LEP and ADIPOQ DNA methylation changes might be involved in obesity development and its related complications. The objective of this study wa s to assess whether LEP and ADIPOQ DNA methylation levels measured in subcutaneous (SAT) and visceral adipose tissues (VAT) are associated with anthropometric measures and metabolic profile in severely obese men and women. These analyses were repeated with DNA methylation profiles from blood cells obtained from the same individuals to determine whether they showed similarities.

Methods Paired SAT, VAT and blood samples were obtained from 73 severely obese patients undergoing a bioliopancreatic diversion with duodenal switch. LEP and ADIPOQ DNA methylation and mRNA levels were quantified using bisulfite-pyrosequencing and qRT-PCR respectively. Pearson’s correlation coefficients were computed to determine the associations between LEP and ADIPOQ DNA methylation levels, anthropometric measures and metabolic profile.

Results DNA methylation levels at the ADIPOQ gene locus in SAT was positively associated with BMI and waist girth whereas LEP DNA methylation levels in blood cells were negatively associated with body mass index (BMI). Fasting LDL-C levels were found to be positively correlated with DNA methylation levels at LEP -CpG11 and -CpG17 in blood and SAT and with ADIPOQ DNA methylation levels in SAT (CpGE1 and CpGE3) and VAT (CpGE1).

Conclusions These results confirm that LEP and ADIPOQ epigenetic profiles are associated with obesity. We also report associations between LDL-C levels and both LEP and ADIPOQ DNA methylation levels suggesting that LDL-C might regulate their epigenetic profiles in adipose tissues. Furthermore, similar correlations were observed between LDL-C and LEP blood

237

DNA methylation levels suggesting a common regulatory pathway of DNA methylation in both adipose tissues and blood.

Keywords: Subcutaneous adipose tissue, visceral adipose tissue, epigenetic, metabolic complications

238

BACKGROUND The incidence of obesity and its related disorders (dyslipidemia, hypertension, type 2 diabetes and cardiovascular diseases) has been constantly increasing in the last few decades leading to a global obesity epidemic [1,2]. Although the heritability estimates for obesity range between 6%-85% depending on the trait assessed [3], the obesity-related genetic variants identified have so far explained less than 2% of the heritability of obesity [4,5]. Hence, it is unlikely that the current obesity epidemic is solely caused by genetic variations. The interactions between the gene variants and the components of our obesogenic environment are very likely contributing to the increasing obesity rates.

Genes are known to adapt to the environment through epigenetic modifications [6,7] among other mechanisms. Epigenetics refers to the molecular mechanisms regulating gene expression without affecting the DNA sequence [8]. DNA methylation, the most understood epigenetic mark, primarily occurs on the cytosine upstream of a guanine (dinucleotide CpG) and is catalyzed by the DNA methyltransferases (DNMTs) [9]. The methylation of cytosines in a CpG context has been shown to be sensitive to environmental stimuli including in utero [10-12] and post-natal environmental conditions [13,14].

Epigenetic modifications contribute to the pathogenesis of obesity and its obesity-related metabolic complications. Indeed, studies have reported that DNA methylation levels at candidate gene loci related to obesity and metabolic diseases are impaired in blood and adipose tissues of obese patients [15,16] and in low weight loss responder to diet and exercise interventions [17-20]. The leptin ( LEP ) and adiponectin ( ADIPOQ ) genes are probably those that have warranted the most attention so far. These genes encode for leptin and adiponectin proteins, which are mainly synthesized and secreted by the adipocytes. Leptin plasma concentrations are increased in obese subjects (leptin resistance is suspected) and has both anorexigenic and proinflammatory properties [21,22], whereas adiponectin improves insulin sensitivity, exerts anti-inflammatory actions and its secretion is significantly reduced in obesity [21,22].

We have previously reported that maternal hyperglycaemia (2 h post-oral glucose tolerance test (OGTT)) during the second trimester of pregnancy is associated with decreased placental

239

DNA methylation levels at LEP [23] and ADIPOQ [24] gene loci suggesting that epigenetic adaptations could be involved in fetal metabolic programming and increase newborn lifelong susceptibility to obesity and metabolic disorders. Other groups have reported that whole blood LEP DNA methylation levels are negatively associated with birth weight and child BMI at 17 months [25]. In addition, DNA methylation levels at the LEP and ADIPOQ gene promoters in blood were recently found to be lower in obese and insulin resistant adolescents [26]. Altogether these results suggest that LEP and ADIPOQ DNA methylation profiles might be involved in the pathology of obesity and cardiometabolic diseases. Nevertheless, LEP and ADIPOQ epigenetic profiles in adipose tissue and their associations with obesity and obesity-associated metabolic perturbations have not been assessed so far. Accordingly, we hypothesized that decreased LEP DNA methylation and increased ADIPOQ DNA methylation in adipose tissue could lead to higher degree of obesity and pro-inflammatory state, dyslipidemia, hypertension and insulin resistance. Henceforth, the objective of this study was to determine whether LEP and ADIPOQ DNA methylation levels in subcutaneous (SAT) and visceral (VAT) adipose tissues were associated with obesity and obesity-related complications severely obese men and women. SAT and VAT were both analysed because they show specific gene expression profiles (ex. LEP and ADIPOQ ) [27,28] and associations with cardiovascular risk factors [29]. Moreover, we tested whether adipokine epigenetic profiles in blood reflect those in adipose tissues and whether they could be used as proxies.

240

METHODS Subjects Blood, SAT and VAT samples were obtained from 33 men and 40 premenopausal women (BMI >40 kg/m 2) undergoing bioliopancreatic diversion with duodenal switch to treat obesity. They were selected based on the fact that they were free of treatment for dyslipidemia, hypertension and diabetes. The surgical and sampling procedures have been described previously [30,31]. All participants provided a written informed consent before their inclusion in the study, and all clinical data were denominalized. This project was performed in collaboration with the Tissue bank for the study of obesity and its complications at the Institut Universitaire de Cardiologie et de Pneumologie de Québec. The project was approved by this institution’s and the Université Laval’s ethics committees and was conducted in accordance with the Declaration of Helsinki.

Nucleic acid extraction DNA was purified from whole blood samples with the Gentra Puregene Blood Kit (Qiagen, Valencia, CA). DNA and RNA from SAT and VAT were extracted as previously described [32]. RNA quality was assessed with Agilent 2100 Bioanalyzer RNA Nano Chips (Agilent Technologies, Santa Clara, CA). Three RNA samples from SAT and VAT had low RNA integrity numbers (RIN < 6.0) and were excluded from the analysis. The other RNA samples in SAT and VAT showed a high quality with mean RIN values of 8.0 ± 0.8 and 8.3 ± 0.6 respectively. RNA samples were not available for blood samples.

DNA methylation analyses and genotyping DNA methylation levels at CpG sites were assessed using pyrosequencing (Pyromark Q24, QIAGEN-Biotage). Combined with the NaBis DNA treatment, pyrosequencing is a quantitative real-time sequencing technology that allows to measure DNA methylation levels (%) at a single cytosine (CpG) of a given genomic region. The NaBis treatment of DNA (EpiTect Bisulfite Kit, Qiagen) specifically converts unmethylated cytosines into uracil, while the methylated cytosines are protected from this transition, creating a cytosine/thymine polymorphism. Once treated, NaBis-DNA is amplified (Pyromark PCR kit, Qiagen), and the cytosine and thymine alleles are quantified by pyrosequencing [33]. Specific PCR and

241 pyrosequencing primer pairs for LEP and ADIPOQ DNA methylation analyses are described in Tables 8.1 and 8.2.

Genotyping of the LEP single nucleotide polymorphism (SNP) rs2167670 was performed in the three tissues using pyrosequencing as reported before [34]. The rs2167270 genotype was identical in all three tissues analysed for the 73 patients. Genotype frequencies (GG: 30 (41.1%); GA: 35 (47.9%) and AA: 8 (11.0%)) were found to be under Hardy-Weinberg equilibrium ( p > 0.05). Carriers of the minor A allele (GA/AA) were grouped together for statistical analysis purposes as the number of homozygous AA was very low.

LEP and ADIPOQ mRNA measurements mRNA levels in SAT and VAT were quantified by quantitative real-time PCR (qRT-PCR). Complementary DNA (cDNA) was generated from total RNA using a random primer hexamer provided with the High Capacity cDNA Archive Kit from Applied Biosystems (Foster City, CA). Equal amounts of cDNA were run in duplicate and amplified in a 20 μL reaction containing 10 μL of Universal PCR Master Mix (Applied Biosystems). Primers and Taqman probes were obtained from Applied Biosystems ( LEP : Hs00174877_m1 and ADIPOQ : Hs00605917_m1). The Glyceraldehyde 3-phosphate dehydrogenase (GAPDH: Hs99999905_m1; Applied Biosystems) housekeeping gene was amplified in parallel. LEP, ADIPOQ and GAPDH amplifications were performed using the Applied Biosystems 7500 Real Time PCR System, as recommended by the manufacturer (Applied Biosystems). LEP and ADIPOQ mRNA (Ct) levels were quantified relative to change in GAPDH gene expression (Ct). GAPDH /ADIPOQ and GAPDH/LEP Ct ratios (1/x) were used for the analysis.

242

Table 8.1- PCR and pyrosequencing primers for LEP gene proximal promoter CpG island amplification and pyrosequencing Target Target sequence Chromosomal Target sequence after PCR and pyrosequencing primers Length CpGs (5’ to 3’) Region a bisulfite conversion (5’ to 3’) (bp) (5’to 3’)

F: GGGGAGGGTAGGTATGGAG TC7GTAGGAATC6GCAGC5 chr7:127 881 330 TC7GTAGGAATC6GTAGC CpG3 to R: CCCTACATCCCTCCTAACT GCCARC4GGTTGCAAGGT to 5GTT ARC4GGTTG TAAGG 162 CpG7 seq: GGGTAGGTATGGAGT AAGGCCCC3GGC 2GC 1G chr7:127 881 374 TAAGG TTT C3GGC 2GC 1G

C17 GGGGC16 GGGAGCTGG C17 GGGGC16 GGGAG TTG C15 GCTAGAAATGC14 GCC13 GC15 GTTAGAAATGC14 GT F:ATTTTAGGGAGGTATTTAAGGGTG CpG11 chr7:127 881 230 GGGGCCTGC12 GGGGCAG C13 GGGG TT TGC12 GGGG T R:ACCATTCCTACCAAACTCCATACCTACCC to to 239 TTGC11 GCAAGTTGTGATC AGTTGC11 GTAAGTTGTG seq: GGTAAGTAGTTATTTTGAGGG CpG17 chr7:127 881 316 10 GGGCC 9GCTATAAGWG ATC10 GGG TC9GTTATAA GGGC 8G GWGGGGC8G

GC31 GC30 GC29 GTGGCTCCT GC31 GC30 GC29 GTGG TTTT CpG23 chr7:127 881 125 F:GAGTTTTTGGAGGGATATTAAGGA GGM28 GC27 GCC26 GAGGCC TGGM28 GC27 GTC26 GAGG to to R:CAACTCCCCCCCCCCCCCTCAAAATAA 194 CTCCCTC25 GAGGCCCC24 G TTT TTTT TC25 GAGG TTT C CpG31 chr7:127 881 173 seq: GGGAGGTATTTAAGGG C23 GAG 24 GC23 GAG

The CpG sites are numbered according to Bouchard et al . 2010 [23]. The underlined CpG sites were epigenotyped in the current study T in red font are cytosines that have been converted to thymine after Nabis treatment of DNA F; Forward. R; Reverse. Seq; Sequencing The primers were designed from bisulfite converted sequence using Pyromark Assay Design software (version 2.0.1.15; Qiagen). UCSC Genome Browser (Human Feb. 2009: NM_000230)

243

Table 8.2- PCR and pyrosequencing primers for ADIPOQ gene CpG islands amplification and pyrosequencing Target Target sequence Chromosomal Target sequence after PCR and pyrosequencing primers Length Region (5’ to 3’) Region a NaBis treatment (5’to 3’) (5’ to 3’) (bp) TGCGGTCGCCCCGGCT TGCGGTCG TTT CGGTTT F:GGATTTTTATTTAGGAGAGTTGTTTT CCCCGGCTCCAGAGC chr3:186 545 134 CpG Island A TT CGGTTTT AGAGCG TT R: ACCCTAAACCTCCCCTTTCTACC GCCCGCATTCCCGRGA to 161 AdipoA3 CG TATT TT CGAGAGAGG seq:ATTTTTATTTAGGAGAGTTGTTTTT GAGGCGATGTGGGGG chr3:186 545 202 CGATGTGGGGG TT CGG CCCGGG

F: GGTGGTAGGAGGTGATAGTTTAA CGCGGTGGCTCACGCC chr3:186 557 086 CGCGGTGG TTTACG TT T CpG Island C R: ACTCCCCACCTCAAATAATCCAC TGTCATTCCAGCACTT to GT TATT TT AG TATTTTG 199 AdipoC1 seq: GAAATGTTTTTTTGGTTAGG TGGGAGGCCG chr3:186 557 128 GGAGG TCG

GCGTACGTATGTGGAT Chr3:186 562 910 GCGTACGTATGTGGATG F: TGGTGAGTGGGATGTTTTGTTTTA CpG Island E GTGTGGATGTGGTGTG to TGTGGATGTGGTGTGTG R: ACACACACCTCCACCTAT 180 AdipoE2 TGGKTGTGCGCGT Chr3:186 562 954 GGTGTGCGCGT seq: CACACACCTCCACCTATA

The CpG island are numbered according to Bouchard et al . 2012 [24]. The underlined CpG sites were epigenotyped in the current study. T in red font are cytosines that have been converted to thymine after Nabis treatment of DNA F; Forward. R; Reverse. Seq; Sequencing The primers were designed from bisulfite converted sequence using Pyromark Assay Design software (version 2.0.1.15; Qiagen). a UCSC Genome Brower (Human Feb, 2009: NM_001177800)

Statistical analyses The mean DNA methylation of the 21 CpGs analysed in the proximal promoter CpG island of LEP gene (Figure 7.1) was first computed ( LEP -Mean) and analysed. Moreover, since we [34] and other groups [35-37] have previously reported that CpGs located between CpG7 to CpG17 are of first interest for LEP gene expression regulation through DNA methylation changes, we analysed these CpGs individually to identify those more likely to be regulatory. Out of these 8 CpGs, we excluded the CpG sites that were found to be unmethylated ( ≤10.0%) or hypermethylated ( ≥90%) as they show low DNA methylation variability and are thus unlikely to explain the phenotypic variability. Hence, CpG12 to CpG16 were not analysed further in adipose tissues and blood (Figure 7.1).

At ADIPOQ gene locus , CpG island A and C were either unmethylated ( ≤10.0%) or hypermethylated ( ≥90%) and were thus not further analysed (Figure 7.5). Mean DNA methylation levels were computed for CpG island E in SAT, VAT ( ADIPOQ -Mean). CpGE1 and CpGE3 were analysed individually in SAT and VAT, whereas CpGE2 (hypermethylated) was not analysed further. In blood, CpGE3 was the only one analysed as the ADIPOQ -Mean, and CpGE1 and CpGE2 were found to be hypermethylated (Figure 7.5).

The normal distribution of all variables was assessed using a Kolmogorov-Smirnov test. Fasting triglyceride (TG), C-reactive protein (CRP) and both fasting glucose and DNA methylation levels at ADIPOQ -CpGE3 locus in blood were found to be normally distributed after they were log10-transformed and ranked respectively. The associations between adipokine genes DNA methylation levels, anthropometric measures and metabolic profile were assessed with partial Pearson’s correlations. The partial Pearson correlations were also used to determine the relationship between fasting low-density lipoprotein cholesterol (LDL- C) levels, LEP DNA methylation and mRNA levels in SAT. Pearson’s correlation coefficients were adjusted for the following covariates when appropriate: sex, age, and waist circumference. Waist circumference is a stronger cardiometabolic disease risk marker and was preferred to BMI as a covariate [38,39]. Moreover, all results remained unchanged after consideration of smoking status. Two-sided p-values ≤ 0.05 were considered statistically significant. The statistical analyses were performed with the IBM SPSS Statistics 20 software (release 20.0.0, SPSS, Chicago, Il, USA). 245

RESULTS The characteristics of the subjects included in this study are shown in Table 8.3. All subjects were severely obese (obese class III [40]) with BMI ranging from 40.0 to 60.0 kg/m 2. The patients were slightly hypertensive but had generally good metabolic health without diabetes or dyslipidemia [41,42].

Table 8.3- Characteristics of the subjects studied (n=73) Mean ± SD Range (min-max) Men (%) 33 (45.2%) - Age (years) 34.7 ± 7.1 21.4 - 53.8 BMI (kg/m 2) 49.6 ± 6.0 40.0 - 60.0 Hip circumference (cm) 147.7 ± 14.0 123.0 - 193.0 Waist circumference (cm) 139.3 ± 16.6 99.0 - 180.0 Waist Hip Ratio 0.95 ± 0.11 0.68 - 1.17 Fasting glucose (mmol/l) a 5.51 ± 1.05 4.00 – 8.70 Systolic blood pressure (mm Hg) 137.0 ± 14.0 101.0 – 183.0 Diastolic blood pressure (mm Hg) 86.0 ± 10.0 57.0 – 108.0 TC (mmol/l) 4.87 ± 0.85 3.22 – 6.92 LDL -C (mmol/l) 2.96 ± 0.76 1.20 – 5.40 HDL -C (mmol/l) 1.17 ± 0.27 0.70 – 2.12 TC/HDL -C 4.32 ± 1.24 0.98 – 7.56 TG a (mmol/l) 1.52 ± 0.98 0.52 – 6.89 CRP a (mg/L) (n=53) 8.2 ± 10.2 2.0 – 54.9 Current Smokers 17 (23.3%) - BMI, body Mass Index; TC, total cholesterol; LDL-C, low-density lipoprotein-cholesterol; HDL-C, high-density lipoprotein-cholesterol; TC/HDL-C, total cholesterol to high-density lipoprotein- cholesterol ratio; TG, triglycerides; CRP, c-reactive protein aGeometric mean

LEP and ADIPOQ DNA methylation and anthropometric variables To determine whether LEP and ADIPOQ epigenetic profiles are involved in the pathogenesis of obesity and cardiometabolic complications, we first assessed the associations between LEP and ADIPOQ DNA methylation levels in adipose tissues and blood and obesity-related anthropometric measures. The mean DNA methylation levels of LEP promoter CpG island were found to be negatively correlated with BMI (r = −0.328; p = 0.005) and hip circumference (r = −0.230; p = 0.05) (Pearson’s correlation coefficients adjusted for age and sex) (Table 8.4). To identify the CpGs that are more likely to be regulatory, LEP -CpG7, LEP - CpG11 and LEP -CpG17 were analysed independently. Negative correlations were observed between BMI and LEP -CpG7 (r = −0.252; p = 0.03) and LEP -CpG11 (r = −0.234; p = 0.05) (Figure 8.1-Panel A and B). As obesity-related proinflammatory response is associated with

246 higher plasma leptin levels, we also assessed whether LEP DNA methylation levels in blood cells are associated with circulating levels of the pro-inflammatory CRP. Lower LEP -Mean and LEP -CpG7 DNA methylation levels in blood were associated with increased levels of CRP ( LEP -Mean: r = −0.285; p = 0.05 and LEP -CpG7: r = −0.397, p = 0.004, n = 53) (Table 8.6). Of note, the correlations reported between LEP DNA methylation levels in blood and BMI were no longer significant after adjusting for CRP levels ( LEP -Mean: r = −0.237; p = 0.10; LEP -CpG7: r = −0.151; p = 0.294 and LEP -CpG11: r = −0.155; p = 0.283 (n = 53)).

ADIPOQ DNA methylation levels in SAT were found correlated with BMI ( ADIPOQ -Mean: r = 0.250; p = 0.04 and ADIPOQ -CpGE1: r = 0.265; p = 0.03) (Figure 8.1-Panel C) (Table 8.4) and waist circumference ( ADIPOQ -Mean: r = 0.361; p = 0.002; ADIPOQ -CpGE1: r = 0.364; p = 0.002 and ADIPOQ -CpGE3: r = 0.304; p = 0.01) (Figure 8.2-Panel A and B) (Table 8.4). Moreover, DNA methylation levels at ADIPOQ-CpGE3 locus in SAT were positively correlated with hip circumference (r = 0.234; p = 0.05) (Table 8.4). No additional association was observed between LEP and ADIPOQ DNA methylation levels and anthropometric variables (Table 8.4).

247

Figure 8.1- LEP and ADIPOQ DNA methylation levels according to body mass index (BMI) in severely obese patients LEP DNA methylation levels at CpG7 (A) and CpG11 (B) in blood were associated with BMI. In SAT, ADIPOQ DNA methylation levels at CpGE1 were positively associated with BMI (C). aAdjusted for age and sex (n=73).

Figure 8.2- ADIPOQ DNA methylation levels according to waist circumference in severely obese patients ADIPOQ DNA methylation levels at CpGE1 (A) and CpGE3 (B) in SAT were positively correlated with waist circumference. aAdjusted for age and sex (n=73).

248

Table 8.4- Pearson correlation coefficients between LEP and ADIPOQ DNA methylation and mRNA levels in blood, subcutaneous (SAT) and visceral adipose tissue (VAT) and anthropometric variables (adjusted for age and sex) (n=73) Body Mass Index (kg/m 2) Waist Circumference (cm) Hip Circumference (cm) Waist Hip Ratio r p r p r p r p BLOOD LEP -CpG7 -0.252 0.03 -0.107 0.38 -0.197 0.10 0.116 0.34 LEP -CpG11 -0.234 0.05 -0.178 0.14 -0.214 0.07 0.060 0.62 LEP -CpG17 -0.151 0.21 -0.065 0.59 -0.157 0.19 0.104 0.39 LEP-Mean -0.328 0.005 -0.167 0.16 -0.230 0.05 0.074 0.54 ADIPOQ-CpGE3 a 0.131 0.28 -0.152 0.21 -0.026 0.83 -0.104 0.39 SAT LEP -CpG7 0.059 0.62 0.141 0.24 0.068 0.57 0.082 0.50 LEP -CpG11 0.023 0.85 0.107 0.37 -0.007 0.95 0.137 0.26 LEP -CpG17 -0.091 0.45 0.063 0.60 -0.102 0.40 0.166 0.17 LEP-Mean 0.108 0.37 0.194 0.11 0.140 0.24 0.063 0.60 LEP mRNA levels 0.211 0.08 0.138 0.25 0.228 0.06 -0.090 0.46 ADIPOQ -CpGE1 0.265 0.03 0.364 0.002 0.205 0.09 0.168 0.16 ADIPOQ -CpGE3 0.192 0.11 0.304 0.010 0.234 0.05 0.054 0.66 ADIPOQ-Mean 0.250 0.04 0.361 0.002 0.201 0.09 0.160 0.18 ADIPOQ mRNA levels -0.074 0.54 -0.128 0.29 -0.022 0.86 -0.101 0.41 VAT LEP -CpG7 0.107 0.37 0.002 0.98 0.048 0.69 -0.004 0.98 LEP -CpG11 0.045 0.71 0.080 0.505 -0.028 0.82 0.125 0.30 LEP -CpG17 -0.074 0.54 0.099 0.412 -0.007 0.95 0.088 0.46 LEP-Mean 0.037 0.76 0.116 0.33 0.022 0.86 0.101 0.40 LEP mRNA levels 0.119 0.32 0.173 0.15 0.038 0.76 0.142 0.24 ADIPOQ -CpGE1 -0.072 0.55 -0.046 0.71 -0.103 0.39 0.031 0.80 ADIPOQ -CpGE3 -0.141 0.242 -0.076 0.53 -0.058 0.63 -0.047 0.70 ADIPOQ-Mean -0.105 0.38 -0.057 0.64 -0.106 0.38 0.024 0.84 ADIPOQ mRNA levels -0.068 0.58 -0.075 0.54 0.003 0.98 -0.101 0.41 aResults obtained after rank transformation of the DNA methylation levels; bAdjusted for age and sex; Values in bold type are statistically significant ( p≤0.05 )

249

LEP and ADIPOQ DNA methylation and obesity-related complications We next determined whether LEP and ADIPOQ DNA methylation levels in adipose tissue and blood were associated with obesity-related complications including dyslipidemia, hyperglycemia and hypertension. Fasting low-density lipoprotein-cholesterol (LDL-C) levels were positively correlated with LEP -Mean DNA methylation levels in VAT (r = 0.273; p = 0.02) and ADIPOQ -Mean DNA methylation levels in SAT (r = 0.268; p = 0.03) and VAT (r = 0.245; p = 0.04) (Table 8.5). Analyses of individual CpG sites revealed positive correlations between LDL-C levels and DNA methylation levels at LEP -CpG17 locus in blood (r = 0.234; p = 0.05) and SAT (r = 0.391; p = 0.001) (Table 8.5). At the ADIPOQ gene loci, CpGE1 (r = 0.236; p = 0.05) and CpGE3 (r = 0.292; p = 0.01) in SAT and CpGE1 in VAT (CpGE1: r = 0.267; p = 0.03) were also positively correlated with fasting LDL-C levels (Table 8.5). A trend for association was also observed between LDL-C and DNA methylation levels at LEP -CpG11 in blood and SAT (Table 8.5). DNA methylation levels at the ADIPOQ gene loci ( ADIPOQ -Mean and ADIPOQ -CpGE3) in SAT and at LEP -CpG7 in VAT were associated with fasting total cholesterol (TC) and high-density lipoprotein-cholesterol (HDL- C), respectively (Table 8.6). Adipokine genes DNA methylation levels were not found to be associated with fasting glucose levels and either systolic or diastolic blood pressure (Table 8.6).

LEP and ADIPOQ DNA methylation and mRNA levels in SAT and VAT, and cardiometabolic risk factors To further explore the functionality of the associations reported in the two previous sections, we verified whether LEP and ADIPOQ gene expression and DNA methylation levels in SAT and VAT were correlated with phenotypic variability.

We have previously reported that LEP -CpG17 DNA methylation levels are negatively associated with LEP mRNA levels in SAT, specifically in carriers of the rs2167270 A alleles (GA/AA genotypes; r = −0.367, p = 0.02) [34] (Table 8.7). The LEP genotypes were thus taken into account. LDL-C levels were found to be negatively correlated with LEP mRNA levels (r = −0.317; p = 0.04) in rs2167270 A allele carriers only (Table 8.7). Of note, the correlation between LEP mRNA and LDL-C levels was no longer significant after adjusting

250

Pearson’s correlation coefficient for LEP -CpG17 DNA methylation levels (r = −0.205; p = 0.21) (Table 8.7).

In SAT, DNA methylation levels at ADIPOQ -CpGE3 were negatively correlated with ADIPOQ mRNA levels (r = 0.257; p = 0.03). ADIPOQ mRNA levels in SAT or VAT were not associated with BMI, waist girth, hip circumference or LDL-C levels (Table 8.4 and Table 8.5)

251

Table 8.5- Pearson correlation coefficients between fasting LDL-C levels and both LEP and ADIPOQ DNA methylation and mRNA levels in subcutaneous (SAT) and visceral adipose tissues (VAT) LDL-C levels (mmol/L) LDL-C levels (mmol/L) Adjusted Adjusted for age and sex for age, sex and WG r P r p BLOOD LEP -CpG7 0.133 0.27 0.122 0.31 LEP -CpG11 0.222 0.06 0.206 0.09 LEP -CpG17 0.239 0.04 0.234 0.05 LEP-Mean 0.178 0.138 0.162 0.18 ADIPOQ-CpGE3 a 0.161 0.17 0.149 0.22 SAT LEP -CpG7 0.090 0.46 0.108 0.37 LEP -CpG11 0.215 0.07 0.231 0.06 LEP -CpG17 0.380 0.001 0.391 0.001 LEP-Mean 0.190 0.11 0.218 0.07 LEP mRNA levels −0.113 0.35 −0.098 0.42 ADIPOQ-CpGE1 0.176 0.14 0.236 0.05 ADIPOQ-CpGE3 0.242 0.04 0.292 0.01 ADIPOQ-Mean 0.206 0.08 0.268 0.03 ADIPOQ mRNA 0.024 0.85 0.009 0.94 levels VAT LEP -CpG7 0.130 0.28 0.131 0.28 LEP -CpG11 0.158 0.19 0.169 0.16 LEP -CpG17 0.114 0.34 0.127 0.30 LEP-Mean 0.256 0.03 0.273 0.02 LEP mRNA levels 0.160 0.18 0.034 0.78 ADIPOQ-CpGE1 0.270 0.02 0.267 0.03 ADIPOQ-CpGE3 0.188 0.12 0.181 0.14 ADIPOQ-Mean 0.250 0.04 0.245 0.04 ADIPOQ mRNA −0.111 0.37 −0.121 0.33 levels WC,waist circumference aResults obtained after rank transformation of DNA methylation levels Values in bold type are statistically significant: p ≤ 0.05

252

Table 8.6- Pearson correlation coefficients between LEP and ADIPOQ DNA methylation and mRNA levels in blood, subcutaneous (SAT) and visceral adipose tissues (VAT) and cardiometabolic risk factors (adjusted for age, sex and waist circumference) (n=73)

TG b TC HDL-C Glucose a CRP b SBP DBP (mmo/L) (mmo/L) (mmo/L) (mmo/L) (mg/L ) (n=53) (mm Hg) (mm Hg) r p r p r p r p r p r p r p BLOOD LEP -CpG7 0.119 0.33 0.061 0.62 -0.035 0.77 0.125 0.30 -0.397 0.004 -0.060 0.62 -0.050 0.68 LEP -CpG11 0.050 0.68 0.085 0.48 -0.063 0.60 0.142 0.24 -0.187 0.19 0.074 0.54 0.099 0.42 LEP -CpG17 -0.049 0.69 0.137 0.26 0.029 0.81 0.038 0.76 -0.078 0.59 -0.056 0.65 0.002 0.98 LEP-Mean 0.024 0.87 0.058 0.69 -0.057 0.69 -0.111 0.45 -0.285 0.05 0.105 0.47 0.025 0.86 ADIPOQ- 0.059 0.63 0.077 0.53 -0.092 0.45 0.067 0.58 0.196 0.17 0.147 0.23 0.065 0.60 CpGE3 a SAT LEP -CpG7 -0.139 0.25 0.045 0.71 0.074 0.54 0.085 0.48 0.165 0.25 0.024 0.85 0.082 0.50 LEP -CpG11 -0.066 0.59 0.083 0.49 -0.163 0.18 0.187 0.12 0.047 0.74 0.034 0.78 0.146 0.23 LEP -CpG17 -0.037 0.76 0.213 0.08 -0.042 0.73 -0.036 0.77 0.136 0.35 -0.140 0.25 0.041 0.74 LEP-Mean -0.047 0.75 0.265 0.06 -0.005 0.97 0.017 0.91 0.145 0.32 0.142 0.33 0.274 0.06 LEP mRNA -0.028 0.82 -0.014 0.91 0.128 0.29 -0.177 0.14 -0.073 0.62 0.208 0.09 0.151 0.21 levels ADIPOQ - 0.045 0.71 0.163 0.18 -0.212 0.08 0.090 0.46 0.186 0.20 0.008 0.95 0.042 0.73 CpGE1 ADIPOQ - 0.086 0.48 0.233 0.05 -0.192 0.11 0.001 0.99 0.137 0.342 -0.022 0.93 -0.008 0.95 CpGE3 ADIPOQ- 0.022 0.88 0.377 0.007 -0.152 0.29 0.135 0.35 0.201 0.16 -0.083 0.57 -0.021 0.89 Mean ADIPOQ 0.068 0.58 -0.068 0.58 -0.087 0.48 0.062 0.61 -0.118 0.42 0.104 0.39 0.007 0.95 mRNA levels VAT LEP -CpG7 0.014 0.91 0.035 0.77 -0.237 0.05 0.182 0.13 0.043 0.77 0.008 0.95 0.127 0.29 LEP -CpG11 -0.100 0.41 0.067 0.58 -0.141 0.24 0.145 0.23 0.106 0.47 0.097 0.42 0.199 0.10 LEP -CpG17 -0.156 0.20 0.153 0.21 0.128 0.29 -0.029 0.81 0.142 0.33 -0.037 0.76 0.061 0.62 LEP-Mean -0.161 0.26 0.196 0.17 -0.019 0.897 -0.048 0.74 0.133 0.36 0.093 0.52 0.178 0.22 LEP mRNA 0.019 0.88 0.117 0.33 -0.112 0.36 0.311 0.009 -0.114 0.43 0.178 0.14 0.310 0.009 levels ADIPOQ - 0.003 0.98 0.137 0.26 -0.174 0.15 -0.103 0.40 0.171 0.24 -0.043 0.73 -0.166 0.17 CpGE1

253

ADIPOQ - -0.083 0.49 0.110 0.37 -0.024 0.85 -0.121 0.32 0.121 0.40 0.012 0.93 -0.107 0.38 CpGE3 ADIPOQ- -0.072 0.62 0.176 0.22 -0.004 0.98 -0.064 0.66 0.161 0.26 0.013 0.93 -0.146 0.31 Mean ADIPOQ -0.083 0.50 -0.104 0.40 -0.084 0.50 0.098 0.43 -0.213 0.5 -0.003 0.98 0.017 0.89 mRNA levels TG, triglycerides ; TC, total cholesterol; HDL-C, high-density lipoprotein-cholesterol; CRP, C-reactive protein; SBP, systolic blood pressure, DBP, diastolic blood pressure. a b Results obtained after rank transformation of the variable; Results obtained after log 10 -transformation Values in bold type are statistically significant (p ≤ 0.05)

254

Table 8.7- Pearson correlation coefficients between LDL-C levels, LEP mRNA and LEP gene CpG17 DNA methylation levels in subcutaneous adipose tissue (SAT) according to the rs2167270 genotype LEP -CpG17 LEP mRNA levels DNA methylation levels ALL GG GA/AA ALL GG GA/AA n = 73 n = 30 n = 43 n = 73 n = 30 n = 43 LDL-C levels −0.097 0.142 −0.317 * 0.370 ** 0.400 * 0.384 ** Adjusted for sex and waist girth LDL-C levels −0.035 0.138 −0.205 - - - Adjusted for sex, waist girth and LEP -CpG17 DNA methylation levels LDL -C levels - - - 0.360 ** 0.399 * 0.303 † Adjusted for sex, waist girth and LEP mRNA levels LEP -CpG17 DNA methylation −0.177 0.038 −0.367 * - - - levels Adjusted for sex LEP -CpG17 DNA methylation −0.152 −0.021 −0.282 † - - - levels Adjusted for sex and LDL-C levels Pearson correlations are statistically significant: †p ≤ 0.10; *p ≤ 0.05 ; ** p ≤ 0.01.

255

DISCUSSION In the current study, we report that LEP and ADIPOQ DNA methylation levels, measured in paired adipose tissues and blood samples, are associated with obesity-related anthropometric variables and fasting LDL-C levels.

We first demonstrated that lower LEP promoter DNA methylation levels in blood cells are associated with higher BMI. Several cross-sectional studies have reported lower LEP DNA methylation levels in blood cells of newborns and children with higher birth weight and BMI [25], in obese and insulin resistant adolescents [26] and obese women [43]. Our findings are also concordant with fetal metabolic programming studies in humans and rodent models which have lately shown that lower LEP DNA methylation levels in blood, placenta, VAT, liver and muscle are associated with a risk for obesity and metabolic diseases in the offspring [10,44,23]. It is thus tempting to speculate on whether the LEP epigenetic profile we are reporting in blood was established in utero and might have been involved in the development of obesity in the patients of the current study. However, we would have expected that the LEP epigenetic signature that we are describing in blood would also have been present in adipose tissues, if programmed in utero . Because the correlations between LEP DNA methylation levels and BMI were attenuated after adjusting for CRP levels, we hypothesized that the obesity-related proinflammatory response per se contributed to the alteration of LEP epigenetic profile in blood cells. Leptin is mainly produced by adipose tissues but is also expressed by peripheral blood mononuclear cells [45]. It is also recognized that plasma leptin and CRP levels are upregulated in obesity and proinflammatory states and closely related [46]. Plasmatic elevation of CRP levels observed in obese subjects has been associated with higher plasma concentrations and leptin resistance [46]. Hence, increased CRP levels might, to some extent, regulate plasmatic leptin concentrations and leptin resistance via the modification of LEP DNA methylation levels. Unfortunately, because blood cell counts were not available, we cannot exclude that LEP DNA methylation variability and the associations reported with CRP and BMI might be partially attributed to blood cell composition changes between samples. However, if cellular composition changes impact the results, this effect is likely modest as highlighted by Talens et al . [47]. DNA methylation regulation is (partly) tissue-specific and might explain the discrepancy between the associations reported in blood and adipose tissues [48,49]. Also, we cannot exclude that LEP epigenetic profile of these

256

“metabolically-healthy” individuals might have been re-programmed by the post-natal environmental and stochastic factors.

We also report that ADIPOQ DNA methylation levels in SAT are positively associated with BMI and waist circumference. ADIPOQ DNA methylation levels at CpGE3 are also associated with ADIPOQ mRNA levels in SAT. This suggests that epigenetic modifications at ADIPOQ gene locus are functional and could potentially be involved in the pathogenesis of impaired glucose tolerance and insulin resistance associated with obesity. Nevertheless, we cannot exclude that higher ADIPOQ DNA methylation levels would have led to higher degree of obesity. In accordance with this hypothesis, we have lately reported that placental ADIPOQ DNA methylation levels are impaired following exposure to maternal glucose 2 h post-OGTT at second trimester of pregnancy suggesting that ADIPOQ epigenetic profile can increase susceptibility to obesity in the newborn [24]. Whether ADIPOQ epigenetic profile in SAT is established before or after the onset of obesity will need to be confirmed, but is clearly of strong interest.

Interestingly, LEP DNA methylation levels in blood, SAT and VAT, and ADIPOQ DNA methylation levels in SAT and VAT were both found to be positively associated with LDL- C levels suggesting a common epigenetic regulation independently of their biological roles although these two adipokines are oppositely regulated. In addition, we report that the association between LDL-C and LEP mRNA levels are partially dependent on LEP rs2167270 genotype and DNA methylation levels at CpG17. I n vitro studies have shown that the incubation of endothelial cells with LDL or oxidized-LDL increases DNA methylation levels at specific gene loci through the induction of DNA methyltransferase 1 (DNMT1) expression and activity [50,51]. Interestingly, the use of statins, the most prescribed lipid lowering drugs, is associated with the down regulation of DNMT activity and demethylation of BMP2 promoter in mice and cell culture models [52]. Whether the effect of statins is direct (DNMT activity) or mediated through LDL-C lowering needs to be further investigated. Still, our results and those from these previous studies suggest that LDL-C might be involved in the regulation of LEP and ADIPOQ gene DNA methylation levels with possible impacts on mRNA transcription, and that, independently of their biological roles. It is recognized that the treatment of dyslipidemia with statins increases insulin resistance and the risk for type 2

257 diabetes [53,54]. The modifications of LDL-C levels and adipokines epigenetic profile by statins might be one of the mechanisms contributing to the insulin resistance state. Consequently, it will be of great clinical interest to confirm the directionality of these associations and to further investigate their respective mechanisms of regulation through epigenetic changes.

