Analysis of the Susceptibility, Prevalence, and Pathogenicity of the Opportunistic Pathogen Acanthamoeba

ANALYSIS OF THE SUSCEPTIBILITY, PREVALENCE, AND PATHOGENICITY OF THE OPPORTUNISTIC PATHOGEN ACANTHAMOEBA

DISSERTATION

Presented in Partial Fulfillment of the Requirements for

the Degree Doctor of Philosophy in the Graduate

School of The Ohio State University

MEGAN SHOFF, MS

*****

The Ohio State University 2008

Dissertation Committee: Approved By:

Paul Fuerst, Advisor ______David Denlinger

Laura Kubato Advisor Graduate Program in Evolution, Ecology, Thomas Mauger and Organismal Biology

ABSTRACT

The ubiquitous, free-living naked amoeba, Acanthamoeba, is an opportunistic pathogen that can cause the painful eye disease Acanthamoeba keratitis (AK), and, in immunocompromised individuals, the fatal disease granulomatous amebic encephalitis (GAE). AK is a rare corneal disease that effects contact lens wearers more than non-contact lens wearers, though up to 10-

15% of cases do occur in non-contact lens wearers.1, 2 The aims of this work were threefold: 1) to determine the susceptibility of recent clinical and environmental strains of Acanthamoeba to contact lens cleaning solutions and to determine if the inclusion of taurine provided a protective benefit to the amoebae, 2) to determine whether, and to what level, acanthamoebae were present in domestic water in the greater Chicago area and if the amoebae could be linked to the recent outbreak of AK in that area, and 3) to determine if an invertebrate animal model, the grasshopper Schistocerca americana, could be used in initial pathogenicity and

virulence studies of Acanthamoeba. A range of strains were examined from both

“environmental” sources (domestic water supply) and from clinical samples.

Acanthamoebae isolates from both clinical and environmental sources were tested for their susceptibility to commonly used contact lens multi-purpose cleaning solutions (MPS) and hydrogen peroxide cleaning solutions. These toxicity tests showed that different strains responded differently to the effects of the cleaning solutions. In all cases cysts were more resistant than trophic amoebae and no MPS was 100% effective at killing acanthamoebae, and, as would be expected, the hydrogen peroxide systems performed better than the

MPS. However, reduced concentrations of hydrogen peroxide do not provide a kill rate comparable to what is currently available. Over a 2 year period, 228 water samples were obtained from the greater Chicago area and scored for the presence of protists including Acanthamoeba. Over 50% of domestic water samples tested positive for protists, with 20% being positive for Acanthamoeba.

The genotypes found in both the water and clinical isolates were not unique, with most belonging to the T4 genotype (44 samples), and only 4 T3. Finally, the pathogenicity study was done to determine if grasshoppers could be used to evaluate the pathogenicity and/or virulence of Acanthamoeba. It was shown that grasshoppers do respond differently to clinical versus environmental strains, and are a promising possible animal model for use in the study of Acanthamoeba.

iii

DEDICATION

Dedicated to my parents, Randy and Rebecca, and my brother and sister, Brad

and Katie, for all of their love and support.

ACKNOWLEDGMENTS

I would like to thank Paul Fuerst and Greg Booton for giving me the opportunity to continue work I enjoy. Many thanks to Laura Kubatko, without whom I would have not been able to decipher the statistics. I also need to thank the many graduate and undergraduate students I have had the opportunity to work with while in the Fuerst lab: Mike Sovic, Jennifer Carmichael, and Bob

Fitak, and of course the undergraduates that have helped with my project,

Mandy, Stephanie, Jillian, and Nick. I also need to thank the friends I’ve found at OSU, whose support has been invaluable: Chrissy, Jimmy, Liam, Tara,

Monica, Kaylan, and Jen.

My collaborators at other institutions also need to be thanked, as they have provided invaluable insights and have provided me with samples and data

I would have had difficulty obtaining on my own, most notably Charlotte Joslin and Elmer Tu at the University of Illinois-Chicago and Govinda Visvesvara at the

CDC. I can only hope that I can continue collaborations with these remarkable doctors and scientists in the future.

I also need to thank my master’s advisor, whom I now consider both my mentor and friend, Andrew Rogerson, without whom I never would have taken this path. Just as importantly, I need to thank my friends and family outside of academia, whose friendship, love and support over the years has been invaluable. My friends, Cayce, whose friendship is invaluable; Ryan, whose friendship I will always treasure; Dave, who sends me props when I need them, and Jeff, who can always put a smile on my face. I would never have gotten to where I am without my family, Bethany, who understands the craziness of my life and always listened to me; Brad, whose support and faith in me lifts me up;

Katie, who helps me keep it all in perspective; my mom, who is always there for me; and my dad, whose love and support I can always count on.

VITA

Nova Southeastern University, Davie, FL M.S. in Marine Biology and Marine Environmental Science 2006 Thesis: “The Importance of Strain Differences in the Opportunistic Pathogen Acanthamoeba”

University of Texas, Austin, TX B.S. in Applied Learning and Development 1998 Minor in Biology

The Ohio State University, Columbus, OH Graduate Research Associate 2006-Present

Graduate Teaching Associate: 2008 EEOB 640, Population Genetics

Nova Southeastern University, Dania Beach, FL Graduate Research Associate 2005

Nova Southeastern University, Davie, FL Graduate Teaching Assistant: 2003-2005 Microbiology Anatomy and Physiology II Biology I

PUBLICATIONS

Sriram, R., M. Shoff, G. Booton, P. Fuerst, GS Visvesvara. 2008. Acanthamoeba

spp. cysts survive desiccation for more than 20 years. J. Clin Microbiol. Oct 15

[Epub ahead of print].

vii

Shoff, M., C. Joslin, E. Tu, L. Kubatko, P. Fuerst. 2008. Efficacy of contact lens

systems against recent clinical and tap water Acanthamoeba isolates. Cornea.

Jul; 27(6):713-9.

Shoff, M., A. Rogerson, K. Kessler; S. Schatz, D. Seal. 2008. Prevalence of

Acanthamoeba and Other Naked Amoebae in South Florida Domestic Water.

Journal of Water and Health. 6(1): 99-104.

Shoff, M., A. Rogerson, S. Schatz, and D. Seal. 2007. Variable responses of

Acanthamoeba strains to three multipurpose lens cleaning solutions.

Optometry and Vision Science (OVS). March; 84(3): 202-207.

Joslin, C., E. Tu, M. Shoff, G. Booton, P. Fuerst, T. McMahon, R. Anderson, M.

Dworkin, J. Sugar, F. Davis, L. Stayner. 2007. The association of contact lens

solution use and Acanthamoeba keratitis. American Journal of Ophthalmology.

144(2): 169-180.

Tu, E., C. Joslin, J. Sugar, G. Booton, M. Shoff. 2008. The Relative Value of

Confocal Microscopy and Superficial Corneal Scrapings in the Diagnosis of

Acanthamoeba Keratitis. Cornea. Aug; 27(7):764-72.

Tu, E., C. Joslin, J. Sugar, M. Shoff, G. Booton. 2008. Prognostic Factors

Affecting Visual Outcome in Acanthamoeba keratitis. Ophthalmology. June 19

[Epub ahead of print].

Shoff, M., A. Rogerson, D. Seal. 2007. Author’s Response to Editor. Optometry

and Vision Science. Oct; 84(10): 996-997.

viii

FIELDS OF STUDY

Major Field: Evolution, Ecology, and Organismal Biology

TABLE OF CONTENTS

ABSTRACT ...... ii

DEDICATION ...... iv

ACKNOWLEDGMENTS ...... v

VITA ...... vii

TABLE OF CONTENTS ...... x

LIST OF FIGURES ...... xiii

LIST OF ABBREVIATIONS ...... xvii

INTRODUCTION ...... 1

History of Acanthamoeba ...... 1

Biology of Acanthamoeba ...... 2

Classification of Acanthamoeba ...... 5

Acanthamoeba in the Environment ...... 7

Acanthamoeba and Human Infection...... 8

General Description and Aims ...... 10

Aims ...... 11

Selection of Isolates ...... 15

Maintenance of Bacterized Acanthamoeba Cultures ...... 16

CHAPTER 1 ...... 19

EFFICACY TESTING...... 19

Background and Rationale ...... 19

Efficacy of contact lens systems against recent clinical and tap water Acanthamoeba

isolates...... 21

Background and Rationale ...... 21

Methods and Materials ...... 24

Results ...... 28

Discussion ...... 29

H2O2 Testing ...... 34

Background and Rationale ...... 34

Methods and Materials ...... 35

Results ...... 37

Discussion ...... 38

CHAPTER 2 ...... 47

DOMESTIC WATER TESTING AND AK CORRELATION ...... 47

Background and Rationale ...... 47

Methods and Materials ...... 52

Results ...... 54

Discussion ...... 55

CHAPTER 3 ...... 65

PATHOGENICITY TESTS...... 65

Background and Rationale ...... 65

Methods and Materials ...... 69 xi

Results ...... 71

Discussion ...... 72

CHAPTER 4 ...... 90

DISCUSSION AND CONCLUSIONS ...... 90

LIST OF REFERENCES ...... 99

APPENDICES ...... 113

APPENDIX A: MEDIA FORMULATIONS ...... 113

APPENDIX B: DNEASY KIT MANUFACTURER’S INSTRUCTIONS: PROTOCOL

FOR DNA PURIFICATION OF ANIMAL TISSUES ...... 115

APPENDIX D: ETHANOL PREPARATION OF DNA FOR SEQUENING ...... 117

APPENDIX E: RAW DATA ...... 119

Efficacy Tests, Taurine Data ...... 119

APPENDIX F: SEQUENCE DATA ...... 124

APPENDIX G: COPYRIGHT PERMISSION ...... 146

xii

LIST OF FIGURES

FIGURE 1: COMPLETE MOISTUREPLUS MULTIPURPOSE SOLUTION (ADVANCED MEDICAL

OPTICS). RECALLED WORLDWIDE MAY 25, 2007...... 18

FIGURE 2: ACANTHAMOEBA KERATITIS WITH DEEP STROMAL INVOLVEMENT (PHOTO

COURTESY OF ELMER TU)...... 18

FIGURE 3: STRAIN ID’S, SOURCES, GENOTYPES AND CLINICAL PRESENTATION OF INFECTIONS.

...... 40

FIGURE 4: CONTACT LENS CLEANING SOLUTION BRAND NAMES, INCLUDING

MANUFACTURER, RECOMMENDED DISINFECTION TIMES, AND INGREDIENTS AS STATED

ON PACKAGES...... 41

FIGURE 5: SURVIVAL RATES OF EACH ACANTHAMOEBA STRAIN IS PROVIDED FOR EACH

SOLUTION FOR BOTH 6H AND 24H TREATMENT TIMES AT ALL TAURINE LEVELS.

PERCENTAGE SURVIVAL, AS WELL AS NUMBER OF TRIALS WITH SURVIVING AMOEBAE,

ARE GIVEN...... 42

FIGURE 6: PERCENT SURVIVAL OF TRIALS FOR EACH CLEANING SOLUTION TESTED.

SURVIVAL PERCENTAGES ARE FOR ALL TIMES, STRAINS, AND TAURINE LEVELS

COMBINED...... 43

FIGURE 7: STRAIN SURVIVAL RESPONSES TO FIVE CONCENTRATIONS OF HYDROGEN PEROXIDE

SOLUTION...... 44

xiii

FIGURE 8: STRAIN RESPONSES TO HYDROGEN PEROXIDE SOLUTIONS, ALL CONCENTRATIONS

COMBINED...... 45

FIGURE 9: GROWTH RESPONSES TO VARYING CONCENTRATIONS OF HYDROGEN PEROXIDE,

ALL STRAINS COMBINED...... 46

FIGURE 10: CHICAGO-AREA ACANTHAMOEBA KERATITIS CASES BY YEAR (AS OF 10/1/08).

FROM JOSLIN ET AL 2008.118 ...... 58

FIGURE 11: ACANTHAMOEBA KERATITIS CASES BY YEAR BASED ON CDC MULTI-STATE DATA

(SLIDE ACCESSED OCTOBER 6, 2008 AT

HTTP://WWW.FDA.GOV/OHRMS/DOCKETS/AC/08/SLIDES/2008-4363S1-03-

VERANI-CDC.PDF ) ...... 59

FIGURE 12: SUMMARY OF MOLECULAR RESULTS OF ACANTHAMOEBA ISOLATES EXAMINED IN

THE CURRENT STUDY. N/D IS NO DATA AVAILABLE...... 60

FIGURE 13: MAP OF THE GREATER CHICAGO AREA INDICATING ZIP CODES SAMPLED FOR TAP

WATER STUDY ...... 62

FIGURE 14: PROTIST PRESENCE IN TAP WATER BY SAMPLED HOMES. OF THE 228 HOMES

SAMPLED, APPROXIMATELY 51% WERE CULTURE POSITIVE FOR PROTISTS, WITH MORE

THAN 20% POSITIVE FOR ACANTHAMOEBA...... 63

FIGURE 15: PROTIST PRESENCE IN TAP WATER BY ZIP CODE. OF A TOTAL OF 143 ZIP CODES

SAMPLED, APPROXIMATELY 60% WERE CULTURE-POSITIVE FOR PROTISTS, WITH MORE

THAN 25% POSITIVE FOR ACANTHAMOEBA...... 64

FIGURE 16: INVERTEBRATE INNATE IMMUNE RESPONSES...... 75

FIGURE 17: ISOLATES USED IN THE PATHOGENICITY STUDY...... 76

xiv

FIGURE 18: SURVIVAL PLOT FOR CONTROL VS. PLACEBO GROUPS, P-VALUE > 0.7352...... 77

FIGURE 19: SURVIVAL PLOT FOR INFECTED VS. UNINFECTED GRASSHOPPERS. P-VALUE <

0.0001...... 78

FIGURE 20: SURVIVAL PLOT COMPARING SURVIVABILITY OF ALL SOURCES. P-VALUE < 0.001.

...... 79

FIGURE 21: STATISTICAL DATA FOR ALL SOURCE PAIRWISE COMPARISONS. HIGHLIGHTED

COMPARISONS ARE THE ONLY NON-SIGNIFICANT COMPARISONS...... 80

FIGURE 22: SURVIVAL PLOT COMPARISONS FOR CONCENTRATIONS. P-VALUE < 0.001...... 81

FIGURE 23: STATISTICAL DATA FOR ALL CONCENTRATION PAIRWISE COMPARISONS.

HIGHLIGHTED COMPARISONS ARE THE ONLY NON-SIGNIFICANT COMPARISONS...... 82

FIGURE 24: SURVIVAL PLOT COMPARING ALL AK STRAINS...... 83

FIGURE 25: SURVIVAL PLOT COMPARING ALL GAE STRAINS. THIRTY PERCENT SURVIVAL IS

RESULT OF INCLUSION OF LOWEST CONCENTRATION, WHICH DID NOT RESULT IN

INFECTION. P-VALUE > 0.7201...... 84

FIGURE 26: SURVIVAL PLOT OF ALL TAPWATER STRAINS...... 85

FIGURE 27: STATISTICAL DATA FOR ALL TAPWATER PAIRWISE COMPARISONS. HIGHLIGHTED

COMPARISON IS THE ONLY NON-SIGNIFICANT COMPARISON...... 86

FIGURE 28: SURVIVAL PLOT COMPARING TAPWATER STRAIN W06-201 TO ALL GAE

STRAINS. P-VALUE < 0.0001...... 87

FIGURE 29: SURVIVAL PLOT COMPARING TAPWATER STRAIN W06-201 TO ALL AK STRAINS.

P-VALUE < 0.0001...... 88

FIGURE 30: CULTURE RESULTS FOR INFECTED EXPIRED GRASSHOPPERS FOR ALL

CONCENTRATIONS...... 89

xvi

LIST OF ABBREVIATIONS

AK Acanthamoeba keratitis

AS amoeba saline

C degrees Celsius d day(s)

GAE granulomatous amoebic encephalitis h hour(s)

L liter(s) min minute(s)

MPS Multi-Purpose Solution

NNAS non-nutrient amoeba saline

PHMB polyhexamethylene biguanide

PYG peptone-yeast-glucose

xvii

INTRODUCTION

Background and Rationale

History of Acanthamoeba

The genus Acanthamoeba was originally described in 1930 by Sir Aldo

Castellani when he isolated naked amoebae from a yeast culture.3 Douglass, in an attempt to classify this amoeba, initially named it Hartmannella castellanii, in the genus Hartmannella.4 However, the type species was later determined to be a distinct genus separate from Hartmanenella and was reclassified as Acanthamoeba castellanii. For years these common free-living amoebae were considered harmless environmental organisms. Later, acanthamoebae were reported to be possible pathogens, first by Jahnes et al. in 1957 and again in 1958 by Clyde G.

Culbertson, who described encephalitis in mice caused by Acanthamoeba spp.5, 6

At the time of Cultbertson’s findings, confusion still existed regarding the nomenclature of Acanthamoeba spp. and thus Culbertson named the pathogen

Hartmannella-Acanthamoeba. Hartmannella spp. rarely, if ever, cause human infections and therefore any historical reference to this amoeba in relation to human disease can likely be considered to be Acanthamoeba. The first verified human case of amoebic encephalitis involving Acanthamoeba did not occur until

1972 when it was reported by Jager and Stamm.7 The first documented cases of

Acanthamoeba keratitis (AK) cases were described in 1973 by Jones et al. Since then, many studies have shown Acanthamoeba to be the major causative agent of

AK, and awareness about the problem has grown with the popularity of wearing contact lenses, the leading risk factor for AK. Historically AK has been a rare disease, with only 1.65 to 2.01 cases per million contact lens wearers cases per year.8 The past five years, however, have seen a dramatic increase, prompting several studies including a case-control epidemiological study by the University of Illinois-Chicago’s Charlotte Joslin and Elmer Tu as well as a CDC study to assess the alarming increase of AK. As of June, 2008, the CDC has indicated that cases have not returned to baseline and are continuing to occur at higher-than- expected rates, despite the leading risk factor, determined to be consumer use of

Advanced Medical Optics’s multipurpose solution, Complete Moisture Plus

Multipurpose Solution (Figure 1) being removed from the market May 25, 2007.9

Biology of Acanthamoeba

Acanthamoeba spp. are eukaryotic naked amoebae that have two life stages; a metabolically active trophozoite (=troph) form and a dormant cyst form.10, 11

Members of Acanthamoeba are “naked” amoebae as they lack any tests or outer cell walls through which pseudopodia emerge.12 In trophozoite form,

Acanthamoeba range from 25-40 µm in diameter. They have a large single nucleus with a prominent central nucleolus and cytoplasmic organelles that are usually 2

evident in the cytoplasm.13 The morphology of Acanthamoeba is distinctive due to its fringe of pointed pseudopodia known as acanthapodia. This gives the cell a

“spiny” appearance and explains the derivation of the genus name (acanth is

Latin for spiny). These slow-moving organisms also usually have active contractile vacuoles that expel water at regular intervals.10, 14, 15 As is common for amoebae, they feed by phagocytosis, an ingestion process that involves food cup formation on the cell surface.16 Acanthamoeba spp. are not considered selective feeders and have been shown to consume a range of bacteria including

E. coli, Enterobacter, and Klebsiella (bacterial species that are often used to feed

Acanthamoeba cultures in the laboratory), other bacteria, yeasts, and even polystyrene beads.17 However, it is not uncommon to have difficulties culturing some strains of Acanthamoeba without the use of live bacteria, such as E. coli or

Enterobacter aerogenes, as a prey source.

Acanthamoeba readily encyst when exposed to adverse environmental conditions such as reduced food.10 Cysts of acanthamoebae are smaller than the trophozoites and typically range 10-30 µm in diameter. They have a distinctive double wall composed of two major layers with a space between the two layers.13

When viewed, the inner wall often appears to have pulled away from the outer wall accounting for the stellate appearance common, though not always seen, in acanthamoebae cysts.14 As cysts, Acanthamoeba are extremely resilient and have been shown to withstand extreme conditions, including tolerance to chlorine,

dialdehyde, and high temperatures.18 Frequently these amoebae encyst in response to depleted food, but once prey is available, acanthamoebae will excyst, although just how the amoebae sense the new food source is unknown.10

Acanthamoeba frequently harbor endosymbiotic or intracellular bacteria, including Legionella species, Chlamydia-like spp., Burkholderia picketti, B. pseudomallei, Vibrio cholerae, Cytophaga sp., Mycobacterium avium, Listeria monocytogens, Shigella dysenteriae, S. sonnei, and others.10, 19-22 It is commonly believed that this relationship may enhance the spread and survival of these bacteria, many of which are human pathogens. It is understood that the bacteria are able to survive while the cell is in cyst form thereby protecting them from adverse environmental conditions.10 Numerous studies have focused on the interaction of Acanthamoeba spp. and the bacterium Legionella pneumophila. This bacterium is the causative agent in Legionnaire’s disease, a type of pneumonia.

In this partnership, Acanthamoeba provides a niche for the growth and survival of

Legionella bacteria and Acanthamoeba is believed to be a transmission vector, and the presence of Acanthamoeba harboring Legionella in air conditioning units supports this hypothesis. Even after treatment with cooling tower biocides, some Acanthamoeba species have been shown to expel vesicles containing living

Legionella pneumophila bacteria, with each vesicle containing hundreds of bacteria.

Other studies have shown that the effectiveness of biocides are reduced when

Legionella pneumophila are grown within Acanthamoeba. 23-27 This relationship is

especially concerning, as Legionnaire’s disease is a potentially life-threatening disease, and increases in occurrence of Legionnaires has been seen, like AK cases, since 2003.28 This suggests that the increases could be linked, the most probable link being increases of Acanthamoeba in the water supply.

Classification of Acanthamoeba

The genus Acanthamoeba contains at least 18 named species according to

Page.29 The species are currently identified on the basis of weak diagnostic features such as temperature tolerance and cyst appearance. Cysts can be smooth or rough, and the form of the endocyst (the inner wall) has been used in identification. For example, identifications are based on whether the endocyst is closely applied to the outer wall, or alternatively is pulled away giving a scalloped, stellate or polygonal appearance to the cyst. Increasingly, however, we are realizing that cyst appearance is not a rigid feature and can change as a function of culture condition.

As noted earlier, acanthamoebae are free-living protozoa, however, some strains are opportunistically pathogenic. Because of this, there is much interest in the genus and increasingly molecular approaches are being used to identify strain and species differences. Currently, Acanthamoeba has been classified into

16 distinct genotypes (T1 – T16: based on nuclear and mitochondrial small- subunit rRNA genes).30 As more molecular information becomes available, this characterization may change.12, 30-32 Whether the genotypes reflect different 5

species is unknown, though additional genotyping supports some of the original grouping into three group classifications.33 The current belief is that genotype T4 followed by T3, T6, and T11 are the forms responsible for most cases of

Acanthamoeba keratitis.34 However, it must be noted that the T4 genotype is the most common environmental isolate and its predominance in infections may be related to its dominance in the environment.35 For instance, T5 sewage sludge isolates from South Africa have been shown to be cytopathogenic to human cells in vitro, but have only recently been shown to cause fatal disseminated acanthamebiasis (widespread extracerebral disease).32, 36 It has yet to be determined what makes a particular Acanthamoeba isolate opportunistically pathogenic. Unlike true obligate pathogens, the invasion of human tissue is not part of the life-cycle of this amoeba. Therefore, other genotypes cannot be excluded from the list of possible pathogens. Besides genotype, other factors may be important such as relative abundance, history of genotype contact with the host, nature of bacterial endosymbionts, strain morphology and ability to attach to the cornea, immune response and competence of the host, or a plethora of other factors yet to be determined.

As noted above, the identification of Acanthamoeba to species is problematic as it is based largely on the morphology of cysts. The 18 named species are grouped into three classifications (Groups 1, 2, and 3) depending on cyst morphology. But as noted above, this is an imprecise method of identification

since cyst morphology has been shown to change with culture conditions.16 The taxonomy of the group is currently under review and at this time most documented cases of AK infections do not attempt to include a species name. A revision of the genus is warranted since recent molecular studies have shown that some Acanthamoeba strains bearing the same name are less related than strains bearing different names. Likewise, molecular approaches have shown that strains named differently can belong to a single strain population.30, 37, 38

Therefore, generally strains are referred to by their genotype and no attempt is made to assign species names to isolates obtained.

Acanthamoeba in the Environment

Acanthamoebae are free-living amoebae that are seemingly ubiquitous, partly due to their ability to withstand extremely variable conditions and the fact that they are able to encyst when exposed to conditions that are not conducive to growth. They are one of the most common protozoa found in soil and freshwater environments.16 Isolates have been found in freshwater fish 39, sewage sludge 32, air, soil, freshwater, seawater, tap water, swimming pools, hot tubs, humans, and even at >2,500 m below sea level.11, 40-43 With acanthamoebae being so abundant in both natural and man-made habitats, it is not surprising that most people have been exposed to the amoeba, and approximately 80% of the population have antibodies against this organism.40, 44

Acanthamoeba and Human Infection

Due to the ubiquity of Acanthamoeba, humans are frequently coming into contact with different strains and/or species.10, 45 When a potentially pathogenic strain of Acanthamoeba encounters a susceptible host, either through contact lens use, corneal injury, or because the host is immunocompromised, it can cause sight threatening amoebic keratitis, or, much less commonly, the more serious condition granulomatous amoebic encephalitis (GAE). Acanthamoeba spp. are also known to cause skin and sinus infections. Further, as noted previously,

Acanthamoeba can harbor bacterial pathogens.

Acanthamoeba keratitis (AK) is an infection of the cornea that produces severe pain and photophobia (light sensitivity)1 that can occur in both healthy and susceptible individuals, being more common in contact lens wearers (Figure 2).

It is believed that contact lens wear increases the susceptibility of a host to amoebic keratitis because the contact lens acts as a vector, conveying the amoebae onto the cornea where they attach and cause infection.46 It is also possible that contact lenses cause micro-abrasions of the cornea, producing mild eye trauma and adhesion sites for the amoebae. The infection is often sight- threatening as treatment is often delayed due to misdiagnoses as either herpes simplex virus or bacterial keratitis. This delay in appropriate therapy increases the risk of detrimental outcome.47 Contact lens wear is recognized as the leading risk factor for AK, although an estimated 10-15% of amoebic keratitis sufferers

are non-contact lens wearers.1, 16 Most incidences of AK infections in non-contact lens wearers occur in developing nations and are thought to follow eye trauma prior to exposure to the amoebae through contact with contaminated water.12, 2, 16

Granulomatous Amoebic Encephalitis (GAE) is a progressive disease of the central nervous system. Although this disease is primarily found in patients with a compromised immune system (due to alcoholism, drug abuse, chemotherapy, organ transplantation, steroid treatments, human immunodeficiency virus [HIV], pregnancy, or systemic lupus erythematosus), there have been reported cases of healthy individuals contracting GAE.16, 17

Acanthamoeba spp. are thought to infect individuals via a number of possible routes, including introduction through skin lesions, inhalation into the lungs, haematogenous spread (i.e. in the bloodstream), or directly through the neuroepithelium (membrane in the nasal cavity containing sensory nerve endings).11, 17, 21, 48 The progression of GAE may be slow and initial incubation times can last months. Early symptoms of GAE include headaches, nausea, vomiting and fever. Ultimately, amoebae migrate to the brain and cause lesions and necrosis of brain tissues, leading to death.16, 48

Acanthamoebae are also able to cause skin infections in both immunocompromised and healthy individuals. These skin infections are usually found in individuals suffering from GAE, however, the two infections can occur independently.16 It is unknown if the skin infections are a mode of infection

leading to GAE or a result of the amoebic infection spreading throughout the body.16 Recently, Acanthamoeba was shown to be the cause of a fatal disseminated infection in a heart transplant patient.36

General Description and Aims

Some of the free-living naked amoebae belonging to the genus Acanthamoeba can be opportunistically pathogenic and cause the sight-threatening eye infection

Acanthamoeba keratitis (AK) as well as, less commonly, skin, sinus, and respiratory infections.10 Acanthamoeba have also been shown to cause the central nervous system infection Granulomatous Amoebic Encephalitis (GAE).49-53

Although many studies have examined Acanthamoeba, it is still unclear what makes these free-living amoebae become invasive and cause infections in humans. Acanthamoeba are not normally parasitic and appear to only cause disease when a strain comes into contact with a susceptible host such as a person with a corneal abrasion or compromised immune system. Infections are rare, although it is clear from immunological studies that most people have come into contact with the genus Acanthamoeba and have antibodies against these amoebae.10, 21, 54 One of the main goals of this study was to determine the etiology and epidemiology of AK in order to reduce the risk and rate of

Acanthamoeba infections. The primary hypothesis behind the proposed research is that pathogenic Acanthamoeba are found and transmitted through tap water and that the formulations of commonly used contact lens cleaning solutions

coupled with poor use habits increase the risk of AK. This hypothesis is based on the following observations. First, previous studies have found Acanthamoeba and other protists in tap water.55, 56 Second, an increase in the incidence of AK began shortly after the EPA introduced new guidelines reducing residual biocides in drinking water.57 Third, users of particular multi-purpose contact lens cleaning solutions are more likely to develop AK.58 Based on these observations, the experimental focus of this research was on comparing tap water and AK geographically and genotypically and testing strains of

Acanthamoeba against different contact lens cleaning solutions. Second, as it is unknown what makes particular isolates of Acanthamoeba pathogenic, and currently the only model for testing pathogenicity is the vertebrate model, which is both ethically and logistically problematic, a pathogenicity study was also done using a novel invertebrate model, the grasshopper Schistocerca Americana.

Aims

1. Determine occurrence rate of Acanthamoeba in Chicago area Tap Water.

Previous findings by Kilvington et al. linked tap water to AK cases in the

United Kingdom.56 Water samples from a current AK outbreak area

(Chicago) were tested. Tap water samples from the greater Chicago, IL area

were collected and analyzed for the presence of Acanthamoeba. Genotyping of

positive Acanthamoeba cultures was then undertaken. Sequences obtained

will were compared to sequences obtained from AK patients in Chicago. 11

a. Tap water samples were collected throughout the Chicago area and

processed in order to isolate Acanthamoeba. These amoebae were then

analyzed for geographical relationships and genotyped.

b. AK cases from the University of Illinois-Chicago (UIC) were processed in

order to culture Acanthamoeba. These amoebae were then genotyped.

c. Isolates and sequences of AK and tap water samples from the Chicago

area were compared for sequence similarity and geographical similarity.

2. Test contact lens cleaning solution efficacy against Acanthamoeba. A

range of genotypically documented Acanthamoeba strains collected from

environmental sources and corneal infections were used in the efficacy

studies. The methods used compared the susceptibility of five strains under

different circumstances. Unlike most studies that suspend cells or cysts in the

test fluid, the present method used attached cells to mimic those on a contact

lens surface. It is believed that attachment might help protect cells from the

biocidal effects of lens solutions. In this way, the method better mimics the

response of amoebae attached to the surface of a lens than other studies that

use axenic cultures that are spun down and vortexed repeatedly. Further,

unlike previous methods, the current method caused minimal disturbance to

the cells during testing.59

a. Test to see if particular ingredients in some MPS provide a protective

benefit to Acanthamoeba. Research has shown that users of Complete®

MoisturePlus™ Multi-purpose solution (Complete) is associated with a

higher rate of AK infection.58, 60 Complete, unlike other cleaning solutions,

contains the ingredient taurine, an amino acid known to induce

encystment in Acanthamoeba, possibly providing the amoebae with a

protective benefit.

i. Multiple strains of Acanthamoeba trophozoites were grown on

varying concentrations of taurine-saline agar and then exposed to

different cleaning solutions to determine if exposure to taurine

protects the amoebae from the biocidal effects of the cleaning

solutions. b. Determine the minimum concentration of hydrogen peroxide (H2O2)

needed to deactivate Acanthamoeba. Many contact lens users do not use

cleaning systems using H2O2 as, if it is not fully neutralized, it can burn

the eyes. If lower concentrations of H2O2 can be used and remain

effective, contact lens wearers may be more likely to use this more

effective cleaning solution.

i. Multiple strains of Acanthamoeba cysts were exposed to varying

concentrations of H2O2 in order to determine the minimum biocidal

concentration.

