Supporting Information
Kiso et al. 10.1073/pnas.0808324106 SI Text R&D Systems), GFP (1:20; Santa Cruz), K14 (1:100; Covance), Generation of Sox21 KO Mouse. A C57BL/6 mouse genomic clone K31 (1:200; Progen). K32 (1:20; Progen), K71 (1:3200; kindly harboring the Sox21 gene was obtained from the BACPAC provided by Y. Shimomura) (2), K82 (1:20; Progen), Filaggrin Resources Center at Children’s Hospital Oakland Research (1:100; Covance), K10 (1:100; Covance), PCNA (1:50; Santa Institute (Oakland, CA). Because the Sox21 gene is composed of Cruz), Ki67 (1:50; Santa Cruz). These antibodies were detected a single exon, we replaced the coding sequence with EGFP by using appropriate secondary antibodies conjugated with cDNA in frame at the translational initiation site. The short Alexa488, Cy3, or Alexa594. 1.3-kb homology arm was prepared from sequences just up- stream of this translation initiation site and the 5.0-kb long arm Preparation of RNA from the Skins of WT and Msx2-Null Mice and was located just after the Sox21 coding region. Both regions were Semiquantitative RT-PCR. Back skins were dissected from 12-week- subcloned into the pgk-neo-pgk-DT-A cassette to generate the old WT and Msx2-null mice. Tissues were treated with RNAlater targeting vector (Fig. S1). The resulting linearized vector (25 g) for subsequent RNA extraction. Total RNA extracts were pu- was then electroporated into TT2 ES cells and G418-resistant rified by using an RNeasy mini kit (Qiagen) and normalized cell clones were further selected by PCR. Correct homologous RNA quantities were reverse-transcribed with SuperScript III Ϫ recombination was confirmed by Southern blotting analysis, and RNase H reverse transcriptase (Invitrogen) using oligo(dT) targeted cell clones were aggregated with ICR 8-cells and then primers. cDNAs were adjusted to equal loading levels by PCR transferred to pseudopregnant female mouse recipients. The amplification for Gapdh. PCR amplification was performed for resulting chimeric mice were bred with MCH (closed ICR colony Sox21 and Msx2 using LA Taq polymerase with GC buffer established in CLEA, Kanagawa, Japan) females. Germ-line (Takara) and Ex Taq polymerase (Takara), respectively. The transmission of the targeted allele was confirmed by PCR. The amplification conditions were 5 min at 94°C, 22–40 cycles of 15 s floxed neomycin cassette was later removed by breeding with a at94°C,5sat60°C(63°C for Sox21), and 30 s (15 s for Sox21) CAG-Cre transgenic mouse (1). at 72 °C. The primer sequences are listed in Table S2.
Histological Methods and Antibodies. Skin tissue was always ob- Cell Proliferation Assay. Mice at P10 were injected s.c. with 50 g/g tained from the midback region of age-matched mouse litter- body weight of BrdU. Two hours after injection, the animals mates. For histology, tissues were fixed in 4% PFA before were killed and excised skin samples were fixed in 4% PFA and paraffin embedding. The sections were then stained with hema- embedded in paraffin. BrdU incorporation was monitored with toxylin and eosin. Alternatively, fresh-frozen tissues were em- anti-BrdU antibody (1:300; Sigma) followed by detection using bedded in OCT (Sakura), and sections were immunostained by anti-mouse IgG conjugated with Alexa594. TO-PRO-3 iodide using the primary antibodies described above, followed by (Invitrogen) was used as a nuclear counterstain. The numbers of secondary antibodies and DAPI counterstaining, and observed BrdU-positive cells per microscopic field were counted in 10 by confocal microscopy (Zeiss LSM510). The following primary randomly selected fields (200ϫ magnification) in the epidermis antibodies were used in the current experiments: Sox21 (1:20; of each skin section.
