Molecular Phylogeny of the Higher Taxa of Odonata (Insecta) Inferred from COI, 16S Rrna, 28S Rrna, and EF1 Sequences

Home , Aeshna crenata, Aeshnoidea, Anisogomphus, Asiagomphus, Burmagomphus, Calopterygoidea

bs_bs_banner

Entomological Research 44 (2014) 65–79

RESEARCH PAPER Molecular phylogeny of the higher taxa of Odonata (Insecta) inferred from COI, 16S rRNA, 28S rRNA, and EF1-α sequences Min Jee KIM1, Kwang Soo JUNG2, Nam Sook PARK3, Xinlong WAN1,4, Ki-Gyoung KIM5, Jumin JUN6, Tae Joong YOON7, Yeon Jae BAE7, Sang Mong LEE3 and Iksoo KIM1

1 Department of Applied Biology, College of Agriculture & Life Sciences, Chonnam National University, Gwangju, Korea 2 College of Natural Sciences, Andong National University, Andong, Korea 3 College of Natural Resources & Life Science, Pusan National University, Pusan, Korea 4 Institute of Health and Environmental Ecology, Wenzhou Medical College, Wenzhou City, Zhejiang, China 5 Biological Resources Research Department, National Institute of Biological Resources, Incheon, Korea 6 Wildlife Genetic Resources Center, National Institute of Biological Resources, Incheon, Korea 7 Environmental Science and Ecological Engineering, College of Life Sciences and Biotechnology, Korea University, Seoul, Korea

Correspondence Abstract Iksoo Kim, Department of Applied Biology, College of Agriculture & Life Sciences, In this study, we sequenced both two mitochondrial genes (COI and 16S rRNA) Chonnam National University, Gwangju and nuclear genes (28S rRNA and elongation factor-1α) from 71 species of 500-757, Korea. Odonata that represent 7 superfamilies in 3 suborders. Phylogenetic testing for Email: [email protected] each two concatenated gene sequences based on function (ribosomal vs protein- coding genes) and origin (mitochondrial vs nuclear genes) proved limited resolu- Received 6 September 2013; tion. Thus, four concatenated sequences were utilized to test the previous accepted 6 March 2014. phylogenetic hypotheses of higher taxa of Odonata via Bayesian inference (BI) and doi: 10.1111/1748-5967.12051 maximum likelihood (ML) algorithms, along with the data partition by the BI method. As a result, three slightly different topologies were obtained, but the BI tree without partition was slightly better supported by the topological test. This topology supported the suborders Anisoptera and Zygoptera each being a monophyly, and the close relationship of Anisozygoptera to Anisoptera. All the families represented by multiple taxa in both Anisoptera and Zygoptera were consistently revealed to each be a monophyly with the highest nodal support. Unlike consistent and robust familial relationships in Zygoptera those of Anisoptera were partially unresolved, presenting the following relationships: ((((Libellulidae + Corduliidae) + Macromiidae) + Gomphidae + Aeshnidae) + Anisozygoptera) + (((Coenagrionidae + Platycnemdidae) + Calopterygidae) + Lestidae). The subfamily Sympetrinae, represented by three genera in the anisopteran family Libellulidae, was not monophyletic, dividing Crocothemis and Deielia in one group together with other subfamilies and Sympetrum in another independent group.

Key word: COI, elongation factor-1α, Odonata phylogeny, 16S rRNA, 28S rRNA.

is characterized by a broader hindwing, possession of the Introduction crossvein that divides the discoidal cell into a triangle and The insect order Odonata contains approximately 5500 super triangle in both wings, and outstretched wings when at species and is divided into three suborders: Anisoptera, rest, whereas Zygoptera is characterized by a hindwing Zygoptera, and Anisozygoptera (Toﬁlski 2004). Anisoptera essentially similar to the forewing, wings parallel to the

© 2014 The Entomological Society of Korea and Wiley Publishing Asia Pty Ltd M. J. Kim et al. body when at rest, and widely separated eyes (Needham 16S and 28S rRNAs from 32 species belonging to 1903; Tillyard 1923, 1928). The third suborder Anisoptera, Anisozygoptera, and Zygoptera (Fig. 1H). Both Anisozygoptera is composed of two living species, found in of these studies, that included limited taxonomic diversity, Japan and in the Himalayas, respectively. Although the have shown paraphyly of Zygoptera, placing the damselfly Anisozygoptera is morphologically intermediate between family Lestidae, belonging to Lestoidea, as the sister to Anisoptera and Zygoptera in adult body and wings, this either the monophyletic Anisoptera (Fig. 1G) or the suborder is often grouped together with Anisoptera, under monophyletic Anisoptera + Anisozygoptera (Fig. 1H). Sub- the name Epiprocta (Bechly 1996; Lohmann 1996; Trueman sequent further extensive work was performed by Fleck 1996; Rehn 2003; Hasegawa & Kasuya 2006). et al. (2008) based on the 2026 aligned positions from 16S Along with the phylogenetic position of Anisozygoptera rRNA, tRNAVal, and 12S rRNA. With the inclusion of 121 there have been many studies that have attempted to resolve species in 12 families and five superfamilies for Anisoptera, the relationships within the Odonata, but conflicting rela- one species for Anisozygoptera, and 17 species in seven tionships still exist. One of the unresolved relationships families and four superfamilies for Zygoptera, this study includes each monophyly of Anisoptera and Zygoptera. The also supports paraphyly of Zygoptera, associating the dam- monophyly of Anisoptera has been proposed by wing vena- selfly family Lestidae to the monophyletic Anisoptera + tion (Fraser 1957; Fig. 1A), flight apparatus and copulatory Anisozygoptera (Fig. 1I). On the other hand, molecular data structures (Pfau 1991; Fig. 1B), and also from wing venation by Dumont et al. (2010) and combined data of morphologi- with the cladistic parsimony method (Trueman 1996; cal, molecular, and fossil record by Bybee et al. (2008) have Fig. 1C), whereas the non-monophyly of Zygoptera was shown monophyletic Zygoptera (Figs 1J–L). proposed in these studies (Figs 1A–C). On the other hand, Among the anisopteran families the Libellulidae is the the monophyly of both suborders have been supported by largest group that is distributed world-wide containing other several studies (Carle 1982; Bechly 1996; Rehn 2003; ∼1000 species in 11–13 subfamilies, with one of the sub- Figs 1D–F). families, Sympetrinae, containing ∼200 species in 22 genera Monophylies of several superfamilies have also been (Tillyard 1917; Fraser 1957; Bridges 1994; Steinmann 1997; ambiguous among morphological studies, providing conflict Pilgrim & Von Dohlen 2008). The monophyly of and unresolved relationships. For example, Fraser (1957) Sympetrinae has been supported by morphological studies. supported monophylies of superfamilies for a limited For example, Fraser (1957) classified this subfamily based group such as the Libelluloidea for Anisoptera and the on four synapomorphic characters such as non-extended last Coenagrionoidea and the Calopterygoidea for Zygoptera. antenodal crossvein (ACV) of the forewings beyond the Pfau (1991) supported monophylies for the Coenagrionoidea subcosta, placement of the arculus between the first and and Calopterygoidea, and Libelluloidea. Trueman (1996) second ACV, conspicuous radial and medial planates, and supported monophyly only for Libelluloidea, Carle (1982) broad hindwing base with a highly visible anal loop. for Coenagrionoidea and Libelluloidea, Bechly (1996) for However, these characters are shared with other subfamilies, Calopterygoidea, Coenagrionoidea, and Libelluloidea, and lacking synapomorphy for the subfamily Sympetrinae (Ware Rehn (2003) only for Libelluloidea. Due to the lack of et al. 2007; Pilgrim & Von Dohlen 2008). monophylies in most superfamilies, familial relationships In order to expand our understanding for odonate phylog- are also mostly unresolved and inconsistent among studies. eny and enrich molecular markers, in this study we sequenced Nevertheless, the sister relationship of Corduliidae and a total of ∼3.8 kb consisting of mitochondrial COI (1147 bp), Libellulidae within Libelluloidea was concordantly found mitochondrial 16S rRNAincluding tRNALeu (UUR) and tRNAVal in Trueman (1996), Bechly (1996), and Rehn (2003) (1368–1374 bp), nuclear 28S rRNA (830–842 bp), and (Figs 1C,E,F). Among superfamilial relationships in nuclear elongation factor-1α (EF-1α) (541 bp). These Anisoptera, eitherAeshnoidea (Figs 1A,B,E) or Gomphoidea sequences were utilized to infer evolutionary patterns of each (Figs 1C,F) has been placed as the most basal lineage. Other gene, and to test the previous phylogenetic hypotheses of superfamilial relationships are mostly obscured by non- Odonata. monophyletic superfamilies in Anisoptera. Molecular phylogenetic studies within Odonata provided Materials and methods somewhat more consistent relationships regarding higher taxonomic relationships among studies, but still relation- Taxon sampling ships within several taxonomic levels are neither well resolved nor consistent (Figs 1G–L). Saux et al. (2003) The 71 odonate species included in this study (Table S1) is sequenced a partial 12S ribosomal RNA (rRNA) from 26 composed of 3 of the 3 suborders, 7 of the 8 superfamilies, species belonging to Anisoptera and Zygoptera (Fig. 1G). and 10 of the 28 families in world-wide odonate diversity Also, Hasegawa and Kasuya (2006) sequenced both a partial (Bridges 1994; Rehn 2003). At least one family was