Acanthamoeba is a very persistent and resilient opportunistic pathogen. The increase in infections caused by this organism emphasizes the need to

determine the source of infection as well as finding optimal contact lens

cleaning solutions to minimize the risk of infection.

3. Determine if grasshoppers are a reliable model organism for testing

Acanthamoeba virulence and pathogenicity. As Acanthamoeba cause the

serious, and often fatal, disease GAE, their increase in water supplies could

have more dire effects than an increase in eye infections. Therefore,

additionally, several strains of clinical, environmental, and culture collection

Acanthamoeba isolates were cultured axenically and then tested for

pathogenicity using a grasshopper model fashioned after a recent study on

locusts.61

A previous study found that the African migratory locust, as insect

innate immune responses are similar to mammals, could be used as a model

to study Acanthamoeba pathogenesis, though only one known pathogenic

strain was used during testing. The present tests used multiple strains of

clinical, environmental, and culture collection origin to test for pathogenicity

using a similar model.

a. Strains of Acanthamoeba isolated from both clinical and tap water sources

were grown axenically and injected intra-abdominally into the insect

model to test for pathogenicity.

Selection of Isolates

Isolates used for the efficacy tests were from various sources, including corneal scrapings from AK patients (courtesy of Elmer Tu), environmental samples from the Chicago-area water supply (courtesy of Charlotte Joslin) and environmental isolates from the Columbus-area water supply (courtesy of

Megan Shoff). None of the isolates were axenically grown. Genotyping was performed using the Rns diagnostic fragment 3 (DF3).34 All isolates chosen for the efficacy studies are of the T4 genotype, which is the most common genotype isolated in Acanthamoeba keratitis.33 Corneal isolates were selected according to the patient’s clinical presentation, including an early, moderate, and advanced stage of disease, as shown in Table 1. Environmental isolates were selected as they represent potential causative agents of disease in an extremely common and universal exposure, the domestic water supply.

Both clinical and environmental samples were cultured axenically for use in the pathogenicity study. Isolates used for the pathogenicity tests were determined by the ability to grow the various corneal and environmental strains obtained axenically. Not all strains of Acanthamoeba will grow to needed concentrations when cultured axenically, so only those with appropriate axenic densities were used. Five corneal strains from a recent outbreak in the greater

Chicago area, three tap water isolates, and two isolates obtained from the CDC from GAE patients were used for the pathogenicity studies. In addition, three

additional, publicly available strains were used: an ATCC human brain isolate, genotype T1 (ATCC 50494), an ATCC human corneal isolate genotype T4 (ATCC

50497) and ATCC soil isolate genotype T9 (ATCC 30135).

It is understood that by culturing the amoebae axenically, their pathogenicity may be reduced. It is well known that these amoebae are negatively impacted by long-term axenic growth, as they are less able to encyst, multiply more slowly, and can lose their pathogenicity all together, though it can often be restored by passage through a mouse.16, 62 Unfortunately, in order to determine pathogenicity, the cultures must be axenic or it would not be possible to determine if it was the amoebae or the bacteria that led to death. An attempt was made to minimize the effect of axenic culture by limiting the amount of time the cultures were grown axenically. Cultures, other than the ATCC strains, were grown axenically for less than nine months. Further, it has been proposed that the endosymbiotic relationship that some bacteria have with Acanthamoeba make the amoebae more virulent; as those amoebae that have endosymbionts cannot be grown axenically, amoebae that have endosymbiotic relationships with bacteria were not tested. This is regrettable, but cannot be helped.

Maintenance of Bacterized Acanthamoeba Cultures

All bacterized cultures were maintained at room temperature (~23° C). The collection of acanthamoebae isolates were subcultured onto non-nutrient amoeba saline (NNAS) agar streaked with live E. aerogenes every 4 to 8 weeks. After this 16

time, trophic amoebae have replicated and migrated along the bacterial streak

(prey bacteria). As prey is depleted, the cells encyst. To prevent the agar plates from drying out (amoebae migrate in the thin water film on the surface of the agar) all plates were sealed with Parafilm “M” (Pechiney Plastic Packaging,

Chicago, IL). To subculture amoebae, a block of agar containing a group of cysts

(ca. 100) was cut from the plate and transferred (cysts down) onto a fresh plate.

The strains that were used in the experiments were subcultured more frequently than stock cultures so that fresh cultures were always on hand. Generally, a freshly inoculated plate is rich in trophic amoebae between 3 and 7 days and full of cysts after 2 weeks.

Figure 1: Complete MoisturePlus Multipurpose Solution (Advanced Medical Optics). Recalled worldwide May 25, 2007.

Figure 2: Acanthamoeba keratitis with deep stromal involvement (photo courtesy of Elmer Tu).

CHAPTER 1

EFFICACY TESTING

Background and Rationale

As stated previously, AK is a serious and rare infection of the cornea that is usually sight threatening. Because AK is rare, the epidemiology in the United

States is poorly understood. However, a statistically significant increase in AK cases occurred in the Chicago-area beginning in June 2003,57 with a total of 63 incident cases identified through the end of 2006. Due to the serious nature of

Acanthamoeba keratitis, the CDC launched a national outbreak investigation involving 35 states to determine the number of cities that have noticed an increase in Acanthamoeba keratitis diagnoses, including Philadelphia,63, 64

Portland,65 San Francisco66, and Boston.67

Contact lens wear is the leading AK risk factor with as many as 80 – 95% of AK cases reporting contact lens use.57, 68-71,1, 16 Contact lenses (CL) can create corneal micro-abrasions offering a portal of entry for acanthamoebae,72 or act as a vector moving amoebae onto the cornea.46 With an estimated 36 million contact lens wearers in the U.S., a large number of people could be at risk.73, 74

Poor contact lens hygiene has also been identified as a risk factor for AK,8, 69,

75 as storage cases may become contaminated with acanthamoebae, particularly if tap water is used for cleaning.76, 77 Several in vitro studies have studied the efficacy of MPS on Acanthamoeba,46, 78 with the general result that as a whole they are largely ineffective, especially against cysts. Though different strains of

Acanthamoeba vary in their susceptibility to cleaning solutions, one study showed that even the most effective Multi-purpose cleaning solution (MPS) studied had more than a 50% survival rate of trophozoites after 24h of exposure,59 though hydrogen peroxide systems may be more effective, particularly 2-step systems.79,

80 Some believe it is likely that active trophozoites are necessary for the onset of an infection,81 but this stipulation has not been proven. Therefore, effective disinfection methods are necessary to kill or inactivate both trophozoites and the more resistant cysts if excystation and infection is to be avoided.

Contact lens solutions in 2006 were independently associated with Fusarium keratitis, another rare and serious eye infection that is not normally associated with contact lens use.82 This outbreak was explained at least in part by the real- life hygiene-related behaviors of solution resuse83 and not recapping lens solutions or contact lens cases, which caused MPS evaporation and formation of

MPS drying film that allowed organism survival.84 Because the current AK outbreak represents the second concurrent outbreak of an extremely rare and serious eye infection,57, 82 and use of a specific solution combined with specific

hygiene-related variables altering solution effectivenes was associated with the

Fusarium outbreak,83, 84 similar hygiene-related variables altering solution effectivenes needed to be investigated to determine the association with AK.

One of the purposes of this study was to investigate the effectiveness of contact lens cleaning solutions against Acanthamoeba..

Further, previous studies studying responses of Acanthamoeba strains to different MPS found that of the three solutions tested, Complete (Allergan,

Irvine, CA) appeared to be relatively ineffective 59 This conclusion is supported by the findings of Joslin et al (2007) wherein 52.8% of the AK cases were users of

Complete MoisturePlus product (Advanced Medical Optics, Santa Ana, CA).

This product contains, as an active ingredient, the amino acid taurine. Taurine, in conjunction with sodium chloride (NaCl) and magnesium chloride (MgCl), has been shown to induce encystment in Acanthameoba. 85

Efficacy of contact lens systems against recent clinical and tap water Acanthamoeba isolates

Megan Shoff, Charlotte Joslin, Elmer Tu, Laura Kubatko, and Paul Fuerst.

2008. Cornea. Jul; 27(6):713-9.

Background and Rationale

Acanthamoebae are ubiquitous protozoa most commonly found in freshwater and soil environments. Their ability to encyst during periods of adverse environmental conditions allows them to inhabit a variety of habitats.

However, even as trophozoites, these amoebae are able to tolerate high temperatures, with strains tolerating temperatures up to 39°C and several strains growing at up to 42°C.18, 35 Many strains can grow in salinities up to 32 ppt and are also chlorine and biocide resistant,18, 35, 78 which explains their presence in swimming pools, hot-tubs, and tap water.40 Due to the ubiquity of acanthamoebae and the fact that they can be cultured axenically, they have been the subject of much research, with most studies dealing with their opportunistic pathogenicity. However, despite intense research, the factors that make this amoeba an occasional human pathogen are unclear.

Acanthamoeba keratitis (AK) is a serious and rare infection of the cornea that is usually sight threatening. Because AK is rare, the epidemiology is poorly understood. Contact lens wear is generally accepted as the leading risk factor, though exactly how wear increases the risk of infection is unclear. The U.S. annualized incidence has been conservatively estimated to range from 1.65 to

2.01 cases per million contact lens wearers,8 however, it may be as much as 15 times more common in the UK, Europe and Hong Kong.69, 75, 86

A statistically significant increase in AK cases is occurring in the Chicago- area that began in June, 2003,87 with a total of 63 incident cases identified through the end of 2006. Increases in AK have also been observed in Philadelphia,63, 64

Portland,65 San Francisco66, and Boston.63 Due to the serious nature of

Acanthamoeba keratitis, the CDC launched a national outbreak investigation with

cases reported in 35 states and Puerto Rico to determine the risk factors associated with Acanthamoeba keratitis.88, 89

Recent results from two independent epidemiological studies by the

University of Illinios at Chicago58 and the CDC88 found approximatley 50 - 55% of AK cases used Advance Medical Optics Complete MoisturePlus Multi-

Purpose Solution (AMO, Santa Ana, CA; Complete MoisturePlus), resulting in more than a fifteen-fold increase in the risk of Acanthamoeba keratitis with

Complete MoisturePlus use and its voluntary recall by AMO.90 Unlike other

MPS, Complete MoisturePlus contains the amino acid taurine as an active ingredient, as well as the chemical hydroxypropyl methylcellulose (HPMC), which is used as a lubricant. Taurine, in conjunction with sodium chloride

(NaCl) and magnesium chloride (MgCl), has been shown to induce encystment in Acanthamoeba.85, 91-94 It has been previously hypothesized that the taurine inclusion in Complete MoisturePlus may provide Acanthamoeba a protective benefit, possibly by inducing it to form more resilient cysts, making the amoebae more resistant to the amoebicidal properties of the cleaning solution.95 In addition, as recent clinical isolates are infrequently used in Acanthamoeba disinfectant efficacy testing and the methods used vary greatly among studies, the possibility exists that testing conditions may decrease amoeba viability and may overstate apparent solution efficacy. The purposes of these studies are 1) to determine the efficacy of commonly available contact lens solutions against

recent clinical and tap water Acanthamoeaba isolates; and 2) to determine if taurine inclusion increases Acanthamoeba survival and resistance against commonly used contact lens disinfectants.

Methods and Materials

Selection of Isolates

Isolates used in this study were from various sources, including corneal scrapings from AK patients (courtesy of EYT), environmental isolates from the

Chicago-area water supply (courtesy of CEJ) and environmental isolates from the

Columbus-area water supply (courtesy of MES, Figure 3). None of the isolates were axenically grown. Genotyping was performed using the Rns diagnostic fragment 3 (DF3).34 All chosen isolates were of the T4 genotype, which is the most common genotype isolated in Acanthamoeba keratitis.33 Corneal isolates were selected according to the patient’s clinical presentation, including an early, moderate, and advanced stage of disease. Environmental isolates were selected as they represent potential causative agents of disease in an extremely common and universal exposure, the domestic water supply.

Selection of Multi-Purpose Cleaning Solutions

Three MPS were chosen based on manufacturer dominance in the United

States market share, including OPTI-FREE® Express® (Alcon, Ft. Worth, TX; Opti-

Free), ReNu MultiPlus® Multi-Purpose Solution (Bausch & Lomb, Rochester, NY;

ReNu), and COMPLETE® Moisture PLUS™ Multi-Purpose Solution (Advanced 24

Medical Optics, AMO, Santa Ana, CA; Complete MoisturePlus).96 The AMO

Trade Name (Generic) MPS was also chosen as its formulation contains neither taurine nor HPMC, but otherwise uses the same disinfectant as Complete

MoisturePlus (polyhexamthylene biguanide, 0.0001%). Hydrogen peroxide systems chosen included two one-step peroxide systems commonly available in the US: ClearCare® (CibaVision, Duluth, GA; ClearCare) and UltraCare®

Disinfecting (AMO, UltraCare). Two-step hydrogen peroxide systems (those which provide a significant exposure time to hydrogen peroxide prior to peroxide neutralization) are no longer available in the US or internationally.

Hydrogen peroxide systems appear to be more effective against Acanthamoeba than the commonly used multipurpose solutions.46, 78-80 UltraCare uses a neutralizing tablet that is added at the beginning of treatment, and is therefore not a true two-step system. Contact lens solution formulations and the manufacturer’s recommended disinfection time as listed on the bottle labels of tested solutions are shown in Figure 4.

Efficacy Tests

Trophozoites, as determined by light microscopy, of the five test strains

(~100 cells) were placed on either 0.25% taurine-saline agar (levels previously associated with causing encystation of Acanthamoeba85), 0.05% taurine-saline agar

(levels found in Complete MoisturePlus97) or non-nutrient amoeba saline agar

(NNAS) containing no taurine. These were incubated at room temperature for 72

hours with Enterobacter aerogenes as prey. After the 72 hour incubation, the amoebae were tested for 6 hours and 24 hours in each of the 6 solutions as previously described.78 However, as we were testing the effects of taurine (and its ability to provide a protective benefit to the Acanthamoeba), no consideration was given as to whether cysts or trophozoites were chosen. Briefly, blocks

(2mmx2mm) of agar with amoeba (ca. 50 cells per block) were cut out of the plates and transferred to an aliquot of MPS or hydrogen peroxide solution and held in a 24 well untreated tissue culture plate (MPS and UltraCare) or the container provided with solution (Clear Care). Testing containers (glass, plastic or untreated polysterene) have previously been shown to result in no significant difference in Acanthamoeba survival.98 For each test solution (ReNu, Complete

MoisturePlus, Generic, Optifree, Clear Care, and UltraCare), three trials (i.e. replicates) and a control were run. Controls consisted of strains being exposed to amoeba saline. Each strain of Acanthamoeba was tested for survival after 6 hours and 24 hours of exposure to the solution at ~21° C (room temperature). The neutralizing tablet for UltraCare was added immediately in the 6 hour trials, and at 12 hours in the 24 hour trials to simulate a two-step hydrogen peroxide system. After treatment, the agar blocks containing the isolates were transferred to DifcoTM Dey/Engley Broth (Becton, Dickinson and Co., Sparks, MD). This broth neutralizes the disinfectant and has been shown to have no toxic effect on amoebae.99 After neutralizing for five minutes, the blocks containing amoebae

were rinsed twice (at 5 and 10 minutes) with amoeba saline before re-inoculating the amoebae onto a NNAS agar plate seeded with live E. aerogenes to test for survival. The agar plates were sealed with Parafilm and incubated at 21° C.

Plates were examined over the following week to check for growth using a light microscope. Positive growth (observed as trophic amoebae migrating along the

E. aerogenes prey streak) was indicative of treatment survival.

It has been suggested that the current method of testing using agar plugs could lead to the inactivation of the test solutions (namely, the binding of the agar acidic polysaccharide to a cationic preservative, such as PHMB, could lead to loss of biocidal efficacy),100, 101 However, in recent tests,102 three of the strains used in this study (Chicago-area tap water, Columbus-area water, and a corneal isolate) were tested using ReNu, Complete MoisturePlus, and OptiFree, both with the addition of an agar plug and without an agar plug. Tests were run at

27°C for 6h, with controls in which strains were exposed to amoeba saline. The results in all cases were the same between the two trials; the amoebae survived the treatments both with and without the agar plug.102

Statistical Analysis

The presence of any viable Acanthamoeba for a single trial was used as an outcome measure since the quantity of amoeba necessary for corneal infection is unknown. The percentage of trials with Acanthamoeba survival is reported

Logistic regression analyses using presence or absence of growth as the response

were used to assess the effect of solution, strain, and taurine concentration on growth. All analyses were carried out using SYSTAT version 12.00.08.

Results

Nearly all control trials (178 of 180) resulted in positive growth. The percent survival of the five strains when exposed to the different cleaning solutions is shown in Figures 5 and 6. All four MPS were largely ineffective;

ReNu, Complete MoisturePlus, and the AMO generic MPS had 100% survival of all strains after 6 hours and 24 hours, while OptiFree had 100% survival for all strains after 6 hours and for 4 of the 5 strains after 24 hours. The two hydrogen peroxide systems fared much better; Clear Care had survival of 3 of the 5 strains after 6 hours and 2 of 5 strains after 24 hours. Ultracare was the most effective with complete survival of only the Chicago area tap water strain (06-039) at 6h, and no survival of any strain at 24 hours. There were significant differences between the effectiveness of the MPS and the hydrogen peroxide cleaning systems (p-value <0.001). The five strains also showed significant differences in their response to the hydrogen peroxide cleaning solutions (p-value <0.001).

Taurine had no significant effect relating to the Acanthamoeba survival for the solutions or the strains. This lack of effect is particularly evident when comparing strain survival across taurine levels for the hydrogen peroxide solutions (Figure 5).

Discussion

Our results demonstrate that use of recent clinical and tap water

Acanthamoeba isolates in efficacy testing of common MPS results in 100% survival and total amoebicidal ineffectiveness at a 6 hour disinfection time (Figure 5).

These findings are important, because the six-hour period meets or exceeds manufacturer’s recommended disinfection times and approximates overnight disinfection (Figure 4). Similarly, Acanthamoeba survival was equivalent when comparing AMO Complete MoisturePlus and the AMO generic MPS, which contains neither taurine nor HPMC, but otherwise uses the same disinfectant

(polyhexamthylene biguanide, 0.0001%). Hydrogen peroxide systems were more effective against most Acanthamoeba strains, even at 6 hours (Figure 5). Because of complete Acanthamoeba survival with all MPS, we were unable to fully evaluate the effect of taurine addition; however, among hydrogen peroxide systems without complete Acanthamoeba survival, there was not a statistically significant difference in Acanthamoeba survival with or without taurine present.

This suggests the addition of taurine, a component unique to Complete

MoisturePlus, may not be responsible for the increased AK risk seen in users of this contact lens disinfectant.

The Acanthamoeba T4 strains used in this study are isolates selected from clinical disease and isolates present in the domestic water supply, which is a common, universal exposure. Of all tested strains, the Chicago area tap water

strain (06-039) was the strain most resistant to solution disinfection (Figure 5).

This is concerning, as the Chicago area tap water strain has the exact same genetic T4 sequence as one of the corneal Acanthamoeba isolates collected in the

Chicago AK series, suggesting not only that the water supply could be the source of the organism, but also that Acanthamoeba strains present in the water supply are pathogenic in causing Acanthamoeba keratitis in humans103. In previous

United Kingdom studies, the genetic typing of corneal Acanthamoeba isolates identically matched the Acanthamoeba isolates cultured from the water supply within the patient’s home.56

No standard protocols exist when testing the efficacy of contact lens solutions against Acanthamoeba, and neither the Federal Drug Administration nor the International Organization for Standardization require Acanthamoeba inclusion as a challenge organism when testing solution efficacy.99 As such, methods used in testing Acanthamoeba disinfectant efficacy vary greatly, and results among different studies are frequently contradictory.93, 99 We chose a dichotomous outcome measure based on the presence or absence of viable

Acanthamoeba cysts and trophozoites. Ideally, if Acanthamoeba pathogenesis was better understood, particularly if the threshold for allowable organisms under which clinical disease does not occur could be established, then quantitative methods would be preferred. Unfortunately, the quantity of amoebae necessary for promoting corneal infection remains undetermined.54 However, in the

presence of an increase of AK both in Chicago as well as nationally,58, 88 the possibility exists that changes in the water supply may be promoting biofilm growth and consequently increasing the Acanthamoeba load in the water supply to undetermined and potentially pathogenic levels.87 It is important, therefore, to consider that the dichotomous outcome measure may be more appropriate if an increase in the overall load of Acanthamoeba organisms, overwhelming the marginal anti-acanthamoebal properties of current MPS solutions, is a mechanism of the current outbreak. This may be especially relevant since roughly 40% of AK cases in both the UIC and CDC studies were using solutions other than the AMO Complete MoisturePlus product strongly associated with disease.58, 88

Our results suggesting poor MPS efficacy are generally consistent with previous studies that use various methods in the evaluation of disinfectant efficacy;72, 78, 80, 104, 105 however, we had a very high amoeba survival rate, which may be a function of the virulence of the organisms used. A number of factors have been identified which affect the viability of Acanthamoeba in vitro. Since extensive laboratory cycling may significantly reduce the viability of

Acanthamoeba isolates,93 the utilization of our recent clinical and tap water isolates may be a factor in our success in cultivating the amoeba and its comparatively higher virulence. Our MPS testing with recent clinical and tap water T4 isolates resulted even higher Acanthamoeba survival than previous MPS

testing with primarily environmental T3, T4 and T5 isolates using our same methodologies,59 suggesting that recent clinical and tap water T4 isolates may indeed have increased virulence. In microbiological methods, however, there is little argument that the use of recent clinical isolates is preferred when available and would likely be the most valid reflection of true environmental virulence and pathogenicity.

Alternative explanations for increased Acanthamoeba survival could be that our method of amoebicidal testing uniquely uses attached cells grown on bacteria agar cubes to mimic growing conditions on a biofilm-coated contact lens or lens case surface, as opposed to using trophozoites or cysts suspended in liquid media or test solution. As cell attachment could protect Acanthamoeba from amoebicidal effects of lens solutions, MPS testing using less resistant, suspended trophozoite and cyst techniques may suggest improved solution

Acanthamoeba efficacy compared to our methods of real life simulation. Similarly, many studies use axenic cultures, which are known to decrease organism virulence, 93, 106 potentially decreasing Acanthamoeba survival with disinfection.

In contrast, the wild type strains from recent corneal and tap water isolates were grown on non-nutrient amoeba saline agar streaked with live E. aerogenes, which best simulates the amoeba food source and growth in non-laboratory settings.

Further, our method of amoebicidal testing induces minimal artifactual damage to the Acanthamoeba during testing – cells are never dislodged from the agar

surface, centrifuged or pipetted – which is more realistic with the environment of a contact lens or lens case. These various stressors, all of which may decrease amoeba viability, are frequently imposed in other studies and could overstate apparent solution efficacy. As such, we believe our results with nearly complete

Acanthamoeba survival may more accurately reflect actual amoeba survival as we have more closely simulated the natural environment of the Acanthamoeba.

Our findings are important for two reasons; first, they suggest that MPS in general, when challenged against Acanthamoeba organisms under conditions that closely simulate a natural environment, are ineffective. Second, we found considerable survival differences among T4 strains with different genetic subtypes, with the strain most resistant to disinfectants originating from the

Chicago area tap water, which emphasizes the importance of testing with multiple strains. Results strongly suggest additional study of amoebicidal properties of contact lens solutions as well as the virulence of tap water isolates from the water supply is warranted. Furthermore, consideration of these findings should be strongly weighed in clinical settings, including the possibility of daily disposable contact lenses and/or hydrogen peroxide systems use to minimize potential Acanthamoeba exposure resulting from inadequate MPS disinfection.

H2O2 Testing

Background and Rationale

As stated above, recent results from two independent epidemiological studies by the University of Illinios at Chicago58 and the CDC88 found approximatley 50 - 55% of AK cases used Advance Medical Optics Complete

MoisturePlus Multi-Purpose Solution (AMO, Santa Ana, CA; Complete

MoisturePlus), resulting in more than a fifteen-fold increase in the risk of

Acanthamoeba keratitis with Complete MoisturePlus use and its voluntary recall by AMO.90

As recent efficacy tests have shown that hydrogen peroxide contact lens cleaning solutions are much more effective at inactivating Acanthamoeba107, it would be ideal if these solutions were used by most contact lens wearers.

Unfortunately, these cleaning solutions are not popular with contact lens users as many have had negative experiences using the products, most likely due to lack of complete neutralization of the hydrogen peroxide. It is believed that if a lower concentration of hydrogen peroxide could be utilized, it would be easier and faster to neutralize and therefore less likely to cause discomfort. This study tested five different Acanthamoeba strains against five concentrations of a commercially available hydrogen peroxide lens cleaning system.

Methods and Materials

Selection of Isolates

Isolates used in this study were from various sources, including corneal scrapings from AK patients (courtesy of EYT), environmental isolates from the

Chicago-area water supply (courtesy of CEJ) and environmental isolates from the

Columbus-area water supply (courtesy of MES) (Figure 3). None of the isolates were axenically grown. Genotyping was performed using the Rns diagnostic fragment 3 (DF3).34 All chosen isolates were of the T4 genotype, which is the most common genotype isolated in Acanthamoeba keratitis.33 Corneal isolates were selected according to the patient’s clinical presentation, including an early, moderate, and advanced stage of disease. Environmental isolates were selected as they represent potential causative agents of disease in an extremely common and universal exposure, the domestic water supply.

Selection of Hydrogen Peroxide Cleaning Solution

The hydrogen peroxide system chosen is a one-step peroxide systems commonly available in the US, UltraCare® Disinfecting (Advanced Medical

Optics, UltraCare). Two-step hydrogen peroxide systems (those which provide a significant exposure time to hydrogen peroxide prior to peroxide neutralization) are no longer generally available in the US or internationally. Hydrogen peroxide systems appear to be more effective against Acanthamoeba than the commonly used multipurpose solutions.46, 78-80, 107 UltraCare uses a neutralizing

tablet that is added at the beginning of treatment, and is therefore not a true two- step system.

Efficacy Tests

For each of the 5 efficacy test strains of Acanthamoeba (Figure 3), blocks

(2mmx2mm) of agar with amoeba cysts (ca. 50 cells per block) were cut out of the plates and transferred to a 24-well culture plate containing an aliquot of

UltraCare hydrogen peroxide solution (3%, 2.5%, 2%, 1.5% and 1% H2O2 ).

Testing containers (glass, plastic or untreated polysterene) have previously been shown to result in no significant difference in Acanthamoeba survival.98 For each test concentration, ten trials (i.e. replicates) and two controls were run. Controls consisted of strains being exposed to amoeba saline. Each strain of Acanthamoeba was tested for survival after 6 hours and 24 hours of exposure to the solution at

~21° C (room temperature). The neutralizing tablet for UltraCare was added immediately in the 6 hour trials, and at 6 hours in the 24 hour trials to simulate a two-step hydrogen peroxide system. After the treatment times, the blocks containing amoebae were rinsed twice (at 5 and 10 minutes) with amoeba saline before re-inoculating the amoebae onto a NNAS agar plate seeded with live E. aerogenes to test for survival. The agar plates were sealed with Parafilm and incubated at 21° C. Plates were examined over the following three weeks to check for growth using a light microscope. Positive growth (observed as trophic

amoebae migrating along the E. aerogenes prey streak) was indicative of treatment survival.

Statistical Analysis

Square tests using the PHStat 2 add-in for Microsoft Excel version 11.0 (Prentice

Hall, 2001) were applied to determine differences.

Results

All control trials resulted in positive growth. The percent survival of the five strains when exposed to the different solution concentrations for 24h is shown in Figure 8. Full strength Ultracare (3%) was the most effective with complete survival of only the Chicago area tap water strain (06-039) at 6h, and no survival of any strain at 24 hours (Figures 7 and 9). The five strains showed significant differences in their response to the different hydrogen peroxide concentrations (p-value <0.005). The four reduced concentrations all had survival percentages significantly higher than the 3% H2O2 concentration (p- value < 0.005).

Discussion

The aim of this study was to determine if reduced concentrations of H2O2 could be effective in killing Acanthamoeba. These results suggest Acanthamoeba survival is significantly increased with reduced concentrations of hydrogen peroxide, and therefore lower concentrations are not effective.

As seen in the previous study,107 of all tested strains, the Chicago area tap water strain (06-039) was the strain most resistant to solution disinfection

(Figures 7 and 8). Once again, this is concerning, as the Chicago area tap water strain has the exact same genetic T4 sequence as one of the corneal Acanthamoeba isolates collected in the Chicago AK.

No standard protocols exist yet when testing the efficacy of contact lens solutions against Acanthamoeba, and neither the Federal Drug Administration nor the International Organization for Standardization require Acanthamoeba inclusion as a challenge organism when testing solution efficacy.99 As such, methods used in testing Acanthamoeba disinfectant efficacy vary greatly, and results among different studies are frequently contradictory.93, 99 A dichotomous outcome measure based on the presence or absence of viable Acanthamoeba cysts and trophozoites was again used. If it was understood how exactly Acanthamoeba infected the cornea, especially if the threshold for allowable organisms under which clinical disease does not occur could be established, then more precise quantitative methods would be preferred. Unfortunately, the quantity of

amoebae necessary for promoting corneal infection remains undetermined.54

However, the increase of AK both in Chicago as well as nationally58, 88 may indicate that changes in the water supply is promoting additional biofilm growth within the water distribution systems and consequently increasing the

Acanthamoeba load in the water supply to currently undetermined and potentially pathogenic levels.87 It is important, therefore, to consider that the dichotomous outcome measure may be more appropriate if an increase in the overall load of

Acanthamoeba organisms, overwhelming any anti-acanthamoebal properties of current cleaning solutions, is a mechanism of the current outbreaks.

Unfortunately, these findings do not support the use of lower concentrations of hydrogen peroxide in contact lens cleaning solutions.

However, these findings are important in that it was once again shown that considerable survival differences exist among T4 strains with different genetic subtypes, with the strain most resistant to disinfectants originating from the

Chicago area tap water, which emphasizes the importance of testing with multiple strains. As stated previously, these results also suggest additional study of amoebicidal properties of contact lens solutions as well as the virulence of tap water isolates from the water supply is warranted.

Strain Source of Isolate Genotype Clinical Presentation of Infection 06-004 UIC-AK T4 Advanced 06-061 UIC-AK T4 Moderate 06-035 UIC-AK T4 Early 06-039 Chicago-area T4 Not applicable water C06-038 Columbus water T4 Not applicable

Figure 3: Strain ID’s, sources, genotypes and clinical presentation of infections.