The identification of DNA methylation surrogate measures in readily accessible tissue remains an important challenge in epigenetic epidemiology [55,11]. In the current study, paired adipose tissues and blood samples were analysed and tested to assess whether they show DNA methylation profile similarities at adipokine gene loci. DNA methylation levels at LEP -CpG11 and CpG17 were found to be associated with LDL-C levels in both SAT and blood samples. These two CpGs were recently identified by our group among the most promising CpG sites to be used in blood as a surrogate for LEP DNA methylation in adipose tissues [34]. DNA methylation levels at CpG11 and CpG17 were found to be modestly but significantly correlated between SAT and blood (r = 0.43, p < 0.01; r = 0.58, p < 0.01 respectively) [34]. These two CpGs are respectively within C/EBP and SP1 transcription factor binding sites (TFBS), both involved in LEP gene expression regulation [56,35]. The correlations reported between LEP -CpG11 and -CpG17 DNA methylation and LDL-C levels in SAT and blood suggesting that DNA methylation regulation by LDL-C at these two CpG sites is common to both tissues. Moreover, as these associations are similar in SAT and blood, they are very likely independent of cellular count. The current results thus support that LEP - CpG11 and -CpG17 DNA methylation levels in blood are potential relevant surrogates for SAT DNA methylation levels.

The strengths of the current study include analyses of two adipokines central in energy metabolism regulation in two adipose tissue compartments and in blood. Blood is the most clinically accessible tissue whereas adipose tissues are those biologically relevant for the study of obesity and adipokine epigenetic regulation. Access to adipose tissues remains restricted, and this study provides insights on the use of blood as a potential surrogate tissue in epigenetic epidemiology. None of our participants were taking medication to treat any of the metabolic syndrome components and were on average metabolically fit. This metabolically-healthy obese population has a unique obesity phenotype and metabolism, and

258

LEP and ADIPOQ DNA methylation profiles might be distinct in these participants. Consequently, the results reported in the current study need to be validated in normal weight populations as well as obese populations with cardiometabolic complications. Moreover, as we are reporting cross-sectional observations, longitudinal and functional studies are needed to determine the causality of the relationships between adipokine DNA methylation, anthropometric variables and plasma LDL-C levels.

CONCLUSIONS This study provides further evidence that LEP DNA methylation levels in blood cells and ADIPOQ DNA methylation levels in SAT are associated with obesity-related anthropometric measures. It also suggests that LDL-C, known to regulate DNA methylation processes, could be involved in adipokines’ gene expression regulation through epigenetic changes. Interestingly, similar correlations were observed between LEP DNA methylation and LDL- C levels in blood and SAT. This might be of clinical importance considering that the access to biologically active tissues, such as adipose tissues is limited.

259

ABBREVIATIONS ADIPOQ, Adiponectin; BMI, Body mass index; CRP, C-reactive protein; DNMT, DNA methyltransferase; HDL-C, High-density lipoprotein cholesterol; LDL-C, Low-density lipoprotein cholesterol; LEP, Leptin; SAT, Subcutaneous adipose tissue; SNP, Single nucleotide polymorphism; TC, Total cholesterol; VAT, Visceral adipose tissue

COMPETING INTEREST The authors declare that they have no competing interest.

AUTHOR’S CONTRIBUTIONS A.A.H contributed to the study design, performed the data collection, the data analysis/interpretation and wrote the manuscript. C.L. contributed to data collection and revised the manuscript. S.B., O.L., L.B., S.M., M.C.V. and A.T. participated in the conception of the study design and revised the manuscript. M.F.H. and L.B. conceived the study design, participated in the data analysis/interpretation process and revised the manuscript. All authors read and approved the final manuscript.

ACKNOWLEDGMENTS The authors acknowledge the invaluable collaboration of the surgery team, bariatric surgeons (Hould F.S., Lebel S., Marceau P.) and biobank staff of the IUCPQ. The authors also express their gratitude to Céline Bélanger, Chicoutimi Hospital, for her thoughtful language revision of the manuscript. L.B. is a junior research scholar from the Fonds de la recherche du Québec - santé (FRQS). M.F.H. was a FRSQ Research Scholar and was awarded Clinical Scientist award by the Canadian Diabetes Association; she is now supported by American Heart Association (AHA) and American Diabetes Association (ADA) awards. L.B. and M.F.H. are members of the FRQS-funded Centre de recherche du CHUS. A.T. is the director of a Research Chair in Bariatric and Metabolic Surgery. M.C.V. is the recipient of the Canada Research Chair in Genomics Applied to Nutrition and Health. A.A.H. is the recipient of a doctoral training award from the FRQS and the Faculté de Médecine et des Sciences de la Santé de l’Université de Sherbrooke. This project was supported by the Canadian Institutes of Health Research and the FRQS.

260

REFERENCES

1. Malik VS, Willett WC, Hu FB. Global obesity: trends, risk factors and policy implications. Nat Rev Endocrinol. 2013;9(1):13–27.

2. Swinburn BA, Sacks G, Hall KD, McPherson K, Finegood DT, Moodie ML, et al . The global obesity pandemic: shaped by global drivers and local environments. Lancet. 2011;378(9793):804–14.

3. Yang W, Kelly T, He J. Genetic epidemiology of obesity. Epidemiol Rev. 2007;29:49–61.

4. Waalen J. The genetics of human obesity. Translational research: the journal of laboratory and clinical medicine. 2014;164(4):293-301.

5. Hebebrand J, Volckmar AL, Knoll N, Hinney A. Chipping away the 'missing heritability': GIANT steps forward in the molecular elucidation of obesity - but still lots to go. Obes Facts. 2010;3(5):294–303.

6. Jaenisch R, Bird A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet. 2003;33:245–54.

7. Turner BM. Epigenetic responses to environmental change and their evolutionary implications. Philos Trans R Soc Lond B Biol Sci. 2009;364(1534):3403–18.

8. Henikoff S, Matzke MA. Exploring and explaining epigenetic effects. Trends Genet. 1997;13(8):293–5.

9. Bird A. DNA methylation patterns and epigenetic memory. Genes Dev. 2002;16(1):6–21.

10. Tobi EW, Lumey LH, Talens RP, Kremer D, Putter H, Stein AD, et al . DNA methylation differences after exposure to prenatal famine are common and timing- and sex-specific. Hum Mol Genet. 2009;18(21):4046–53.

11. Houde AA, Hivert MF, Bouchard L. Fetal epigenetic programming of adipokines. Adipocyte. 2013;2(1):41–6.

261

12. Pilsner JR, Hall MN, Liu X, Ilievski V, Slavkovich V, Levy D, et al . Influence of prenatal arsenic exposure and newborn sex on global methylation of cord blood DNA. PloS One. 2012;7(5), e37147.

13. Ling C, Ronn T. Epigenetic adaptation to regular exercise in humans. Drug Discov Today. 2014; 19(7):1015-8.

14. Gillberg L, Jacobsen SC, Ronn T, Brons C, Vaag A. PPARGC1A DNA methylation in subcutaneous adipose tissue in low birth weight subjects–impact of 5 days of high-fat overfeeding. Metabolism. 2014;63(2):263–71.

15. Dick KJ, Nelson CP, Tsaprouni L, Sandling JK, Aissi D, Wahl S et al . DNA methylation and body-mass index: a genome-wide analysis. Lancet. 2014;383(9933):1990-8.

16. Milagro FI, Gomez-Abellan P, Campion J, Martinez JA, Ordovas JM, Garaulet M. CLOCK, PER2 and BMAL1 DNA methylation: association with obesity and metabolic syndrome characteristics and monounsaturated fat intake. Chronobiol Int. 2012;29(9):1180– 94.

17. Jacobsen SC, Gillberg L, Bork-Jensen J, Ribel-Madsen R, Lara E, Calvanese V, et al . Young men with low birthweight exhibit decreased plasticity of genome-wide muscle DNA methylation by high-fat overfeeding. Diabetologia. 2014;57(6):1154–8.

18. Bouchard L, Rabasa-Lhoret R, Faraj M, Lavoie ME, Mill J, Perusse L, et al . Differential epigenomic and transcriptomic responses in subcutaneous adipose tissue between low and high responders to caloric restriction. Am J Clin Nutr. 2010;91(2):309–20.

19. Ronn T, Volkov P, Davegardh C, Dayeh T, Hall E, Olsson AH, et al . A six months exercise intervention influences the genome-wide DNA methylation pattern in human adipose tissue. PLoS Genet. 2013;9(6), e1003572.

20. Moleres A, Campion J, Milagro FI, Marcos A, Campoy C, Garagorri JM, et al . Differential DNA methylation patterns between high and low responders to a weight loss intervention in overweight or obese adolescents: the EVASYON study. FASEB J. 2013;27(6):2504–12.

262

21. Fantuzzi G. Adipose tissue, adipokines, and inflammation. J Allergy Clin Immunol. 2005;115(5):911–9.

22. Havel PJ. Update on adipocyte hormones: regulation of energy balance and carbohydrate/lipid metabolism. Diabetes. 2004;53 Suppl 1:S143–51.

23. Bouchard L, Thibault S, Guay SP, Santure M, Monpetit A, St-Pierre J, et al . Leptin gene epigenetic adaptation to impaired glucose metabolism during pregnancy. Diab Care. 2010;33(11):2436–41.

24. Bouchard L, Hivert MF, Guay SP, St-Pierre J, Perron P, Brisson D. Placental adiponectin gene DNA methylation levels are associated with mothers' blood glucose concentration. Diabetes. 2012;61(5):1272–80.

25. Obermann-Borst SA, Eilers PH, Tobi EW, de Jong FH, Slagboom PE, Heijmans BT, et al . Duration of breastfeeding and gender are associated with methylation of the LEPTIN gene in very young children. Pediatr Res. 2013;74(3):344–9.

26. Garcia-Cardona MC, Huang F, Garcia-Vivas JM, Lopez-Camarillo C, Del Rio Navarro BE, Navarro Olivos E et al . DNA methylation of leptin and adiponectin promoters in children is reduced by the combined presence of obesity and insulin resistance. Int J Obes (Lond). 2014;38(11):1457-65.

27. van Harmelen V, Dicker A, Ryden M, Hauner H, Lonnqvist F, Naslund E, et al . Increased lipolysis and decreased leptin production by human omental as compared with subcutaneous preadipocytes. Diabetes. 2002;51(7):2029–36.

28. Lihn AS, Bruun JM, He G, Pedersen SB, Jensen PF, Richelsen B. Lower expression of adiponectin mRNA in visceral adipose tissue in lean and obese subjects. Mol Cell Endocrinol. 2004;219(1–2):9–15.

29. Neeland IJ, Ayers CR, Rohatgi AK, Turer AT, Berry JD, Das SR, et al . Associations of visceral and abdominal subcutaneous adipose tissue with markers of cardiac and metabolic risk in obese adults. Obesity (Silver Spring). 2013;21(9):E439–47.

263

30. Marceau P, Hould FS, Simard S, Lebel S, Bourque RA, Potvin M, et al . Biliopancreatic diversion with duodenal switch. World J Surg. 1998;22(9):947–54.

31. Vohl MC, Sladek R, Robitaille J, Gurd S, Marceau P, Richard D, et al . A survey of genes differentially expressed in subcutaneous and visceral adipose tissue in men. Obes Res. 2004;12(8):1217–22.

32. Bouchard L, Faucher G, Tchernof A, Deshaies Y, Lebel S, Hould FS, et al . Comprehensive genetic analysis of the dipeptidyl peptidase-4 gene and cardiovascular disease risk factors in obese individuals. Acta Diabetol. 2009;46(1):13–21.

33. Dejeux E, El abdalaoui H, Gut IG, Tost J. Identification and quantification of differentially methylated loci by the pyrosequencing technology. Methods Mol Biol. 2009;507:189–205.

34. Houde AA, Legare C, Hould FS, Lebel S, Marceau P, Tchernof A, et al . Cross-tissue comparisons of leptin and adiponectin: DNA methylation profiles. Adipocyte. 2014;3(2):132–40.

35. Melzner I, Scott V, Dorsch K, Fischer P, Wabitsch M, Bruderlein S, et al . Leptin gene expression in human preadipocytes is switched on by maturation-induced demethylation of distinct CpGs in its proximal promoter. J Biol Chem. 2002;277(47):45420–7.

36. Stoger R. In vivo methylation patterns of the leptin promoter in human and mouse. Epigenetics. 2006;1(4):155–62.

37. Marchi M, Lisi S, Curcio M, Barbuti S, Piaggi P, Ceccarini G, et al . Human leptin tissue distribution, but not weight loss-dependent change in expression, is associated with methylation of its promoter. Epigenetics. 2011;6(10):1198–206.

38. Janssen I, Katzmarzyk PT, Ross R. Waist circumference and not body mass index explains obesity-related health risk. Am J Clin Nutr. 2004;79(3):379–84.

264

39. Despres JP, Lemieux I, Bergeron J, Pibarot P, Mathieu P, Larose E, et al . Abdominal obesity and the metabolic syndrome: contribution to global cardiometabolic risk. Arterioscler Thromb Vasc Biol. 2008;28(6):1039–49.

40. World Health Organisation. Obesity: preventing and managing the global epidemic. Report of a WHO consultation. World Health Organ Tech Rep Ser. 2000;894:i-xii, 1–253.

41. American Diabetes Association. Standards of medical care in diabetes--2014. Diab Care. 2014;37 Suppl 1:S14-80.

42. National Cholesterol Education Program Expert Panel. Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) final report. Circulation. 2002;106(25):3143–421.

44. Khalyfa A, Carreras A, Hakim F, Cunningham JM, Wang Y, Gozal D. Effects of late gestational high-fat diet on body weight, metabolic regulation and adipokine expression in offspring. Int J Obes (Lond). 2013;37(11):1481–9.

45. Samara A, Marie B, Pfister M, Visvikis-Siest S. Leptin expression in Peripheral Blood Mononuclear Cells (PBMCs) is related with blood pressure variability. Clin Chim Acta. 2008;395(1–2):47–50.

46. Hribal ML, Fiorentino TV, Sesti G. Role of C reactive protein (CRP) in leptin resistance. Curr Pharm Des. 2014;20(4):609–15.

47. Talens RP, Boomsma DI, Tobi EW, Kremer D, Jukema JW, Willemsen G, et al . Variation, patterns, and temporal stability of DNA methylation: considerations for epigenetic epidemiology. FASEB J. 2010;24(9):3135–44.

265

48. Song F, Smith JF, Kimura MT, Morrow AD, Matsuyama T, Nagase H, et al . Association of tissue-specific differentially methylated regions (TDMs) with differential gene expression. Proc Natl Acad Sci U S A. 2005;102(9):3336–41.

49. Kitamura E, Igarashi J, Morohashi A, Hida N, Oinuma T, Nemoto N, et al . Analysis of tissue-specific differentially methylated regions (TDMs) in humans. Genomics. 2007;89(3):326–37.

50. Kumar A, Kumar S, Vikram A, Hoffman TA, Naqvi A, Lewarchik CM, et al . Histone and DNA methylation-mediated epigenetic downregulation of endothelial Kruppel-like factor 2 by low-density lipoprotein cholesterol. Arterioscler Thromb Vasc Biol. 2013;33(8):1936–42.

51. Yang TC, Chen YJ, Chang SF, Chen CH, Chang PY, Lu SC. Malondialdehyde mediates oxidized LDL-induced coronary toxicity through the Akt-FGF2 pathway via DNA methylation. J Biomed Sci. 2014;21:11.

52. Kodach LL, Jacobs RJ, Voorneveld PW, Wildenberg ME, Verspaget HW, van Wezel T, et al . Statins augment the chemosensitivity of colorectal cancer cells inducing epigenetic reprogramming and reducing colorectal cancer cell 'stemness' via the bone morphogenetic protein pathway. Gut. 2011;60(11):1544–53.

53. Sattar N, Preiss D, Murray HM, Welsh P, Buckley BM, de Craen AJ, et al . Statins and risk of incident diabetes: a collaborative meta-analysis of randomised statin trials. Lancet. 2010;375(9716):735–42.

54. Aiman U, Najmi A, Khan RA. Statin induced diabetes and its clinical implications. J Pharmacol Pharmacother. 2014;5(3):181–5.

55. Mill J, Heijmans BT. From promises to practical strategies in epigenetic epidemiology. Nat Rev Genet. 2013;14(8):585–94.

56. Mason MM, He Y, Chen H, Quon MJ, Reitman M. Regulation of leptin promoter function by Sp1, C/EBP, and a novel factor. Endocrinology. 1998;139(3):1013–22.

CHAPITRE 9 - DISCUSSION

Dans le cadre de la présente thèse, nous avons utilisé les approches à l’échelle du génome et par gènes candidats afin d’identifier les voies métaboliques et les gènes présentant des modifications épigénétiques chez le nouveau-né (échantillons de placenta et sang de cordon) suite à l’exposition in utero à l’hyperglycémie maternelle. Les résultats des 4 premiers articles de cette thèse démontrent que la méthylation de l’ADN des gènes impliqués dans les voies biologiques des maladies métaboliques, notamment dans la régulation du métabolisme énergétique et lipidique, est altérée par l’exposition à l’hyperglycémie maternelle. Nos résultats supportent donc l’hypothèse selon laquelle la méthylation de l’ADN est impliquée dans la programmation métabolique fœtale associée au DG. De plus, ils suggèrent que la signature épigénétique mise en place in utero suite à l’exposition au DG pourrait prédisposer les nouveau-nés à l’obésité et aux CCM. Les deux premières sections de cette discussion présenteront les résultats des études que nous avons réalisées par l’approche à l’échelle du génome et par gènes candidats, les limites des deux stratégies utilisées ainsi que certaines perspectives de recherche dans le contexte de la programmation fœtale associée au DG.

La troisième section de cette discussion présentera un résumé des résultats des trois études exploratoires qui ont été réalisées afin de mieux comprendre les variations de méthylation de deux gènes candidats de la programmation métabolique fœtale, les gènes LEP et ADIPOQ , dans différents tissus. La comparaison de la méthylation de LEP et ADIPOQ a notamment été réalisée dans le sang et les dépôts de tissu adipeux sous-cutané et viscéral de sujets sévèrement obèses afin d’identifier des similarités et de déterminer si certains sites CpG pourraient éventuellement être utilisés comme marqueurs de la susceptibilité à l’obésité et aux maladies métaboliques en clinique. L’identification de tels marqueurs pourrait s’avérer particulièrement prometteuse pour améliorer la prévention de l’obésité et des CCM chez les nouveau-nés. Cependant, l’étude des modifications épigénétiques dans le contexte de la programmation fœtale étant au stade embryonnaire, plusieurs aspects doivent encore être élucidés avant l’utilisation de tels marqueurs en clinique. La dernière partie de la discussion présentera les défis pour l’identification de marqueurs épigénétiques associés à la 267 programmation métabolique fœtale tout en mettant en contexte les résultats de notre étude exploratoire sur les gènes LEP et ADIPOQ .

9.1 Analyse du méthylome du placenta et du sang de cordon suite à l’exposition au diabète gestationnel

9.1.1 Le résumé des résultats de notre étude épigénomique

La première approche que nous avons utilisée afin de caractériser l’impact du DG sur la méthylation de l’ADN du nouveau-né est l’approche pangénomique. À l’aide de micropuces Infinium HumanMethylation 450K d’Illumina, nous avons analysé dans 44 échantillons de placenta et de sang de cordon la méthylation de plus de 450 000 sites CpG distribués à travers le génome. La comparaison du méthylome des échantillons de placenta et de sang cordon provenant de mère ayant eu une grossesse normoglycémique (n=14) avec celui de mères diagnostiquées avec un DG (critères de l’OMS) (n=30) a permis d’identifier les gènes épigénétiquement modifié par l’exposition au DG. Cette étude est très innovante dans le domaine de la recherche sur la programmation métabolique fœtale et est d’ailleurs la première publiée sur le sujet. Malheureusement, la taille échantillonnale de cette première étude était insuffisante et aucun des gènes identifiés n’a démontré de différence de méthylation significative à l’échelle pangénomique (Bonferroni = 1,06 x 10 -7 ou p = 0,05/473 864 sites CpG situés sur des autosomes). Les meilleures valeurs de p obtenues étaient tout de même de l’ordre de p de 1,61 x 10 -6 pour le placenta et de 2,00 x 10 -5 pour le sang de cordon. Afin de pallier le manque de puissance statistique de notre étude et de diminuer les risques d’erreurs de type I, nous avons eu recours à deux stratégies. La première consiste à utiliser une approche convergente, soit l’analyse conjointe des échantillons de placenta et de sang de cordon. L’identification de gènes démontrant des différences de méthylation significatives dans ces deux tissus permet d’augmenter les probabilités que nos résultats soient des vrais positifs. Parmi les gènes démontrant des différences de méthylation nominalement significative ( p ≤ 0,05) entre les échantillons de placenta et de sang de cordon exposés ou non exposés au DG, nous avons identifié 1 029 gènes communs aux deux tissus. Ensuite, nous avons fait une analyse ontologique afin d’identifier les voies métaboliques présentant le plus grand nombre de gènes épigénétiquement modifiés par l’exposition au DG dans le placenta, le sang de cordon et conjointement dans ces deux tissus.

268

L’analyse des voies métaboliques a révélé que les gènes épigénétiquement modifiés par une exposition au DG étaient principalement impliqués dans des voies biologiques associées aux maladies métaboliques, notamment celles du métabolisme du glucose et du DT2. Notre étude épigénomique est la première à suggérer que les modifications épigénétiques induites par le DG ne sont pas aléatoires mais qu’elles cibleraient particulièrement les voies biologiques des maladies métaboliques. De ce fait, nos résultats supportent le rôle de la méthylation de l’ADN dans la programmation métabolique fœtale. De plus, bien que les différences de méthylation observées entre les échantillons de placenta et de sang de cordon exposés ou non exposés au DG n’atteignent pas le seuil de significativité statistique à l’échelle pangénomique, cette étude a permis d’identifier des gènes candidats potentiels de la programmation métabolique fœtale associée au DG. Afin de confirmer l’association entre l’exposition in utero au DG et le profil épigénétique de certains de ces gènes, nous avons analysé leur méthylation dans la cohorte de naissance Gen3G provenant du Centre hospitalier universitaire de Sherbrooke (CHUS) et qui est indépendante à la nôtre. Les 10 gènes que nous avons sélectionnés pour la validation sont présents dans les voies biologiques associées aux maladies métaboliques et sont donc plus susceptibles d’être impliqués dans la programmation métabolique fœtale. Ces mêmes 10 gènes ont des niveaux de méthylation qui sont significativement affectés par l’exposition au DG à la fois dans le placenta et dans le sang de cordon (p ≤ 0,01 dans les deux tissus). Cette approche convergente, en plus de diminuer le risque d’erreur de type 1, permet d’identifier les gènes qui sont susceptibles d’être épigénétiquement modifiés dans les autres tissus du nouveau-né, incluant les tissus métaboliquement actifs.

Une avenue de recherche intéressante, qui n’a cependant pas été abordée dans la présente thèse, consisterait à valider, dans un cohorte indépendante, l’association entre le DG et la méthylation des gènes démontrant des différences de méthylation les plus statistiquement significatives dans les échantillons de placenta et le sang de cordon exposés ou non exposés au DG de la cohorte E-21 (Tableau 9.1). La majorité de ces gènes ont précédemment été associés au métabolisme énergétique et/ou à certaines CCM. Ils constituent donc aussi d’excellents gènes candidats potentiels de la programmation métabolique fœtale (Tableau 9.1). Les gènes ADAP1 , STC2 , TRIM15 et KHDC1 n’ont pas

269 de fonction biologique identifiée dans la régulation du métabolisme énergétique et des maladies cardiométaboliques. Néanmoins, ils pourraient s’avérer être impliqués dans le développement de ces pathologies. Afin de valider l’implication de ces gènes dans la programmation métabolique fœtale, il serait intéressant de confirmer les associations rapportées dans la cohorte E-21 et de déterminer, à l’aide d’études longitudinales, si la méthylation de ces gènes est associée au développement de l’obésité et des CCM. Des études fonctionnelles à l’aide de modèles in vitro et animaux pourraient subséquemment être utilisées pour déterminer la fonction biologique de ces gènes et leurs rôles précis dans le développement des maladies associées à l’obésité.

270

Tableau 9.1– Les 5 gènes démontrant les différences de méthylation les plus significatives entre les échantillons de placenta ou de sang de cordon exposés au DG et à un environnement in utero normoglycémique dans la cohorte E-21 DG TNG GÈNE # SONDE MOY. É-T MOY. É-T P FONCTION BIOLOGIQUE PLACENTA SNP associés à des anomalies du rythme cardiaque (fibrillation ventriculaire) DPP6 cg03472695 51,3% 7,2% 64,3% 6,2% 1,01E-06 (Chopra et Knollmann, 2011) TOX2 cg16970323 22,7% 4,3% 33,8% 6,9% 1,61E-06 SNP associé à la pression artérielle systolique et diastolique (Basson et al ., 2014) Encode une flavine-monooxygénase de type 1 (FMO1) impliquée dans la FMO1 cg02456238 81,6% 3,9% 86,0% 2,8% 2,79E-05 régulation de l'homéostasie énergétique (Veeravalli et al ., 2014) Encode un récepteur du peptide vasoactif intestinal (VIP) qui stimule la VIPR1 cg10970409 15,0% 3,5% 20,6% 3,8% 7,34E-05 sécrétion d'insuline et de glucagon (Moody et al ., 2011) Encode la protéine centaurine-alpha 1 exprimée dans le cerveau, le tissu ADAP1 cg05085844 48,5% 12,6% 33,8% 7,3% 8,37E-05 adipeux, le cœur et le muscle et reconnue pour interagir avec plusieurs protéines kinases (Whitley et al ., 2002) SANG DE CORDON Encode la stanniocalcine de type 2 , un agent hypocalcique qui joue un rôle STC2 cg01984743 53,2% 3,7% 60,6% 5,3% 1,00E-05 importante dans le métabolisme du calcium et du phosphate (Yeung et al ., 2012) SNP associés à la concentration plasmatique de triglycérides et de lipoprotéines TRIB1 cg06992846 55,0% 3,4% 60,3% 2,5% 2,00E-05 (Kathiresan et al ., 2008; Edmondson et al ., 2011; Kraja et al , 2011; De Castro-Oros et al ., 2014) Encode la BTB/POZ domain-containing protein 1 impliquée dans la BTBD1 cg01695279 48,7% 3,5% 54,0% 3,6% 1,20E-04 différenciation cellulaire notamment celle des cellules mésenchymateuses en cellules musculaires et adipeuses (Pisani et al., 2007) Encode la protéine TRIM15, membre de la famille des protéines à motif TRIM15 cg03261948 75,0% 3,0% 79,3% 3,6% 1,60E-04 tripartite, elle a récemment été associée à la migration et l'adhésion cellulaire (Uchil et al ., 2014) KHDC1 cg01394339 67,6% 5,5% 73,5% 2,4% 1,80E-04 Encode la protéine KHDC1 dont la fonction biologique est encore inconnue DG, diabète gestationnel; TNG, tolérance normale au glucose (normoglycémiques); MOY, moyenne; É-T, écart-type

271

9.1.2 La validation des résultats de notre étude épigénomique

Tel que présenté dans le chapitre 3, la validation des associations entre l’hyperglycémie maternelle et la méthylation de l’ADN des 10 gènes les plus prometteurs de la cohorte E-21 a été effectuée par pyroséquençage de l’ADN traité au bisulfite de sodium. Pour des raisons techniques, il n’a pas été possible de quantifier la méthylation de deux des 10 gènes sélectionnés. Parmi les 8 gènes analysés dans la cohorte Gen3G, nous avons démontré qu’il existe une relation linéaire entre la glycémie maternelle et la méthylation de l’ADN pour trois des 8 gènes que nous avons analysés. En effet, nous avons observé que la glycémie 2h post- HGPO au 2e trimestre de la grossesse est négativement corrélée avec les niveaux de méthylation des gènes BRD2 et LRP1B dans le placenta, ainsi qu’avec ceux des gènes BRD2 , CACNA1D et LRP1B dans le sang de cordon. Ces trois gènes candidats ont précédemment été associés au développement de l’obésité et de certaines CCM. Ainsi, une perturbation du profil de méthylation de ces gènes pourrait vraisemblablement être impliquée dans la programmation métabolique fœtale du nouveau-né exposé au DG. Il est intéressant de noter que ces associations sont seulement présentes chez les mères ayant eu une grossesse normoglycémique. Cela suggère que l’épigénome peut être modifié par la glycémie maternelle même lorsqu’elle est en deçà des seuils diagnostiques du DG.

En outre, le fait que les associations entre la glycémie maternelle et la méthylation de l’ADN ne confirment pas celles observés dans la cohorte E-21 chez les femmes avec DG peut potentiellement être expliqué par la disparité entre les critères diagnostiques du DG des deux cohortes. Dans la cohorte E-21, le diagnostic de DG a suivi les critères de l’OMS tandis que les critères de l’IADPSG, plus stricts, ont été utilisés pour le diagnostic de DG de la cohorte Gen3G. Parmi les mères diagnostiquées avec un DG dans la cohorte Gen3G (n=20), 5 n’auraient pas été diagnostiquées avec un DG si les critères de l’OMS avaient été appliqués. Ces femmes avaient une glycémie 2h post-HGPO plus basse que 7,8 mmol/L (4,9 à 7,5 mmol/L). De ce fait, le métabolisme glucidique des femmes diagnostiquées avec un DG dans la cohorte Gen3G est possiblement moins détérioré que celui des femmes de la cohorte E- 21. Le traitement (diète ou diète et insuline) des femmes diagnostiquées avec un DG pourrait également avoir eu un impact significatif sur les niveaux de méthylation des gènes du placenta et du sang de cordon. Une étude exploratoire que nous avons réalisées avec les

272 résultats d’analyses des micropuces 450K de la cohorte E-21 suggère d’ailleurs que la méthylation de certains gènes est influencée par le traitement du DG. Brièvement, nous avons mené une analyse de la covariance (ANCOVA) afin de comparer le méthylome du placenta et du sang cordon provenant des mères normoglycémiques (n=14) avec celui des mères avec un DG traité avec une diète (n=16) ou une diète et de l’insuline (n=13). Les gènes présentant les différences de méthylation les plus significatives entre les 3 groupes ( p ≤ 1 x10 -5) sont présentés dans la figure 9.1. Nos résultats démontrent que la méthylation de certains gènes (TOX2 , DPP6 et STC2 ) n’est pas influencée par la nature du traitement du DG (Figure 9.1 – Panneau A). Cependant, nous avons observé que les niveaux de méthylation de d’autres gènes (PLB1 , GNASAS et MYH7B ) sont différents chez les mères avec un DG traitées avec une diète et sont similaires entre les mères normoglycémiques et ayant un DG traitées avec une diète et de l’insuline (Figure 9.1- Panneau B). Ces résultats préliminaires suggèrent que le traitement à l’insuline pourrait normaliser les niveaux de méthylation de certains loci. Des études à plus grandes échelles sont néanmoins nécessaires afin de valider l’effet du traitement du DG sur le méthylome du placenta et du sang de cordon. De plus, des modèles de culture cellulaire de placenta analysant les effets indépendants et combinés de l’hyperglycémie et de l’insuline sur la méthylation des gènes permettraient de déterminer si le traitement à l’insuline modifie la méthylation de l’ADN de façon directe ou via son action hypoglycémiante. Ces études in vitro pourraient également nous permettre d’en apprendre davantage sur les mécanismes moléculaires et cellulaires pouvant associés l’hyperglyécmie aux perturbations du méthylome. Des modèles de culture de cellules placentaires et de cellules trophoblastiques immortalisées BeWo ont précédemment été utilisés pour étudier l’effet du glucose et de l’insuline sur l’expression de gènes candidats (Gauster et al ., 2011; Araujo et al ., 2013).

273

*Valeur p ANCOVA ajusté pour l’IMC de la mère au premier trimestre, les antécédents de DG, l’âge gestationnel et le sexe du nouveau-né **Les moyennes sont significativement différentes entre les deux groupes p ≤ 0.01

Figure 9.1- Effet du traitement du DG sur le méthylome du placenta et du sang de cordon A-La nature du traitement du DG n’a aucun effet sur la méthylation de certains gènes du placenta (TOX2 et DPP6 ) et du sang de cordon ( STC2 ). Pour ces trois gènes les niveaux de méthylations sont similaires entre les échantillons de placenta et de sang de cordon provenant des mères traitées avec une diète (DG-D) ou une diète et de l’insuline (DG-I). B-Par contre, les niveaux de méthylation des gènes PLB1 , GNASAS et MYH7B sont influencés par le traitement du DG. Les niveaux de méthylation de ces gènes sont différents chez les mères avec un DG traité avec une diète (DG-D) et sont similaires entre les mères ayant une tolérance normale au glucose (TNG) et ayant un DG traité avec une diète et de l’insuline (DG-I).

274

Les résultats de notre étude de validation suggèrent que le critère diagnostique du DG et/ou la nature du traitement du DG peut avoir un impact sur le méthylome du placenta et du sang de cordon. De plus, ils confirment qu’il existe une relation linéaire entre la glycémie maternelle et la méthylation de certains gènes associés aux voies biologiques des maladies métaboliques, et ce même lorsque la glycémie est sous le seuil des critères diagnostiques du DG. Il est reconnu qu’une légère augmentation de la glycémie maternelle au 2 e trimestre de la grossesse, chez les mères normoglycémiques ou avec un DG, est positivement corrélée avec le poids du bébé, son adiposité à la naissance ainsi qu’avec les concentrations de peptide-C du sang de cordon (Catalano et al ., 2003; Hill et al ., 2005; Metzger et al ., 2008; HAPO, 2009; Luo et al ., 2010; Gesteiro et al ., 2011; Farah et al ., 2011). L’augmentation des complications néonatales en réponse à des concentrations croissantes de glucoses maternelles pourrait être, du moins en partie, causée par la perturbation des niveaux de méthylation de l’ADN de certains gènes. À la lumière de ces résultats, l’étude de la relation linéaire entre la glycémie maternelle et le méthylome du nouveau-né chez les mères normoglycémiques seulement apparaît optimale pour la réalisation d’études multicentriques où les critères diagnostiques du DG diffèrent d’un centre à l’autre. Cette stratégie permet de contrer l’effet des critères diagnostiques sur le méthylome.

9.1.3 Les limites de notre étude épigénomique

L’étude épigénomique que nous avons réalisée présente certaines limites qui pourraient expliquer les disparités entre les résultats obtenus dans la cohorte E-21 et Gen3G. Des facteurs confondants tels que le l’hétérogénéité cellulaire des échantillons de placenta et de sang de cordon, les variables biologiques de la mère et du nouveau-né de même que des variants génétiques sont susceptibles d’avoir influencé la méthylation de certains gènes identifiés dans le cadre de notre étude épigénomique ou de validation.

9.1.3.1 L’hétérogénéité cellulaire

Chaque type cellulaire possède un patron de méthylation spécifique qui détermine l’expression des gènes. La présence de différents types de cellules au sein d’un échantillon peut donc avoir un impact sur les niveaux de méthylation observés. Des études ont d’ailleurs

275 rapportées que la variabilité de méthylation d’une minorité de sites CpG peut-être causée par l’hétérogénéité cellulaire des échantillons analysés (Talens et al ., 2010; Elliot et al ., 2014; Yuan et al ., 2014). Par conséquent, nous ne pouvons pas exclure que certains de nos résultats soient des faux positifs ou des faux négatifs en raison de la variation de composition cellulaire, en lien avec le DG, de nos échantillons de placenta et de sang de cordon entre les deux cohortes. Les décomptes cellulaires de nos échantillons n’étaient malheureusement pas disponibles. À l’avenir, il serait préférable de procéder au décompte des cellulaires afin de les considérer dans nos modèles statistiques.

Il existe cependant d’autres stratégies afin d’identifier les gènes dont le profil de méthylation est influencé par la composition cellulaire. La déconvolution statistique est une alternative économique et efficace au décompte cellulaire. Cette méthode a notamment été utilisée pour corriger l’effet de la composition cellulaire sur les niveaux de méthylation d’échantillons de sang complet, de cerveau, de placenta et de tumeur gastrique (Houseman et al , 2012; Houseman et al ., 2014; Zou et al ., 2014; Guintivano et al ., 2014). L’équipe du Pre Celia Greenwood de l’Université McGill travaille actuellement avec notre équipe sur des algorithmes statistiques qui permettraient de corriger les résultats de notre étude épigénomique pour la composition cellulaire des échantillons. Dans une étude exploratoire, ils ont utilisé la méthode de surrogate variable analysis précédemment développée pour corriger l’effet de l’hétérogénéité cellulaire dans les études d’expression génique et très similaire à celle utilisée par Houseman (Leek et Storey, 2007; Houseman et al ., 2014). Les résultats préliminaires de leurs analyses démontrent que la correction pour la composition cellulaire diminue l’erreur standard des résultats et augmente le nombre de sites CpG pour lesquels la méthylation est significativement associée au DG dans le placenta et le sang de cordon (Tableau 9.2) (Bathnagar, 2014). Par conséquent, ces résultats suggèrent que l’ajustement pour l’hétérogénéité cellulaire aurait un impact positif sur les résultats de notre étude épigénomique. Des analyses supplémentaires sont cependant nécessaires afin de déterminer si certaines des différences de méthylation identifiées dans notre étude épigénomique étaient dues à la variation de la composition cellulaire de nos échantillons.

276

Tableau 9.2- Nombre de sites CpG affectés par l’exposition au DG dans le placenta et le sang de cordon avant et après la correction pour le décompte cellulaire Valeur p ≤ 1 x 10 -7 1 x 10 -6 1 x 10 -5 1 x 10 -4 1 x 10 -3 0.01 0.05 Placenta Modèle statistique I 0 1 4 44 259 2 492 13 425 Modèle statistique II 1 6 16 87 451 3 368 15 919 Sang de cordon Modèle statistique I 1 1 8 35 253 2 648 14 457 Modèle statistique II 1 5 22 94 575 4 150 18 365 *375 611 et 375 518 sites CpG ont été analysés dans le placenta et le sang de cordon respectivement. Modèle Statistique I- L’association entre la méthylation et l’exposition au DG a été corrigée pour l’âge gestationnel seulement. Modèle Statistique II- L’association entre la méthylation et l’exposition au DG a été corrigée pour l’âge gestationnel et le décompte cellulaire selon la méthode de surrogate variable analysis .

Tiré et modifié Bhatnagar S: Analysis of Methylation data in Cordblood and Placenta tissues (résultats non publiés)

9.1.3.2 Les variables biologiques

Pendant les trois années de mes études doctorales, plusieurs équipes se sont intéressées aux facteurs environnementaux pouvant contribuer à la modification des niveaux de méthylation de l’ADN. Dans le contexte de la programmation fœtale, des variables maternelles telles que l’IMC pré-grossesse, le gain de poids pendant la grossesse, la consommation de tabac et d’alcool, la composition de la diète et le stress ont été associées à la perturbation des niveaux de méthylation de certains sites CpG du placenta et/ou du sang de cordon (Wilhelm-Benartzi et al ., 2012; Dominguez-Salas et al ., 2014; Morales et al ., 2014; Hogg et al ., 2014; Nielsen et al ., 2014, Babenko et al ., 2015;). Il est aussi reconnu que le mode d’accouchement, l’âge gestationnel et le sexe de nouveau-né sont associés à des changements de méthylation du placenta et du sang de cordon (Cruickshank et al ., 2013; Almgren et al ., 2014; Hogg et al ., 2014; Parets et al ., 2014). Les facteurs biologiques confondants représentent donc un défi de taille pour l’étude des modifications épigénétiques dans le contexte de la programmation fœtale. Toutefois, le suivi longitudinal des mères de notre étude pangénomique nous a permis d’apparier les mères des deux groupes étudiés pour différentes variables métaboliques maternelles au 1 er trimestre de la grossesse potentiellement confondantes (Tableau 2.1). De plus, des analyses supplémentaires ont révélé qu’il n’y a aucune différence significative entre les deux groupes pour l’âge gestationnel, le sexe du nouveau-né, le mode d’accouchement,

277 la consommation de tabac et d’alcool et le niveau de stress des mères (Tableau 9.3). Le gain de poids des mères pendant la grossesse et la composition de la diète des mères (donneurs de groupement méthyl (acide folique, vitamine B12, choline, etc…)) sont les deux seules variables maternelles potentiellement confondantes pour lesquels nous n’avons pas pu corriger notre modèle statistique. Le gain de poids des mères pendant la grossesse semble avoir affecté quelques-unes des associations rapportées dans notre étude épigénomique (16% et 10% des associations dans le placenta et le sang de cordon respectivement) (Voir chapitre 2). La composition de la diète des mères pourrait aussi avoir influencé la méthylation à un nombre restreint de sites CpG (Dominguez-Salas et al ., 2014). Par contre, étant donné que nous avons réussi à contrôler l’effet de la plupart des variables confondantes, la majorité des différences de méthylation rapportées dans notre étude épigénomique seraient vraisemblablement engendrées par l’exposition au DG.