66 Entomological Research 44 (2014) 65–79 © 2014 The Entomological Society of Korea and Wiley Publishing Asia Pty Ltd 04TeEtmlgclSceyo oe n ie ulsigAi t Ltd Pty Asia Publishing Wiley and Korea of Society Entomological The 2014 © Research Entomological

A Fraser (1957) B Pfau (1991) C Trueman (1996) Lestidae Lestoidea (Z) Coengrionidae Coengrionoidea (Z) Lestidae Lestoidea (Z) Calopterygidae Calopterygoidea (Z) Lestidae Lestoidea (Z) Coengrionidae Coengrionoidea (Z) Epiophlebioidea (AZ) Epiophlebiidae Calopterygidae Calopterygoidea (Z) Calopterygidae Calopterygoidea (Z) Aeshnidae Aeshnoidea (A) Epiophlebiidae Epiophlebioidea (AZ) Aeshnidae Aeshnoidea (A) Gomphidae Gomphoidea (A) Aeshnidae Aeshnoidea (A) Libellulidae Libelluloidea (A) Cordulegastridae Cordulegastroidea (A) Gomphidae Gomphoidea (A) Cordulegastridae Cordulegastroidea (A)

44 Libellulidae Libelluloidea (A) Cordulegastridae Cordulegastroidea (A) Gomphidae Gomphoidea (A)

21)65–79 (2014) Coengrionidae Coengrionoidea (Z) Libellulidae Libelluloidea (A) Epiophlebiidae Epiophlebioidea (AZ)

D Carle (1982) E Bechley (1996) F Rehn (2003) Coenagrionidae Coenagrionoidea (Z) Lestidae Lestoidea (Z) Lestidae Lestoidea (Z) Lestidae Lestoidea (Z) Coenagrionidae Coenagrionoidea (Z) Coenagrionidae Coenagrionoidea (Z) Calopterygidae Calopterygoidea (Z) Calopterygidae Calopterygoidea (Z) Calopterygidae Calopterygoidea (Z) Libellulidae Corduliidae Libelluloidea (A) Aeshnidae Aeshnoidea (A) Aeshnidae Aeshnoidea (A) Cordulegastridae Cordulegastroidea (A) Gomphidae Gomphoidea (A) Macromiidae Cordulegastridae Cordulegastroidea (A) Libellulidae Libelluloidea (A) Cordulegastridae Cordulegastroidea (A) Aeshnoidea (A) Gomphidae Gomphoidea (A) Libellulidae Libelluloidea (A) Aeshnidae Gomphidae Epiophlebiidae Epiophlebioidea (AZ) Epiophlebiidae Epiophlebioidea (AZ) Gomphoidea (A) Epiophlebiidae Epiophlebioidea (AZ)

G Saux et al. (2003) H Hasegawa and Kasuya (2006) I Fleck et al. (2008) Libellulidae Libelluloidea (A) Libellulidae Libelluloidea (A) Corduliidae Macromiidae Lestidae Lestoidea (Z) Petaluridae Aeshnoidea (A) Cordulegastridae Cordulegastroidea (A) Aeshnidae Aeshnoidea (A) Cordulegastridae Cordulegastroidea (A) Gomphidae Gomphoidea (A) Cordulegastridae Cordulegastroidea (A) Gomphidae Gomphoidea (A) Aeshnidae Aeshnoidea (A) Libellulidae Libelluloidea (A) Epiophlebidae Epiophlebioidea (AZ) Epiophlebidae Epiophlebioidea (AZ) Lestidae Lestoidea (Z) Gomphidae Gomphoidea (A) Lestidae Lestoidea (Z) Calopterygidae Calopterygoidea (Z) Coenagrionidae Coenagrionoidea (Z) Coengrionidae Coenagrionoidea (Z) Platycnemididae Calopterygidae Calopterygoidea (Z) Coenagrionoidea (Z) Calopterygidae Calopterygoidea (Z) Coengrionidae Coengrionidae Coenagrionoidea (Z) Platycnemididae

J Dumont et al. (2010) K Bybee et al. (2008) L Bybee et al. (2008) Coengrionidae I Coenagrionoidea (Z) Calopterygidae Calopterygoidea (Z) Coengrionidae Calopterygidae Calopterygoidea (Z) Coenagrionoidea (Z) Platycnemididae Platycnemididae Coengrionidae Coengrionoidea (Z) Coenagrionoidea (Z)

Coengrionidae II Calopterygidae Calopterygoidea (Z) Platycnemididae Odonata of phylogeny molecular A Lestidae Lestoidea (Z) Lestidae Lestoidea (Z) Lestidae Lestoidea (Z) Libellulidae Corduliidae Libellulidae Macromiidae Libelluloidea (A) Macromiidae Libelluloidea (A) Macromiidae Libelluloidea (A) Corduliidae Libellulidae Corduliidae Gomphidae Gomphoidea (A) Gomphidae Gomphoidea (A) Gomphidae Gomphoidea (A) Aeshnidae Aeshnoidea (A) Aeshnidae Aeshnoidea (A) Aeshnidae Aeshnoidea (A) Cordulegastridae Cordulegastroidea (A) Epiophlebidae Epiophlebioidea (AZ) Epiophlebidae Epiophlebioidea (AZ) Epiophlebiidae Epiophlebioidea (AZ)

Figure 1 Representation of previous phylogenetic hypotheses of Odonata. (A)–(F) represent the hypotheses based on morphological characters, (G)–(J) represent the hypotheses based on molecular analysis, and (K) and (L) represents the hypotheses based on both molecular and morphological data. Within parentheses indicate subordinal names (A, Anisoptera; Z, Zygoptera; 67 and AZ, Anisozygoptera). Dots on nodes indicate monophyly of suborders. We followed Dijkstra et al. (2013a) for classiﬁcation of Odonata. M. J. Kim et al.