1. Sakai K, Miyazaki J (1997) A transgenic mouse line that retains Cre recombinase activity 2. Aoki N, et al. (2001) A novel type II cytokeratin, mK6irs, is expressed in the Huxley and in mature oocytes irrespective of the cre transgene transmission. Biochem Biophys Res Henle layers of the mouse inner root sheath. J Invest Dermatol 116:359–365. Commun 237:318–324.
Kiso et al. www.pnas.org/cgi/content/short/0808324106 1of9 NspI EcoRI NspI EcoRI Normal allele Sox21
Targeting vector EGFP-pA Pgk-neo-pA Pgk-DTA
Sox21-L3 GFP-R2 lox lox
Targeted allele (neo) EGFP-pA Pgk-neo-pA
Cre recombinase
Targeted allele (∆neo) EGFP-pA
GFP-pA-L2 Sox21-LA-R3
Fig. S1. The targeting strategy used to knock out the Sox21 gene. The top schematic shows the genomic organization of the Sox21 gene, the second diagram shows the structure of the targeting vector, and the third is the predicted structure of the Sox21locus after homologous recombination. The exon of Sox21 was deleted and replaced with a floxed neo cassette (the arrowheads on the line represent loxP sites). A germ-line chimeric mouse was then generated from recombinant ES cells containing the targeted allele and crossed with a CAG-Cre mouse to remove the neo cassette and establish the Sox21 KO mouse line. Primers used for the genotyping are: Sox21-L3, 5Ј-CCACTCGCCTAAACCTGCACTCAAAG-3Ј; GFP-R2, 5Ј-ACGTCGCCGTCCAGCTCGACC-3Ј; GFP-pA-L2, 5Ј- GACAATAGCAGGCATGCTGGGG-3Ј; Sox21-LA-R3, 5Ј-CCA AGCCAGCGGACTCAGAGAC-3Ј
Kiso et al. www.pnas.org/cgi/content/short/0808324106 2of9 Fig. S2. Hair cycle-dependent phenotypes in Sox21-null mice. (A) Histogram indicating the numbers of Sox21-null mice that exhibited a complete hairless phenotype. Mice were monitored over a 70-day period after birth. (B) Histological changes identified upon stripping of 40-day-old WT mice and Sox21-null mice. Sections were prepared at 5, 10, and 15 days after stripping. (C) Long-term follow-up of cyclic alopecia observed in several mice of a different genetic background. The Sox21-null (ϩneo) generated by an intercross of F1 heterozygotes derived from an MCH female crossed with B6/CBA chimera (male) was analyzed for 319 days. (D) Photographs of independent Sox21-null (⌬neo) mice generated by an intercross of F1 heterozygotes derived from a CAG-Cre (MCH) female crossed with a B6/CBA chimera. Photographs were taken after 10, 14, 19, 27, 33, and 36 months. Neither the absence nor presence of the neo cassette nor the sex of the animal had an effect upon the phenotype. (E) Histological sections showing hair cycle-dependent epidermal phenotypes. Sections were prepared from different parts of back skins showing different hair cycle stages of Sox21ϩ/Ϫ and Sox21Ϫ/Ϫ individuals at 9 months old. Epidermal hyperplasia and enlarged sebaceous glands were observed in catagen stage in Sox21Ϫ/Ϫ mouse.
Kiso et al. www.pnas.org/cgi/content/short/0808324106 3of9 Fig. S3. Sox21 expression in the interfollicular epidermis and infundibulum. (A) Immunohistological detection of Sox21 in a P5 Sox21ϩ/ϩ epidermis using the layer-specific protein markers Filaggrin for the cornified layer, K10 for the suprabasal layer, and K14 for the basal layer. Staining for the cell cycle marker PCNA was also performed. (B) Detection of proliferating cells in Sox21ϩ/ϩ, Sox21ϩ/ Ϫ, and Sox21ϩ/ϩ skin samples at P10. Proliferating cells were detected by immunoreactivity against incorporated BrdU. BrdU-positive cells were quantified in the interfollicular epidermis (IFE) and infundibulum region, respectively. (C) Expression of Sox21 and Sox21-GFP during first hair cycle, P7 (anagen), P15 (catagen), and P19 (telogen). The magnified images in the infundibulum and a part of interfollicular epidermis are also shown. The increased cell proliferation was detected by anti-Ki67 antibody in the absence of Sox21.