Brand Name Manufacturer Manufacturer Ingredients Recommended Disinfection Time ReNu Bausch & Lomb 4 hours HYDRANATE® MultiPlus® (hydroxyalkylphosphonate), boric acid, Multi- edetate disodium, poloxamine, sodium Purpose borate and sodium chloride; preserved Solution with DYMED® (polyaminopropyl biguanide) 0.0001% COMPLETE® AMO 4 hours hydroxypropyl methylcellulose, Moisture propylene glycol, polyhexamethylene PLUS™ biguanide 0.0001%, phosphate and taurine, Poloxamer 237, edetate disodium, sodium chloride, potassium chloride, and purified water. OPTI-FREE® Alcon 6 hours sodium citrate, sodium chloride, boric Express® acid, sorbitol, AMP-95†, TETRONIC®1 1304, with edetate disodium 0.05%, POLYQUAD® (polyquaternium-1) 0.001% and ALDOX®(myristamidopropyl dimethylamine) 0.0005% ClearCare® CIBAVision 6 hours hydrogen peroxide 3%, Sodium chloride 0.79%, stabilized with phosphoric acid, a phosphate buffered system and Pluronic 17R4 (cleaning agent) Trade name AMO 6 hours polyhexamethylene biguanide (Generic) (0.0001%), phosphate buffer, Poloxamer 237, edetate disodium, sodium chloride, potassium chloride, purified water UltraCare AMO 6 hours Solution contains hydrogen peroxide 3% (stabilized with sodium stannate and sodium nitrate, and buffered with phosphates) and purified water. Neutralizing Tablets contain catalase, hydroxypropyl methylcellulose, and cyanocobalamin (vitamin B12) with buffering and tableting agents.

Figure 4: Contact lens cleaning solution brand names, including manufacturer, recommended disinfection times, and ingredients as stated on packages.

Survival 6h 24h Taurine Level Taurine Level Overall Strain Source 0% 0.05% 0.25% 0% 0.05% 0.25% Survival 100% 100% 100% 100% 100% 100% 06-039 IL TW 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% C06-038 OH TW 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 100% 06-035 AK

Renu 3/3 3/3 3/3 3/3 3/3 3/3 90/90 100% 100% 100% 100% 100% 100% 06-061 AK 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 06-004 AK 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 06-039 IL TW 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% C06-038 OH TW 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 100% 06-035 AK 3/3 3/3 3/3 3/3 3/3 3/3 90/90

Complete 100% 100% 100% 100% 100% 100% 06-061 AK 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 06-004 AK 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 06-039 IL TW 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% C06-038 OH TW 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 100% 06-035 AK 3/3 3/3 3/3 3/3 3/3 3/3 90/90 100% 100% 100% 100% 100% 100% 06-061 AK AMO Generic 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 06-004 AK 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 06-039 IL TW 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% C06-038 OH TW 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 94.4% 06-035 AK 3/3 3/3 3/3 3/3 3/3 3/3 85/90 OptiFree 100% 100% 100% 67% 0% 67% 06-061 AK 3/3 3/3 3/3 2/3 0/3 2/3 100% 100% 100% 100% 100% 100% 06-004 AK 3/3 3/3 3/3 3/3 3/3 3/3 100% 100% 100% 100% 100% 100% 06-039 IL TW 3/3 3/3 3/3 3/3 3/3 3/3 67% 33% 67% 33% 0% 0% C06-038 OH TW 2/3 1/3 2/3 1/3 0/3 0/3 100% 100% 100% 100% 100% 33% 54.4% 06-035 AK 3/3 3/3 3/3 3/3 3/3 1/3 49/90

Clear Care 100% 67% 67% 0% 0% 0% 06-061 AK 3/3 2/3 2/3 0/3 0/3 0/3 33% 33% 0% 0% 0% 0% 06-004 AK 1/3 1/3 0/3 0/3 0/3 0/3 100% 100% 100% 0% 0% 0% 06-039 IL TW 3/3 3/3 3/3 0/3 0/3 0/3 33% 0% 33% 0% 0% 0% C06-038 OH TW 1/3 0/3 1/3 0/3 0/3 0/3 0% 100% 100% 0% 0% 0% 25.5% 06-035 AK 0/3 3/3 3/3 0/3 0/3 0/3 23/90

UltraCare 33% 0% 33% 0% 0% 0% 06-061 AK 1/3 0/3 1/3 0/3 0/3 0/3 100% 0% 33% 0% 0% 0% 06-004 AK 3/3 0/3 1/3 0/3 0/3 0/3

Figure 5: Survival rates of each Acanthamoeba strain is provided for each solution for both 6h and 24h treatment times at all taurine levels. Percentage survival, as well as number of trials with surviving amoebae, are given.

100.0%

90.0%

80.0%

70.0%

60.0%

50.0%

40.0%

Percent Survival Percent 30.0%

20.0%

10.0%

0.0% Renu Complete Generic OptiFree Clear Care UltraCare Solution

Figure 6: Percent Survival of Trials for each cleaning solution tested. Survival percentages are for all times, strains, and taurine levels combined.

H2O2 Survival Overall Concentration Strain Source 6h 24h Survival 100% 100% 06-039 IL TW 10/10 10/10 100% 80% C06-038 OH TW 10/10 8/10 100% 70% 56% 06-035 AK

10/10 7/10 28/50 1.00% 100% 0% 06-061 AK 10/10 0/10 100% 20% 06-004 AK 10/10 2/10 100% 100% 06-039 IL TW 10/10 10/10 100% 90% C06-038 OH TW 10/10 9/10 100% 70% 52% 06-035 AK

10/10 7/10 26/50 1.50% 100% 0% 06-061 AK 10/10 0/10 100% 0% 06-004 AK 10/10 0/10 100% 80% 06-039 IL TW 10/10 8/10 100% 30% C06-038 OH TW 10/10 3/10 100% 20% 28% 06-035 AK

10/10 2/10 14/50 2.00% 100% 0% 06-061 AK 10/10 0/10 100% 0% 06-004 AK 10/10 0/10 100% 40% 06-039 IL TW 10/10 4/10 100% 60% C06-038 OH TW 10/10 6/10 100% 0% 22% 06-035 AK

10/10 0/10 11/50 2.50% 100% 0% 06-061 AK 10/10 0/10 100% 10% 06-004 AK 10/10 1/10 100% 0% 06-039 IL TW 10/10 0/10 100% 0% C06-038 OH TW 10/10 0/10 100% 0% 2.0% 06-035 AK 10/10 0/10 1/50 3.00$% 80% 10% 06-061 AK 8/10 1/10 100% 0% 06-004 AK 10/10 0/10

Figure 7: Strain survival responses to five concentrations of hydrogen peroxide solution.

Figure 8: Strain responses to hydrogen peroxide solutions, all concentrations combined.

Figure 9: Growth responses to varying concentrations of hydrogen peroxide, all strains combined.

CHAPTER 2

DOMESTIC WATER TESTING AND AK CORRELATION

Background and Rationale

Acanthamoeba spp. are opportunistic pathogens that form resistant double- walled cysts under adverse conditions. It has long been believed that tap water is an important factor in the etiology of Acanthamoeba keratitis (AK) infections.56

It is generally accepted that contact lens wearers who clean and rinse their lenses in tap water can introduce amoebae onto the lens surface, initiate colonization of the lens and provide the means for transferring an infective dose to the eye surface.56 The use of tap water to clean lens storage cases can also result in the proliferation of amoebae within the case. Further, recent epidemiological investigations have shown that there is an increased AK risk associated with wearing contacts while showering.58 In order for this to be plausible, acanthamoebae must both be present in tap water and be able to withstand the rigors of water treatment plants, primarily filtration and chlorination, as it has already been shown that acanthamoebae can withstand commonly used MPS.

Previous studies have shown the presence of acanthamoebae in domestic water

supplies abroad and in south Florida,55, 56 however, a single U.S. study is not enough to give an accurate baseline level for acanthamoebae as different geographical areas have different water sources and treatment facilities. A recent study by Thomas et al108 which studied the presence of amoebae and amoebae- resistant bacteria at several points in a water treatment plant found acanthamoebae to be present in the source water, in the sand filtration biofilm, and at the distant point after treatment (i.e. in the distribution system after treatment), indicating that these amoebae are surviving the treatment process, with other naked amoebae present at each step of treatment.108 Further, investigations by Andrew Rogerson et al at Marshall University showed an

11.6% Acanthamoeba spp. presence when testing 1L samples of running tapwater

(A. Rogerson, pers. Comm.). The present studies will attempt to find culturable acanthamoebae in the greater Chicago domestic water supply and will use molecular analysis to determine if isolates cultured from tap water are related geographically and/or genotypically to those isolated from corneal scrapings of

AK patients from the ongoing Chicago AK outbreak.

AK is extremely rare in the U.S. where infection rates range from only 1.65 to 2.01 cases per million contact lens wearers, but may be up to 15 times more common in the UK, Europe and Hong Kong.2, 8, 75, 86 Domestic water supplies have been implicated as a source for AK contamination in the UK, with one case series reporting that 30% of AK cases were supplied with Acanthamoeba-

colonized tap water.56 Some areas in the United States, however, have recently seen significant increases in that rate; more than 60 cases have been diagnosed at the University of Illinois, Chicago (UIC) in the past three years, as compared to 2-

3 per year previously.8, 57, 58 It is hypothesized that changes in water treatments may have led to an increase in biofilms and thus an increase in Acanthamoeba in the water supply, as cases continue to present even after the recall of the implicated MPS in May 2007 (Figures 10 and 11). Work in the Fuerst lab has already ruled out the presence of new, more virulent strains of acanthamoebae as the cause of the Chicago outbreak.109 This study will attempt to identify the prevalence of Acanthamoeba and other amoebae in tap water in the Chicago areas to determine the risk for amoebal infections of the cornea in contact lens wearers and determine if any isolates recovered are identical to AK isolates. Both the tap water and AK isolates that are recovered were identified to genotype using molecular analyses of the nuclear small subunit (ssu) ribosomal RNA gene (Rns) and classified as one of the 15 previously identified genotypes, T1-T16.30, 33, 110

Due to the apparent link between contaminated water exposure and AK risk, of primary interest is the analysis of the domestic water supply. After the

EPA reduced the allowable levels of carcinogenic disinfection byproducts with the Stage 1 Disinfectants and Disinfection Byproducts Rule in December 1998,111 treatment plants have reduced disinfection byproducts by changing their disinfection methods by reducing the amount or type of chlorine used, changing

when they add chlorine, or removing organic material from water, as disinfection byproducts are produced when disinfectants (such as chlorines, chloramines, chlorine dioxide, and ozone) react with organic matter present in the water.112 Though disinfection additives are introduced throughout water systems, most pipes are colonized by microorganisms that Acanthamoeba and other protists can graze on. The levels of chlorines and other disinfectants directly relate to the amount of biofilm present and thus the level of

Acanthamoeba this biofilm can support.113-117 Therefore, disinfection residuals minimize Acanthamoeba colonization by reducing available biofilm for

Acanthamoeba to graze upon.

EPA compliance deadlines were January 2002 for large surface water systems and 2 years later in January 2004 for small ground water systems.111

Therefore, due to the timing of the recent Chicago AK outbreak (Figure 6),57 it seems reasonable to suspect the apparent increase in incidence may be related to the water supply. It is hypothesized that the reduction of biocides due to the

EPA’s new guidelines has led to an inadequate control of the microorganisms in the water distribution systems and this in turn is increasing the levels of

Acanthamoeba. This, in turn, could increase the incidence of AK, as well as possibly GAE and infections caused by endosymbiotic bacteria, as biofilms in distribution systems increase and are able to support increasing numbers of protists, including Acanthamoeba and their endosymbionts. These new

regulations are now in effect for essentially all U.S. domestic water supplies. It is possible that this decrease of biocides may have shifted the microbial risk balance and increased the risk of AK. As pipes within distribution systems develop increased biofilms,113, 116, 117 distances between water treatment and end usage may become significant because colonization of microorganisms may increase downstream from the treatment centers where chlorine concentrations are lower.114

An attempt was made to culture and genotype all Acanthamoeba found in water samples. The most common genotype implicated in AK infections is the

T4 genotype. However, this genotype is also the most common type isolated from the environment, comprising some 72% of all acanthamoebae encountered.12 It follows that the prevalence of T4s in eye infections may simply reflect their abundance in Nature rather than a predisposition to cause infection.

The sequences found were compared to the sequences found in the corneal isolates that were obtained from Charlotte Joslin and Elmer Tu at UIC to identify any genotypic similarities or differences between environmental and clinical isolates.

The ultimate goal of the tap water study was to examine if there is a link between AK and Acanthamoeba colonization of the Chicago area domestic water supply. It is hoped that additional studies in cities experiencing increased rates

of AK infections will be conducted in order to solidify the link between the domestic water supply and the incidence of AK infections.

Methods and Materials

Water samples were collected from sites in the greater Chicago area. The only consistent sampling site for homes in the U. S. is the water storage tank

(cistern tank) serving the toilet. This site has the advantage that it is constantly bathed in cold water supplied by the municipal water mains for that area. Since it is relatively undisturbed and rarely (if ever) cleaned, many tanks have a noticeable biofilm. It is this film and the associated water that was sampled for amoebae. Water was sampled in all cases using sterile swabs from the inside surface film of the lavatory cistern reservoir tank. Further, 50 mL of tank water serving the lavatory was also sampled. In most cases, the ultimate source of water was cold municipal mains water; some locations, though not many, were well water supplies. The presence of amoebae in samples was assayed using an enrichment cultivation method appropriate for Acanthamoeba. Amoebae were identified based on diagnostic features discernable by light microscopy.

Sample sites were determined by an ongoing case-control study involving

UIC AK cases beginning in 2003.118 Samples were collected between June 1, 2006

– June 1, 2008 as previously described119 as well as obtaining additional 50 ml water samples from the cistern storage tank. Briefly, two sterile cotton swabs were used to thoroughly scrape a two-inch square area of the inner tank surface

below the water line and water from the tank was collected in a sterile 50ml sample tube. Samples were returned to the laboratory to be processed. The swab tips were placed on non-nutrient amoeba saline (NNAS, Appendix 1) agar plates seeded with Enterobacter aerogenes. The 50 ml water samples were passed through a .45µm filter and filters were placed on NNAS plates seeded with E. aerogenes. After at least two weeks of incubation, the plates were rinsed with amoeba saline to dislodge amoebae and the washings were examined by light microscopy. Cultures positive for Acanthamoeba were transferred to liquid media, either amoeba saline or PYG-712 (appendix 1). Once cultures had grown out to a density of at least 1 x 104 cells/ml, they were processed for DNA extraction using the Qiagen DNeasy kit (Qiagen, Inc., Valencia, CA), following the protocol as written for DNA extraction for animal tissue (appendix 2).

Corneal scrapings from the University of Illinois-Chicago (UIC) were stored in Page’s amoeba saline29 and sent to OSU for culture and genotyping. Upon arrival at OSU, aliquots of saline were placed on NNAS seeded with live E. aerogenes for culturing of Acanthamoeba. Samples positive for Acanthamoeba were then transferred to liquid culture, both in amoeba saline and PYG-712 media.

Once cultures had grown out in liquid media, they were processed for DNA extraction as described above.

After extractions, PCR was performed on the extracted DNA to amplify amplicon ASA.S1 that contains the diagnostic fragment 3 (DF3) region of the Rns,

which has previously been shown to be a highly informative region capable of predicting the genotype as reliable as the entire 18S gene.32, 34, 35 Primers specific for Acanthamoeba, JDP1 (5’- GGCCCAGATCGTTTACCGTGAA-3’) and JDP2 (5’-

TCTCACAAGCTGCTAGGGAGTCA-3’), were used in all cases.12, 32, 120 Those

PCR samples that had the expected band at ~450 bp were then cleaned using

Qiaquik PCR clean-up kit (Qiagen, Inc., Valencia, CA) or ExoSAP-IT

(USB/Affymetrix, Cleveland, OH) and the resulting PCR product was then sequenced using the Rns conserved primer 892c (5’-

GTCAGAGGTGAAATTCTTGG-3’) on the Applied Biosystems terminator 3001 automated fluorescent DNA sequencer (Applied Biosystems, system, Foster City,

CA), as described previously.12, 109

Sequences were then genotyped by comparing them to previously identified sequences available from GenBank

(http://www.ncbi.nlm.nih.gov/Genbank/) and aligned using MEGA 4.0.32, 121

Sequences were deposited in GenBank as indicated in Figure 12, Appendix 5.

Results

A total of 228 households’ samples from 143 zip codes in the Chicago area have been processed. Amoebae (regardless of genus) were present in 117

(51.87%) of these homes sampled. Acanthamoeba were found in 46 households

(20.18 %, Figure 14). 37 of the zip codes (25.87%) had samples positive for

Acanthamoeba with 85 of the 143 zip codes (59.44%) being positive for either

Acanthamoeba, other amoebae, or both (Figure 15). Of the tap water samples that came from homes of AK patients, 21.21% were positive for the presence of

Acanthamoeba in the tapwater, however, 39.39% had positive tap water samples within the same zip code.

Acanthamoeba isolates were characterized with respect to the Rns genotypes using DF3. A total of 48 samples (thus far) were genotyped, 24 tap water samples and 24 AK samples (Figure 12). Of these samples, 44 were genotype T4 (21 tap water and 23 AK) and 4 were genotype T3 (3 tap water and 1

AK), as seen in Table 5. No other genotypes were found in any of the tapwater or AK samples. The sequences from homes of AK patients with positive

Acanthamoeba cultures from their tap water were not the same as the sequences obtained from corneal scrapings. Sequences were aligned to those previously submitted to Genbank for identification.

Discussion

It is believed that the recent increase in AK is linked to the changes made to the allowable biocides being reduced by the EPA.57, 58, 109, 118 It was therefore expected that not only would there be a higher percentage of water samples in the Chicago area with culturable Acanthamoeba compared to the previous S.

Florida study, but that many of these samples would correlate to actual AK infections and show the same geographical clustering as has been shown in the

AK cases.57 More than 20% of the Chicago area water samples had culturable

Acanthamoeba, far greater than the one other published U.S. tap water study which found only approximately 3% of South Florida tap water with culturable

Acanthamoeba, as well as more than the Rogerson study which found 11% of samples with culturable acanthamoebae (pers. Comm..), with more than 25% of the zip codes samples having culturable Acanthamoeba.55 As expected, most genotypes for the tap water and AK cases were of genotype T4, with sequences similar to those previously seen. These results are as expected, as Booton et al showed that 72% of environmental isolates were T4,12 and several studies have shown that most AK cases are also of the T4 genotype.12, 32, 34, 122 This agrees with

Booton et al,109 which showed that the increase in AK cases is not the result of new, more virulent, species of Acanthamoeba. It is likely that it is Acanthamoeba genotype T4’s abundance in nature (and in tap water) that makes it the predominate genotype seen in both eye and brain infections.12, 122 As genotype

T4 strains can be divided into several sub-groups (P. Fuerst, unpublished data), analysis of some of the T4’s found in this study were further analyzed to determine where within the T4 group these strains belong. Of particular interest was isolate W06-201, which was highly pathogenic in the pathogenicity study, this isolate was determined to belong in T4 subgroup 2, which contains many other pathogenic strains.

The alarmingly high incidence rate of 20% of culturable Acanthamoeba combined with the increase of AK cases is cause for concern, especially in light of

the fact that 1) Legionella cases have increased since 200328 and 2) There has been a small outbreak of Cryptosporidium cases.123 Legionella has been shown to use

Acanthamoeba as a vector for transmission and the increase in Acanthamoeba could possibly be linked to the increase of cases of Legionnaire’s disease. Also, with the reduced allowable biocides in the water supply, it is possible that other pathogenic protists, such as Cryptosporidium, may also be establishing themselves in the water supply, and we may see an increase of other water-borne diseases.

Additional research into these possibilities is warranted and needs to be conducted before additional harm is done and the lives of thousands may be impacted.

Chicago Acanthamoeba Outbreak Complete MoisturePlus Multipurpose Solution Recall

30 25 20 15 10

Total AK Cases AK Total Expected IR 5 0

1999 2000 2001 2002 2003 2004 2005 2006 2007

2008 YTD Acanthamoeba Year (beginning 6/1)

Figure 10: Chicago-area Acanthamoeba keratitis cases by year (as of 10/1/08). From Joslin et al 2008.118

Figure 11: Acanthamoeba keratitis cases by year based on CDC multi-state data (slide accessed October 6, 2008 at http://www.fda.gov/ohrms/dockets/ac/08/slides/2008- 4363s1-03-VERANI-CDC.pdf )

OSU Isolate Source of Zip Code of UIC ID# Genotype Genbank # ID # Sample Source W06-166 107 Tapwater 46307 T4 W06-100 63 Tapwater 46321 T4 06-071 80381729 AK 46321 Pcr + W07-133 326 Tap water 46366 Pcr + 06-004 80318599 AK 46565 T4 EU168076 W07-048 247 (80365821) Tap water 49043 Pcr + 06-052 80365821 AK 49043 T4 W06-146 143 Tapwater 49426 T4 W06-003 5 Tapwater 60007 T4 W06-221 55 Tapwater 60007 T4 W06-207 198 Tapwater 60007 T4 W06-062 146 Tap water 60010 T4 06-069 80381692 AK 60025 T4 W06-222 149 Tap water 60051 T3 W07-135 341 (80445080) Tap water 60089 T4 07-073 80445080 AK 60089 Pcr+ W06-101 165 (80192713) Tap water 60102 T4 05-014 80192713 AK 60102 T3 EU168071 06-002 80312968 AK 60107 T4 EU168075 W08-035 392 Tap water 60090 W06-072 108 Tap water 60115 W06-212 11 Tap water 60137 T4 W06-269 233 (80345388) Tap water 60187 T3 W07-036 105 Tap water 60188 T4 W06-194 212 Tap water 60188 T4 W06-163 172 Tap water 60193 Pcr + W08-009 313 Tap water 60402 Pcr + W08-021, 022 346 Tap water 60402 W06-048, 054 58 Tap water 60423 W06-229 276 (80376918) Tapwater 60423 T4 06-061 80376918 AK 60423 T4 W06-264 152 Tap water 60435 T4 07-075 80444974 AK 60440 T4 W06-084 119 Tap water 60451 06-073 80383482 AK 60451 T4 W07-080 10 (80320410) Tap water 60461 Pcr + Continued

Figure 12: Summary of molecular results of Acanthamoeba isolates examined in the current study. N/d is no data available.

Figure 12 continued 06-005 80320410 AK 60461 T4 EU168077 W06-174 103 Tap water 60462 T4 W06-103 88 Tap water 60464 Pcr + W07-065 140 Tap water 60491 Pcr + W06-201 170 Tap water 60491 T4 06-033 80351060 AK 60505 T4 EU168081 W08-029 383 (80361540) Tap water 60517 Pcr + 06-050 80361540 AK 60517 05-003 80275731 AK 60521 T4 EU168067 05-009 80275742 AK 60525 T4 EU168068 06-042 80357530 AK 60527 06-049 80361440 AK 60540 T4 W07-006 256 Tap water 60548 W06-087 86 Tap water 60564 T4 W07-131 123 Tap water 60608 T4 06-001 80306191 AK 60611 T4 EU168074 W07-087 329 Tap water 60613 08-005 80490861 AK 60613 T4 08-007 80497247 AK 60613 W07-003 269 Tap water 60638 07-095 80474596 AK 60639 Mixed W07-024 48 Tap water 60641 T4 W06-131 131 (72423403) Tapwater 60641 T3 05-023 72423403 AK 60641 T4 EU168073 05-012 80284736 AK 60647 T4 W06-129 99 Tapwater 60647 T4 06-053 77225381 AK 60649 T4 05-011 80281504 AK 60941 T4 EU168069 W06-140 183 Tapwater 60964 T4 W07-015 231 Tapwater 61364 07-047 80421141 AK 63129 T4 06-057 80371178 AK n/d T4 06-051 803646622 AK n/d 06-016 80334423 AK n/d T4 EU168078 06-024 80346050 AK n/d T4 EU168079 06-025 80346590 AK n/d T4 EU168080 06-059 80375425 AK n/d

Continued

Map of the Greater Chicago Area indicating zip codes sampled for tap water tap for sampled codes zip indicating Area Chicago study Greater of Map the

13 Figure

Protist Presence by Sample

20% Acanthamoeba positive samples 49% Protist positive, Acanth neg

protist negative 31%

Figure 14: Protist presence in tap water by sampled homes. Of the 228 homes sampled, approximately 51% were culture positive for protists, with more than 20% positive for Acanthamoeba.

Protist Presence by Zip Code

26% Acanthamoeba positive zip codes 40% protist positive, Acanthamoeba negative zip codes protist negative zip codes

34%

Figure 15: Protist presence in tap water by zip code. Of a total of 143 zip codes sampled, approximately 60% were culture-positive for protists, with more than 25% positive for Acanthamoeba.

CHAPTER 3

PATHOGENICITY TESTS

Background and Rationale

Several studies have looked into the viability of using insect models for pathogenicity and virulence studies, as using mammalian hosts is quite expensive, leads to mammalian suffering, and raises ethical concerns.124-127 In contrast, insects can be obtained and used in large numbers and are relatively inexpensive to maintain. Further, their use in pathogenicity and virulence studies raise little, if any, ethical concerns. Also, when infected, insects’ infection process is faster than that of mammals, meaning that results can be obtained more rapidly.125 The immunity exhibited by invertebrates is functionally similar to that of vertebrates, and several aspects of the innate immune response for both mammals and insects are common to both.128 The response in both insects and mammals recognizes foreign invaders and uses similar pathways to activate the appropriate immune response.125, 126, 129 Further, as the innate immune system is relatively conserved between mammals and insects, the mechanisms needed for pathogens to avoid the immune systems of both hosts are similar.125

The insect immune response involves several aspects. The immune defense begins with the cuticle, which is analogous to mammalian skin and, like skin, works as a barrier to prevent the entry of pathogens.125, 126 The innate immune system of insects has two main response reactions, the humoral reactions and the cellular reactions (Figure 16). The humoral reactions are analogous to the human acute phase response and are triggered by wounds or infections. The humoral reactions include melanisation (deposition of melanin on the microbe within the haemolymph), hemolymph clotting, and the synthesis of immune-proteins

(rapidly synthesized antimicrobial peptides, mainly within the fat body).126, 130

The cellular reactions include phagocytosis, nodule formation, and encapsulation. The insect body cavity (haemoceol) contains the substance haemolymph which is analogous to mammalian blood and transports nutrients, waste products, and signal molecules, whereas the fat body is analogous to the mammalian liver.126 It is in the haemolymph that most of the immune response occurs. Haemolymph contains cells called haemocytes that function much like the phagocytes of mammals. Several types of haemocytes have been identified, the main types being prohaemocytes (differentiate into the other cell types), plasmatocytes (phagocytic and contain lysosomal enzymes), granulocytes

(phagocytic), coagulocytes (involved in clotting), spherulocytes, and oenocytoids.126, 131 The plasmatocytes and granulocytes are the main cells involved in phagocytosis, nodule formation and encapsulation, which are

important for the insects’ defense against microorganisms.126, 131 Further, in

Drosophila, plasmatocytes have been shown to be involved in the synthesis of anti-microbial peptides.

The insect, like mammals, has an impressive blood-brain barrier as it is necessary to keep hemolymph separate from neurons as the hemolymph’s excessive ionic makeup is deleterious to the nerve cells.132 As in vertebrates, a compromised barrier in an insect would invariably lead to death. The blood- brain barrier encompasses the entire avascular CNS in the insect. The insect blood-brain barrier consists of pleated sheet septate and tight junctions that occur between the perineurial cells, between the glia and the perineurial cell, as well as, possibly, between glia cells. The glial and perineurial cells form a layer that covers the nerves and the junctions that bind them provide the barrier to keep the hemolymph from contacting the nerve cells. The perineurial cells are 4-6 sided and form a monolayer of cells covering nerves and neuropiles, with their borders containing pleated sheet septate junctions. The perineurial cells do not come into contact with neurons, however they are adjacent to the glial cells which cover and adhere to neurons.132

Given the prevalence of Acanthamoeba in tap water, its abundance in nature, and the severity of both AK and GAE infections caused by some strains, there is clearly a need to be able to distinguish potentially harmful strains from benign strains. It has been proposed that pathogenic and non-pathogenic strains of

Acanthamoeba can initially be differentiated using an invertebrate insect model rather than the more commonly used, and more problematic, mammalian animal model. It has been shown that insect and mammalian innate immune responses are similar,131, 133, 134 and thus could prove to be an important modeling system.129 The African migratory locust has previously been used to determine the virulence of Escherichia coli K1124, 135 and Khan et al. recently identified the

African migratory locust as a possible insect model for the purpose of determining the pathogenicity of acanthamoebae.61 Their preliminary study, however, was too limited in scope (having tested only one strain of

Acanthamoeba) to adequately show that the locust could be used reliably as a model organism. The method was proposed as a method that would eliminate the need for an animal model for initial distinguishing between pathogenic and non-pathogenic acanthamoebae. The current study will use isolates of amoebae isolated from clinical and environmental isolates, as well as three established

ATCC strains, and the grasshopper Schistocerca americana, as the locusts used in previous pathogenicity studies cannot be readily obtained in the U.S. The present study’s aim is to determine if the locust/grasshopper model is useful in determining pathogenicity for both known pathogenic (clinical isolates) and unknown (environmental) strains. It is hoped that future studies will confirm the findings using mammalian models, assuaging concerns of any superfluous extrapolation of results.

Methods and Materials

A colony of Schistocerca Americana eggs obtained from a colony kept by Mike

Adams at the University of California, Riverside were reared under crowded conditions at 30°C and fed daily with fresh kale supplemented with wheat germ, with a light cycle of 12h. The second-generation of grasshoppers were used for experimental purposes.

As described previously, 61, 136, 137 with the exception of using grasshoppers rather than locusts, mature grasshoppers (5 male and 5 female per strain/concentration) were randomly chosen for controls and trials. In the experimental trials, the following Acanthamoeba strains were used: 5 clinical AK,

3 tap water, and 2 GAE strains that were provided by Govinda Visvesvara at the

CDC; an ATCC human brain isolate genotype T1 (ATCC 50494); an ATCC human cornea isolate genotype T4 (ATCC 50497); and an ATCC soil isolate genotype T9 (ATCC 30135). This resulted in a total of 13 strains being tested

(Figure 17). For each of the 13 strains tested, after 15 minutes in a -4°C freezer, ten grasshoppers were injected with 10µl for each of the three suspensions, 1x106,

1x104, and 1x102 (for injections of 10,000, 100, and 1 amoebae per injection, respectively) acanthamoebae in PYG-712 medium, between two abdominal terga using sterile plastic pipette tips with a stainless steel needle held in the bore by dental cement (Crown Lok™, Reliance Orthodontic Products, Inc., Itasca, IL).136

In the placebo groups, ten grasshoppers were injected with the same volume of

sterile PYG-712 medium. In the control groups, ten grasshoppers were simply monitored. All grasshoppers were kept in plastic “critter” cages (plastic

9”x6”x6.5” cages with vented tops) in groups of 10 and fed normally throughout testing. Mortality was recorded every 24h, when any dead grasshoppers were removed to prevent cannibalism. 61, 136

In order to determine if the Acanthamoeba invaded the grasshopper brain and contributed to death, the brains of half of the infected grasshoppers were dissected out after death using fine sterile forceps. After 3 washes with amoeba saline, when possible (as many of the brains were too necrotized to extract whole), the brains were incubated with pentamidine (40μM) at 37°C for 60 min to kill any extracellular amoebae, and then rinsed again 3 times with amoeba saline, then vortexed for 30 seconds before being plated on NNAS seeded with E. aerogenes. Positive growth of amoebae was scored as indicative of infection.

Further, samples of muscle tissue from the abdomen and fat bodies were also cultured on NNAS seeded with live E. aerogenes to determine if the amoebae spread haematogenously. Grasshoppers were monitored for 80 days post injection, after which results were censored.