Table 1 Primer sequences used to amplify each gene in Odonata

Gene Primer name Sequences (from 5’ to 3’) References

COI ODO-COI-F2 GGATCTCTAATTGGAGATGATCA Designed in this study ODO-COI-R1 CGTCGTGGTATTCCTCTTAGT Designed in this study ODO-COI-R2 TCTGAATATCGTCGTGGTATTCC Designed in this study ODO-COI-Inter-F4† ATCAAATACCWYTATTTGTATGAGC Designed in this study ODO-COI-Inter-R1† CTTCDGGRTGTCCAAAGAATC Designed in this study ODO-COI-Inter-R2† GAAATTATWCCAAATCCTGG Designed in this study 16S rRNA ODO-16S-F1 ATTGGGACCTTTACGAATTTGA Designed in this study ODO-16S-F2 TTATTTGGCCCCTTACGAAT Designed in this study ODO-16S-R1 GCTCTAAAATATGCACACATCG Designed in this study ODO-16S-R2 TATGTCAGGTCAAGGTGCAA Designed in this study ODO-16S-Inter-F2† ATTATGCTACCTTTGCACGGTC Designed in this study ODO-16S-Inter-R1† GGCAAATATARTTCTCGCCTG Designed in this study 28S rRNA ODO-28S-F1 AAGGTAGCCAAATGCCTCATC Hasegawa and Kasuya (2006) ODO-28S-R1 AGTAGGGTAAAACTAACCT Hasegawa and Kasuya (2006) EF1-α Lib EF1Fa GGAGAATTCGAAGCTGGTATCTC Pilgrim and Von Dohlen (2008) Lib EF1Ra GACACGTTCTTCACGTTGAAACC Pilgrim and Von Dohlen (2008)

†Internal primers used for cycle sequencing. included in the analysis to represent the odonate superfam- (Hasegawa & Kasuya 2006; Pilgrim & Von Dohlen 2008). ily, but Hemiphlebioidea, represented by a single species The primer information is listed in Table 1. (Hemiphlebia mirabilis), was not included in this study. On Mitochondrial COI gene was amplified with AccuPower the other hand, the Epiophlebia superstes (from Japan), PCR PreMix (Bioneer, Daejeon, Korea) under the following which is one of the two species belonging to Anisozygoptera conditions: initial denaturation for 7 min at 94°C, followed was included in this study. Voucher specimens were depos- by 35 cycles of 1 min at 94°C, 1 min at 48–53°C, and 1 min ited in the National Institute of Biological Resources, at 72°C, with a final 7-minute extension at 72°C. For other Incheon, Korea. genes annealing temperatures were only variable (48–51°C for both 16S rRNA and 28S rRNA and 50–53°C for EF1-α). The PCR product was purified with a PCR purification DNA extraction, PCR, cloning, and sequencing Kit (Bioneer). The COI gene amplicons were directly With the plan to increase the gene number and sequence sequenced, whereas those from other genes were cloned into length for the subsequent expanded study we used all fresh a pGEM-T Easy vector (Promega). For the cloning process, specimens that were newly collected, except for E. superstes. XL1-Blue competent cells (Stratagene, Santa Clara, CA, After collection in the field, the samples were frozen at –70°C USA) were transformed with the ligated DNA, and the until being used for molecular analysis. Total DNA was resultant plasmid DNA was isolated using a Wizard Plus SV extracted from hind legs or partial thorax muscle using a Minipreps DNA Purification System (Promega). DNA Wizard Genomic DNA Purification Kit, in accordance with sequencing was conducted using the ABI PRISM BigDye the manufacturer’s instructions (Promega, Madison, WI, Terminator ver. 3.1 Cycle Sequencing Kit with an ABI 377 USA). To amplify 1147 bp of COI gene the primers, ODO- Genetic Analyzer (PE Applied Biosystems, Foster City, CA, COI-F2 for the forward direction and both ODO-COI-R1 and USA). For COI and 16S rRNA genes internal primers were ODO-COI-R2 for the reverse direction were designed from used for cycle sequencing (Table 1). All products were three full-length mitochondrial genomes of Odonata sequenced from both strands. (Yamauchi et al. 2004; Zhang et al. 2008; Lee et al. 2009) and used selectively for better amplification. From the same Sequence analysis and alignment full-length sequence information two sets of primers for 16S rRNAwere designed from the 5’end of ND1 and the 3’end of Sequence delimitation and alignment were conducted using tRNAVal to amplify ∼1370 bp encompassing the whole CLUSTAL W2 (Larkin et al. 2007). Each complete gene tRNALeu and 16S rRNA, and used selectively for better ampli- sequence was compared with available GenBank-registered fication. On the other hand, the primers for both ∼835 bp of sequences through Blast search (http://blast.ncbi.nlm.nih 28S rRNA and 541 bp of elongation factor-1 alpha (EF-1α) .gov/Blast.cgi) to verify the appropriacy of sequences. were each adapted from pre-existing published ones Additionally, COI sequences were searched for BOLD-IDS

Table 2 List of substitution models Data sets Partition Selected model Applied model

COI – GTR+I+G GTR+I+G 16S rRNA – HKY+I+G HKY+I+G 28S rRNA – GTR+I+G GTR+I+G EF1-α – SYM+I+G GTR+I+G COI + 16S rRNA – GTR+I+G GTR+I+G COI + 16S rRNA 2 Ind. Ind. 28S rRNA + EF1-α – GTR+I+G GTR+I+G 28S rRNA + EF1-α 2 Ind. Ind. All gene (COI + 16S rRNA + 28S rRNA + EF1-α) – GTR+I+G GTR+I+G All gene (COI + 16S rRNA + 28S rRNA + EF1-α) 4 Ind. Ind.

–, not applied; Ind., individual model was applied for each gene.

(Ratnasingham & Hebert 2007) to compare sequences to 1974) Modeltest ver. 3.7 (Posada & Crandall 1998) was those of identical or similar species. In order to obtain used. Individual models and data sets are, respectively, pro- codon-based alignment for each protein-coding gene (PCG), vided in Table 2. The maximum likelihood (ML) analyses the nucleotide sequence of each PCG was subjected to were conducted using PHYML (Guindon et al. 2005), RevTrans ver. 1.4 (Wernersson & Pedersen 2003). The well- specifying the number of substitution rate categories as aligned conserved blocks of each PCG were selected using four and the starting tree as a BIONJ distance-based tree. GBlocks 0.91b (Castresana 2000), with the minimum length The confidence values of the ML tree were evaluated via a of a block set to 10 and allowed gap positions set to none for bootstrap test with 1000 iterations. The Bayesian inference COI and EF1-α. On the other hand, the 16S and 28S rRNA (BI) analyses were conducted using MrBayes ver. 3.1 genes were set for the parameters for rDNA alignments at (Huelsenbeck & Ronquist 2001). The model chosen by minimum length of a block as 5, allowing gaps in half Modeltest was applied to each partition unlinked, when position, as recommended in Massana et al. (2004). Each partition option was employed for BI analysis. When a gene and concatenated gene sequences were utilized to best-fit model is absent either in BI, ML, or both methods, obtain sequence divergence at each taxonomic level using the next available model with the second highest AIC score unrooted pairwise distance with PAUP* ver. 4.01b10 was chosen for BI and ML analyses. Two independent runs (Swofford 2002). Nucleotide composition was calculated by of four incrementally heated Markov chain Monte Carlo MEGA 4 (Tamura et al. 2011). (MCMC) chains (one cold chain and three hot chains) were simultaneously run for one-to-three million generations depending on the dataset, with sampling conducted Phylogenetic analyses every 100 generations. The convergence of MCMC, which Previous phylogenetic studies have shown uncertainty of was monitored by the average standard deviation of split the sister to Odonata, presenting Paleoptera hypothesis frequencies, reached below 0.01 within one-to-three [Neoptera + (Ephemeroptera + Odonata)], Metapterygota million generations depending on the dataset, and the hypothesis [Ephemeroptera + (Odonata + Neoptera)], and initial 25% of the sampled trees were discarded as burn-in. Chiastomyaria hypothesis [Odonata + (Ephemeroptera + The confidence values of the BI tree are presented as the Neoptera)] (Hennig 1981; Hovmöller et al. 2002; Kjer 2004; Bayesian posterior probabilities (BPP) in percentages. Kjer et al. 2006; Zhang et al. 2008). Selecting particular Phylogenetic analyses were performed for each of the gene neopteran orders as outgroup is difficult to achieve practically sequences and the concatenated sequences. with certainty, because they consist of about 30 orders that Different tree topologies obtained through different can be divided further into several groups (e.g., Hemipteroid dataset or tree construction methods was tested for statistical assemblage, Orthopteroid assemblage, and Holometabola). confidence using Treefinder (Jobb et al. 2004) applying Thus, we used two ephemeropteran species as outgroups respective models. The values of each topology were deter- (Ephemera orientalis and Cloeon dipterum) considering mined via six statistical tests each with 5000 replications: recent phylogenetic studies, which showed either a sister expected-likelihood weights (ELW) (Strimmer & Rambaut relationship between Ephemeroptera and Odonata (Ishiwata 2002), bootstrap probability (Felsenstein 1981), Kishino– et al. 2011) or a rather basal position of Ephemeroptera Hasegawa (KH) (Kishino & Hasegawa 1989), Shimodaira– compared to Odonata (Simon et al. 2012). Hasegawa (SH) (Shimodaira & Hasegawa 1999), weighted In order to select a substitution model via comparison of SH (WSH) (Shimodaira & Hasegawa 1999), and approxi- the Akalike Information Criterion (AIC) scores (Akaike mately unbiased (AU) (Shimodaira 2002).

