Filogenia molecular, delimitação de espécies, desenvolvimento inicial e história evolutiva do gênero Echinaster (Asteroidea:Echinodermata)

Elinia Medeiros Lopes

Rio de Janeiro 2016 i

Filogenia molecular, delimitação de espécies, desenvolvimento inicial e história evolutiva do gênero Echinaster (Asteroidea:Echinodermata)

Elinia Medeiros Lopes

Tese apresentada ao Instituto de Biologia da Universidade Federal do Rio de Janeiro, como parte dos requisitos necessários à obtenção do título de Doutor em Ciências Biológicas na área de Biodiversidade e Biologia Evolutiva.

Orientador: Dr. Carlos Renato Rezende Ventura Co-orientador:Dr. Paulo Cesar de Paiva

Rio de Janeiro 2016

ii

Banca examinadora:

______Dra. Michelle Regina Lemos Klautau (Presidente) Departamento de Zoologia/Universidade Federal do Rio de Janeiro

______Dra. Haydée Andrade Cunha Departamento de Oceanografia biológica/Universidade do Estado do Rio de Janeiro

______Dr. Anderson Vilasboa de Vasconcellos Departamento de Genética//Universidade do Estado do Rio de Janeiro

______Dr. Marcelo Weksler Fundação Oswaldo Cruz, Instituto Oswaldo Cruz

______Dr. Fábio Bettini Pitombo Departamento de Biologia Marinha/Universidade Federal Fluminense

______Dra. Leila Maria Pessôa (Suplente) Departamento de Zoologia/Universidade Federal do Rio de Janeiro

______Dr. Cristiano Valentim da Silva Lazoski (Suplente) Departamento de Genética//Universidade Federal do Rio de Janeiro

Rio de Janeiro 2016 iii

Ficha Catalográfica

Lopes, Elinia Medeiros Filogenia molecular, delimitação de espécies, desenvolvimento inicial e história evolutiva do gênero Echinaster (Asteroidea:Echinodermata). 111p.

Tese de doutorado em Biodiversidade e Biologia Evolutiva, 2016.

1. Echinodermata. 2. Asteroidea. 3. Variação morfológica. 4. Filogenia. 5. Filogeografia 6. Genética populacional 7. Desenvolvimento inicial.

I – Ventura, Carlos Renato Rezende. II. Universidade Federal do Rio de Janeiro III – Doutorado

Rio de Janeiro 2016 iv

Agradecimentos

Aos meus pais e irmãos por todo amor, apoio e incentivo. Ao Bruno, pelo companheirismo e apoio em todos os momentos. Obrigada por estarem ao meu lado sempre. Aos orientadores Renato Ventura e Paulo Paiva pela orientação, dedicação e confiança no meu trabalho. Por toda amizade e carinho durante esses anos que estamos trabalhando juntos e também pelo estímulo e colaboração ao meu enriquecimento profissional e pessoal. A Rocío Pérez-Portela, orientadora durante o doutorado sanduiche na Espanha, pela contribuição ao trabalho e todo aprendizado que tive durante o período de estágio. Agradeço ao CEAB (centro de estudos avançados de Blanes-Espanha), em especial Xavier Turon, pelo acolhimento e todo suporte dado durante o estágio sanduiche. Agradeço todos que me contribuíram com o envio e coleta de amostras para o desenvolvimento deste trabalho: Dr. Gustav Paulay (Florida Museum of Natural History/USA), Dr. Timothy O'Hara (Museum Victoria/Austrália), Dr. Bernard Picton (National Museums of Northern Ireland/Irlanda), Dr. Francisco A Solis Marin e Mrs. Carolina Martín (Instituto de Ciencias del Mar y Limnologia/México), equipe do projeto Coral Vivo pelas amostras de Arraial'dAjuda, Nataly Slivak pelas amostras de Florianópolis e Anne Gondim pela ajuda na coleta em João Pessoa. A toda equipe do laboratório de Echinodermata e Polychaeta, por toda ajuda na elaboração da tese e pelo ótimo relacionamento que mantemos no laboratório e que torna o trabalho muito agradável. Um agradecimento especial a Mariana, Bárbara, Alanna, Marcela, Fernanda, Monique, Carlos, Victor e Gustavo, companheiros de trabalho e grandes amigos que conquistei e que certamente estarão para sempre no meu coração. Obrigada pela ajuda e apoio durante o doutorado e pelas conversas diárias, gargalhadas, fofocas, desabafos emocionais, cervejas no china e mangue. Com vocês o trabalho se torna muito mais prazeroso. A todos outros os amigos que me acompanharam nesse período e que me deram força, nos momentos tristes e felizes. Obrigada a todos! Ao programa de Pós Graduação em Biodiversidade e Biologia Evolutiva pelo suporte ao longo do doutorado, disciplinas e pelas sugestões e correções durante os seminários de avaliação interno e exame de qualificação. Em especial a Dr. Cristiano Lazoski, Dr Joana Zanol, Dr Cláudia AM Russo, Dr Daniela M Takiya, Dr Antônio M Solé- Cava pelas sugestões no artigo referente ao capítulo 1 desta tese. Ao CAPES pela bolsa de doutorado e ao projeto CAPES-DGU pela bolsa de doutorado Sanduiche.

v

Índice Resumo ------1 Introdução Geral ------2 Referências ------6 Capítulo 1 - The molecular phylogeny of the sea star Echinaster (Asteroidea: 7 Echinasteridae) provides insights for genus taxonomy ------Abstract ------9 Introduction ------9 Materials and Methods ------11 Sampling------11 DNA extraction, amplification and alignment ------12 Phylogenetic analysis ------13 Results ------15 Sequences ------15 Phylogenetic analysis ------15 Discussion ------18 Acknowledgments ------21 References ------22 Capítulo 2 - Incipient speciation revealed by morphological, morphometric and genetic approaches: a study case in sea stars Echinaster (Othilia) along the Brazilian coast ------49 Abstract ------51 Introduction ------51 Material and Methods ------54 Samples------54 Geometric morphometrics ------55 Morphological character analysis ------55 DNA extraction, polymerase chain reaction (PCR), sequencing and alignment ------56 Phylogenetic analysis and genetic distance ------56 Phylogeographic analysis ------58 Population and demographic analysis ------59 Results ------59 Morphometric geometrics ------59 Morphological analysis ------60 Phylogenetic analysis ------62 Phylogeographic analysis ------62 Population and demographic analysis ------63 Discussion ------65 Conclusion ------68 Acknowledgments ------69 References ------69 Capítulo 3 - Development of the sea star Echinaster (Othilia) brasiliensis (Asteroidea:Echinasteridae): a comparative analysis making inference about the 91 evolution of developmental modes and skeletal plates in Asteroidea------vi