The days of survival post-injection date were recorded and analysis was done using JMP 7.0.1 survivability/reliability tests. Bonferroni adjustments to control for type-1 errors in pairwise multiple comparisons were applied as needed.138

Results

Survival of controls compared to placebos was not significantly different, as seen in Figure 18 (p-value > .74), and males compared to females was also not significant (p-value > 0.75). When all strains and all concentrations of infected grasshoppers are combined and compared to the controls and placebos, there is a significant difference in survival between the two groups (P<0.0001, Fig. 19).

When comparing the six sources of amoebae, GAE, AK, Soil, TW, Control, and

Placebo, it can be seen that significant differences do occur between some groups

(P<0.0001, Fig. 20). All four of the infective sources are significantly different than the control/placebo group. However, the soil strain actually had survivability greater than that of the control/placebo group, as well as a greater survivability versus strains from all of the other source groups (Figure 21).

However, AK strains versus GAE strains were not significant (P-value > 0.2828.

When considering infective doses, for most strains, the lowest dose of 102 amoebae/ml (1 amoeba per injection) did not lead to increased mortality.

However, strain W06-201 did show a statistically significant increase in mortality when this lowest dose is compared to the control/placebo. When comparing all trials at all concentrations, it can be seen that the control/placebo group

(concentration of 0) fits with the lowest concentration (concentration of 100), while the 104 and 106 group together (Figures 22 and 23). However, when one looks at each strain individually, one sees that generally there is an increased

mortality rate with the highest concentration, 106, when compared to the 104 infective dose. There do not appear to be clear separations between individual strains within the AK source group, other than 06-016, which did not reduce mortality to the same extent as the other isolates (Figure 24). This is true also of the GAE group, where none of the three strains seem to be more virulent than any others (Figure 25). When analyzing the tapwater group, W06-201 is clearly more virulent than the other two tapwater strains. (Figures 26 and 27). When comparing only W06-201 to either the GAE strains or the AK strains, W06-201 is statistically more virulent than both (Figures 28 and 29).

Culture results show that the majority of grasshoppers exhibit extensive infection by Acanthamoeba after 15d post-injection (Figure 30). W06-201 showed infection in all dissected grasshoppers, even those expiring at day 8 and at concentration 102. For those strains and concentrations not showing infection for most cultures, counts include those grasshoppers dying within 7d post-injection, and death was most likely due to trauma resulting from the injection process or negative reaction to time in the freezer, as controls and placebos also had deaths within the first 7d.

Discussion

There was a clear and statistically significant difference between the survival of the infected grasshoppers and both the control and placebo groups.

Interestingly, grasshoppers infected with the ATCC soil strain were not

negatively affected by the amoebal infection. This was not true for the grasshoppers infected with the tapwater strains. This is an interesting finding in that we believe most infections for AK are due to tapwater exposure, and these findings could indicate that GAE infections could also have tapwater as the source of infection. The most virulent strain, more so than even any of the GAE strains, was isolate W06-201, a tapwater isolate from the Chicago area, though it should be noted that this particular strain is from a home using well water, and not Chicago municipal water. Strain W06-201 showed significant pathogenicity even at the lowest concentration of 102 amoebae/ml, which means only approximately 1 amoeba was injected into each grasshopper. The GAE strains did not show as much of an increase in virulence over the other strains as was expected, and survival was not significant compared to either the AK group or tapwater groups. This could be due to the fact that all three GAE strains have been in axenic culture for an extended period of time. 07-092 has been in culture at ATCC since 1981, 07-030 has been in culture since 1988, and 07-011 was isolated in 1994 and went through several axenic subcultures before being cryo- preserved and then revitalized in 2006. It has been shown that extended periods in axenic culture reduces virulence and ability to encyst, and so these long culture times could have contributed to the reduced virulence. Also, it should be noted that the tapwater strains were chosen for their ability to grow well in axenic culture. This ability could account for their appearing as virulent as the

AK and GAE strains. With the exception of strain W06-201, all strains showed significantly reduced pathogenicity with the lowest concentration (Figures 23 and 24). It should be noted that the actual number of amoebae injected for each concentration was 106, 10,000 amoebae injected, 104, 100 amoebae injected, and

102, only 1 amoeba injected. These results show that in most cases as few as 100 amoebae can lead to infection, and, in some cases, a single amoeba can lead to infection. This phenomenon could also be an artifact of the animal model, S.

Americana, being quite small compared to the typical animal models of the mouse or guinea pig.

These results, while interesting, do not definitively prove that grasshoppers can be a reliable model for initial pathogenicity and virulence tests for Acanthamoeba. In order to prove that grasshoppers are a reliable model, a similar study using a more typical animal model (such as a mouse) will need to be performed using the same strains so that virulence can be compared in the mammal and invertebrate models.

Cellular Reactions Reactions Cells Involved Description Phagocytosis Hemocytes: Cellular ingestion of foreign Plasmocytes and material granulocytes Nodule Hemocytes: Hemocytes aggregate to entrap Formation Plasmocytes and bacteria granulocytes Encapsulation Hemocytes: Capsule of overlapping layers of Plasmocytes and hemocytes is formed around granulocytes protozoans, nematodes, eggs, or larvae of parasitic insects Humoral Reactions Reactions Description Melanisation Formation of black pigment; deposition of melanin on the microbe within the haemolymph Hemolymph Clotting Proteins involved: Clotting Lipophorin Vitellogenin-like Immune Rapid synthesis of Peptides Produced: Proteins antimicrobial peptides, Attacin-like bacterial inducible mainly in the fat body proteins (Gram –ve) Lysozyme hydrolases Cecropins (Gram +ve and –ve) Defensins (Gram +ve) Proline-rich antimicrobial peptides (Gram –ve) Diptericins (Gram –ve, only found in dipteran species so far)

Figure 16: Invertebrate innate immune responses.

OSU # Outside Genotype Disease Severity/Source* Source ID AK UIC # 06-016 0334423 T4 Mild ring infiltrate

06-025 80346590 T4 Epithelititis

06-057 80371178 T4 Epithelititis with radial neuritis

07-075 80444974 T4 Deep stromal

07-047 80421141 T4 Deep stromal

Tapwater W06-087 86 T4 No AK

W06-174 103 T4 No AK

W06-201 170 T4 AK case home

GAE CDC # 07-030 CDC:V124 T4 Brain tissue, India

07-011 CDC:V329 T1 Brain tissue, Ohio

ATCC ATCC # 07-091 50497 T4 AK

07-092 50494 T1 GAE

07-093 30135 T9 Soil

Figure 17: Isolates used in the pathogenicity study. *Epithelititis and epithelilitis with radial neuritis are “anterior” or mild disease severity, while the mild ring infiltrate and deep stromal would be considered “deep” or advanced/severe disease. (Charlotte Joslin, Elmer Tu, Pers. Comm.)

Survival Plot

1.0 Control 0.9 Placebo 0.8 0.7 0.6 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 18: Survival plot for Control (N=130) vs. Placebo (N=130) groups, p-value > 0.7352.

Survival Plot

1.0 Infected 0.9 Uninfected 0.8 0.7 0.6 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 19: Survival plot for Infected (N=390) vs. Uninfected (N=260) Grasshoppers. P- value < 0.0001.

Survival Plot

1.0 AK 0.9 Control 0.8 GAE 0.7 Placebo 0.6 Soil Tapw ater 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 20: Survival plot comparing survivability of all sources, AK (N=180), Control (N=130), GAE (N=90), Placebo (N=130), Soil (N=30), Tapwater (N=90). P-value < 0.001.

Comparisons by Source Source Comparisons p-value < Bonferroni value Significant? All Sources 0.0001 yes Tapwater Vs. GAE 0.0503 0.003333333 no Tapwater vs. AK 0.0076 0.003333333 no Tapwater vs. Soil 0.0001 0.003333333 yes Tapwater vs. Placebo 0.0001 0.003333333 yes Tapwater vs. Control 0.0001 0.003333333 yes GAE vs. AK 0.2828 0.003333333 no GAE vs. Soil 0.0001 0.003333333 yes GAE vs. Placebo 0.0001 0.003333333 yes GAE vs. Control 0.0001 0.003333333 yes AK vs. Soil 0.0001 0.003333333 yes AK vs. Placebo 0.0001 0.003333333 yes AK vs. Control 0.0001 0.003333333 yes Soil vs. Placebo 0.0032 0.003333333 yes Soil vs. Control 0.0078 0.003333333 no Placebo vs. Control 0.0001 0.003333333 yes

Figure 21: Statistical data for all source pairwise comparisons. Highlighted comparisons are the only non-significant comparisons.

Survival Plot

1.0 0 0.9 100 0.8 10000 0.7 1000000 0.6 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 22: Survival Plot Comparisons for Concentrations, 0 (N=260), 100 (N= 130), 10000 (N=130), 1000000 (N=130). P-value < 0.001.

Comparisons by Concentration Concentration Comparisons p value < bonferroni value significant? All concentrations 0.0001 yes 0 vs. 100 0.2923 0.008333333 no 0 vs. 10000 0.0001 0.008333333 yes 0 vs. 1000000 0.0001 0.008333333 yes 100 vs. 10000 0.0001 0.008333333 yes 100 vs. 1000000 0.0001 0.008333333 yes 10000 vs. 1000000 0.03263 0.008333333 no

Figure 23: Statistical data for all concentration pairwise comparisons. Highlighted comparisons are the only non-significant comparisons.

Survival Plot

1.0 06-016 0.9 06-025 0.8 06-057 0.7 07-047 0.6 07-075 07-091 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 24: Survival Plot comparing all AK strains, (N=180).

Survival Plot

1.0 07-011 0.9 07-030 0.8 07-092 0.7 0.6 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 25: Survival plot comparing all GAE Strains (N=90). Thirty percent survival is result of inclusion of lowest concentration, which did not result in infection. P-value > 0.7201.

Survival Plot

1.0 W06-087 0.9 W06-174 0.8 W06-201 0.7 0.6 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 26: Survival plot of all tapwater strains (N=90).

Tapwater Comparisons

Strain Comparisons p value < Bonferroni value significant? All TW 0.0001 yes

W06-087 vs. W06 -174 0.4339 0.016666667 no W06-087 vs. W06-201 0.0001 0.016666667 yes W06-174 vs. W06-201 0.0063 0.016666667 yes

Figure 27: Statistical data for all tapwater pairwise comparisons. Highlighted comparison is the only non-significant comparison.

Survival Plot

1.0 GAE 0.9 Tapw ater 0.8 0.7 0.6 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 28: Survival plot comparing Tapwater Strain W06-201 (N=30) to all GAE strains (N=90). P-value < 0.0001.

Survival Plot

1.0 AK 0.9 Tapw ater 0.8 0.7 0.6 0.5

Surviving 0.4 0.3 0.2 0.1 0.0 0 10 20 30 40 50 60 70 80 Age

Figure 29: Survival plot comparing Tapwater Strain W06-201 (N=30) to all AK strains (N=180). P-value < 0.0001.

Concentration Brain Muscle Fat Body W06-201 102 100% 100% 100% 104 100% 100% 100% 106 100% 100% 100% W06-174 102 100% 100% 100% 104 100% 100% 100% 106 100% 100% 100% W06-087 102 100% 50% 0% 104 100% 100% 100% 106 100% 100% 100% 07-011 102 100% 50% 50% 104 100% 0% 50% 106 100% 100% 100% 07-030 102 100% 100% 50% 104 80% 100% 80% 106 100% 50% 60% 07-092 102 0% 0% 0% 104 100% 80% 50% 106 100% 100% 80% 06-016 102 0% 0% 0% 104 50% 50% 50% 106 80% 60% 100% 06-025 102 0% 0% 0% 104 100% 60% 80% 106 80% 80% 100% 06-057 102 0% 0% 0% 104 0% 0% 0% 106 100% 80% 80% 07-047 102 0% 0% 0% 104 100% 100% 100% 106 100% 100% 100% 07-075 102 0% 0% 0% 104 100% 100% 100% 106 100% 100% 100% 07-091 102 0% 0% 0% 104 80% 80% 80% 106 100% 100% 100% 07-093 102 0% 0% 0% 104 80% 80% 80% 106 80% 80% 80%

Figure 30: Culture results for infected expired grasshoppers for all concentrations.

CHAPTER 4

DISCUSSION AND CONCLUSIONS

Acanthamoeba spp. cause the serious, but rarely seen, diseases Acanthamoeba keratitis (AK) and Granulomatous Amoebic Encephalitis (GAE). Most cases of

AK seen in the United States are contact lens wearers, which is why it is believed that contacts are the vector by which most people are infected.38 Though many studies have been done to determine the effectiveness of contact lens cleaning solutions on acanthamoebae, these studies are usually testing only a small number of Acanthamoeba strains that have been in axenic culture for long periods of time.72, 104, 105, 139, 140 The present research is unique in that it not only tested both commonly used multi-purpose contact lens cleaning solutions as well as hydrogen peroxide-based systems, it also tested newly cultured, non-axenic clinical and environmental isolates. This is an important aspect in determining the effectiveness of cleaning solutions and to ascertain if there are any contact lens cleaning solutions currently on the market that are better at eliminating acanthamoebae than others. This research shows that there are clear strain differences when isolates are treated with cleaning solutions. It also shows that the currently available MPS solutions are not able to adequately protect users

from Acanthamoeba colonizing their contact lenses and contact lens cases.

However, it does lend support for the use of hydrogen peroxide based systems as they, though not 100% effective, are much better at eradicating acanthamoebae. This research did not, however, adequately explain why the most important risk factor found in the recent outbreak of AK was use the of

Advanced Medical Optics’s Complete® MoisturePlus™ Multipurpose Solution.

It was speculated that Advanced Medical Optics’s addition of taurine, an amino acid shown to lead to encystation of Acanthamoeba, could be the cause of the increased incidence rate of AK in Advanced Medical Optics’s users, but the addition of taurine in culture media appeared to have no effect. However, a recent study by Kilvington et al141 tested a wide range of multi-purpose formulations and found that increased encystment occurred with the presence of propylene glycol in combination with additional factors, as yet unknown. It is possible that the increased encystment caused by the inclusion of propylene glycol and the other, unknown factors, led to a protective benefit for the

Acanthamoeba by inducing a faster-than-normal encystment rate that would protect the amoebae from the biocide. Of course, this does not account for the more than 50% of cases that did not use the recalled product, nor for the fact that cases continue to be reported, long after AMO’s product has been off the shelves.118 Given these findings and the ongoing increased rate of AK infections, it is imperative that guidelines are created and regulations enacted that require

the manufacturing companies of contact lens disinfection systems to test and be effective against Acanthamoeba. Thankfully, one positive outcome of the recent outbreak of AK is that the FDA is considering creating just such regulations

(James Saviola, FDA, Pers. Comm.).

It has been hypothesized that most sufferers of AK come into contact with the amoeba through tapwater.72, 139 The tapwater in the United States is arguably the safest drinking water in the world.111 However, most testing relies on the removal of bacterial pathogens at the treatment plant, and does not mean that waterborne agents at the protozoan level do not get transmitted or are not present in the distribution systems of our municipal water supplies.

Cryptosporidium has been known to colonize municipal water supplies and has led to infections of the intestinal tract. Like Acanthamoeba, Cryptosporidium is able to form cysts and can tolerate commonly used disinfectants such as the biocides used for water treatement.142 An outbreak of cryptosporidiosis in Milwaukee in

1993 sickened 400,000 people exposed to the pathogen through the municipal water supply, and all outbreaks of Cryptosporidiosis in the U.S. to date have occurred due to Cryptosporidium in the public utility water supplies that had passed government requirements for water safety. This suggests that the water treatments prior to the reductions in biocides were not adequate to remove

Cryptosporidium,142 and one can only assume that with reduced levels of biocides outbreaks will become more prevalent. This further suggests that the water

treatments would not be adequate for protecting against Acanthamoeba cysts or other possible pathogenic protists that may flourish in the water supply. It is possible that recent increased cases of cryptosporidiosis123 and legionelliosis28 are somehow linked to the changing microhabitat and biofilms within water distribution systems. The tapwater sampling from the Chicago area showed an alarming percentage of amoeba in the water supply (51% of samples). This percentage is actually a low estimate of the number and type of protists that actually inhabit the water supply. As only methods appropriate for culturing

Acanthamoeba were utilized, any protist needing different culture media to proliferate would not have been noted. Further, a tapwater study by A.

Rogerson showed a higher rate of culturable acanthamoebae from collecting water samples from running water than the swab method (as was used in the present study), which may further indicate that this tapwater study is greatly underestimating amoebal rates (A. Rogerson, Pers. Comm.). This high percentage is more than twice the rate seen in the Florida tapwater study,55 which is another concern. It is worrying that pathogens may be thriving in our water systems, and that regulations have been altered without adequate testing of possible ramifications. These findings support the view that Acanthamoeba are present and surviving in tapwater, and that tapwater can support growing populations of the organism, presumably in the biofilm coating the distribution system. This is not only of concern because Acanthamoeba can cause AK, but that

it can also cause several other, potentially fatal, infections in immunocompromised individuals (GAE, skin lesions, disseminated infections) as well as transport other pathogenic microorganisms that are endosymbionts, such as Legionella. These findings support that the current chemical disinfectant levels found in the water supply are inadequate. This study also helps explain the high incidence of genotype T4 involved in AK infections. If tapwater is in fact the mode of transmission for AK, then the predominant genotype in tapwater should be the predominant genotype in AK cases, which was the case in these studies, again supporting this theory.

Since Acanthamoeba spp. can also cause the fatal disease GAE, there is also interest in determining the virulence and pathogenicity of strains of

Acanthamoeba. Currently, most pathogenicity and virulence studies are done with mice,143, 144 however these studies are problematic due to their high cost, legal and ethical issues. Previous studies on E. coli virulence have been conducted using locusts as an animal model.124, 135 A recent study tested the ability of the locust model in determining Acanthamoeba’s pathogenicity.61 As locusts are not readily available for use in the U.S., they are not a feasible model organism for researchers in the U. S. Therefore, the grasshopper Schistocerca americana was used in order to attempt to replicate the results of the Khan et al61 locust study using additional test strains and a related organism. The grasshoppers used in this study did not die within 14 days as was reported with

the locust infections done by Khan et al.61 This discrepancy could be due to differences between the species of insect, but could also be due to differences in mode of infection, strains used, or maintenance (i.e. temperature, humidity, cage type) of insect colonies. Though the survival times different between these two studies, the current study does support the finding of Khan et al that insects

(grasshoppers or locusts) could be used as a model organism for the initial testing of Acanthamoeba pathogenicity. It would appear that virulence, at least in terms of AK severity, could not be reliably tested using this model, as the time of survival did not correlate to disease severity. In fact, one of the more severe eye infection isolates, 06-016, had survival rates greater than the placebo and control groups. However, there were clear differences between most strains of the infected grasshoppers when compared to control and placebos, including all of the GAE, all but one of the AK and all of the tapwater strains. The ATCC soil strain, 07-093 had survival rates exceeding the control and placebo groups, though this excess could be explained by the number of grasshoppers compared, i.e. 30 grasshoppers infected with strain 07-093 to 260 combined control and placebo grasshoppers. The most virulent strain, reducing survival more than even the GAE strains, was a Chicago tapwater isolate W06-201. This strain was obtained from a home of an AK patient. Though it was impossible to determine if the tapwater strain and the AK strain from the same home had identical 18S sequences (as this patient was diagnosed before UIC began sending corneal

scrapings to OSU), it is interesting nonetheless that the most deadly strain came from tapwater, especially considering that W06-201 was infectious even when injecting as few as one amoeba. This finding also supports our use of a dichotomous outcome in the efficacy studies, for if only a single amoebae can cause infection, a contact lens cleaning solution would have to have a 100% kill rate to be fully effective against Acanthamoeba. When looking at all combined infected grasshoppers there was a clear and statistical difference between the survival of the infected grasshoppers and both the control and placebo groups.

This result combined with 1) the soil isolate not reducing survival, 2) all GAE isolates decreasing survival, and 3) tapwater isolates (the likely source of AK and possibly GAE infections) all decreasing survival would seem to indicate that grasshoppers could be a reliable model for initial pathogenicity testing. This study is also interesting in that amoebal loads as low as a single amoeba were used in trial infections. In most cases, not surprisingly, the lowest concentration of amoeba, 102 amoebae/ml (injection of 10μl means approximately 1 amoeba/injection) did not lead to decreased survival. However, both the 106and

104 concentrations (injections of 10,000 and 100 amoebae, respectively), did lead to decreased survival, indicating that infective concentrations may be much lower than previously expected. If as few as a single amoeba could lead to infection, these results should influence not only water quality standards, but also future contact lens solution requirements. Additional insect models would

also be interesting; grasshoppers were used due to their relationship to the previously used locusts, however, it is possible that another insect model, such a

Galleria mellonella (Greater Wax Moth), which was used in a Pseudomans aeruginoa study,145 could be a more manageable model. As S. americana will eat through mesh cages, it is unwise to keep infected specimens in them; however, it is possible that their confinement in the plastic critter cages could be detrimental to them as they beat themselves against the top and sides of the cage, which could conceivably increase mortality. An insect like G. mellonella larvae, if sensitive to

Acanthamoeba infection, is easy to obtain and maintain and would not have some of the containment problems found with S. americana. However, as stated previously, additional studies will need to be undertaken to definitively show that the results found in this insect study, and any subsequent studies, can predict how these strains would affect a mammal model. Future studies would need to use the same strains and concentrations of amoebae in order to compare the pathogenicity results between the mammal and insect models.

Unfortunately, in order to do these pathogenicity tests on a mammal model the mammal needs to be modified to be immunocompromised, an expensive and timely production.

The present study has addressed strain variation in acanthamoebae and shown important differences in tolerance to contact lens cleaning solutions.

These differences have application in lens cleaning solution testing and should

be noted when the FDA creates methodologies and requirements for the testing of solution efficacy against these organisms. With the high levels of culturable

Acanthamoeba and other protists found in the Chicago area water supply combined with recent increases in Legionnaire’s disease28 and the outbreak of cryptosporidiosis,123 though not yet linked to the public water supply, these findings highlight the need for additional research into the effectiveness of the current level of purification of the public water supply. Additional domestic water sampling over additional geographic areas around the country is needed to determine if we should in fact expect to see an increase in waterborne diseases.

The prevalence of acanthamoebae and other naked amoebae should be a warning to water quality managers. Survival of eukaryotic cysts and even trophozoites in the water distribution system implies that both obligate pathogens such as Cryptosporidium and opportunistic pathogens such as

Acanthamoeba, Naegleria, and Balamuthia, could flourish in the water supply and could pose a great health risk to the population.

LIST OF REFERENCES

1. Walochnik, J., et al., Discrimination between Clinically Relevant and Nonrelevant Acanthamoeba Strains Isolated from Contact Lens-Wearing Keratitis Patients in Austria. Journal of Clinical Microbiology, 2000. 38(11): p. 3932-3936.

2. Radford, C.F., D.C. Minassian, and J.K.G. Dart, Acanthamoeba keratitis in England and Wales: incidence, outcome and risk factors. British Journal of Ophthalmology, 2002. 86: p. 536-542.

3. Castellani, A., An amoeba growing a cultures of a yeast. Journal of Tropical Medicine and Hygiene, 1930. 33(160): p. 188-191.

4. Douglas, M., Notes on the classification of the amoeba found by Castellani in cultures of a yeast-like fungus. Journal of Tropical Medicine and Hygiene, 1930. 33: p. 258.

5. Culbertson, C., J. Smith, and J. Minner, Acanthamoeba: observations on animal pathogenicity. Science, 1958. 127: p. 1506.

6. Culbertson, C., et al., Experimental infection of mice and monkeys by Acanthamoeba. American Journal of Pathology, 1959. 35: p. 185-197.

7. Jager, B. and W. Stamm, Brain abscesses caused by free-living amoeba probably of the genus Hartmannella in a patient with Hodgkin's disease. Lancet, 1972. II: p. 343-345.

8. Schaumberg, D., K. Snow, and M. Dana, The epidemic of Acanthamoeba keratitis: where do we stand? Cornea, 1998. 17(1): p. 3-10.

9. Advanced Medical Optics, AMO Announces Voluntary Recall of Complete MoisturePlusTM Multipurpose Solution. 2007.

10. Illingworth, C.D. and S.D. Cook, Acanthamoeba keratitis. Survey of Ophthalmology, 1998. 42(6): p. 493-508. 99

11. Marciano-Cabral, F. and S.G. Bradley, Current Research on Free-living Amebae Causing Granulomatous Amebic Encephalitis. Journal of Eukaryotic Microbiology, 2001. suppl.: p. 3S.

12. Booton, G.C., et al., Identification and Distribution of Acanthamoeba Species Genotypes Associated with Nonkeratitis Infections. Journal of Clinical Microbiology, 2005. 43(4): p. 1689-1693.

13. Martinez, A.J., Free-Living Amebas: Natural History, Prevention, Diagnosis, Pathology, and Treatment of Disease. 1985, Boca Raton, FL: CRC Press, Inc.

14. Health Protection Agency, Isolation and Identification of Acanthamoeba Species, in Health Protection Agency Standard Operating Procedure. 2003, Health Protection Agency Standards Unit, Evaluations and Standards Laboratory, Specialist and Reference Microbiology Division. p. 1-11.

15. Martinez, A.J. and G.S. Visvesvara, Free-living, Amphizoic and opportunistic amebas. Brain Patholology, 1997. 7: p. 583-598.

16. Marciano-Cabral, F. and G. Cabral, Acanthamoeba spp. as Agents of Disease in Humans. Clinical Microbiology Reviews, 2003. 16(2): p. 273- 307.

17. Ma, P., et al., Naegleria and Acanthamoeba infections: Review. Reviews of Infectious Diseases, 1990. 12(3): p. 490-513.

18. Shoff, M., The Importance of Strain Differences in the Opportunistic Pathogen Acanthamoeba in Oceanographic Center. 2006, Nova Southeastern University: Dania Beach, FL. p. 123.

19. Muller, K., E. Schmid, and R. Michel, Intracellular bacteria of Acanthamoebae resembling Legionella spp. turned out to be Cytophaga sp. Zentralblatt fuer Bakteriologie, 1999. 289(4): p. 389-97.

20. Michel, R. and B. Hauroeder, Isolation of an Acanthamoeba strain with intracellular Burkholderia pickettii infection. Zentralblatt fuer Bakteriologie, 1997. 285(4): p. 541-557.

21. Schuster, F.L., Cultivation of Pathogenic and Opportunistic Free-Living Amebas. Clinical Microbiology Reviews, 2002. 15(3): p. 342-354.

100

22. Saeed, A., et al., Acanthamoeba castellanii an environmental host for Shigella dysenteriae and Shigella sonnei. Arch Microbiol, 2008.

23. Centers for Disease Control and Prevention. MMWR (1994) Legionnaires' Disease Associated with Cooling Towers--Massachusetts, Michigan, and Rhode Island, 1993. 43. January 2, 2008. http://www.cdec.gov/mmwR/preview/mmwrhtml/00031925.htm

24. Brown, C.M., et al., A community outbreak of Legionnaires' disease linked to hospital cooling towers: an epidemiological method to calculate dose of exposure. International Journal of Epidemiology, 1999. 28: p. 353-359.

25. Holden, E., et al., Intracellular growth of Legionella pneumophila within Acanthamoeba castellanii Neff. Infection and Immunity, 1984. 45(1): p. 18-24.

26. Berk, S.G., et al., Production of Respirable Vesicles Containing Live Legionella pneumophila Cells by Two Acanthamoeba spp. Appl. Environ Microbiol, 1998. 64(1): p. 279-286.

27. Barker, J., et al., Relationship between Legionella pneumophila and Acanthamoeba polyphaga: Physiological Status and Susceptibility to Chemical Inactivation. Appl. Environ Microbiol, 1992. 58(8): p. 2420-2425.

28. Neil, K. and R. Berkelman, Increasing incidence of legionellosis in the United States, 1990-2005: changing epidemiologic trends. Clin Infect Dis, 2008. 47(5): p. 591-9.

29. Page, F.C., A New Key to Freshwater and Soil Gymnamoebae with instructions for culture. 1988, Ambleside, Cumbria: Freshwater Biological Association, The Ferry House. 122.

30. Fuerst, P.A. and G.C. Booton. The phylogenetic structure of Acanthamoeba as seen through the window of the small subunit ribosomal RNA gene: genotypes and "species" do not reflect the same images. in XIIth International Meeting on the Biology and Pathogenicity of Free-Living Amoeba. 2007. Wako, Japan.

31. Hewett, M.K., et al., Identification of a New Acanthamoeba 18S rRNA Gene Sequence Type, Corresponding to the Species Acanthamoeba jacobsi Sawyer, Nerad and Visvesvara, 1992 (Lobosea: Acanthamoebidae). ACTA Protozoologica, 2003. 42: p. 325-329.

101

32. Schroeder, J.M., et al., Use of Subgenic 18S Ribosomal DNA PCR and Sequencing for Genus and Genotype Identification of Acanthamoebae from Humans with Keratitis and from Sewage Sludge. Journal of Clinical Microbiology, 2001. 39(5): p. 1903-1911.

33. Stothard, D.R., et al., The Evolutionary History of the Genus Acanthamoeba and the Identification of Eight New 18S rRNA Gene Sequence Types. J. Eukaryot. Microbiol., 1998. 45(1): p. 45-54.

34. Booton, G.C., et al., 18S Ribosomal DNA Typing and Tracking of Acanthamoeba Species Isolates from Corneal Scrape Specimens, Contact Lenses, Lens Cases, and Home Water Supplies of Acanthamoeba Keratitis Patients in Hong Kong. Journal of Clinical Microbiology, 2002. 40(5): p. 1621-1625.

35. Booton, G.C., et al., Molecular and Physiological Evaluation of Subtropical Environmental Isolates of Acanthamoeba spp., Causal Agent of Acanthamoeba Keratitis. Journal of Eukaryotic Microbiology, 2004. 51(2): p. 192-200.

36. Barete, S., et al., Fatal Disseminated Acanthamoeba lenticulata Infection in a Heart Transplant Patient. Emerging Infectious Diseases, 2007. 13(5): p. 736-738.

37. Jongwutiwes, S., et al., Heterogeneity in cyst morphology within isolates of Acanthamoeba from keratitis patients in Thailand. Tropical medicine & international health, 2000. 5(5): p. 335-40.

38. Seal, D.V., Acanthamoeba keratitis update--incidence, molecular epidemiology and new drugs for treatment. Eye, 2003. 17: p. 1-13.

39. Dykova, I., et al., Acanthamoeba strains isolated from organs of freshwater fishes. Journal of Parasitology, 1999. 85(6): p. 1106-1113.

40. Khan, N.A., Pathogenesis of Acanthamoeba infections. Microbial Pathogenesis, 2003: p. 1-9.

41. Samples, J.R., et al., Acanthamoeba keratitis possibly acquired from a hot tub. Archives of Ophthalmology, 1984. 102(5): p. 707-710.

42. Badenoch, P.R., et al., Nasal carriage of free-living amoebae. Microbial Ecology in Health and Disease, 1988. 1(3): p. 209-211. 102

43. Davis, P.G., D.A. Caron, and J.M. Sieburth, Oceanic Amoebae from the North Atlantic: Culture, Distribution, and Taxonomy. Transactions of the American Microscopical Society, 1978. 97(1): p. 73-88.

44. Walochnik, J., et al., Characterisation and differentiation of pathogenic and non-pathogenic Acanthamoea strains by their protein and antigen profiles. Parasitology Research, 2004. 92(4): p. 289-98.

45. Kingston, D. and D.C. Warhurst, Isolation of amoebae from the air. Journal of Medical Microbiology, 1969. 2: p. 27-36.

46. Beattie, T., et al., Determination of Amoebicidal Activities of Multipurpose Contact Lens Solutions by Using a Most Probable Number Enumeration Technique. Journal of Clinical Microbiology, 2003. 41(7): p. 2992-3000.