Table 3 Within-superfamily, within-family No. of Total and within-subfamily sequence divergence α Taxon species COI 16S rRNA 28S rRNA EF-1 genes (%) in Odonata

Anisoptera Libelluloidea 30 20.32 21.29 5.45 13.67 15.40 Libellulidae 26 20.23 16.26 3.03 9.93 12.11 Corduliidae 1 Macromiidae 4 17.27 12.23 1.69 0.73 9.41 Aeshnoidea 7 12.44 4.84 0.36 5.51 5.92 Aeshnidae 7 12.44 4.84 0.36 5.51 5.92 Gomphoidea 11 18.97 17.56 4.60 6.65 13.37 Gomphidae 11 18.97 17.56 4.60 6.65 13.37 Anisozygoptera Epiophlebioidea 1 Epiophlebiidae 1 Zygoptera Calopterygoidea 2 17.18 13.85 0.50 2.95 10.31 Calopterygidae 2 17.18 13.85 0.50 2.95 10.31 Coenagrionoidea 15 19.78 22.04 4.30 11.64 15.77 Coenagrionidae 13 18.44 18.88 4.30 9.79 13.61 Platycnemididae 2 15.13 9.72 0.89 3.21 8.07 Lestoidea 4 18.89 14.76 1.34 5.36 11.00 Lestidae 4 18.89 14.76 1.34 5.36 11.00

ering the two types of data are unlinked and evolve under Results different evolutionary constraints, it would be a good prac- tice to combine both mitochondrial and nuclear genes (Lin Dataset characteristics & Danforth 2004). In ﬁve odonate families, which were The sequence lengths of the 71 odonate species were 1147 bp represented by multiple species the divergence of concat- in COI, 1545 bp–1598 bp in 16S rRNA, 822–842 bp in 28S enated sequences ranked in the order of Coenagrionidae rRNA, and 541 bp in EF-1α, respectively, revealing length (13.61%), Gomphidae (13.37%), Libellulidae (12.11%), variations due to insertion/deletion in the rRNAs, but not in Lestidae (11.00%), Macromiidae (9.4%), and Aeshnidae the protein-coding COI and EF-1α (Table S2). The sequence (5.92%), although the number of taxonomic groups in each length of the 16S rRNA and 28S rRNA increased to 2121 bp family differ from each other (Table 3). and 868 bp, respectively, when gaps were introduced to The average A/T content of concatenated four genes was improved alignment. However, the conserved blocks selected 62.2% (Table S2). In contrast, that of each mitochondrial with the inclusion of outgroups via GBlocks analysis gene was 65.7% in COI and 74.1% in 16S rRNA, respec- (Castresana 2000) provided 1147 bp in COI (100% of tively, showing higher A/T content than that of concatenated original sequences), 1584 bp in 16S rRNA (74% of origi- four genes. Between the two mitochondrial genes, the 16S nal sequences), 830 bp in 28S rRNA (96% of original rRNAgene evidenced obviously higherA/T content than was sequences), and 541 bp in EF-1α (100% of original detected in the COI gene. Such a trend has also been reported sequences), respectively (Table S2), providing a total of in many mitochondrial genomes studies, including those of 4002 bp. These conserved blocks for each gene and concat- the Odonata (Hong et al. 2009; Lee et al. 2009; Kim et al. enated gene were subsequently utilized for phylogenetic 2011). On the other hand, the nuclear gene demonstrates analysis. much lower A/T content compared to mitochondrial genes as Within-familial sequence divergence ranged from 43.3 % in 28S rRNA and 50.2 % in EF1-α (Table S2). 12.44%–20.23% in COI, 4.84%–18.88% in 16S rRNA, Relatively lower A/T content in the nuclear genes has also 0.36%–4.60% in 28S rRNA, and 5.36%–9.93% in EF1-α, been reported in many previous studies including that of resulting in 5.92%–13.61% of divergence in concatenated odonate phylogeny (e.g., Bybee et al. 2008). sequences (Table 3). To the level of odonate families, thus, The A/T content was almost similar among taxonomic 28S rRNA showed the least divergence and EF1-α next, groups. For example, the A/T content of the four concat- revealing the conserved nature of nuclear genes, whereas enated genes between two suborders was 62.6% in mitochondrial genes were more variable (Table 3). Consid- Anisoptera, whereas it was 61.5% in Zygoptera (Table S2).

A B 50.0 40.0 40.0 30.0 30.0 20.0 20.0

10.0 10.0

0.0 0.0

C D 35.0 30.0 30.0 25.0 25.0 20.0 20.0 15.0 15.0 10.0 10.0 5.0 5.0 0.0 0.0

E 35.0

30.0

25.0

20.0

15.0 T

10.0 C A 5.0 G 0.0

Figure 2 Comparison of nucleotide composition of each gene at family level. (A) COI, (B) 16S rRNA, (C) 28S rRNA, and (D) EF-1α, and (E) total genes. The values at y-axis indicate percentage of nucleotide composition.

Likewise, the range of the A/T content among all species and function (rRNA genes vs PCGs) were performed, but the was 62.6%–68.5% in COI, 71.2%–73.0% in 16S rRNA, resolving power of the single and each two-gene combination 43.0%–43.8% in 28S rRNA, and 48.9%–51.7% in EF1-α, appeared to be insufﬁcient, in that splitting among members revealing a relatively small divergence range (Fig. 2). of the same family, substantially low node support, and/or both were often observed. For example, mitochondrial DNA- based phylogeny (COI + 16S rRNA) placed Anisoptera non- Gene-based phylogenetic analyses monophyly in all analyses (Figs S1A–C) and Zygoptera non- Phylogenetic analyses using individual genes (each COI, 16S monophyly in the BI method without partitioning and the ML rRNA, 28S rRNA, and EF-1α) and combination of each two method (Figs S1A,C). Nuclear DNA-based phylogeny (28S genes based on origin (mitochondrial genes vs nuclear genes) rRNA and EF-1α) was also unsatisfactory in that