Abstract ------92 Introduction ------93 Material and Methods ------95 Results ------95 Discussion ------97 Acknowledgments ------101 Literature Cited ------101 Considerações finais ------110

Índice de figuras

Capítulo 1

Figure 1 ------34 Figure 2 ------35 Figure S1------44 Figure S2 ------45 Figure S3 ------46 Figure S4 ------47 Figure S5 ------48 Capítulo 2

Figure 1 ------74 Figure 2 ------75 Figure 3 ------76 Figure 4 ------77 Figure 5 ------78 Figure 6 ------79 Figure 7 ------80 Figure 8 ------81 Figure 9 ------82 Figure 10 ------84 Capítulo 3

Figure 1 ------105 Figure 2 ------106 Figure 3 ------107 Figure 4 ------108 Figure 5 ------109 Figure 6 ------109

vii

Índice de tabelas

Capítulo 1

Table 1 ------36 Table 2 ------36 Table S1------37 Table S2 ------40 Table S3 ------40 Table S4------41 Table S5------43 Capítulo 2

Table 1 ------84 Table 2 ------85 Table 3 ------85 Table S1 ------87 Table S2 ------88 Table S3 ------89 Table S4 ------90 Capítulo 3

Table 1 ------104

1

Resumo

O objetivo principal deste trabalho foi contribuir e ampliar o conhecimento do gênero de estrela do mar Echinaster com relação às questões sistemáticas, filogenéticas, ontogenéticas e evolutivas. Para tal, foram utilizadas diferentes abordagens morfológicas (morfologia tradicional e morfometria), genéticas (utilizando genes mitocondriais e nucleares) e o estuudo do desenvolvimento larval e de juvenis. Os resultados indicaram o não monofiletismo do gênero Echinaster e sugeriram a revalidação do subgênero Othilia como gênero. Os dados morfológicos não corroboraram os resultados das análises genéticas, demonstrando que os caracteres morfológicos utilizados na taxonomia do grupo não são robustos. Os resultados indicam que a grande variabilidade morfológica observada é resultado de plasticidade fenotípica.

Os dados moleculares indicaram recente expansão populacional e um processo de especiação incipiente entre as duas linhagens delimitadas geneticamente ao longo da costa brasileira. O modo de desenvolvimento larval e de juvenis de E. (O.) brasiliensis é semelhante ao descrito para outras espécies do gênero, produzindo uma larva braquiolária lecitotrófica com curto período no plâncton. Estes resultados levantam a hipótese que este padrão se manteve conservado ao longo da história evolutiva deste grupo. Por fim, o crescimento das placas esqueléticas no juvenil de Echinaster são homólogos aos Asteroidea não-Paxillosidas.

2

Introdução Geral

As espécies de estrelas do mar do gênero Echinaster Müller & Troschel, 1840 têm distribuição tropical ocorrendo desde águas rasas até regiões mais profundas da plataforma continental ao longo dos oceanos Atlântico, Pacifico e Índico (Clark &

Downey 1992). São consideradas euritópicas, ou seja, capazes de tolerar uma vasta gama de habitats ou de condições ecológicas (Turner 2013). Apresentam relevante papel ecológico nas comunidades marinhas e podem ser encontradas em costões rochosos, fundos de sedimento lamoso ou arenoso e até mesmo em regiões de manguezais. A maioria das espécies de Echinaster, cujo ciclo de vida é conhecido, são gonocóricas e se reproduzem anualmente por fertilização externa (Turner 2013). Produzem larvas braquiolárias pelágicas e lecitotróficas de curta duração (Atwood 1973; Sidall, 1979;

Watts et al. 1982; Turner 2013). Contudo, ovos demersais foram descritos para as espécies E. (O.) graminicula Campbell & Turner, 1984 e E.(O.) sentus Say, 1825

(Atwood 1973; Sidall 1979). Reprodução assexuada por autotomia dos braços foi observada apenas para E. luzonicus Gray, 1840 (Clark & Downey 1992).

O gênero Echinaster pertence à família Echinasteridae Verrill, 1870, única família da ordem Spinulosida. A família é composta por oito gêneros. Há uma desproporcionalidade na diversidade de espécies entre os gêneros de Echinasteridae quando comparada a outras famílias de Asteroidea (Mah & Blake 2012). Os gêneros

Echinaster (30 espécies) e Henricia (90 espécies) juntos possuem 90% do total conhecido de espécies para a família. Estudos recentes reconstruíram Echinaster e

Henricia como gêneros-irmãos (Feuda & Smith 2015). Entretanto, outros gêneros da família não foram incluídos nestes estudos. A única filogenia existente para Echinaster foi proposta por Fontanella & Hopkins (2003) que sugeriram uma possível parafilía para o gênero no Atlântico, com base em alguns caracteres morfológicos. De acordo 3

com este trabalho, as espécies do subgênero Echinaster (Othilia) formaram um clado monofilético, grupo irmão do clado formado por Echinaster (Echinaster) sepositos

Retzius, 1783 e Henricia sanguinolenta O.F. Müller, 1776..

Atualmente, o gênero Echinaster está representado por 30 espécies válidas, sendo 12 destas distribuídas pelo oceano Atlântico. Clark (1987) classificou dois subgêneros: Echinaster (Echinaster) e Echinaster (Othilia), entretanto, esta divisão em dois subgêneros foi proposta apenas para as espécies do Atlântico. As espécies do Indo-

Pacífico permaneceram classificadas apenas dentro do gênero Echinaster. No litoral brasileiro são distinguidas três espécies: E. (Othilia) guyanensis Clark, 1987, E.

(Othilia) echinophorus Lamarck, 1816, que ocorrem nas regiões norte e nordeste, e E.

(Othilia) brasiliensis Müller & Troschel, 1840, que se distribui nas regiões sul e sudeste. A região do Cabo Frio é considerada um local de borda de distribuição, ou seja,

é o limite meridional de distribuição de E. (O.) echinophorus e E. (O.) guyanensis, e o limite setentrional de distribuição de E. (O.) brasiliensis (Clark & Downey 1992). A região do litoral do Espírito Santo já foi considerada um cinturão híbrido entre E. (O.) echinophorus e E. (O.) brasiliensis (Avila-Pires 1983), devido à grande sobreposição dos caracteres morfológicos. Posteriormente, os indivíduos desta região foram classificados como E. (O.) guyanensis (Clark 1987). Outras cinco espécies já foram descritas para costa do Brasil, todas posteriormente sinonimizadas como E. (O.) brasiliensis (Clark & Downey 1992; Gondim et al. 2014).