47. Schuster, F.L. and L.S. Jacob, Effects of magainins on ameba and cyst stages of Acanthamoeba polyphaga. Antimicrobial Agents & Chemotherapy, 1992. 36(6): p. 1263-1271.

48. Ferrante, A., Free-living amoebae: Pathogenicity and immunity. Parasite Immunology, 1991. 13(1): p. 31-47.

49. Anzil, A.P., et al., Amebic Meningoencephalitis in a Patient With AIDS Caused by a Newly Recognized Opportunistic Pathogen. Arch Pathol Lab Med, 1991. 115: p. 21-25.

50. Denney, C.F., et al., Amebic meningoencephalitis caused by Balamuthia mandrillaris: case report and review. Clin Infect Dis, 1997. 25(6): p. 1354-8.

51. Deol, I., et al., Encephalitis due to a free-living amoeba (Balamuthia mandrillaris): case report with literature review. Surg Neurol, 2000. 53(6): p. 611-6.

52. Duke, B.J., et al., Balamuthia mandrillaris Meningoencephalitis Presenting with Acute Hydrocephalus. Pediatric Neurosurgery, 1997. 26: p. 107-111.

53. Gordon, S.M., et al., Culture isolation of Acanthamoeba species and leptomyxid amebas from patients with amebic meningoencephalitis, including two patients with AIDS. Clin Infect Dis, 1992. 15(6): p. 1024-30.

103

54. Niederkorn, J.Y., et al., The pathogenesis of Acanthamoeba keratitis. Microbes and Infection, 1999. 1(6): p. 437-443.

55. Shoff, M.E., et al., Prevalence of Acanthamoeba and other naked amoebae in South Florida domestic water. J Water Health, 2008. 6(1): p. 99-104.

56. Kilvington, S., et al., Acanthamoeba Keratitis: The Role of Domestic Tap Water Contamination in the United Kingdom. Investigative Ophthalmology & Visual Science, 2004. 45(1): p. 165-169.

57. Joslin, C.E., et al., Epidemiological Characteristics of a Chicago-area Acanthamoeba Keratitis Outbreak. American Journal of Ophthalmology, 2006. 142(2): p. 212-217.

58. Joslin, C., et al. American Journal of Ophthalmology (2007) The Association of Contact Lens Solution Use and Acanthamoeba Keratitis. July 5, 2007. http://www.uic.edu/com/eye/Department/News/Joslin%20Ancethoe mebia%20Press/AJO%206.07%20uncorrected%20proof.pdf

59. Shoff, M., et al., Variable responses of Acanthamoeba strains to three multipurpose lens cleaning solutions. Optom Vis Sci, 2007. 84(3): p. 202-7.

60. Centers for Disease Control and Prevention. MMWR (2007) Acanthamoeba Keratits--Multiple States, 2005-2007. 56(Dispatch). 5/30/2007. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm56d526a1.htm

61. Khan, N.A., et al. A novel model for the study in vivo of central nervous system infections due to free-living amoebae. in XII International Conference on the Biology and Pathogenicity of Free-Living Amoebae. 2007. Wako, Japan.

62. Kohsler, M., et al., Acanthamoeba strains lose their abilities to encyst synchronously upon prolonged axenic culture. Parasitol Res, 2008. 102(5): p. 1069-72.

63. Thebpatiphat, N.M., et al., Acanthamoeba Keratitis: A Parasite on the Rise. Cornea, 2007. 26(6): p. 701-706.

64. Hammersmith, K., Diagnosis and management of Acanthamoeba keratitis. Curr Opin Ophthalmol, 2006. 17(4): p. 327-331.

104

65. Mathers, W., Use of higher medication concentrations in the treatment of Acanthamoeba keratitis. Archives of Ophthalmology, 2006. 124(6): p. 923.

66. Sansanayudh et al., IOVS 2007. 48(ARVO E-Abstract 756).

67. Tanhehco et al., IOVS 2007. 48: p. ARVO E-Abstract 754.

68. Powell, M. and G. Somero, Adaptations to Sulfide by Hydrothermal Vent Animals: Sites and Mechanisms of Detoxification and Metabolism. Biol. Bull., 1986. 171: p. 274-290.

69. Radford, C.F., D.C. Minassian, and J.K. Dart, Acanthamoeba keratitis in England and Wales: incidence, outcome, and risk factors. Br J Ophthalmol, 2002. 86(5): p. 536-42.

70. Radford, C.F., O.J. Lehmann, and J.K. Dart, Acanthamoeba keratitis: multicentre survey in England 1992-6. National Acanthamoeba Keratitis Study Group. Br J Ophthalmol, 1998. 82(12): p. 1387-92.

71. Stehr-Green, J.K., T.M. Bailey, and G.S. Visvesvara, The epidemiology of Acanthamoeba keratitis in the United States. AM. J. OPHTHALMOL., 1989. 107(4): p. 331-336.

72. Harf, C., Efficacy of contact lens disinfecting solutions for prevention of Acanthamoeba keratitis. Clinical Infectious Diseases, 1991. 13(no. 5 suppl): p. S413.

73. Barr, J. Contact Lens Spectrum (2006) Annual Report Contact Lenses 2005. March 17, 2007. http://www.clspectrum.com/article.aspx?article=&loc=archive\2006\jan uary\0106026.htm

74. Contact Lens Council. Statistics on Contact Lens Wear in the U.S. 2007 [cited March 28, 2007]; Available from: http://www.contactlenscouncil.org/stats.htm.

75. Lam, D.S., et al., Incidence and risk factors for microbial keratitis in Hong Kong: comparison with Europe and North America. Eye, 2002. 16(5): p. 608-18.

105

76. Houang, E., et al., Microbial keratitis in Hong Kong: relationship to climate, environment and contact-lens disinfection. Transactions of the Royal Society of Tropical Medicine and Hygiene, 2001. 95: p. 361-367.

77. Ledee, D.R., et al., Acanthamoeba griffini: Molecular Characterization of a New Corneal Pathogen. Investigative Ophthalmology & Visual Science, 1996. 37(3): p. 544-550.

78. Shoff, M., et al., Variable responses of Acanthamoeba strains to three multipurpose lens cleaning solutions. OVS, 2007. 84(3).

79. Hiti, K., et al., One- and two-step hydrogen peroxide contact lens disinfection solutions against Acanthamoeba: How effective are they? Eye, 2005. 19: p. 1301-1305.

80. Hughes, R. and S. Kilvington, Comparison of Hydrogen Peroxide Contact Lens Disinfection Systems and Solutions against Acanthamoeba polyphaga. Antimicrobial Agents & Chemotherapy, 2001. 45(7): p. 2038-2043.

81. Simmons, P.A., et al., Effect of patient wear and extent of protein deposition on adsorption of Acanthamoeba to five types of hydrogel contact lenses. Optometry and Vision Science, 1996. 73(6): p. 362-368.

82. Chang, D.C., et al., Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. American Journal of Ophthalmology, 2006. 142(5): p. 896-897.

83. Levy, B., D. Heiler, and S. Norton, Report on testing from an investigation of fusarium keratitis in contact lens wearers. Eye Contact Lens, 2006. 32(6): p. 256-61.

84. Zhang, S., et al., Growth and survival of Fusarium solani-F. oxysporum complex on stressed multipurpose contact lens care solution films on plastic surfaces in situ and in vitro. Cornea, 2006. 25(10): p. 1210-6.

85. Murti, C.R.K. and O.P. Shukla, Differentiation of pathogenic amoebae: encystation and excystation of Acanthamoeba culbertsoni--A model. J. Biosci, 1984. 6(4): p. 475-489.

86. Seal, D.V., et al., Population-based cohort study of microbial keratitis in Scotland: incidence and features. Cont Lens Anterior Eye, 1999. 22(2): p. 49-57. 106

87. Joslin, C.E., et al., Epidemiological characteristics of a Chicago-area Acanthamoeba keratitis outbreak. Am J Ophthalmol, 2006. 142(2): p. 212-7.

88. Acanthamoeba keratitis multiple states, 2005-2007. MMWR Morb Mortal Wkly Rep, 2007. 56(21): p. 532-4.

89. Morbidity and Mortality Weekly Report Dispatch 2007; Acanthamoeba Keratitis: Multiple States, 2005-2007. Centers for Disease Control and Prevention. 56. July 18, 2007. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5621a4.htm

90. U. S. Food and Drug Administration. FDA News: P07-93 Advanced Medical Optics Voluntarily Recalls Complete MoisturePlus Contact Lens Solution, May 26, 2007. July 18, 2007. http://www.fda.gov/bbs/topics/NEWS/2007/NEW01641.html

91. Singh, B.N., Pathogenic and non-pathogenic amoeba. 1975, London, United Kingdom: Macmillan.

92. Weisman, R.A., Differentiation in Acanthamoeba castellanii. Ann. Rev. Microbiol., 1976. 30: p. 189-219.

93. Hughes, R., W. Heaselgrave, and S. Kilvington, Acanthamoeba polyphaga Strain Age and Method of Cyst Production Influence the Observed Efficacy of Therapeutic Agents and Contact Lens Disinfectants. Antimicrobial Agents & Chemotherapy [Antimicrob. Agents Chemother.]. 2003. 47(10): p. 3080-3084.

94. Hughes, R., P. Andrew, and S. Kilvington, Enhanced Killing of Acanthamoeba Cysts with a Plan Peroxidase-Hydrogen Peroxide-Halide Antimicrobial System. Appl. Environ Microbiol, 2003. 69(5): p. 2563-2567.

95. Moskowitz, A. OCULAR SURGERY NEWS U.S. EDITION (2007) Task force report offers contact lens solution safety warnings. July 15. Dec 2, 2007. http://www.osnsupersite.com/view.asp?rID=22776

96. Westphal, S.P., Bausch & Lomb Solution Recall Exposes Risks for Eye Infections, in The Wall Street Journal. 2006.

97. Thimons, J.J. Contact Lens Spectrum (2004) Examining Taurine's Role in Ocular Biochemistry and in CL Wear. 5?29/2007. 107

http://www.clspectrum.com/article.aspx?article=&loc=archive\2004\ap ril\0404038.htm

98. Beattie, T.K., et al., Determination of Amoebicidal Activities of Multipurpose Contact Lens Solutions by Using a Most Probable Number Enumeration Technique. Journal of Clinical Microbiology, 2003. 41(7): p. 2992-3000.

99. Buck, S.L., R.A. Rosenthal, and B.A. Schlech, Methods used to evaluate the effectiveness of contact lens solutions and other compounds against Acanthamoeba: a review of the literature. Contact Lens Association of Ophthalmologists Journal, 2000. 26: p. 72-84.

100. Kennedy, J. and I. Bradshaw, The assay of acidic polysaccharides in solution with poly(hexamethylenebiguanidinium chloride). Carbohydrate Research, 1986. 156: p. 79-85.

101. Groemminger, S. and S. Norton, Letter to the Editor: Variable responses of Acanthamoeba strains to three multipurpose lens cleaning solutions Optometry and Vision Science, 2007. 84(10): p. 996.

102. Shoff, M., D. Seal, and A. Rogerson, Authors' Response: Variable responses of Acanthamoeba strains to three multipurpose lens cleaning solutions. Optometry and Vision Science, 2007. 84(10): p. 996-997.

103. Booton et al., IOVS 2007. (48): p. ARVO-E-Abstract 3234.

104. Liedel, K.K. and G.C. Begley, The effectiveness of soft contact lens disinfection systems against Acanthamoeba on the lens surface. Journal of the American Optometric Association, 1996. 67: p. 135-142.

105. Ludwig, I., et al., Susceptibility of Acanthamoeba to soft contact lens disinfection systems. Investigative Ophthalmology & Visual Science, 1986. 27: p. 626-8.

106. Mazur, T., E. Hadas, and I. Iwanicka, The duration of the cyst stage and the viability and virulence of Acanthamoeba isolates. Trop. Med. Parasitol., 1995. 46: p. 102-108.

107. Shoff, M., et al., Efficacy of Contact Lens Systems Agains Recent Clinical and Tap Water Acanthamoeba Isolates. Cornea, 2008. In Press.

108

108. Thomas, V., et al., Biodiversity of amoebae and amoebae-resisting bacteria in a drinking water treatment plant. Environ Microbiol, 2008.

109. Booton, G.C., et al., Genotypic Identification of Acanthamoeba sp. Isolates Associated with an Outbreak of Acanthamoeba keratitis (AK). . Cornea, 2008. [in press].

110. Gast, R.J., Development of an Acanthamoeba-specific reverse dot-blot and the discovery of a new ribotype. J Eukaryot Microbiol, 2001. 48: p. 609-615.

111. USEPA. Drinking Water Standards. 2005 [cited 1-18-06]; Available from: http://www.epa.gov/safewater/standards.html.

112. Dorworth, L. Disinfection with Chlorine. 2006 [cited January 11, 2006; Available from: http://www.iisgcp.org/water/wic/chlorine.htm.

113. LeChevallier, M., T. Babcock, and R. Lee, Examination and characterization of distribution system biofilms. Appl. Environ Microbiol, 1987. 53(12): p. 2714-2724.

114. Characklis, W., Bacterial Regrowth in Distribution Systems, in AWWARF. 1988: Denver, CO.

115. Crozes, G. and R. Cushing, Evaluating biological regrwoth in distribution systems, in AWWARF. 2000: Denver, CO.

116. Winiecka-Krusnell, J. and E. Linder, Bacterial infections of free-living amoebae. Res. Microbiol., 2001. 152: p. 613-619.

117. Huws, S., A. McBain, and P. Gilbert, Protozoan grazing and its impact upon population dynamics in biofilm communities. Journal of Applied Microbiology, 2005. 98(1): p. 238-244.

118. Joslin, C.E., et al., The Association Between Acanthamoeba Keratitis and the Presence of Acanthamoeba in Water Supplies Sampled From the Home, in ISEE. 2008: CA.

119. Shoff, M., et al., Prevalence of Acanthamoeba and Other Naked Amoebae in South Florida Domestic Water. Journal of Water and Health, 2007. In Press.

109

120. Schuster, F.L. and G.S. Visvesvara, Free-living amoebae as opportunistic and non-opportunistic pathogens of humans and animals. Int J Parasitol, 2004. 34(9): p. 1001-27.

121. Tamura, K., et al., Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 2007. 24: p. 1596- 1599.

122. Yera, H., et al., The genotypic characterisation of Acanthamoeba isolates from human ocular samples. Br J Ophthalmol, 2008. 92(8): p. 1139-41.

123. Columbus Dispatch (2008) Parasite is making Scioto River unsafe, health department warns. October 22, 2008. http://www.dispatch.com/live/content/local_news/stories/2008/09/12 /badwater.html

124. Mokri-Moayyed, B., G.J. Goldsworthy, and N.A. Khan, Development of a novel ex vivo insect model for studying virulence determinants of Escherichia coli K1. J Med Microbiol, 2008. 57(Pt 1): p. 106-10.

125. Scully, L.R. and M.J. Bidochka, Developing insect models for the study of current and emerging human pathogens. FEMS Microbiol Lett, 2006. 263(1): p. 1-9.

126. Kavanagh, K. and E.P. Reeves, Exploiting the potential of insects for in vivo pathogenicity testing of microbial pathogens. FEMS Microbiol Rev, 2004. 28(1): p. 101-12.

127. Cotter, G., S. Doyle, and K. Kavanagh, Development of an insect model for the in vivo pathogenicity testing of yeasts. FEMS Immunol Med Microbiol, 2000. 27(2): p. 163-9.

128. Cooper, E.L. and D. Geffen, Immune Response: Evolution, in Encyclopedia of life sciences. 2007, John Wiley: Hoboken. p. 1-11.

129. Kavanagh, K. and E.P. Reeves, Insect and Mammalian Innate Immune Responses Are Much Alike. Microbe, 2007. 2(12): p. 596-599.

130. Vilmos, P. and E. Kurucz, Insect immunity: evolutionary roots of the mammalian innate immune system. Immunol Lett, 1998. 62(2): p. 59-66.

110

131. Boman, H.G. and D. Hultmark, Cell-free immunity in insects. Annu Rev Microbiol, 1987. 41: p. 103-26.

132. Carlson, S.D., et al., Blood barriers of the insect. Annu Rev Entomol, 2000. 45: p. 151-74.

133. Hoffmann, J.A., J.M. Reichhart, and C. Hetru, Innate immunity in higher insects. Curr Opin Immunol, 1996. 8(1): p. 8-13.

134. Hultmark, D., Immune reactions in Drosophila and other insects: a model for innate immunity. Trends Genet, 1993. 9: p. 178-183.

135. Khan, N.A. and G.J. Goldsworthy, Novel model to study virulence determinants of Escherichia coli K1. Infect Immun, 2007. 75(12): p. 5735-9.

136. Mullen, L., M. Lightfoot, and G. Goldsworthy. Induced hyperlipaemia and immune challenge in locusts. 2004 [cited Sept. 27, 2007]; Available from: http://eprints.bbk.ac.uk/archive/00000239.

137. Goldsworthy, G., et al. Interactions between the endocrine and immune systems in locusts. 2003 [cited Sept. 27, 2007]; Available from: http://eprints.bbk.ac.uk/archive/00000246.

138. Logan, B.R., H. Wang, and M.-J. Zhang, Pairwise multiple comparison adjustment in survival analysis. Statistics in Medicine, 2005. 24: p. 2509- 2523.

139. Kilvington, S. and C. Anger, A comparison of cyst age and assay method of the efficacy of contact lens disinfectants against Acanthamoeba. British Journal of Ophthalmology, 2001. 85: p. 336-340.

140. Kilvington, S., et al., Effect of contact lens disinfectants against Acanthamoeba cysts, ed. K.R. Wilhelmus and D.B. Jones. 1991. S414-S415.

141. Kilvington, S., et al., Encystment of Acanthamoeba during incubation in multipurpose contact lens disinfectant solutions and experimental formulations. Eye Contact Lens, 2008. 34(3): p. 133-9.

142. Juranek, D.D., Cryptosporidiosis: Sources of Infection and Guidelines for Prevention. Clinical Infectious Diseases, 1995. 21(Suppl1): p. S57-61.

111

143. Kong, H.H., S.T. Yee, and D.I. Chung, [Comparison of virulence by Acanthamoeba strains in a murine model of acquired immunodeficiency syndrome]. Korean J Parasitol, 1998. 36(1): p. 23-31.

144. Janitschke, K., et al., Animal model Balamuthia mandrillaris CNS infection: contrast and comparison in immunodeficient and immunocompetent mice: a murine model of "granulomatous" amebic encephalitis. J Neuropathol Exp Neurol, 1996. 55(7): p. 815-21.

145. Jander, G., L.G. Rahme, and F.M. Ausubel, Positive correlation between virulence of Pseudomonas aeruginosa mutants in mice and insects. J Bacteriol, 2000. 182(13): p. 3843-5.

112

APPENDICES

APPENDIX A: MEDIA FORMULATIONS

Difco D/E Neutralizing Broth

1. D/E Neutralizing Broth 39 g 2. dH2O 1 L

Amoeba Saline

1. Prepare 5 Stock Solutions : a. NaCl : 1.20 g/100 ml b. CaCl2 : 0.04 g/100 ml c. MgSO4 : 0.04 g/100 ml d. Na2HPO4 : 1.42 g/100 ml e. KH2PO4 : 1.36 g/100 ml 2. Add 10 ml of each stock solution to 950 ml dH2O

Non-Nutrient Amoeba Saline Agar (NNAS)

1. Bacteriological agar 15 g 2. Amoeba saline 1 L

ATCC medium: PYG 712

Basal Medium Proteose Peptone (BD 211684) 20.0 g Yeast extract 1.0 g Distilled water to 950.0 ml

Prepare and sterilize separately each of the following components and 113

add directly to the basal medium as indicated below to avoid precipitation:

0.4 M MgSO4 . 7H2O 10.0 ml 0.05 M CaCl2 8.00 ml 0.1 M Sodium citrate . 2H2O 34.0 ml 0.005 M Fe(NH4)2(SO4)2 . 6H2O 10.0 ml 0.25 M Na2HPO4 . 7H2O 10.0 ml 0.25 M KH2PO4 10.0 ml

Adjust pH to 6.5. Autoclave 25 minutes at 121C.

Add aseptically:

2 M Glucose (filter-sterilized) 50.0 ml

114

APPENDIX B: DNEASY KIT MANUFACTURER’S INSTRUCTIONS: PROTOCOL FOR DNA PURIFICATION OF ANIMAL TISSUES

All solutions except specimen’s are provided by the kit.

1. Place sample solution in a 1.5 ml microcentrifuge tube and centrifuge for 5

minutes at 7,500 rpm and discard the supernatant.

2. Add 180 µl Buffer ATL to resuspend.

3. Add 20 µl proteinase K, mix by vortexing, and incubate at 55 C in a

shaking water bath for 3-24 h.

4. Vortex for 15 s. Add 200 µl Buffer AL to the sample, mixing thoroughly

by vortexing and then incubate at 70 C for 10 min.

5. Add 200 µl ethanol (96-100%) to the sample, and mix thoroughly by

vortexing.

6. Pipet the mixture from step 5 into the DNeasy spin column placed in a 2

ml collection tube. Centrifuge at ≥8000 rpm for 1 min. Discard flow-

through and collection tube.

7. Place the DNeasy spin column in a new 2 ml collection tube, add 500 µl

Buffer AW1, and centrifuge for 1 min at ≥8000 rpm. Discard flow-

through and collection tube.

115

8. Place the DNeasy spin column in a 2 ml collection tube, add 500 µl

Buffer AW2, and centrifuge for 3 min at full speed to dry the DNeasy

membrane. Discard flow-through and collection tube.

9. Place the DNeasy spin column in a clean 1.5 ml or 2 ml microcentrifuge

tube (not provided by kit) and pipet 200 µl Buffer AE directly onto the

DNeasy membrane. Incubate at room temperature for 1 min, and then

centrifuge for 1 min at ≥8000 rpm to elute.

10. Repeat elution once as described in step 9.

116

APPENDIX D: ETHANOL PREPARATION OF DNA FOR SEQUENING

1. Remove caps from tubes containing DNA template and add: a. 8μl of deionized water b. 32μl of non-denatured 95% ethanol and aspirate 2. Place in 1.5ml tube

3. Vortex briefly (all vortex briefly are ~3 sec)

4. Sit in the dark at room temperature for 10 minutes

5. Spin at 13,000 RPM for 20 minutes

6. Remove supernatant with pipette

7. Add 250ul 70% ethanol

8. Vortex briefly

9. Spin for 10 minutes at 13,000 RPM

10. Gently pour off supernatant and remove any remaining super with pipette (CAREFULLY!) 11. Dry samples in heat block @ 70° C for ~30 min (sample must be COMPLETELY dry!) 12. Add 15ul of Hi-Di formamide to dry tubes

13. Aspirate several times while scraping the bottom of the tube

14. Vortex for ~5 seconds

15. Spin down

117

16. Transfer to sequencing tubes

118

APPENDIX E: RAW DATA Efficacy Tests, Taurine Data

Response Response Response Growth = 1 Solution Treatment Taurine Growth = 1 Solution Treatment Taurine Growth = 1 Solution Treatment Taurine Strain Strain Strain No Growth Type Time Concent. No Growth Type Time Concent. No Growth Type Time Concent. = 0 = 0 = 0 Trial 1 1 06-039 Renu 6h 20mM Trial 1 1 06-039 Renu 6h 0.05% Trial 1 1 06-039 Renu 6h 0mM Trial 2 1 06-039 Renu 6h 20mM Trial 2 1 06-039 Renu 6h 0.05% Trial 2 1 06-039 Renu 6h 0mM Trial 3 1 06-039 Renu 6h 20mM Trial 3 1 06-039 Renu 6h 0.05% Trial 3 1 06-039 Renu 6h 0mM Control 1 06-039 Renu 6h 20mM Control 1 06-039 Renu 6h 0.05% Control 1 06-039 Renu 6h 0mM Trial 1 1 C06-038 Renu 6h 20mM Trial 1 1 C06-038 Renu 6h 0.05% Trial 1 1 C06-038 Renu 6h 0mM Trial 2 1 C06-038 Renu 6h 20mM Trial 2 1 C06-038 Renu 6h 0.05% Trial 2 1 C06-038 Renu 6h 0mM Trial 3 1 C06-038 Renu 6h 20mM Trial 3 1 C06-038 Renu 6h 0.05% Trial 3 1 C06-038 Renu 6h 0mM Control 1 C06-038 Renu 6h 20mM Control 1 C06-038 Renu 6h 0.05% Control 1 C06-038 Renu 6h 0mM Trial 1 1 06-035 Renu 6h 20mM Trial 1 1 06-035 Renu 6h 0.05% Trial 1 1 06-035 Renu 6h 0mM Trial 2 1 06-035 Renu 6h 20mM Trial 2 1 06-035 Renu 6h 0.05% Trial 2 1 06-035 Renu 6h 0mM Trial 3 1 06-035 Renu 6h 20mM Trial 3 1 06-035 Renu 6h 0.05% Trial 3 1 06-035 Renu 6h 0mM Control 1 06-035 Renu 6h 20mM Control 1 06-035 Renu 6h 0.05% Control 1 06-035 Renu 6h 0mM Trial 1 1 06-061 Renu 6h 20mM Trial 1 1 06-061 Renu 6h 0.05% Trial 1 1 06-061 Renu 6h 0mM Trial 2 1 06-061 Renu 6h 20mM Trial 2 1 06-061 Renu 6h 0.05% Trial 2 1 06-061 Renu 6h 0mM Trial 3 1 06-061 Renu 6h 20mM Trial 3 1 06-061 Renu 6h 0.05% Trial 3 1 06-061 Renu 6h 0mM Control 1 06-061 Renu 6h 20mM Control 1 06-061 Renu 6h 0.05% Control 1 06-061 Renu 6h 0mM Trial 1 1 06-004 Renu 6h 20mM Trial 1 1 06-004 Renu 6h 0.05% Trial 1 1 06-004 Renu 6h 0mM Trial 2 1 06-004 Renu 6h 20mM Trial 2 1 06-004 Renu 6h 0.05% Trial 2 1 06-004 Renu 6h 0mM Trial 3 1 06-004 Renu 6h 20mM Trial 3 1 06-004 Renu 6h 0.05% Trial 3 1 06-004 Renu 6h 0mM Control 1 06-004 Renu 6h 20mM Control 1 06-004 Renu 6h 0.05% Control 1 06-004 Renu 6h 0mM Trial 1 1 06-039 Renu 24h 20mM Trial 1 1 06-039 Renu 24h 0.05% Trial 1 1 06-039 Renu 24h 0mM Trial 2 1 06-039 Renu 24h 20mM Trial 2 1 06-039 Renu 24h 0.05% Trial 2 1 06-039 Renu 24h 0mM Trial 3 1 06-039 Renu 24h 20mM Trial 3 1 06-039 Renu 24h 0.05% Trial 3 1 06-039 Renu 24h 0mM Control 1 06-039 Renu 24h 20mM Control 1 06-039 Renu 24h 0.05% Control 1 06-039 Renu 24h 0mM Trial 1 1 C06-038 Renu 24h 20mM Trial 1 1 C06-038 Renu 24h 0.05% Trial 1 1 C06-038 Renu 24h 0mM Trial 2 1 C06-038 Renu 24h 20mM Trial 2 1 C06-038 Renu 24h 0.05% Trial 2 1 C06-038 Renu 24h 0mM Trial 3 1 C06-038 Renu 24h 20mM Trial 3 1 C06-038 Renu 24h 0.05% Trial 3 1 C06-038 Renu 24h 0mM Control 1 C06-038 Renu 24h 20mM Control 1 C06-038 Renu 24h 0.05% Control 1 C06-038 Renu 24h 0mM Trial 1 1 06-035 Renu 24h 20mM Trial 1 1 06-035 Renu 24h 0.05% Trial 1 1 06-035 Renu 24h 0mM Trial 2 1 06-035 Renu 24h 20mM Trial 2 1 06-035 Renu 24h 0.05% Trial 2 1 06-035 Renu 24h 0mM Trial 3 1 06-035 Renu 24h 20mM Trial 3 1 06-035 Renu 24h 0.05% Trial 3 1 06-035 Renu 24h 0mM Control 1 06-035 Renu 24h 20mM Control 1 06-035 Renu 24h 0.05% Control 1 06-035 Renu 24h 0mM Trial 1 1 06-061 Renu 24h 20mM Trial 1 1 06-061 Renu 24h 0.05% Trial 1 1 06-061 Renu 24h 0mM Trial 2 1 06-061 Renu 24h 20mM Trial 2 1 06-061 Renu 24h 0.05% Trial 2 1 06-061 Renu 24h 0mM Trial 3 1 06-061 Renu 24h 20mM Trial 3 1 06-061 Renu 24h 0.05% Trial 3 1 06-061 Renu 24h 0mM Control 1 06-061 Renu 24h 20mM Control 1 06-061 Renu 24h 0.05% Control 1 06-061 Renu 24h 0mM Trial 1 1 06-004 Renu 24h 20mM Trial 1 1 06-004 Renu 24h 0.05% Trial 1 1 06-004 Renu 24h 0mM Trial 2 1 06-004 Renu 24h 20mM Trial 2 1 06-004 Renu 24h 0.05% Trial 2 1 06-004 Renu 24h 0mM Trial 3 1 06-004 Renu 24h 20mM Trial 3 1 06-004 Renu 24h 0.05% Trial 3 1 06-004 Renu 24h 0mM Control 1 06-004 Renu 24h 20mM Control 1 06-004 Renu 24h 0.05% Control 1 06-004 Renu 24h 0mM Trial 1 1 06-039 Complete 6h 20mM Trial 1 1 06-039 Complete 6h 0.05% Trial 1 1 06-039 Complete 6h 0mM Trial 2 1 06-039 Complete 6h 20mM Trial 2 1 06-039 Complete 6h 0.05% Trial 2 1 06-039 Complete 6h 0mM Trial 3 1 06-039 Complete 6h 20mM Trial 3 1 06-039 Complete 6h 0.05% Trial 3 1 06-039 Complete 6h 0mM Control 1 06-039 Complete 6h 20mM Control 1 06-039 Complete 6h 0.05% Control 1 06-039 Complete 6h 0mM Trial 1 1 C06-038 Complete 6h 20mM Trial 1 1 C06-038 Complete 6h 0.05% Trial 1 1 C06-038 Complete 6h 0mM Trial 2 1 C06-038 Complete 6h 20mM Trial 2 1 C06-038 Complete 6h 0.05% Trial 2 1 C06-038 Complete 6h 0mM Trial 3 1 C06-038 Complete 6h 20mM Trial 3 1 C06-038 Complete 6h 0.05% Trial 3 1 C06-038 Complete 6h 0mM Control 1 C06-038 Complete 6h 20mM Control 1 C06-038 Complete 6h 0.05% Control 1 C06-038 Complete 6h 0mM Trial 1 1 06-035 Complete 6h 20mM Trial 1 1 06-035 Complete 6h 0.05% Trial 1 1 06-035 Complete 6h 0mM Trial 2 1 06-035 Complete 6h 20mM Trial 2 1 06-035 Complete 6h 0.05% Trial 2 1 06-035 Complete 6h 0mM Trial 3 1 06-035 Complete 6h 20mM Trial 3 1 06-035 Complete 6h 0.05% Trial 3 1 06-035 Complete 6h 0mM Control 1 06-035 Complete 6h 20mM Control 1 06-035 Complete 6h 0.05% Control 1 06-035 Complete 6h 0mM Trial 1 1 06-061 Complete 6h 20mM Trial 1 1 06-061 Complete 6h 0.05% Trial 1 1 06-061 Complete 6h 0mM Trial 2 1 06-061 Complete 6h 20mM Trial 2 1 06-061 Complete 6h 0.05% Trial 2 1 06-061 Complete 6h 0mM Trial 3 1 06-061 Complete 6h 20mM Trial 3 1 06-061 Complete 6h 0.05% Trial 3 1 06-061 Complete 6h 0mM Control 1 06-061 Complete 6h 20mM Control 1 06-061 Complete 6h 0.05% Control 1 06-061 Complete 6h 0mM Trial 1 1 06-004 Complete 6h 20mM Trial 1 1 06-004 Complete 6h 0.05% Trial 1 1 06-004 Complete 6h 0mM Trial 2 1 06-004 Complete 6h 20mM Trial 2 1 06-004 Complete 6h 0.05% Trial 2 1 06-004 Complete 6h 0mM Trial 3 1 06-004 Complete 6h 20mM Trial 3 1 06-004 Complete 6h 0.05% Trial 3 1 06-004 Complete 6h 0mM Control 1 06-004 Complete 6h 20mM Control 1 06-004 Complete 6h 0.05% Control 1 06-004 Complete 6h 0mM Trial 1 1 06-039 Complete 24h 20mM Trial 1 1 06-039 Complete 24h 0.05% Trial 1 1 06-039 Complete 24h 0mM Trial 2 1 06-039 Complete 24h 20mM Trial 2 1 06-039 Complete 24h 0.05% Trial 2 1 06-039 Complete 24h 0mM Trial 3 1 06-039 Complete 24h 20mM Trial 3 1 06-039 Complete 24h 0.05% Trial 3 1 06-039 Complete 24h 0mM Control 1 06-039 Complete 24h 20mM Control 1 06-039 Complete 24h 0.05% Control 1 06-039 Complete 24h 0mM Trial 1 1 C06-038 Complete 24h 20mM Trial 1 1 C06-038 Complete 24h 0.05% Trial 1 1 C06-038 Complete 24h 0mM Trial 2 1 C06-038 Complete 24h 20mM Trial 2 1 C06-038 Complete 24h 0.05% Trial 2 1 C06-038 Complete 24h 0mM Trial 3 1 C06-038 Complete 24h 20mM Trial 3 1 C06-038 Complete 24h 0.05% Trial 3 1 C06-038 Complete 24h 0mM Control 1 C06-038 Complete 24h 20mM Control 1 C06-038 Complete 24h 0.05% Control 1 C06-038 Complete 24h 0mM Trial 1 1 06-035 Complete 24h 20mM Trial 1 1 06-035 Complete 24h 0.05% Trial 1 1 06-035 Complete 24h 0mM Trial 2 1 06-035 Complete 24h 20mM Trial 2 1 06-035 Complete 24h 0.05% Trial 2 1 06-035 Complete 24h 0mM Trial 3 1 06-035 Complete 24h 20mM Trial 3 1 06-035 Complete 24h 0.05% Trial 3 1 06-035 Complete 24h 0mM Control 1 06-035 Complete 24h 20mM Control 1 06-035 Complete 24h 0.05% Control 1 06-035 Complete 24h 0mM Trial 1 1 06-061 Complete 24h 20mM Trial 1 1 06-061 Complete 24h 0.05% Trial 1 1 06-061 Complete 24h 0mM Trial 2 1 06-061 Complete 24h 20mM Trial 2 1 06-061 Complete 24h 0.05% Trial 2 1 06-061 Complete 24h 0mM Trial 3 1 06-061 Complete 24h 20mM Trial 3 1 06-061 Complete 24h 0.05% Trial 3 1 06-061 Complete 24h 0mM Control 1 06-061 Complete 24h 20mM Control 1 06-061 Complete 24h 0.05% Control 1 06-061 Complete 24h 0mM Trial 1 1 06-004 Complete 24h 20mM Trial 1 1 06-004 Complete 24h 0.05% Trial 1 1 06-004 Complete 24h 0mM Trial 2 1 06-004 Complete 24h 20mM Trial 2 1 06-004 Complete 24h 0.05% Trial 2 1 06-004 Complete 24h 0mM Trial 3 1 06-004 Complete 24h 20mM Trial 3 1 06-004 Complete 24h 0.05% Trial 3 1 06-004 Complete 24h 0mM Control 1 06-004 Complete 24h 20mM Control 1 06-004 Complete 24h 0.05% Control 1 06-004 Complete 24h 0mM 119