Entomological Research 44 (2014) 65–79 71 © 2014 The Entomological Society of Korea and Wiley Publishing Asia Pty Ltd M. J. Kim et al. monophyletic Zygoptera was only obtained by the ML Corduliidae))), although a close relationship of method and monophyletic Anisoptera was never recovered Anisozygoptera to Anisoptera was obvious (Fig. 3B). Tree (Figs S1D–F). Further, non-monophyletic family was only C obtained by the ML method was most well resolved, observed when two concatenated nuclear genes were used. supporting the sister relationship between Anisozygoptera For example, among seven genera in Coenagrionidae that is and Anisoptera, the monophyletic Anisoptera, and the divided into two subfamilies (Coenagrioninae and monophyletic Zygoptera, presenting (Anisozygoptera + Psuedagrioninae), the genus Ceriagrion that belongs to the (Gomphidae + (Aeshnidae + (Macromiidae + (Libellulidae + subfamily Psuedagrioninae was placed as the sister to the Corduliidae)))) (Fig. 3C). However, many nodes were very group composed of Platycnemididae and Calopterygidae, poorly supported. For example, the nodal support for the leaving other genera in the subfamily Coenagrioninae sister relationships between Libelluloidea and Aeshnoidea monophyletic in the nuclear DNA-based phylogeny, although was only 31% and the sister group Anisoptera and this phenomenon is much lessened in the mitochondrial Anisozygoptera was supported only by 72.4% (Fig. 3C). DNA-based phylogeny (Figs S1D–F). Previously, the family In order to further clarify the inconsistency presented in Coenagrionidae has been questioned for its monophyly, but the three trees, topological tests (Jobb et al. 2004) were the genera included in current study have never been ques- performed, applying the GTR + I + G model. The six statis- tioned for their non-monophyletic status within the family tical tests performed (ELW, BP, KH, SH, WSH, and AU) (Bybee et al. 2008; Carle et al. 2008; Dumont et al. 2010). confirmed that tree C (Fig. 3C) evidenced confidence values This may have occurred because nuclear genes have better completely deviant from the range of 95%, providing 0% in resolution for deep phylogeny, whereas mitochondrial genes six analyses (Table 4). Tree B (Fig. 3B) evidenced confi- have some merit for recent phylogenetic divergence. When dence values well within the range of the 0.95% only in the four genes were concatenated, such a non-monophyletic SH and WSH tests, and marginally in the KH, ELW, and BP family was not observed (Fig. 3). Therefore, we limited our tests, suggesting that topology B has the possibility to be data presentation and discussion on the phylogenetic recon- accepted, but overall statistical confidence is comparatively struction to the trees generated on the basis of the four very low (Table 4). On the other hand, tree A (Fig. 3A) was concatenated gene sequences. supported with the confidence values well within the range of 95% in all analyses, providing values of 0.95%–1.0%, suggesting that tree A, which was obtained by the BI method Concatenated phylogenetic analyses and without partitioning, is comparatively well accepted in topological test current data analysis. The analyses based on concatenation of the four genes, with Twenty-six species of Libellulidae included in this different analytical methods (BI and ML methods) and study belong to five subfamilies: Libellulinae, Sym- BI-based partitioning strategy (four partitions based on petrinae, Trameinae, Brachydiplactinae, and Trithemistinae genes) recovered monophylies of all families and revealed (Steinmann 1997). Three topologies obtained in this study consistent familial and superfamilial relationships of consistently divided the Libellulidae into two groups: one that Zygoptera as ((Coenagrionoidea + Calopterygoidea) + includes all Sympetrum and another that includes remaining Lestoidea) in all analyses (Fig. 3). However, the relationships subfamilies and two species of Sympetrinae (Crocothemis among Anisozygoptera and anisopteran superfamilies were servilia and Deielia phaon), presenting the Sympetrinae non- fluctuating, presenting three topologies (termed treeA, B, and monophyly (Figs 3A–C). In the latter group, each C. servilia C; Figs 3A–C). Tree A was supported by the BI method and D. phaon grouped together with each Brachydiplactinae without partitioning (Fig. 3A), tree B by the BI method with and Trithemistinae, both of which were represented by a four partitions (Fig. 3B), and tree C by the ML method single species. (Fig. 3C). Tree A clearly placed Anisoptera and Anisozygoptera as sisters to each other and supported the monophyletic Anisoptera by 0.82 BPP. Discussion On the other hand, the anisopteran superfamilies Libelluloidea, Gomphoidea, and Aeshnoidea were unre- Subordinal relationships solved, presenting the relationships (Anisozygoptera + (Aeshnidae + Gomphidae + (Macromiidae + (Libellulidae + The Anisozygoptera, which is represented by a relict family Corduliidae)))) (Fig. 3A). Tree B obtained with the partition Epiophlebiidae and Anisoptera together are often named as option was the least resolved in that the Anisozygoptera, Epiprocta on the basis of morphological characters Aeshnoidea, Gomphoidea, and Libelluloidea all were unre- (Lohmann 1996). Our analysis on the bases of four concat- solved, presenting the relationships (Anisozygoptera + enated genes also supported Epiprocta (Fig. 3). This rela- Aeshnidae + Gomphidae + (Macromiidae + (Libellulidae + tionship has also been supported by several previous

1.00 Orthetrum japonicum A 1.00 Orthetrum albistylum Orthetrum lineostigma 1.00 0.95 Orthetrum triangulare Lib 1.00 Libellula quadrimaculata 1.00 Libellula angelina 0.96 Lyriothemis pachygastra 1.00 Nannophya pygmaea Bra 0.98 0.95 Crocothemis servilia 1.00 Deielia phaon Sym Pseudothemis zonata Tri 1.00 Pantala flavescens Tra Rhyothemis fuliginosa Libellulidae 1.00 Sympetrum parvulum 1.00 Sympetrum kunckeli Libelluloidea 1.00 Sympetrum eroticum 1.00 1.00 Sympetrum baccha 1.00 Sympetrum pedemontanum 1.00 Sympetrum infuscatum Sym 0.62 Sympetrum risi 1.00 Sympetrum darwinianum 0.95 1.00 1.00 Sympetrum frequens 0.97 Sympetrum speciosum Sympetrum uniforme 1.00 Sympetrum striolatum 1.00 Sympetrum fonscolombii Somatochlora graeseri Corduliidae 1.00 Macromia amphigena 1.00 Macromia manchurica 1.00 Macromia daimoji Macromiidae

Epophthalmia elegans Anisoptera 1.00 Shaogomphus postocularis 1.00 Asiagomphus coreanus 1.00 Burmagomphus collaris 0.69 Anisogomphus maacki 0.82 1.00 Davidius lunatus 1.00 Trigomphus citimus Gomphidae Gomphoidea Trigomphus nigripes 0.98 1.00 1.00 Lamelligomphus ringens 1.00 Nihonogomphus minor Sieboldius albardae Gomphidia confluens 0.95 1.00 Anax nigrofasciatus 1.00 Anax parthenope

1.00 Aeschnophlebia longistigma 1.00 Polycanthagyna melanictera Aeshnidae Aeshnoidea 1.00 Aeshna crenata Aeshna mixta 1.00 Gynacantha japonica Epiophlebia superstes Epiophlebiidae Anisozygoptera 1.00 Paracercion v nigrum 1.00 Paracercion melanotum Paracercion calamorum 1.00 1.00 Paracercion sieboldii 1.00 Ischnura senegalensis 1.00 1.00 Ischnura elegans Ischnura asiatica 1.00 1.00 Coenagrion johanssoni Coenagrionidae Coenagrionoidea Coenagrion lanceolatum 0.98 Mortonagrion selenion 1.00 Ceriagrion auranticum 1.00 1.00 Ceriagrion nipponicum Ceriagrion melanurum 1.00 1.00 Platycnemis phyllopoda Copera tokyoensis Platycnemididae 1.00 Calopteryx japonica 0.99 Atrocalopteryx atrata Calopterygidae Calopterygiodea Zygoptera 1.00 Sympecma paedisca 1.00 Indolestes peregrinus Lestoidea 1.00 Lestes japonicus Lestidae Lestes temporaris 1.00 Ephemera orientalis Cloeon dipterum 0.1

Figure 3 The phylogenetic analyses using the concatenated mitochondrial COI, 16S rRNA, nuclear 28S rRNA, and EF-1α genes. (A) Bayesian Inference phylogram obtained with the dataset COI + 16S rRNA + 28S rRNA + EF-1α, which is not partitioned. The numbers at each node specify Bayesian posterior probabilities (BPP). (B) Bayesian Inference phylogram obtained with the dataset COI + 16S rRNA + 28S rRNA + EF-1α, which is divided into four partitions. The numbers at each node specify BPP. (C) Maximum Likelihood phylogram obtained with the dataset COI + 16S rRNA + 28S rRNA + EF-1α. The numbers at each node specify bootstrap percentage of 1000 pseudoreplicates. Two species of Ephemeroptera were used as outgroups. The subfamily names Lib, Bra, Sym, Tri, and Tri in Libellulidae were abbreviated for Libellulinae, Sympetrinae, Brachydiolacinae, Trithemistinae, and Trameinae, respectively. The scale bar indicates the number of substitutions per site.