A grande instabilidade taxonômica dentro do gênero Echinaster, assim como na família Echinasteridae, pode ser atribuída à grande variabilidade morfológica existente tanto dentro das populações como entre populações, e ausência de bons caracteres diagnósticos (Atwood 1973; Scheibling & Lawrence 1982; Watts et al. 1982; Campbell

& Turner 1984; Clark 1987; Clark & Downey 1992; Ringvold & Stien 2001; Eernisse 4

2010). Muitos casos de sinonímia já foram registrados tanto entre espécies quanto entre gêneros e famílias (de acordo com a base de dados WoRMS – World Register of Marine

Species). Destes, 53 casos foram registrados somente para as espécies de Echinaster. As controvérsias taxonômicas em relação a espécies de Echinaster gera dificuldade para identificação durante levantamentos faunísticos (Gondim et al. 2014). A destruição de hábitats, os poluentes, a captura predatória e a falta de conhecimento básico sobre as espécies de Echinaster brasileiras resultaram na sua inclusão na Lista de Espécies

Ameaçadas de Invertebrados Aquáticos do Brasil (Amaral & Leite 2008).

O objetivo deste trabalho foi ampliar o conhecimento do gênero Echinaster com relação as questões sistemáticas, filogenéticas, ontogenéticas e evolutivas. O trabalho está organizado em três capítulos apresentados sob forma de artigo. O primeiro capítulo intitula-se "The molecular phylogeny of the sea star Echinaster (Asteroidea:

Echinasteridae) provides insights for genus taxonomy” e teve como objetivo o estudo das relações filogenéticas entre as espécies de Echinaster por meio de dados moleculares. Foram utilizadas 14 espécies representativas do gênero Echinaster distribuídas ao longo dos oceanos Atlântico, Pacífico e Índico. Adicionalmente, cinco espécies do gênero irmão Henricia foram contempladas com o objetivo específico de testar hipóteses de monofiletismo do gênero Echinaster. As análises filogenéticas foram realizadas utilizando dois genes mitocondriais (COI e 16S) e um gene nuclear (28S).

O segundo capítulo intitula-se "Incipient speciation revealed by morphological, morphometric and genetic approaches: a study case in sea stars Echinaster (Othilia) along the Brazilian coast" e teve como objetivo principal a elucidação de questões taxonômicas e da história evolutiva destas importantes espécies de estrela do mar do litoral brasileiro, especialmente devido à sua abundância e ao seu papel regulador nas comunidades de invertebrados marinhos. Nesta investigação são combinadas técnicas 5

morfométricas para a identificação objetiva de formas distintas, aspectos da taxonomia tradicional e variações genéticas (utilizando os genes mitocondriais COI e 16S) das três espécies do gênero ao longo do litoral brasileiro. Análises morfológicas, morfométricas, filogenéticas, filogeográficas, de genética populacional e demografia histórica foram realizadas buscando um maior entendimento dos padrões e processos da história evolutiva do grupo.

O terceiro artigo intitula-se " Development of the sea star Echinaster (Othilia) brasiliensis (Asteroidea:Echinasteridae): a comparative analysis making inference about the evolution of developmental modes and skeletal plates in Asteroidea" e teve como objetivo descrever o desenvolvimento inicial da espécie Echinaster (Othilia) brasiliensis e fazer inferências quanto a questões relacionadas a dispersão da espécie e aspectos evolutivos dos modos de desenvolvimento larval e homologia do arranjo das primeiras placas esqueléticas no juvenil.

6

Referências

Amaral, A. & Leite, F. (2008) Invertebrados aquáticos. In: Livro vermelho da fauna brasileira ameaçada de extinção. (Eds A. Machado, G. Drummond & A. Pagilia), pp. 156–301. Ministério do Meio Ambiente, Brasilia-DF. Atwood, D.G. (1973) Larval development in the Asteroid Echinaster echinophorus. Biol Bull, 144, 1–11. Avila-Pires, T.C.S. (1983) Contribuição ao estudo do gênero Echinaster Müller & Troschel, 1840 (Echinodermata:Asteroidea) no litoral Brasileiro. An. Academia Brasileira de Ciências 55, 4, 431–448. Campbell, D.B. & Turner, R.L. (1984) Echinaster graminicola, A new species of spinulosid sea star Echinodermata Asteroidea from the West coast of Florida. Proceedings of The Biological Society of Washington, 97, 167–178. Clark, A.M. (1987) Notes on Atlantic and other Asteroidea-Echinasteridae. Bulletin of the British Museum Natural History (Zoology), 53, 65–78. Clark, A.M. & Downey, M.E. (1992) Starfishes of the Atlantic. Chapman and Hall, London. Eernisse, D.J. (2010) Zootaxa, Henricia pumila sp. nov.: A brooding seastar (Asteroidea)... Zootaxa, 36, 22 – 36. Feuda, R. & Smith, A.B. (2015) Phylogenetic signal dissection identifies the root of starfishes. Plos One, 10, e0123331. Fontanella, F.M. & Hopkins, T.S. (2003) Preliminary phylogeny of Echinaster (Othilia) from the Gulf of Mexico based on morphological characters (Echinodermata: Asteroidea). Echinoderm Research 2001, 91–95. Gondim, A., Lindsey Christoffersen, M. & Dias, T. (2014) Taxonomic guide and historical review of starfishes in northeastern Brazil (Echinodermata, Asteroidea). ZooKeys, 449, 1– 56. Mah, C.L. & Blake, D.B. (2012) Global diversity and phylogeny of the Asteroidea (Echinodermata). PloS one, 7, e35644. Ringvold, H. & Stien, J. (2001) Biochemical differentiation of two groups within the species- complex Henricia Gray, 1840 (Echinodermata, Asteroidea) using starch-gel electrophoresis. Hydrobiologia, 459, 57–59. Scheibling, R.E. & Lawrence, J.M. (1982) Differences in reproductive strategies of morphs of the genus Echinaster (Echinodermata: Asteroidea) from the Eastern Gulf of Mexico. Marine Biology, 70, 51–62. Sidall, S.E. (1979) Development of ossicules in juveniles of the sea star Echinaster sentus. Bulletin Marine of Science. 29, 278-282. Turner, R.L. (2013) Echinaster. In: Starfish: Biology & Ecology of the Asteroidea. (Ed. J.M. Lawrence), pp. 200–214. The Johns Hopkins University Press, Baltimore. Maryland. Watts, S.A., Scheibling, R.E., Marsh, A.G. & McClintock, J.B. (1982) Effect of temperature and salinity on larval development of sibling species of Echinaster (Echinodermata: Asteroidea) and their hybrids. Biological Bulletin, 163, 348–354.