Tableau 9.3- Comparaison des facteurs pouvant influencer le méthylome du nouveau- né chez les mères avec un diabète gestationnel (DG) et les mères avec une tolérance normale au glucose (TNG) de la cohorte E-21 DG TNG P (n=30) (n=14) Age gestationnel 39,2 ± 1,5 39,1 ± 1,2 0,83 Sexe du nouveau -né Masculin 16 (53,3%) 7 (50,0%) 0,84 Féminin 14 (46,7%) 7 (50,0%) Mode d’accouchement Vaginal 27 (90,0%) 12 (85,7%) 0,68 Césarienne 3 (10,0%) 2 (14,3%) Consommation de Tabac 1 (3,0%) 0 0,49 Consommation occasionnelle d’alcool 3 (10,0%) 1 (7,1%) 0,76 Niveau de stress des mères Faible 11 (37,9%) 7 (50,0%) Modéré 15 (51,8%) 5 (35,7%) 0,92 Élevé 3 (10,3%) 2 (14,3%)

Le modèl murin du DG, induit par l’injection de STZ en début de grossesse, pourraient notamment être utilisé afin de valider que les variations épigénétiques observées dans la cohorte E-21 sont engendrées par l’augmentation de l’hyperglycémie maternelle et non par d’autres variables confondantes. De plus, les cellules trophoblastiques provenant d’échantillons de placenta prélevés à la naissance ou alternativement des lignées cellulaires immortalisées de tropohoblastes (BeWo, JAR ou JEG-3) pourraient être mises en culture

278 avec différentes concentrations de glucose pour isoler l’effet de l’hyperglycémie sur la méthylation de l’ADN et confirmer les résultats de notre étude pangénomique.

Dans notre étude de validation, les mères de cohorte Gen3G ont été sélectionnées pour qu’elles aient des caractéristiques métaboliques les plus similaires possibles à celles des mères de la cohorte E-21. Néanmoins, certaines différences étaient inévitables. Au premier trimestre de la grossesse, l’IMC des mères NGT de la cohorte Gen3G (28,0 ± 6,5 kg/m 2) est significativement plus élevé que celui des mères de la cohorte E-21 (E-21 : 25,3 ±3,8 kg/m 2) (p ≤ 0,01). Afin de pallier cette différence, nous avons ajusté les corrélations entre la glycémie maternelle et la méthylation de l’ADN pour cette variable potentiellement confondante. Les antécédents de DG, l’âge gestationnel et le sexe du nouveau-né ont aussi été inclus comme covariables dans notre modèle statistique puisque ces variables avaient tendance ou étaient significativement différentes entre les deux cohortes et qu’elles ont été associées à des différences épigénétiques.

9.1.3.2 Les variants génétiques

Les variants génétiques ou les SNP présents chez les nouveau-nés sont également susceptibles d’avoir influencé les résultats de notre étude épigénomique et de validation. Dans un premier temps, des SNP localisés au niveau des sites CpG ou à l’intérieur du site de liaison des sondes de la micropuce 450K peuvent interférer avec la liaison des sondes sur l’ADN. Puisque les sondes ne peuvent pas se lier correctement aux sites CpG d’intérêts, les niveaux de méthylation quantifiés peuvent ne pas correspondent à la réalité. Une étude a récemment estimé que les niveaux de méthylation de 49,3% des sites CpG analysés avec la micropuce 450K pourraient potentiellement être affectés par des SNP (Chen et al., 2013). La majorité des SNP associés à ces sites CpG ont des fréquences alléliques très faibles (< 1.0%), cependant près de 10% d’entre eux présentent des fréquences alléliques plus élevés que 5.0% (Chen et al ., 2013). Par conséquent, il est probable que certaines des différences de méthylation observées entre les échantillons de placenta et de sang de cordon exposés ou non exposés au DG dans la cohorte E-21 soient indirectement causées par la présence d’un SNP nuisant à l’hybridation des sondes de la micropuce 450K sur l’ADN. Néanmoins, ce phénomène semble marginal puisque notre équipe et plusieurs autres (Roessler et al ., 2012;

279

Milenkovic et al ., 2014; ) ont validé avec succès les résultats de la micropuce 450K par la technique de pyroséquençage.

Dans un deuxième temps, il apparaît maintenant de plus en plus évident que certains variants génétiques ont un impact sur le phénotype via la régulation des niveaux de méthylation de certains sites CpG (Bell et al ., 2011; Heyn et al ., 2013; Moen et al ., 2013). Ces variants génétiques sont appellées meQTL puisqu’ils sont associés à la méthylation de sites CpG situés à proximité de ceux-ci. L’interaction entre le génotype du meQTL et l’environnement in utero peut aussi moduler les niveaux de méthylation de l’ADN des ces loci (Teh et al ., 2014). Le génotype permettrait d’expliquer jusqu’à 25% de la variabilité des niveaux de méthylation de certains CpG alors que 75% de la variabilité de méthylation serait expliquée par l’interaction entre le génotype et l’environnement in utero (Teh et al ., 2014).

Il est donc possible que la présence de SNP en lien avec des meQTL chez certains nouveau-nés de la cohorte E-21 ou Gen3G puisse expliquer certaines discordances observées entre les deux cohortes. Dans la cohorte E-21 par exemple, le profil de méthylation du site cg19285525 au niveau du gène RBMS1 du placenta est distinctif de la présence d’un SNP et d’un meQTL. Ainsi, la différence de méthylation observée à ce locus est vraisemblablement due à des différences de fréquences alléliques entre les nouveau-nés exposés et non exposés au DG. Afin de déterminer la contribution du génotype dans les associations que nous avons identifiées, les régions où sont localisés les sites CpG d’intérêt devraient idéalement être séquencées. Toutefois, comme les meQTL peuvent être situés jusqu’à 1 M pb d’un site CpG, il serait préférable d’utiliser l’approche pangénomique (GWAS) en parallèle avec notre étude épigénomique pour l’identification des meQTL (Sun et al ., 2014). Il est intéressant de noter que des SNP associés à l’obésité ou à des CCM ont précédemment été identifiés sur un ou à proximité des gènes démontrant des différences de méthylation entre les échantillons de placenta et/ou de sang de cordon exposés et non-exposés au DG. L’étude des associations entre ces SNP, la méthylation de l’ADN et l’exposition à l’hyperglycémie maternelle nous permettra sans aucun doute de mieux comprendre la régulation des niveaux de méthylation de ces gènes et leur rôle dans la programmation métaboliques fœtale.

280

9.2 Modifications épigénétiques des gènes du métabolisme des lipides suite à l’exposition au diabète gestationnel

En parallèle à notre étude épigénomique incluant la validation, nous avons utilisé l’approche par gènes candidats afin d’identifier des gènes épigénétiquement modifiés suite à l’exposition au DG. Cette stratégie a déjà permis d’identifier des gènes du métabolisme énergétique (LEP , ADIPOQ , IGFBP3 et IGF1R ) et des gènes soumis à l’empreinte parentale ( MEST , GNAS ) dont la méthylation est affectée par les concentrations de glucose maternel au 2e trimestre de la grossesse (Bouchard et al ., 2010; Bouchard et al ., 2012; El Hajj et al ., 2013; Desgagné et al ., 2014; Chen et al ., 2014). Dans le cadre de cette thèse, nous nous sommes intéressés à deux gènes candidats du métabolisme des lipoprotéines, soit la LPL et ABCA1 . Nous avons aussi arrêté notre choix sur ces deux gènes puisqu’il est reconnu que les grossesses compliquées par un DG sont caractérisées par l’altération de la fonction placentaire incluant les mécanismes de transport des lipides (Jansson et al ., 2006; Gauster et al., 2012). Dans une étude pangénomique, Radaelli a d’ailleurs rapporté que les gènes du métabolisme des lipides du placenta étaient ceux qui étaient principalement affectés par l’exposition au DG (plus de 32 gènes) (Radaelli et al ., 2009). De surcroît, les niveaux d’expression d’ARNm placentaire des gènes LPL et ABCA1 ont précédemment été associés à l’exposition à des conditions intra-utérines défavorables incluant le DG et l’obésité maternelle (Radaelli et al ., 2009; Dube et al ., 2012; Dube et al ., 2013, Baumann et al ., 2013). La perturbation du transport des lipides de la mère vers le fœtus pourrait donc vraisemblablement être impliquée dans la macrosomie fœtale et la susceptibilité accrue à l’obésité, aux dyslipidémies et aux MCV observées chez les nouveau-nés exposés in utero au DG. Dans un contexte exploratoire, nous avons donc sélectionné les gènes LPL et ABCA1 et posé l’hypothèse que la méthylation de l’ADN à ces loci est sensible à l’hyperglycémie maternelle et serait impliquée dans la programmation métabolique fœtale. Le gène LPL encode la lipoprotéine lipase (LPL). Dans le placenta, cette enzyme hydrolyse les triglycérides (TG) des chylomicron et des VLDL de la circulation maternelle afin de permettre la libération des acides gras libres vers la circulation fœtale (McCoy et al ., 2002 ; Larque et al ., 2011)((Figure 9.2). De son côté, la protéine placentaire ABCA1, encodée par ABCA1 , est impliquée dans l’homéostasie du cholestérol chez la mère et le fœtus (Keelan et al ., 2011) (Figure 9.2).

281

Les résultats de l’analyse de la méthylation de LPL et ABCA1 dans le placenta sont présentés dans les chapitres 4 et 5 de cette thèse. Brièvement, ils démontrent que la glycémie maternelle 2h post-HGPO au 2e trimestre de la grossesse et les niveaux de c-HDL sont corrélés avec les niveaux de méthylation des gènes LPL et ABCA1. Une association négative entre la méthylation de LPL du côté fœtal du placenta et les niveaux de glucose maternel au 2e trimestre de la grossesse de même qu’avec les niveaux des c-HDL au 3 e trimestre de la grossesse a été rapportée. Du côté maternel du placenta, nous avons observés que les niveaux de méthylation du gène ABCA1 sont positivement corrélés avec les niveaux de glucose maternel au 2 e trimestre de la grossesse et négativement corrélés avec les niveaux de c-HDL au 1 er trimestre. L’ensemble de ces résultats suggèrent donc que la méthylation de LPL et ABCA1 est altérée par les concentrations de glucose et de cholestérol-HDL maternelles à des moments précis de la grossesse. Ces adaptations épigénétiques pourraient avoir un impact fonctionnel sur le transport des lipides de la circulation maternelle vers fœtus puisque nous avons rapporté des associations entre les niveaux de méthylation placentaire de ces deux gènes et leurs niveaux respectifs d’ARNm.

Pour le gène ABCA1 , en plus d’avoir identifié des corrélations entre la méthylation du côté maternel du placenta et le profil métabolique maternel, nous avons observé une corrélation entre la méthylation d’ ABCA1 du côté fœtal du placenta et les niveaux de TG du sang de cordon. De plus, nous avons rapporté une corrélation négative entre les variations de méthylation d’ ABCA1 dans le sang de cordon et la glycémie maternelle au 2 e trimestre de la grossesse. L’ensemble des modifications épigénétiques du gène ABCA1 suggèrent que le méthylome du placenta et du sang de cordon s’adaptent aux stimuli maternels et fœtaux pour optimiser le transfert materno-fœtal du cholestérol et assurer la croissance et le développement normal du fœtus. Ces adaptations épigénétiques, bénéfiques pour le fœtus in utero , pourraient cependant contribuer au développement ultérieur de dyslipidémies et de maladies cardiovasculaires chez le nouveau-né. Afin de mieux comprendre la régulation épigénétique d’ ABCA1 par le profil métabolique maternel et fœtal simultanément, la perfusion placentaire ex vivo pourrait être utilisée (Haggarty et al ., 1999). Ce modèle permet de contrôler les influx placentaire provenant de la circulation maternelle et fœtale. La

282 méthylation du placenta ex vivo pourrait donc être étudiée suite à l’administration de différentes concentrations maternelles et fœtales de lipoprotéines et de glucose.

Les adaptations épigénétiques des gènes LPL et ABCA1 observées dans le placenta et le sang de cordon suite à l’exposition à l’hyperglycémie et aux dyslipidémies maternelles sont susceptibles de programmer la santé métabolique du fœtus en altérant le transport materno-fœtal des lipides. De surcroît, si ces modifications épigénétiques sont également présentes dans d’autres tissus métaboliquement actifs du nouveau-né, elles pourraient contribuer, à long-terme, au développement des dyslipidémies et des MCV. Il est par exemple reconnu que la LPL est fortement exprimée dans le tissu adipeux, le muscle squelettique et le cœur, où elle joue un rôle clé dans le métabolisme des lipoprotéines (Wang et Eckel, 2009). Notre équipe a par ailleurs démontré que la variabilité de méthylation du gène LPL dans le tissu adipeux est corrélée avec les concentrations plasmiques de c-HDL chez des sujets sévèrement obèses adultes (Guay et al , 2013). Les épipolymorphismes du gène LPL dans le placenta, s’ils sont présents dans le tissu adipeux, pourraient donc contribuer, à long-terme, au développement des dyslipidémies et des MCV . Plusieurs études supportent également le rôle de la méthylation du gène ABCA1 dans la programmation métabolique fœtale. La méthylation d’ ABCA1 du sang des adultes a notamment été associée à l’exposition prénatale à la Dutch Hunger Famine (Tobi et al ., 2009). De plus, la méthylation d’ ABCA1 , dans les leucocytes, est associée aux concentrations plasmiques de c- HDL et à la maladie coronarienne (Guay et al , 2012; Guay et al ., 2014).

Nos résultats et ceux des précédentes études, suggèrent que la méthylation des gènes LPL et ABCA1 peut être programmée in utero par le profil métabolique maternel et possiblement contribuer à la pathogenèse des dyslipidémies et des MCV. Des études de validation et in vitro sont nécessaires pour confirmer l’effet du glucose et des lipides sur la méthylation et l’expression de ces gènes dans le placenta. De plus, des études longitudinales comparant la méthylation de ces deux gènes candidats dans plusieurs tissus permettront de déterminer si les marques de méthylation observées dans le placenta à la naissance sont présentes dans d’autres tissus, stables dans le temps et associées au développement de l’obésité et des CCM.

283

Compte tenu que le DG est associé à l’altération du profil épigénétique de deux gènes candidats du métabolisme des lipides placentaires, il semble pertinent de poursuivre l’analyse de l’effet du DG sur la méthylation des autres gènes du métabolisme lipidique placentaire soit : la lipase endothéliale ( EL/LIPG ), la protéine de transfert des phospholipides ( PLTP ), l’ATP binding-cassette transporter G1 ( ABCG1 ), les protéines de liaison et de transport des acides gras ( FATP et FABP ), et les récepteurs placentaires des lipoprotéines ( LRP1 , LDLR , SRB1, VLDLR ) (Figure 9.2). L’expression de ces gènes a été associée à des conditions maternelles défavorables incluant le DG, l’obésité et les dyslipidémies (Ethier-Chiasson et al ., 2007; Gauster et al ., 2011; Lager et Powell, 2012; Scholler et al ., 2012; Baumann et al ., 2013). Des équipes, incluant la nôtre ont également démontré que la méthylation des gènes ABCG1 , PLTP , EL est associée aux concentrations plasmatiques de lipoprotéines, aux maladies cardiovasculaires de même qu’à la résistance à l’insuline. Ceci suggère qu’elle pourrait contribuer à la programmation métabolique fœtale (Guay et al ., 2014; Peng et al ., 2014; Hidalgo et al ., 2014; Pfeifferm et al ., 2015). Dans le futur, il sera intéressant de déterminer si la méthylation de ces gènes peut être modifiée par l’exposition à l’hyperglycémie maternelle.

En raison de l’insulino-resistance, l’hyperglycémie maternelle est généralement accompagnée d’autres perturbations métaboliques incluant les dyslipidémies et l’augmentation de la concentration d’acides aminés en circulation (Butte, 2000; Catalano, 2014). Le glucose, les acide gras libres, le cholestérol et les acide aminés peuvent traverser la barrière placentaire via des mécanismes de transport actifs ou passifs (Lager et Powell, 2012; Palisnki, 2009). Ces macromolécules sont donc susceptibles de contribuer à la programmation de la signature épigénétique et de la santé métabolique du nouveau-né.

Notre analyse de la méthylation des gènes LPL et ABCA1 a d’ailleurs permis de démontrer, pour la première fois, que le profil lipidique maternel, à différents stades de la grossesse, est associé à des épivariations placentaires. Les niveaux de c-HDL maternels semblent influencer la méthylation de LPL indépendamment de la glycémie maternelle tandis que ces deux variables métaboliques interagissent dans la régulation de la méthylation d’ ABCA1. Le profil épigénétique d’ ABCA1 est aussi associé à la concentration de TG

284 maternelle. Les résultats issus d’études épidémiologiques prospectives et rétrospectives ont déjà suggéré que le profil lipidique maternel indépendamment du diagnostic de DG, joue un rôle important dans la programmation de la santé métabolique du nouveau-né. En effet, il a été démontré que les niveaux de TG, de cholestérol et de c-HDL sont corrélés avec le poids des nouveau-nés à la naissance (DiCianni et al ., 2005, Kulkarni et al ., 2013, Misra et al ., 2011; Kramer et al ., 2013; Hwang et al ., 2014). L’exposition à l’hypercholestérolémie maternelle est également reconnue comme une cause de l’augmentation des lésions athérosclérotiques chez les fœtus, les enfants et les adolescents et du développement de maladies cardiovasculaires (Napoli et al ., 1997; Napoli et al ., 1999; Napoli et Palinski, 2001). Les concentrations maternelles de lipides auxquelles les enfants et les adolescents ont été exposés in utero sont aussi associés à leur d’adiposité (Gademan et al ., 2014; Romejko- Wolniewicz et al ., 2014 ). L’ensemble de ces données suggère donc que la programmation de la santé métabolique et cardiovasculaire du nouveau-né par le profil lipidique maternel peut être régulée par des mécanismes épigénétiques. L’étude des concentrations lipidiques des mères avec ou sans DG dans le contexte de la programmation épigénétique fœtale est encore inexplorée mais s’avère être une avenue de recherche prometteuse qui nous permettra sans doute d’en apprendre d’avantage sur les facteurs étiologiques des MCV et leur prévention. Les mères atteintes d’hypercholestérolémie familiale, pourraient être utilisées à cette fin.

Les mécanismes moléculaires par lesquels le glucose et les lipides peuvent réguler l’épigénome du nouveau-né restent essentiellement incompris. Des études in vitro suggèrent que l’hyperglycémie peut moduler la méthylation de l’ADN via son action sur les DNMT et les TET, plus particulièrement TET3 (Chiang et al ., 2009; Zhang et al ., 2014). De plus, l’incubation de cellules endothéliales avec des concentrations croissantes de c-LDL et de c- LDL oxydés est associée à l’augmentation de l’activité des DNMT et des niveaux de méthylation de l’ADN (Kumar et al ., 2013; Yang et al ., 2014). La quantification de l’expression relative de DNMT et des TET dans le placenta et le sang de cordon des nouveau- nés exposés et non exposés au DG pourrait nous renseigner sur les mécanismes moléculaires impliqués dans la programmation épigénétique associée au DG. De plus, des cellules trophoblastiques ou des cellules endothéliales de la veine de cordon ombilical humain

285

(HUVECs) pourraient être mises en culture avec différentes concentrations de glucose et/ou de lipoprotéines afin de déterminer leur impact respectif et éventuellement synergique sur l’expression et l’activité des enzymes impliquées dans les processus de méthylation et de déméthylation.

286

Figure 9.2- Fonction des protéines des gènes candidats de la programmation métabolique fœtale impliqués dans le transport materno-fœtal des lipides La lipoprotéine lipase (LPL) est localisée à la surface des cellules endothéliales des villi du placenta où elle hydrolyse les TG des chylomicrons et des VLDL de la circulation maternelle pour permettre le transfert des acides gras libres (AGL) vers le fœtus (McCoy et al ., 2002 ; Larque et al ., 2011). De son côté, la lipase endothéliale (EL/LIPG) assure le transfert des AGL vers le fœtus en hydrolysant les phospholipides des HDL maternels (Larque et al ., 2011). Les AGL sont aussi transportés de la circulation maternelle vers la circulation fœtale via les protéines de liaison et de transport des acides gras (FABP et FATP) (Lager et Powell, 2012). LDLR, LRP1, SRB1 et VLDL sont des récepteurs transmembranaires qui permettent le transfert placentaire du cholestérol via l’endocytose des lipoprotéines. LDLR se lie et internalise les lipoprotéines contenant l’ApoE et l’ApoB soient les VLDL et les LDL. VLDLR est le principal récepteurs endocytiques des lipoprotéines avec ApoE donc des VLDL et SRB1 lie les ester de cholestérol donc les HDL (Dube et al ., 2013). De son côté, LRP1 a plusieurs ligands incluant les VLDL, HDL et les chylomicrons (Lillis et al ., 2008). La fonction d’ABCA1 du côté maternel du placenta est encore méconnue. Certaines études suggèrent qu’elle pourrait être impliquée dans le transport du cholestérol maternel vers le placenta et qu’elle pourrait aussi transférer le cholestérol du placenta vers la circulation maternelle pour prévenir l’accumulation cytotoxique d’oxystérols dans le placenta (Aye et al ., 2010). Du côté fœtal du placenta, ABCA1 assure le transfert du cholestérol des cellules endothéliales du placenta vers les apolipoproteines E et A1 pour la formation des HDL naissant (Stefulj et al ., 2009; Keelan et al ., 2011;). ABCG1 est principalement exprimé du côté fœtal du placenta. La protéine ABCG1 encodée par ce gène régule l’efflux de cholestérol placentaire vers les HDL du fœtus (Stefulj et al ., 2009; Aye et al ., 2010). La protéine de transfert des phospholipides (PLTP) du côté fœtal du placenta serait une des source de PLPT de la circulation fœtal et celle-ci interagirait avec ABCA1 et ABCG1 pour la formation des HDL (Scholler et al ., 2012).

287

9.3 Associations entre les modifications épigénétiques observées chez les nouveau-nés exposés au diabète gestationnel et les indicateurs de santé et de croissance fœtale

Le deuxième objectif de cette thèse était de déterminer si les adaptations épigénétiques du nouveau-né, en réponse à l’exposition in utero au DG, sont associées à des indicateurs de santé et de croissance fœtale. Ceci permettrait de déterminer si le développement et la santé métabolique du nouveau-né sont altérés, dès la naissance, et que ces altérations sont liées à certaines des modifications épigénétiques identifiées. Plusieurs variables anthropométriques peuvent être utilisées pour représenter la croissance du fœtus et son état de santé périnatale. (poids à la naissance, IMC, index pondéral (poids (kg)/grandeur(m 3)). Cependant, le poids à la naissance est le plus couramment utilisé (WHO, 2006). Dans le cadre de cette thèse, nous avons donc déterminé si le poids à la naissance est associé avec les niveaux de méthylation des gènes différentiellement méthylés du placenta et du sang de cordon identifiés dans notre étude pangénomique. Lors de notre approche par gènes candidats, nous avons également testé les associations entre la méthylation des gènes LPL et ABCA1 du placenta et le poids à la naissance. De plus, comme ces deux gènes sont impliqués dans le transport materno-fœtal des lipides nous avons déterminé si les variations épigénétiques de ces gènes étaient associées à des indicateurs de l’efficacité du transfert placentaire des nutriments soit : le poids du placenta et le ratio entre le poids du bébé et le poids du placenta (Barker et al., 2011). La présence d’associations entre la méthylation de LPL et d’ ABCA1 et le profil lipidique du sang de cordon a aussi été investiguée.

Parmi les gènes différentiellement méthylés suite à l’exposition au DG dans le placenta (n = 3 271; p ≤ 0,05) et dans le sang de cordon (3 757 gènes; p ≤ 0,05), nous avons seulement identifié 326 et 117 gènes associés au poids à la naissance. Ainsi, nos résultats suggèrent que les gènes épigénétiquement modifiés par l’hyperglycémie maternelle ont peu d’effet sur la croissance fœtale. Le traitement et le suivi médical rigoureux des femmes diagnostiquées avec un DG lors de notre étude pourraient expliquer ces résultats. En effet, plusieurs études épidémiologiques ont démontré que les complications périnatales associées au DG, incluant la macrosomie, pouvaient être prévenues par le traitement et le suivi des femmes diagnostiquées avec un DG (Landon et al ., 2009; Horvath et al ., 2010; Falavigna et al ., 2012). Toutefois, il a été rapporté que le traitement du DG ne procure pas de bénéfice

288 sur la santé métabolique à long-terme des nouveau-nés (Gillman et al ., 2010). En conséquence, même si le DG et les épipolymorpshimes associées à l’exposition au DG n’ont pas d’impact sur la croissance fœtale, ils pourraient contribuer au développement de l’obésité et des CCM notamment leur une influence sur l’adipogenèse fœtale et sur l’accumulation de masse grasse au niveau abdominal (Godfrey et al ., 2011). Des études épigénétiques ont d’ailleurs démontré que la méthylation de certains gènes du sang de cordon étaient associée au phénotype de l’obésité chez les enfants, indépendamment du poids à la naissance (Godfrey et al ., 2011; Relton et al ., 2012).

Dans le placenta, la méthylation des gènes candidats LPL et ABCA1 n’est pas associée au poids à la naissance des nouveau-nés ou à d’autres indices de croissance fœtale. Cependant, nous avons observé des corrélations entre les niveaux de méthylation de ces deux gènes et les concentrations de TG, de c-HDL, de CT/c-HDL du sang de cordon. Les particules de c-HDL ont des propriétés antiathérogènes et anti-inflammatoire (Soran et al ., 2012). Les perturbations des niveaux de c-HDL à la naissance pourraient donc contribuer au développement futur de dyslipidémies, de l’athérosclérose et des MCV chez ces enfants. Les concentrations de lipoprotéines chez le nouveau-né ont été associées à l’exposition au DG, au DT2, à l’obésité maternelle de même qu’à la perturbation de la croissance fœtale (retard de croissance intra-uterin et la macrosomie). Chacune de ces conditions est reconnue pour augmenter la susceptibilité aux MCV chez le nouveau-né (Merzouk et al , 2000a; Merzouk et al ., 2000b; Markenson et al ., 2011; Pecks et al ., 2012). Les concentrations de c-HDL chez les adultes ont également été associées à l’exposition in utero à un environnement défavorable (Roseboom et al ., 2000a). Il a aussi été démontré que les dyslipidémies chez les enfants et les adolescents persiste, dans la plupart des cas, jusqu’à l’âge adulte, et peuvent prédire l’apparition future d’événements cardiovasculaires (Klag et al ., 1993; Daniels et Greer, 2008). Plusieurs modèles murins ont également démontré que les concentrations de lipoprotéines à la naissance et à l’âge adulte sont programmées in utero par l’environnement fœtal (Lucas et al ., 1996; Kind et al ., 1999). La signature épigénétique des gènes LPL et ABCA1 du nouveau-né, mise en place in utero , pourraient possiblement contribuer à la programmation du métabolisme des lipoprotéines ainsi qu’au développement de l’obésité et des CCM. Les associations entre la méthylation de ces deux gènes, les niveaux de c-HDL et

289 les maladies cardiovasculaires précédemment rapportées par notre équipe dans une population adulte supportent cette hypothèse (Guay et al ., 2012; Guay et al ., 2013). En outre, ils suggèrent que les variations de méthylation observées dans le placenta pourraient être présentes dans d’autres tissus et persister jusqu’à l’âge adulte. Des études longitudinales devront être conduites pour suivre l’évolution du profil lipidique des enfants exposés et non exposés au DG. Ces études pourront aussi de déterminer si la méthylation de LPL et d’ ABCA1 , dans le sang ou d’autres tissus (tissu adipeux, muscle), est stable dans le temps et associée au développement des dyslipidémies et des maladies cardiovasculaires.

290

9.4 État actuel des connaissances concernant l’identification des gènes épigénétiquement impliqués dans la programmation métabolique fœtale associée au diabète gestationnel

Les résultats de la présente thèse démontrent que la méthylation de certains gènes du placenta et du sang de cordon, et potentiellement des autres tissus du nouveau-né, est modulée par l’exposition au DG. Les épipolymorphismes engendrés par l’exposition au DG sont principalement retrouvés aux loci de gènes impliqués dans les voies biologiques des maladies métaboliques, notamment celles du métabolisme énergétique et des lipides. De ce fait, l’ensemble de nos résultats suggère que la méthylation de l’ADN est un des mécanismes moléculaires impliqués dans la programmation métabolique fœtale du nouveau-né exposé au DG. Outre les différences de méthylation entre les échantillons de placenta et de sang de cordon exposés ou non exposés au DG, nous avons rapporté des associations linéaires entre la glycémie maternelle au 2e trimestre de la grossesse et la méthylation de l’ADN, et ce même lorsque les concentrations de glucose maternelles sont sous le seuil des critères diagnostiques du DG. Ces résultats suggèrent qu’une légère élévation de la glycémie maternelle peut modifier la méthylation de gènes du nouveau-né et possiblement augmenter le risque qu’il a de développer de l’obésité et des CCM. La relation linéaire entre la glycémie maternelle et les complications métaboliques néonatales et postnatales a d’ailleurs déjà été établie dans la littérature (Catalano et al ., 2003; Hill et al ., 2005; Metzger et al ., 2008; HAPO, 2009; Farah et al ., 2011). À la lumière de ces résultats et des nôtres, il apparaît primordial d’abaisser les valeurs seuils pour le diagnostique du DG tel que récemment proposé par l’IADPSG. Puisqu’il n’existe toujours pas de biomarqueurs pouvant prédire le développement du DG en début de grossesse, ceci permettra le dépistage, le diagnostic et le suivi d’un plus grand nombre de mères et de réduire les effets néfastes de l’hyperglycémie sur la santé métabolique du nouveau-né. En outre, des programmes de prévention visant l’adoption de saines habitudes de vie (alimentation et activité physique) devraient être mise en place chez les femmes à haut risque de DG et ce avant et au début de la grossesse. Ces stratégies permettront d’assurer un environnement favorable pour la croissance et le développement du fœtus et de diminuer les risques d’obésité et de CCM, à long terme, chez les nouveau-nés.

291

Les épipolymorphismes que nous avons identifiés dans le cadre de cette thèse et d’autres à venir pourraient aussi éventuellement être utilisés en clinique comme marqueurs de l’exposition à un environnement in utero défavorable et pour prédire la susceptibilité à l’obésité et aux CCM chez le nouveau-né. De plus, des traitements pharmacologiques (inhibiteurs de la méthylation de l’ADN ( 5-azacytidine)) et nutritionnels pourront possiblement être utilisés dans le futur afin de renverser la méthylation de ces gènes candidats, in utero ou à la naissance, et de prévenir le développement de l’obésité et de CCM (Szyf, 2009). Chez le rat, il a notamment été démontré que la supplémentation en donneurs de groupement méthyl pendant la gestation pouvait prévenir les modifications épigénétiques associées à l’exposition à une diète maternelle restreinte en protéine (Lillycrop et al ., 2005). La supplémentation d’acide folique et de leptine chez les rats nouveau-nés a également été associée à une diminution des complications métaboliques engendrées par une exposition à une environnement fœtal défavorable (Vickers et al ., 2005; Gluckman et al ., 2007; Burdge et al ., 2009;). L’effet de ces supplémentations sur la méthylation de l’ADN n’a pas été investigué dans ces trois dernières études cependant, celle-ci est fortement suspectée d’être impliquée. Certaines évidences suggèrent que l’allaitement pourrait aussi modifier la signature épigénétique de certains gènes et diminuer les risques d’obésité et de co-morbidités chez les nouveau-né (Obermann-Borst et al ., 2013; Plagemann et al ., 2012)

L’application de ces traitements en clinique, pour la prévention de l’obésité chez le nouveau-né, n’est toutefois pas encore envisageable puisque plusieurs aspects demeurent incompris dans le domaine de la programmation fœtale. Les marques de méthylation modifiées par l’exposition à l’hyperglycémie maternelle que nous avons identifiées ne constituent que la pointe de l’iceberg (Figure 9.3). Dans un premier temps, les études que nous avons réalisées étant transversales, l’effet de l’hyperglycémie maternelle sur la méthylation des gènes du placenta et du sang de cordon devra être validé par des études fonctionnelles in vitro et avec des modèles animaux du DG induit par la STZ. Le suivi longitudinal des enfants exposés ou non au DG, de la naissance au décès, et dans plusieurs tissus, doit aussi être réalisé afin de répondre aux interrogations actuelles (Figure 9.3). Des réponses à ces questions pourront aussi être obtenues en utilisant des modèles in vitro et animaux. L’étude des variants génétiques est aussi nécessaire pour déterminer la relation

292 entre le génotype et les niveaux de méthylation des sites CpG d’intérêt et leur contribution respective à la variabilité phénotypique (Figure 9.3). En outre, certains de ces aspects seront sans aucun doute éclaircis par le Roadmap Epigenomics Project (Kundaje et al., 2015) . Ce projet a parmi ses objectifs, l’analyse de la méthylation de l’ADN et des transcrits d’ARN de plus de 111 types cellulaires et tissulaires humains. Par conséquent, il permettra l’identification des régions du génome, spécifiques à chaque tissu, dont l’expression est régulée par la méthylation de l’ADN et qui sont impliquées dans le développement de certaines pathologies incluant l’obésité et les CCM. Dans le cadre de cette thèse, nous avons tenté de répondre à deux des précédentes questions en effectuant une étude exploratoire avec les gènes LEP et ADIPOQ , deux gènes candidats de la programmation métabolique fœtale.

Figure 9.3- Interrogations et plan de travail visant l’identification de marqueurs épigénétiques de la susceptibilité à l’obésité et aux complications cardiométaboliques

293

9.4.1 La spécificité cellulaire de la méthylation de l’ADN des gènes LEP et ADIPOQ

Les gènes LEP et ADIPOQ sont d’excellents gènes candidats pour la programmation métabolique fœtale puisqu’ils codent pour des protéines, la leptine et l’adiponectine, sécrétées par le tissu adipeux et reconnues pour leurs fonctions dans le métabolisme énergétique et la sensibilité à l’insuline (Havel, 2002). De nombreuses études, présentées dans la section 1.6.2.2 de cette thèse, suggèrent d’ailleurs que la méthylation de ces gènes pourraient être programmée in utero et responsable du développement de l’obésité et CCM qui y sont associées. Notre équipe a notamment rapporté que les niveaux de méthylation de LEP et ADIPOQ placentaire sont négativement corrélés avec la glycémie maternelle 2h post- HGPO au 2e trimestre de la grossesse (Bouchard et al ., 2010; Bouchard et al ., 2012). Toutes ces études ont été réalisées dans les cellules sanguines circulantes, le placenta ou le sang de cordon. Il reste donc à vérifier si les variations épigénétiques observées dans ces trois tissus sont aussi présentes dans les tissus métaboliquement actifs (tissu adipeux). De plus, il est nécessaire de confirmer l’impact fonctionnel de la méthylation sur les niveaux de transcrits des gènes LEP et ADIPOQ dans ces tissus. Si les variations de méthylation de LEP et d’ADIPOQ du sang de cordon et/ou du placenta peuvent prédire ceux des tissus plus métaboliquement actifs (tissus adipeux) et moins accessibles, la méthylation du sang de cordon ou du placenta pourrait facilement être analysée en clinique. De plus, si la méthylation de LEP et d’ADIPOQ à la naissance s’avère associée au développement de l’obésité et des CCM, elle pourrait être utilisée comme marqueur de la santé métabolique chez le nouveau-né et permettre une prise en charge précoce favorisant la prévention de l’obésité et des CCM.

Plusieurs études suggèrent que les niveaux de méthylation de certains loci sont corrélés entre différents tissus, notamment entre les tissus périphériques (sang de cordon, placenta, cellules sanguines circulantes et cellules buccales) et les tissus internes (foie, cerveau, muscle, pancréas, tissu adipeux sous-cutané) (Murphy et al ., 2012; Herzog et al ., 2013; Varley et al ., 2013; Slieker et al., 2013). De plus, les résultats de Hon, obtenus à l’aide d’un modèle murin, suggèrent que le profil de méthylation de certains sites CpG, établi pendant le développement embryonnaire, serait commun aux tissus provenant du même feuillet embryonnaire (endoderme, mésoderme et ectoderme) (Hon et al ., 2014). Ainsi, les

294 variations épigénétiques des tissus accessibles (fèces (endoderme), sang (endoderme), cellules buccales (ectoderme)) pourraient être extrapolées à celles des tissus internes de même origine embryonnaire. L’impact fonctionnel de la méthylation sur l’expression des gènes serait, quant à elle, spécifique à chaque tissu parce que régulé par l’expression des facteurs de transcriptions qui leur sont propre (Blatter et Farnham, 2013). Nous avons d’ailleurs récemment démontré, que la variabilité de la méthylation au niveau du promoteur du gène la LPL est associée à l’expression de la LPL dans le tissu adipeux, tandis que la méthylation au niveau de l’intron 1 est associée à l’expression de la LPL dans le placenta (Houde et al ., 2014; Guay et al ., 2013).

Dans le but de mieux comprendre les variations de méthylation de gènes LEP et ADIPOQ de même que leur impact fonctionnel dans différents tissus, nous avons analysé de nouveau les données de méthylation précédemment publiées par notre équipe (Bouchard et al ., 2010; Bouchard et al ., 2012). En comparant les niveaux de méthylation de LEP du côté maternel et fœtal du placenta et les niveaux de méthylation d’ADIPOQ du placenta et du sang de cordon, nous avons remarqué que les variations de méthylation, d’un CpG à l’autre, suivent le même patron dans les 3 tissus (Figure 6.2). Ensuite, nous avons voulu déterminer si ce patron de méthylation était le même dans les tissus adipeux, le tissu le plus métaboliquement pertinent. Toutefois, comme le tissu adipeux des nouveau-nés est inaccessible pour des raisons éthiques, nous avons poursuivi notre étude exploratoire en comparant les niveaux de méthylation de LEP et d’ADIPOQ sanguin à ceux des tissus adipeux sous-cutané et viscéral de sujets sévèrement obèses. Encore une fois, nous avons observé le même patron de variation de méthylation dans ces trois tissus (Figure 7.7). Pour notre équipe, ces résultats suggèrent que la méthylation de chaque CpG analysé des gènes LEP et ADIPOQ varie, à partir d’une valeur prédéfinie, de façon similaire dans l’ensemble des tissus. Cette valeur prédéfinie serait établie à la naissance par l’environnement in utero et la génétique et pourrait déterminer la susceptibilité à long-terme à l’obésité et aux CCM et la réponse aux stimuli environnementaux. D’ailleurs, des études suggèrent que l’environnement in utero modifie, non seulement les valeurs prédéfinies de méthylation de chacun des sites CpG, mais aussi la capacité d’adaptation des niveaux de méthylation en réponse aux stimuli environnementaux post-nataux (Brons et al ., 2010; Gilbberg et al , 2014 ;

295

Jacobsen et al ., 2014). Une diminution de la capacité d’adaptation de l’épigénome a par ailleurs été associée au développement de la résistance à l’insuline (Brons et al ., 2010). La méthylation de l’ADN a aussi été associée, à maintes reprises, à l’ampleur de la perte de poids en réponse à une intervention nutritionnelle et/ou d’activité physique (Bouchard et al ., 2010 ; Moleres et al ., 2013 ; Ronn et al ., 2013). De ce fait, la signature épigénétique (incluant les niveaux de base des marques de méthylation et la plasticité de l’épigénome), mise en place in utero , pourrait expliquer pourquoi certains sujets gagnent du poids plus facilement et ont plus difficulté à en perdre suite à un régime alimentaire et à la pratique d’activité physique.