Kiso et al. www.pnas.org/cgi/content/short/0808324106 4of9 Fig. S4. Defects in the hair cuticle of Sox21-null mouse. (A) Relationship between keratin protein expressions and interlocking structures. Keratin proteins K32 and K82 are specifically localized in the layer of hair cuticle. Although the expression of these 2 proteins are not completely merged, the speckled structure of K82 is resembled to the interlocking structure revealed in the semithin section of the WT hair cuticle. The K82 expression is markedly reduced and the corresponding interlocking structure is lost in the Sox21-null hair cuticle. (B) Plucked hairs. (C) Histogram indicating the ratio of ‘‘detached’’ hair shafts as shown at left. Total numbers of hair follicles examined are indicated in the graph.
Kiso et al. www.pnas.org/cgi/content/short/0808324106 5of9 Fig. S5. Sox21 expression is unaltered in the Msx2-null epidermis. Semiquantitative RT-PCR analyses were conducted for the genes indicated using total RNAs prepared from the epidermis of E15.5, E17.5, and P0 WT mice (A), P0 WT, Sox21ϩ/Ϫ, and Sox21Ϫ/Ϫ mice (B), and 12-week-old adult WT and Msx2Ϫ/Ϫ mice (C). The number of PCR cycles for each gene is listed in parentheses. Gapdh was amplified as a control. (A) The expression of the cuticle keratin genes Krt32 and Krt82 commences at around P0 after the initiation of Sox21 and Msx2 expression. (B) The expression of cuticle keratin genes was found to be significantly down-regulated in both P0 and P5 Sox21-null back skins. The Msx2 gene, however, was unaffected at P0. (C) The expression levels of Sox21 and cuticle keratin genes were unchanged between WT and Msx2-null adult mice.
Kiso et al. www.pnas.org/cgi/content/short/0808324106 6of9 Table S1. Microarray expression report for 119 probe sets with average array signals for each Sox21 genotype tested Fold Normalized Normalized Normalized change, Agilent ID Gene symbol intensity,WT intensity, Hetero intensity, KO WT vs. KO A51P200034 A030003K21Rik 1.515 (0.732 to 3.138) 1.487 (1.268 to 1.744) 0.01 151.50 A51P399789 Krtap12-1 1.491 (0.65 to 3.416) 1.599 (1.35 to 1.895) 0.01 149.10 A51P269721 5530401N06Rik 1.292 (0.763 to 2.189) 1.393 (1.237 to 1.568) 0.01 129.20 A51P520224 1.287 (0.644 to 2.57) 1.578 (1.356 to 1.837) 0.01 128.70 A52P1163599 A030014E15Rik 1.283 (0.72 to 2.287) 1.524 (1.28 to 1.815) 0.01 128.30 A51P239367 Krt82 1.206 (0.877 to 1.659) 1.22 (1.123 to 1.325) 0.01 120.60 A52P641641 1.176 (0.729 to 1.896) 1.398 (1.271 to 1.538) 0.01 117.60 A51P493437 0.989 (0.764 to 1.281) 1.328 (1.236 to 1.427) 0.01 98.93 A51P107463 A830053O21Rik 1.346 (0.687 to 2.639) 1.441 (1.313 to 1.58) 0.0156 (0.015 to 0.0164) 86.07 A51P344636 Olfr476 1.616 (0.642 to 4.07) 1.536 (1.358 to 1.736) 0.021 (0.0167 to 0.0264) 76.92 A51P360374 Krt32 1.261 (0.846 to 1.88) 1.297 (1.154 to 1.458) 0.0212 (0.0195 to 0.0231) 59.46 A51P370458 A030006P16Rik 1.47 (0.744 to 2.905) 1.566 (1.256 to 1.953) 0.0318 (0.0282 to 0.036) 46.16 A52P8361 2410006F04Rik 1.523 (0.603 to 3.849) 1.604 (1.397 to 1.841) 0.0431 (0.0365 to 0.051) 35.31 A52P284298 A030007E19Rik 1.15 (0.667 to 1.981) 1.428 (1.333 to 1.531) 0.0482 (0.0407 to 0.0571) 23.86 A52P253037 2810047C21Rik 1.678 (0.619 to 4.55) 1.553 (1.381 to 1.745) 0.0791 (0.0779 to 0.0803) 21.21 A51P382152 Procr 1.328 (0.776 to 2.272) 1.397 (1.224 to 1.594) 0.0693 (0.0616 to 0.0779) 19.17 A52P313656 1.665 (0.699 to 3.962) 1.371 (1.301 to 1.445) 0.0915 (0.0864 to 0.0969) 18.19 A51P293496 Dnajc5 g 1.533 (0.72 to 3.265) 1.577 (1.28 to 1.943) 0.0895 (0.0644 to 0.124) 17.13 A51P487175 Acsm3 0.999 (0.954 to 1.046) 1.114 (1.107 to 1.121) 0.109 (0.0925 to 0.129) 9.15 A51P165185 Cldn7 1.487 (1.163 to 1.902) 1.043 (0.837 to 1.3) 0.171 (0.157 to 0.187) 8.69 A51P502701 Arhgef2 1.296 (0.855 to 1.962) 1.297 (1.145 to 1.469) 0.162 (0.156 to 0.168) 8.00 A51P494561 Il1f10 1.398 (0.809 to 2.418) 1.265 (1.191 to 1.344) 0.18 (0.175 to 0.184) 7.78 A51P373142 1.36 (1.06 to 1.745) 1.103 (0.94 to 1.294) 0.179 (0.124 to 0.257) 7.62 A51P395281 4732495G21Rik 1.034 (0.968 to 1.106) 1.157 (1.032 to 1.297) 0.155 (0.123 to 0.197) 6.66 A51P476209 Fscn3 1.354 (0.744 to 2.462) 1.3 (1.256 to 1.346) 0.205 (0.176 to 0.24) 6.59 A51P228777 Fcho1 2.341 (1.045 to 5.243) 1 (0.993 to 1.007) 0.365 (0.335 to 0.398) 6.42 A52P223446 Itsn2 2.163 (1.816 to 2.576) 0.995 (0.9 to 1.1) 0.401 (0.364 to 0.442) 5.39 A51P107998 9930013L23Rik 1.232 (0.818 to 1.855) 1.394 (1.182 to 1.643) 0.23 (0.165 to 0.321) 5.36 A52P176993 4733401H21Rik 1.291 (0.646 to 2.582) 1.4 (1.354 to 1.447) 0.255 (0.231 to 0.28) 5.07 A51P207301 1.125 (1.052 to 1.202) 1.114 (0.948 to 1.31) 0.231 (0.187 to 0.285) 4.88 A51P273626 Cadps 1.195 (1.016 to 1.407) 