7

Capítulo 1

The molecular phylogeny of the sea star Echinaster (Asteroidea: Echinasteridae) provides insights for genus taxonomy. 8

The molecular phylogeny of the sea star Echinaster (Asteroidea: Echinasteridae) provides insights for genus taxonomy.

Elinia Medeiros Lopes1,2, Rocio Pérez-Portela3,#, Paulo Cesar de Paiva4, Carlos Renato

Rezende Ventura2,*

1 Biodiversity and Evolutionary Biology Graduate program of the Federal University of Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil.

2 Laboratory of Echinodermata, Department of Invertebrates, National Museum/Federal University of Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil.

3 Marine Ecology Department, Centre for Advanced Studies of Blanes (CEAB-CSIC), Blanes, Girona, Spain

4 Laboratory of Polychaeta, Department of Zoology, Institute of Biology - CCS/Federal University of Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil.

# Current Address: Rosenstiel School of Marine & Atmospheric Science, University of Miami, 4600 Rickenbacker Cswy, Miami, FL 33149, USA

*author for correspondence: Email: [email protected] Phone: 55 21 3938-6983

Keywords: Starfish, Spinulosida, Othilia, Mitochondrial DNA, Nuclear DNA.

9

Abstract

In this study, we used sequences of two mitochondrial genes, Cytochrome c

Oxidase I (COI) and 16S rRNA, and one nuclear gene, 28S rRNA, in order to: (a) test the monophyly of the sea star genus Echinaster, and (b) understand the phylogenetic relationships among species and subgenera within this genus. Phylogenetic analyses based on Bayesian Inference and Maximum Likelihood methods revealed three clades with high values of genetic divergence among them (K2P distances over 23%). One of the clades grouped all Echinaster (Othilia) species, and the other two clades included

Echinaster (non-Othilia) species and Henricia species, separately. Despite that the relationships between Henricia, Othilia and Echinaster could not be completely clarified, the Othilia clade was a well-supported group with shared diagnostic morphological characters. Moreover, the approximately unbiased test (AU test) applied to the phylogenetic reconstruction rejected the hypothesis of the genus Echinaster as a monophyletic group. According to these results, we suggest the revalidation of Othilia as genus instead of a subgenus within Echinaster. Our study clarifies important points about the phylogenetic relationships among species of Echinaster. Other important systematic questions about the taxonomic classification of Echinaster and Henricia still remain open, but this molecular study provides bases for future research on the topic.

Introduction

Sea stars of the genus Echinaster are widely distributed across tropical and temperate waters of the Atlantic, Pacific and Indian Oceans (Mah 2015). Species of the genus are commonly found in sandy bottom and rocky shores, from shallow waters to the continental mid-shelf, and also in mangrove ecosystems (Clark & Downey 1992).

The large phenotypic plasticity of Echinaster species and its short-lived brachiolaria 10

larva, which limits its dispersal potential (Turner 2013), are two important biological factors involved in the evolutionary history of this genus.

The genus Echinaster is included within the Family Echinasteridae (Order

Spinulosida) that currently comprises eight genera (Mah 2015): Aleutihenricia Clark &

Jewett, 2010 (four species); Dictyaster Wood-Mason & Alcock, 1891 (one species);

Echinaster Müller & Troschel, 1840 (30 species); Henricia Gray, 1840 (90 species);

Metrodira Gray, 1840 (one species); Odontohenricia Rowe & Albertson, 1988 (eight species); Plectaster Sladen, 1889 (one species); and Rhopiella Fisher, 1940 (two species). The large variation in the number of species per genus shows an imbalance in species diversity within the Echinasteridae compared to other families of the Class

Asteroidea (Mah & Blake 2012). The genera Echinaster and Henricia encompass 90% of all known species of the family Echinasteridae. These two diverse genera are also the most studied, but species delimitation and taxonomic classification between species and the two genera have proven difficult (Clark & Downey 1992). Species of Echinaster and Henricia have been used as representatives of the family Echinasteridae to clarify evolutionary relationships of sea stars at the level of order and family (Blake 1987, Gale

1987, Lafay et al. 1995, Smith 1997, Knott & Wray 2000, Janies et al. 2011, Mah &

Blake 2012, Feuda & Smith 2015). These studies have shown that Echinaster and

Henricia are closely related genera, but the phylogeny within the family Echinasteridae, and the order Spinulosida still remains unclear (Feuda & Smith 2015). Only the most recent studies based on phylogenomic analyses using transcriptomes of several echinoderm groups indicated that Spinulosida is a sister group of Valvatida (Reich et al.

2015).

The large morphological variability, phenotypic plasticity, and doubtful species delimitation due to the absence of consistent diagnostic characters have contributed to 11

the persistence of many taxonomic uncertainties in the genus Echinaster, and also within the family Echinasteridae (Clark 1987, Clark & Downey 1992, Ringvold & Stien

2001). The morphological variability of Echinaster has been studied mainly for species inhabiting from the Gulf of Mexico to Brazil (Atwood 1973, Tuttle & Lindahl 1980,

Scheibling 1982, Watts et al. 1982, Avila-Pires 1983, Campbell & Turner 1984, Clark

& Downey 1992, Fontanella & Hopkins 2003, Hopkins et al. 2003, Turner 2013), but the controversy about the actual number of species within the family has been also fueled by taxonomic conclusions based on ill-preserved type specimens (Fontanella &

Hopkins 2003).

Currently, the genus Echinaster (Clark 1987) is divided into two subgenera:

Echinaster (Echinaster) and Echinaster (Othilia). However, the Indo-Pacific species of

Echinaster have not been classified within any of these subgenera. The phylogeny proposed by Fontanella & Hopkins (2003) suggested paraphyly of the genus

Echinaster. Nevertheless, this phylogeny was solely based on morphological characters and species from the Gulf of Mexico, giving therefore an incomplete picture of evolutionary relationships among species and subgenera.