Dans le contexte de cette thèse, il aurait été intéressant de valider cette hypothèse en utilisant des cellules de placenta exposées ou non exposées au DG avec des concentrations croissantes de glucose et/ou de lipides. Ceci permettrait d’évaluer la capacité d’adaptation épigénétique des échantillons des deux groupes. De plus, des souris adultes, ayant été exposées in utero au DG induit par la STZ ou à un environnement normoglycémique, pourraient être nourries avec une diète contrôle ou riche en gras pendant une courte période afin de comparer, chez les quatre groupes, la variabilité et les niveaux de base de méthylation de gènes candidats de la programmation métabolique ainsi que la réponse phénotypique. La méthylation des gènes candidats de la programmation métabolique fœtale pourrait aussi être analysée avant et suite à un challenge métabolique (diète, exercice, test HGPO, etc…) chez les enfants ayant été exposés ou non exposés au DG.

Dans notre étude exploratoire, nous avons également observé que la méthylation des sites CpG11, CpG16 et CpG17 du gène LEP est corrélée entre sang et les tissus adipeux sous- cutané et viscéral. Par ailleurs, des corrélations spécifiques aux tissus et dépendantes du génotype rs2167270 ont été observées entre la méthylation de ces CpG et la quantité relative de transcrits de LEP dans les tissus adipeux sous-cutané et viscéral. Pour le gène ADIPOQ , les CpG pour lesquels les niveaux de méthylation sont corrélés avec les niveaux d’ARNm sont différents dans le tissu adipeux sous-cutané et viscéral. Ces résultats confirment que la méthylation de certains loci est corrélée entre différents tissus et que la régulation de l’expression génique de LEP et ADIPOQ , par la méthylation de l’ADN, est spécifique à

296 chaque tissu. De plus, ils suggèrent que les niveaux de méthylation sanguin des CpG 11, 16 et 17 peuvent être utilisés comme marqueurs des niveaux de méthylation des tissus adipeux.

L’importance de la méthylation des CpG 11, 16 et 17 dans la régulation de l’expression du gène LEP a déjà été validée in vitro avec des adipocytes en culture (Melzner et al ., 2002). Cependant, l’effet de la méthylation sur l’activité transcriptionnelle de d’ADIPOQ dans les adipocytes ou le tissu adipeux n’a pas encore été investigué. Des adipocytes en culture traités avec des agents déméthylants ou inhibiteurs des DNMT pourraient être utilisés afin de valider le rôle fonctionnel de la méthylation dans l’expression du gène ADIPOQ .

9.4.2 Les associations entre la méthylation des gènes LEP et ADIPOQ et des facteurs de risques cardiométaboliques chez l’adulte

La dernière partie de notre étude exploratoire consistait à évaluer si la méthylation des sites CpG 11, 16 et 17 de LEP et des sites CpG E1, E2 et E3 d’ ADIPOQ dans les tissus adipeux sous-cutané et viscéral est impliquée dans la programmation de la santé métabolique. Pour ce faire, nous avons déterminé si la méthylation de ces sites CpG, dans les tissus adipeux et le sang, est associée avec des facteurs de risques cardiométaboliqes des sujets sévèrement obèses. Cette étude est la première à analyser la méthylation de LEP et d’ADIPOQ dans des tissus adipeux humain dans ce contexte. Chez la souris adulte, les niveaux de méthylation de gènes lep et adipoq du tissu adipeux viscéral ont été associés à l’exposition à un environnement in utero obésogène (Khalyfa et al ., 2013). Néanmoins, aucun modèle animal n’a encore évalué si la méthylation de ces gènes à la naissance est stable et associée au développement de CCM chez les adultes.

Contrairement à nos attentes, nos résultats suggèrent que le phénotype (obésité (BMI, circonférence de la taille) et les niveaux de c-LDL) des adultes sévèrement obèses modifie les niveaux de méthylation de LEP et ADIPOQ plutôt que l’inverse. Notre étude est transversale et des études fonctionnelles sont cependant nécessaires pour valider la directionnalité des associations que nous avons rapportées. Toutefois, elle suggère que chez les adultes sévèrement obèses, la méthylation de ces deux gènes candidats pourrait jouer un

297 rôle important dans les voies biologiques associant l’inflammation et la résistance à l’insuline à l’obésité chez les adultes (Figure 9.4). Ces associations devront être confirmées chez des patients normopondéraux et avec une obésité plus modérée puisque la régulation de métabolisme énergétique et des marques épigénétiques chez ces sujets pourraient s’avérer être différente de celle des individus sévèrement obèses.

Les résultats de notre étude exploratoire ne permettent donc pas d’établir de lien entre la signature épigénétique de LEP et ADIPOQ et le développement de l’obésité et des CCM à l’âge adulte. Par conséquent, plusieurs informations clées manquent encore, nous empêchant, pour l’instant, de recommander l’utilisation de la méthylation de LEP et ADIPOQ comme marqueur de la susceptibilité à l’obésité en clinique. Le lien entre les épipolymorphismes des gènes LEP et ADIPOQ à la naissance et le développement de l’obésité et des CCM demeure encore incompris. Le suivi longitudinal de cohorte de patients exposés ou non au DG sera primordial pour déterminer si les marques de méthylation observées sont associées à des indicateurs de santé métabolique à différents stades du développement post-natal. Une telle étude permettra aussi d’évaluer l’évolution des épipolymorphismes des gènes LEP et ADIPOQ dans différents tissus de la naissance à l’âge adulte. En outre, des modèles animaux pourraient être utilisé afin de déterminer plus rapidement si la méthylation de ces deux gènes candidats à la naissance est stable dans le temps et associée au développement de l’obésité et des CCM.

L’effet de la signature épigénétique de LEP et ADIPOQ à la naissance sur le développement de l’obésité et des CCM pendant l’enfance, l’adolescence et l’âge adulte demeure en zone grise. Par contre, certaines données probantes suggèrent que le profil de méthylation de ces deux gènes, programmé in utero , puisse contribuer au développement de l’obésité. Chez le fœtus, la leptine et l’adiponectine jouent un rôle clé dans la différenciation adipocytaire et les concentrations néonatales de ces adipokines avec des indicateurs d’adiposité chez le nouveau-né (Poulos et al ., 2010; Aye et al ., 2013). Par conséquent, les modifications épigénétiques des gènes LEP et ADIPOQ , induites par l’exposition au DG, pourraient nuire au développement des adipocytes et à leur fonction. De nombreux modèles animaux ont d’ailleurs démontré que le tissu adipeux fœtal était très sensible aux stimuli

298 nutritionnels maternels. De surcroît, l’exposition à un environnement défavorable en fin de grossesse est associé à la modification des mécanismes de différentiation adipocytaire et du métabolisme des lipides (Symonds et al ., 2003; Desai et Ross, 2011; Lukaszewski et al ., 2013). Plus récemment, la culture de préadipocytes a permis de démontrer que la méthylation de LEP , la maturation des adipocytes et la fonction adipocytaire sont perturbées chez les sujets adultes avec un faible poids à la naissance en comparaison avec ceux de poids normal (Schultz et al ., 2014). Cette perturbation est également associée à une augmentation du degré d’adiposité à l’âge adulte (Schultz et al ., 2014). Ainsi, l’exposition in utero à un environnement défavorable incluant le DG, pourrait programmer la méthylation de LEP et ADIPOQ et les mécanismes de différenciation adipocytaire chez le nouveau-né (Figure 9.4). À long-terme, cette programmation pourrait altérer la fonction endocrinienne du tissu adipeux, favoriser l’accumulation de tissus et le développement de l’obésité et des CCM qui y sont associées. Tel que suggéré par Schultz et ses collaborateurs, la culture primaire de biopsies de préadipocytes provenant de sujets exposés au DG et à un environnement in utero normoglycémiques pourrait être utilisé pour comparer la fonction adipocytaire des deux groupes, de même que les niveaux de méthylation, d’ARNm et de protéines des deux adipokines qui nous intéressent dans le contexte de la programmation métabolique fœtale.

299

Figure 9.4- Proposition des facteurs modulant la méthylation de LEP et ADIPOQ in utero et à l’âge adulte et leur possible contribution au développement de l’obésité et des complications cardiométaboliques Pendant le développement embryonnaire, l’exposition à un environnement fœtal défavorable tel que le DG est associée à la perturbation des niveaux de méthylation des gènes LEP et ADIPOQ du nouveau-né. Ces modifications épigénétiques, possiblement fonctionnelles, pourraient programmer la fonction et la différentiation adipocytaire du nouveau-né le prédisposant à l’obésité. Chez les enfants et les adolescents, l’impact fonctionnel des épivariations de LEP et d’ ADIPOQ demeure encore en zone grise . Chez les adultes sévèrement obèses, la méthylation de LEP et d’ ADIPOQ serait impliquée dans certaines pathologies cardiométaboliques (l’inflammation et la résistance à l’insuline) associées à l’obésité.

CHAPITRE 10 - CONCLUSION

Les travaux de la présente thèse démontrent que le DG est associé à la signature épigénétique de gènes clés du métabolisme énergétique et des lipides dans le placenta et le sang de cordon. La méthylation de l’ADN semble donc constituer l’un des mécanismes moléculaires contribuant à la programmation de la santé métabolique du nouveau-né en réponse à l’exposition à un environnement in utero défavorable. De ce fait, la mise en œuvre de programme de prévention auprès des femmes enceintes est primordiale afin d’assurer un environnement favorable pour la croissance et le développement du fœtus et de freiner le développement de l’obésité et des CCM chez les nouveau-nés.

Le jour où les modifications épigénétiques identifiées seront utilisées en clinique afin d’identifier les nouveau-nés qui présentent un risque accru de développer de l’obésité et de CCM n’est pas encore arrivé. Néanmoins, le suivi longitudinal des enfants ayant été exposés au DG et à un environnement fœtal normoglycémique permettra d’en apprendre davantage sur le rôle de l’épigénétique dans la programmation métabolique. En outre, les connaissances relatives à l’épigénétique et la programmation fœtale sont appelées à se développer rapidement au cours des prochaines années puisque ces deux domaines de recherche sont en pleine effervescence. L’utilisation des marqueurs épigénétiques pour la prévention de l’obésité chez les nouveau-nés est peut-être plus près que nous le croyons.

REMERCIEMENTS

Je souhaite tout d’abord remercier mon directeur de recherche, Pr Luigi Bouchard, pour la confiance qu’il m’a accordée bien que mon expérience passée de recherche et de travail était limitée au monde agricole animal. Je lui exprime toute ma reconnaissance pour la liberté scientifique, le temps, le support et les précieux conseils qu’il m’a su me prodiguer tout au long de mon parcours. Je voudrais aussi le remercier pour toutes les opportunités qu’il m’a données pour participer à des camps de formation scientifique et à des congrès d’envergure nationale et internationale. Les trois dernières années sous la supervision du Pr Bouchard ont été des plus stimulantes et enrichissantes, j’en ressors avec un bagage scientifique et personnel qui sera très utile dans la réalisation de mes projets futurs.

Je tiens ensuite à remercier le programme de bourses de la Faculté de médecine et des sciences de la santé de l’Université Sherbrooke, les Fonds de recherche du Québec en santé (FRQS) et Diabète Québec pour les bourses octroyées lors de mes études doctorales.

J’adresse également mes remerciements au personnel du laboratoire ECOGENE-21 qui ont contribué de près et de loin à ce projet de recherche. Des remerciements particuliers à Sébastien Claveau, Nadia Mior, Denise Morin et Marie-Claude Morissette, des professionnels de recherche qui m’ont transmis leurs connaissances et leur savoir-faire et qui m’ont toujours offert leur support. Merci pour les nombreux 5 à 7 et soupers qui ont générer plusieurs fous rires et souvenirs.

Je veux aussi remercier les étudiants et stagiaires que j’ai côtoyés pendant mes études : Mickael Bouchard, Sandra Côté, Véronique Desgagné, Camélia Dubois-Bouchard, Cécilia Légaré, Cynthia Lessard et Johannie Munger. Vous avez rendu mon milieu de travail stimulant et amical. Un grand merci à mes collègues et amis, Simon-Pierre Guay et Stéphanie-May Ruchat, pour les échanges scientifiques qui ont mené à l’élaboration de grandes théories et de grands projets qui vont bien évidemment finir par être publiés dans Nature . Merci pour votre soutien et votre positivisme. Je garde de précieux souvenirs de nos escapades en sols saguenéen, américain et européen. 302

Mes remerciements sont aussi adressés à mes amis, Angèle, Christine, Julia, Maxime, Judith, Guillaume, Philippe, Laurence, Lorraine et Pierre. Vous qui étiez géographiquement loin mais qui m’avez soutenus et encouragés pendant cette aventure de trois ans. Merci pour vos visites, votre support et pour tous les moments de plaisir passés à vos côtés.

Un merci spécial à Mathieu qui a su au cours de la dernière année supporter mes sautes d’humeurs, causées par mon deuxième chromosome X, et trouver les bons mots pour me faire rire. Merci pour ton support moral et tes conseils autant d’ordre personnel que scientifique.

Mes derniers remerciements vont à mes parents, mon frère et Stéphanie qui m’ont toujours encouragés et soutenus dans mes épreuves et dans mon retour aux études. Merci à mes parents de m’avoir légué des valeurs de travail et de persévérance qui ont sans aucun doute été déterminantes pour la réussite de ce projet.

LISTE DES RÉFÉRENCES

Abel, JL, Rissman, EF (2013) Running-induced epigenetic and gene expression changes in the adolescent brain. Int J Dev Neurosci. 31 (6) : 382-390.

ADA (2013) Standards of medical care in diabetes--2013. Diabetes Care. 36 Suppl 1 : S11- 66.

Adkins, RM, Tylavsky, FA, Krushkal, J (2012) Newborn umbilical cord blood DNA methylation and gene expression levels exhibit limited association with birth weight. Chem Biodivers. 9 (5) : 888-899.

Agurs-Collins, T, Bouchard, C (2008) Gene-nutrition and gene-physical activity interactions in the etiology of obesity. Introduction. Obesity (Silver Spring). 16 Suppl 3 : S2-4.

Ahima, RS (2011) Digging deeper into obesity. J Clin Invest. 121 (6) : 2076-2079.

Ahmad, S, Varga, TV, Franks, PW (2013) Gene x environment interactions in obesity: the state of the evidence. Hum Hered. 75 (2-4) : 106-115.

Alberti, KG, Zimmet, P, Shaw, J (2005) The metabolic syndrome--a new worldwide definition. Lancet. 366 (9491) : 1059-1062.

Almgren, M, Schlinzig, T, Gomez-Cabrero, D, Gunnar, A, Sundin, M, Johansson, S, Norman, M, Ekstrom, TJ (2014) Cesarean delivery and hematopoietic stem cell epigenetics in the newborn infant: implications for future health? Am J Obstet Gynecol. 211 (5) : 502 e501-508.

Anway, MD, Skinner, MK (2006) Epigenetic transgenerational actions of endocrine disruptors. Endocrinology. 147 (6 Suppl) : S43-49.

AOCG (2013) Practice Bulletin No. 137: Gestational diabetes mellitus. Obstet Gynecol. 122 (2 Pt 1) : 406-416.

Araujo, JR, Correia-Branco, A, Ramalho, C, Goncalves, P, Pinho, MJ, Keating, E, Martel, F (2013) L-methionine placental uptake: characterization and modulation in gestational diabetes mellitus. Reprod Sci. 20:1492-507.

Aravin, AA, Hannon, GJ (2008) Small RNA silencing pathways in germ and stem cells. Cold Spring Harb Symp Quant Biol. 73 : 283-290.

Archambault, C, Arel, R, Filion, KB (2014) Gestational diabetes and risk of cardiovascular disease: a scoping review. Open Med. 8 (1) : e1-9.

Aref, AB, Ahmed, OM, Ali, LA, Semmler, M (2013) Maternal rat diabetes mellitus deleteriously affects insulin sensitivity and Beta-cell function in the offspring. J Diabetes 304

Res. 2013 : 429154.

Atkins, V, Flozak, AS, Ogata, ES, Simmons, RA (1994) The effects of severe maternal diabetes on glucose transport in the fetal rat. Endocrinology. 135 (1) : 409-415.

Avner, P, Heard, E (2001) X-chromosome inactivation: counting, choice and initiation. Nat Rev Genet. 2 (1) : 59-67.

Aye, IL, Waddell, BJ, Mark, PJ, Keelan, JA (2010) Placental ABCA1 and ABCG1 transporters efflux cholesterol and protect trophoblasts from oxysterol induced toxicity. Biochim Biophys Acta. 1801 (9) : 1013-1024.

Aye, IL, Powell, TL, Jansson, T (2013) Review: Adiponectin--the missing link between maternal adiposity, placental transport and fetal growth? Placenta. 34 Suppl : S40-45.

Azzi, S, Sas, TC, Koudou, Y, Le Bouc, Y, Souberbielle, JC, Dargent-Molina, P, Netchine, I, Charles, MA (2014) Degree of methylation of ZAC1 (PLAGL1) is associated with prenatal and post-natal growth in healthy infants of the EDEN mother child cohort. Epigenetics. 9 (3) : 338-345.

Babenko, O, Kovalchuk, I, Metz, GA (2015) Stress-induced perinatal and transgenerational epigenetic programming of brain development and mental health. Neurosci Biobehav Rev. 48C : 70-91.

Baccarelli, A, Wright, RO, Bollati, V, Tarantini, L, Litonjua, AA, Suh, HH, Zanobetti, A, Sparrow, D, Vokonas, PS, Schwartz, J (2009) Rapid DNA methylation changes after exposure to traffic particles. Am J Respir Crit Care Med. 179 (7) : 572-578.

Bachman, M, Uribe-Lewis, S, Yang, X, Williams, M, Murrell, A, Balasubramanian, S (2014) 5-Hydroxymethylcytosine is a predominantly stable DNA modification. Nat Chem. advance online publication.

Baker, JL, Olsen, LW, Sorensen, TI (2008) Weight at birth and all-cause mortality in adulthood. Epidemiology. 19 (2) : 197-203.

Banister, CE, Koestler, DC, Maccani, MA, Padbury, JF, Houseman, EA, Marsit, CJ (2011) Infant growth restriction is associated with distinct patterns of DNA methylation in human placentas. Epigenetics. 6 (7) : 920-927.

Banovich, NE, Lan, X, Mcvicker, G, Van De Geijn, B, Degner, JF, Blischak, JD, Roux, J, Pritchard, JK, Gilad, Y (2014) Methylation QTLs are associated with coordinated changes in transcription factor binding, histone modifications, and gene expression levels. PLoS Genet. 10 (9) : e1004663.

Barbour, LA, Mccurdy, CE, Hernandez, TL, Kirwan, JP, Catalano, PM, Friedman, JE (2007) Cellular mechanisms for insulin resistance in normal pregnancy and gestational diabetes. Diabetes Care. 30 Suppl 2 : S112-119.

305

Barbour, LA, Mccurdy, CE, Hernandez, TL, Friedman, JE (2011) Chronically increased S6K1 is associated with impaired IRS1 signaling in skeletal muscle of GDM women with impaired glucose tolerance postpartum. J Clin Endocrinol Metab. 96 (5) : 1431-1441.

Barker, DJ, Winter, PD, Osmond, C, Margetts, B, Simmonds, SJ (1989) Weight in infancy and death from ischaemic heart disease. Lancet. 2 (8663) : 577-580.

Barker, DJ, Osmond, C, Simmonds, SJ, Wield, GA (1993a) The relation of small head circumference and thinness at birth to death from cardiovascular disease in adult life. BMJ. 306 (6875) : 422-426.

Barker, DJ, Hales, CN, Fall, CH, Osmond, C, Phipps, K, Clark, PM (1993b) Type 2 (non- insulin-dependent) diabetes mellitus, hypertension and hyperlipidaemia (syndrome X): relation to reduced fetal growth. Diabetologia. 36 (1) : 62-67.

Barker, DJ (1995) Intrauterine programming of adult disease. Mol Med Today. 1 (9) : 418- 423.

Barker, DJ, Eriksson JG, Kajantie E, Alwasel SH, Fall CH, Roseboom TJ, Osmond C (2011) The maternal and placental origins of chronic disease. Dans: GJ Burton, DJ Barker, A Moffett, K Thornburg (Éd). The Placenta and Human Developmental Programming . Cambridge University Press (1e éd.), 2-16.

Barlow, DP, Bartolomei, MS (2014) Genomic imprinting in mammals. Cold Spring Harb Perspect Biol. 6 (2).

Barsh, GS, Farooqi, IS, O'rahilly, S (2000) Genetics of body-weight regulation. Nature. 404 (6778) : 644-651.

Bartel, DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116 (2) : 281-297.

Basson, J, Sung, YJ, Schwander, K, Kume, R, Simino, J, De Las Fuentes, L, Rao, D (2014) Gene-education interactions identify novel blood pressure loci in the Framingham Heart Study. Am J Hypertens. 27 (3) : 431-444.

Bhatnagar S (2014) Analysis of Methylation data in Cordblood and Placenta tissues . Non publié

Baumann, M, Korner, M, Huang, X, Wenger, F, Surbek, D, Albrecht, C (2013) Placental ABCA1 and ABCG1 expression in gestational disease: Pre-eclampsia affects ABCA1 levels in syncytiotrophoblasts. Placenta. 34 (11) : 1079-1086.

Bays, HE, Toth, PP, Kris-Etherton, PM, Abate, N, Aronne, LJ, Brown, WV, Gonzalez- Campoy, JM, Jones, SR, Kumar, R, La Forge, R, Samuel, VT (2013) Obesity, adiposity, and dyslipidemia: a consensus statement from the National Lipid Association. J Clin Lipidol. 7 (4) : 304-383.

306

Beisel, C, Paro, R (2011) Silencing chromatin: comparing modes and mechanisms. Nat Rev Genet. 12 (2) : 123-135.

Bell, JT, Pai, AA, Pickrell, JK, Gaffney, DJ, Pique-Regi, R, Degner, JF, Gilad, Y, Pritchard, JK (2011) DNA methylation patterns associate with genetic and gene expression variation in HapMap cell lines. Genome Biol. 12 (1) : R10.

Bellamy, L, Casas, JP, Hingorani, AD, Williams, D (2009) Type 2 diabetes mellitus after gestational diabetes: a systematic review and meta-analysis. Lancet. 373 (9677) : 1773-1779.

Ben-Haroush, A, Yogev, Y, Hod, M (2004) Epidemiology of gestational diabetes mellitus and its association with Type 2 diabetes. Diabet Med. 21 (2) : 103-113.

Berger, SL (2007) The complex language of chromatin regulation during transcription. Nature. 447 (7143) : 407-412.

Bertram, CE, Hanson, MA (2001) Animal models and programming of the metabolic syndrome. Br Med Bull. 60 : 103-121.

Bestor, TH (2000) The DNA methyltransferases of mammals. Hum Mol Genet. 9 (16) : 2395- 2402.

Bird, AP (1986) CpG-rich islands and the function of DNA methylation. Nature. 321 (6067) : 209-213.

Bird, AP, Wolffe, AP (1999) Methylation-induced repression--belts, braces, and chromatin. Cell. 99 (5) : 451-454.

Bird, AP (2002) DNA methylation patterns and epigenetic memory. Genes Dev. 16 (1) : 6- 21.

Blattler, A, Farnham, PJ (2013) Cross-talk between site-specific transcription factors and DNA methylation states. J Biol Chem. 288 (48) : 34287-34294.

Blewitt, ME, Gendrel, AV, Pang, Z, Sparrow, DB, Whitelaw, N, Craig, JM, Apedaile, A, Hilton, DJ, Dunwoodie, SL, Brockdorff, N, Kay, GF, Whitelaw, E (2008) SmcHD1, containing a structural-maintenance-of-chromosomes hinge domain, has a critical role in X inactivation. Nat Genet. 40 (5) : 663-669.

Blondeau, B, Joly, B, Perret, C, Prince, S, Bruneval, P, Lelievre-Pegorier, M, Fassot, C, Duong Van Huyen, JP (2011) Exposure in utero to maternal diabetes leads to glucose intolerance and high blood pressure with no major effects on lipid metabolism. Diabetes Metab. 37 (3) : 245-251.

Boden, G (1996) Fuel metabolism in pregnancy and in gestational diabetes mellitus. Obstet Gynecol Clin North Am. 23 (1) : 1-10.

307

Boekelheide, K, Blumberg, B, Chapin, RE, Cote, I, Graziano, JH, Janesick, A, Lane, R, Lillycrop, K, Myatt, L, States, JC, Thayer, KA, Waalkes, MP, Rogers, JM (2012) Predicting later-life outcomes of early-life exposures. Environ Health Perspect. 120 (10) : 1353-1361.

Boerschmann, H, Pfluger, M, Henneberger, L, Ziegler, AG,Hummel, S (2010) Prevalence and predictors of overweight and insulin resistance in offspring of mothers with gestational diabetes mellitus. Diabetes Care. 33 (8) : 1845-1849.

Boney, CM, Verma, A, Tucker, R, Vohr, BR (2005) Metabolic syndrome in childhood: association with birth weight, maternal obesity, and gestational diabetes mellitus. Pediatrics. 115 (3) : e290-296.

Borghol, N, Suderman, M, Mcardle, W, Racine, A, Hallett, M, Pembrey, M, Hertzman, C, Power, C, Szyf, M (2012) Associations with early-life socio-economic position in adult DNA methylation. Int J Epidemiol. 41 (1) : 62-74.

Bouchard, L, Rabasa-Lhoret, R, Faraj, M, Lavoie, ME, Mill, J, Perusse, L, Vohl, MC (2010) Differential epigenomic and transcriptomic responses in subcutaneous adipose tissue between low and high responders to caloric restriction. Am J Clin Nutr. 91 (2) : 309-320.

Bouchard, L, Thibault, S, Guay, SP, Santure, M, Monpetit, A, St-Pierre, J, Perron, P, Brisson, D (2010) Leptin gene epigenetic adaptation to impaired glucose metabolism during pregnancy. Diabetes Care. 33 (11) : 2436-2441.

Bouchard, L, Hivert, MF, Guay, SP, St-Pierre, J, Perron, P, Brisson, D (2012) Placental adiponectin gene DNA methylation levels are associated with mothers' blood glucose concentration. Diabetes. 61 (5) : 1272-1280.

Bouwland-Both, MI, Van Mil, NH, Stolk, L, Eilers, PH, Verbiest, MM, Heijmans, BT, Tiemeier, H, Hofman, A, Steegers, EA, Jaddoe, VW, Steegers-Theunissen, RP (2013) DNA methylation of IGF2DMR and H19 is associated with fetal and infant growth: the generation R study. PLoS One. 8 (12) : e81731.

Breitling, LP, Yang, R, Korn, B, Burwinkel, B, Brenner, H (2011) Tobacco-smoking-related differential DNA methylation: 27K discovery and replication. Am J Hum Genet. 88 (4) : 450- 457.

Brons, C, Jacobsen, S, Nilsson, E, Ronn, T, Jensen, CB, Storgaard, H, Poulsen, P, Groop, L, Ling, C, Astrup, A, Vaag, A (2010) Deoxyribonucleic acid methylation and gene expression of PPARGC1A in human muscle is influenced by high-fat overfeeding in a birth-weight- dependent manner. J Clin Endocrinol Metab. 95 (6) : 3048-3056.

Buchanan, TA, Kjos, SL (1999) Gestational diabetes: risk or myth? J Clin Endocrinol Metab. 84 (6) : 1854-1857.

Buchanan, TA (2001) Pancreatic B-cell defects in gestational diabetes: implications for the pathogenesis and prevention of type 2 diabetes. J Clin Endocrinol Metab. 86 (3) : 989-993.

308

Burdge, GC, Hanson, MA, Slater-Jefferies, JL, Lillycrop, KA (2007) Epigenetic regulation of transcription: a mechanism for inducing variations in phenotype (fetal programming) by differences in nutrition during early life? Br J Nutr. 97 (6) : 1036-1046.

Burdge, GC, Lillycrop, KA, Phillips, ES, Slater-Jefferies, JL, Jackson, AA, Hanson, MA (2009) Folic acid supplementation during the juvenile-pubertal period in rats modifies the phenotype and epigenotype induced by prenatal nutrition. J Nutr. 139 (6) : 1054-1060.

Butler, JS, Koutelou, E, Schibler, AC, Dent, SY (2012) Histone-modifying enzymes: regulators of developmental decisions and drivers of human disease. Epigenomics. 4 (2) : 163-177.

Butte, NF (2000) Carbohydrate and lipid metabolism in pregnancy: normal compared with gestational diabetes mellitus. Am J Clin Nutr. 71 (5 Suppl) : 1256S-1261S.

Byun, HM, Siegmund, KD, Pan, F, Weisenberger, DJ, Kanel, G, Laird, PW, Yang, AS (2009) Epigenetic profiling of somatic tissues from human autopsy specimens identifies tissue- and individual-specific DNA methylation patterns. Hum Mol Genet. 18 (24): 4808-4817.

Calle, EE, Kaaks, R (2004) Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat Rev Cancer. 4 (8) : 579-591.

Campos, EI, Stafford, JM, Reinberg, D (2014) Epigenetic inheritance: histone bookmarks across generations. Trends Cell Biol.

Cannell, IG, Kong, YW, Bushell, M (2008) How do microRNAs regulate gene expression? Biochem Soc Trans. 36 (Pt 6) : 1224-1231.

Carless, MA, Kulkarni, H, Kos, MZ, Charlesworth, J, Peralta, JM, Goring, HH, Curran, JE, Almasy, L, Dyer, TD, Comuzzie, AG, Mahaney, MC, Blangero, J (2013) Genetic effects on DNA methylation and its potential relevance for obesity in Mexican Americans. PLoS One. 8 (9) : e73950.

Carmona, JJ, Sofer, T, Hutchinson, J, Cantone, L, Coull, B, Maity, A, Vokonas, P, Lin, X, Schwartz, J, Baccarelli, AA (2014) Short-term airborne particulate matter exposure alters the epigenetic landscape of human genes associated with the mitogen-activated protein kinase network: a cross-sectional study. Environ Health. 13 (1) : 94.

Carpenter, MW, Coustan, DR (1982) Criteria for screening tests for gestational diabetes. Am J Obstet Gynecol. 144 (7) : 768-773.

Carr, DB, Utzschneider, KM, Hull, RL, Tong, J, Wallace, TM, Kodama, K, Shofer, JB, Heckbert, SR, Boyko, EJ, Fujimoto, WY, Kahn, SE (2006) Gestational diabetes mellitus increases the risk of cardiovascular disease in women with a family history of type 2 diabetes. Diabetes Care. 29 (9) : 2078-2083.

Carrel, L, Willard, HF (2005) X-inactivation profile reveals extensive variability in X-linked gene expression in females. Nature. 434 (7031) : 400-404.

309

Carrera, I, Treisman, JE (2008) Message in a nucleus: signaling to the transcriptional machinery. Curr Opin Genet Dev. 18 (5) : 397-403.

Catalano, PM, Tyzbir, ED, Wolfe, RR, Calles, J, Roman, NM, Amini, SB, Sims, EA (1993) Carbohydrate metabolism during pregnancy in control subjects and women with gestational diabetes. Am J Physiol. 264 (1 Pt 1) : E60-67.

Catalano, PM, Huston, L, Amini, SB, Kalhan, SC (1999) Longitudinal changes in glucose metabolism during pregnancy in obese women with normal glucose tolerance and gestational diabetes mellitus. Am J Obstet Gynecol. 180 (4) : 903-916.

Catalano, PM, Thomas, A, Huston-Presley, L, Amini, SB (2003) Increased fetal adiposity: a very sensitive marker of abnormal in utero development. Am J Obstet Gynecol. 189 (6) : 1698-1704.

Catalano, PM, Hauguel-De Mouzon, S (2011) Is it time to revisit the Pedersen hypothesis in the face of the obesity epidemic? Am J Obstet Gynecol. 204 (6) : 479-487.

Catalano, PM, Mcintyre, HD, Cruickshank, JK, Mccance, DR, Dyer, AR, Metzger, BE, Lowe, LP, Trimble, ER, Coustan, DR, Hadden, DR, Persson, B, Hod, M, Oats, JJ (2012) The hyperglycemia and adverse pregnancy outcome study: associations of GDM and obesity with pregnancy outcomes. Diabetes Care. 35 (4) : 780-786.

Catalano, PM (2014) Trying to understand gestational diabetes. Diabet Med. 31 (3) : 273- 281.

Cerf, ME (2013) Beta cell dysfunction and insulin resistance. Front Endocrinol (Lausanne). 4: 37.

Cetin, I, De Santis, MS, Taricco, E, Radaelli, T, Teng, C, Ronzoni, S, Spada, E, Milani, S, Pardi, G (2005) Maternal and fetal amino acid concentrations in normal pregnancies and in pregnancies with gestational diabetes mellitus. Am J Obstet Gynecol. 192 (2) : 610-617.

Chaligne, R, Heard, E (2014) X-chromosome inactivation in development and cancer. FEBS Lett. 588 (15) : 2514-2522.

Challier, JC, Hauguel, S, Desmaizieres, V (1986) Effect of insulin on glucose uptake and metabolism in the human placenta. J Clin Endocrinol Metab. 62 (5) : 803-807.

Chaput, JP, Perusse, L, Despres, JP, Tremblay, A, Bouchard, C (2014) Findings from the Quebec Family Study on the Etiology of Obesity: Genetics and Environmental Highlights. Curr Obes Rep. 3 : 54-66.

Chatzi, L, Papadopoulou, E, Vafiadi, M, Pappas, A, Kogevinas, M (2011) Maternal glucose at 28 weeks of gestation is not associated with obesity in 2-year-old offspring: the Belfast Hyperglycemia and Adverse Pregnancy Outcome (HAPO) family study: comment on Pettit et al . Diabetes Care. 34 (1) : e10.

310

Chen, D, Zhang, A, Fang, M, Fang, R, Ge, J, Jiang, Y, Zhang, H, Han, C, Ye, X, Huang, H, Liu, Y, Dong, M (2014) Increased methylation at differentially methylated region of GNAS in infants born to gestational diabetes. BMC Med Genet. 15 (1) : 108.

Chen, LL, Carmichael, GG (2010) Decoding the function of nuclear long non-coding RNAs. Curr Opin Cell Biol. 22 (3) : 357-364.

Chen, YA, Lemire, M, Choufani, S, Butcher, DT, Grafodatskaya, D, Zanke, BW, Gallinger, S, Hudson, TJ, Weksberg, R (2013) Discovery of cross-reactive probes and polymorphic CpGs in the Illumina Infinium HumanMethylation450 microarray. Epigenetics. 8 (2) : 203- 209.

Chen, YW, Chenier, I, Tran, S, Scotcher, M, Chang, SY, Zhang, SL (2010) Maternal diabetes programs hypertension and kidney injury in offspring. Pediatr Nephrol. 25 (7) : 1319-1329.

Chiang, EP, Wang, YC, Chen, WW, Tang, FY (2009) Effects of insulin and glucose on cellular metabolic fluxes in homocysteine transsulfuration, remethylation, S- adenosylmethionine synthesis, and global deoxyribonucleic acid methylation. J Clin Endocrinol Metab. 94 (3) : 1017-1025.

Chopra, N, Knollmann, BC (2011) Genetics of sudden cardiac death syndromes. Curr Opin Cardiol. 26 (3) : 196-203.

Clarke-Harris, R, Wilkin, TJ, Hosking, J, Pinkney, J, Jeffery, AN, Metcalf, BS, Godfrey, KM, Voss, LD, Lillycrop, KA, Burdge, GC (2014) PGC1alpha promoter methylation in blood at 5-7 years predicts adiposity from 9 to 14 years (EarlyBird 50). Diabetes. 63 (7) : 2528-2537.

Clausen, TD, Mathiesen, ER, Hansen, T, Pedersen, O, Jensen, DM, Lauenborg, J, Damm, P (2008) High prevalence of type 2 diabetes and pre-diabetes in adult offspring of women with gestational diabetes mellitus or type 1 diabetes: the role of intrauterine hyperglycemia. Diabetes Care. 31 (2) : 340-346.

Clausen, TD, Mathiesen, ER, Hansen, T, Pedersen, O, Jensen, DM, Lauenborg, J, Schmidt, L, Damm, P (2009) Overweight and the metabolic syndrome in adult offspring of women with diet-treated gestational diabetes mellitus or type 1 diabetes. J Clin Endocrinol Metab. 94 (7) : 2464-2470.

Collins, LJ, Schonfeld, B, Chen, XS (2011) The epigenetics of non-coding RNA. Dans: TO Tollefsbol (Éd). Handbook of epigenetics . Elsevier (1e éd.), 49-61.

Comuzzie, AG, Allison, DB (1998) The search for human obesity genes. Science. 280 (5368) : 1374-1377.

Cooper, WN, Khulan, B, Owens, S, Elks, CE, Seidel, V, Prentice, AM, Belteki, G, Ong, KK, Affara, NA, Constancia, M, Dunger, DB (2012) DNA methylation profiling at imprinted loci after periconceptional micronutrient supplementation in humans: results of a pilot randomized controlled trial. FASEB J. 26 (5) : 1782-1790.

311

Cosson, E (2010) Diagnostic criteria for gestational diabetes mellitus. Diabetes Metab. 36 (6 Pt 2) : 538-548.

Cotton, AM, Lam, L, Affleck, JG, Wilson, IM, Penaherrera, MS, Mcfadden, DE, Kobor, MS, Lam, WL, Robinson, WP, Brown, CJ (2011) Chromosome-wide DNA methylation analysis predicts human tissue-specific X inactivation. Hum Genet. 130 (2) : 187-201.

Cotton, AM, Ge, B, Light, N, Adoue, V, Pastinen, T, Brown, CJ (2013) Analysis of expressed SNPs identifies variable extents of expression from the human inactive X chromosome. Genome Biol. 14 (11) : R122.

Cotton, AM, Price, EM, Jones, MJ, Balaton, BP, Kobor, MS, Brown, CJ (2014) Landscape of DNA methylation on the X chromosome reflects CpG density, functional chromatin state and X-chromosome inactivation. Hum Mol Genet.

Coustan, DR (2013) Gestational diabetes mellitus. Clin Chem. 59 (9) : 1310-1321.

Cruickshank, MN, Oshlack, A, Theda, C, Davis, PG, Martino, D, Sheehan, P, Dai, Y, Saffery, R, Doyle, LW, Craig, JM (2013) Analysis of epigenetic changes in survivors of preterm birth reveals the effect of gestational age and evidence for a long term legacy. Genome Med. 5 (10) : 96.

Crume, TL, Ogden, L, Daniels, S, Hamman, RF, Norris, JM, Dabelea, D (2011) The impact of in utero exposure to diabetes on childhood body mass index growth trajectories: the EPOCH study. J Pediatr. 158 (6) : 941-946.

Dabelea, D, Crume, T (2011) Maternal environment and the transgenerational cycle of obesity and diabetes. Diabetes. 60 (7) : 1849-1855.