1.00 Orthetrum japonicum 1.00 Orthetrum albistylum B Orthetrum lineostigma 1.00 0.95 Orthetrum triangulare Lib 1.00 Libellula quadrimaculata Libellula angelina 0.99 0.89 Lyriothemis pachygastra Nannophya pygmaea Bra 1.00 Crocothemis servilia 0.93 0.79 1.00 Deielia phaon Sym Pseudothemis zonata Tri 1.00 Pantala flavescens Tra Rhyothemis fuliginosa 1.00 Sympetrum parvulum Libellulidae 0.98 Sympetrum kunckeli Libelluloidea 1.00 Sympetrum eroticum 1.00 1.00 Sympetrum baccha 1.00 Sympetrum pedemontanum Sympetrum infuscatum 1.00 Sympetrum risi Sym 0.99 1.00 Sympetrum darwinianum 0.55 Sympetrum frequens 1.00 1.00 Sympetrum speciosum 1.00 Sympetrum uniforme 1.00 Sympetrum striolatum 0.99 Sympetrum fonscolombii Somatochlora graeseri Corduliidae 1.00 Macromia amphigena 1.00 Macromia manchurica 1.00 Macromia daimoji Macromiidae Epophthalmia elegans Anisoptera 1.00 Shaogomphus postocularis 1.00 Asiagomphus coreanus 0.98 Burmagomphus collaris 0.80 Anisogomphus maacki 1.00 Davidius lunatus 1.00 Trigomphus citimus 0.99 Gomphidae Gomphoidea 0.81 Trigomphus nigripes 1.00 1.00 Lamelligomphus ringens 1.00 Nihonogomphus minor Sieboldius albardae Gomphidia confluens 1.00 Anax nigrofasciatus 0.51 Anax parthenope 1.00 Aeschnophlebia longistigma 1.00 Polycanthagyna melanictera Aeshnidae Aeshnoidea 1.00 Aeshna crenata Aeshna mixta 1.00 Gynacantha japonica Epiophlebia superstes Epiophlebiidae Anisozygoptera 1.00 Paracercion v nigrum 1.00 0.59 Paracercion melanotum 1.00 Paracercion sieboldii

1.00 Paracercion calamorum a

1.00 Ischnura senegalensis i 1.00 n 1.00 Ischnura elegans o

Ischnura asiatica r 1.00 1.00 g Coenagrion johanssoni a Coenagrionoidea Coenagrion lanceolatum n 0.99 e

Mortonagrion selenion o

1.00 Ceriagrion auranticum C 1.00 1.00 Ceriagrion nipponicum Ceriagrion melanurum 1.00 1.00 Platycnemis phyllopoda Copera tokyoensis Platycnemididae 1.00 Calopteryx japonica Zygoptera 0.99 Atrocalopteryx atrata Calopterygidae Calopterygiodea 0.71 Sympecma paedisca 1.00 Indolestes peregrinus 1.00 Lestes japonicus Lestidae Lestoidea Lestes temporaris 1.00 Ephemera orientalis Cloeon dipterum 0.1

Figure 3 Continued morphological studies (Fraser 1957; Carle 1982; Pfau 1991; of cladistic parsimony method using the skeletal morphol- Bechly 1996; Trueman 1996; Rehn 2003) and molecular ogy and wing venation of adults, complemented with a few studies (Hasegawa & Kasuya 2006; Fleck et al. 2008). larval characters from 85 genera belonging to 45 families Among them Rehn (2003) supported Epiprocta on the basis and subfamilies. Recent comprehensive molecular and

100 Sympetrum parvulum C 100 Sympetrum kunckeli 100 Sympetrum eroticum 99.5 Sympetrum baccha Sympetrum pedemontanum 44.2 100 Sympetrum infuscatum

100 Sympetrum risi Sym 98.4 Sympetrum darwinianum 100 Sympetrum frequens 99.9 100 Sympetrum speciosum Sympetrum uniforme 100 47.2 Sympetrum striolatum Sympetrum fonscolombii Libellulidae 100 Rhyothemis fuliginosa Pantala flavescens Tra Libelluloidea 100 Orthetrum japonicum 100 100 Orthetrum albistylum Orthetrum lineostigma 96.6 100 Orthetrum triangulare Lib 100 Libellula quadrimaculata Libellula angelina 69.8 47.7 59.8 Lyriothemis pachygastra 100 Pseudothemis zonata Tri Deielia phaon 54.6 Crocothemis servilia Sym 99 83.1 Nannophya pygmaea Bra Somatochlora graeseri Corduliidae 100 Macromia amphigena 96.2 Macromia manchurica 100 31 Macromia daimoji Macromiidae Epophthalmia elegans Anisoptera 84.2 Polycanthagyna melanictera 99.6 Aeschnophlebia longistigma Anax nigrofasciatus 100 100 Anax parthenope Aeshnidae Aeshnoidea 100 Aeshna mixta Aeshna crenata 77.4 Gynacantha japonica 42.2 100 Asiagomphus coreanus 87.7 Shaogomphus postocularis 78.4 Burmagomphus collaris 50.1 Anisogomphus maacki 73.9 Davidius lunatus 72.4 100 Nihonogomphus minor Gomphidae Gomphoidea 72.8 71.6 Lamelligomphus ringens 100 Trigomphus citimus 100 Trigomphus nigripes Sieboldius albardae Gomphidia confluens Epiophlebia superstes Epiophlebiidae Anisozygoptera 52.2 Paracercion calamorum 100 Paracercion sieboldii Paracercion melanotum 87 100 Paracercion v nigrum 100 100 Ischnura elegans 97.9 100 Ischnura senegalensis Coenagrionidae Ischnura asiatica 100 100 Coenagrion johanssoni Coenagrionoidea Coenagrion lanceolatum 71.9 Mortonagrion selenion 100 Ceriagrion auranticum 73.7 100 Ceriagrion nipponicum Ceriagrion melanurum 99.9 100 Copera tokyoensis Platycnemis phyllopoda Platycnemididae 100 Calopteryx japonica Atrocalopteryx atrata Calopterygidae Calopterygiodea Zygoptera 51.5 100 Lestes japonicus 100 Lestes temporaris Lestoidea Indolestes peregrinus Lestidae 94.9 Sympecma paedisca 97.9 Ephemera orientalis Cloeon dipterum

0.1

Figure 3 Continued

morphological data by Bybee et al. (2008) has also shown BPP (Fig. 3A). This result suggests each suborder the validity of Epiprocta under all analyses. monophyletic groups. Nevertheless, several previous studies With regard to the monophyly of each odonate suborder, suggested non-monophyletic Zygoptera (Fig. 1). In particu- the monophyletic Anisoptera was supported with 0.82 BPP lar, Fleck et al. (2008) performed phylogenetic analysis and the monophyletic Zygoptera was supported with 0.99 based on 2026 bp of mitochondrial genes (16S rRNA,