The aims of our study are to evaluate the monophyly of the genus Echinaster using molecular markers, and to understand the phylogenetic relationships among representative species of Echinaster from the Atlantic, Indian and Pacific Oceans.

Materials and Methods

Sampling

Fourteen of the 30 species of the genus Echinaster from the Atlantic, Pacific and

Indian Oceans, and the Mediterranean Sea were analyzed in this study (Fig. 1). In addition, five species of the closely-related genus Henricia, from the Atlantic and 12

Pacific Oceans were also included in the dataset (see distribution details in Fig. 1).

Samples of E. (O.) echinophorus Lamarck 1816, the type species of the subgenus

Echinaster (Othilia); E. (E.) sepositus Retzius, 1783, the type species of the subgenus

Echinaster (Echinaster), and Henricia oculata Pennant, 1777, the type species of the genus Henricia, were also included in the analyses. The outgroups were selected based on results of recent phylogenomic analyses performed by Reich (2015) to obtain a better evolutionary framework for Echinaster. The species considered as outgroups were:

Luidia foliolata Grube, 1866 (Order Paxillosida); Tosia autralis Gray, 1840 and Patiria miniata Brandt, 1835 (Order Valvatida); and Odontaster validus Koehler, 1906 (Order

Valvatida).

All tissue samples were obtained from the Florida Museum of Natural History

(USA), National Museum-Rio de Janeiro (Brazil), Museum of Victoria (Australia),

National Museum of Northern Ireland (Ireland), University of Barcelona (Spain), and

Institute of Marine and Limnology Science (México). In addition, some sequences were obtained from the GenBank database (NCBI) (see details in Table S1).

DNA extraction, amplification and alignment

DNA was extracted from ethanol-preserved tissues (tube feet) using a

REDExtract-N-Amp Tissue PCR Kit (Sigma-Aldrich). Two different gene fragments of mitochondrial DNA (mtDNA), the 16S rRNA and the cytochrome c oxidase subunit I

(hereafter 16S and COI, respectively), and one nuclear fragment, the 28S rRNA

(hereafter 28S), were amplified and sequenced. Amplifications of DNA were performed using the REDExtract-N-Amp PCR Reaction Mix (Sigma-Aldrich), following the manufacturer’s protocol. Details about the primers used, and the PCR conditions applied are listed in Table S2. After amplification of the DNA fragments, the PCR 13

products were purified and sequenced using the Automated Sequencer of the

Scientific/Technics Services of the University of Barcelona (Spain), by Macrogen Inc.

(South Korea), and/or at the Molecular Biodiversity Laboratory/Federal University of

Rio de Janeiro (Brazil).

DNA sequences were trimmed and edited with MEGA version 5.05 (Tamura et al. 2011), and then aligned using the CLUSTALW algorithm as implemented in the same software with default parameters. In addition, 16S sequences were aligned using the software MAFFT through the portal CIPRES (Miller et al. 2010) with default parameters. Alignments were manually checked. We created a dataset using a Gblock run in SeaView version 4 (Gouy et al. 2010) considering less-stringent selection to avoid unsuitable sites for phylogenetic analyses. MEGA version 5.10 (Tamura et al.

2011) was also used to estimate transition/transversion ratios under the Kimura’s two- parameter model, base frequencies, and tests of homogeneity. Proportions of synonymous differences per synonymous site (dS) and non-synonymous differences per non-synonymous site (dN) for COI, using the Li (1993) and Pamilo & Bianchi (1993) method, were also calculated. The software Dambe version 5 (Xia 2013) was used to measure saturation of nucleotide sites in the COI (Xia et al. 2003, Xia & Lemey 2009).

The secondary structure of the rDNA was reconstructed using the ViennaRNA web server (Gruber et al. 2008), and the substitution rate in loop and stem regions (number of substitutions in each region/number of bases in each region) was manually estimated.

Phylogenetic analysis

Phylogenetic trees were reconstructed using the Maximum Likelihood (ML) and

Bayesian Inference (BI) methods from databases of each independent gene, and also from a dataset of concatenated sequences from different gene fragments. The 14

phylogenetic analyses were performed using a dataset partitioned by gene region without the third codon of the COI to avoid bias due to saturation at this position.

However, analyses including the third codon position of the COI were also conducted in order to verify the phylogenetic resolution among some terminal nodes. Nucleotide substitution models for each gene fragment were selected based on an Akaike information criterion (AIC) using jModelTest version 0.1.1 (Posada 2008). ML reconstructions were performed in RAxML BlackBox (Stamatakis 2014) on a partitioned dataset in the CIPRES Science Gateway (Miller et al. 2010). Node support was evaluated using 1,000 rapid bootstrap algorithms (Stamatakis et al. 2008). BI analyses were performed using the software MrBayes version 3.1.2 (Ronquist &

Huelsenbeck 2003) on a partitioned dataset of concatenated sequences. Two independent runs [each performed for four Markov-Chain Monte Carlo (MCMC) simulations] were conducted for 10 million generations, sampled every 1,000 generations, to estimate posterior probabilities. The software Tracer version 1.5

(Rambaut & Drummond 2009) was used to confirm that the effective sample size (ESS) values were above the recommended value of 200 for stability measurement. A consensus tree was calculated after excluding the first 500 trees as burn-in.

We developed the approximately unbiased test (AU test) (Shimodaira 2002) with the software CONSEL (Shimodaira & Hasegawa 2001) in order to compare alternative topologies of the trees obtained. Constrained trees were estimated and per- site log-likelihoods were computed using RAxML v7.2.2 (Stamatakis 2014). The different topologies tested are included as Supplementary Material.

The COI sequences were used to calculate genetic distances among the main phylogenetic clades, under the Kimura’s two-parameter model (Kimura 1980), in 15

MEGA. We applied this particular model for comparison with previous studies in

Asteroidea.

Results

Sequences

The final aligned dataset included 46 sequences with a total length of 1,292 bp:

473 bp of 16S (after 13% cutoff in Gblock), 496 bp of COI and 323 bp of 28S. The models selected for each fragment were as follow: GTR for 16S, GTR+G for COI,

K2P+G for COI without third codon position, and HKY+G for 28S. Those fragments that could not be sequenced in some samples were coded as missing data in the concatenated matrix. No saturation was found in the different fragments analysed (Iss <

Iss.c with p < 0.05), except for third codon position of the COI sequences that presented considerable saturation (p > 0.05). A heterogeneous pattern of substitution was detected across the third codon position of the COI, i.e. the test of homogeneity rejected the null hypothesis that the third codon position of the COI evolved according to the same pattern of substitution as the first two codon positions. Similar substitution rates were detected between loop and stem regions of the 16S and 18S fragments. Substitution rates in the loop and stem regions were, respectively, 56-58% and 46-47% for 16S and,

48-53% and 43-50% for 28S. Data on the transition/transversion rates, base frequencies, and proportions of synonymous (dS) and non-synonymous (dN) substitutions can be found as Supplementary Material (Tables S3 and S4).