Daniels, SR, Greer, FR (2008) Lipid screening and cardiovascular health in childhood. Pediatrics. 122 (1) : 198-208.

Davies, MN, Volta, M, Pidsley, R, Lunnon, K, Dixit, A, Lovestone, S, Coarfa, C, Harris, RA, Milosavljevic, A, Troakes, C, Al-Sarraj, S, Dobson, R, Schalkwyk, LC, Mill, J (2012) Functional annotation of the human brain methylome identifies tissue-specific epigenetic variation across brain and blood. Genome Biol. 13 (6) : R43.

Davis, TL, Trasler, JM, Moss, SB, Yang, GJ, Bartolomei, MS (1999) Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics. 58 (1) : 18-28.

Davis, TL, Yang, GJ, Mccarrey, JR, Bartolomei, MS (2000) The H19 methylation imprint is erased and re-established differentially on the parental alleles during male germ cell development. Hum Mol Genet. 9 (19) : 2885-2894.

Day, FR, Loos, RJ (2011) Developments in obesity genetics in the era of genome-wide association studies. J Nutrigenet Nutrigenomics. 4 (4) : 222-238.

312

Dayeh, TA, Olsson, AH, Volkov, P, Almgren, P, Ronn, T, Ling, C (2013) Identification of CpG-SNPs associated with type 2 diabetes and differential DNA methylation in human pancreatic islets. Diabetologia. 56 (5) : 1036-1046.

De Castro-Oros, I, Cenarro, A, Tejedor, MT, Baila-Rueda, L, Mateo-Gallego, R, Lamiquiz- Moneo, I, Pocovi, M, Civeira, F (2014) Common genetic variants contribute to primary hypertriglyceridemia without differences between familial combined hyperlipidemia and isolated hypertriglyceridemia. Circ Cardiovasc Genet. 7 (6) : 814-821.

Deckelbaum, RJ, Williams, CL (2001) Childhood obesity: the health issue. Obes Res. 9 Suppl 4 : 239S-243S.

Defossez, PA (2013) Ceci n'est pas une DNMT: recently discovered functions of DNMT2 and their relation to methyltransferase activity (Comment on DOI 10.1002/bies.201300088). Bioessays. 35 (12) : 1024.

Defronzo, RA, Tobin, JD, Andres, R (1979) Glucose clamp technique: a method for quantifying insulin secretion and resistance. Am J Physiol. 237 (3) : E214-223.

Desai, M, Ross, MG (2011) Fetal programming of adipose tissue: effects of intrauterine growth restriction and maternal obesity/high-fat diet. Semin Reprod Med. 29 (3) : 237-245.

Desgagne, V, Hivert, MF, St-Pierre, J, Guay, SP, Baillargeon, JP, Perron, P, Gaudet, D, Brisson, D, Bouchard, L (2014) Epigenetic dysregulation of the IGF system in placenta of newborns exposed to maternal impaired glucose tolerance. Epigenomics. 6 (2) : 193-207.

Di Cianni, G, Miccoli, R, Volpe, L, Lencioni, C, Ghio, A, Giovannitti, MG, Cuccuru, I, Pellegrini, G, Chatzianagnostou, K, Boldrini, A, Del Prato, S (2005) Maternal triglyceride levels and newborn weight in pregnant women with normal glucose tolerance. Diabet Med. 22 (1) : 21-25.

Dias, BG, Ressler, KJ (2014) Parental olfactory experience influences behavior and neural structure in subsequent generations. Nat Neurosci. 17 (1) : 89-96.

Dick, KJ, Nelson, CP, Tsaprouni, L, Sandling, JK, Aissi, D, Wahl, S, Meduri, E, Morange, PE, Gagnon, F, Grallert, H, Waldenberger, M, Peters, A, Erdmann, J, Hengstenberg, C, Cambien, F, Goodall, AH, Ouwehand, WH, Schunkert, H, Thompson, JR, Spector, TD, Gieger, C, Tregouet, DA, Deloukas, P, Samani, NJ (2014) DNA methylation and body-mass index: a genome-wide analysis. Lancet. 383 (9933) : 1990-1998.

D'ippolito, S, Tersigni, C, Scambia, G, Di Simone, N (2012) Adipokines, an adipose tissue and placental product with biological functions during pregnancy. Biofactors. 38 (1) : 14-23.

Do Amaral, CL, Milagro, FI, Curi, R, Martinez, JA (2014) DNA methylation pattern in overweight women under an energy-restricted diet supplemented with fish oil. Biomed Res Int. 2014 : 675021.

Dolinoy, DC, Das, R, Weidman, JR, Jirtle, RL (2007) Metastable epialleles, imprinting, and

313 the fetal origins of adult diseases. Pediatr Res. 61 (5 Pt 2) : 30R-37R.

Dominguez-Salas, P, Moore, SE, Baker, MS, Bergen, AW, Cox, SE, Dyer, RA, Fulford, AJ, Guan, Y, Laritsky, E, Silver, MJ, Swan, GE, Zeisel, SH, Innis, SM, Waterland, RA, Prentice, AM, Hennig, BJ (2014) Maternal nutrition at conception modulates DNA methylation of human metastable epialleles. Nat Commun. 5 : 3746.

Dornhorst, A, Chan, SP (1998) The elusive diagnosis of gestational diabetes. Diabet Med. 15 (1) : 7-10.

Dube, E, Gravel, A, Martin, C, Desparois, G, Moussa, I, Ethier-Chiasson, M, Forest, JC, Giguere, Y, Masse, A, Lafond, J (2012) Modulation of fatty acid transport and metabolism by maternal obesity in the human full-term placenta. Biol Reprod. 87 (1) : 14, 11-11.

Dube, E, Ethier-Chiasson, M, Lafond, J (2013) Modulation of cholesterol transport by insulin-treated gestational diabetes mellitus in human full-term placenta. Biol Reprod. 88 (1) : 16.

Dubern, B, Clement, K (2012) Leptin and leptin receptor-related monogenic obesity. Biochimie. 94 (10) : 2111-2115.

Duhl, DM, Vrieling, H, Miller, KA, Wolff, GL, Barsh, GS (1994) Neomorphic agouti mutations in obese yellow mice. Nat Genet. 8 (1) : 59-65.

Durnwald, CP (2013) Insulin analogues in the treatment of gestational diabetes mellitus. Clin Obstet Gynecol. 56 (4) : 816-826.

Edmondson, AC, Braund, PS, Stylianou, IM, Khera, AV, Nelson, CP, Wolfe, ML, Derohannessian, SL, Keating, BJ, Qu, L, He, J, Tobin, MD, Tomaszewski, M, Baumert, J, Klopp, N, Doring, A, Thorand, B, Li, M, Reilly, MP, Koenig, W, Samani, NJ, Rader, DJ (2011) Dense genotyping of candidate gene loci identifies variants associated with high- density lipoprotein cholesterol. Circ Cardiovasc Genet. 4 (2) : 145-155.

El Hajj, N, Pliushch, G, Schneider, E, Dittrich, M, Muller, T, Korenkov, M, Aretz, M, Zechner, U, Lehnen, H, Haaf, T (2013) Metabolic programming of MEST DNA methylation by intrauterine exposure to gestational diabetes mellitus. Diabetes. 62 (4) : 1320-1328.

El Hajj, N, Schneider, E, Lehnen, H, Haaf, T (2014) Epigenetics and life-long consequences of an adverse nutritional and diabetic intrauterine environment. Reproduction. 148 (6) : R111- 120.

Elliott, HR, Tillin, T, Mcardle, WL, Ho, K, Duggirala, A, Frayling, TM, Davey Smith, G, Hughes, AD, Chaturvedi, N,Relton, CL (2014) Differences in smoking associated DNA methylation patterns in South Asians and Europeans. Clin Epigenetics. 6 (1) : 4.

Engel, SM, Joubert, BR, Wu, MC, Olshan, AF, Haberg, SE, Ueland, PM, Nystad, W, Nilsen, RM, Vollset, SE, Peddada, SD, London, SJ (2014) Neonatal genome-wide methylation patterns in relation to birth weight in the Norwegian Mother and Child Cohort. Am J

314

Epidemiol. 179 (7) : 834-842.

Ethier-Chiasson, M, Duchesne, A, Forest, JC, Giguere, Y, Masse, A, Mounier, C, Lafond, J (2007) Influence of maternal lipid profile on placental protein expression of LDLr and SR- BI. Biochem Biophys Res Commun. 359 (1) : 8-14.

Fadl, HE, Ostlund, IK, Magnuson, AF, Hanson, US (2010) Maternal and neonatal outcomes and time trends of gestational diabetes mellitus in Sweden from 1991 to 2003. Diabet Med. 27 (4) : 436-441.

Falavigna, M, Schmidt, MI, Trujillo, J, Alves, LF, Wendland, ER, Torloni, MR, Colagiuri, S, Duncan, BB (2012) Effectiveness of gestational diabetes treatment: a systematic review with quality of evidence assessment. Diabetes Res Clin Pract. 98 (3) : 396-405.

Fan, S, Zhang, X (2009) CpG island methylation pattern in different human tissues and its correlation with gene expression. Biochem Biophys Res Commun. 383 (4) : 421-425.

Farah, N, Hogan, J, O'dwyer, V, Stuart, B, Kennelly, M, Turner, MJ (2011) Influence of maternal glycemia on intrauterine fetal adiposity distribution after a normal oral glucose tolerance test at 28 weeks gestation. Exp Diabetes Res. 2011 : 951203.

Farooqi, IS, O'rahilly, S (2004) Monogenic human obesity syndromes. Recent Prog Horm Res. 59 : 409-424.

Fasshauer, M, Bluher, M, Stumvoll, M (2014) Adipokines in gestational diabetes. Lancet Diabetes Endocrinol. 2 (6) : 488-499.

Fatica, A, Bozzoni, I (2014) Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet. 15 (1) : 7-21.

Fei, C, Mclaughlin, JK, Tarone, RE, Olsen, J (2007) Perfluorinated chemicals and fetal growth: a study within the Danish National Birth Cohort. Environ Health Perspect. 115 (11) : 1677-1682.

Feig, DS, Zinman, B, Wang, X, Hux, JE (2008) Risk of development of diabetes mellitus after diagnosis of gestational diabetes. CMAJ. 179 (3) : 229-234.

Feinberg, AP, Irizarry, RA, Fradin, D, Aryee, MJ, Murakami, P, Aspelund, T, Eiriksdottir, G, Harris, TB, Launer, L, Gudnason, V, Fallin, MD (2010) Personalized epigenomic signatures that are stable over time and covary with body mass index. Sci Transl Med. 2 (49) : 49ra67.

Flanagan, JM, Brook, MN, Orr, N, Tomczyk, K, Coulson, P, Fletcher, O, Jones, ME, Schoemaker, MJ, Ashworth, A, Swerdlow, A, Brown, R, Garcia-Closas, M (2014) Temporal stability and determinants of white blood cell DNA methylation in the Breakthrough Generations Study. Cancer Epidemiol Biomarkers Prev.

Fowden, AL, Sibley, C, Reik, W, Constancia, M (2006) Imprinted genes, placental

315 development and fetal growth. Horm Res. 65 Suppl 3 : 50-58.

Fraga, MF, Ballestar, E, Paz, MF, Ropero, S, Setien, F, Ballestar, ML, Heine-Suner, D, Cigudosa, JC, Urioste, M, Benitez, J, Boix-Chornet, M, Sanchez-Aguilera, A, Ling, C, Carlsson, E, Poulsen, P, Vaag, A, Stephan, Z, Spector, TD, Wu, YZ, Plass, C, Esteller, M (2005) Epigenetic differences arise during the lifetime of monozygotic twins. Proc Natl Acad Sci U S A. 102 (30) : 10604-10609.

Friedman, JE, Ishizuka, T, Shao, J, Huston, L, Highman, T, Catalano, P (1999) Impaired glucose transport and insulin receptor tyrosine phosphorylation in skeletal muscle from obese women with gestational diabetes. Diabetes. 48 (9) : 1807-1814.

Gademan, MG, Vermeulen, M, Oostvogels, AJ, Roseboom, TJ, Visscher, TL, Van Eijsden, M, Twickler, MT, Vrijkotte, TG (2014) Maternal prepregancy BMI and lipid profile during early pregnancy are independently associated with offspring's body composition at age 5-6 years: the ABCD study. PLoS One. 9 (4) : e94594.

Galliano, D, Bellver, J (2013) Female obesity: short- and long-term consequences on the offspring. Gynecol Endocrinol. 29 (7) : 626-631.

Galtier, F (2010) Definition, epidemiology, risk factors. Diabetes Metab. 36 (6 Pt 2) : 628- 651.

Garcia-Cardona, MC, Huang, F, Garcia-Vivas, JM, Lopez-Camarillo, C, Del Rio Navarro, BE, Navarro Olivos, E, Hong-Chong, E, Bolanos-Jimenez, F, Marchat, LA (2014) DNA methylation of leptin and adiponectin promoters in children is reduced by the combined presence of obesity and insulin resistance. Int J Obes (Lond). 38 (11) : 1457-1465.

Gauster, M, Hiden, U, Van Poppel, M, Frank, S, Wadsack, C, Hauguel-De Mouzon, S, Desoye, G (2011) Dysregulation of placental endothelial lipase in obese women with gestational diabetes mellitus. Diabetes. 60 (10) : 2457-2464.

Gauster, M, Desoye, G, Totsch, M, Hiden, U (2012) The placenta and gestational diabetes mellitus. Curr Diab Rep. 12 (1) : 16-23.

Ge, ZJ, Liang, QX, Luo, SM, Wei, YC, Han, ZM, Schatten, H, Sun, QY, Zhang, CL (2013) Diabetic uterus environment may play a key role in alterations of DNA methylation of several imprinted genes at mid-gestation in mice. Reprod Biol Endocrinol. 11 : 119.

Gendrel, AV, Tang, YA, Suzuki, M, Godwin, J, Nesterova, TB, Greally, JM, Heard, E, Brockdorff, N (2013) Epigenetic functions of smchd1 repress gene clusters on the inactive X chromosome and on autosomes. Mol Cell Biol. 33 (16): 3150-3165.

Gertz, J, Varley, KE, Reddy, TE, Bowling, KM, Pauli, F, Parker, SL, Kucera, KS, Willard, HF, Myers, RM (2011) Analysis of DNA methylation in a three-generation family reveals widespread genetic influence on epigenetic regulation. PLoS Genet. 7 (8) : e1002228.

Gesteiro, E, Bastida, S, Sanchez Muniz, FJ (2011) Effects of maternal glucose tolerance,

316 pregnancy diet quality and neonatal insulinemia upon insulin resistance/sensitivity biomarkers in normoweight neonates. Nutr Hosp. 26 (6) : 1447-1455.

Gibbs, JR, Van Der Brug, MP, Hernandez, DG, Traynor, BJ, Nalls, MA, Lai, SL, Arepalli, S, Dillman, A, Rafferty, IP, Troncoso, J, Johnson, R, Zielke, HR, Ferrucci, L, Longo, DL, Cookson, MR, Singleton, AB (2010) Abundant quantitative trait loci exist for DNA methylation and gene expression in human brain. PLoS Genet. 6 (5) : e1000952.

Gillberg, L, Jacobsen, SC, Ronn, T, Brons, C, Vaag, A (2014) PPARGC1A DNA methylation in subcutaneous adipose tissue in low birth weight subjects--impact of 5 days of high-fat overfeeding. Metabolism. 63 (2) : 263-271.

Gillman, MW, Rifas-Shiman, S, Berkey, CS, Field, AE, Colditz, GA (2003) Maternal gestational diabetes, birth weight, and adolescent obesity. Pediatrics. 111 (3) : e221-226.

Gillman, MW, Oakey, H, Baghurst, PA, Volkmer, RE, Robinson, JS, Crowther, CA (2010) Effect of treatment of gestational diabetes mellitus on obesity in the next generation. Diabetes Care. 33 (5) : 964-968.

Gluckman, PD, Lillycrop, KA, Vickers, MH, Pleasants, AB, Phillips, ES, Beedle, AS, Burdge, GC, Hanson, MA (2007) Metabolic plasticity during mammalian development is directionally dependent on early nutritional status. Proc Natl Acad Sci U S A. 104 (31) : 12796-12800.

Godfrey, KM, Sheppard, A, Gluckman, PD, Lillycrop, KA, Burdge, GC, Mclean, C, Rodford, J, Slater-Jefferies, JL, Garratt, E, Crozier, SR, Emerald, BS, Gale, CR, Inskip, HM, Cooper, C, Hanson, MA (2011) Epigenetic gene promoter methylation at birth is associated with child's later adiposity. Diabetes. 60 (5) : 1528-1534.

Goll, MG, Kirpekar, F, Maggert, KA, Yoder, JA, Hsieh, CL, Zhang, X, Golic, KG, Jacobsen, SE, Bestor, TH (2006) Methylation of tRNAAsp by the DNA methyltransferase homolog Dnmt2. Science. 311 (5759) : 395-398.

Gomez-Uriz, AM, Milagro, FI, Mansego, ML, Cordero, P, Abete, I, De Arce, A, Goyenechea, E, Blazquez, V, Martinez-Zabaleta, M, Martinez, JA, Lopez De Munain, A, Campion, J (2014) Obesity and ischemic stroke modulate the methylation levels of KCNQ1 in white blood cells. Hum Mol Genet.

Gong, L, Pan, YX, Chen, H (2010) Gestational low protein diet in the rat mediates Igf2 gene expression in male offspring via altered hepatic DNA methylation. Epigenetics. 5 (7) : 619- 626.

Griffith, JS, Mahler, HR (1969) DNA ticketing theory of memory. Nature. 223 (5206) : 580- 582.

Grun, F (2010) Obesogens. Curr Opin Endocrinol Diabetes Obes. 17 (5) : 453-459.

Grundberg, E, Meduri, E, Sandling, JK, Hedman, AK, Keildson, S, Buil, A, Busche, S, Yuan,

317

W, Nisbet, J, Sekowska, M, Wilk, A, Barrett, A, Small, KS, Ge, B, Caron, M, Shin, SY, Lathrop, M, Dermitzakis, ET, Mccarthy, MI, Spector, TD, Bell, JT, Deloukas, P (2013) Global analysis of DNA methylation variation in adipose tissue from twins reveals links to disease-associated variants in distal regulatory elements. Am J Hum Genet. 93 (5) : 876-890.

Grundy, SM, Brewer, HB, Jr., Cleeman, JI, Smith, SC, Jr., Lenfant, C (2004) Definition of metabolic syndrome: Report of the National Heart, Lung, and Blood Institute/American Heart Association conference on scientific issues related to definition. Circulation. 109 (3) : 433-438.

Guay, SP, Voisin, G, Brisson, D, Munger, J, Lamarche, B, Gaudet, D,Bouchard, L (2012a) Epigenome-wide analysis in familial hypercholesterolemia identified new loci associated with high-density lipoprotein cholesterol concentration. Epigenomics. 4 (6) : 623-639.

Guay, SP, Brisson, D, Munger, J, Lamarche, B, Gaudet, D, Bouchard, L (2012b) ABCA1 gene promoter DNA methylation is associated with HDL particle profile and coronary artery disease in familial hypercholesterolemia. Epigenetics. 7 (5) : 464-472.

Guay, SP, Brisson, D, Lamarche, B, Marceau, P, Vohl, MC, Gaudet, D, Bouchard, L (2013) DNA methylation variations at CETP and LPL gene promoter loci: new molecular biomarkers associated with blood lipid profile variability. Atherosclerosis. 228 (2) : 413-420.

Guay, SP, Brisson, D, Lamarche, B, Gaudet, D, Bouchard, L (2014) Epipolymorphisms within lipoprotein genes contribute independently to plasma lipid levels in familial hypercholesterolemia. Epigenetics. 9 (5) : 718-729.

Guay, SP, Legare, C, Houde, AA, Mathieu, P, Bosse, Y, Bouchard, L (2014) Acetylsalicylic acid, aging and coronary artery disease are associated with ABCA1 DNA methylation in men. Clin Epigenetics. 6 (1) : 14.

Guibert, S, Forne, T, Weber, M (2012) Global profiling of DNA methylation erasure in mouse primordial germ cells. Genome Res. 22 (4) : 633-641.

Guillemette, L, Lacroix, M, Battista, MC, Doyon, M, Moreau, J, Menard, J, Ardilouze, JL, Perron, P, Hivert, MF (2014) TNFalpha dynamics during the oral glucose tolerance test vary according to the level of insulin resistance in pregnant women. J Clin Endocrinol Metab. 99 (5) : 1862-1869.

Guintivano, J, Arad, M, Gould, TD, Payne, JL, Kaminsky, ZA (2014) Antenatal prediction of postpartum depression with blood DNA methylation biomarkers. Mol Psychiatry. 19 (5) : 560-567.

Gunderson, EP, Hedderson, MM, Chiang, V, Crites, Y, Walton, D, Azevedo, RA, Fox, G, Elmasian, C, Young, S, Salvador, N, Lum, M, Quesenberry, CP, Lo, JC, Sternfeld, B, Ferrara,

318

A, Selby, JV (2012) Lactation intensity and postpartum maternal glucose tolerance and insulin resistance in women with recent GDM: the SWIFT cohort. Diabetes Care. 35 (1) : 50- 56.

Guo, H, Zhu, P, Yan, L, Li, R, Hu, B, Lian, Y, Yan, J, Ren, X, Lin, S, Li, J, Jin, X, Shi, X, Liu, P, Wang, X, Wang, W, Wei, Y, Li, X, Guo, F, Wu, X, Fan, X, Yong, J, Wen, L, Xie, SX, Tang, F, Qiao, J (2014) The DNA methylation landscape of human early embryos. Nature. 511 (7511) : 606-610.

Gutierrez-Arcelus, M, Lappalainen, T, Montgomery, SB, Buil, A, Ongen, H, Yurovsky, A, Bryois, J, Giger, T, Romano, L, Planchon, A, Falconnet, E, Bielser, D, Gagnebin, M, Padioleau, I, Borel, C, Letourneau, A, Makrythanasis, P, Guipponi, M, Gehrig, C, Antonarakis, SE, Dermitzakis, ET (2013) Passive and active DNA methylation and the interplay with genetic variation in gene regulation. Elife. 2 : e00523.

Hackett, JA, Surani, MA (2013) DNA methylation dynamics during the mammalian life cycle. Philos Trans R Soc Lond B Biol Sci. 368 (1609) : 20110328.

Haggarty, P, Ashton, J, Joynson, M, Abramovich, DR, Page, K (1999) Effect of maternal polyunsaturated fatty acid concentration on transport by the human placenta. Biol Neonate. 75 (6) : 350-359.

Haggarty, P, Hoad, G, Horgan, GW, Campbell, DM (2013) DNA methyltransferase candidate polymorphisms, imprinting methylation, and birth outcome. PLoS One. 8 (7) : e68896.

Hajkova, P, Erhardt, S, Lane, N, Haaf, T, El-Maarri, O, Reik, W, Walter, J, Surani, MA (2002) Epigenetic reprogramming in mouse primordial germ cells. Mech Dev. 117 (1-2) : 15- 23.

Hales, CN, Barker, DJ (2001) The thrifty phenotype hypothesis. Br Med Bull. 60 : 5-20.

Hamlin, HJ (2012) Prenatal stress and development: beyond the single cause and effect paradigm. Birth Defects Res C Embryo Today. 96 (4) : 289-298.

Han, J, Xu, J, Long, YS, Epstein, PN, Liu, YQ (2007) Rat maternal diabetes impairs pancreatic beta-cell function in the offspring. Am J Physiol Endocrinol Metab. 293 (1) : E228- 236.

HAPO (2009) Hyperglycemia and Adverse Pregnancy Outcome (HAPO) Study: associations with neonatal anthropometrics. Diabetes. 58 (2) : 453-459.

Harshman, SW, Young, NL, Parthun, MR, Freitas, MA (2013) H1 histones: current perspectives and challenges. Nucleic Acids Res. 41 (21) : 9593-9609.

Havel, PJ (2002) Control of energy homeostasis and insulin action by adipocyte hormones: leptin, acylation stimulating protein, and adiponectin. Curr Opin Lipidol. 13 (1) : 51-59.

319

Havel, PJ (2004) Update on adipocyte hormones: regulation of energy balance and carbohydrate/lipid metabolism. Diabetes. 53 Suppl 1: S143-151.

Hay, WW, Jr. (2006) Placental-fetal glucose exchange and fetal glucose metabolism. Trans Am Clin Climatol Assoc. 117 : 321-339; discussion 339-340.

Heid, IM, Jackson, AU, Randall, JC, Winkler, TW, Qi, L, Steinthorsdottir, V, Thorleifsson, G, Zillikens, MC, Speliotes, EK, Magi, R, Workalemahu, T, White, CC, Bouatia-Naji, N, Harris, TB, Berndt, SI, Ingelsson, E, Willer, CJ, Weedon, MN, Luan, J, Vedantam, S, Esko, T, Kilpelainen, TO, Kutalik, Z, Li, S, Monda, KL, Dixon, AL, Holmes, CC, Kaplan, LM, Liang, L, Min, JL, Moffatt, MF, Molony, C, Nicholson, G, Schadt, EE, Zondervan, KT, Feitosa, MF, Ferreira, T, Lango Allen, H, Weyant, RJ, Wheeler, E, Wood, AR, Estrada, K, Goddard, ME, Lettre, G, Mangino, M, Nyholt, DR, Purcell, S, Smith, AV, Visscher, PM, Yang, J, Mccarroll, SA, Nemesh, J, Voight, BF, Absher, D, Amin, N, Aspelund, T, Coin, L, Glazer, NL, Hayward, C, Heard-Costa, NL, Hottenga, JJ, Johansson, A, Johnson, T, Kaakinen, M, Kapur, K, Ketkar, S, Knowles, JW, Kraft, P, Kraja, AT, Lamina, C, Leitzmann, MF, Mcknight, B, Morris, AP, Ong, KK, Perry, JR, Peters, MJ, Polasek, O, Prokopenko, I, Rayner, NW, Ripatti, S, Rivadeneira, F, Robertson, NR, Sanna, S, Sovio, U, Surakka, I, Teumer, A, Van Wingerden, S, Vitart, V, Zhao, JH, Cavalcanti-Proenca, C, Chines, PS, Fisher, E, Kulzer, JR, Lecoeur, C, Narisu, N, Sandholt, C, Scott, LJ, Silander, K, Stark, K, Tammesoo, ML, Teslovich, TM, Timpson, NJ, Watanabe, RM, Welch, R, Chasman, DI, Cooper, MN, Jansson, JO, Kettunen, J, Lawrence, RW, Pellikka, N, Perola, M, Vandenput, L, Alavere, H, Almgren, P, Atwood, LD, Bennett, AJ, Biffar, R, Bonnycastle, LL, Bornstein, SR, Buchanan, TA, Campbell, H, Day, IN, Dei, M, Dorr, M, Elliott, P, Erdos, MR, Eriksson, JG, Freimer, NB, Fu, M, Gaget, S, Geus, EJ, Gjesing, AP, Grallert, H, Grassler, J, Groves, CJ, Guiducci, C, Hartikainen, AL, Hassanali, N, Havulinna, AS, Herzig, KH, Hicks, AA, Hui, J, Igl, W, Jousilahti, P, Jula, A, Kajantie, E, Kinnunen, L, Kolcic, I, Koskinen, S, Kovacs, P, Kroemer, HK, Krzelj, V, Kuusisto, J, Kvaloy, K, Laitinen, J, Lantieri, O, Lathrop, GM, Lokki, ML, Luben, RN, Ludwig, B, Mcardle, WL, Mccarthy, A, Morken, MA, Nelis, M, Neville, MJ, Pare, G, Parker, AN, Peden, JF, Pichler, I, Pietilainen, KH, Platou, CG, Pouta, A, Ridderstrale, M, Samani, NJ, Saramies, J, Sinisalo, J, Smit, JH, Strawbridge, RJ, Stringham, HM, Swift, AJ, Teder-Laving, M, Thomson, B, Usala, G, Van Meurs, JB, Van Ommen, GJ, Vatin, V, Volpato, CB, Wallaschofski, H, Walters, GB, Widen, E, Wild, SH, Willemsen, G, Witte, DR, Zgaga, L, Zitting, P, Beilby, JP, James, AL, Kahonen, M, Lehtimaki, T, Nieminen, MS, Ohlsson, C, Palmer, LJ, Raitakari, O, Ridker, PM, Stumvoll, M, Tonjes, A, Viikari, J, Balkau, B, Ben-Shlomo, Y, Bergman, RN, Boeing, H, Smith, GD, Ebrahim, S, Froguel, P, Hansen, T, Hengstenberg, C, Hveem, K, Isomaa, B, Jorgensen, T, Karpe, F, Khaw, KT, Laakso, M, Lawlor, DA, Marre, M, Meitinger, T, Metspalu, A, Midthjell, K, Pedersen, O, Salomaa, V, Schwarz, PE, Tuomi, T, Tuomilehto, J, Valle, TT, Wareham, NJ, Arnold, AM, Beckmann, JS, Bergmann, S, Boerwinkle, E, Boomsma, DI, Caulfield, MJ, Collins, FS, Eiriksdottir, G, Gudnason, V, Gyllensten, U, Hamsten, A, Hattersley, AT, Hofman, A, Hu, FB, Illig, T, Iribarren, C, Jarvelin, MR, Kao, WH, Kaprio, J, Launer, LJ, Munroe, PB, Oostra, B, Penninx, BW, Pramstaller, PP, Psaty, BM, Quertermous, T, Rissanen, A, Rudan, I, Shuldiner, AR, Soranzo, N, Spector, TD, Syvanen, AC, Uda, M, Uitterlinden, A, Volzke, H, Vollenweider, P, Wilson, JF, Witteman, JC, Wright, AF, Abecasis, GR, Boehnke, M, Borecki, IB, Deloukas, P, Frayling, TM, Groop, LC, Haritunians, T, Hunter, DJ, Kaplan, RC, North, KE, O'connell, JR, Peltonen, L, Schlessinger,

320

D, Strachan, DP, Hirschhorn, JN, Assimes, TL, Wichmann, HE, Thorsteinsdottir, U, Van Duijn, CM, Stefansson, K, Cupples, LA, Loos, RJ, Barroso, I, Mccarthy, MI, Fox, CS, Mohlke, KL, Lindgren, CM (2010) Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. Nat Genet. 42 (11) : 949-960.

Heijmans, BT, Tobi, EW, Stein, AD, Putter, H, Blauw, GJ, Susser, ES, Slagboom, PE, Lumey, LH (2008) Persistent epigenetic differences associated with prenatal exposure to famine in humans. Proc Natl Acad Sci U S A. 105 (44) : 17046-17049.

Hemberger, M, Dean, W, Reik, W (2009) Epigenetic dynamics of stem cells and cell lineage commitment: digging Waddington's canal. Nat Rev Mol Cell Biol. 10 (8) : 526-537.

Herceg, Z, Murr, T (2011) Mecanisms of histone modifications. Dans TO Tollefsbol (Éd). Handbook of epigenetics . Elsevier (1e éd.), 25-45.

Hernandez, TL, Anderson, MA, Chartier-Logan, C, Friedman, JE, Barbour, LA (2013) Strategies in the nutritional management of gestational diabetes. Clin Obstet Gynecol. 56 (4): 803-815.

Herrera, BM, Keildson, S, Lindgren, CM (2011) Genetics and epigenetics of obesity. Maturitas. 69 (1) : 41-49.

Herzog, E, Galvez, J, Roks, A, Stolk, L, Verbiest, M, Eilers, P, Cornelissen, J, Steegers, E, Steegers-Theunissen, R (2013) Tissue-specific DNA methylation profiles in newborns. Clin Epigenetics. 5 (1) : 8.

Heyn, H, Moran, S, Hernando-Herraez, I, Sayols, S, Gomez, A, Sandoval, J, Monk, D, Hata, K, Marques-Bonet, T, Wang, L, Esteller, M (2013) DNA methylation contributes to natural human variation. Genome Res. 23 (9) : 1363-1372.

Hidalgo, B, Irvin, MR, Sha, J, Zhi, D, Aslibekyan, S, Absher, D, Tiwari, HK, Kabagambe, EK, Ordovas, JM, Arnett, DK (2014) Epigenome-wide association study of fasting measures of glucose, insulin, and HOMA-IR in the Genetics of Lipid Lowering Drugs and Diet Network study. Diabetes. 63 (2) : 801-807.

Hill, JC, Krishnaveni, GV, Annamma, I, Leary, SD, Fall, CH (2005) Glucose tolerance in pregnancy in South India: relationships to neonatal anthropometry. Acta Obstet Gynecol Scand. 84 (2) : 159-165.

Hillier, TA, Pedula, KL, Schmidt, MM, Mullen, JA, Charles, MA, Pettitt, DJ (2007) Childhood obesity and metabolic imprinting: the ongoing effects of maternal hyperglycemia. Diabetes Care. 30 (9) : 2287-2292.

Hing, B, Gardner, C, Potash, JB (2014) Effects of negative stressors on DNA methylation in the brain: implications for mood and anxiety disorders. Am J Med Genet B Neuropsychiatr Genet. 165B (7) : 541-554.

321

Hochberg, I, Hochberg, Z (2010) Hypothalamic obesity. Endocr Dev. 17 : 185-196.

Hogg, K, Blair, JD, Von Dadelszen, P,Robinson, WP (2013) Hypomethylation of the LEP gene in placenta and elevated maternal leptin concentration in early onset pre-eclampsia. Mol Cell Endocrinol. 367 (1-2) : 64-73.

Hogg, K, Price, EM, Robinson, WP (2014) Improved reporting of DNA methylation data derived from studies of the human placenta. Epigenetics. 9 (3) : 333-337.

Holliday, R, Pugh, JE (1975) DNA modification mechanisms and gene activity during development. Science. 187 (4173) : 226-232.

Holliday, R (1987) The inheritance of epigenetic defects. Science. 238 (4824) : 163-170.

Holtcamp, W (2012) Obesogens: an environmental link to obesity. Environ Health Perspect. 120 (2) : a62-68.

Homko, C, Sivan, E, Chen, X, Reece, EA, Boden, G (2001) Insulin secretion during and after pregnancy in patients with gestational diabetes mellitus. J Clin Endocrinol Metab. 86 (2) : 568-573.

Hon, GC, Rajagopal, N, Shen, Y, Mccleary, DF, Yue, F, Dang, MD, Ren, B (2013) Epigenetic memory at embryonic enhancers identified in DNA methylation maps from adult mouse tissues. Nat Genet. 45 (10) : 1198-1206.

Hopkins, SA, Artal, R (2013) The role of exercise in reducing the risks of gestational diabetes mellitus. Womens Health (Lond Engl). 9 (6) : 569-581.

Horvath, K, Koch, K, Jeitler, K, Matyas, E, Bender, R, Bastian, H, Lange, S, Siebenhofer, A (2010) Effects of treatment in women with gestational diabetes mellitus: systematic review and meta-analysis. BMJ. 340 : c1395.

Horvath, S (2013) DNA methylation age of human tissues and cell types. Genome Biol. 14 (10) : R115.

Horvath, S, Erhart, W, Brosch, M, Ammerpohl, O, Von Schonfels, W, Ahrens, M, Heits, N, Bell, JT, Tsai, PC, Spector, TD, Deloukas, P, Siebert, R, Sipos, B, Becker, T, Rocken, C, Schafmayer, C, Hampe, J (2014) Obesity accelerates epigenetic aging of human liver. Proc Natl Acad Sci U S A. 111 (43) : 15538-15543.

Houde, AA, St-Pierre, J, Hivert, MF, Baillargeon, JP, Perron, P, Gaudet, D, Brisson, D,Bouchard, L (2014) Placental lipoprotein lipase DNA methylation levels are associated with gestational diabetes mellitus and maternal and cord blood lipid profiles. J Dev Orig Health Dis. 5 (2) : 132-141.

Houseman, EA, Accomando, WP, Koestler, DC, Christensen, BC, Marsit, CJ, Nelson, HH, Wiencke, JK, Kelsey, KT (2012) DNA methylation arrays as surrogate measures of cell mixture distribution. BMC Bioinformatics. 13 : 86.

322

Houseman, EA, Molitor, J, Marsit, CJ (2014) Reference-free cell mixture adjustments in analysis of DNA methylation data. Bioinformatics. 30 (10) : 1431-1439.

Huang, PL (2009) A comprehensive definition for metabolic syndrome. Dis Model Mech. 2 (5-6) : 231-237.

Huszar, D, Lynch, CA, Fairchild-Huntress, V, Dunmore, JH, Fang, Q, Berkemeier, LR, Gu, W, Kesterson, RA, Boston, BA, Cone, RD, Smith, FJ, Campfield, LA, Burn, P, Lee, F (1997) Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell. 88 (1) : 131-141.

Hwang, JY, Choi, HI, Kim, H, Jang, W, Ha, EH, Park, C, Chang, N (2014) Relationship of maternal grain intake and serum triglyceride levels with infant birth weight: Mothers and Children's Environmental Health (MOCEH) study. Eur J Clin Nutr.

Isganaitis E, Patti ME (2011). Adipocyte Development and Experimental Obesity, Dans: RH Lustig (Ed.), Obesity Before Birth: Maternal and Prenatal Influences on the Offspring , (1e ed), San Francisco, USA, Springer-Endocrine Updates 30, page 332

Ishida, M, Moore, GE (2013) The role of imprinted genes in humans. Mol Aspects Med. 34 (4) : 826-840.

Iurlaro, M, Ficz, G, Oxley, D, Raiber, EA, Bachman, M, Booth, MJ, Andrews, S, Balasubramanian, S, Reik, W (2013) A screen for hydroxymethylcytosine and formylcytosine binding proteins suggests functions in transcription and chromatin regulation. Genome Biol. 14 (10) : R119.

Jablonka, E, Lamb, MJ (2002) The changing concept of epigenetics. Ann N Y Acad Sci. 981 : 82-96.

Jacobsen, SC, Brons, C, Bork-Jensen, J, Ribel-Madsen, R, Yang, B, Lara, E, Hall, E, Calvanese, V, Nilsson, E, Jorgensen, SW, Mandrup, S, Ling, C, Fernandez, AF, Fraga, MF, Poulsen, P, Vaag, A (2012) Effects of short-term high-fat overfeeding on genome-wide DNA methylation in the skeletal muscle of healthy young men. Diabetologia. 55 (12) : 3341-3349.

Jacobsen, SC, Gillberg, L, Bork-Jensen, J, Ribel-Madsen, R, Lara, E, Calvanese, V, Ling, C, Fernandez, AF, Fraga, MF, Poulsen, P, Brons, C, Vaag, A (2014) Young men with low birthweight exhibit decreased plasticity of genome-wide muscle DNA methylation by high- fat overfeeding. Diabetologia. 57 (6) : 1154-1158.

Jaenisch, R, Bird, A (2003) Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet. 33 Suppl : 245-254.

James, WP (2008) WHO recognition of the global obesity epidemic. Int J Obes (Lond). 32 Suppl 7 : S120-126.

Jansson, T, Ekstrand, Y, Bjorn, C, Wennergren, M, Powell, TL (2002) Alterations in the activity of placental amino acid transporters in pregnancies complicated by diabetes.

323

Diabetes. 51 (7) : 2214-2219.

Jansson, T, Cetin, I, Powell, TL, Desoye, G, Radaelli, T, Ericsson, A, Sibley, CP (2006) Placental transport and metabolism in fetal overgrowth -- a workshop report. Placenta. 27 Suppl A : S109-113.

Jensen, DM, Sorensen, B, Feilberg-Jorgensen, N, Westergaard, JG, Beck-Nielsen, H (2000) Maternal and perinatal outcomes in 143 Danish women with gestational diabetes mellitus and 143 controls with a similar risk profile. Diabet Med. 17 (4) : 281-286.