Response Response Response Solution Treatment Taurine Solution Treatment Taurine Solution Treatment Taurine Growth = 1 Strain Growth = 1 Strain Growth = 1 Strain No Growth Type Time Concent. No Growth Type Time Concent. No Growth Type Time Concent. = 0 = 0 = 0 Trial 1 1 06-039 OptiFree 6h 20mM Trial 1 1 06-039 OptiFree 6h 0.05% Trial 1 1 06-039 OptiFree 6h 0mM Trial 2 1 06-039 OptiFree 6h 20mM Trial 2 1 06-039 OptiFree 6h 0.05% Trial 2 1 06-039 OptiFree 6h 0mM Trial 3 1 06-039 OptiFree 6h 20mM Trial 3 1 06-039 OptiFree 6h 0.05% Trial 3 1 06-039 OptiFree 6h 0mM Control 1 06-039 OptiFree 6h 20mM Control 1 06-039 OptiFree 6h 0.05% Control 1 06-039 OptiFree 6h 0mM Trial 1 1 C06-038 OptiFree 6h 20mM Trial 1 1 C06-038 OptiFree 6h 0.05% Trial 1 1 C06-038 OptiFree 6h 0mM Trial 2 1 C06-038 OptiFree 6h 20mM Trial 2 1 C06-038 OptiFree 6h 0.05% Trial 2 1 C06-038 OptiFree 6h 0mM Trial 3 1 C06-038 OptiFree 6h 20mM Trial 3 1 C06-038 OptiFree 6h 0.05% Trial 3 1 C06-038 OptiFree 6h 0mM Control 1 C06-038 OptiFree 6h 20mM Control 1 C06-038 OptiFree 6h 0.05% Control 1 C06-038 OptiFree 6h 0mM Trial 1 1 06-035 OptiFree 6h 20mM Trial 1 1 06-035 OptiFree 6h 0.05% Trial 1 1 06-035 OptiFree 6h 0mM Trial 2 1 06-035 OptiFree 6h 20mM Trial 2 1 06-035 OptiFree 6h 0.05% Trial 2 1 06-035 OptiFree 6h 0mM Trial 3 1 06-035 OptiFree 6h 20mM Trial 3 1 06-035 OptiFree 6h 0.05% Trial 3 1 06-035 OptiFree 6h 0mM Control 1 06-035 OptiFree 6h 20mM Control 1 06-035 OptiFree 6h 0.05% Control 1 06-035 OptiFree 6h 0mM Trial 1 1 06-061 OptiFree 6h 20mM Trial 1 1 06-061 OptiFree 6h 0.05% Trial 1 1 06-061 OptiFree 6h 0mM Trial 2 1 06-061 OptiFree 6h 20mM Trial 2 1 06-061 OptiFree 6h 0.05% Trial 2 1 06-061 OptiFree 6h 0mM Trial 3 1 06-061 OptiFree 6h 20mM Trial 3 1 06-061 OptiFree 6h 0.05% Trial 3 1 06-061 OptiFree 6h 0mM Control 1 06-061 OptiFree 6h 20mM Control 1 06-061 OptiFree 6h 0.05% Control 1 06-061 OptiFree 6h 0mM Trial 1 1 06-004 OptiFree 6h 20mM Trial 1 1 06-004 OptiFree 6h 0.05% Trial 1 1 06-004 OptiFree 6h 0mM Trial 2 1 06-004 OptiFree 6h 20mM Trial 2 1 06-004 OptiFree 6h 0.05% Trial 2 1 06-004 OptiFree 6h 0mM Trial 3 1 06-004 OptiFree 6h 20mM Trial 3 1 06-004 OptiFree 6h 0.05% Trial 3 1 06-004 OptiFree 6h 0mM Control 1 06-004 OptiFree 6h 20mM Control 1 06-004 OptiFree 6h 0.05% Control 1 06-004 OptiFree 6h 0mM Trial 1 1 06-039 OptiFree 24h 20mM Trial 1 1 06-039 OptiFree 24h 0.05% Trial 1 1 06-039 OptiFree 24h 0mM Trial 2 1 06-039 OptiFree 24h 20mM Trial 2 1 06-039 OptiFree 24h 0.05% Trial 2 1 06-039 OptiFree 24h 0mM Trial 3 1 06-039 OptiFree 24h 20mM Trial 3 1 06-039 OptiFree 24h 0.05% Trial 3 1 06-039 OptiFree 24h 0mM Control 1 06-039 OptiFree 24h 20mM Control 1 06-039 OptiFree 24h 0.05% Control 1 06-039 OptiFree 24h 0mM Trial 1 1 C06-038 OptiFree 24h 20mM Trial 1 1 C06-038 OptiFree 24h 0.05% Trial 1 1 C06-038 OptiFree 24h 0mM Trial 2 1 C06-038 OptiFree 24h 20mM Trial 2 1 C06-038 OptiFree 24h 0.05% Trial 2 1 C06-038 OptiFree 24h 0mM Trial 3 1 C06-038 OptiFree 24h 20mM Trial 3 1 C06-038 OptiFree 24h 0.05% Trial 3 1 C06-038 OptiFree 24h 0mM Control 1 C06-038 OptiFree 24h 20mM Control 1 C06-038 OptiFree 24h 0.05% Control 1 C06-038 OptiFree 24h 0mM Trial 1 1 06-035 OptiFree 24h 20mM Trial 1 1 06-035 OptiFree 24h 0.05% Trial 1 1 06-035 OptiFree 24h 0mM Trial 2 1 06-035 OptiFree 24h 20mM Trial 2 1 06-035 OptiFree 24h 0.05% Trial 2 1 06-035 OptiFree 24h 0mM Trial 3 1 06-035 OptiFree 24h 20mM Trial 3 1 06-035 OptiFree 24h 0.05% Trial 3 1 06-035 OptiFree 24h 0mM Control 1 06-035 OptiFree 24h 20mM Control 1 06-035 OptiFree 24h 0.05% Control 1 06-035 OptiFree 24h 0mM Trial 1 0 06-061 OptiFree 24h 20mM Trial 1 0 06-061 OptiFree 24h 0.05% Trial 1 1 06-061 OptiFree 24h 0mM Trial 2 1 06-061 OptiFree 24h 20mM Trial 2 0 06-061 OptiFree 24h 0.05% Trial 2 1 06-061 OptiFree 24h 0mM Trial 3 1 06-061 OptiFree 24h 20mM Trial 3 0 06-061 OptiFree 24h 0.05% Trial 3 0 06-061 OptiFree 24h 0mM Control 1 06-061 OptiFree 24h 20mM Control 1 06-061 OptiFree 24h 0.05% Control 1 06-061 OptiFree 24h 0mM Trial 1 1 06-004 OptiFree 24h 20mM Trial 1 1 06-004 OptiFree 24h 0.05% Trial 1 1 06-004 OptiFree 24h 0mM Trial 2 1 06-004 OptiFree 24h 20mM Trial 2 1 06-004 OptiFree 24h 0.05% Trial 2 1 06-004 OptiFree 24h 0mM Trial 3 1 06-004 OptiFree 24h 20mM Trial 3 1 06-004 OptiFree 24h 0.05% Trial 3 1 06-004 OptiFree 24h 0mM Control 1 06-004 OptiFree 24h 20mM Control 1 06-004 OptiFree 24h 0.05% Control 1 06-004 OptiFree 24h 0mM Trial 1 1 06-039 Clear Care 6h 20mM Trial 1 1 06-039 Clear Care 6h 0.05% Trial 1 1 06-039 Clear Care 6h 0mM Trial 2 1 06-039 Clear Care 6h 20mM Trial 2 1 06-039 Clear Care 6h 0.05% Trial 2 1 06-039 Clear Care 6h 0mM Trial 3 1 06-039 Clear Care 6h 20mM Trial 3 1 06-039 Clear Care 6h 0.05% Trial 3 1 06-039 Clear Care 6h 0mM Control 1 06-039 Clear Care 6h 20mM Control 1 06-039 Clear Care 6h 0.05% Control 1 06-039 Clear Care 6h 0mM Trial 1 1 C06-038 Clear Care 6h 20mM Trial 1 1 C06-038 Clear Care 6h 0.05% Trial 1 1 C06-038 Clear Care 6h 0mM Trial 2 1 C06-038 Clear Care 6h 20mM Trial 2 0 C06-038 Clear Care 6h 0.05% Trial 2 1 C06-038 Clear Care 6h 0mM Trial 3 0 C06-038 Clear Care 6h 20mM Trial 3 0 C06-038 Clear Care 6h 0.05% Trial 3 0 C06-038 Clear Care 6h 0mM Control 1 C06-038 Clear Care 6h 20mM Control 1 C06-038 Clear Care 6h 0.05% Control 1 C06-038 Clear Care 6h 0mM Trial 1 1 06-035 Clear Care 6h 20mM Trial 1 1 06-035 Clear Care 6h 0.05% Trial 1 1 06-035 Clear Care 6h 0mM Trial 2 1 06-035 Clear Care 6h 20mM Trial 2 1 06-035 Clear Care 6h 0.05% Trial 2 1 06-035 Clear Care 6h 0mM Trial 3 1 06-035 Clear Care 6h 20mM Trial 3 1 06-035 Clear Care 6h 0.05% Trial 3 1 06-035 Clear Care 6h 0mM Control 1 06-035 Clear Care 6h 20mM Control 1 06-035 Clear Care 6h 0.05% Control 1 06-035 Clear Care 6h 0mM Trial 1 0 06-061 Clear Care 6h 20mM Trial 1 1 06-061 Clear Care 6h 0.05% Trial 1 1 06-061 Clear Care 6h 0mM Trial 2 1 06-061 Clear Care 6h 20mM Trial 2 0 06-061 Clear Care 6h 0.05% Trial 2 1 06-061 Clear Care 6h 0mM Trial 3 1 06-061 Clear Care 6h 20mM Trial 3 1 06-061 Clear Care 6h 0.05% Trial 3 1 06-061 Clear Care 6h 0mM Control 1 06-061 Clear Care 6h 20mM Control 1 06-061 Clear Care 6h 0.05% Control 1 06-061 Clear Care 6h 0mM Trial 1 0 06-004 Clear Care 6h 20mM Trial 1 1 06-004 Clear Care 6h 0.05% Trial 1 0 06-004 Clear Care 6h 0mM Trial 2 0 06-004 Clear Care 6h 20mM Trial 2 0 06-004 Clear Care 6h 0.05% Trial 2 1 06-004 Clear Care 6h 0mM Trial 3 0 06-004 Clear Care 6h 20mM Trial 3 0 06-004 Clear Care 6h 0.05% Trial 3 0 06-004 Clear Care 6h 0mM Control 1 06-004 Clear Care 6h 20mM Control 1 06-004 Clear Care 6h 0.05% Control 1 06-004 Clear Care 6h 0mM Trial 1 1 06-039 Clear Care 24h 20mM Trial 1 1 06-039 Clear Care 24h 0.05% Trial 1 1 06-039 Clear Care 24h 0mM Trial 2 1 06-039 Clear Care 24h 20mM Trial 2 1 06-039 Clear Care 24h 0.05% Trial 2 1 06-039 Clear Care 24h 0mM Trial 3 1 06-039 Clear Care 24h 20mM Trial 3 1 06-039 Clear Care 24h 0.05% Trial 3 1 06-039 Clear Care 24h 0mM Control 1 06-039 Clear Care 24h 20mM Control 1 06-039 Clear Care 24h 0.05% Control 1 06-039 Clear Care 24h 0mM Trial 1 0 C06-038 Clear Care 24h 20mM Trial 1 0 C06-038 Clear Care 24h 0.05% Trial 1 0 C06-038 Clear Care 24h 0mM Trial 2 0 C06-038 Clear Care 24h 20mM Trial 2 0 C06-038 Clear Care 24h 0.05% Trial 2 0 C06-038 Clear Care 24h 0mM Trial 3 1 C06-038 Clear Care 24h 20mM Trial 3 0 C06-038 Clear Care 24h 0.05% Trial 3 0 C06-038 Clear Care 24h 0mM Control 1 C06-038 Clear Care 24h 20mM Control 1 C06-038 Clear Care 24h 0.05% Control 1 C06-038 Clear Care 24h 0mM Trial 1 1 06-035 Clear Care 24h 20mM Trial 1 1 06-035 Clear Care 24h 0.05% Trial 1 1 06-035 Clear Care 24h 0mM Trial 2 1 06-035 Clear Care 24h 20mM Trial 2 1 06-035 Clear Care 24h 0.05% Trial 2 0 06-035 Clear Care 24h 0mM Trial 3 1 06-035 Clear Care 24h 20mM Trial 3 1 06-035 Clear Care 24h 0.05% Trial 3 0 06-035 Clear Care 24h 0mM Control 1 06-035 Clear Care 24h 20mM Control 1 06-035 Clear Care 24h 0.05% Control 1 06-035 Clear Care 24h 0mM Trial 1 0 06-061 Clear Care 24h 20mM Trial 1 0 06-061 Clear Care 24h 0.05% Trial 1 0 06-061 Clear Care 24h 0mM Trial 2 0 06-061 Clear Care 24h 20mM Trial 2 0 06-061 Clear Care 24h 0.05% Trial 2 0 06-061 Clear Care 24h 0mM Trial 3 0 06-061 Clear Care 24h 20mM Trial 3 0 06-061 Clear Care 24h 0.05% Trial 3 0 06-061 Clear Care 24h 0mM Control 1 06-061 Clear Care 24h 20mM Control 1 06-061 Clear Care 24h 0.05% Control 1 06-061 Clear Care 24h 0mM Trial 1 0 06-004 Clear Care 24h 20mM Trial 1 0 06-004 Clear Care 24h 0.05% Trial 1 0 06-004 Clear Care 24h 0mM Trial 2 0 06-004 Clear Care 24h 20mM Trial 2 0 06-004 Clear Care 24h 0.05% Trial 2 0 06-004 Clear Care 24h 0mM Trial 3 0 06-004 Clear Care 24h 20mM Trial 3 0 06-004 Clear Care 24h 0.05% Trial 3 0 06-004 Clear Care 24h 0mM Control 1 06-004 Clear Care 24h 20mM Control 1 06-004 Clear Care 24h 0.05% Control 1 06-004 Clear Care 24h 0mM

120

Response Response Response Solution Treatment Taurine Solution Treatment Taurine Solution Treatment Taurine Growth = 1 Strain Growth = 1 Strain Growth = 1 Strain No Growth Type Time Concent. No Growth Type Time Concent. No Growth Type Time Concent. = 0 = 0 = 0 Trial 1 1 06-039 UltraCare 6h 20mM Trial 1 1 06-039 UltraCare 6h 0.05% Trial 1 1 06-039 UltraCare 6h 0mM Trial 2 1 06-039 UltraCare 6h 20mM Trial 2 1 06-039 UltraCare 6h 0.05% Trial 2 1 06-039 UltraCare 6h 0mM Trial 3 1 06-039 UltraCare 6h 20mM Trial 3 1 06-039 UltraCare 6h 0.05% Trial 3 1 06-039 UltraCare 6h 0mM Control 1 06-039 UltraCare 6h 20mM Control 1 06-039 UltraCare 6h 0.05% Control 1 06-039 UltraCare 6h 0mM Trial 1 1 C06-038 UltraCare 6h 20mM Trial 1 0 C06-038 UltraCare 6h 0.05% Trial 1 1 C06-038 UltraCare 6h 0mM Trial 2 0 C06-038 UltraCare 6h 20mM Trial 2 0 C06-038 UltraCare 6h 0.05% Trial 2 0 C06-038 UltraCare 6h 0mM Trial 3 0 C06-038 UltraCare 6h 20mM Trial 3 0 C06-038 UltraCare 6h 0.05% Trial 3 0 C06-038 UltraCare 6h 0mM Control 1 C06-038 UltraCare 6h 20mM Control 1 C06-038 UltraCare 6h 0.05% Control 1 C06-038 UltraCare 6h 0mM Trial 1 1 06-035 UltraCare 6h 20mM Trial 1 1 06-035 UltraCare 6h 0.05% Trial 1 0 06-035 UltraCare 6h 0mM Trial 2 1 06-035 UltraCare 6h 20mM Trial 2 1 06-035 UltraCare 6h 0.05% Trial 2 0 06-035 UltraCare 6h 0mM Trial 3 1 06-035 UltraCare 6h 20mM Trial 3 1 06-035 UltraCare 6h 0.05% Trial 3 0 06-035 UltraCare 6h 0mM Control 1 06-035 UltraCare 6h 20mM Control 1 06-035 UltraCare 6h 0.05% Control 1 06-035 UltraCare 6h 0mM Trial 1 1 06-061 UltraCare 6h 20mM Trial 1 0 06-061 UltraCare 6h 0.05% Trial 1 0 06-061 UltraCare 6h 0mM Trial 2 0 06-061 UltraCare 6h 20mM Trial 2 0 06-061 UltraCare 6h 0.05% Trial 2 0 06-061 UltraCare 6h 0mM Trial 3 0 06-061 UltraCare 6h 20mM Trial 3 0 06-061 UltraCare 6h 0.05% Trial 3 1 06-061 UltraCare 6h 0mM Control 1 06-061 UltraCare 6h 20mM Control 1 06-061 UltraCare 6h 0.05% Control 1 06-061 UltraCare 6h 0mM Trial 1 1 06-004 UltraCare 6h 20mM Trial 1 0 06-004 UltraCare 6h 0.05% Trial 1 1 06-004 UltraCare 6h 0mM Trial 2 0 06-004 UltraCare 6h 20mM Trial 2 0 06-004 UltraCare 6h 0.05% Trial 2 1 06-004 UltraCare 6h 0mM Trial 3 0 06-004 UltraCare 6h 20mM Trial 3 0 06-004 UltraCare 6h 0.05% Trial 3 1 06-004 UltraCare 6h 0mM Control 1 06-004 UltraCare 6h 20mM Control 1 06-004 UltraCare 6h 0.05% Control 1 06-004 UltraCare 6h 0mM Trial 1 0 06-039 UltraCare 24h 20mM Trial 1 0 06-039 UltraCare 24h 0.05% Trial 1 0 06-039 UltraCare 24h 0mM Trial 2 0 06-039 UltraCare 24h 20mM Trial 2 0 06-039 UltraCare 24h 0.05% Trial 2 0 06-039 UltraCare 24h 0mM Trial 3 0 06-039 UltraCare 24h 20mM Trial 3 0 06-039 UltraCare 24h 0.05% Trial 3 0 06-039 UltraCare 24h 0mM Control 1 06-039 UltraCare 24h 20mM Control 1 06-039 UltraCare 24h 0.05% Control 1 06-039 UltraCare 24h 0mM Trial 1 0 C06-038 UltraCare 24h 20mM Trial 1 0 C06-038 UltraCare 24h 0.05% Trial 1 0 C06-038 UltraCare 24h 0mM Trial 2 0 C06-038 UltraCare 24h 20mM Trial 2 0 C06-038 UltraCare 24h 0.05% Trial 2 0 C06-038 UltraCare 24h 0mM Trial 3 0 C06-038 UltraCare 24h 20mM Trial 3 0 C06-038 UltraCare 24h 0.05% Trial 3 0 C06-038 UltraCare 24h 0mM Control 0 C06-038 UltraCare 24h 20mM Control 1 C06-038 UltraCare 24h 0.05% Control 1 C06-038 UltraCare 24h 0mM Trial 1 0 06-035 UltraCare 24h 20mM Trial 1 0 06-035 UltraCare 24h 0.05% Trial 1 0 06-035 UltraCare 24h 0mM Trial 2 0 06-035 UltraCare 24h 20mM Trial 2 0 06-035 UltraCare 24h 0.05% Trial 2 0 06-035 UltraCare 24h 0mM Trial 3 0 06-035 UltraCare 24h 20mM Trial 3 0 06-035 UltraCare 24h 0.05% Trial 3 0 06-035 UltraCare 24h 0mM Control 1 06-035 UltraCare 24h 20mM Control 1 06-035 UltraCare 24h 0.05% Control 1 06-035 UltraCare 24h 0mM Trial 1 0 06-061 UltraCare 24h 20mM Trial 1 0 06-061 UltraCare 24h 0.05% Trial 1 0 06-061 UltraCare 24h 0mM Trial 2 0 06-061 UltraCare 24h 20mM Trial 2 0 06-061 UltraCare 24h 0.05% Trial 2 0 06-061 UltraCare 24h 0mM Trial 3 0 06-061 UltraCare 24h 20mM Trial 3 0 06-061 UltraCare 24h 0.05% Trial 3 0 06-061 UltraCare 24h 0mM Control 1 06-061 UltraCare 24h 20mM Control 1 06-061 UltraCare 24h 0.05% Control 1 06-061 UltraCare 24h 0mM Trial 1 0 06-004 UltraCare 24h 20mM Trial 1 0 06-004 UltraCare 24h 0.05% Trial 1 0 06-004 UltraCare 24h 0mM Trial 2 0 06-004 UltraCare 24h 20mM Trial 2 0 06-004 UltraCare 24h 0.05% Trial 2 0 06-004 UltraCare 24h 0mM Trial 3 0 06-004 UltraCare 24h 20mM Trial 3 0 06-004 UltraCare 24h 0.05% Trial 3 0 06-004 UltraCare 24h 0mM Control 1 06-004 UltraCare 24h 20mM Control 1 06-004 UltraCare 24h 0.05% Control 0 06-004 UltraCare 24h 0mM Trial 1 1 06-039 Generic 6h 20mM Trial 1 1 06-039 Generic 6h 0.05% Trial 1 1 06-039 Generic 6h 0mM Trial 2 1 06-039 Generic 6h 20mM Trial 2 1 06-039 Generic 6h 0.05% Trial 2 1 06-039 Generic 6h 0mM Trial 3 1 06-039 Generic 6h 20mM Trial 3 1 06-039 Generic 6h 0.05% Trial 3 1 06-039 Generic 6h 0mM Control 1 06-039 Generic 6h 20mM Control 1 06-039 Generic 6h 0.05% Control 1 06-039 Generic 6h 0mM Trial 1 1 C06-038 Generic 6h 20mM Trial 1 1 C06-038 Generic 6h 0.05% Trial 1 1 C06-038 Generic 6h 0mM Trial 2 1 C06-038 Generic 6h 20mM Trial 2 1 C06-038 Generic 6h 0.05% Trial 2 1 C06-038 Generic 6h 0mM Trial 3 1 C06-038 Generic 6h 20mM Trial 3 1 C06-038 Generic 6h 0.05% Trial 3 1 C06-038 Generic 6h 0mM Control 1 C06-038 Generic 6h 20mM Control 1 C06-038 Generic 6h 0.05% Control 1 C06-038 Generic 6h 0mM Trial 1 1 06-035 Generic 6h 20mM Trial 1 1 06-035 Generic 6h 0.05% Trial 1 1 06-035 Generic 6h 0mM Trial 2 1 06-035 Generic 6h 20mM Trial 2 1 06-035 Generic 6h 0.05% Trial 2 1 06-035 Generic 6h 0mM Trial 3 1 06-035 Generic 6h 20mM Trial 3 1 06-035 Generic 6h 0.05% Trial 3 1 06-035 Generic 6h 0mM Control 1 06-035 Generic 6h 20mM Control 1 06-035 Generic 6h 0.05% Control 1 06-035 Generic 6h 0mM Trial 1 1 06-061 Generic 6h 20mM Trial 1 1 06-061 Generic 6h 0.05% Trial 1 1 06-061 Generic 6h 0mM Trial 2 1 06-061 Generic 6h 20mM Trial 2 1 06-061 Generic 6h 0.05% Trial 2 1 06-061 Generic 6h 0mM Trial 3 1 06-061 Generic 6h 20mM Trial 3 1 06-061 Generic 6h 0.05% Trial 3 1 06-061 Generic 6h 0mM Control 1 06-061 Generic 6h 20mM Control 1 06-061 Generic 6h 0.05% Control 1 06-061 Generic 6h 0mM Trial 1 1 06-004 Generic 6h 20mM Trial 1 1 06-004 Generic 6h 0.05% Trial 1 1 06-004 Generic 6h 0mM Trial 2 1 06-004 Generic 6h 20mM Trial 2 1 06-004 Generic 6h 0.05% Trial 2 1 06-004 Generic 6h 0mM Trial 3 1 06-004 Generic 6h 20mM Trial 3 1 06-004 Generic 6h 0.05% Trial 3 1 06-004 Generic 6h 0mM Control 1 06-004 Generic 6h 20mM Control 1 06-004 Generic 6h 0.05% Control 1 06-004 Generic 6h 0mM Trial 1 1 06-039 Generic 24h 20mM Trial 1 1 06-039 Generic 24h 0.05% Trial 1 1 06-039 Generic 24h 0mM Trial 2 1 06-039 Generic 24h 20mM Trial 2 1 06-039 Generic 24h 0.05% Trial 2 1 06-039 Generic 24h 0mM Trial 3 1 06-039 Generic 24h 20mM Trial 3 1 06-039 Generic 24h 0.05% Trial 3 1 06-039 Generic 24h 0mM Control 1 06-039 Generic 24h 20mM Control 1 06-039 Generic 24h 0.05% Control 1 06-039 Generic 24h 0mM Trial 1 1 C06-038 Generic 24h 20mM Trial 1 1 C06-038 Generic 24h 0.05% Trial 1 1 C06-038 Generic 24h 0mM Trial 2 1 C06-038 Generic 24h 20mM Trial 2 1 C06-038 Generic 24h 0.05% Trial 2 1 C06-038 Generic 24h 0mM Trial 3 1 C06-038 Generic 24h 20mM Trial 3 1 C06-038 Generic 24h 0.05% Trial 3 1 C06-038 Generic 24h 0mM Control 1 C06-038 Generic 24h 20mM Control 1 C06-038 Generic 24h 0.05% Control 1 C06-038 Generic 24h 0mM Trial 1 1 06-035 Generic 24h 20mM Trial 1 1 06-035 Generic 24h 0.05% Trial 1 1 06-035 Generic 24h 0mM Trial 2 1 06-035 Generic 24h 20mM Trial 2 1 06-035 Generic 24h 0.05% Trial 2 1 06-035 Generic 24h 0mM Trial 3 1 06-035 Generic 24h 20mM Trial 3 1 06-035 Generic 24h 0.05% Trial 3 1 06-035 Generic 24h 0mM Control 1 06-035 Generic 24h 20mM Control 1 06-035 Generic 24h 0.05% Control 1 06-035 Generic 24h 0mM Trial 1 1 06-061 Generic 24h 20mM Trial 1 1 06-061 Generic 24h 0.05% Trial 1 1 06-061 Generic 24h 0mM Trial 2 1 06-061 Generic 24h 20mM Trial 2 1 06-061 Generic 24h 0.05% Trial 2 1 06-061 Generic 24h 0mM Trial 3 1 06-061 Generic 24h 20mM Trial 3 1 06-061 Generic 24h 0.05% Trial 3 1 06-061 Generic 24h 0mM Control 1 06-061 Generic 24h 20mM Control 1 06-061 Generic 24h 0.05% Control 1 06-061 Generic 24h 0mM Trial 1 1 06-004 Generic 24h 20mM Trial 1 1 06-004 Generic 24h 0.05% Trial 1 1 06-004 Generic 24h 0mM Trial 2 1 06-004 Generic 24h 20mM Trial 2 1 06-004 Generic 24h 0.05% Trial 2 1 06-004 Generic 24h 0mM Trial 3 1 06-004 Generic 24h 20mM Trial 3 1 06-004 Generic 24h 0.05% Trial 3 1 06-004 Generic 24h 0mM Control 1 06-004 Generic 24h 20mM Control 1 06-004 Generic 24h 0.05% Control 1 06-004 Generic 24h 0mM