Phylogenetic analyses

Phylogenetic reconstructions from BI and ML methods, and from all gene fragments, were congruent, with the major clades and most of the species being clearly 16

resolved. Figure 2 shows the best ML reconstruction (lnL= -9299.754216) obtained from the concatenated dataset of the three gene fragments without third codon position of the COI, with the bootstrap supports (BSP) and posterior probabilities (PP) of the BI analysis indicated on the nodes.

The ML reconstruction showed three main clades. One of the clades grouped all

Echinaster (Othilia) species from Florida/Gulf of Mexico, Brazil (South-Western

Atlantic) and Eastern Pacific (hereafter named Othilia clade). Despite the low support on some nodes for the separate gene fragments, separate COI, 16S and 28S phylogenetic trees always recovered E. (Othilia) species as a well-supported clade

(Figs. S1-S4). Another clade included Echinaster species from the Indian Ocean and

Western Pacific Ocean (Indo-Western Pacific), together with Echinaster (Echinaster) species (represented by E. (E.) sepositus) from the Eastern Atlantic and Mediterranean

Sea (hereafter termed Echinaster clade). The species Henricia tahia appeared as a sister taxon of this Echinaster clade. Finally, a third clade included some Henricia species from the Pacific and Atlantic Oceans. The species described as Echinaster (Echinaster farquhari) also clustered in this group. Echinaster (non-Othilia) and Henricia were recovered as closely related clades, and were separated from all Echinaster (Othilia) species. The phylogenetic tree obtained from the concatenated dataset, including the third codon position of COI, showed low node support for the clustering of Echinaster and Henricia clades (54% BSB and 0.64 PP) and resolved a different relationship among South-Western Atlantic species (Supplementary Material - Fig. S5).

The AU test, that evaluated our best ML tree against the likelihood of the topologies of the best constrained trees (see Table 1 and Supplementary Material), showed that the topology of Echinaster and Othilia as sister clades that would evidence the existence of a single genus comprised of these two clades separated from Henricia, 17

was significantly different from the best ML topology presented in Figure 2 and Table

1. Therefore, the hypothesis of genus Echinaster monophyly can be rejected.

Within the main clades, the Othilia clade was divided into two sub-groups: the

Eastern Pacific sub-group (represented by E. (O.) tenuispina), and the Western Atlantic sub-group. The concatenated dataset excluding the third codon position of the COI did not resolve phylogenetic relationships among the different species of the Western

Atlantic sub-group. In the phylogenetic tree using all codon positions of the COI, the

Western Atlantic sub-group (Supplementary Material - Fig. S5) included species identified as E. (O.) spinulosus from Florida/Gulf of Mexico, which appeared as a sister clade of other species from Florida/Gulf of Mexico identified as E. (O.) sentus and E.

(O.) paucispinus, and Brazilian species identified as E. (O.) echinophorus, E. (O.) brasilienis and E. (O.) guyanensis. Species from Brazil appeared to be further divided into two groups, although with low node support: one included only specimens of E.

(O.) echinophorus, and the another specimens identified as E. (O.) brasiliensis, E. (O.) echinophorus and E. (O.) guyanensis, although species did not cluster together on separate branches. In the Caribbean/Gulf of Mexico clade, specimens morphologically identified as E. (O.) sentus and E. (O.) pauscispinus did not cluster separately as different taxa based on our molecular data. In the Echinaster clade, E. purpureus could not be differentiated from E.luzonicus, except when all COI positions were included in analyses (Supplementary Material - Fig. S5).

The Kimura 2-parameter (K2P) distances, based on COI sequences, are shown in

Table 2. Although the genetic distances measured were over 20% for all clades, the highest divergence was found between the Othilia and Henricia clades (28.4%). Intra- clade variation was similar for the Othilia (3.3%) and Henricia (3.2%) clades and lower 18

than that for Echinaster (11.3%). Table S5 (Supplementary Material) shows the raw pairwise K2P distances that were used to create Table 1.

Discussion

The phylogenetic results here raise questions about the taxonomic status of

Echinaster as a monophyletic genus, and Echinaster (Othilia) and Echinaster

(Echinaster) as subgenera within this genus. Our study reconstructed Echinaster

(Othilia) as a well-supported and highly divergent clade from one that included

Echinaster (non-Othilia) and Henricia. Our phylogenetic reconstruction supports the view of a previous study based on morphological characters that pointed out a closer relationship between E. (Echinaster) and Henricia than between E. (Echinaster) and

Echinaster (Othilia) (Fontanella & Hopkins 2003).

Several authors have highlighted the difficulties of distinguishing Echinaster and

Henricia species (Tortonese & Downey 1977, Clark 1987, Clark & Downey 1992).

Only a few morphological characters (such as the arrangements of skeletal plates, the shape of arms, the thickness of skin, and the shape, length and arrangement of spines) have been used to distinguish them. Nevertheless, both Henricia and Echinaster display high intra-specific, intra-population and inter-population variation for these characters

(Clark & Downey 1992). The subgenus E. (Othilia) was previously considered a distinct genus, Othilia, based on the presence of patches of crystal bodies (or glass tubercles) (Tortonese & Downey 1977). However, later, due to the description of some crystal bodies in E. (Echinaster) sepositus from Western Africa, the genus Othilia was reduced to the level of subgenus (Clark & Tortonese 1986). Hence, only two diagnostic characters currently define the subgenus Othilia (Clark 1987). One is the arrangement of plates in a longitudinal series along the median part of each arm, with transversal 19

plates linking them (regular reticulum); the skeletons of other species, such as those of

E. (Echinaster) and Henricia, have an irregular reticulum. The second character is the complete lack of actinal plates between the inferomarginal and adambulacral plates.

However, this latter character is not completely diagnostic, since neither E. luzonicus nor E. callosus from the Pacific Ocean possess actinal plates. Because of these exceptions, Othilia has remained as a subgenus within Echinaster until a full revision of the genus can be performed (Clark & Tortonese 1986). On the other hand, species of

Echinaster from the Indian and Pacific Oceans have never been described in detail, and therefore the presence or absence of crystal bodies has never been reported.