Jenuwein, T, Allis, CD (2001) Translating the histone code. Science. 293 (5532) : 1074-1080.

Johnson TB, Coghill RD (1925). The discovery of 5-methyl-cytosine in tuberculinic acid, the nucleic acid of the Tubercle bacillus . J Am Chem Soc 47 (11): 2838–2844

Jones, PA (2012) Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nat Rev Genet. 13 (7) : 484-492.

Jones, PL, Veenstra, GJ, Wade, PA, Vermaak, D, Kass, SU, Landsberger, N, Strouboulis, J, Wolffe, AP (1998) Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat Genet. 19 (2) : 187-191.

Joubert, BR, Haberg, SE, Nilsen, RM, Wang, X, Vollset, SE, Murphy, SK, Huang, Z, Hoyo, C, Midttun, O, Cupul-Uicab, LA, Ueland, PM, Wu, MC, Nystad, W, Bell, DA, Peddada, SD, London, SJ (2012) 450K epigenome-wide scan identifies differential DNA methylation in newborns related to maternal smoking during pregnancy. Environ Health Perspect. 120 (10) : 1425-1431.

Jousse, C, Parry, L, Lambert-Langlais, S, Maurin, AC, Averous, J, Bruhat, A, Carraro, V, Tost, J, Letteron, P, Chen, P, Jockers, R, Launay, JM, Mallet, J, Fafournoux, P (2011) Perinatal undernutrition affects the methylation and expression of the leptin gene in adults: implication for the understanding of metabolic syndrome. FASEB J. 25 (9) : 3271-3278.

Junien, C, Nathanielsz, P (2007) Report on the IASO Stock Conference 2006: early and lifelong environmental epigenomic programming of metabolic syndrome, obesity and type II diabetes. Obes Rev. 8 (6) : 487-502.

Kaneda, M, Okano, M, Hata, K, Sado, T, Tsujimoto, N, Li, E, Sasaki, H (2004) Essential role for de novo DNA methyltransferase Dnmt3a in paternal and maternal imprinting. Nature. 429 (6994) : 900-903.

Kathiresan, S, Melander, O, Guiducci, C, Surti, A, Burtt, NP, Rieder, MJ, Cooper, GM, Roos, C, Voight, BF, Havulinna, AS, Wahlstrand, B, Hedner, T, Corella, D, Tai, ES, Ordovas, JM, Berglund, G, Vartiainen, E, Jousilahti, P, Hedblad, B, Taskinen, MR, Newton-Cheh, C, Salomaa, V, Peltonen, L, Groop, L, Altshuler, DM, Orho-Melander, M (2008) Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. Nat Genet. 40 (2) : 189-197.

324

Katoh, M (2014) Cardio-miRNAs and onco-miRNAs: circulating miRNA-based diagnostics for non-cancerous and cancerous diseases. Front Cell Dev Biol. 2 : 61.

Katzmarzyk, PT, Janssen, I (2004) The economic costs associated with physical inactivity and obesity in Canada: an update. Can J Appl Physiol. 29 (1) : 90-115.

Kautzky-Willer, A, Prager, R, Waldhausl, W, Pacini, G, Thomaseth, K, Wagner, OF, Ulm, M, Streli, C, Ludvik, B (1997) Pronounced insulin resistance and inadequate beta-cell secretion characterize lean gestational diabetes during and after pregnancy. Diabetes Care. 20 (11) : 1717-1723.

Keelan, JA, Aye, IL, Mark, PJ,Waddell, BJ (2011) ABCA1 and placental cholesterol efflux. Placenta. 32 (9) : 708-709; author reply 710-701.

Kelstrup, L, Damm, P, Mathiesen, ER, Hansen, T, Vaag, AA, Pedersen, O, Clausen, TD (2013) Insulin resistance and impaired pancreatic beta-cell function in adult offspring of women with diabetes in pregnancy. J Clin Endocrinol Metab. 98 (9) : 3793-3801.

Kessous, R, Shoham-Vardi, I, Pariente, G, Sherf, M, Sheiner, E (2013) An association between gestational diabetes mellitus and long-term maternal cardiovascular morbidity. Heart. 99 (15) : 1118-1121.

Khalyfa, A, Carreras, A, Hakim, F, Cunningham, JM, Wang, Y, Gozal, D (2013) Effects of late gestational high-fat diet on body weight, metabolic regulation and adipokine expression in offspring. Int J Obes (Lond). 37 (11) : 1481-1489.

Khandelwal, M, Homko, C, Reece, EA (1999) Gestational diabetes mellitus: controversies and current opinions. Curr Opin Obstet Gynecol. 11 (2) : 157-165.

Kim, C, Newton, KM, Knopp, RH (2002) Gestational diabetes and the incidence of type 2 diabetes: a systematic review. Diabetes Care. 25 (10) : 1862-1868.

Kim, J, Kim, K, Kim, H, Yoon, G, Lee, K (2014) Characterization of age signatures of DNA methylation in normal and cancer tissues from multiple studies. BMC Genomics. 15 (1) : 997.

Kim, SY, England, L, Wilson, HG, Bish, C, Satten, GA, Dietz, P (2010) Percentage of gestational diabetes mellitus attributable to overweight and obesity. Am J Public Health. 100 (6) : 1047-1052.

Kim, SY, England, JL, Sharma, JA, Njoroge, T (2011) Gestational diabetes mellitus and risk of childhood overweight and obesity in offspring: a systematic review. Exp Diabetes Res. 2011 : 541308.

Kim, SY, Saraiva, C, Curtis, M, Wilson, HG, Troyan, J, Sharma, AJ (2013) Fraction of gestational diabetes mellitus attributable to overweight and obesity by race/ethnicity, California, 2007-2009. Am J Public Health. 103 (10): e65-72.

Kind, KL, Clifton, PM, Katsman, AI, Tsiounis, M, Robinson, JS, Owens, JA (1999)

325

Restricted fetal growth and the response to dietary cholesterol in the guinea pig. Am J Physiol. 277 (6 Pt 2) : R1675-1682.

Kitzmiller, JL, Dang-Kilduff, L, Taslimi, MM (2007) Gestational diabetes after delivery. Short-term management and long-term risks. Diabetes Care. 30 Suppl 2 : S225-235.

Klag, MJ, Ford, DE, Mead, LA, He, J, Whelton, PK, Liang, K-Y, Levine, DM (1993) Serum Cholesterol in Young Men and Subsequent Cardiovascular Disease. New England Journal of Medicine. 328 (5) : 313-318.

Knight, B, Shields, BM, Hill, A, Powell, RJ, Wright, D, Hattersley, AT (2007) The impact of maternal glycemia and obesity on early postnatal growth in a nondiabetic Caucasian population. Diabetes Care. 30 (4) : 777-783.

Koletzko, B, Brands, B, Poston, L, Godfrey, K, Demmelmair, H (2012) Early nutrition programming of long-term health. Proc Nutr Soc. 71 (3) : 371-378.

Koukoura, O, Sifakis, S, Soufla, G, Zaravinos, A, Apostolidou, S, Jones, A, Widschwendter, M, Spandidos, DA (2011) Loss of imprinting and aberrant methylation of IGF2 in placentas from pregnancies complicated with fetal growth restriction. Int J Mol Med. 28 (4) : 481-487.

Kraja, AT, Vaidya, D, Pankow, JS, Goodarzi, MO, Assimes, TL, Kullo, IJ, Sovio, U, Mathias, RA, Sun, YV, Franceschini, N, Absher, D, Li, G, Zhang, Q, Feitosa, MF, Glazer, NL, Haritunians, T, Hartikainen, AL, Knowles, JW, North, KE, Iribarren, C, Kral, B, Yanek, L, O'reilly, PF, Mccarthy, MI, Jaquish, C, Couper, DJ, Chakravarti, A, Psaty, BM, Becker, LC, Province, MA, Boerwinkle, E, Quertermous, T, Palotie, L, Jarvelin, MR, Becker, DM, Kardia, SL, Rotter, JI, Chen, YD, Borecki, IB (2011) A bivariate genome-wide approach to metabolic syndrome: STAMPEED consortium. Diabetes. 60 (4) : 1329-1339.

Kramer, MS, Kahn, SR, Dahhou, M, Otvos, J, Genest, J, Platt, RW, Evans, RW (2013) Maternal lipids and small for gestational age birth at term. J Pediatr. 163 (4) : 983-988.

Kruman, Ii, Fowler, AK (2014) Impaired one carbon metabolism and DNA methylation in alcohol toxicity. J Neurochem. 129 (5) : 770-780.

Kubo, A, Ferrara, A, Windham, GC, Greenspan, L, Deardorff, J, Hiatt, RA, Quesenberry, CP, Jr., Laurent, C, Mirabedi, AS, Kushi, LH (2014) Maternal Hyperglycemia During Pregnancy Predicts Adiposity of the Offspring. Diabetes Care.

Kulkarni, SR, Kumaran, K, Rao, SR, Chougule, SD, Deokar, TM, Bhalerao, AJ, Solat, VA, Bhat, DS, Fall, CH, Yajnik, CS (2013) Maternal lipids are as important as glucose for fetal growth: findings from the Pune Maternal Nutrition Study. Diabetes Care. 36 (9) : 2706-2713.

Kumar, A, Kumar, S, Vikram, A, Hoffman, TA, Naqvi, A, Lewarchik, CM, Kim, YR, Irani, K (2013) Histone and DNA methylation-mediated epigenetic downregulation of endothelial Kruppel-like factor 2 by low-density lipoprotein cholesterol. Arterioscler Thromb Vasc Biol. 33 (8) : 1936-1942.

326

Kundaje A, Meuleman W, Ernst J, Bilenky M, Yen A, Heravi-Moussavi A, Kheradpour P, Zhang Z, Wang J, Ziller MJ, et al . (2015) Integrative analysis of 111 reference human epigenomes. Nature. 518:317-30.

Kwak, SH, Choi, SH, Jung, HS, Cho, YM, Lim, S, Cho, NH, Kim, SY, Park, KS, Jang, HC (2013) Clinical and genetic risk factors for type 2 diabetes at early or late post partum after gestational diabetes mellitus. J Clin Endocrinol Metab. 98 (4) : E744-752.

Labonte, B, Suderman, M, Maussion, G, Navaro, L, Yerko, V, Mahar, I, Bureau, A, Mechawar, N, Szyf, M, Meaney, MJ, Turecki, G (2012) Genome-wide epigenetic regulation by early-life trauma. Arch Gen Psychiatry. 69 (7) : 722-731.

Lacroix, M, Battista, MC, Doyon, M, Menard, J, Ardilouze, JL, Perron, P, Hivert, MF (2013a) Lower adiponectin levels at first trimester of pregnancy are associated with increased insulin resistance and higher risk of developing gestational diabetes mellitus. Diabetes Care. 36 (6) : 1577-1583.

Lacroix, M, Kina, E, Hivert, MF (2013b) Maternal/fetal determinants of insulin resistance in women during pregnancy and in offspring over life. Curr Diab Rep. 13 (2) : 238-244.

Lager, S, Powell, TL (2012) Regulation of nutrient transport across the placenta. J Pregnancy. 2012 : 179827.

Lain, KY, Catalano, PM (2007) Metabolic changes in pregnancy. Clin Obstet Gynecol. 50 (4) : 938-948.

Landon, MB, Spong, CY, Thom, E, Carpenter, MW, Ramin, SM, Casey, B, Wapner, RJ, Varner, MW, Rouse, DJ, Thorp, JM, Jr., Sciscione, A, Catalano, P, Harper, M, Saade, G, Lain, KY, Sorokin, Y, Peaceman, AM, Tolosa, JE, Anderson, GB (2009) A multicenter, randomized trial of treatment for mild gestational diabetes. N Engl J Med. 361 (14) : 1339- 1348.

Langevin, SM, Pinney, SM, Leung, YK, Ho, SM (2014) Does epigenetic drift contribute to age-related increases in breast cancer risk? Epigenomics. 6 (4) : 367-369.

Larque, E, Demmelmair, H, Gil-Sanchez, A, Prieto-Sanchez, MT, Blanco, JE, Pagan, A, Faber, FL, Zamora, S, Parrilla, JJ, Koletzko, B (2011) Placental transfer of fatty acids and fetal implications. Am J Clin Nutr. 94 (6 Suppl) : 1908S-1913S.

Larsen, F, Gundersen, G, Lopez, R, Prydz, H (1992) CpG islands as gene markers in the human genome. Genomics. 13 (4) : 1095-1107.

Lauenborg, J, Mathiesen, E, Hansen, T, Glumer, C, Jorgensen, T, Borch-Johnsen, K, Hornnes, P, Pedersen, O, Damm, P (2005) The prevalence of the metabolic syndrome in a danish population of women with previous gestational diabetes mellitus is three-fold higher than in the general population. J Clin Endocrinol Metab. 90 (7) : 4004-4010.

327

Law, CM, De Swiet, M, Osmond, C, Fayers, PM, Barker, DJ, Cruddas, AM, Fall, CH (1993) Initiation of hypertension in utero and its amplification throughout life. BMJ. 306 (6869) : 24-27.

Le Petit, C, Berthelot, JM (2006) Obesity--a growing issue. Health Rep. 17 (3) : 43-50.

Lee, HM, Nguyen, DT, Lu, LF (2014) Progress and challenge of microRNA research in immunity. Front Genet. 5 : 178.

Lee, KW, Richmond, R, Hu, P, French, L, Shin, J, Bourdon, C, Reischl, E, Waldenberger, M, Zeilinger, S, Gaunt, T, Mcardle, W, Ring, S, Woodward, G, Bouchard, L, Gaudet, D, Davey-Smith, G, Relton, C, Paus, T, Pausova, Z (2014) Prenatal Exposure to Maternal Cigarette Smoking and DNA Methylation: Epigenome-Wide Association in a Discovery Sample of Adolescents and Replication in an Independent Cohort at Birth through 17 Years of Age. Environ Health Perspect.

Leek, JT, Storey, JD (2007) Capturing heterogeneity in gene expression studies by surrogate variable analysis. PLoS Genet. 3 (9) : 1724-1735.

Lesseur, C, Armstrong, DA, Paquette, AG, Koestler, DC, Padbury, JF, Marsit, CJ (2013) Tissue-specific Leptin promoter DNA methylation is associated with maternal and infant perinatal factors. Mol Cell Endocrinol. 381 (1-2) : 160-167.

Lesseur, C, Armstrong, DA, Paquette, AG, Li, Z, Padbury, JF, Marsit, CJ (2014) Maternal obesity and gestational diabetes are associated with placental leptin DNA methylation. Am J Obstet Gynecol.

Li, B, Carey, M, Workman, JL (2007) The role of chromatin during transcription. Cell. 128 (4) : 707-719.

Lienert, F, Wirbelauer, C, Som, I, Dean, A, Mohn, F, Schubeler, D (2011) Identification of genetic elements that autonomously determine DNA methylation states. Nat Genet. 43 (11) : 1091-1097.

Lillis, AP, Van Duyn, LB, Murphy-Ullrich, JE, Strickland, DK (2008) LDL receptor-related protein 1: unique tissue-specific functions revealed by selective gene knockout studies. Physiol Rev. 88 (3) : 887-918.

Lillycrop, KA, Phillips, ES, Jackson, AA, Hanson, MA, Burdge, GC (2005) Dietary protein restriction of pregnant rats induces and folic acid supplementation prevents epigenetic modification of hepatic gene expression in the offspring. J Nutr. 135 (6) : 1382-1386.

Lillycrop, KA, Phillips, ES, Torrens, C, Hanson, MA, Jackson, AA, Burdge, GC (2008) Feeding pregnant rats a protein-restricted diet persistently alters the methylation of specific cytosines in the hepatic PPAR alpha promoter of the offspring. Br J Nutr. 100 (2) : 278-282.

Lim, AL, Ng, S, Leow, SC, Choo, R, Ito, M, Chan, YH, Goh, SK, Tng, E, Kwek, K, Chong, YS, Gluckman, PD, Ferguson-Smith, AC (2012) Epigenetic state and expression of

328 imprinted genes in umbilical cord correlates with growth parameters in human pregnancy. J Med Genet. 49 (11) : 689-697.

Lister, R, Ecker, JR (2009) Finding the fifth base: genome-wide sequencing of cytosine methylation. Genome Res. 19 (6) : 959-966.

Lister, R, Pelizzola, M, Dowen, RH, Hawkins, RD, Hon, G, Tonti-Filippini, J, Nery, JR, Lee, L, Ye, Z, Ngo, QM, Edsall, L, Antosiewicz-Bourget, J, Stewart, R, Ruotti, V, Millar, AH, Thomson, JA, Ren, B, Ecker, JR (2009) Human DNA methylomes at base resolution show widespread epigenomic differences. Nature. 462 (7271) : 315-322.

Liu, X, Chen, Q, Tsai, HJ, Wang, G, Hong, X, Zhou, Y, Zhang, C, Liu, C, Liu, R, Wang, H, Zhang, S, Yu, Y, Mestan, KK, Pearson, C, Otlans, P, Zuckerman, B, Wang, X (2014) Maternal preconception body mass index and offspring cord blood DNA methylation: exploration of early life origins of disease. Environ Mol Mutagen. 55 (3) : 223-230.

Lu, D, Willard, D, Patel, IR, Kadwell, S, Overton, L, Kost, T, Luther, M, Chen, W, Woychik, RP, Wilkison, WO (1994) Agouti protein is an antagonist of the melanocyte-stimulating- hormone receptor. Nature. 371 (6500) : 799-802.

Lucas, A, Baker, BA, Desai, M,Hales, CN (1996) Nutrition in pregnant or lactating rats programs lipid metabolism in the offspring. Br J Nutr. 76 (4) : 605-612.

Lucifero, D, Mertineit, C, Clarke, HJ, Bestor, TH, Trasler, JM (2002) Methylation dynamics of imprinted genes in mouse germ cells. Genomics. 79 (4) : 530-538.

Lucifero, D, Mann, MR, Bartolomei, MS, Trasler, JM (2004) Gene-specific timing and epigenetic memory in oocyte imprinting. Hum Mol Genet. 13 (8) : 839-849.

Lukaszewski, MA, Eberle, D, Vieau, D, Breton, C (2013) Nutritional manipulations in the perinatal period program adipose tissue in offspring. Am J Physiol Endocrinol Metab. 305 (10) : E1195-1207.

Luo, ZC, Delvin, E, Fraser, WD, Audibert, F, Deal, CI, Julien, P, Girard, I, Shear, R, Levy, E, Nuyt, AM (2010) Maternal glucose tolerance in pregnancy affects fetal insulin sensitivity. Diabetes Care. 33 (9) : 2055-2061.

Luu, PL, Scholer, HR, Arauzo-Bravo, MJ (2013) Disclosing the crosstalk among DNA methylation, transcription factors, and histone marks in human pluripotent cells through discovery of DNA methylation motifs. Genome Res. 23 (12) : 2013-2029.

Ma, B, Wilker, EH, Willis-Owen, SA, Byun, HM, Wong, KC, Motta, V, Baccarelli, AA, Schwartz, J, Cookson, WO, Khabbaz, K, Mittleman, MA, Moffatt, MF, Liang, L (2014) Predicting DNA methylation level across human tissues. Nucleic Acids Res. 42 (6) : 3515- 3528.

Malcolm, J (2012) Through the looking glass: gestational diabetes as a predictor of maternal and offspring long-term health. Diabetes Metab Res Rev. 28 (4) : 307-311.

329

Manolio, TA, Collins, FS, Cox, NJ, Goldstein, DB, Hindorff, LA, Hunter, DJ, Mccarthy, MI, Ramos, EM, Cardon, LR, Chakravarti, A, Cho, JH, Guttmacher, AE, Kong, A, Kruglyak, L, Mardis, E, Rotimi, CN, Slatkin, M, Valle, D, Whittemore, AS, Boehnke, M, Clark, AG, Eichler, EE, Gibson, G, Haines, JL, Mackay, TF, Mccarroll, SA, Visscher, PM (2009) Finding the missing heritability of complex diseases. Nature. 461 (7265) : 747-753.

Markenson, G, Belisle, E, Knee, A, Collins, S, Gawade, P, Chasan-Taber, L (2011) Does gestational diabetes impact maternal or cord blood lipids? American Journal of Obstetrics & Gynecology. 204 (1) : S108.

Maunakea, AK, Chepelev, I, Cui, K, Zhao, K (2013) Intragenic DNA methylation modulates alternative splicing by recruiting MeCP2 to promote exon recognition. Cell Res. 23 (11) : 1256-1269.

Mayo, K, Melamed, N, Vandenberghe, H, Berger, H (2014) The impact of adoption of the International Association of Diabetes in Pregnancy Study Group criteria for the screening and diagnosis of gestational diabetes. Am J Obstet Gynecol.

Mccarthy, MI, Abecasis, GR, Cardon, LR, Goldstein, DB, Little, J, Ioannidis, JP, Hirschhorn, JN (2008) Genome-wide association studies for complex traits: consensus, uncertainty and challenges. Nat Rev Genet. 9 (5) : 356-369.

Mccoy, MG, Sun, GS, Marchadier, D, Maugeais, C, Glick, JM, Rader, DJ (2002) Characterization of the lipolytic activity of endothelial lipase. J Lipid Res. 43 (6) : 921-929.

Mcguinness, D, Mcglynn, LM, Johnson, PC, Macintyre, A, Batty, GD, Burns, H, Cavanagh, J, Deans, KA, Ford, I, Mcconnachie, A, Mcginty, A, Mclean, JS, Millar, K, Packard, CJ, Sattar, NA, Tannahill, C, Velupillai, YN, Shiels, PG (2012) Socio-economic status is associated with epigenetic differences in the pSoBid cohort. Int J Epidemiol. 41 (1) : 151- 160.

Mellen, M, Ayata, P, Dewell, S, Kriaucionis, S, Heintz, N (2012) MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system. Cell. 151 (7) : 1417-1430.

Melzner, I, Scott, V, Dorsch, K, Fischer, P, Wabitsch, M, Bruderlein, S, Hasel, C, Moller, P (2002) Leptin gene expression in human preadipocytes is switched on by maturation-induced demethylation of distinct CpGs in its proximal promoter. J Biol Chem. 277 (47) : 45420- 45427.

Merzouk, H, Bouchenak, M, Loukidi, B, Madani, S, Prost, J, Belleville, J (2000a) Fetal macrosomia related to maternal poorly controlled type 1 diabetes strongly impairs serum lipoprotein concentrations and composition. J Clin Pathol. 53 (12) : 917-923.

Merzouk, H, Meghelli-Bouchenak, M, Loukidi, B, Prost, J, Belleville, J (2000b) Impaired serum lipids and lipoproteins in fetal macrosomia related to maternal obesity. Biol Neonate. 77 (1) : 17-24.

330

Messerschmidt, DM, Knowles, BB, Solter, D (2014) DNA methylation dynamics during epigenetic reprogramming in the germline and preimplantation embryos. Genes Dev. 28 (8) : 812-828.

Metzger, BE, Lowe, LP, Dyer, AR, Trimble, ER, Chaovarindr, U, Coustan, DR, Hadden, DR, Mccance, DR, Hod, M, Mcintyre, HD, Oats, JJ, Persson, B, Rogers, MS, Sacks, DA (2008) Hyperglycemia and adverse pregnancy outcomes. N Engl J Med. 358 (19) : 1991- 2002.

Metzger, BE, Gabbe, SG, Persson, B, Buchanan, TA, Catalano, PA, Damm, P, Dyer, AR, Leiva, A, Hod, M, Kitzmiler, JL, Lowe, LP, Mcintyre, HD, Oats, JJ, Omori, Y, Schmidt, MI (2010) International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy. Diabetes Care. 33 (3) : 676-682.

Meyer, K, Lubo, Z (2007) Fetal programming of cardiac function and disease. Reprod Sci. 14 (3) : 209-216.

Milagro, FI, Gomez-Abellan, P, Campion, J, Martinez, JA, Ordovas, JM, Garaulet, M (2012) CLOCK, PER2 and BMAL1 DNA methylation: association with obesity and metabolic syndrome characteristics and monounsaturated fat intake. Chronobiol Int. 29 (9) : 1180-1194.

Milenkovic, D, Vanden Berghe, W, Boby, C, Leroux, C, Declerck, K, Szarc Vel Szic, K, Heyninck, K, Laukens, K, Bizet, M, Defrance, M, Dedeurwaerder, S, Calonne, E, Fuks, F, Haegeman, G, Haenen, GR, Bast, A, Weseler, AR (2014) Dietary flavanols modulate the transcription of genes associated with cardiovascular pathology without changes in their DNA methylation state. PLoS One. 9 (4) : e95527.

Mill, J, Heijmans, BT (2013) From promises to practical strategies in epigenetic epidemiology. Nat Rev Genet. 14 (8) : 585-594.

Miltenberger, RJ, Mynatt, RL, Wilkinson, JE, Woychik, RP (1997) The role of the agouti gene in the yellow obese syndrome. J Nutr. 127 (9) : 1902S-1907S.

Minnes, S, Lang, A, Singer, L (2011) Prenatal tobacco, marijuana, stimulant, and opiate exposure: outcomes and practice implications. Addict Sci Clin Pract. 6 (1) : 57-70.

Misra, VK, Trudeau, S, Perni, U (2011) Maternal serum lipids during pregnancy and infant birth weight: the influence of prepregnancy BMI. Obesity (Silver Spring). 19 (7) : 1476-1481.

Moen, EL, Zhang, X, Mu, W, Delaney, SM, Wing, C, Mcquade, J, Myers, J, Godley, LA, Dolan, ME, Zhang, W (2013) Genome-wide variation of cytosine modifications between European and African populations and the implications for complex traits. Genetics. 194 (4) : 987-996.

Moleda, P, Homa, K, Safranow, K, Celewicz, Z, Fronczyk, A, Majkowska, L (2013) Women with normal glucose tolerance and a history of gestational diabetes show significant impairment of beta-cell function at normal insulin sensitivity. Diabetes Metab. 39 (2) : 155-

331

162.

Moleres, A, Campion, J, Milagro, FI, Marcos, A, Campoy, C, Garagorri, JM, Gomez- Martinez, S, Martinez, JA, Azcona-Sanjulian, MC, Marti, A (2013) Differential DNA methylation patterns between high and low responders to a weight loss intervention in overweight or obese adolescents: the EVASYON study. FASEB J. 27 (6) : 2504-2512.

Moody, TW, Ito, T, Osefo, N, Jensen, RT (2011) VIP and PACAP: recent insights into their functions/roles in physiology and disease from molecular and genetic studies. Curr Opin Endocrinol Diabetes Obes. 18 (1) : 61-67.

Moore, LG, Charles, SM, Julian, CG (2011) Humans at high altitude: hypoxia and fetal growth. Respir Physiol Neurobiol. 178 (1) : 181-190.

Morales, E, Groom, A, Lawlor, DA, Relton, CL (2014) DNA methylation signatures in cord blood associated with maternal gestational weight gain: results from the ALSPAC cohort. BMC Res Notes. 7 : 278.

Morgan, HD, Sutherland, HG, Martin, DI, Whitelaw, E (1999) Epigenetic inheritance at the agouti locus in the mouse. Nat Genet. 23 (3) : 314-318.

Morisset, AS, St-Yves, A, Veillette, J, Weisnagel, SJ, Tchernof, A, Robitaille, J (2010) Prevention of gestational diabetes mellitus: a review of studies on weight management. Diabetes Metab Res Rev. 26 (1) : 17-25.

Much, D, Beyerlein, A, Rossbauer, M, Hummel, S, Ziegler, AG (2014) Beneficial effects of breastfeeding in women with gestational diabetes mellitus. Mol Metab. 3 (3) : 284-292.

Murphy, SK, Huang, Z, Hoyo, C (2012) Differentially methylated regions of imprinted genes in prenatal, perinatal and postnatal human tissues. PLoS One. 7 (7) : e40924.

Must, A, Spadano, J, Coakley, EH, Field, AE, Colditz, G, Dietz, WH (1999) The disease burden associated with overweight and obesity. JAMA. 282 (16) : 1523-1529.

Napoli, C, D'armiento, FP, Mancini, FP, Postiglione, A, Witztum, JL, Palumbo, G, Palinski, W (1997) Fatty streak formation occurs in human fetal aortas and is greatly enhanced by maternal hypercholesterolemia. Intimal accumulation of low density lipoprotein and its oxidation precede monocyte recruitment into early atherosclerotic lesions. J Clin Invest. 100 (11) : 2680-2690.

Napoli, C, Glass, CK, Witztum, JL, Deutsch, R, D'armiento, FP, Palinski, W (1999) Influence of maternal hypercholesterolaemia during pregnancy on progression of early atherosclerotic lesions in childhood: Fate of Early Lesions in Children (FELIC) study. Lancet. 354 (9186) : 1234-1241.

Napoli, C, Palinski, W (2001) Maternal hypercholesterolemia during pregnancy influences the later development of atherosclerosis: clinical and pathogenic implications. Eur Heart J. 22 (1) : 4-9.

332

Nathan, BM, Moran, A (2008) Metabolic complications of obesity in childhood and adolescence: more than just diabetes. Curr Opin Endocrinol Diabetes Obes. 15 (1) : 21-29.

NDDG (1979) Classification and diagnosis of diabetes mellitus and other categories of glucose intolerance. National Diabetes Data Group. Diabetes. 28 (12) : 1039-1057.

Negrato, CA, Montenegro Junior, RM, Von Kostrisch, LM, Guedes, MF, Mattar, R, Gomes, MB (2012) Insulin analogues in the treatment of diabetes in pregnancy. Arq Bras Endocrinol Metabol. 56 (7) : 405-414.

Nehiri, T, Duong Van Huyen, JP, Viltard, M, Fassot, C, Heudes, D, Freund, N, Deschenes, G, Houillier, P, Bruneval, P, Lelievre-Pegorier, M (2008) Exposure to maternal diabetes induces salt-sensitive hypertension and impairs renal function in adult rat offspring. Diabetes. 57 (8) : 2167-2175.

Nehring, I, Chmitorz, A, Reulen, H, Von Kries, R, Ensenauer, R (2013) Gestational diabetes predicts the risk of childhood overweight and abdominal circumference independent of maternal obesity. Diabet Med. 30 (12) : 1449-1456.

Nielsen, CH, Larsen, A, Nielsen, AL (2014) DNA methylation alterations in response to prenatal exposure of maternal cigarette smoking: A persistent epigenetic impact on health from maternal lifestyle? Arch Toxicol.

Nielsen, DA, Utrankar, A, Reyes, JA, Simons, DD, Kosten, TR (2012) Epigenetics of drug abuse: predisposition or response. Pharmacogenomics. 13 (10) : 1149-1160.

Nilsson, E, Jansson, PA, Perfilyev, A, Volkov, P, Pedersen, M, Svensson, MK, Poulsen, P, Ribel-Madsen, R, Pedersen, NL, Almgren, P, Fadista, J, Ronn, T, Klarlund Pedersen, B, Scheele, C, Vaag, A, Ling, C (2014) Altered DNA methylation and differential expression of genes influencing metabolism and inflammation in adipose tissue from subjects with type 2 diabetes. Diabetes. 63 (9) : 2962-2976.

Noctor, E, Crowe, C, Carmody, LA, Kirwan, B, O'dea, A, Glynn, LG, Mcguire, BE, O'shea, PM, Dunne, FP (2014) ATLANTIC-DIP: prevalence of metabolic syndrome and insulin resistance in women with previous gestational diabetes mellitus by International Association of Diabetes in Pregnancy Study Groups criteria. Acta Diabetol.

Novakovic, B, Gordon, L, Wong, NC, Moffett, A, Manuelpillai, U, Craig, JM, Sharkey, A, Saffery, R (2011) Wide-ranging DNA methylation differences of primary trophoblast cell populations and derived cell lines: implications and opportunities for understanding trophoblast function. Mol Hum Reprod. 17 (6) : 344-353.

Novakovic, B, Saffery, R (2012) The ever growing complexity of placental epigenetics - role in adverse pregnancy outcomes and fetal programming. Placenta. 33 (12) : 959-970.

Novakovic, B, Ryan, J, Pereira, N, Boughton, B, Craig, JM, Saffery, R (2014) Postnatal stability, tissue, and time specific effects of AHRR methylation change in response to maternal smoking in pregnancy. Epigenetics. 9 (3) : 377-386.

333

Oberdoerffer, S (2012) A conserved role for intragenic DNA methylation in alternative pre- mRNA splicing. Transcription. 3 (3) : 106-109.

Obermann-Borst, SA, Eilers, PH, Tobi, EW, De Jong, FH, Slagboom, PE, Heijmans, BT, Steegers-Theunissen, RP (2013) Duration of breastfeeding and gender are associated with methylation of the LEPTIN gene in very young children. Pediatr Res. 74 (3) : 344-349.

Okano, M, Bell, DW, Haber, DA, Li, E (1999) DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell. 99 (3) : 247-257.

O'reilly, JR, Reynolds, RM (2013) The risk of maternal obesity to the long-term health of the offspring. Clin Endocrinol (Oxf). 78 (1) : 9-16.

O'reilly, MW, Avalos, G, Dennedy, MC, O'sullivan, EP, Dunne, F (2011) Atlantic DIP: high prevalence of abnormal glucose tolerance post partum is reduced by breast-feeding in women with prior gestational diabetes mellitus. Eur J Endocrinol. 165 (6) : 953-959.

Oriot, P, Selvais, P, Radikov, J, Jacobs, JL, Gilleman, U, Loumaye, R, Fernandez, C (2014) Assessing the incidence of gestational diabetes and neonatal outcomes using the IADPSG guidelines in comparison with the Carpenter and Coustan criteria in a Belgian general hospital. Acta Clin Belg. 69 (1) : 8-11.

Osmond, C, Barker, DJ, Winter, PD, Fall, CH, Simmonds, SJ (1993) Early growth and death from cardiovascular disease in women. BMJ. 307 (6918) : 1519-1524.

Ovesen, P, Jensen, D, Damm, P, Rasmussen, S, Kesmodel, U (2014) Maternal and neonatal outcomes in pregnancies complicated by gestational diabetes. A nation-wide study. J Matern Fetal Neonatal Med. 1-14.

Page, KA, Romero, A, Buchanan, TA, Xiang, AH (2014) Gestational diabetes mellitus, maternal obesity, and adiposity in offspring. J Pediatr. 164 (4) : 807-810.

Palinski, W (2009) Maternal-fetal cholesterol transport in the placenta: good, bad, and target for modulation. Circ Res. 104 (5) : 569-571.

Paneth, N, Susser, M (1995) Early origin of coronary heart disease (the "Barker hypothesis"). BMJ. 310 (6977) : 411-412.

Parets, SE, Conneely, KN, Kilaru, V, Fortunato, SJ, Syed, TA, Saade, G, Smith, AK, Menon, R (2013) Fetal DNA Methylation Associates with Early Spontaneous Preterm Birth and Gestational Age. PLoS One. 8 (6) : e67489.

Pasek, RC, Gannon, M (2013) Advancements and challenges in generating accurate animal models of gestational diabetes mellitus. Am J Physiol Endocrinol Metab. 305 (11) : E1327- 1338.

Patel, S, Fraser, A, Davey Smith, G, Lindsay, RS, Sattar, N, Nelson, SM, Lawlor, DA (2012) Associations of gestational diabetes, existing diabetes, and glycosuria with offspring obesity

334 and cardiometabolic outcomes. Diabetes Care. 35 (1): 63-71.

Pecks, U, Brieger, M, Schiessl, B, Bauerschlag, DO, Piroth, D, Bruno, B, Fitzner, C, Orlikowsky, T, Maass, N, Rath, W (2012) Maternal and fetal cord blood lipids in intrauterine growth restriction. J Perinat Med. 40 (3) : 287-296.

Pedersen, J (1954) Weight and length at birth of infants of diabetic mothers. Acta Endocrinol (Copenh). 16 (4) : 330-342.

Peng, P, Wang, L, Yang, X, Huang, X, Ba, Y, Chen, X, Guo, J, Lian, J, Zhou, J (2014) A preliminary study of the relationship between promoter methylation of the ABCG1, GALNT2 and HMGCR genes and coronary heart disease. PLoS One. 9 (8) : e102265.

Persson, Pb, Bondke Persson, A (2013) Obesity: the BIG issue. Acta Physiol (Oxf). 207 (1) : 1-4.

Peters, J (2014) The role of genomic imprinting in biology and disease: an expanding view. Nat Rev Genet. 15 (8) : 517-530.

Petropoulos, S, Guillemin, C, Ergaz, Z, Dimov, S, Suderman, M, Weinstein-Fudim, L, Ornoy, A, Szyf, M (2014) Gestational Diabetes Alters Offspring DNA Methylation Profiles in Human and Rat: Identification of Key Pathways involved in Endocrine System Disorders, Insulin Signaling, Diabetes Signaling and IL-K Signaling. Endocrinology. en20141643.

Pettitt, DJ, Mckenna, S, Mclaughlin, C, Patterson, CC, Hadden, DR, Mccance, DR (2010) Maternal glucose at 28 weeks of gestation is not associated with obesity in 2-year-old offspring: the Belfast Hyperglycemia and Adverse Pregnancy Outcome (HAPO) family study. Diabetes Care. 33 (6) : 1219-1223.

Pfeifferm, L, Wahl, S, Pilling, LC, Reischl, E, Sandling, JK, Kunze, S, Holdt, LM, Kretschmer, A, Schramm, K, Adamski, J, Klopp, N, Illig, T, Hedman, AK, Roden, M, Hernandez, DG, Singleton, AB, Thasler, WE, Grallert, H, Gieger, C, Herder, C, Teupser, D, Meisinger, C, Spector, TD, Kronenberg, F, Prokisch, H, Melzer, D, Peters, A, Deloukas, P, Ferrucci, L, Waldenberger, M (2015) DNA Methylation of Lipid-Related Genes Affects Blood Lipid Levels. Circ Cardiovasc Genet.

Phipps, K, Barker, DJ, Hales, CN, Fall, CH, Osmond, C, Clark, PM (1993) Fetal growth and impaired glucose tolerance in men and women. Diabetologia. 36 (3) : 225-228.

Piatek, MJ, Werner, A (2014) Endogenous siRNAs: regulators of internal affairs. Biochem Soc Trans. 42 (4) : 1174-1179.

Piccolo, FM, Fisher, AG (2014) Getting rid of DNA methylation. Trends Cell Biol. 24 (2) : 136-143.

Pirkola, J, Pouta, A, Bloigu, A, Miettola, S, Hartikainen, AL, Jarvelin, MR, Vaarasmaki, M (2010) Prepregnancy overweight and gestational diabetes as determinants of subsequent diabetes and hypertension after 20-year follow-up. J Clin Endocrinol Metab. 95 (2) : 772-

335

778.

Pisani, DF, Coldefy, AS, Elabd, C, Cabane, C, Salles, J, Le Cunff, M, Derijard, B, Amri, EZ, Dani, C, Leger, JJ, Dechesne, CA (2007) Involvement of BTBD1 in mesenchymal differentiation. Exp Cell Res. 313 (11) : 2417-2426.

Plagemann, A, Harder, T, Rake, A, Melchior, K, Rittel, F, Rohde, W,Dorner, G (1998) Hypothalamic insulin and neuropeptide Y in the offspring of gestational diabetic mother rats. Neuroreport. 9 (18) : 4069-4073.

Plagemann, A, Harder, T, Janert, U, Rake, A, Rittel, F, Rohde, W, Dorner, G (1999a) Malformations of hypothalamic nuclei in hyperinsulinemic offspring of rats with gestational diabetes. Dev Neurosci. 21 (1) : 58-67.