Table 4 Results of topological tests indicating a robust phylogenetic relationship among families. With regard to the Zygoptera clear familial relationships Topology are limitedly available in previously studies partially due to non-monophyly of Zygoptera (Fig. 1). However, the most ABC extensive study by Bybee et al. (2008) consistently provided + + ELW 0.9539647 0.04763685 0 the relationships (((Coenagrionidae Platycnemididae) BP 0.95758 0.04448 0 Calopterygidae) + Lestidae) both by MP and BI analyses. A KH 1 0.05748 0 recent molecular study (COI, 16S rRNA, and 28S rRNA) for SH 1 0.3555 0 comprehensive familial relationships of Zygoptera also evi- WSH 1 0.10066 0 denced similar relationships (Dijkstra et al. 2013b). This AU 0.9579511 0.04040324 0 relationship is also supported by our concatenated analysis, providing relatively high nodal support (Figs 3A–B). Never- Topologies A, B and C represent Figure 3A–C. theless, a recent morphological study using an anatomical dataset of the head morphology and endoskeletal features for tRNAVal, and 12S rRNA) with an extensive taxon sampling Anisoptera has shown unresolved relationships among also resulted in paraphyly of Zygoptera, placing the damsel- Libellulidae, Macromiidae, and Corduliidae as a clustered fly Lestidae as the basal lineage of the Epiprocta. On the one clade (Blanke et al. 2013). other hand, Dumont et al. (2010) has shown two different Superfamilial relationships of Anisoptera were not clearly topologies, depending on the sequences employed. Based on resolved in our study (Fig. 3). The anisopteran superfamilies ∼1800 bp of 18S rRNA sequence they observed (Libelluloidea, Aeshnoidea, and Gomphoidea) were monophyletic Zygoptera, whereas ∼2400 bp from nuclear unresolved, presenting the relationships (Aeshnidae + ribosomal 5.8S, 18S, ITS1, and ITS2, which definitely Gomphidae + (Macromiidae + (Libellulidae + Corduliidae))) include rapidly evolving segments of sequences, has shown (Figs 3A–B). Previous phylogenetic studies using morpho- the zygopteran Lestidae the basal lineage of Anisoptera, logical data have also shown incongruent results. For supporting non-monophyletic Zygoptera. However, further example, Rehn (2003), Trueman (1996), and Carle (1982) extensive studies performed by Bybee et al. (2008) and have shown Gomphidae to be the most basal lineage of Carle et al. (2008) have shown the Zygoptera monophyly Anisoptera, whereas Fraser (1957) and Pfau (1991) placed and Bybee et al. (2008) suggested that a paraphyletic Aeshinidae as the most basal lineage. Molecular data have Zygoptera is an artifact caused by limited taxon sampling also shown conflict relationships. For example, Saux et al. within the suborder, the use of a single molecular marker, (2003) have shown Gomphidae to be the most basal lineage of and failing to perform concatenated molecular analyses. Anisoptera in some analyses, whereas Hasegawa and Kasuya Furthermore, Dijkstra and Kalkman (2012) in the course of (2006) placed the Libellulidae as the most basal lineage, review of European Odonata supported monophyly of Dumont et al. (2010) placed Aeshnidae as the most basal Zygoptera, placing Lestidae the sister to the remaining lineage, and Fleck et al. (2008) placed the groupAeshnidae + zygopteran families. In addition, Davis et al. (2011) using Gomphidae as the most basal lineage of Anisoptera, showing fossil data also supported each Anisoptera and Zygoptera conflict placement of the basal lineage of Anisoptera. The monophyletic group. Our concatenated analysis always most extensive study, which incorporated molecular, mor- recovered the monophyletic Zygoptera (Fig. 3) and placed phological, and fossil data performed by Bybee et al. (2008) zygopteran Lestidae as the sister to the remaining damsel- has shown the basal lineage of Anisoptera as the group flies, but paraphyletic Zygoptera was often observed in some Aeshnidae + Gomphidae by the MP method and Aeshnidae analyses when either two mitochondrial or nuclear genes by the BI method. Taken these together, the exact relation- along were employed, emphasizing the importance of ships of Anisozygoptera to anisopteran families remained employing multiple genes (Fig. S1). unclear, requiring further scrutinized study for this particular relationship. Familial and superfamilial relationships Non-monophyly of Sympetrinae in Libellulidae Libelluloidea represented by three anisopteran families, Macromiidae, Libellulidae, and Corduliidae has consistently Due to the limited taxon sampling of below-familial level shown the relationships (Macromiidae + (Libellulidae + relationships (i.e., subfamily), the monophyly of each Corduliidae)) (Fig. 3). This relationship was also supported subfamily cannot evidently be discussed. However, two sta- by morphological study by Rehn (2003), molecular studies tistically acceptable topologies consistently divided the by Fleck et al. (2008) and Dumont et al. (2010), and both Libellulidae into two groups. The possibility of non- molecular and morphological study by Bybee et al. (2008), monophyly of Sympetrinae has also been suggested by

76 Entomological Research 44 (2014) 65–79 © 2014 The Entomological Society of Korea and Wiley Publishing Asia Pty Ltd A molecular phylogeny of Odonata molecular data (Ware et al. 2007) and both molecular and Blanke A, Greve C, Mokso R, Beckmann F, Misof B (2013) An wing morphological data (Pilgrim & Von Dohlen 2008). For updated phylogeny of Anisoptera including formal conver- example, Ware et al. (2007) using 28S rRNA and 16S rRNA gence analysis of morphological characters. Systematic Ento- have shown the sister relationship between Crocothemis and mology 38: 474–490. the group composed of Brachydiplactinae + Palpopleurinae. Bridges CA (1994) Catalogue of the Family-Group, Genus- This topology seems also to be held in our analysis in that the Group and Species-Group Names of the Odonata of the World, Crocothemis belonging to Sympetrinae and the Nannophya, 3rd edn. Private Publication, Urbana, IL. belonging to Brachydiplactinae, was placed as the sister to Bybee SM, Ogden TH, Branham MA, Whiting MF (2008) Mol- each (Figs 3A–B). In the case of Deielia, our topologies ecules, morphology and fossils: a comprehensive approach to odonate phylogeny and the evolution of the odonate wing. supported the sister relationship between the Deielia and a Cladistics 23: 1–38. member of Trithemistinae, but Ware et al. (2007) have Carle FL (1982) The wing vein homologies and phylogeny of the shown the sister relationship between Deielia and a member Odonata: a continuing debate. Societas Internationalis of Brachydiplactinae, even though multiple species of Odonatologica Rapid Communications 4: 1–57. Trithemistinae were included in the analysis. Pilgrim & Carle FL, Kjer KM, May ML (2008) Evolution of Odonata, with Von Dohlen (2008) also tested the monophyly of the subfam- special reference to Coenagrionoidea (Zygoptera). Arthropod ily Sympetrinae using three molecular markers and 38 wing Systematics & Phylogeny 66: 37–44. venation characters. They found non-monophyletic Castresana J (2000) Selection of conserved blocks from multiple Sympetrinae, subdividing the subfamily into six lineages. alignments for their use in phylogenetic tool. Current Opinion They also found that other subfamilies such as Brachy- in Genetics and Development 8: 668–674. diplactinae, Leucorrhininae, Trameinae, and Trithemistinae Davis RB, Nicholson DB, Saunders ELR, Mayhew PJ (2011) were not monophyletic, but found the Libellulinae Fossil gaps inferred from phylogenies alter the apparent nature monophyletic as seen in our analysis (Figs 3A–B). Conse- of diversification in dragonflies and their relatives. BMC Evo- quently, they concluded that many of the wing venation lutionary Biology 11: 252–261. characters that were employed to define the Sympetrinae Dijkstra K-DB, Bechly G, Bybee SM et al. (2013a) The classifi- were homoplasious characters, requiring synapomorphic cation and diversity of dragonflies and damselflies (Odonata). characters for further progressed Sympetrinae phylogeny. Zootaxa 3703: 036–045. The current study does not cover the diversity of species-rich Dijkstra K-DB, Kalkman VJ (2012) Phylogeny, taxonomy and Sympetrinae and also other subfamilies in Libellulidae. Thus, classification of European dragonflies and damselflies an expanded study that includes the diversity of Libellulidae (Odonata): a review. Organisms Diversity & Evolution 12: is required for decisive and robust conclusion on the 209–227. Sympetrinae non-monophyly. Dijkstra K-DB, Kalkman VJ, Dow RA, Stokvis FR, van Tol J (2013b) Redefining the damselfly families: the first comprehensive molecular phylogeny of Zygoptera (Odonata). System- atic Entomology 39: 68–96. Acknowledgments Dumont HJ, Vierstraete A, Vanfleteren JR (2010) A molecular This work was supported by research grants from the phylogeny of the Odonata (Insecta). Systematic Entomology National Institute of Biological Resources- “Origin of Bio- 35: 6–18. logical Diversity of Korea: Molecular Phylogenetic Analy- Felsenstein J (1981) Evolutionary trees from DNA sequences: a ses of Major Korean Taxa” awarded to Iksoo Kim. We, the maximum likelihood approach. Journal of Molecular Evolu- authors, appreciate Professor Jong Wook Lee at Yeungnam tion 17: 368–376. University for providing Epiophlebia superstes. Fleck G, Ullrich B, Brenk M et al. (2008) A phylogeny of anisopterous dragonflies using mtRNA genes and mixed nucleotide/doublet models. Journal of Zoological Systematics References and Evolutionary Research 46: 310–322. Fraser FC (1957) A Reclassification of the Order Odonata. Royal Akaike H (1974) A new look at the statistical model Zoological Society of New South Wales, Sydney. identification. IEEE Transaction on Automatic Control 19: Guindon S, Lethiec F, Duroux P, Gascuel O (2005) PHYML 716–723. Online – a web server for fast maximum likelihood-based Bechly G (1996) Morphologische Untersuchungen am phylogenetic inference. Nucleic Acids Research 33: W557– Flugelgeader der rezenten Libellen und deren Stamm- W559. gruppenvertreter (Insecta; Pterygota; Odonata) unter Hasegawa E, Kasuya E (2006) Phylogenetic analysis of the insect besonderer Berucksichtigung der phylogenetischen Systematik order Odonata using 28S and 16S rDNA sequences: a compari- und des Grundplanes der Odonata. Petalura (Special Volume) 2: son between data sets with different evolutionary rates. Ento- 1–402. mological Science 9: 55–66.