The major lineages obtained from our phylogenetic analyses (i.e. the Henricia,

Echinaster and Othilia clades) displayed genetic distances ranging from 23.5% to

28.4% for the COI gene. These values are high if we consider that mean inter-generic divergence for this gene is around 14% for Asteroidea (Ward et al. 2008). Therefore, the inter-clade divergences obtained among the Henricia, Echinaster and Othilia clades here are over the threshold usually considered as discriminating between different genera of this animal group. Hence, all results suggest that Othilia should be raised to the level of genus instead of a subgenus of Echinaster. This hypothesis is supported by the monophyly of the Othilia clade, its high molecular divergences, and the presence of morphological features that could be defined as diagnostic characters of the genus.

These consistent morphological diagnostic characters that should be considered for

Othilia as a genus are: (a) the presence of conspicuous spines, and (b) the arrangement of skeletal plates in a longitudinal series (regular reticulum). In contrast, Henricia and

Echinaster (non-Othilia) species are characterized by the presence of inconspicuous spines and an irregular reticulum. 20

The clustering of H. tahia within the Echinaster (non-Othilia) clade, and E. farquhari within the Henricia clade, indicates that the systematics of these two species needs to be investigated to confirm their taxonomic classification. Therefore, for

Echinaster and Henricia, the diagnostic characters at the levels of genus, subgenus and species should be extensively revisited to make a comprehensive list of morphological characters for species identification.

More detailed observation of the Othilia clade reveals some taxonomic conflicts between E. (O.) sentus and E. (O.) paucispinus from the Gulf of Mexico/Florida, and for E. (O.) brasiliensis, E. (O.) guyanensis and E. (O.) echinophorus from Brazil.

According to the molecular data, E. (O.) brasiliensis and E. (O.) guyanensis should be synonymized, and the status of E. (O.) echinophorus should be revised since it appears to be polyphyletic. The molecular data presented here corroborate previous taxonomic studies in Othilia, highlighting the fact that the currently used diagnostic characters are not sufficiently robust for species-level discrimination (Fontanella & Hopkins 2003).

The specific status of the Echinaster from the Indo-Western Pacific and Eastern

Atlantic seems to be confirmed by our analyses. In particular, different morphotypes have previously been recognized for the species E. luzonicus (Clark & Rowe 1971).

Molecular systematics and population genetic studies of widely distributed marine species with considerable morphological plasticity have, in many cases, demonstrated the existence of cryptic species complexes (Klautau et al. 1999; Knowlton 2000; Hart et al. 2003; Hart et al. 2006; Barroso et al. 2010; Pérez-Portela et al. 2013a, 2013b).

Therefore, the clustering of individuals of E. luzonicus in different branches together with its wide geographical distribution may indicate a process of cryptic speciation that deserves further investigation. The low resolution between E. luzonicus and E. purpureus from the Indo-Western Pacific, as well as among Caribbean and Brazilian 21

species, for the COI fragment analysis when only 1st an 2nd codon positions were used suggests that the phylogenetic signal lies in the 3rd codon position for these more recent lineages.

The estimated synonymous/non-synonymous substitution and transition/transversion rates are higher among the main clades reconstructed here than those observed for other studied echinoderms (Lessios et al. 1999, 2001, Mccartney et al. 2000, Biermann et al. 2003, Foltz et al. 2004, Zigler & Lessios 2004, Lessios 2008).

Thus, our results suggest a very ancient split among Henricia, Othilia and Echinaster clades. Therefore, we cannot disregard completely the possibility that the sister relationship of Henricia and Echinaster (non-Othilia) could be due to long-branch attraction (Bergsten 2005) caused by high divergence among sequences and the inclusion of only five species of Henricia from a total of 90 known species. Despite that the relationship between Henricia and Echinaster (non-Othilia) could not be completely clarified here, we believe that the results obtained in this study are sufficient to conclude that the more highly divergent clade Othilia could be elevated to genus level.

Our molecular analyses address important issues about the evolutionary relationships among Echinaster species. According to our molecular phylogenetic results, and previous morphological analyses developed by other authors, we suggest reverting Othilia to the level of genus. Unraveling the divergence and evolutionary relationships among Henricia, Echinaster (sensu stricto) and Othilia requires further investigation including new molecular markers and other genera of the Family

Echinasteridae to put them within a broader evolutionary framework.

Acknowledgments

This paper is part of the DS requirements of E.M.L. at the Biodiversity and

Evolutionary Biology Graduate program of the Federal University of Rio de Janeiro. 22

We thank Dr Cristiano Lazoski, Dr Joana Zanol, Dr Cláudia AM Russo, Dr Daniela M

Takiya and Dr Antônio M Solé-Cava for critical comments that improved the early drafts of this manuscript. We are grateful to Dr Gustav Paulay (Florida Museum of

Natural History/USA), Dr Timothy O'Hara (Museum Victoria/Australia), Dr Bernard

Picton (National Museums of Northern Ireland/Ireland), Dr Francisco A Solis Marin and Mrs. Carolina Martín (Instituto de Ciencias del Mar y Limnologia/Mexico), Dr

Nadia Ameziane and Dr Marc Eléaume (Muséum National d’Histoire Naturelle/France) for providing relevant samples of several species and access to collections. We also thank Dr Xavier Turon (Centro de Estudios Avanzados de Blanes) for providing laboratory facilities during the Sandwich Ph.D. scholarship of E.M.L. The Instituto

Chico Mendes de Conservação da Biodiversidade (ICMBio) provided the permits to collect specimens from Brazil. This manuscript was edited for proper English language, grammar, punctuation, spelling, and overall style by qualified native English John O'

Brien.