Plagemann, A, Harder, T, Melchior, K, Rake, A, Rohde, W, Dorner, G (1999b) Elevation of hypothalamic neuropeptide Y-neurons in adult offspring of diabetic mother rats. Neuroreport. 10 (15) : 3211-3216.

Plagemann, A, Harder, T, Brunn, M, Harder, A, Roepke, K, Wittrock-Staar, M, Ziska, T, Schellong, K, Rodekamp, E, Melchior, K, Dudenhausen, JW (2009) Hypothalamic proopiomelanocortin promoter methylation becomes altered by early overfeeding: an epigenetic model of obesity and the metabolic syndrome. J Physiol. 587 (Pt 20) : 4963-4976.

Plagemann, A, Harder, T, Schellong, K, Schulz, S,Stupin, JH (2012) Early postnatal life as a critical time window for determination of long-term metabolic health. Best Pract Res Clin Endocrinol Metab. 26 (5) : 641-653.

Poirier, P, Despres, JP (2003) Waist circumference, visceral obesity, and cardiovascular risk. J Cardiopulm Rehabil. 23 (3) : 161-169.

Poirier, P, Giles, TD, Bray, GA, Hong, Y, Stern, JS, Pi-Sunyer, FX, Eckel, RH (2006) Obesity and cardiovascular disease: pathophysiology, evaluation, and effect of weight loss: an update of the 1997 American Heart Association Scientific Statement on Obesity and Heart Disease from the Obesity Committee of the Council on Nutrition, Physical Activity, and Metabolism. Circulation. 113 (6) : 898-918.

Potter, C, Mckay, J, Groom, A, Ford, D, Coneyworth, L, Mathers, JC, Relton, CL (2013) Influence of DNMT genotype on global and site specific DNA methylation patterns in neonates and pregnant women. PLoS One. 8 (10) : e76506.

Poulos, SP, Hausman, DB, Hausman, GJ (2010) The development and endocrine functions of adipose tissue. Mol Cell Endocrinol. 323 (1) : 20-34.

Quilter, CR, Cooper, WN, Cliffe, KM, Skinner, BM, Prentice, PM, Nelson, L, Bauer, J, Ong, KK, Constancia, M, Lowe, WL, Affara, NA, Dunger, DB (2014) Impact on offspring methylation patterns of maternal gestational diabetes mellitus and intrauterine growth restraint suggest common genes and pathways linked to subsequent type 2 diabetes risk. FASEB J. 28 (11) : 4868-4879.

336

Quintero-Ronderos, P, Montoya-Ortiz, G (2012) Epigenetics and autoimmune diseases. Autoimmune Dis. 2012 : 593720.

Radaelli, T, Lepercq, J, Varastehpour, A, Basu, S, Catalano, PM, Hauguel-De Mouzon, S (2009) Differential regulation of genes for fetoplacental lipid pathways in pregnancy with gestational and type 1 diabetes mellitus. Am J Obstet Gynecol. 201 (2) : 209 e201-209 e210.

Rakyan, VK, Blewitt, ME, Druker, R, Preis, JI, Whitelaw, E (2002) Metastable epialleles in mammals. Trends Genet. 18 (7) : 348-351.

Ranadive, SA, Vaisse, C (2008) Lessons from extreme human obesity: monogenic disorders. Endocrinol Metab Clin North Am. 37 (3) : 733-751, x.

Ratner, RE, Christophi, CA, Metzger, BE, Dabelea, D, Bennett, PH, Pi-Sunyer, X, Fowler, S, Kahn, SE (2008) Prevention of diabetes in women with a history of gestational diabetes: effects of metformin and lifestyle interventions. J Clin Endocrinol Metab. 93 (12) : 4774- 4779.

Ravelli, AC, Van Der Meulen, JH, Michels, RP, Osmond, C, Barker, DJ, Hales, CN, Bleker, OP (1998) Glucose tolerance in adults after prenatal exposure to famine. Lancet. 351 (9097) : 173-177.

Ravelli, AC, Van Der Meulen, JH, Osmond, C, Barker, DJ, Bleker, OP (1999) Obesity at the age of 50 y in men and women exposed to famine prenatally. Am J Clin Nutr. 70 (5) : 811- 816.

Reik, W, Kelsey, G (2014) Epigenetics: Cellular memory erased in human embryos. Nature. 511 (7511) : 540-541.

Relton, CL, Groom, A, St Pourcain, B, Sayers, AE, Swan, DC, Embleton, ND, Pearce, MS, Ring, SM, Northstone, K, Tobias, JH, Trakalo, J, Ness, AR, Shaheen, SO, Davey Smith, G (2012) DNA methylation patterns in cord blood DNA and body size in childhood. PLoS One. 7 (3) : e31821.

Retnakaran, R, Ye, C, Hanley, A, Sermer, M, Connelly, P, Zinman, B, Hamilton, J (2013) Effect of maternal gestational diabetes on the cardiovascular risk factor profile of infants at 1 year of age. Nutr Metab Cardiovasc Dis. 23 (12) : 1175-1181.

Reynolds, RM, Jacobsen, GH, Drake, AJ (2013) What is the evidence in humans that DNA methylation changes link events in utero and later life disease? Clin Endocrinol (Oxf). 78 (6) : 814-822.

Riggs, AD (1975) X inactivation, differentiation, and DNA methylation. Cytogenet Cell Genet. 14 (1) : 9-25.

Rkhzay-Jaf, J, O'dowd, JF, Stocker, CJ (2012) Maternal Obesity and the Fetal Origins of the Metabolic Syndrome. Curr Cardiovasc Risk Rep. 6 (5): 487-495.

337

Robertson, KD (2005) DNA methylation and human disease. Nat Rev Genet. 6 (8) : 597-610.

Robson-Ansley, PJ, Saini, A, Toms, C, Ansley, L, Walshe, IH, Nimmo, MA, Curtin, JA (2014) Dynamic changes in dna methylation status in peripheral blood Mononuclear cells following an acute bout of exercise: Potential impact of exercise-induced elevations in interleukin-6 concentration. J Biol Regul Homeost Agents. 28 (3) : 407-417.

Roca-Rodriguez, MM, Lopez-Tinoco, C, Fernandez-Deudero, A, Murri, M, Garcia-Palacios, MV, Garcia-Valero, MA, Tinahones-Madueno, FJ, Aguilar-Diosdado, M (2012) Adipokines and metabolic syndrome risk factors in women with previous gestational diabetes mellitus. Diabetes Metab Res Rev. 28 (6) : 542-548.

Roessler, J, Ammerpohl, O, Gutwein, J, Hasemeier, B, Anwar, SL, Kreipe, H, Lehmann, U (2012) Quantitative cross-validation and content analysis of the 450k DNA methylation array from Illumina, Inc. BMC Res Notes. 5 : 210.

Romejko-Wolniewicz, E, Lewandowski, Z, Zareba-Szczudlik, J,Czajkowski, K (2014) BMI of the firstborn offspring at age 12 reflects maternal LDL and HDL cholesterol levels at term pregnancy and postpartum. J Matern Fetal Neonatal Med. 27 (9) : 914-920.

Ronn, T, Ling, C (2013) Effect of exercise on DNA methylation and metabolism in human adipose tissue and skeletal muscle. Epigenomics. 5 (6) : 603-605.

Ronn, T, Volkov, P, Davegardh, C, Dayeh, T, Hall, E, Olsson, AH, Nilsson, E, Tornberg, A, Dekker Nitert, M, Eriksson, KF, Jones, HA, Groop, L, Ling, C (2013) A six months exercise intervention influences the genome-wide DNA methylation pattern in human adipose tissue. PLoS Genet. 9 (6) : e1003572.

Roseboom, TJ, Van Der Meulen, JH, Osmond, C, Barker, DJ, Ravelli, AC, Bleker, OP (2000a) Plasma lipid profiles in adults after prenatal exposure to the Dutch famine. Am J Clin Nutr. 72 (5) : 1101-1106.

Roseboom, TJ, Van Der Meulen, JH, Osmond, C, Barker, DJ, Ravelli, AC, Schroeder-Tanka, JM, Van Montfrans, GA, Michels, RP, Bleker, OP (2000b) Coronary heart disease after prenatal exposure to the Dutch famine, 1944-45. Heart. 84 (6) : 595-598.

Roseboom, T, De Rooij, S, Painter, R (2006) The Dutch famine and its long-term consequences for adult health. Early Hum Dev. 82 (8) : 485-491.

Ruchat, SM, Mottola, MF (2013) The important role of physical activity in the prevention and management of gestational diabetes mellitus. Diabetes Metab Res Rev. 29 (5) : 334-346.

Ryan, EA, O'sullivan, MJ, Skyler, JS (1985) Insulin action during pregnancy. Studies with the euglycemic clamp technique. Diabetes. 34 (4) : 380-389.

Sacks, DA (2007) Etiology, detection, and management of fetal macrosomia in pregnancies complicated by diabetes mellitus. Clin Obstet Gynecol. 50 (4) : 980-989.

338

Saitou, M, Kagiwada, S, Kurimoto, K (2012) Epigenetic reprogramming in mouse preimplantation development and primordial germ cells. Development. 139 (1) : 15-31.

Sandovici, I, Hoelle, K, Angiolini, E, Constancia, M (2012) Placental adaptations to the maternal-fetal environment: implications for fetal growth and developmental programming. Reprod Biomed Online. 25 (1) : 68-89.

Santos, F, Hendrich, B, Reik, W, Dean, W (2002) Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev Biol. 241 (1) : 172-182.

Schnedl, WJ, Ferber, S, Johnson, JH, Newgard, CB (1994) STZ transport and cytotoxicity. Specific enhancement in GLUT2-expressing cells. Diabetes. 43 (11) : 1326-1333.

Schneider, E, Pliushch, G, El Hajj, N, Galetzka, D, Puhl, A, Schorsch, M, Frauenknecht, K, Riepert, T, Tresch, A, Muller, AM, Coerdt, W, Zechner, U, Haaf, T (2010) Spatial, temporal and interindividual epigenetic variation of functionally important DNA methylation patterns. Nucleic Acids Res. 38 (12) : 3880-3890.

Scholler, M, Wadsack, C, Lang, I, Etschmaier, K, Schweinzer, C, Marsche, G, Dieber- Rotheneder, M, Desoye, G, Panzenboeck, U (2012) Phospholipid transfer protein in the placental endothelium is affected by gestational diabetes mellitus. J Clin Endocrinol Metab. 97 (2) : 437-445.

Schultz, NS, Broholm, C, Gillberg, L, Mortensen, B, Jorgensen, SW, Schultz, HS, Scheele, C, Wojtaszewski, JF, Pedersen, BK, Vaag, A (2014) Impaired leptin gene expression and release in cultured preadipocytes isolated from individuals born with low birth weight. Diabetes. 63 (1) : 111-121.

Seisenberger, S, Peat, JR, Hore, TA, Santos, F, Dean, W, Reik, W (2013) Reprogramming DNA methylation in the mammalian life cycle: building and breaking epigenetic barriers. Philos Trans R Soc Lond B Biol Sci. 368 (1609) : 20110330.

Shah, BR, Retnakaran, R, Booth, GL (2008) Increased risk of cardiovascular disease in young women following gestational diabetes mellitus. Diabetes Care. 31 (8) : 1668-1669.

Shang, M, Lin, L (2014) IADPSG criteria for diagnosing gestational diabetes mellitus and predicting adverse pregnancy outcomes. J Perinatol. 34 (2) : 100-104.

Shang, M, Lin, L, Ma, L, Yin, L (2014) Investigation on the suitability of the International Association of Diabetes and Pregnancy Study Group diagnostic criteria for gestational diabetes mellitus in China. J Obstet Gynaecol. 34 (2) : 141-145.

Shao, J, Yamashita, H, Qiao, L, Draznin, B, Friedman, JE (2002) Phosphatidylinositol 3- kinase redistribution is associated with skeletal muscle insulin resistance in gestational diabetes mellitus. Diabetes. 51 (1) : 19-29.

Shao, WJ, Tao, LY, Gao, C, Xie, JY, Zhao, RQ (2008) Alterations in methylation and expression levels of imprinted genes H19 and Igf2 in the fetuses of diabetic mice. Comp

339

Med. 58 (4) : 341-346.

Sharma, P, Garg, G, Kumar, A, Mohammad, F, Kumar, SR, Tanwar, VS, Sati, S, Sharma, A, Karthikeyan, G, Brahmachari, V, Sengupta, S (2014) Genome wide DNA methylation profiling for epigenetic alteration in coronary artery disease patients. Gene. 541 (1) : 31-40.

Shields, M, Tjepkema, M (2006) Regional differences in obesity. Health Rep. 17 (3) : 61-67.

Shrey, K, Suchit, A, Nishant, M, Vibha, R (2009) RNA interference: emerging diagnostics and therapeutics tool. Biochem Biophys Res Commun. 386 (2) : 273-277.

Shukla, S, Kavak, E, Gregory, M, Imashimizu, M, Shutinoski, B, Kashlev, M, Oberdoerffer, P, Sandberg, R, Oberdoerffer, S (2011) CTCF-promoted RNA polymerase II pausing links DNA methylation to splicing. Nature. 479 (7371) : 74-79.

Singh, AS, Mulder, C, Twisk, JW, Van Mechelen, W, Chinapaw, MJ (2008) Tracking of childhood overweight into adulthood: a systematic review of the literature. Obes Rev. 9 (5) : 474-488.

Slieker, RC, Bos, SD, Goeman, JJ, Bovee, JV, Talens, RP, Van Der Breggen, R, Suchiman, HE, Lameijer, EW, Putter, H, Van Den Akker, EB, Zhang, Y, Jukema, JW, Slagboom, PE, Meulenbelt, I, Heijmans, BT (2013) Identification and systematic annotation of tissue- specific differentially methylated regions using the Illumina 450k array. Epigenetics Chromatin. 6 (1) : 26.

Smith, AK, Kilaru, V, Kocak, M, Almli, LM, Mercer, KB, Ressler, KJ, Tylavsky, FA, Conneely, KN (2014) Methylation quantitative trait loci (meQTLs) are consistently detected across ancestry, developmental stage, and tissue type. BMC Genomics. 15 : 145.

Smith, ZD, Chan, MM, Humm, KC, Karnik, R, Mekhoubad, S, Regev, A, Eggan, K, Meissner, A (2014) DNA methylation dynamics of the human preimplantation embryo. Nature. 511 (7511) : 611-615.

Soran, H, Hama, S, Yadav, R, Durrington, PN (2012) HDL functionality. Curr Opin Lipidol. 23 (4) : 353-366.

Soto, E, Bahado-Singh, R (2013) Fetal abnormal growth associated with substance abuse. Clin Obstet Gynecol. 56 (1) : 142-153.

Stefulj, J, Panzenboeck, U, Becker, T, Hirschmugl, B, Schweinzer, C, Lang, I, Marsche, G, Sadjak, A, Lang, U, Desoye, G, Wadsack, C (2009) Human endothelial cells of the placental barrier efficiently deliver cholesterol to the fetal circulation via ABCA1 and ABCG1. Circ Res. 104 (5) : 600-608.

Stenhouse, E, Wright, DE, Hattersley, AT, Millward, BA (2006) Maternal glucose levels influence birthweight and 'catch-up' and 'catch-down' growth in a large contemporary cohort. Diabet Med. 23 (11) : 1207-1212.

340

Stirzaker, C, Taberlay, PC, Statham, AL, Clark, SJ (2014) Mining cancer methylomes: prospects and challenges. Trends Genet. 30 (2) : 75-84.

St-Pierre, J, Hivert, MF, Perron, P, Poirier, P, Guay, SP, Brisson, D, Bouchard, L (2012) IGF2 DNA methylation is a modulator of newborn's fetal growth and development. Epigenetics. 7 (10) : 1125-1132.

Subramaniam, D, Thombre, R, Dhar, A, Anant, S (2014) DNA methyltransferases: a novel target for prevention and therapy. Front Oncol. 4 : 80.

Suderman, M, Borghol, N, Pappas, JJ, Pinto Pereira, SM, Pembrey, M, Hertzman, C, Power, C, Szyf, M (2014) Childhood abuse is associated with methylation of multiple loci in adult DNA. BMC Med Genomics. 7 : 13.

Sun, YV (2014) The Influences of Genetic and Environmental Factors on Methylome-wide Association Studies for Human Diseases. Curr Genet Med Rep. 2 (4) : 261-270.

Swinburn, BA, Sacks, G, Hall, KD, Mcpherson, K, Finegood, DT, Moodie, ML, Gortmaker, SL (2011) The global obesity pandemic: shaped by global drivers and local environments. Lancet. 378 (9793) : 804-814.

Symonds, ME, Mostyn, A, Pearce, S, Budge, H, Stephenson, T (2003) Endocrine and nutritional regulation of fetal adipose tissue development. J Endocrinol. 179 (3) : 293-299.

Szyf, M (2009) Epigenetics, DNA methylation, and chromatin modifying drugs. Annu Rev Pharmacol Toxicol. 49 : 243-263.

Talens, RP, Boomsma, DI, Tobi, EW, Kremer, D, Jukema, JW, Willemsen, G, Putter, H, Slagboom, PE, Heijmans, BT (2010) Variation, patterns, and temporal stability of DNA methylation: considerations for epigenetic epidemiology. FASEB J. 24 (9) : 3135-3144.

Talens, RP, Christensen, K, Putter, H, Willemsen, G, Christiansen, L, Kremer, D, Suchiman, HE, Slagboom, PE, Boomsma, DI, Heijmans, BT (2012) Epigenetic variation during the adult lifespan: cross-sectional and longitudinal data on monozygotic twin pairs. Aging Cell. 11 (4) : 694-703.

Tam, WH, Ma, RC, Yang, X, Ko, GT, Tong, PC, Cockram, CS, Sahota, DS, Rogers, MS, Chan, JC (2008) Glucose intolerance and cardiometabolic risk in children exposed to maternal gestational diabetes mellitus in utero. Pediatrics. 122 (6) : 1229-1234.

Tamashiro, KL, Moran, TH (2010) Perinatal environment and its influences on metabolic programming of offspring. Physiol Behav. 100 (5) : 560-566.

Tan, EK, Tan, EL (2013) Alterations in physiology and anatomy during pregnancy. Best Pract Res Clin Obstet Gynaecol. 27 (6) : 791-802.

Teh, AL, Pan, H, Chen, L, Ong, ML, Dogra, S, Wong, J, Macisaac, JL, Mah, SM, Mcewen, LM, Saw, SM, Godfrey, KM, Chong, YS, Kwek, K, Kwoh, CK, Soh, SE, Chong, MF,

341

Barton, S, Karnani, N, Cheong, CY, Buschdorf, JP, Stunkel, W, Kobor, MS, Meaney, MJ, Gluckman, PD, Holbrook, JD (2014) The effect of genotype and in utero environment on interindividual variation in neonate DNA methylomes. Genome Res. 24 (7) : 1064-1074.

Teschendorff, AE, West, J, Beck, S (2013) Age-associated epigenetic drift: implications, and a case of epigenetic thrift? Hum Mol Genet. 22 (R1): R7-R15.

Thamotharan, M, Mcknight, RA, Thamotharan, S, Kao, DJ, Devaskar, SU (2003) Aberrant insulin-induced GLUT4 translocation predicts glucose intolerance in the offspring of a diabetic mother. Am J Physiol Endocrinol Metab. 284 (5) : E901-914.

Thompson, D, Berger, H, Feig, D, Gagnon, R, Kader, T, Keely, E, Kozak, S, Ryan, E, Sermer, M,Vinokuroff, C (2013) Diabetes and pregnancy. Can J Diabetes. 37 Suppl 1 : S168- 183.

Thompson, RF, Atzmon, G, Gheorghe, C, Liang, HQ, Lowes, C, Greally, JM, Barzilai, N (2010) Tissue-specific dysregulation of DNA methylation in aging. Aging Cell. 9 (4) : 506- 518.

Tobi, EW, Lumey, LH, Talens, RP, Kremer, D, Putter, H, Stein, AD, Slagboom, PE, Heijmans, BT (2009) DNA methylation differences after exposure to prenatal famine are common and timing- and sex-specific. Hum Mol Genet. 18 (21) : 4046-4053.

Turan, N, Ghalwash, MF, Katari, S, Coutifaris, C, Obradovic, Z, Sapienza, C (2012) DNA methylation differences at growth related genes correlate with birth weight: a molecular signature linked to developmental origins of adult disease? BMC Med Genomics. 5 : 10.

Twells, LK, Gregory, DM, Reddigan, J, Midodzi, WK (2014) Current and predicted prevalence of obesity in Canada: a trend analysis. CMAJ Open. 2 (1) : E18-26.

Uchil, PD, Pawliczek, T, Reynolds, TD, Ding, S, Hinz, A, Munro, JB, Huang, F, Floyd, RW, Yang, H, Hamilton, WL, Bewersdorf, J, Xiong, Y, Calderwood, DA, Mothes, W (2014) TRIM15 is a focal adhesion protein that regulates focal adhesion disassembly. J Cell Sci. 127 (Pt 18) : 3928-3942.

Vaarasmaki, M, Pouta, A, Elliot, P, Tapanainen, P, Sovio, U, Ruokonen, A, Hartikainen, AL, Mccarthy, M, Jarvelin, MR (2009) Adolescent manifestations of metabolic syndrome among children born to women with gestational diabetes in a general-population birth cohort. Am J Epidemiol. 169 (10) : 1209-1215.

Valette, M, Bellisle, F, Carette, C, Poitou, C, Dubern, B, Paradis, G, Hercberg, S, Muzard, L, Clement, K, Czernichow, S (2013) Eating behaviour in obese patients with melanocortin- 4 receptor mutations: a literature review. Int J Obes (Lond). 37 (8) : 1027-1035.

Van Eijk, KR, De Jong, S, Boks, MP, Langeveld, T, Colas, F, Veldink, JH, De Kovel, CG, Janson, E, Strengman, E, Langfelder, P, Kahn, RS, Van Den Berg, LH, Horvath, S, Ophoff, RA (2012) Genetic analysis of DNA methylation and gene expression levels in whole blood of healthy human subjects. BMC Genomics. 13 : 636.

342 van Vliet-Ostaptchouk JV, Snieder H, Lagou V (2012) Gene-Lifestyle Interactions in Obesity. Current Nutrition Reports . 26 (1): 184-196.

Varley, KE, Gertz, J, Bowling, KM, Parker, SL, Reddy, TE, Pauli-Behn, F, Cross, MK, Williams, BA, Stamatoyannopoulos, JA, Crawford, GE, Absher, DM, Wold, BJ, Myers, RM (2013) Dynamic DNA methylation across diverse human cell lines and tissues. Genome Res. 23 (3) : 555-567.

Veenendaal, MV, Costello, PM, Lillycrop, KA, De Rooij, SR, Van Der Post, JA, Bossuyt, PM, Hanson, MA, Painter, RC, Roseboom, TJ (2012) Prenatal famine exposure, health in later life and promoter methylation of four candidate genes. J Dev Orig Health Dis. 3 (6) : 450-457.

Veeravalli, S, Omar, BA, Houseman, L, Hancock, M, Gonzalez Malagon, SG, Scott, F, Janmohamed, A, Phillips, IR, Shephard, EA (2014) The phenotype of a flavin-containing monooyxgenase knockout mouse implicates the drug-metabolizing enzyme FMO1 as a novel regulator of energy balance. Biochem Pharmacol. 90 (1) : 88-95.

Verma, A, Boney, CM, Tucker, R, Vohr, BR (2002) Insulin resistance syndrome in women with prior history of gestational diabetes mellitus. J Clin Endocrinol Metab. 87 (7) : 3227- 3235.

Vickers, MH, Gluckman, PD, Coveny, AH, Hofman, PL, Cutfield, WS, Gertler, A, Breier, BH, Harris, M (2005) Neonatal leptin treatment reverses developmental programming. Endocrinology. 146 (10) : 4211-4216.

Vidal, AC, Murphy, SK, Murtha, AP, Schildkraut, JM, Soubry, A, Huang, Z, Neelon, SE, Fuemmeler, B, Iversen, E, Wang, F, Kurtzberg, J, Jirtle, RL, Hoyo, C (2013) Associations between antibiotic exposure during pregnancy, birth weight and aberrant methylation at imprinted genes among offspring. Int J Obes (Lond). 37 (7) : 907-913.

Voisin, S, Almen, MS, Moschonis, G, Chrousos, GP, Manios, Y, Schioth, HB (2014a) Dietary fat quality impacts genome-wide DNA methylation patterns in a cross-sectional study of Greek preadolescents. Eur J Hum Genet.

Voisin, S, Eynon, N, Yan, X, Bishop, DJ (2014b) Exercise training and DNA methylation in humans. Acta Physiol (Oxf).

Waalen, J (2014) The genetics of human obesity. Transl Res.

Wang, D, Liu, X, Zhou, Y, Xie, H, Hong, X, Tsai, HJ, Wang, G, Liu, R, Wang, X (2012) Individual variation and longitudinal pattern of genome-wide DNA methylation from birth to the first two years of life. Epigenetics. 7 (6) : 594-605.

Wang, H, Eckel, RH (2009) Lipoprotein lipase: from gene to obesity. Am J Physiol Endocrinol Metab. 297 (2) : E271-288.

Watanabe, T, Lin, H (2014) Posttranscriptional Regulation of Gene Expression by Piwi

343

Proteins and piRNAs. Mol Cell. 56 (1) : 18-27.

Waterland, RA, Jirtle, RL (2003) Transposable elements: targets for early nutritional effects on epigenetic gene regulation. Mol Cell Biol. 23 (15) : 5293-5300.

Whayne, TF (2014) Epigenetics in the development, modification, and prevention of cardiovascular disease. Mol Biol Rep.

Whincup, PH, Kaye, SJ, Owen, CG, Huxley, R, Cook, DG, Anazawa, S, Barrett-Connor, E, Bhargava, SK, Birgisdottir, BE, Carlsson, S, De Rooij, SR, Dyck, RF, Eriksson, JG, Falkner, B, Fall, C, Forsen, T, Grill, V, Gudnason, V, Hulman, S, Hypponen, E, Jeffreys, M, Lawlor, DA, Leon, DA, Minami, J, Mishra, G, Osmond, C, Power, C, Rich-Edwards, JW, Roseboom, TJ, Sachdev, HS, Syddall, H, Thorsdottir, I, Vanhala, M, Wadsworth, M, Yarbrough, DE (2008) Birth weight and risk of type 2 diabetes: a systematic review. JAMA. 300 (24) : 2886- 2897.

Whitley, P, Gibbard, AM, Koumanov, F, Oldfield, S, Kilgour, EE, Prestwich, GD, Holman, GD (2002) Identification of centaurin-alpha2: a phosphatidylinositide-binding protein present in fat, heart and skeletal muscle. Eur J Cell Biol. 81 (4) : 222-230.

WHO (1999) World Health Organization. Definition, Diagnosis and Classification of Diabetes Mellitus and its Complications. Part 1: Diagnosis and Classification of Diabetes Mellitus. WHO/NCD/NCS/99.2 ed. Geneva: World Health Organization .

WHO (2000) Obesity: preventing and managing the global epidemic. Report of a WHO consultation. World Health Organ Tech Rep Ser. 894 : i-xii, 1-253.

WHO (2006) Towards the Development of a Strategy for Promoting Optimal Fetal Development. Report of a WHO consultation: viii, 1-38.

Wilhelm-Benartzi, CS, Houseman, EA, Maccani, MA, Poage, GM, Koestler, DC, Langevin, SM, Gagne, LA, Banister, CE, Padbury, JF, Marsit, CJ (2012) In utero exposures, infant growth, and DNA methylation of repetitive elements and developmentally related genes in human placenta. Environ Health Perspect. 120 (2) : 296-302.

Wolff, GL, Kodell, RL, Moore, SR, Cooney, CA (1998) Maternal epigenetics and methyl supplements affect agouti gene expression in Avy/a mice. FASEB J. 12 (11) : 949-957.

Wright, CS, Rifas-Shiman, SL, Rich-Edwards, JW, Taveras, EM, Gillman, MW, Oken, E (2009) Intrauterine exposure to gestational diabetes, child adiposity, and blood pressure. Am J Hypertens. 22 (2) : 215-220.

Xu, Y, Shen, S, Sun, L, Yang, H, Jin, B, Cao, X (2014) Metabolic syndrome risk after gestational diabetes: a systematic review and meta-analysis. PLoS One. 9 (1) : e87863.

Yan, J, Li, X, Su, R, Zhang, K, Yang, H (2014) Long-term effects of maternal diabetes on blood pressure and renal function in rat male offspring. PLoS One. 9 (2) : e88269.

344

Yang, BT, Dayeh, TA, Volkov, PA, Kirkpatrick, CL, Malmgren, S, Jing, X, Renstrom, E, Wollheim, CB, Nitert, MD, Ling, C (2012) Increased DNA methylation and decreased expression of PDX-1 in pancreatic islets from patients with type 2 diabetes. Mol Endocrinol. 26 (7) : 1203-1212.

Yang, TC, Chen, YJ, Chang, SF, Chen, CH, Chang, PY, Lu, SC (2014) Malondialdehyde mediates oxidized LDL-induced coronary toxicity through the Akt-FGF2 pathway via DNA methylation. J Biomed Sci. 21 : 11.

Yang, W, Kelly, T, He, J (2007) Genetic epidemiology of obesity. Epidemiol Rev. 29 : 49- 61.

Yeung, BH, Law, AY, Wong, CK (2012) Evolution and roles of stanniocalcin. Mol Cell Endocrinol. 349 (2) : 272-280.

Yuan, W, Xia, Y, Bell, CG, Yet, I, Ferreira, T, Ward, KJ, Gao, F, Loomis, AK, Hyde, CL, Wu, H, Lu, H, Liu, Y, Small, KS, Vinuela, A, Morris, AP, Berdasco, M, Esteller, M, Brosnan, MJ, Deloukas, P, Mccarthy, MI, John, SL, Bell, JT, Wang, J, Spector, TD (2014) An integrated epigenomic analysis for type 2 diabetes susceptibility loci in monozygotic twins. Nat Commun. 5 : 5719.

Zavalza-Gomez, AB, Anaya-Prado, R, Rincon-Sanchez, AR, Mora-Martinez, JM (2008) Adipokines and insulin resistance during pregnancy. Diabetes Res Clin Pract. 80 (1) : 8-15.

Zeilinger, S, Kuhnel, B, Klopp, N, Baurecht, H, Kleinschmidt, A, Gieger, C, Weidinger, S, Lattka, E, Adamski, J, Peters, A, Strauch, K, Waldenberger, M, Illig, T (2013) Tobacco smoking leads to extensive genome-wide changes in DNA methylation. PLoS One. 8 (5) : e63812.

Zhang, K, Shi, ZM, Chang, YN, Hu, ZM, Qi, HX, Hong, W (2014) The ways of action of long non-coding RNAs in cytoplasm and nucleus. Gene. 547 (1) : 1-9.

Zhang, Q, Liu, X, Gao, W, Li, P, Hou, J, Li, J, Wong, J (2014) Differential regulation of the ten-eleven translocation (TET) family of dioxygenases by O-linked beta-N- acetylglucosamine transferase (OGT). J Biol Chem. 289 (9) : 5986-5996.

Zhang, Y, Kent, JW, 2nd, Lee, A, Cerjak, D, Ali, O, Diasio, R, Olivier, M, Blangero, J, Carless, MA, Kissebah, AH (2013) Fatty acid binding protein 3 (fabp3) is associated with insulin, lipids and cardiovascular phenotypes of the metabolic syndrome through epigenetic modifications in a Northern European family population. BMC Med Genomics. 6 : 9.

Zou, J, Lippert, C, Heckerman, D, Aryee, M, Listgarten, J (2014) Epigenome-wide association studies without the need for cell-type composition. Nat Methods. 11 (3) : 309- 311.

345

ANNEXE 1

Top differentially methylated genes in placenta and cord blood ( p<0.001) exposed or not to gestational diabetes mellitus. PLACENTA GDM NGT GENE SYMBOLE ID PROBE # PROBE MEAN SD MEAN SD MEAN DIFF. P-VALUE ADAP1 cg05085844 0,485 0,126 0,338 0,073 0,147 8,37E-05 ADAT3 cg20243900 0,869 0,019 0,885 0,040 0,016 5,67E-04 AIRE cg26472802 0,340 0,120 0,497 0,138 0,156 9,64E-04 ARHGEF10L cg07233343 0,681 0,082 0,764 0,047 0,082 9,64E-04 ASTN1 cg23492043 0,285 0,113 0,434 0,105 0,149 2,02E-04 ATP11A cg17015340 0,870 0,032 0,893 0,010 0,023 2,88E-04 ATXN1 cg04699519 0,444 0,065 0,527 0,051 0,083 1,79E-04 B4GALNT4 cg05431163 0,268 0,115 0,393 0,108 0,125 6,32E-04 BACE2 cg04954795 0,601 0,046 0,541 0,082 0,059 3,63E-04 BACH2 cg18477569 0,683 0,034 0,723 0,026 0,041 9,53E-05 BUB3 cg23423227 0,293 0,039 0,335 0,026 0,043 9,64E-04 C1orf94 cg13329248 0,403 0,098 0,513 0,077 0,109 4,54E-04 C2orf64 cg13293296 0,899 0,031 0,935 0,021 0,036 2,99E-04 CA3 cg12264626 2 0,378 0,080 0,454 0,049 0,076 5,08E-04 CD248 cg11067179 0,615 0,086 0,513 0,071 0,102 9,64E-04 CDH2 cg15698842 0,216 0,100 0,344 0,099 0,128 5,08E-04 CTPS cg09801607 0,571 0,028 0,606 0,031 0,035 8,69E-04 DBX1 cg02878244 0,355 0,167 0,529 0,112 0,174 7,03E-04 DPP10 cg11731746 0,689 0,082 0,777 0,063 0,088 4,54E-04 DPP6 cg03472695 0,513 0,072 0,643 0,062 0,130 1,01E-06 FLJ42709 cg14047844 2 0,205 0,134 0,363 0,123 0,158 5,67E-04 FMO1 cg02456238 0,816 0,039 0,860 0,028 0,044 2,79E-05 GABBR2 cg14633800 0,669 0,099 0,569 0,098 0,100 9,64E-04 GALNTL6 cg25281820 0,393 0,095 0,286 0,055 0,107 9,53E-05 GBP4 cg27285720 0,719 0,035 0,758 0,024 0,039 1,08E-04 GJD4 cg14187335 0,121 0,061 0,202 0,069 0,081 2,88E-04 GLT1D1 cg22740141 0,140 0,072 0,222 0,055 0,082 1,79E-04 GP6 cg19589161 0,810 0,083 0,879 0,038 0,069 3,23E-04 GRM1 cg19645248 0,558 0,174 0,735 0,089 0,177 8,69E-04 HOXD9 cg08363794 0,543 0,086 0,647 0,076 0,104 3,23E-04 HTR1A cg15092168 0,313 0,127 0,462 0,103 0,148 3,23E-04 IGF1R cg23681489 6 0,179 0,139 0,359 0,109 0,180 1,23E-04 KCNE1 cg09258032 0,722 0,067 0,795 0,051 0,073 7,82E-04 KIAA0556 cg27636914 0,744 0,030 0,777 0,019 0,032 9,53E-05 KRTAP10-1 cg12307092 0,413 0,054 0,481 0,051 0,068 8,69E-04

346

LACRT cg10125195 0,589 0,054 0,520 0,068 0,069 8,69E-04 LBXCOR1 cg11601252 0,110 0,079 0,170 0,068 0,060 9,64E-04 LOC200726 cg20841047 0,144 0,035 0,188 0,042 0,044 7,82E-04 MICA cg03990811 2 0,273 0,110 0,403 0,073 0,130 1,08E-04 MUC5B cg26490626 0,616 0,046 0,678 0,072 0,062 7,82E-04 NCRNA00162 cg12025048 0,565 0,096 0,667 0,077 0,102 2,02E-04 NFATC1 cg03511628 0,535 0,165 0,665 0,151 0,130 3,63E-04 NPR3 cg14311471 0,179 0,103 0,289 0,081 0,110 4,83E-04 NXPH1 cg06335867 0,409 0,158 0,595 0,139 0,186 7,82E-04 OLIG1 cg21569006 2 0,269 0,075 0,377 0,088 0,108 2,56E-04 ONECUT2 cg06067372 0,128 0,072 0,208 0,059 0,080 6,32E-04 OR2G2 cg17903359 0,322 0,096 0,455 0,122 0,133 8,69E-04 OR5A1 cg15392147 0,229 0,144 0,447 0,206 0,218 2,27E-04 P2RX4 cg16599007 0,687 0,086 0,767 0,051 0,080 9,64E-04 PCDH8 cg10484958 0,406 0,126 0,548 0,075 0,141 1,23E-04 PCDHB6 cg07519638 0,436 0,052 0,511 0,067 0,075 4,54E-04 PCDHGA4 cg06428620 2 0,177 0,067 0,282 0,129 0,105 1,40E-04 PDE6G cg16592596 0,764 0,045 0,807 0,033 0,043 7,03E-04 PENK cg11060276 0,143 0,057 0,207 0,063 0,065 9,64E-04 POU3F1 cg18451114 0,103 0,074 0,181 0,074 0,078 7,82E-04 POU4F3 cg04701505 0,244 0,106 0,386 0,123 0,143 3,63E-04 PRDM16 cg04493316 0,483 0,100 0,595 0,087 0,112 5,67E-04 PRKAR1B cg14835981 2 0,847 0,031 0,882 0,026 0,035 1,40E-04 PTK2B cg25881049 0,592 0,071 0,664 0,060 0,073 6,32E-04 PTPRA cg01608477 0,832 0,043 0,872 0,029 0,040 8,69E-04 PTPRN2 cg08490529 2 0,665 0,118 0,784 0,063 0,120 2,88E-04 SAMD9 cg16554153 0,696 0,181 0,840 0,026 0,143 6,32E-04 SATB2 cg17204275 0,116 0,055 0,193 0,073 0,077 2,27E-04 SDK1 cg21582785 0,523 0,072 0,589 0,039 0,067 8,69E-04 SLC11A1 cg03291396 0,074 0,015 0,112 0,069 0,038 6,32E-04 SLC47A1 cg17332016 0,101 0,047 0,179 0,092 0,078 9,64E-04 SLC6A18 cg24585559 0,325 0,054 0,400 0,070 0,075 7,82E-04 SLC6A5 cg26213155 0,722 0,165 0,861 0,087 0,139 4,54E-04 SMPD1 cg24682012 0,295 0,038 0,337 0,033 0,042 9,64E-04 SPATA18 cg10574494 0,455 0,036 0,482 0,025 0,027 4,06E-04 TBX5 cg23827572 0,443 0,155 0,643 0,112 0,201 2,27E-04 TMEM132C cg03414202 0,553 0,129 0,700 0,086 0,147 2,88E-04 TMEM51 cg09249173 0,848 0,050 0,894 0,027 0,046 4,54E-04 TOX2 cg16970323 0,227 0,043 0,338 0,069 0,111 1,61E-06 TRPM5 cg22081905 0,435 0,077 0,347 0,070 0,088 3,63E-04 VIPR1 cg10970409 0,150 0,035 0,206 0,038 0,056 7,34E-05

347

VPREB1 cg01891260 0,329 0,062 0,257 0,065 0,072 7,03E-04 ZIC5 cg10679688 0,225 0,089 0,351 0,075 0,125 9,53E-05 Mean 0,450 0,081 0,525 0,070 0,075 Mean diff. 0,075 SD 0,046

CORD BLOOD GDM NGT GENE SYMBOLE ID PROBE # PROBE MEAN SD MEAN SD MEAN DIFF. P-VALUE ADAP1 cg05085844 0,801 0,056 0,740 0,040 0,061 8,60E-04 ANO1 cg06673840 0,683 0,042 0,768 0,079 0,085 4,20E-04 ARID1B cg02662417 0,719 0,097 0,603 0,078 0,116 8,50E-04 BDKRB2 cg24010952 0,384 0,038 0,343 0,027 0,041 6,70E-04 BTBD1 cg01695279 0,487 0,035 0,540 0,036 0,053 1,20E-04 CHP2 cg01062539 0,871 0,040 0,811 0,048 0,060 2,40E-04 CYP2E1 cg19837601 0,736 0,048 0,789 0,036 0,053 8,50E-04 E2F5 cg14145632 0,606 0,047 0,656 0,038 0,050 7,60E-04 ETV6 cg06225767 0,540 0,032 0,582 0,032 0,042 2,80E-04 FLJ43860 cg16670021 0,746 0,037 0,782 0,024 0,036 7,60E-04 FMN2 cg13966628 0,330 0,035 0,367 0,025 0,037 5,20E-04 FOXK1 cg23587176 0,534 0,052 0,477 0,036 0,057 4,10E-04 FTH1 cg09367425 0,383 0,039 0,433 0,037 0,050 5,20E-04 GABBR1 cg12292060 0,412 0,030 0,447 0,040 0,035 8,60E-04 GDPD1 cg06071746 0,529 0,025 0,563 0,036 0,034 6,70E-04 GPR133 cg21726551 0,580 0,034 0,614 0,026 0,034 3,20E-04 KHDC1 cg01394339 0,676 0,055 0,735 0,024 0,059 1,80E-04 KIAA1688 cg02340818 0,721 0,037 0,767 0,029 0,046 5,90E-04 KLF6 cg25749254 0,616 0,023 0,645 0,030 0,029 6,70E-04 LASP1 cg05766251 0,287 0,030 0,250 0,032 0,037 8,50E-04 LEF1 cg12271317 0,775 0,034 0,809 0,026 0,034 7,60E-04 LOC285830 cg16289618 0,350 0,043 0,302 0,035 0,048 8,50E-04 MIER1 cg15930380 0,530 0,041 0,575 0,025 0,045 5,40E-04 MYH7B cg11092487 2 0,498 0,040 0,445 0,031 0,053 1,80E-04 NBEAL2 cg02670466 0,766 0,035 0,800 0,025 0,034 7,60E-04 NCOR2 cg11132120 0,935 0,018 0,728 0,366 0,207 2,20E-04 NR4A2 cg03339537 0,248 0,031 0,214 0,020 0,034 6,70E-04 OR2B11 cg14830002 2 0,381 0,057 0,310 0,036 0,071 2,40E-04 PCCA cg10117603 0,868 0,031 0,901 0,020 0,033 9,00E-04 PCDHB2 cg24448113 0,446 0,032 0,484 0,036 0,038 5,90E-04 PIK3CG cg00661777 0,576 0,041 0,630 0,042 0,054 6,70E-04 PLD6 cg11713493 0,621 0,025 0,661 0,032 0,040 7,40E-04

348

PPM1M cg08438690 0,404 0,048 0,461 0,026 0,057 4,90E-04 PPP2R2C cg02766173 0,266 0,036 0,231 0,022 0,035 6,00E-04 PRKCZ cg24578937 0,313 0,053 0,249 0,045 0,064 2,10E-04 PTP4A3 cg04480665 0,808 0,035 0,851 0,028 0,043 8,10E-04 RASA3 cg24113818 0,647 0,068 0,738 0,064 0,091 5,20E-04 RPS6KB2 cg17375396 0,445 0,039 0,492 0,041 0,047 8,10E-04 SH3BP4 cg13530377 0,690 0,028 0,724 0,031 0,034 5,20E-04 SLC12A6 cg18464823 0,465 0,031 0,504 0,029 0,039 9,00E-04 SLC37A1 cg13265003 0,513 0,036 0,471 0,029 0,042 6,70E-04 SLC6A1 cg19877765 0,267 0,031 0,320 0,051 0,053 2,40E-04 SNORA54 cg13059136 2 0,591 0,054 0,521 0,041 0,070 2,60E-04 SORL1 cg22327175 0,283 0,033 0,249 0,019 0,034 4,60E-04 SP6 cg23643375 0,563 0,052 0,487 0,090 0,076 9,60E-04 SPATA21 cg16384864 0,535 0,042 0,579 0,028 0,044 9,60E-04 SPTLC2 cg18872420 0,719 0,157 0,571 0,155 0,148 9,60E-04 STC2 cg01984743 2 0,532 0,037 0,606 0,053 0,074 1,00E-05 TECPR1 cg23184226 0,594 0,047 0,638 0,028 0,044 8,10E-04 TMEM63C cg22824376 0,079 0,017 0,117 0,078 0,038 4,60E-04 TRIB1 cg06992846 0,550 0,034 0,603 0,025 0,053 2,00E-05 TRIM15 cg03261948 0,750 0,030 0,793 0,036 0,043 1,60E-04 ZBTB32 cg03068068 0,637 0,032 0,676 0,028 0,039 2,10E-04 ZCCHC14 cg10375267 0,606 0,040 0,647 0,032 0,041 8,50E-04 Mean 0,554 0,041 0,561 0,045 0,054 Mean diff. 0,053 SD 0,030 *For genes having more than one probe differentially methylated at p<0.001, the most significant result is presented

349

ANNEXE 2

Most promising genes that were differentially methylated between placenta and cord blood samples exposed or not to GDM ( p<0.05) and correlated with newborn weight (p<0.01).