1.085 (0.984 to 1.196) 0.251 (0.2 to 0.315) 4.77 A51P122981 1700045I11Rik 1.627 (0.86 to 3.077) 1.371 (1.14 to 1.649) 0.348 (0.312 to 0.389) 4.67 A51P273928 1.56 (0.828 to 2.938) 1.37 (1.172 to 1.601) 0.342 (0.286 to 0.408) 4.56 A51P211616 Slc27a6 1.09 (0.981 to 1.211) 1.208 (1.019 to 1.433) 0.239 (0.232 to 0.246) 4.56 A51P205779 Cd5l 1.519 (1.413 to 1.633) 1 (0.98 to 1.02) 0.342 (0.279 to 0.42) 4.44 A51P305642 Krtap5-1 1.216 (0.781 to 1.894) 1.258 (1.219 to 1.299) 0.283 (0.263 to 0.305) 4.30 A52P531693 Pacsin1 1.77 (1.593 to 1.967) 0.992 (0.875 to 1.125) 0.421 (0.406 to 0.437) 4.20 A52P819789 1.591 (1.503 to 1.684) 0.988 (0.843 to 1.157) 0.394 (0.344 to 0.452) 4.04 A52P520341 A130023I24Rik 1.217 (0.755 to 1.961) 1.55 (1.245 to 1.93) 0.318 (0.25 to 0.404) 3.83 A51P504127 Krtap5-4 1.218 (0.805 to 1.843) 1.267 (1.195 to 1.343) 0.32 (0.3 to 0.34) 3.81 A51P322396 Ugt3a1 1.021 (0.793 to 1.314) 1.641 (1.207 to 2.231) 0.276 (0.256 to 0.298) 3.70 A52P153685 Hecw2 1.065 (1.032 to 1.099) 1.033 (0.968 to 1.102) 0.291 (0.264 to 0.319) 3.66 A52P947954 1.315 (1.168 to 1.481) 0.991 (0.864 to 1.136) 0.394 (0.354 to 0.439) 3.34 A51P306229 Ipo7 1.087 (0.9 to 1.314) 1.275 (1.1 to 1.477) 0.327 (0.314 to 0.341) 3.32 A52P907393 1.377 (1.377 to 1.377) 0.992 (0.878 to 1.122) 0.419 (0.412 to 0.426) 3.29 A52P623053 Add2 1.32 (1.083 to 1.609) 0.999 (0.957 to 1.043) 0.403 (0.347 to 0.469) 3.27 A52P384535 Arhgap24 1.002 (0.945 to 1.063) 1.102 (1.055 to 1.15) 0.314 (0.259 to 0.38) 3.19 A52P147345 1.289 (0.736 to 2.259) 1.369 (1.264 to 1.484) 0.405 (0.344 to 0.478) 3.18 A51P322285 4930573I19Rik 1.17 (0.889 to 1.539) 1.112 (1.111 to 1.113) 0.374 (0.317 to 0.443) 3.12 A51P144014 Gdap5 1.301 (1.106 to 1.531) 1.069 (0.894 to 1.279) 0.419 (0.375 to 0.47) 3.10 A52P739182 1.201 (0.995 to 1.449) 1.224 (1.005 to 1.489) 0.389 (0.351 to 0.432) 3.09 A51P493816 9830134C10Rik 1.51 (0.951 to 2.397) 1.107 (1.049 to 1.168) 0.491 (0.465 to 0.518) 3.08 A51P136508 Avp 1.345 (0.86 to 2.105) 1.231 (1.14 to 1.329) 0.439 (0.357 to 0.54) 3.06 A52P859194 1.085 (0.965 to 1.22) 1.042 (1.035 to 1.049) 0.365 (0.336 to 0.397) 2.97 A52P627099 Tnrc6b 1.377 (1.353 to 1.402) 0.986 (0.834 to 1.166) 0.464 (0.454 to 0.475) 2.97 A51P290974 1.19 (0.736 to 1.924) 1.279 (1.264 to 1.293) 0.408 (0.32 to 0.52) 2.92 A51P237040 Nog 1.416 (0.803 to 2.499) 1.222 (1.197 to 1.248) 