121

Response Response Response Growth Treatment Treatment Growth = 1 Treatment Growth = 1 Strain H2O2 % = 1 No Strain H2O2 % Strain H2O2 % Time Time No Growth Time No Growth = 0 Growth = 0 = 0 Trial 1 1 06-039 6h 0.025 Trial 1 0 06-039 24h 0.025 Trial 6 1 C06-038 6h 0.020 Trial 2 1 06-039 6h 0.025 Trial 2 0 06-039 24h 0.025 Trial 7 1 C06-038 6h 0.020 Trial 3 1 06-039 6h 0.025 Trial 3 0 06-039 24h 0.025 Trial 8 1 C06-038 6h 0.020 Trial 4 1 06-039 6h 0.025 Trial 4 1 06-039 24h 0.025 Trial 9 1 C06-038 6h 0.020 Trial 5 1 06-039 6h 0.025 Trial 5 0 06-039 24h 0.025 Trial 10 1 C06-038 6h 0.020 Trial 1 1 C06-038 6h 0.025 Trial 1 1 C06-038 24h 0.025 Trial 6 1 06-035 6h 0.020 Trial 2 1 C06-038 6h 0.025 Trial 2 0 C06-038 24h 0.025 Trial 7 1 06-035 6h 0.020 Trial 3 1 C06-038 6h 0.025 Trial 3 1 C06-038 24h 0.025 Trial 8 1 06-035 6h 0.020 Trial 4 1 C06-038 6h 0.025 Trial 4 1 C06-038 24h 0.025 Trial 9 1 06-035 6h 0.020 Trial 5 1 C06-038 6h 0.025 Trial 5 1 C06-038 24h 0.025 Trial 10 1 06-035 6h 0.020 Trial 1 1 06-035 6h 0.025 Trial 1 0 06-035 24h 0.025 Trial 6 1 06-061 6h 0.020 Trial 2 1 06-035 6h 0.025 Trial 2 0 06-035 24h 0.025 Trial 7 1 06-061 6h 0.020 Trial 3 1 06-035 6h 0.025 Trial 3 0 06-035 24h 0.025 Trial 8 1 06-061 6h 0.020 Trial 4 1 06-035 6h 0.025 Trial 4 0 06-035 24h 0.025 Trial 9 1 06-061 6h 0.020 Trial 5 1 06-035 6h 0.025 Trial 5 0 06-035 24h 0.025 Trial 10 1 06-061 6h 0.020 Trial 1 1 06-061 6h 0.025 Trial 1 0 06-061 24h 0.025 Trial 6 1 06-004 6h 0.020 Trial 2 1 06-061 6h 0.025 Trial 2 0 06-061 24h 0.025 Trial 7 1 06-004 6h 0.020 Trial 3 1 06-061 6h 0.025 Trial 3 0 06-061 24h 0.025 Trial 8 1 06-004 6h 0.020 Trial 4 1 06-061 6h 0.025 Trial 4 0 06-061 24h 0.025 Trial 9 1 06-004 6h 0.020 Trial 5 1 06-061 6h 0.025 Trial 5 0 06-061 24h 0.025 Trial 10 1 06-004 6h 0.020 Trial 1 1 06-004 6h 0.025 Trial 1 0 06-004 24h 0.025 Trial 1 1 06-039 6h 0.015 Trial 2 1 06-004 6h 0.025 Trial 2 0 06-004 24h 0.025 Trial 2 1 06-039 6h 0.015 Trial 3 1 06-004 6h 0.025 Trial 3 0 06-004 24h 0.025 Trial 3 1 06-039 6h 0.015 Trial 4 1 06-004 6h 0.025 Trial 4 0 06-004 24h 0.025 Trial 4 1 06-039 6h 0.015 Trial 5 1 06-004 6h 0.025 Trial 5 0 06-004 24h 0.025 Trial 5 1 06-039 6h 0.015 Trial 6 1 06-039 6h 0.025 Trial 6 0 06-039 24h 0.025 Trial 1 1 C06-038 6h 0.015 Trial 7 1 06-039 6h 0.025 Trial 7 0 06-039 24h 0.025 Trial 2 1 C06-038 6h 0.015 Trial 8 1 06-039 6h 0.025 Trial 8 1 06-039 24h 0.025 Trial 3 1 C06-038 6h 0.015 Trial 9 1 06-039 6h 0.025 Trial 9 1 06-039 24h 0.025 Trial 4 1 C06-038 6h 0.015 Trial 10 1 06-039 6h 0.025 Trial 10 1 06-039 24h 0.025 Trial 5 1 C06-038 6h 0.015 Trial 6 1 C06-038 6h 0.025 Trial 6 1 C06-038 24h 0.025 Trial 1 1 06-035 6h 0.015 Trial 7 1 C06-038 6h 0.025 Trial 7 0 C06-038 24h 0.025 Trial 2 1 06-035 6h 0.015 Trial 8 1 C06-038 6h 0.025 Trial 8 1 C06-038 24h 0.025 Trial 3 1 06-035 6h 0.015 Trial 9 1 C06-038 6h 0.025 Trial 9 0 C06-038 24h 0.025 Trial 4 1 06-035 6h 0.015 Trial 10 1 C06-038 6h 0.025 Trial 10 0 C06-038 24h 0.025 Trial 5 1 06-035 6h 0.015 Trial 6 1 06-035 6h 0.025 Trial 6 0 06-035 24h 0.025 Trial 1 1 06-061 6h 0.015 Trial 7 1 06-035 6h 0.025 Trial 7 0 06-035 24h 0.025 Trial 2 1 06-061 6h 0.015 Trial 8 1 06-035 6h 0.025 Trial 8 0 06-035 24h 0.025 Trial 3 1 06-061 6h 0.015 Trial 9 1 06-035 6h 0.025 Trial 9 0 06-035 24h 0.025 Trial 4 1 06-061 6h 0.015 Trial 10 1 06-035 6h 0.025 Trial 10 0 06-035 24h 0.025 Trial 5 1 06-061 6h 0.015 Trial 6 1 06-061 6h 0.025 Trial 6 0 06-061 24h 0.025 Trial 1 1 06-004 6h 0.015 Trial 7 1 06-061 6h 0.025 Trial 7 0 06-061 24h 0.025 Trial 2 1 06-004 6h 0.015 Trial 8 1 06-061 6h 0.025 Trial 8 0 06-061 24h 0.025 Trial 3 1 06-004 6h 0.015 Trial 9 1 06-061 6h 0.025 Trial 9 0 06-061 24h 0.025 Trial 4 1 06-004 6h 0.015 Trial 10 1 06-061 6h 0.025 Trial 10 0 06-061 24h 0.025 Trial 5 1 06-004 6h 0.015 Trial 6 1 06-004 6h 0.025 Trial 6 0 06-004 24h 0.025 Trial 6 1 06-039 6h 0.015 Trial 7 1 06-004 6h 0.025 Trial 7 0 06-004 24h 0.025 Trial 7 1 06-039 6h 0.015 Trial 8 1 06-004 6h 0.025 Trial 8 0 06-004 24h 0.025 Trial 8 1 06-039 6h 0.015 Trial 9 1 06-004 6h 0.025 Trial 9 1 06-004 24h 0.025 Trial 9 1 06-039 6h 0.015 Trial 10 1 06-004 6h 0.025 Trial 10 0 06-004 24h 0.025 Trial 10 1 06-039 6h 0.015 Trial 1 1 06-039 6h 0.020 Trial 1 1 06-039 24h 0.020 Trial 6 1 C06-038 6h 0.015 Trial 2 1 06-039 6h 0.020 Trial 2 1 06-039 24h 0.020 Trial 7 1 C06-038 6h 0.015 Trial 3 1 06-039 6h 0.020 Trial 3 1 06-039 24h 0.020 Trial 8 1 C06-038 6h 0.015 Trial 4 1 06-039 6h 0.020 Trial 4 0 06-039 24h 0.020 Trial 9 1 C06-038 6h 0.015 Trial 5 1 06-039 6h 0.020 Trial 5 1 06-039 24h 0.020 Trial 10 1 C06-038 6h 0.015 Trial 1 1 C06-038 6h 0.020 Trial 1 0 C06-038 24h 0.020 Trial 6 1 06-035 6h 0.015 Trial 2 1 C06-038 6h 0.020 Trial 2 0 C06-038 24h 0.020 Trial 7 1 06-035 6h 0.015 Trial 3 1 C06-038 6h 0.020 Trial 3 1 C06-038 24h 0.020 Trial 8 1 06-035 6h 0.015 Trial 4 1 C06-038 6h 0.020 Trial 4 0 C06-038 24h 0.020 Trial 9 1 06-035 6h 0.015 Trial 5 1 C06-038 6h 0.020 Trial 5 0 C06-038 24h 0.020 Trial 10 1 06-035 6h 0.015 Trial 1 1 06-035 6h 0.020 Trial 1 0 06-035 24h 0.020 Trial 6 1 06-061 6h 0.015 Trial 2 1 06-035 6h 0.020 Trial 2 1 06-035 24h 0.020 Trial 7 1 06-061 6h 0.015 Trial 3 1 06-035 6h 0.020 Trial 3 1 06-035 24h 0.020 Trial 8 1 06-061 6h 0.015 Trial 4 1 06-035 6h 0.020 Trial 4 0 06-035 24h 0.020 Trial 9 1 06-061 6h 0.015 Trial 5 1 06-035 6h 0.020 Trial 5 1 06-035 24h 0.020 Trial 10 1 06-061 6h 0.015 Trial 1 1 06-061 6h 0.020 Trial 1 0 06-061 24h 0.020 Trial 6 1 06-004 6h 0.015 Trial 2 1 06-061 6h 0.020 Trial 2 0 06-061 24h 0.020 Trial 7 1 06-004 6h 0.015 Trial 3 1 06-061 6h 0.020 Trial 3 0 06-061 24h 0.020 Trial 8 1 06-004 6h 0.015 Trial 4 1 06-061 6h 0.020 Trial 4 0 06-061 24h 0.020 Trial 9 1 06-004 6h 0.015 Trial 5 1 06-061 6h 0.020 Trial 5 0 06-061 24h 0.020 Trial 10 1 06-004 6h 0.015 Trial 1 1 06-004 6h 0.020 Trial 1 0 06-004 24h 0.020 Trial 1 1 06-039 6h 0.010 Trial 2 1 06-004 6h 0.020 Trial 2 0 06-004 24h 0.020 Trial 2 1 06-039 6h 0.010 Trial 3 1 06-004 6h 0.020 Trial 3 0 06-004 24h 0.020 Trial 3 1 06-039 6h 0.010 Trial 4 1 06-004 6h 0.020 Trial 4 0 06-004 24h 0.020 Trial 4 1 06-039 6h 0.010 Trial 5 1 06-004 6h 0.020 Trial 5 0 06-004 24h 0.020 Trial 5 1 06-039 6h 0.010 Trial 6 1 06-039 6h 0.020 Trial 6 1 06-039 24h 0.020 Trial 1 1 C06-038 6h 0.010 Trial 7 1 06-039 6h 0.020 Trial 7 1 06-039 24h 0.020 Trial 2 1 C06-038 6h 0.010 Trial 8 1 06-039 6h 0.020 Trial 8 0 06-039 24h 0.020 Trial 3 1 C06-038 6h 0.010 Trial 9 1 06-039 6h 0.020 Trial 9 1 06-039 24h 0.020 Trial 4 1 C06-038 6h 0.010 Trial 10 1 06-039 6h 0.020 Trial 10 1 06-039 24h 0.020 Trial 5 1 C06-038 6h 0.010

122

Response Response Response Growth Treatment Treatment Growth = 1 Treatment Growth = 1 Strain H2O2 % = 1 No Strain H2O2 % Strain H2O2 % Time Time No Growth Time No Growth = 0 Growth = 0 = 0 Trial 6 0 C06-038 24h 0.020 Trial 1 1 06-035 6h 0.010 Trial 1 1 06-035 24h 0.010 Trial 7 1 C06-038 24h 0.020 Trial 2 1 06-035 6h 0.010 Trial 2 1 06-035 24h 0.010 Trial 8 0 C06-038 24h 0.020 Trial 3 1 06-035 6h 0.010 Trial 3 0 06-035 24h 0.010 Trial 9 0 C06-038 24h 0.020 Trial 4 1 06-035 6h 0.010 Trial 4 0 06-035 24h 0.010 Trial 10 1 C06-038 24h 0.020 Trial 5 1 06-035 6h 0.010 Trial 5 1 06-035 24h 0.010 Trial 6 0 06-035 24h 0.020 Trial 1 1 06-061 6h 0.010 Trial 1 0 06-061 24h 0.010 Trial 7 0 06-035 24h 0.020 Trial 2 1 06-061 6h 0.010 Trial 2 0 06-061 24h 0.010 Trial 8 0 06-035 24h 0.020 Trial 3 1 06-061 6h 0.010 Trial 3 0 06-061 24h 0.010 Trial 9 0 06-035 24h 0.020 Trial 4 1 06-061 6h 0.010 Trial 4 0 06-061 24h 0.010 Trial 10 0 06-035 24h 0.020 Trial 5 1 06-061 6h 0.010 Trial 5 0 06-061 24h 0.010 Trial 6 0 06-061 24h 0.020 Trial 1 1 06-004 6h 0.010 Trial 1 0 06-004 24h 0.010 Trial 7 0 06-061 24h 0.020 Trial 2 1 06-004 6h 0.010 Trial 2 0 06-004 24h 0.010 Trial 8 0 06-061 24h 0.020 Trial 3 1 06-004 6h 0.010 Trial 3 0 06-004 24h 0.010 Trial 9 0 06-061 24h 0.020 Trial 4 1 06-004 6h 0.010 Trial 4 1 06-004 24h 0.010 Trial 10 0 06-061 24h 0.020 Trial 5 1 06-004 6h 0.010 Trial 5 1 06-004 24h 0.010 Trial 6 0 06-004 24h 0.020 Trial 6 1 06-039 6h 0.010 Trial 6 1 06-039 24h 0.010 Trial 7 0 06-004 24h 0.020 Trial 7 1 06-039 6h 0.010 Trial 7 1 06-039 24h 0.010 Trial 8 0 06-004 24h 0.020 Trial 8 1 06-039 6h 0.010 Trial 8 1 06-039 24h 0.010 Trial 9 0 06-004 24h 0.020 Trial 9 1 06-039 6h 0.010 Trial 9 1 06-039 24h 0.010 Trial 10 0 06-004 24h 0.020 Trial 10 1 06-039 6h 0.010 Trial 10 1 06-039 24h 0.010 Trial 1 1 06-039 24h 0.015 Trial 6 1 C06-038 6h 0.010 Trial 6 1 C06-038 24h 0.010 Trial 2 1 06-039 24h 0.015 Trial 7 1 C06-038 6h 0.010 Trial 7 1 C06-038 24h 0.010 Trial 3 1 06-039 24h 0.015 Trial 8 1 C06-038 6h 0.010 Trial 8 1 C06-038 24h 0.010 Trial 4 1 06-039 24h 0.015 Trial 9 1 C06-038 6h 0.010 Trial 9 1 C06-038 24h 0.010 Trial 5 1 06-039 24h 0.015 Trial 10 1 C06-038 6h 0.010 Trial 10 1 C06-038 24h 0.010 Trial 1 1 C06-038 24h 0.015 Trial 6 1 06-035 6h 0.010 Trial 6 1 06-035 24h 0.010 Trial 2 1 C06-038 24h 0.015 Trial 7 1 06-035 6h 0.010 Trial 7 1 06-035 24h 0.010 Trial 3 1 C06-038 24h 0.015 Trial 8 1 06-035 6h 0.010 Trial 8 1 06-035 24h 0.010 Trial 4 1 C06-038 24h 0.015 Trial 9 1 06-035 6h 0.010 Trial 9 1 06-035 24h 0.010 Trial 5 1 C06-038 24h 0.015 Trial 10 1 06-035 6h 0.010 Trial 10 1 06-035 24h 0.010 Trial 1 0 06-035 24h 0.015 Trial 6 1 06-061 6h 0.010 Trial 6 0 06-061 24h 0.010 Trial 2 0 06-035 24h 0.015 Trial 7 1 06-061 6h 0.010 Trial 7 0 06-061 24h 0.010 Trial 3 1 06-035 24h 0.015 Trial 8 1 06-061 6h 0.010 Trial 8 0 06-061 24h 0.010 Trial 4 1 06-035 24h 0.015 Trial 9 1 06-061 6h 0.010 Trial 9 0 06-061 24h 0.010 Trial 5 1 06-035 24h 0.015 Trial 10 1 06-061 6h 0.010 Trial 10 0 06-061 24h 0.010 Trial 1 0 06-061 24h 0.015 Trial 6 1 06-004 6h 0.010 Trial 6 0 06-004 24h 0.010 Trial 2 0 06-061 24h 0.015 Trial 7 1 06-004 6h 0.010 Trial 7 0 06-004 24h 0.010 Trial 3 0 06-061 24h 0.015 Trial 8 1 06-004 6h 0.010 Trial 8 0 06-004 24h 0.010 Trial 4 0 06-061 24h 0.015 Trial 9 1 06-004 6h 0.010 Trial 9 0 06-004 24h 0.010 Trial 5 0 06-061 24h 0.015 Trial 10 1 06-004 6h 0.010 Trial 10 0 06-004 24h 0.010 Trial 1 0 06-004 24h 0.015 Trial 1 1 06-039 6h 0.030 Trial 1 0 06-039 24h 0.030 Trial 2 0 06-004 24h 0.015 Trial 2 1 06-039 6h 0.030 Trial 2 0 06-039 24h 0.030 Trial 3 0 06-004 24h 0.015 Trial 3 1 06-039 6h 0.030 Trial 3 0 06-039 24h 0.030 Trial 4 0 06-004 24h 0.015 Trial 4 1 06-039 6h 0.030 Trial 4 0 06-039 24h 0.030 Trial 5 0 06-004 24h 0.015 Trial 5 1 06-039 6h 0.030 Trial 5 0 06-039 24h 0.030 Trial 6 1 06-039 24h 0.015 Trial 1 1 C06-038 6h 0.030 Trial 1 0 C06-038 24h 0.030 Trial 7 1 06-039 24h 0.015 Trial 2 1 C06-038 6h 0.030 Trial 2 0 C06-038 24h 0.030 Trial 8 1 06-039 24h 0.015 Trial 3 1 C06-038 6h 0.030 Trial 3 0 C06-038 24h 0.030 Trial 9 1 06-039 24h 0.015 Trial 4 1 C06-038 6h 0.030 Trial 4 0 C06-038 24h 0.030 Trial 10 1 06-039 24h 0.015 Trial 5 1 C06-038 6h 0.030 Trial 5 0 C06-038 24h 0.030 Trial 6 0 C06-038 24h 0.015 Trial 1 1 06-035 6h 0.030 Trial 1 0 06-035 24h 0.030 Trial 7 1 C06-038 24h 0.015 Trial 2 1 06-035 6h 0.030 Trial 2 0 06-035 24h 0.030 Trial 8 1 C06-038 24h 0.015 Trial 3 1 06-035 6h 0.030 Trial 3 0 06-035 24h 0.030 Trial 9 1 C06-038 24h 0.015 Trial 4 1 06-035 6h 0.030 Trial 4 0 06-035 24h 0.030 Trial 10 1 C06-038 24h 0.015 Trial 5 1 06-035 6h 0.030 Trial 5 0 06-035 24h 0.030 Trial 6 1 06-035 24h 0.015 Trial 1 1 06-061 6h 0.030 Trial 1 0 06-061 24h 0.030 Trial 7 1 06-035 24h 0.015 Trial 2 0 06-061 6h 0.030 Trial 2 0 06-061 24h 0.030 Trial 8 1 06-035 24h 0.015 Trial 3 1 06-061 6h 0.030 Trial 3 0 06-061 24h 0.030 Trial 9 1 06-035 24h 0.015 Trial 4 1 06-061 6h 0.030 Trial 4 0 06-061 24h 0.030 Trial 10 0 06-035 24h 0.015 Trial 5 1 06-061 6h 0.030 Trial 5 0 06-061 24h 0.030 Trial 6 0 06-061 24h 0.015 Trial 1 1 06-004 6h 0.030 Trial 1 0 06-004 24h 0.030 Trial 7 0 06-061 24h 0.015 Trial 2 1 06-004 6h 0.030 Trial 2 0 06-004 24h 0.030 Trial 8 0 06-061 24h 0.015 Trial 3 1 06-004 6h 0.030 Trial 3 0 06-004 24h 0.030 Trial 9 0 06-061 24h 0.015 Trial 4 1 06-004 6h 0.030 Trial 4 0 06-004 24h 0.030 Trial 10 0 06-061 24h 0.015 Trial 5 1 06-004 6h 0.030 Trial 5 0 06-004 24h 0.030 Trial 6 0 06-004 24h 0.015 Trial 6 1 06-039 6h 0.030 Trial 6 0 06-039 24h 0.030 Trial 7 0 06-004 24h 0.015 Trial 7 1 06-039 6h 0.030 Trial 7 0 06-039 24h 0.030 Trial 8 0 06-004 24h 0.015 Trial 8 1 06-039 6h 0.030 Trial 8 0 06-039 24h 0.030 Trial 9 0 06-004 24h 0.015 Trial 9 1 06-039 6h 0.030 Trial 9 0 06-039 24h 0.030 Trial 10 0 06-004 24h 0.015 Trial 10 1 06-039 6h 0.030 Trial 10 0 06-039 24h 0.030 Trial 1 1 06-039 24h 0.010 Trial 6 1 C06-038 6h 0.030 Trial 6 0 C06-038 24h 0.030 Trial 2 1 06-039 24h 0.010 Trial 7 1 C06-038 6h 0.030 Trial 7 0 C06-038 24h 0.030 Trial 3 1 06-039 24h 0.010 Trial 8 1 C06-038 6h 0.030 Trial 8 0 C06-038 24h 0.030 Trial 4 1 06-039 24h 0.010 Trial 9 1 C06-038 6h 0.030 Trial 9 0 C06-038 24h 0.030 Trial 5 1 06-039 24h 0.010 Trial 10 1 C06-038 6h 0.030 Trial 10 0 C06-038 24h 0.030 Trial 1 1 C06-038 24h 0.010 Trial 6 1 06-035 6h 0.030 Trial 6 0 06-035 24h 0.030 Trial 2 1 C06-038 24h 0.010 Trial 7 1 06-035 6h 0.030 Trial 7 0 06-035 24h 0.030 Trial 3 0 C06-038 24h 0.010 Trial 8 1 06-035 6h 0.030 Trial 8 0 06-035 24h 0.030 Trial 4 0 C06-038 24h 0.010 Trial 9 1 06-035 6h 0.030 Trial 9 0 06-035 24h 0.030 Trial 5 1 C06-038 24h 0.010 Trial 10 1 06-035 6h 0.030 Trial 10 0 06-035 24h 0.030 Trial 6 1 06-061 6h 0.030 Trial 6 0 06-061 24h 0.030 Trial 7 1 06-061 6h 0.030 Trial 7 0 06-061 24h 0.030 Trial 8 1 06-061 6h 0.030 Trial 8 1 06-061 24h 0.030 Trial 9 0 06-061 6h 0.030 Trial 9 0 06-061 24h 0.030 Trial 10 1 06-061 6h 0.030 Trial 10 0 06-061 24h 0.030 Trial 6 1 06-004 6h 0.030 Trial 6 0 06-004 24h 0.030 Trial 7 1 06-004 6h 0.030 Trial 7 0 06-004 24h 0.030 Trial 8 1 06-004 6h 0.030 Trial 8 0 06-004 24h 0.030 Trial 9 1 06-004 6h 0.030 Trial 9 0 06-004 24h 0.030 Trial 10 1 06-004 6h 0.030 Trial 10 0 06-004 24h 0.030

123

APPENDIX F: SEQUENCE DATA

>T4--W06-201

AGGCATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGGATACCGTCGTAGTCT

TAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCG

TCCTTGGCGTCNGTCTTTCNGGGCCGGCCCGGGGACCGCTTANCCCGGTGGCAC

>T3__05-014--UIC-80192713

CCTGTCCTCCTATTTTCAGTGGTTTGCCGCGAGGACCAGGGTAATGATTAATAGGGATAGTTGGGGGC

ATTAATATTTAATTGTCAGAGGTGAAATTCTTGGATTTATGAAAGATTAACTTCTGCGAAAGCATCTG

CCAAGGATGTTTTCATTAATCAAGAACGAAAGTTNGGGGATCGAAGACGATCAGATACCGTCGTAGTC

TTAACCATAAACGATGCCGACCAGNGATTAGGAGACGTTGAATACAAAACACCACCATGCGCATTGCG

GTCGTCTTTGGTGTCGCTCACAAGGCGGAACCNGGGCGGCTTA

>T3__05-020--UIC-10731404

AAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATGCGCATTGCGGTCGTCTT

TGGTGTGTCGCCACAAGGCGGCATCATCGGGACGGCTTAGCTCGCATGGCACCGGTGAATGACTCCCC

TAGCAGCTTGTGAGA

>T3__W06-131_06-044b

TACTGACGATTACTTCTGCGAAAGCATCTGCCCAGGATGTTTTCATTAATCAAGAACGAAAGTCTAGG

GGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACG

TTGAATACAAAACACCACCATGCGCATTGCGGTCGTCTTTGGTGTGTCGCTCACAAGGCGGCATCATC

GGGACGGCTTAGCTCGCATGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCCCAGATCGT

TTACCGTGAATGCGGACGGCCCCAACCGGTTAGAGGGACTGGCTCCTTTTCTTTTAAAACGAGGCGAC

CGAAACCCAATTTAGAAGGGGGGGGGGGGCAAAAAAA 124

>T3__W06-131_06-044

TAATGAGATTACTTCTGCGAAAGCATCTGCCATCGATGTTTTCATTAATCAAGAACGAAAGTTACGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATGCGCATTGCGGTCGTCTTTGGTGTGTCGCTCACAAGGCGGCATCATCG

GGACGGCTTAGCTCGCATGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCC

>T3--W06-222

NCCTTGNGGGAANNACGNTCNGTGTTTNTTNTNNNGAGAACCCTGTTNTCATTANTGCAAGTAACGAA

AGTTAGGGTTTTNGAAGCACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGAT

TAGGAGACGTTGAATACAAAACACCACCATGCGCATTGCGGTCGTCTTTGGTGTCGCTCACAAGGCGG

CACCGGGGCGGCTTAGCTCGCATGGCNCCGGTGAATGANTCCCCTAGCAGNNNGNGAGAAGGCCCNG

>T3 W06-269

AAAATGGATGATTACTTCTGCGAAGCATCTGCCCAGGATGTTTTCATTAATCAAGAACGAAAGTTCAG

GGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGAC

GTTGAATACAAAACACCACCATGCGCATTGCGGTCGTCTTTGGTGTCGCTCACAAGGCGGCACCGGGG

CGGCTTAGCTCGCATGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCCCAGATCGTTTAC

CGTGAATGGGGGTGGTAGCAGCTGGTTAGAGTGACGGGATCGACGCCCGGAAGGTTATTTTTTATTGA

CCCGGCAAGCGTTGTTTTCCCGGGAGGAGAGGGGAGGGGGCCACA

>T3--W06-269

TAATGAAGATTGCTTCTGCGAAGCATCTGCCAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGA

TCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTG

AATACAAAACACCACCATGCGCATTGCGGTCGTCTTTGGTGTCGCTCACAAGGCGGCACCGGGGCGGC

TTAGCTCGCATGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGG

>T4__05-003a-UIC-80275731

GGCGTCGGTTTCGGCCGGCGCGGAGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAG

CTTGTGAGAAAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGG

GCCCAATTCGCCCTATAGTGAGT

125

>T4__05-003b-UIC-80275731

GGCGTCTCGGTCCTTCACGGGGCCGGGGCGCGGGGGTGGCTTAGCCCGGTGGCACCGGTGAATGACTC

CCCTAGCAGCTTGTGAGAAAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCAT

>T4__05-009--UIC-80275742

TTTTCATTAATCAAGAACNAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATA

AACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCACGGCGCGGTCGCCCTTGGCG

TTCGTGTTCACGCACGGGCGCGAGGGCGGTTTAGCCCGATGGCACCGGTGAATGACTCCCT

>T4__05-011--UIC-80281504

ATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCCGCGCGCGCGG

GTGGGTTAG-

>T4--05-011_CL_1

GCCCAGATCGTTTACCGTGAAAAAATTAGAGTGTTCAAAGCAGGCAGATCCAATTTTCTGCCACCGAA

TACANTAGCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTTCAGTTGGTTTTGGCAGCGCTGAG

GACTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTG

GATTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGT

TAGGGGATCGAAGACGATCAGGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGG

AGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCTCGGTCTTTCGGCCGGGGCG

CGGGGATGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAA

>T4--05-011_cl3--UIC-802815o4

GCCCAGATCGTTTACCGTGAAAAAATTAGAGTGTTCAAAGCAGGCAGATCCAATTTTCTGCCCCGAAT

ACATTAGCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTTCAGTTGGTTTTGGCAGCGCTTGGA

CTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTGGA

TTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTA

GGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCCGACCAGCGATTAGGAG

ACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGG

CGCGGGGGTGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAA-

126

>T4__05-013--UIC-80284736

TTTCATTAATCAAGNTCGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAA

ACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCG

TCGGTCTTTCGGGGCCGGCGCNGGGACGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCT-

>T4--W06-101

AAATGACGATTACTTCTGCGAAGCATCTGCCAGGATGTTTTCATTAATCAAGAACGAAAgTCTAGGGG

ATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTT

GAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGCCCTTCAGGGGGCCGGGGCGGGG

GGGTGGCTTAGCCCGGTGGCACCAGTGAATGACTCCCCTACTTGCTAGAAAGAAGGGGTAGATCGTTG

ACCGTGAATACCGACGGGACTGTTTTTATAGAAGGCCTCCCTAAAATATTCTTATATATTTTTGGGCG

GGGAGGCCCCCTCTCTTTTTTTCGGCGGGGGGGGGAAAAAAAAAAAAAAAAAAACTCTTTGGGGGGGG

GGGGGGGAGAGATACATATACACTACAAAATAACAAAGAGAGAGCA-

>08-007 T4 mix questionable

AGTCGAGCGAATGTGCAGTCCGGTTTTcattAATCGGAACGAAGTTCTGGGAtGGAAGACGATAGGAT

ACCGTCGTAGTCTTCTTATAAACGATGCCGACCACCGATTATGAGACGTTGAATACaAAaCACCACCA

TCGTCGCGGTCGTCCTTGGTGTCTCTCCGTCCTTCACGGGGGCGGGGGGCGGGGGCGGCTTaCTCCCG

GTGGCACCGGTGAATGACTCCCCTCCCAGCTTGTGGGAAGAAGGCGATGGTTTTGGCCCGTACATGAT

TTTAGACTAACCCCCCCCTCCTTGCTTCCTTTTACAAAAAGAAAAAAGGAGGGGGGGGCCTATTTCGG

TTCCCCTGGGAATGGGGGGGGGTGGGGGAAAAATGGGCCTCCCCGCCGTGAACCCTTTTTTTTTTTCC

CGCGACACTTTGGGGGAAAATCTCACATGCCGGTAGGGGAGTCAGGCCAAGTTACCCGACCGCGGAGC

GTCTTACATTCTGGTAAGGAGTTCGTCCGCTAACATCCGGGAGATATATTTGAGGTACCCCCCCACGC

AAAAAAAAA------

>T4__05-023--UIC-72423403

GATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTTGCGGTCGTCCTTGGCGT

CTCGGTTTCGGCCGGGGCGCCGGGGATGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGC

TTGTGAGA-

127

>T4__06-001--UIC-80306191

ACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTTGCGGTCGT

CCTTGGCGTCTCGGTTTCGGCCGGGGCGCGGGGATGGCTTAGCCCGGTGGCACCGGTGAATGACTCCC

CTAGCAGCTTGTGAGATGGCCCAGATCGTTTACCGTGAATGACTCCCCTTG-

>T4__06-002--UIC-80312968

CATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCATCCT

TGGCGTTGGTCTTCAAAAGCCAGCGCGGGGGTGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTA

GCAGCTTGTGAGA-

>T4__06-004--UIC-80318599

CGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGA

ATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTGTCTCGGCTTCACGGCCGGGGCTGCTGCTG

AGGGCTGGTTTAGCCCGGTGGCACCGGTGAATTGACTCCCCTAGCA-

>T4__06-005--UIC-80320410

CATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCT

TGGCGTCTTTGTTTCGGCnGGGTGCCGGGGACGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTA

GCAGCTTGTGAGA-

>T4_-06-016--UIC-80334423

TAGGGGATCTGAnGACGnCnGATACCGTCGTAGTCTTAACCATAAACGAnGCCGACCAGCGATTAGGA

GACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGG

GGACGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCC-

>T4--06-016_jdp2b-UIC-80334423

ATACATTAGCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTTCAGTTGGTTTTGGCAGCGCGAG

GACTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTG

GATTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGT

TAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGA

GACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCTCGGGG-

128

>T4--06-016_jdp1

TGCCCCGAATACATTAAnCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTTCAGTTGGTTTTGG

CAGCGCGAGGACTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTG

AAATTCTTGGATTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAnGGATGTTTTCATTAATCAAG

AACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGA-

>T4--06-024_cl_1_UIC_AK

ATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACC

ATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTT

GGCGTCGGTCCTTCACGGGGCCGGCGCGAGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCT

AGCAGCTTGTGAGAAA-

>T4--06-024_cl_4_UIC_AK

ATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGnCCAGATACCGTCGTAGTCTTAACC

ATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTT

GGCGTCGGTCCTTCACGGGGCCGGCGCGAGGGCGGTTTAGCCCGGTGGCACCGGTGAATGACTCCCCT

AGCAGCTTGTGAGAAA-

>T4--06-024_cl_3_UIC_AK

ATGTTTGCATTAATCAAGAACAAAAnTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACC

ATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTT

GGCGTCGGTCCTTCACGGGGCCGGCGCGAGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCT

AGCAGCTTGTGAGAAA-

>T4--06-024_cl_5_UIC_AK

TTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACCATCAGATACCGTCGTAATCTTAACCATAA

ACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCG

TCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGC

TTGTGAGAAA-

>T4--06-025_jdp1

129

CCCTAATACATTACGCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTCAGTTGGTTTTGGCAGC

GCGAGGACTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAAT

TCTTGGATTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAGGGATGTTTTCATTAATCAAGAACG

AAAGTTAGGGGATCGAAGACGATCAGATACCCGTCGTAGTCTTAACCATAAACGATGCCG-

>T4--06-025_jdp2b

CGAGGACTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATT

CTTGGATTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGA

AAGTTAGGGGATCGAAGACGATCAGAnACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATT

AGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTGGTG-

>T4--06-027_jdp1

TCCTCCTATTTTCAGTTGGTTTTGGCAnCGCGAGGACTAGGGTAATGATTAATAGGGATAGTTGGGGG

CATTAATATTTAATTGTCAGAGGTGAAATTCTTGGATTTATGAAAGATTAAnnTCTGTTAAAGCATCT

GCCAGGGAnGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGATnCCC--

>T4--06-027_jdp2b-UIC-80346050-case

AGCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTTCAGTTGGTTTTGGCAGCGCGAGGACTAGG

GTAATGATnAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTGGATTTAT

GAAAGCATTAACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGG

ATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTT

GAATACAAAACACCACCGTCGGCCCGGTCGGCG-

>T4_-06-027--UIC-80346050-case

ATAATAAGAACGAAATnnGGGGATCGAAGAnnCCAGATACCGnCGTAGTCTAACCATAAACGATGCCG

ATAGCGATTAGGAGACGTTGAATACAAAACACCAnGTCGGCGCGGTCGTCCTTGGCGTCGGTCCTTCA

CGGGGCCGGCGCGAGGGCGGCTTATC-

>T4--06-028_cl_1_UIC_AK_case

ATGTTTTCATTAATCAAGAACTAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACC

ATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTT

130

GGCGTCGGTCCTTCACGGGGCCGGCnCGAGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCT

AGCAGCTTGTGAGAAA-

>T4--06-028_cl_5_UIC_AK_case

CATCTGCCACCGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGGAGACGATCAGATACCGTC

GTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGC

GCGGTCGTCCTTGGCGTCGGTCCTTCACGGGGCCGGCGCGAGGGCGGCTTAGCCCGGTGGCACCGGTG

AATGACTCCCCTAGCAGCTTGTGAGAAA-

>T4--06-028_cl_2_UIC_AK_case

ATGTTTTCATTAATnAAGAACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTACCC

ATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTT

GGCGTCGGTCCTTCACGGGGCCGGCGCGAGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCT

AGCAGCTTGTGAGAAA--

>T4--06-028_cl_6_UIC_AK_case

ATGTTTTCATTAATCAAGGACGAAAGTTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACC

ATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTT

GGCGTCGGTCCTTCACGGGGCCGGCGCGAGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCT

AGCAGCTTGTGAGAAA---

>T4_-06-033--UIC-80351060

GCCGGTGGGCGGGnTCGGGGCGCGCnGCnGCGCCGCGACCGTCGTAGTCTnACCnnnAACGnGGCCGA

CCAGCGnnTAGGAGACGTTGAATACAAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTTGTCGGCT

TCACGGCTGGCGGCGCGAGGCGGTTTAGCCCGGTGGCACCGGTGAATGACT-

>T4--06-033_cl1

GCCCAGATCGTTTACCGTGAAAAAATTAGAGTGTTCAAAGCAGGCAGATCCAATTTTCTGCCCCGAAT

ACATTAGCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTTCAGTTGGTTTTGGCANCGCGAGGA

CTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTGGA

TTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAAGGGATGTTTTCATTAATCAAGAACGAAAGTT

131

AGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACCATGCCGACCCAGCGATTAGGA

GACGTTGAAACCAAAACACCCCATCCGGCGCGGTCGTCCTTGGCGTTGTCGGCNTCNCNGCTGGCNGC

CCCCAGGGCCGGNTTACCCCCGGTGGCCCCCGGTGNAATGACTCCCCTANCANCTTGG-

>T4--06-033_CL6

GCCCAGATCGTTTACCGTGAAAAAATTAGANTGTTCAAAGCAGGCAGATCCAATTTTCTGCCACCGAA

TACATTAGCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTTCAGTTGGTTTTGGCNTCNCTAGG

ACTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTGG

ATTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTT

AGGGGATCGAAGACGATCAAGATACCGTCGTACTCTTAACCATAAACGATGCCGACCAGCGATTAGGA

GACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTTGTCGGCTTCCGGCTGGCGGCG

CGAGGGCGGTTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAAGGGCGAACCC

NCACACTGGCGCCGTNCTAGTGGATCCGAGCTCGGTCCCNAGCTTGGGTTGNCNTNCTGCCNTTTCCA

GTCGGAAACCTGTCTGCCCNNCA

>T4--06-033_cl3-UIC-80351060

GCCCAGATCGTTTACCGTGAAAAAATTAGANTGTTCAAAGCAGGCAGATCCAANTTTCTGCCACCGAA

TACATNGGCATGGGATAATGGAATAGGACCCTGTCCTCCTATTTTCAGTTGGTTTTGNNAGCTNTAGG

ACTAGGGTAATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTGG

ATTTATGAAAGATTAACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTT

ACGGGGATCGAAGACGATCAGATACCGTCCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAAG

GAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTTGTCGGCTTCACGGCTGGCG

GCGCGAGGGCNGTTTAGCCCGGTGGCCCGGTGAATGACTCCCTAGCAGCTTGTGAGAA-

>T4--06-052--UIC-80365821

CACTTGANGGACCACTTCTGCGANNTCATCTGCCAAGNCATGTTTTCATTAATCAAGAACGAAAGTTA

GGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGA

CGTTGAATACAAAACACCACCATCGGTGCGGTCGTTCTTGCGTCGGTTTCGGCAAGGCCGCGGGAGCG

132

GCTTAGCCCGGTGGCACCGGTGAATGACTCCCNTANCNGCTTGNGAGAGGGACCNGNTCGTTTGCCGT

GNNTGCNGNCAAAAN-

>T4--W07-135

CGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGCTTAGGAGACGTTGAATACAA

AACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCCGGGGCcGGGG-

>T4 06-053b

TTAGTAAAAGATTAACTTCTGCGAAAGCATCTGATCAGGATGAAAAAAATTAATCAAGAACGAATTGT

TAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGA

GACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGG

GCGCGGGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGG

>T4 06-053

ATATGAAAGATAACTTCTGCGAAAGCATCTGATCAGGATGTTTAGAATAGTCAGAACGAATGCTAGGG

GATCGAAAACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCTACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGCGCG

GGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGG-

>T4--06-057--UIC-80371178

CNACGTGGAANCCCAACTTCTGCGTNTTGCATCTGCCAANGNATGTTTTCATTAATCAAGAACGAAAG

TTAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGG

AGACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCG

GGGACGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGANGGCCC-

>T4--06-059--UIC-80375425

GACNNANNGGGANNCACCAACTTCCTGCTTTTGCATGCTGCCACCGNATGTTTTCATTAATCAAGAAC

GAAAGTTAGGGGATCGAAGACGATCAGCATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCG

ATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCGGTCCTTCACGGGG

CCGGCGCGAGGGCGGCTTANCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGANGG-

>T4--06-061--UIC-80376918

133

AACTTCTGCGNNNCATCTGCCAAGCCATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGAC

GATCAGATNCCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAA

ACACCACCATCGGTGCGGTCGTCCTTGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGG

TGGCACCGGTGAATGACTCCCCTAGCAGCTTGNGAGA-

>T4--W06-229--UIC-80376918

CAAGGCTGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGACTACCGTCGTAGTC

TTAACCATAAACGATGCCGACCAGCGATTANGAGACGTTGAATACAAAACACCACCATCGGTGCGGTC

GTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTANCCCGGTGGCACCGGTGAATGACTC

CCCTANCAGATTGTGAGAA---

>T4--06-069--UIC-80381692

TTTGAAGGACAACTTCTGCGAAGCATCTGCCAAGNCATGTTTTCATTAATCAAGAACGAAAGTTAGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGG

CTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAA-

>T4__06-073

AACTGATGATTACTTCTGCGAAGCATCTGCCAATCGATGTTTTCATTAATCAAGAACGAAAGTTACGG

GGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACG

TTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCTCGGTTTCGGCCGGGGCGCGGGGAC

GGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGTTGATCGTGCCCCCAAC

TATCCCTATTAATCATTACCCAGTCCTCCGGCTGCCAATCGAACCAACTGAAAATAGGAGGACAGGGT

CCTATTCCATTATCCCATGCTATTGGATTCGGGGGCAGAAAATGGGATCTGCCTGCTTTGAACACTCT

AATTTTTTCACGGTAAACGATCTGGGCC-

>T4--07-047(2)-UIC-80421141

ACNNATNTGGGAANACNCNAACTTCCTGCNTNTGCATGCTGCCACCGNATGTTTTCATTAATCAAGAA

CGAAAGTTAGGGGATCGAAGACGATCAGCATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGC

134

GATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCGGTCCTTCACGGG

GCCGGCGCGAGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAA-

>T4--07-069-UIC-31905185

ATCATGACGATTACTTCTGCGAAAGCATCTGATAGGATGTATGGTCATTAATCAAGAACGAAAGTCAG

GGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGAC

GTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTGTCTCGGCTTCACGGCCGGGGCGCG

CGAGGGCGGTTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAAAAATATTAAT

GCCCCCAACTTTCCCTATTAAACAATACCCTAGCCCCGCCCCGCCAAAATTATATGTATATTTG

>T4 07-072

AAACTGATGATTACTTCTGCGAAAGCATCTGCCATCGGATGTTTTGCATTAATCAAGAACGAAAGTTC

AGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAG

ACGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGG

CGCGGGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAA-

>T4 07-072b

TTCTGATGATTACTTCTGCGAAGCATCTGCCTCGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGG

ATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTT

GAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGCGCGG

GGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAA-

>T4--07-075--UIC-80444974

TCTGACGATTACTTCTGCGAAGCATCTGCCAGGATGTTTGGCATTAATCAAGAACGAAATTTAGGGGA

TCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTG

AATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTTTCGGCCGGCGCGGGGGCGGCTTAG

CCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGAAAGATAGGGCCCCCAACTATCC

CTATTTAATCCTTACCCTAGTCCTCCCGCTGCCCAAACCCACGGAAAATAGGTAGTATTGGGCCCTTT

TCCTTTACCCCTCCTTTTTTATTCGGGGGGGGGAGAGTGGGGCTGCCTGCTTTGAACACTCAATTTTT

135

TTCCCCGAAACCATTTGGGGCAAATCTCATACCTGCTAAGGGAGTCAGCCCCGCCCCCACCGGGGCCG

>T4--07-076--UIC-80448302

AAAAATGGAGGATTAACTTCTGCGAAGCATCGATAGGATGTTAGAAAATAATCAAGAACGAAAGTTCA

GGGGATCGAAGAAAATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCCATTAGGAGA

CGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGC

GCGGGGGCGGCTTAACCCGGGGGCAACGGTGAATGACTCCCCTAGCAACTTGTGAGAA-

>T4__08-005

AAATGAGATTACTTCTGCGAAAGCATCTGCCATGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGG

ATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTT

GAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTTTCTGCCGGGGTGCGGGGACGG

GTTAGGCCGATGGCACCGGTGAATGACTCCCCTACCCCCTTGTGATAAGGAGAAGGTCGTGTTCGGTG

AACGTGGATGGGGGCGGTCGGGACGGTGAGAGGATGTCCGTTTGCCCCACCTCCTCACTTTT-

>T4--W06-050--UIC16-06-037

ATGTTTTCATTAATCAAGAACGAAAGTTAGGGgaTCGAAGACGATCAGATACCGTCGTAGTCTTAACC

ATAAACGATGCCGACCAGCGATTAgGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTT

GGCGTCtGtcTTTCGGGgCCGGCGCGGGGgCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAG

CAGCTTGtGAGAA-

>T4--W06-064-06-040--UIC-146

GAAnAGGACCCTGCCCTCCTATTTTCAGTTGGTTTTGGCAGCGCGAGGACTAGGGTAATGATTAATAG

GGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTGGATTTATGAAAGATTAACTTC

TGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAG

ATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCA

CCATCGGTGCGGTCGTCCTTGGCGTCTCGGTTnTTCnCGGGGCCCGGGCnTGG-

>T4--w06-087

136

TTCTGATGATTACTTCTGCGAAGCATCTGCCCAGGATGTTTTCATTAATCAAGAACGAAAGTTCAGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGGCG

GCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGAGAAGTGTTCCG-

>T4--W06-087-06-039--UIC-86

GAAAGTTAGGGGNTCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGA

TTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCG

GCGCGGGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGATGGCCCAGA

TCGTTTACCGTGAACGAN-

>T4_-W06-087-06-039_(TW)

CGATACCnGTCGTAGTCTTAACCATAAACGATGCACGACCAGCGATTAGGAGACGTCTGAATACAAAA

CACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGGCGGCTTAGCCCGG

TGGCACC-

>T4--W06-100

ATCTGACGATTACTTCTGCGAAAGCATCTGCCTAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGCGCG

GGGGTGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGAGAGAAGGC-

>T4--W06-129_06-036

GGCnAACGGAnGCGGACCCTGCCCCTCCTnCCnTCAGTTGGTTTTGGCAGCGCGAGGACTATTGGTAA

TGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCAGAGGTGAAATTCTTGGATTTATGAAA

GATTAACTTCTGCGAAAGCTTCTGCCAAGGATGTTTTCGTTAATCAAGAACCAAAGTTAGGGGATCGA

AGACnATCAGnTACCCGTCGTGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATA

CAAAACACCC-

>T4__W06-129_06-047_(TW)

137

TGTTTTATAATCAAGAACGAATGTnCGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATA

AACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGC

GTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAG

C-

>T4__W06-129_06-047

TGTTTTATAATCAAGAACGAATGTnCGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATA

AACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGC

GTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAG

C-

>T4--W06-140

CGAAGCANCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGATA

CCGTCGTAGTTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACC

ATCGGTGCGGTCGTCCTTGGCGTCTNNGNNNTTCANGGNNCCNGNGCGCGGGGGTGGCTTAGCCGGGT

GGCGCCGGTGAATGACT-

>T4 C06-052

AGAACCAACTTCTGCGAATGCATCTGCCAAGGCATGTTTTCATTAATCAAGAACGAAAGTTAGGGGAT

CGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGA

ATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCNGGGCCGGCGCGGGGACGGCT

TAGCCCGGTGGCACCGGTGAATGACTCCCCTANCNGCTTGTGAGATGGCCCNGNTCGT-

>T4--W06-145--06-046--UIC-183

CATCTGCCCAGGATGTTTTCATTAATCAAGAACGAAAGTTTGGGGATCGAAGACGAnCAGATACCGTC

GTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGT

GCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGGTGGCACCGGTGAA

TGACTCCCCTAGCAGCTTGT-

>T4--W06-145-06-046--UIC

138

TNCGGGAGAGANAACTCAAGAGANGCGNCTGCTAGGATGTTTTnATTAATCAAGAACGAAAGTCNTNG

GGATCGAAGACGANCAGATCCGTCGTAGTCTTAACCATAAACGATGCCGACNNGCGATTAGGAGACGT

TGAATACAAAACACCNCCATCGGNGCGGTCGTCCNTNGGGGTNTGGGCC-

>T4__W06-146-06-045--UIC-143

CAGGGCGnCAGGGnGCGGCCCCCGCCCTCCTCCCTTCAGTTGGTTTTGGCAGCGCGAGGACCnnGGTA

ATGATTAATAGGGATAGTTGGGGGCATTAATATTTAATTGTCGGAGGTGAAATTCTTGGATTTATGAA

AGATTAACTTCTGCGAnnnCATCTGCCAnGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCG

AAGAnGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAAT

ACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTA

GCCCGGTGGCACCGGTGAATGACTCCCCTAGCA-

>T4--W06-168

TGNNTNTNAGAGGGGCAAACNNTGANNANNATANGNAAAGAANGAAAGCCNATCTGTTTTNNNAGAAG

ANCANANACCGTCGAAGNNGGAAGCCGACCAGCGANTANNAGANGTAGNATACAAAACACCACCATCG

GCGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGGCGGCTTATCCCGGTGGCACCNGTG

AATGANTNNNCTAGCAGN-

>T4--W06-174

GNATGTTTTCATTAATCAAGNAACGAAAGTTAGGGGATCGAAGACGATCAGCNTACCGTCGTAGTCTT

AACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCGT

CCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGGTGGCACCGGTNAATGACTCCC

CTAGCAGNTTGTGAGAAG-

>T4--w06-174b

GNATGTTTTCATTAATCAAGNAACGAAAGTTAGGGGATCGAAGACGATCAGCNTACCGTCGTAGTCTT

AACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTCGT

CCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGGTGGCACCGGTNAATGACTCCC

CTAGCAGNTTGTGAGAAG-

>T4--W06-174c

139

AAGTGTAAGATTATCTTCTGCGAAGCATCGAATCTAGGATGTTAGAGAATTAATCAAGAACGAAAGTT

CAGGGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGA

GACGTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGG

GGACGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAG-

>T4--w06-192

CATGNTGCACANCNNATGTTTTCATTAATACAAGAACGAAAGTTANGGGATCGAAGACGATCAGCTAC

CGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCAT

CGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTANCCCGGTGGCACCGG

TGAATGACTCCCCTAGCAGNTTGTGAGAAATCATAAGTCTTTGGGTTCCGGGGGGAGTATGGTCGCAA

GGCTGAAACTTAAAGGAATTGACGGAAGGGCACAT-

>T4--W06-194-892

ACTTCTGCGTNTNTATCTGCCAANCATGTTTTCATTAATCAAGAACGAAAGTTAGGGTTTTCGAAGAC

GATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTANGAGACGTTGAATACAAA

ACACCACCATCGGCGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGGCGGCTTAGCCCG

GTGGCCCCCGTGAATGANTTNCCTAGCAGGTTGTGAGAAATCATAAGTCTTTGGGTTCCGGGGGGAGT

ATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTGGAGCCTGCGGCTTA

ATTTAACTCAACACGGGGAAACTTACCAGGTCCNGACATANNTNNGGATTGACAGGATTGATAGNTCN

TTTCTTGANNTANATGGGGNGGGGGNNGN-

>T4--W06-194-crn5

GCGATTTTATCTGCAAANCCATGTTTTCATTAATCAAGAACGAAAGTTAGGGGNTNGAAGACGATCAG

ATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCA

CCATCGGCGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGGCGGCTTAGCCCGGTGGCA

CCCGTGAATGACTCCCCTAGCAGCTTGTGAGAAATCATAAGTCTTTGGGTTCCGGGGGGAGTATGGTC

GCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACACNCCCTCCNTCC-

>T4--w06-194

140

ATTATGAGATTGCTTCTGCGAAAGCATCTGCCCAGGATGTTTTCATTAATCAAGAACGAAAGTTCAGG

GGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACG

TTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGGC

GGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGG-

>T4--W06-202

CTTCTGCGAAAGCATCTGATAGGATGTTTTCATTAATCAAGAACGAAAGTCAGGGGATCGAAGACGAT

CAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACA

CCACCATCGGCGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGGCGGCTTAGCCCGGCC

GCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGA-

>T4--W06-207-crn5

AACTTCTGCGTTTTCAANCCATGTTTTCATTAATCAAGAACGAAAGTTAGGGNTTCGAAGACGATCAG

ATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCA

CCATCGGTGCGGTCGTCCTTGGCGTCTCGGTTTCGGCCGGGGTGCGGGGACGGCTTAGCCCGGTGGCC

CCNGTGAATGANTCCCCTAGCAGNTTGTGAGAAATCATAAGTCTTTGGGTTCCGGGGGGAGTATGGTC

GCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACAN-

>T4__W06-207a

TATAAAAAAATAACTTCTGCGAAGGTCTGCATCGATGTTTTCATAAATCAAGAACGAAAGTTTCGGGA

TCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTG

AATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTTTCGGCCGGGGTGCGGGGACGGC

TTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAATCATAAGTCTTTGGGTTCCG

GGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACAATTT

>T4--W06-207-892

TTTTATNTGNAAGNATGTTTTCATTAATCAAGAACGAAAGTTAGGGGNTCGAAGACGATCAGATACCG

TCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCG

GTGCGGTCGTCNTTGGCGTCTNGGTTTCGGCCGGGGTGCGGGGACGGCTTAGCCNGGTGGCCCCCNTG

141

AATGATTNNTNTAGCNGGTNGNGAGAAATCATANGTCTTNGGGTTCCGGGGGGANTATANGTNTCAAG

GNTNANANTNAAAGGAATTGACGNAANGGCA-

>T4--W06-212B

CCACCNATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGACTACCGTCGTAGT

CTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGCGCGGT

CGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGCGCGGGGGCGGCTTANCCCGGTGGCTCCTGTGA

ATGACTCCCGTGGCAGCTTGTGAGA-

>T4--W06-216-CRN5

ANACNTGGNGGNNNACTTCTGCGTTTTNATCNGCCAANGCTGTTTTCATTAATCAAGAACGAAAGTTA

GGGNNTCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGA

CGTTGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGC

GCGGGGGCGGCTTANCCCGNCGGCACCGGTGNNTGACTCCCNTNGNAGNTTGTGAGAAATCATAAGTC

TTTGGGTTCCGGGGGGAGTATGGTCGCAAGGCTGAAACTTAAAGGAATTGACAGAAGGGCACANC-

>T4--W06-216-892

ACTTCTGCGTTTTTATCTGCCAACCATGTTTTCATTAATCAAGAACGAAAGTTAGGGNTTCGAAGACG

ATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAA

CACCACCATCGGCGCGGTCGTCCTTGGCGTCTNGGTCCTTCANGGGGCCGGGGCGCGNGGGCGGCTTA

ACCCCCCNGCACCNGTNANTGACTCCCGTNGGAGNTTGTGAGAAATCATAAGTCTTTGGGNTCCNGGG

GGAGTATGGNNGCAAGGCTGAAACTTAAAGGAATTGACGGAAGGGCACCAACACGAGTGGAGCCTGCG

GCTTAATTTGACTCAACACNGGGAAACTTACCAGGTNCGGANATNGNAAGGATTGNCANATTGATAGC

TCTTTCTTTGATTCCTNTGGGGTGGNGGTG--

>T4--W06-221B

CAACCATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGACTACCGTCGTAGTC

TTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACCATCGGTGCGGTC

GTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGGTGGCACCGGTGAATGACTC

CCCTAGCAGCTTGTGAGA-

142

>T4--w06-268

TTGCATGCTGCCACCGNATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGACGATCAGCAT

ACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAATACAAAACACCACC

ATCGGTGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGACGGCTTAGCCCGGTGGCACC

GGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCCCNGNTCGTTN-

>T4 w07-024

AACTGATGATTACTTCTGCGAAGCATCTGCCATCGGATGTTTTCATTAATCAAGAACGAAAGTTAGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTCGGTCTTTCGGGGCCGGCGCGGGGGCG

GCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCCCAGATCGTTTACCGT

GGATGCGGACGGGCGGGGCGGCTTAGAGGGTGGTGATGACTGAGCGGGTTTCTGTTTGTCTTCGATCC

CCCAACTTTCGTTCTCCATTCATGTAAACATCCTTGGGAGGTGGTTTCGCTCCCAATTTTAAAAACTC

TAATTTTTTTCCCGCAAAAAATCTGGGGAAAGATCCAACAAGCTGCTAGGGGAGTCATTCCATCTAAA

CGGTTGGGGGGATAGTTTCCTG-

>T4 w07-036

AAAATGCAGATTAACTTCTGCGAAAGCATCTGCATCGATGTTTTCAAATAATCAAGAACGAAAGTTCG

GGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGAC

GTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGCG

CGGGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCGATCGTTT

ACGGAGGGGGGCGGTTGCCTTTTTTTTTTTTTT-

>T4 w07-070

AACTGACGATTACTTCTGCGAAGCATCTGCCACGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGG

ATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTT

GAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGCGCGG

GGGTGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCCCAGATCGTTT

ACCGTGAATGGGTGTTTGGTGACCCGGTTTTTTGCGCC-

143

>T4 w07-131

AATCTGAGATTACTTCTGCGAAAGCATCTGCCACGGATGTTTTCATTAATCAAGAACGAAAGTTAGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGCGCG

GGGGCGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCCCAGATCGTT

TACCGTGAACGAGGTGGCCGGTGGAGAGGTCCAACTTTTT-

>T4__W07-131

ATGAGATTACTTCTGCGAAGCATCTGCCATGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATC

GAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGTTGAA

TACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTCCTTCACGGGGCCGGGGCGCGGGGG

CGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTAGCAGCTTGTGAGAAGGCCCAGATCGTTTACC

GTGAATGCGGCCGGCCCCGGTTGGTTAGAAGGACTGGATCCTTTACCATTTTGAAAGAGGACGGAGAT

GTTTTATTCCCATTGCCCCTGAAGGGCGGGGGGGGGGGAAAAATTAAACCGCCCTGCTTTAAACCCCC

AATTTTTCCCCCGAAACGGTCTGGGGGAAACTCCAAATGGTGCAGGGGAGTTGTCCAATTAA

>08-004 mixed

ATTCTGTCGATTACTTCTGCGAAGCATCTGCCCAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTTTCTGCCGGGGTGCGGGGACG

GCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTACCCCCTTGTGAGAAGGAGAAGGTCG-

>07-095(2) mixed

TAACTGATGATTACTTCTGCGAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTTGTCCGCTTCCCGGGTGGGGGCGCGAG

GGGGGGGTATCCCGGGGGGGCCCGTGAATGTCTCCCCTCTCACCTTGTGAGAAAAGGCCGAGAGTGTT

CCGTGTATACGGGTGCCCCCGGTCGTTTATAGGGGAAAGATCGCCTATTTTTTTTAGAAACGGCCCAC

ACCGCCCCTTTCCCCTTTTCCCGGGGAGGGGGGGGGGGGGGGGAAAAAAAAAAATCCCCCCTTTTAAA

144

ACCCTCATTTTTTTCCGCGGGAGAGGTTTTGGAAAAATCTACAATGCTTTGAGGGGGAGACTCGCCCT

CCCACAAATTTTGGGAGGATTTTTTGTTTCTTATCGATTTCTCCCCCCCACCATCCCCACACACAAAA

AACACACCCCACAAAAGAGC---

>07-095 mixed

AGAGGAGAGGGCTCGGAAGGATCGGCATGTCGAAATCGTGGGACGAAGTCGGGGATCGAGAAGAAGAA

ATCAGATACCGTCGTAGTCTTAACCATAAACATGCCGACTTCCGATTAGGAGACGTTGAATACAAAAC

ACCACCATCGGCGCGGTCGTCCTTGGCGTTGTCGGCTTCACGGTGGGGGCGCGAGGGCGGATAGCCCC

GTGGACGTGAATGAT-

>07-095b mixed

TACTGATGATTACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGG

GATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGACGT

TGAATACAAAACACCACCATCGGCGCGGTCGTCCTTGGCGTTGTCCGCTTCCCGGGTGGGGGCGCGAG

GGGGGGTTATCCCGGGGGGGCCCGTGAATGACTCCCCTATCACATTGTGAGAAAAGGCCGATCGTTTT

CCGTGTATACGGCTGCCCCCGATTTTTTAGAGGGGACAGATCTCTTATTTTGTATCGCGACGGCCCCC

ACGGGTTCCAACGCTAATATCTGGTGCGGGGGGGGGGGGGGGGAAAAAAAAAGAACCCCCCCCTTAAA

AACCCCAAAATTATTTCGGGGGGGGGAGTTGGCAAGATCACACAAGCTGGCAGGGGAGACACCCCCCC

CAACC--

>08-004b mixed

TATCTGATGATTACTTCTGCGAAAGCATCTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTCTAG

GGGATCGAAGACGATCAGATACCGTCGTAGTCTTAACCATAAACGATGCCGACCAGCGATTAGGAGAC

GTTGAATACAAAACACCACCATCGGTGCGGTCGTCCTTGGCGTCTCGGTTTCTGCCGGGGTGCGGGGA

CGGCTTAGCCCGGTGGCACCGGTGAATGACTCCCCTACCCCCTTGTGATAAGGAGAAGATCGTGTTCG

GTGAATGTGGATGGCGCCGGCCGGTGACGGTGACAGGATCTTATACCTTTATTTATTACGGTCATCAC

CAATTCTTATAAAAAATTATTGCAAAAAGAGGGGGGGGGGGGGGGAAAAAAAAAAGTATAACAAAATA

ATTAAAGGGGGGGGGGTTATAGAGTCAAGATACGATGTTGGACACCCACAA

145

APPENDIX G: COPYRIGHT PERMISSION

146

147

148