Hennig W (1981) Insect Phylogeny. John Wiley & Sons, New homoplasious nature of wing venation. Systematic Entomology York, NY. 3: 159–174. Hong MY, Jeong HC, Kim MJ, Jeong HU, Lee SH, Kim I (2009) Posada D, Crandall KA (1998) Modeltest: testing the model of Complete mitogenome sequence of the jewel beetle, DNA substitution. Bioinformatics 14: 817–818. Chrysochroa fulgidissima (Coleoptera: Buprestidae). Ratnasingham S, Hebert PDN (2007) BOLD: the barcode of life Mitochondrial DNA 20: 46–60. data system. (http://www.barcodinglife.org). Molecular Hovmöller R, Pape T, Kallersjo M (2002) The Palaeoptera Ecology Notes 7: 355–364. problem: basal pterygote phylogeny inferred from 18S and 28S Rehn AC (2003) Phylogenetic analysis of higher-level relation- rDNA sequences. Cladistics 18: 313–323. ships of Odonata. Systematic Entomology 28: 181–239. Huelsenbeck JP, Ronquist F (2001) MrBayes: Bayesian inference Saux C, Simon C, Spicer GS (2003) Phylogeny of the dragonfly of phylogeny. Bioinformatics 17: 754–755. and damselfly order Odonata as inferred by mitochondrial 12S Ishiwata K, Sasaki G, Ogawa J, Miyata T, Su Z-H (2011) ribosomal RNA sequences. Annals of the Entomological Phylogenetic relationships among insect orders based on Society of America 96: 693–699. three nuclear protein-coding gene sequences. Molecular Shimodaira H (2002) An approximately unbiased test of Phylogenetics and Evolution 58: 169–180. phylogenetic tree selection. Systematic Biology 51: 492–508. Jobb G, von Haeseler A, Strimmer K (2004) TREEFINDER: a Shimodaira H, Hasegawa M (1999) Multiple comparisons of log- powerful graphical analysis environment for molecular likelihoods with applications to phylogenetic inference. phylogenetics. BMC Evolutionary Biology 4: 18. Molecular Biology and Evolution 16: 1114–1116. Kim MJ, Kang AR, Jeong HC, Kim G-K, Kim I (2011) Recon- Simon S, Narechania A, Desalle R, Hadrys H (2012) Insect structing intraordinal relationships in Lepidoptera using phylogenomics: exploring the source of incongruence using mitochondrial genome data with the description of two newly new transcriptomic data. Genome Biology and Evolution 4: sequenced lycaenids, Spindasis takanonis and Protantigius 1295–1309. superans (Lepidoptera: Lycaenidae). Molecular Phylogenetics Steinmann H (1997) World Catalogue of Odonata, Vol II: and Evolution 61: 436–445. Anisoptera. Walter de Gruyter, Berlin. Kishino H, Hasegawa M (1989) Evaluation of the maximum Strimmer K, Rambaut A (2002) Inferring confidence sets of pos- likelihood estimate of the evolutionary tree topologies from sibly misspecified gene trees. Proceedings of The Royal Society DNA sequence data and the branching order in Hominoidea. of London B 269: 137–142. Journal of Molecular Evolution 29: 170–179. Swofford DL (2002) PAUP* Phylogenetic Analysis Using Kjer KM (2004) Aligned 18S and insect phylogeny. Systematic Parsimony(*and Other Method) Version 4. 10. Sinauer Asso- Biology 53: 506–514. ciates, Sunderland, MA. Kjer KM, Carle FL, Litman J, Ware J (2006) A molecular phy- Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S logeny of Hexapoda. Arthropod Systematics & Phylogeny 64: (2011) MEGA5: molecular evolutionary genetics analysis 35–44. using maximum likelihood, evolutionary distance, and Larkin MA, Blackshields G, Brown NP et al. (2007) Clustal maximum parsimony methods. Molecular Biology and Evolu- Wand Clustal X version 2.0. Bioinformatics 23: 2947–2948. tion 28: 2731–2739. Lee EM, Hong MY, Kim MI et al. (2009) The complete Tillyard RJ (1917) The Biology of Dragonflies. Cambridge Uni- mitogenome sequences of the palaeopteran insects Ephemera versity Press, Cambridge. orientalis (Ephemeroptera: Ephemeridae) and Davidius Tillyard RJ (1923) The Lower Permian insects of Kansas. Pre- lunatus (Odonata: Gomphidae). Genome 52: 810–817. liminary announcement. Entomological News 34: 292–295. Lin CP, Danforth BN (2004) How do insect nuclear and Tillyard RJ (1928) The evolution of the order Odonata. Records of mitochondrial gene substitution pattern differ? Insight from the Indian Museum 30: 151–172. Bayesian analyses of combined datasets. Molecular Tofilski A (2004) DrawWing, a program for numerical descrip- Phylogenetics and Evolution 30: 686–702. tion of insect wings. Journal of Insect Science 4: 17–21. Lohmann H (1996) Das phylogenetische System der Anisoptera Trueman JWH (1996) A preliminary cladistic analysis of odonate (Odonata). Entomologische Zeitschrift 106: 209–266. wing venation. Odonatologica 25: 59–72. Massana R, Castresana J, Balagué V et al. (2004) Phylogenetic Ware J, Michael M, Kje K (2007) Phylogeny of the higher and ecological analysis of novel marine stramenopiles. Applied Libelluloidea (Anisoptera: Odonata): An exploration of the and Environmental Microbiology 70: 3528–3534. most speciose superfamily of dragonflies. Molecular Needham JG (1903) A genealogic study of dragon-fly wing vena- Phylogenetics and Evolution 45: 289–310. tion. Proceedings of the US National Museum 26: 703–764. Wernersson R, Pedersen AG (2003) Multiple alignment of coding Pfau HK (1991) Contributions of functional morphology to DNA from aligned amino acid sequences. Nucleic Acids the phylogenetic systematics of Odonata. Advances in Research 31: 3537–3539. Odonatolology 5: 109–141. Yamauchi MM, Miya MU, Nishida M (2004) Use of a PCR-based Pilgrim EM, Von Dohlen CD (2008) Phylogeny of the approach for sequencing whole mitochondrial genomes of Sympetrinae (Odonata: Libellulidae): further evidence of the insects: two examples (cockroach and dragonfly) based on the

method developed for decapod crustaceans. Insect Molecular phylogram obtained with the dataset COI + 16S rRNA. The Biology 13: 435–442. numbers at each node specify bootstrap percentage of 1000 Zhang J, Zhou C, Gai Y, Song D, Zhou K (2008) The complete pseudoreplicates. (D) Bayesian inference phylogram mitochondrial genome of Parafronurus youi (Insecta: obtained with the dataset 28S rRNA + EF-1α, which is not Ephemeroptera) and phylogenetic position of the partitioned. The numbers at each node specify Bayesian Ephemeroptera. Gene 424: 18–24. posterior probabilities (BPP). (E) Bayesian inference phylogram obtained with the dataset 28S rRNA + EF-1α, Supporting information which is divided into two partitions. The numbers at each node specify BPP. (F) Maximum likelihood phylogram Additional Supporting Information may be found in the obtained with the dataset 28S rRNA + EF-1α. The numbers online version of this article at the publisher’s web-site: at each node specify bootstrap percentage of 1000 Figure S1. The phylogenetic analyses using two genes. (A) pseudoreplicates. Two species of Ephemeroptera were used Bayesian inference phylogram obtained with the dataset as outgroups. The scale bar indicates the number of substi- COI + 16S rRNA, which is not partitioned. The numbers at tutions per site. each node specify Bayesian posterior probabilities (BPP). Table S1. List of GenBank accession numbers of the (B) Bayesian inference phylogram obtained with the dataset species included in this study. COI + 16S rRNA, which is divided into two partitions. The Table S2. Full taxon names, nucleotide frequencies, and numbers at each node specify BPP. (C) Maximum likelihood gene sizes for the species included in this study.