0.492 (0.47 to 0.515) 2.88 A52P45937 1.208 (0.849 to 1.721) 1.2 (1.151 to 1.25) 0.42 (0.398 to 0.444) 2.87 A52P779578 1.378 (1.125 to 1.686) 0.998 (0.938 to 1.062) 0.48 (0.452 to 0.511) 2.87 A52P518182 Magi3 1.437 (1.104 to 1.87) 1.012 (0.896 to 1.143) 0.502 (0.476 to 0.529) 2.86 A52P92445 Zfat1 1.273 (1.016 to 1.596) 1.146 (0.984 to 1.334) 0.445 (0.431 to 0.46) 2.86 A52P492989 Ncan 1.105 (0.857 to 1.425) 1.176 (1.143 to 1.21) 0.39 (0.336 to 0.453) 2.83 A51P289862 Rap1 gap 1.133 (0.759 to 1.691) 1.259 (1.241 to 1.278) 0.403 (0.359 to 0.452) 2.81 A52P381311 App 1.128 (0.936 to 1.358) 1.124 (1.064 to 1.188) 0.409 (0.362 to 0.463) 2.76 A51P474960 Pitrm1 1.088 (0.912 to 1.299) 1.146 (1.088 to 1.208) 0.397 (0.377 to 0.417) 2.75 A51P362554 Olfr1307 1.189 (1.025 to 1.605) 1 (0.999 to 1.001) 0.433 (0.178 to 0.744) 2.74 A52P1075773 9930024M15Rik 1.278 (1.138 to 1.436) 1.001 (0.862 to 1.164) 0.473 (0.453 to 0.494) 2.70 A51P464860 Pla2 g6 1.217 (0.818 to 1.81) 1.21 (1.182 to 1.239) 0.453 (0.396 to 0.517) 2.69 A51P353814 Crygn 1.419 (0.399 to 5.045) 1.659 (1.371 to 2.008) 0.53 (0.447 to 0.629) 2.68
Kiso et al. www.pnas.org/cgi/content/short/0808324106 7of9 Fold Normalized Normalized Normalized change, Agilent ID Gene symbol intensity,WT intensity, Hetero intensity, KO WT vs. KO A51P327983 4833427G06Rik 1.593 (0.43 to 5.894) 1.413 (1.388 to 1.439) 0.596 (0.581 to 0.612) 2.67 A52P1131666 1.137 (1.086 to 1.192) 0.999 (0.958 to 1.042) 0.43 (0.365 to 0.506) 2.65 A52P197199 1.297 (1.181 to 1.423) 0.995 (0.901 to 1.099) 0.497 (0.49 to 0.503) 2.61 A51P444005 Shroom1 1.351 (0.981 to 1.86) 1.076 (1.019 to 1.136) 0.52 (0.49 to 0.552) 2.60 A51P384230 Sgk2 1.151 (0.815 to 1.626) 1.221 (1.185 to 1.258) 0.444 (0.424 to 0.465) 2.59 A51P334942 Aldh1a1 0.973 (0.771 to 1.229) 1.221 (1.185 to 1.258) 0.389 (0.308 to 0.492) 2.50 A52P419873 Rb1 1.095 (0.971 to 1.235) 1.05 (1.029 to 1.071) 0.439 (0.372 to 0.516) 2.50 A51P325318 Serinc2 1.297 (0.932 to 1.806) 1.184 (1.068 to 1.312) 0.521 (0.516 to 0.526) 2.49 A51P129260 1.209 (1.131 to 1.293) 0.997 (0.924 to 1.076) 0.49 (0.449 to 0.534) 2.47 A52P907928 1.093 (0.655 to 1.823) 1.489 (1.345 to 1.649) 0.446 (0.43 to 0.463) 2.45 A52P577533 AI427515 1.107 (1 to 1.225) 1.054 (1 to 1.11) 0.454 (0.43 to 0.479) 2.44 A51P104197 BC038479 1.035 (0.815 to 1.316) 1.241 (1.185 to 1.3) 0.426 (0.412 