PLACENTA Gene Pearson correlation coefficient a p-value # probes ACER2 0,4732 0,0016 ADRB3 0,4152 0,0062 ANK3 0,4129 0,0066 ATP11A 0,4360 0,0039 ATXN1 0,4388 0,0037 2 BHLHE22 0,4667 0,0018 C10orf96 -0,4156 0,0062 C7orf50 -0,4587 0,0022 CACNA1D 0,4474 0,0030 CAMTA1 0,4945 0,0009 2 CBFA2T3 0,4801 0,0013 CHRM2 0,4100 0,0070 COL11A2 0,4392 0,0036 CPNE4 0,4104 0,0069 CRMP1 0,3947 0,0097 1 CSMD1 -0,4459 0,0031 DAAM2 0,3979 0,0091 DEGS1 0,4734 0,0015 EBF1 -0,4046 0,0079 ELFN2 0,4505 0,0028 ENPP7 0,4231 0,0052 FCHO1 0,4071 0,0075 GALNT9 0,4389 0,0036 2 GLT6D1 0,4276 0,0047 GNAL 0,4116 0,0068 GNASAS 0,5937 <0.0001 5

350

GPT 0,4459 0,0031 GRID1 0,4721 0,0016 GRIN3A 0,4161 0,0061 HLA-B 0,4464 0,0030 HOXD4 0,4554 0,0024 IQCG 0,4726 0,0016 JMJD7-PLA2G4B 0,4605 0,0022 KCNQ1DN 0,4117 0,0067 KCNT1 0,4072 0,0074 2 KIRREL3 0,4838 0,0012 MIR124-1 0,3973 0,0092 MORN1 0,4650 0,0019 MSX1 0,4146 0,0063 NFASC 0,4874 0,0011 NMNAT3 0,3940 0,0098 NTM 0,4806 0,0013 2 NXNL1 0,4134 0,0065 2 OCA2 0,3951 0,0096 PCDH8 0,4271 0,0048 3 PCDHGA4 0,4230 0,0053 PIWIL1 0,4134 0,0065 PLCH2 0,4320 0,0043 PSMB9 0,4304 0,0044 SEPT 9 -0,4627 0,0020 SGK269 0,4133 0,0065 SLAMF7 0,4741 0,0015 SLC17A3 0,4446 0,0032 SLC9A3 0,4951 0,0009 SNORD58A 0,4344 0,0040 TMEM121 0,4091 0,0071 TPO 0,4062 0,0076

351

TSNARE1 0,4123 0,0067 VSTM2B 0,5113 0,0005 ZNF287 0,4180 0,0059 ZNF767 -0,4144 0,0064 aAdjusted for gestational age and gender

CORD BLOOD Gene Pearson correlation coefficient a p-value # probes ANKFN1 -0,4727 0,0027 CTSZ -0,4206 0,0085 GOSR2 -0,4899 0,0018 ITSN2 -0,4723 0,0028 JAZF1 -0,5205 0,0008 LOC643719 0,4325 0,0067 NCOR2 -0,4449 0,0051 NIPAL3 0,4288 0,0072 S100A13 -0,4441 0,0052 2 SNAP23 0,4361 0,0062 STK24 0,4946 0,0016 TBCC 0,4309 0,0069 TTC7B -0,4852 0,0020 aAdjusted for gestational age and gender

352

ANNEXE 3

Performance of bisulfite conversion in placenta (A-B) and cord blood (C-D).

A B

C D

Notes : Performance of positive bisulfite conversion was monitored in the green channel and shown a raw intensity superior to 10,000, and negative controls was monitored in red channel and show a raw intensity inferior to 1000. Four samples were excluded from the cord blood group because of an aberrant bisulfite conversion control, suggesting specific problems with these samples. These samples were excluded from the analyses to avoid misinterpretation.

353

ANNEXE 4

Validation of 19 CpG sites using bisulfite DNA pyrosequencing.

Assays #CpC n Correlation coefficiant (r )* P-value PLACENTA IGF1R_CpGI1 cg23681489 44 0,91 <0.001 IGF1R_CpGI2 cg01224063 44 0,90 <0.001 IGF1R_CpGI3 cg08138544 44 0,87 <0.001 IGF1R_CpGI4 cg06889746 44 0,94 <0.001 IGF1R_CpGI5 cg04385934 44 0,88 <0.001 BTC_CpGI1 cg01280202 41 0,97 <0.001 BTC_CpGI2 cg02546173 44 0,87 <0.001 BTC_CpGI3 cg20122727 43 0,91 <0.001 BTC_CpGI4 cg26298281 42 0,95 <0.001 BTC_CpGI5 cg09346617 44 0,94 <0.001 ONECUT1_CpGI1 cg19611809 43 0,72 <0.001 ONECUT1_CpGI2 cg13877670 44 0,91 <0.001 IGFBP3_CpGI1 cg26434048 44 0,79 <0.001 LPL_CpG1 cg1612591 44 0,84 <0.001 LPL_CpG2 cg08918749 44 0,85 <0.001 LPL_CpG3 cg16420199 43 0,79 <0.001 0,88 CORD BLOOD BDKRB2_CpGI1 cg13515881 38 0,90 <0.001 BDKRB2_CpGI2 cg18424965 38 0,86 <0.001 ARNTL_CpGI1 cg13286116 35 0,94 <0.001 0,90

* Correlation between DNA methylation levels obtained using the HumanMethylation450 BeadChip array and bisulfite DNA pyrosequencing.

354

ANNEXE 5

115 common genes differentially methylated genes in placenta and cord blood exposed or not to gestational diabetes mellitus (GDM) and associated with metabolis diseases pathway in the E-21 birth cohort.

PLACENTA CORD BLOOD NGT GDM NGT GDM Genes* PROBE ID # PROBE MEAN SD MEAN SD P-value PROBE ID # PROBE MEAN SD MEAN SD P-value A2BP1 cg27256528 3 0,220 0,093 0,165 0,092 0,018 cg03623568 4 0,837 0,024 0,801 0,052 0,012 ABCC8 cg15683950 2 0,476 0,125 0,367 0,139 0,023 cg13185308 1 0,373 0,035 0,397 0,036 0,042 ALPL cg06346857 1 0,407 0,066 0,461 0,084 0,032 cg12466599 1 0,774 0,026 0,755 0,03 0,041 APOM cg06241300 3 0,530 0,039 0,573 0,054 0,012 cg04528801 2 0,861 0,037 0,831 0,032 0,011 ATF6 cg19735514 1 0,570 0,078 0,532 0,059 0,021 cg19735514 1 0,754 0,048 0,73 0,035 0,041 ATP10A cg16395892 3 0,881 0,045 0,838 0,061 0,004 cg07986058 1 0,647 0,034 0,614 0,042 0,022 B2M cg18555073 1 0,360 0,038 0,335 0,035 0,034 cg18696027 2 0,181 0,027 0,21 0,038 0,021 BACH2 cg18477569 4 0,723 0,026 0,683 0,034 0,000 cg19039673 1 0,468 0,034 0,439 0,039 0,045 BRD2 cg08491668 3 0,500 0,037 0,461 0,051 0,009 cg11439393 7 0,267 0,016 0,239 0,032 0,004 C6orf10 cg09452510 2 0,838 0,077 0,881 0,036 0,018 cg21750915 3 0,873 0,03 0,849 0,027 0,009 CA5A cg10323962 1 0,822 0,019 0,805 0,031 0,042 cg02435043 1 0,85 0,027 0,83 0,03 0,032 CACNA1C cg03731464 3 0,178 0,098 0,113 0,033 0,013 cg03626208 3 0,368 0,041 0,406 0,046 0,026 CACNA1D cg10409919 4 0,431 0,077 0,348 0,086 0,005 cg13414750 1 0,802 0,038 0,761 0,038 0,006 CACNA1E cg12040203 3 0,874 0,036 0,819 0,066 0,003 cg16241391 1 0,78 0,033 0,756 0,031 0,042 CAMTA1 cg20434152 6 0,509 0,145 0,362 0,164 0,009 cg26669159 1 0,379 0,03 0,357 0,032 0,050 CCDC101 cg05302211 1 0,347 0,033 0,317 0,053 0,021 cg07866632 1 0,269 0,03 0,294 0,03 0,023 CCK cg18789547 3 0,251 0,049 0,222 0,041 0,026 cg18789547 1 0,46 0,031 0,435 0,039 0,045 CDK4 cg03829839 1 0,313 0,058 0,265 0,078 0,023 cg19542346 1 0,452 0,028 0,427 0,031 0,023 CDKN1A cg15474579 2 0,805 0,032 0,785 0,035 0,034 cg18900812 1 0,344 0,037 0,316 0,03 0,030 CHI3L1 cg14165900 1 0,729 0,034 0,750 0,040 0,044 cg02097014 5 0,211 0,02 0,245 0,03 0,002 CHRM2 cg24845274 7 0,182 0,068 0,112 0,070 0,004 cg04748704 1 0,173 0,031 0,151 0,03 0,050

355

CIITA cg04999945 2 0,341 0,064 0,299 0,060 0,014 cg04945379 1 0,817 0,029 0,783 0,031 0,003 CNR1 cg01767599 1 0,865 0,038 0,879 0,060 0,047 cg20510988 1 0,698 0,039 0,67 0,04 0,025 CNTNAP2 cg05422683 1 0,204 0,089 0,131 0,050 0,004 cg03892601 1 0,249 0,04 0,281 0,044 0,034 COL11A2 cg00324223 10 0,473 0,085 0,387 0,082 0,003 cg09261794 4 0,809 0,031 0,779 0,035 0,015 CPLX2 cg22776578 1 0,125 0,050 0,094 0,044 0,042 cg16460727 1 0,804 0,048 0,774 0,042 0,038 CPT1A cg25890640 2 0,637 0,066 0,599 0,053 0,023 cg14249520 1 0,531 0,052 0,567 0,052 0,023 CUX2 cg09567735 2 0,832 0,065 0,794 0,052 0,042 cg08710739 1 0,461 0,046 0,499 0,057 0,036 CYP2E1 cg19571004 2 0,315 0,080 0,254 0,068 0,015 cg19837601 1 0,789 0,036 0,736 0,048 0,001 DAB1 cg15898414 1 0,537 0,068 0,455 0,153 0,039 cg08724028 3 0,861 0,016 0,837 0,03 0,007 BAT1 cg26177760 1 0,854 0,019 0,837 0,030 0,044 cg03031988 2 0,811 0,053 0,753 0,055 0,006 DIP2C cg19334176 6 0,818 0,011 0,797 0,031 0,001 cg01263942 4 0,825 0,059 0,777 0,059 0,021 DLGAP2 cg05951364 7 0,554 0,070 0,471 0,096 0,004 cg11192059 8 0,889 0,024 0,856 0,036 0,007 DLK1 cg16544010 2 0,365 0,047 0,312 0,088 0,024 cg09971646 1 0,406 0,051 0,47 0,06 0,002 DPCR1 cg02894328 1 0,771 0,069 0,701 0,084 0,011 cg03226054 4 0,758 0,03 0,718 0,049 0,004 DRD4 cg09133032 1 0,813 0,054 0,743 0,100 0,015 cg05717871 1 0,775 0,053 0,72 0,09 0,014 DUOX2 cg04184063 4 0,690 0,024 0,656 0,047 0,002 cg04184063 1 0,803 0,03 0,782 0,029 0,010 EHMT2 cg17013729 1 0,923 0,022 0,898 0,041 0,017 cg08594281 2 0,269 0,031 0,31 0,08 0,014 ETS1 cg08452327 2 0,219 0,076 0,156 0,099 0,009 cg26404422 2 0,636 0,033 0,603 0,05 0,034 FGFR1 cg16625770 1 0,708 0,039 0,670 0,058 0,037 cg13278539 2 0,118 0,037 0,16 0,053 0,015 FGFR2 cg15986555 1 0,895 0,046 0,878 0,023 0,034 cg15049101 1 0,843 0,034 0,816 0,042 0,047 FOXO1 cg09792463 1 0,828 0,040 0,789 0,063 0,044 cg01493009 2 0,878 0,063 0,885 0,184 0,013 FRMD4B cg02519681 1 0,249 0,146 0,147 0,103 0,018 cg11377213 2 0,314 0,039 0,352 0,048 0,033 GABBR1 cg22783999 4 0,520 0,062 0,468 0,116 0,018 cg12292060 14 0,447 0,04 0,412 0,03 0,001 GABRA1 cg21757820 1 0,351 0,154 0,241 0,120 0,028 cg24554147 1 0,105 0,019 0,095 0,03 0,044 GABRB3 cg26968476 2 0,413 0,116 0,300 0,126 0,007 cg15482931 2 0,398 0,037 0,367 0,042 0,023 GABRD cg07701567 1 0,662 0,057 0,617 0,088 0,024 cg15825127 2 0,778 0,022 0,749 0,031 0,003 GAD2 cg09056181 3 0,302 0,124 0,195 0,126 0,015 cg11500467 1 0,184 0,031 0,159 0,027 0,024 GNAS cg19589727 6 0,546 0,077 0,504 0,051 0,018 cg19140375 3 0,449 0,025 0,49 0,117 0,026

356

GNAS-AS1 cg20019489 7 0,731 0,081 0,671 0,080 0,010 cg03030267 2 0,791 0,023 0,766 0,036 0,018 GPSM3 cg18689504 1 0,559 0,041 0,521 0,061 0,042 cg21386484 1 0,501 0,029 0,464 0,04 0,010 HCG4 cg14443519 3 0,199 0,153 0,124 0,151 0,013 cg17068675 2 0,849 0,021 0,818 0,034 0,008 HFE cg20485758 1 0,551 0,069 0,502 0,103 0,028 cg13015616 1 0,694 0,028 0,666 0,043 0,018 HIST4H4 cg13064062 1 0,768 0,042 0,727 0,062 0,012 cg08746853 1 0,479 0,035 0,444 0,042 0,010 HLA-A cg19748509 2 0,700 0,110 0,609 0,117 0,011 cg25548869 2 0,084 0,039 0,104 0,03 0,002 HLA-B cg22731440 3 0,581 0,101 0,485 0,132 0,009 cg05129479 2 0,428 0,128 0,325 0,11 0,036 HLA-C cg11867651 4 0,247 0,165 0,375 0,176 0,020 cg11138837 2 0,597 0,105 0,671 0,074 0,025 HLA-DPA1 cg23195763 1 0,720 0,185 0,619 0,144 0,030 cg25824217 5 0,598 0,028 0,568 0,048 0,014 HLA-DPB1 cg04885678 2 0,163 0,055 0,223 0,082 0,009 cg04504217 3 0,589 0,052 0,542 0,071 0,022 HLA-DQB1 cg05724777 3 0,215 0,107 0,305 0,102 0,004 cg13047157 7 0,31 0,085 0,214 0,079 0,002 HLA-DQB2 cg17360552 3 0,360 0,090 0,287 0,064 0,003 cg17360552 2 0,722 0,143 0,606 0,064 0,012 HLA-DRA cg14058932 1 0,648 0,089 0,710 0,114 0,037 cg23732629 2 0,83 0,033 0,787 0,046 0,006 HLA-L cg11456756 1 0,498 0,122 0,561 0,151 0,024 cg04884612 1 0,848 0,03 0,829 0,028 0,031 HSPA1L cg24631716 1 0,605 0,059 0,554 0,081 0,026 cg16587174 1 0,849 0,038 0,827 0,034 0,044 HTR1A cg15092168 2 0,462 0,103 0,313 0,127 0,000 cg10588470 1 0,161 0,033 0,139 0,026 0,031 ICA1 cg16379704 1 0,211 0,040 0,183 0,034 0,035 cg05958816 1 0,843 0,137 0,89 0,022 0,032 IGF1R cg23681489 7 0,359 0,109 0,179 0,139 0,000 cg27139419 2 0,456 0,045 0,425 0,032 0,041 IGFBP2 cg15128555 1 0,798 0,060 0,753 0,075 0,044 cg20366479 1 0,528 0,048 0,491 0,048 0,034 ITPR1 cg18689402 1 0,916 0,106 0,830 0,174 0,024 cg02799411 3 0,281 0,036 0,313 0,045 0,012 KCNQ1 cg20828897 10 0,662 0,056 0,613 0,052 0,003 cg27115973 4 0,844 0,02 0,81 0,038 0,004 KLF11 cg26276650 3 0,343 0,064 0,267 0,103 0,010 cg18825594 1 0,638 0,041 0,601 0,05 0,007 LGALS3 cg02183170 1 0,210 0,049 0,176 0,043 0,032 cg20008101 1 0,46 0,064 0,524 0,07 0,011 LRP1B cg19355806 1 0,675 0,072 0,595 0,104 0,007 cg26413307 1 0,801 0,019 0,776 0,034 0,010 LY6G5C cg22708150 1 0,764 0,091 0,716 0,073 0,042 cg00621943 1 0,807 0,02 0,787 0,032 0,041 MICA cg03990811 22 0,403 0,073 0,273 0,110 0,000 cg02844892 1 0,382 0,056 0,419 0,047 0,038 mir-125B1 cg20475322 1 0,909 0,025 0,881 0,051 0,047 cg07685357 2 0,518 0,039 0,485 0,034 0,024 NMU cg24140037 1 0,911 0,035 0,882 0,033 0,024 cg01802532 1 0,361 0,041 0,33 0,039 0,024

357

NOTCH4 cg25994616 7 0,897 0,055 0,827 0,091 0,005 cg23585168 5 0,665 0,03 0,646 0,027 0,019 NR1H4 cg23256150 1 0,162 0,025 0,200 0,055 0,006 cg09244872 2 0,641 0,037 0,619 0,027 0,044 OBP2A cg14582108 1 0,457 0,076 0,380 0,065 0,001 cg14097499 1 0,779 0,031 0,763 0,028 0,045 PASK cg04003990 1 0,747 0,191 0,577 0,262 0,015 cg19397991 2 0,578 0,029 0,551 0,035 0,039 PBX1 cg05804299 1 0,787 0,056 0,754 0,047 0,044 cg08864944 3 0,459 0,045 0,498 0,059 0,025 PDE3A cg00063703 3 0,183 0,077 0,136 0,029 0,007 cg18639524 3 0,868 0,025 0,846 0,032 0,042 PDE4D cg03154690 2 0,365 0,092 0,272 0,106 0,007 cg06895913 2 0,394 0,043 0,458 0,07 0,002 PHLPP1 cg07187971 1 0,888 0,026 0,906 0,030 0,047 cg13381110 1 0,534 0,058 0,59 0,067 0,016 PPP1R3C cg04839761 2 0,389 0,077 0,290 0,106 0,003 cg23909584 1 0,102 0,035 0,125 0,035 0,047 PPT2 cg18235088 1 0,845 0,044 0,818 0,029 0,020 cg00086577 3 0,62 0,037 0,585 0,045 0,010 PSMB8 cg05872513 6 0,403 0,146 0,250 0,112 0,001 cg11381564 2 0,524 0,035 0,495 0,027 0,015 PSMB9 cg05362405 9 0,377 0,112 0,289 0,114 0,015 cg16853860 4 0,858 0,021 0,836 0,031 0,028 PSORS1C1 cg03034365 1 0,275 0,057 0,327 0,081 0,034 cg19741675 4 0,849 0,035 0,829 0,019 0,019 PTGIR cg07844738 1 0,665 0,069 0,703 0,055 0,028 cg07844738 1 0,719 0,025 0,742 0,035 0,047 PTPN11 cg08933160 1 0,608 0,050 0,561 0,065 0,002 cg08933160 1 0,571 0,036 0,528 0,06 0,018 RBMS1 cg19285525 1 0,644 0,243 0,458 0,253 0,007 cg10673915 4 0,825 0,024 0,796 0,03 0,003 RNF220 cg09557643 3 0,604 0,040 0,577 0,041 0,017 cg21289461 1 0,888 0,032 0,871 0,027 0,024 SLC34A1 cg18003583 1 0,910 0,037 0,867 0,077 0,044 cg21145248 1 0,786 0,028 0,757 0,039 0,036 SLC5A5 cg17933226 1 0,172 0,033 0,215 0,060 0,009 cg10017118 1 0,717 0,032 0,697 0,023 0,039 SLC6A3 cg13723431 1 0,598 0,107 0,493 0,137 0,026 cg14506366 1 0,9 0,045 0,871 0,042 0,036 SORCS2 cg11575234 5 0,528 0,063 0,471 0,073 0,014 cg12598054 6 0,723 0,026 0,693 0,03 0,005 SPATA5 cg09941581 1 0,866 0,018 0,841 0,032 0,004 cg19782686 1 0,407 0,049 0,453 0,052 0,026 STK32C cg25969878 3 0,444 0,063 0,479 0,053 0,032 cg15246131 4 0,702 0,074 0,777 0,091 0,008 TAP1 cg02756056 1 0,421 0,076 0,465 0,075 0,038 cg11807238 1 0,924 0,011 0,893 0,085 0,037 TCF19 cg10647991 9 0,775 0,062 0,831 0,039 0,002 cg10094358 2 0,371 0,036 0,341 0,032 0,014 TCF7L2 cg10520079 1 0,860 0,025 0,878 0,033 0,040 cg15807455 1 0,855 0,031 0,833 0,026 0,026 TFR2 cg10681065 1 0,783 0,052 0,720 0,083 0,021 cg11751434 1 0,136 0,023 0,157 0,033 0,038 TG cg16814719 2 0,419 0,060 0,366 0,055 0,005 cg11883141 1 0,528 0,023 0,502 0,031 0,007

358

TLR5 cg18201671 1 0,763 0,023 0,743 0,031 0,020 cg07015886 1 0,544 0,025 0,52 0,035 0,027 TNF cg26729380 5 0,305 0,044 0,239 0,070 0,003 cg20477259 5 0,677 0,027 0,64 0,043 0,005 TNFRSF1B cg09081517 2 0,772 0,054 0,729 0,044 0,006 cg22677556 1 0,539 0,021 0,51 0,031 0,002 TNXB cg10812186 12 0,709 0,124 0,617 0,146 0,018 cg04539172 6 0,776 0,031 0,762 0,018 0,019 TRIM26 cg11512026 2 0,902 0,009 0,886 0,043 0,026 cg16709517 1 0,857 0,022 0,839 0,031 0,019 TRIM31 cg20591745 4 0,349 0,078 0,433 0,111 0,015 cg02583465 2 0,897 0,012 0,873 0,074 0,033 UBASH3A cg23042151 1 0,730 0,078 0,671 0,102 0,038 cg23042151 1 0,639 0,048 0,591 0,064 0,030 VWA3B cg16349827 2 0,703 0,037 0,673 0,039 0,020 cg16408856 1 0,826 0,032 0,8 0,026 0,015 ZBTB16 cg04628008 1 0,125 0,099 0,069 0,065 0,040 cg09994445 1 0,764 0,024 0,739 0,034 0,044 ZNRD1 cg05663643 1 0,247 0,072 0,197 0,064 0,012 cg01504212 1 0,793 0,028 0,765 0,035 0,027 *For genes having more than one probe differentially methylated at P<0.05, the most significant result is presented. Genes in bold type are the TOP 10 genes differentially methylated in both the placenta and cord blood ( P<0.01) and selected for replication in the Gen3G birth cohort.

359

ANNEXE 6

CpG sites within the 10 genes that were found to be differentially methylated in placenta and cord blood exposed or not to gestational diabetes mellitus (GDM) and associated with metabolic diseases pathway in the E-21 birth cohort.

PLACENTA CORD BLOOD CTRL DG CTRL DG Genes* PROBE ID* MEAN SD MEAN SD P-value Genes* PROBE ID* MEAN SD MEAN SD P-value BRD2 cg08491668 0,500 0,037 0,461 0,051 0,009 BRD2 cg11439393 0,267 0,016 0,239 0,032 0,004 BRD2 cg04798369 0,114 0,071 0,073 0,047 0,032 BRD2 cg17451586 0,299 0,02 0,272 0,031 0,006 BRD2 cg05111146 0,532 0,034 0,489 0,052 0,034 BRD2 cg02471378 0,715 0,059 0,662 0,06 0,006 CACNA1D cg10409919 0,431 0,077 0,348 0,086 0,005 BRD2 cg25158622 0,202 0,025 0,171 0,031 0,008 CACNA1D cg08480458 0,395 0,122 0,305 0,114 0,017 BRD2 cg26953232 0,499 0,026 0,46 0,047 0,014 CACNA1D cg15473186 0,605 0,117 0,509 0,125 0,024 BRD2 cg24275356 0,278 0,023 0,253 0,032 0,026 CACNA1D cg01386883 0,226 0,060 0,184 0,070 0,042 BRD2 cg01393792 0,156 0,045 0,125 0,029 0,036 DLGAP2 cg05951364 0,554 0,070 0,471 0,096 0,004 CACNA1D cg13414750 0,802 0,038 0,761 0,038 0,006 DLGAP2 cg10702238 0,833 0,034 0,745 0,125 0,008 DLGAP2 cg11192059 0,889 0,024 0,856 0,036 0,007 DLGAP2 cg00672445 0,454 0,055 0,398 0,072 0,015 DLGAP2 cg24311644 0,828 0,036 0,795 0,031 0,013 DLGAP2 cg10636144 0,653 0,055 0,616 0,042 0,024 DLGAP2 cg04050941 0,793 0,042 0,759 0,038 0,015 DLGAP2 cg22385595 0,526 0,126 0,424 0,164 0,032 DLGAP2 cg06040034 0,619 0,057 0,568 0,059 0,019 DLGAP2 cg01571203 0,543 0,085 0,590 0,076 0,050 DLGAP2 cg02709139 0,834 0,034 0,804 0,046 0,033 DLGAP2 cg11254573 0,835 0,085 0,767 0,101 0,050 DLGAP2 cg21851391 0,908 0,027 0,891 0,031 0,034 HLA-DQB1 cg05724777 0,215 0,107 0,305 0,102 0,004 DLGAP2 cg17105041 0,767 0,027 0,744 0,031 0,038 HLA-DQB1 cg21036007 0,143 0,049 0,195 0,069 0,021 DLGAP2 cg04687241 0,640 0,027 0,619 0,037 0,047 HLA-DQB1 cg09555323 0,198 0,051 0,241 0,055 0,030 HLA-DQB1 cg10846853 0,144 0,070 0,095 0,053 0,003 KCNQ1 cg20828897 0,662 0,056 0,613 0,052 0,003 HLA-DQB1 cg20770572 0,747 0,261 0,826 0,024 0,030 KCNQ1 cg18450293 0,665 0,046 0,610 0,064 0,006 HLA-DQB1 cg03461499 0,482 0,045 0,440 0,044 0,014 KCNQ1 cg23040992 0,767 0,061 0,698 0,106 0,021 HLA-DQB1 cg26159068 0,762 0,101 0,697 0,100 0,027 KCNQ1 cg12223985 0,851 0,029 0,818 0,052 0,024 HLA-DQB1 cg13047157 0,310 0,085 0,214 0,079 0,002

360

KCNQ1 cg12573502 0,692 0,084 0,628 0,089 0,028 HLA-DQB1 cg21543081 0,740 0,105 0,648 0,093 0,013 KCNQ1 cg25223664 0,561 0,050 0,523 0,064 0,030 HLA-DQB1 cg16345566 0,458 0,221 0,287 0,150 0,008 KCNQ1 cg19923326 0,517 0,045 0,485 0,038 0,032 KCNQ1 cg27115973 0,844 0,020 0,810 0,038 0,004 KCNQ1 cg08920458 0,531 0,141 0,445 0,163 0,037 KCNQ1 cg16811455 0,801 0,026 0,780 0,032 0,022 KCNQ1 cg03365111 0,673 0,083 0,615 0,109 0,048 KCNQ1 cg04894537 0,294 0,037 0,322 0,041 0,025 KCNQ1 cg26884837 0,823 0,099 0,870 0,069 0,050 KCNQ1 cg12949760 0,414 0,035 0,444 0,038 0,031 LRP1B cg19355806 0,675 0,072 0,595 0,104 0,007 LRP1B cg26413307 0,801 0,019 0,776 0,034 0,010 PDE4D cg03154690 0,365 0,092 0,272 0,106 0,007 PDE4D cg06895913 0,394 0,043 0,458 0,070 0,002 PDE4D cg03323696 0,140 0,119 0,073 0,101 0,028 PDE4D cg15410418 0,483 0,031 0,521 0,053 0,022 RBMS1 cg19285525 0,644 0,243 0,458 0,253 0,007 RBMS1 cg10673915 0,825 0,024 0,796 0,030 0,003 TNF cg26729380 0,305 0,044 0,239 0,070 0,003 RBMS1 cg02048613 0,840 0,029 0,800 0,041 0,005 TNF cg21467614 0,319 0,066 0,240 0,086 0,004 RBMS1 cg17824540 0,616 0,041 0,574 0,055 0,020 TNF cg08553327 0,436 0,068 0,373 0,076 0,007 RBMS1 cg05135521 0,589 0,044 0,553 0,048 0,036 TNF cg04425624 0,241 0,047 0,204 0,054 0,026 TNF cg20477259 0,677 0,027 0,640 0,043 0,005 TNF cg10717214 0,182 0,044 0,151 0,051 0,044 TNF cg23384708 0,667 0,023 0,639 0,032 0,006 TNFRSF1B cg09081517 0,772 0,054 0,729 0,044 0,006 TNF cg01360627 0,802 0,031 0,776 0,035 0,025 TNFRSF1B cg17428954 0,360 0,034 0,339 0,037 0,042 TNF cg17755321 0,866 0,025 0,846 0,030 0,027 TNF cg17741993 0,719 0,033 0,686 0,042 0,047 TNFRSF1B cg22677556 0,539 0,021 0,510 0,031 0,002

*Genes and CpGs in bold were epigenotyped in the Gen3G birth cohort.

361

ANNEXE 7

Pearson’s correlation coefficients obtained between maternal characteristics and ABCA1 DNA methylation of placenta and cord blood.

Maternal side of Fetal side of placenta placenta Cord blood Maternal characteristics ABCA1 ABCA1 ABCA1 ABCA1 ABCA1 mean CpG5 CpG6 CpG5 CpG6 r=-0.01 r=-0.05 r=0.11 r=-0.17 r=0.10 1st trimester - Age (years) NS NS NS p=0.10 NS r=0.03 r=0.06 r=0.01 r=0.16 r=-0.12 1st trimester- BMI (kg/m 2) NS NS NS p=0.10 NS 1st trimester- Waist r=0.06 r=0.02 r=0.04 r=0.15 r=-0.12 circumference (cm) NS NS NS NS NS 1st trimester - Fasting r=-0.02 r=0.07 r=-0.18 r=-0.06 r=0.16 glucose (mmol/L) NS NS p=0.08 NS NS 1st trimester - Fasting r=0.03 r=0.05 r=-0.15 r=-0.08 r=-0.05 insulin (mU/L) a NS NS NS NS NS r=0.04 r=0.03 r=-0.16 r=-0.08 r=-0.06 1st trimester – HOMA-IR a NS NS NS NS NS 1st trimester - Total r=-0.09 r=-0.07 r=-0.03 r=0.05 r=-0.01 cholesterol (mmol/L) NS NS NS NS NS 1st trimester – HDL-C r=-0.21 r=-0.24 r=0.02 r=0.03 r=0.07 (mmol/L) p=0.04 p=0.02 NS NS NS

1st trimester – LDL-C r=-0.02 r=0.01 r=-0.03 r=0.04 r=0.05 (mmol/L) NS NS NS NS NS

1st trimester - TG r=0.15 r=0.11 r=0.17 r=0.06 r=-0.24 (mmol/L) a NS NS p=0.09 NS p=0.03 2nd trimester - 2h-post- r=0.25 r=0.15 r=-0.01 r=-0.04 r=-0.26 OGTT glucose p=0.02 NS NS NS p=0.02 concentration (mmol/L) Weight gain between 1 st r=-0.26 r=-0.01 r=-0.16 r=-0.01 r=0.14 and 3 rd trimester p=0.02 NS NS NS NS (% of initial weight) b Mean blood ABCA1 DNA r=-0.11 r=-0.04 r=0.07 r=-0.01 r=0.51 methylation (%) NS NS NS NS p<0.001 Correlation coefficients (r) and p-values were obtained after correction for these potential confounding factors when appropriate : maternal age, BMI, fasting triglyceridemia at first trimester, weight gain between first and third trimester and previous history of GDM. aCorrelation coefficients and p-values obtained after log10-transformation of the variable. bn=95; NS = p>0.10

362

ANNEXE 8

Pearson’s correlation coefficients obtained between fetal characteristics and ABCA1 DNA methylation of placenta and cord blood .

Maternal side of Fetal side of placenta placenta Cord blood Fetal characteristics ABCA1 ABCA1 ABCA1 ABCA1 ABCA1 mean CpG5 CpG6 CpG5 CpG6 r=-0.13 r=0.19 r=0.06 r=-0.07 r=-0.03 Gestational age (weeks) NS p=0.06 NS NS NS r=0.06 r=0.09 r=0.16 r=0.10 r=0.12 Birth weight (kg) NS NS NS NS NS r=0.04 r=0.06 r=0.19 r=0.13 r=0.29 Placenta weight (g) a NS NS p=0.07 NS p=0.01 Fetal-placental weight r=-0.06 r=-0.03 r=-0.16 r=-0.11 r=-0.25 ratio a NS NS NS NS p=0.03 Cord blood total r=-0.01 r=-0.08 r=0.03 r=0.10 r=-0.10 cholesterol (mmol/L) b NS NS NS NS NS Cord blood LDL-C r=0.04 r=-0.11 r=0.04 r=0.08 r=-0.05 (mmol/L) b,c NS NS NS NS NS Cord blood HDL-C r=-0.05 r=-0.10 r=0.19 r=0.12 r=-0.11 (mmol/L) b NS NS p=0.09 NS NS Cord blood TG r=0.01 r=0.07 r=-0.28 r=-0.14 r=-0.13 (mmol/L) b,c NS NS p=0.01 NS NS

Cord blood c-peptides r=0.02 r=0.13 r=-0.12 r=-0.06 r=-0.15 (pmol/L) d NS NS NS NS NS Correlation coefficients (r) and p-values were obtained after correction for these potential confounding factors when appropriate: newborn sex, gestational and maternal age, BMI, fasting triglyceridemia at first trimester, weight gain between first and third trimester and previous history of GDM. an=91 bn=87 cCorrelation coefficients and p-values obtained after log10-transformation of the variable dn=63 NS = p>0.10