to 0.441) 2.43 A51P466378 Itgal 1.325 (0.891 to 1.97) 1.293 (1.109 to 1.508) 0.548 (0.5 to 0.6) 2.42 A51P199135 Cd83 1.174 (1.023 to 1.346) 1.014 (0.977 to 1.052) 0.487 (0.431 to 0.549) 2.41 A52P468851 Ccdc125 1.12 (1.064 to 1.179) 1.071 (0.936 to 1.225) 0.465 (0.438 to 0.494) 2.41 A51P425167 AI427515 1.146 (0.951 to 1.381) 1.12 (1.049 to 1.196) 0.477 (0.472 to 0.482) 2.40 A52P444368 Rnf111 1.112 (0.787 to 1.572) 1.256 (1.213 to 1.301) 0.464 (0.373 to 0.576) 2.40 A52P470046 Cyfip2 1.155 (0.987 to 1.352) 1.231 (1.013 to 1.494) 0.489 (0.486 to 0.493) 2.36 A52P12855 Ankrd43 1.123 (0.918 to 1.373) 1.093 (1.082 to 1.104) 0.482 (0.452 to 0.514) 2.33 A51P205028 Fgf3 1.498 (0.855 to 2.625) 1.331 (1.145 to 1.547) 0.645 (0.599 to 0.694) 2.32 A51P365859 Ankrd43 1.198 (0.975 to 1.471) 1.074 (1.025 to 1.126) 0.517 (0.485 to 0.551) 2.32 A51P410430 Ccdc19 1.269 (0.955 to 1.686) 1.099 (1.045 to 1.157) 0.548 (0.491 to 0.611) 2.32 A51P427794 Ablim3 1.026 (0.979 to 1.075) 1.097 (1.021 to 1.179) 0.447 (0.386 to 0.517) 2.30 A51P462533 1.254 (0.896 to 1.756) 1.141 (1.104 to 1.18) 0.549 (0.545 to 0.553) 2.29 A51P455866 Elf5 1.002 (0.855 to 1.175) 1.15 (1.145 to 1.155) 0.439 (0.427 to 0.451) 2.28 A52P347401 BC050196 1.109 (1.045 to 1.176) 1.028 (0.955 to 1.106) 0.486 (0.471 to 0.501) 2.28 A52P317748 1.159 (1.073 to 1.253) 1.039 (0.927 to 1.165) 0.508 (0.491 to 0.525) 2.28 A51P118300 Sncg 1.023 (0.8 to 1.306) 1.304 (1.2 to 1.418) 0.452 (0.45 to 0.454) 2.26 A52P331981 Zp2 1.153 (0.968 to 1.374) 1.166 (1.032 to 1.316) 0.517 (0.506 to 0.528) 2.23 A52P1147388 6820402I19Rik 1.18 (0.952 to 1.462) 1.089 (1.048 to 1.132) 0.531 (0.53 to 0.531) 2.22 A52P337760 Rspo3 1.019 (0.982 to 1.057) 1.036 (1.018 to 1.054) 0.459 (0.422 to 0.498) 2.22 A51P454190 1.165 (0.869 to 1.561) 1.272 (1.131 to 1.431) 0.526 (0.459 to 0.602) 2.21 A51P188772 Rgnef 1.044 (0.999 to 1.091) 1.064 (1.001 to 1.131) 0.477 (0.441 to 0.516) 2.19 A51P521155 0.979 (0.79 to 1.214) 1.338 (1.21 to 1.479) 0.448 (0.429 to 0.467) 2.19 A51P170508 1.402 (0.747 to 2.63) 1.3 (1.253 to 1.348) 0.643 (0.594 to 0.697) 2.18 A51P431870 Mtap1 s 1.178 (0.976 to 1.421) 1.207 (1.024 to 1.423) 0.544 (0.513 to 0.577) 2.17 A51P356186 Snai3 1.086 (0.939 to 1.255) 1.115 (1.061 to 1.173) 0.505 (0.478 to 0.534) 2.15 A51P337708 Ovgp1 1.069 (0.998 to 1.146) 1.06 (1.002 to 1.12) 0.503 (0.483 to 0.525) 2.13 A52P1107697 ENSMUSG00000075275 1.179 (0.819 to 1.699) 1.28 (1.181 to 1.387) 0.558 (0.534 to 0.584) 2.11 A51P449995 C6 1.103 (0.87 to 1.4) 1.407 (1.13 to 1.752) 0.523 (0.505 to 0.542) 2.11 A51P359173 B230112P13Rik 1.043 (0.973 to 1.119) 1.139 (1.027 to 1.262) 0.497 (0.451 to 0.549) 2.10 A51P101283 1.098 (0.715 to 1.686) 1.353 (1.285 to 1.424) 0.53 (0.48 to 0.585) 2.07 A52P58080 Arhgef12 1.044 (0.972 to 1.122) 1.25 (1.028 to 1.52) 0.511 (0.483 to 0.54) 2.05 A52P445360 Krt20 1.063 (0.926 to 1.219) 1.098 (1.074 to 1.123) 0.527 (0.452 to 0.613) 2.02 A52P507448 1.052 (0.935 to 1.184) 1.133 (1.065 to 1.205) 0.525 (0.522 to 0.528) 2.00
A51P291906 Tlr3 0.775 (0.548 to 1.096) 0.812 (0.729 to 0.904) 2.123 (2.03 to 2.219) 0.365 A51P504194 Il1f6 0.742 (0.558 to 0.986) 0.941 (0.874 to 1.014) 1.988 (1.798 to 2.198) 0.373 A52P630673 Gpr62 0.931 (0.768 to 1.129) 0.704 (0.569 to 0.871) 2.12 (2.054 to 2.189) 0.439 A52P300533 2310043M15Rik 0.964 (0.848 to 1.097) 0.724 (0.58 to 0.903) 2.111 (1.886 to 2.364) 0.457 A52P523146 Rptn 0.918 (0.819 to 1.029) 0.847 (0.738 to 0.971) 1.919 (1.763 to 2.089) 0.478
Kiso et al. www.pnas.org/cgi/content/short/0808324106 8of9 Table S2. Primer sequences for real-time quantitative PCR Primer Direction Sequence (5Ј–3Ј) Product size, bp
A830053O21Rik F GTGGCAAAGGAGGATGTCTT 102 R GAACAAGGGGTTGACCAAGT Dsc2 F CCAGGATATGGATGGCCAGT 51 R ATGCACTTTGCTGTTGTGTGC Foxn1 F GTCGGAAAAGAAGCAACAGC 260 R AGGGCCAAGTCTGTAGAGCA Foxq1 F ACGAGTACCTCATGGGCAAG 88 R TGACGAAACAGTCGTTGAGC Hoxc13 F CCTCTACAGCCCGAAGTGAG 229 R GCGCTTTAGATTTGCTGACC Krt32 F AGTCCCAGAGGGACCTGAGT 123 R GTCCACTTCCTGGTTCTGGT Krt35 F AGGCCCAATCACTGAGAAGA 93 R CGTCAAGGCCTAAAGGACAA Krt82 F TCTATGGGGCTGAAGACCAG 123 R GGTGGCTTTGAAGAAATGA Krt85 F CCAGCTTTACCTGTGGGAGC 51 R CCTGTCACTAAGCGAAGCGC Krtap5-4 F CACAGATCTCAGGCAGCAGA 111 R TGTTGGAGGTGTCTTTGGTG Krtap12-1 F CAAGCCTGTCACCTGTAGCA 129 R CCTGGTGCGAACTCTAAACC Krtap17 F CCCACACCTGTGTGTGAGAC 120 R TGCAAACGAGTCAGGAGATG Msx2 F AACACAAGACCAACCGGAAG 103 R CGCTCTGCTATGGACAGGTA Msx2 (Fig. S5) F CGGTCAAGTCGGAAAATTCCG 233 R GTTCAGAGAGCTGGAGAACTC Sox21 F CCTGGGCAGCGTGGCGGA 164 R CAGACTGCGGGAAGAAGACG -actin F ATAGGAGTCCTTCTGACCCATTCC 155 R ATGACGATATCGCTGCGCTGGT Gapdh F ACCACAGTCCATGCCATCAC 452 R TCCACCACCCTGTTGCTGTA
F, forward.; R, reverse.
Kiso et al. www.pnas.org/cgi/content/short/0808324106 9of9