References Atwood DG 1973. Larval development in the Asteroid Echinaster echinophorus. Biol Bull 144: 1–11. Avila-Pires TCS 1983. Contribuição ao estudo do gênero Echinaster Müller & Troschel, 1840 (Echinodermata:Asteroidea) no litoral Brasileiro. An. Acad. Bras. Ciências 55 4: 431–448. Biermann CH, Kessing BD, & Palumbi SR 2003. Phylogeny and development of marine model species: strongylocentrotid sea urchins. Evol. Dev. 5: 360–371. Blake DB 1987. A classification and phylogeny of post-Palaeozoic sea stars (Asteroidea: Echinodermata). J. Nat. Hist. 21: 481–528. Campbell DB & Turner RL 1984. Echinaster graminicola, A new species of spinulosid sea star Echinodermata Asteroidea from the West coast of Florida. Proc. Biol. Soc. Washingt. 97: 167–178. Clark AM 1987. Notes on Atlantic and other Asteroidea-Echinasteridae. Bull. Br. 23

Museum Nat. Hist. 53: 65–78. Clark AM & Downey ME 1992. Starfishes of the Atlantic. Chapman and Hall, London. 794 pp. Clark AM & Rowe FWE 1971. Monograph of shallow-water Indo-West Pacific Echinoderms. Trust. Br. Museum (Natural Hist. 690: 1–238. Clark A & Tortonese E 1986. Echinaster sepositus madseni N. subsp., from West Africa (Echinodermata:Asteroidea). Atti delta Soc. Ital. di Sci. delta Soc. Ital. di Sci. 127: 65–71. Feuda R & Smith AB 2015. Phylogenetic signal dissection identifies the root of starfishes. PLoS One 10: e0123331. Foltz D, Hrincevich A, & Rocha-Olivares A 2004. Apparent selection intensity for the cytochrome oxidase subunit I gene varies with mode of reproduction in echinoderms. Genetica: 115–125. Fontanella FM & Hopkins TS 2003. Preliminary phylogeny of Echinaster (Othilia) from the Gulf of Mexico based on morphological characters (Echinodermata: Asteroidea). Echinoderm Res. 2001: 91–95. Gale AS 1987. Phylogeny and classification of the Asteroidea (Echinodermata). Zool. Soc. Linn. Soc. 89: 107–132. Gouy M, Guindon S, & Gascuel O 2010. SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol. Biol. Evol. 27: 221–224. Gruber AR, Lorenz R, Bernhart SH, Neubock R, & Hofacker IL 2008. The Vienna RNA Websuite. Nucleic Acids Res. 36: W70–W74. Hopkins TS, Fontanella EM, & Ventura CRR 2003. Morphological diagnosis of three Brazilian sea stars of the genus Echinaster (Sub-genus Othilia). Echinoderm Res. 2001 1: 97–103. Janies DA, Voight JR, & Daly M 2011. Echinoderm phylogeny including Xyloplax, a progenetic asteroid. Syst. Biol. 60: 420–438. Kimura M 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16: 111–120. Knott KE & Wray GA 2000. Controversy and consensus in asteroid systematics: New insights to ordinal and familial relationships. Am. Zool. 40: 382–392. Lafay B, Smith AB, & Christen R 1995. A Combined morphological and molecular approach to the phylogeny of asteroids (Asteroidea: Echinodermata). Syst. Biol. 44: 190. Lessios HA 2008. Great American schism: Divergence of marine organisms after the 24

rise of the Central American Isthmus. Annu. Rev. Ecol. Evol. Syst. 39: 63–91. Lessios HA, Kessing BD, & Pearse JS 2001. Population structure and speciation in tropical seas: global phylogeography of the sea urchin Diadema. Evolution 55: 955–975. Lessios HA, Kessing BD, Robertson DR, & Paulay G 1999. Phylogeography of the pantropical sea urchin Eucidaris in relation to land barriers and ocean currents. Evolution (N. Y). 53: 806–817. Li WH 1993. Unbiased estimation of the rates of synonymous and nonsynonymous substitution. J. Mol. Evol. 36: 96–99. Mah CL 2015. Asteroidea. Accessed through World Regist. Mar. Species http//www.marinespecies.org/aphia.php?p=taxdetails&id=123080 2015-07-06. Mah CL & Blake DB 2012. Global diversity and phylogeny of the Asteroidea (Echinodermata). PLoS One 7: e35644. Mccartney MA, Keller G, & Lessios HA 2000. Dispersal barriers in tropical oceans and speciation in Atlantic and eastern Pacific sea urchins of the genus Echinometra. Mol. Ecol. 9: 1391–1400. Miller MA, Pfeiffer W, & Schwartz T 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In:2010 Gatew. Comput. Environ. Work. GCE 2010. Pamilo P & Bianchi NO 1993. Evolution of the Zfx and Zfy genes: rates and interdependence between the genes. Mol. Biol. Evol. 10: 271–281. Posada D 2008. jModelTest: Phylogenetic model averaging. Mol. Biol. Evol. 25: 1253– 1256. Rambaut A & Drummond AJ 2009. Tracer V1.5. Available from http//beast.bio.ed.ac.uk/Tracer. Reich A, Dunn C, Akasaka K, & Wessel G 2015. Phylogenomic Analyses of Echinodermata Support the Sister Groups of Asterozoa and Echinozoa. PLoS One 10: e0119627. Ringvold H & Stien J 2001. Biochemical differentiation of two groups within the species-complex Henricia Gray, 1840 (Echinodermata, Asteroidea) using starch- gel electrophoresis. Hydrobiologia 459: 57–59. Ronquist F & Huelsenbeck JP 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574. Scheibling RE 1982. Differences in body size and growth rate between morphs of Echinaster (Echinodermata:Asteroidea) from the eastern Gulf of Mexico. Int. Echinoderms Conf.: 291–298. 25

Shimodaira H 2002. An approximately unbiased test of phylogenetic tree selection. Syst. Biol. 51: 492–508. Shimodaira H & Hasegawa M 2001. CONSEL: for assessing the confidence of phylogenetic tree selection. Bioinformatics 17: 1246–1247. Smith AB 1997. Echinoderm phylogeny: How congruent are morphological and molecular estimates? Paleontol. Soc. Pap. 3: 337–355. Stamatakis A 2014. The RAxML v8 . 1 . X Manual. : 1–61. Stamatakis A, Hoover P, & Rougemont J 2008. A rapid bootstrap algorithm for the RAxML Web servers. Syst. Biol. 57: 758–771. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, & Kumar S 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony method. Mol. Biol. Evol. 28: 2731–2739. Tortonese E & Downey M. 1977. On the genera Echinaster Mueller and Troschel and Othilia Gray, and the validity of Verrillaster Downey (Echinodermata: Asteroidea). Proc. Biol. Soc. Washingt. 90: 829–830. Turner RL 2013. Echinaster. In:Starfish Biol. Ecol. Asteroidea. Lawrence JM, ed., pp. 200–214. The Johns Hopkins University Press, Baltimore. Maryland. Tuttle RD & Lindahl R 1980. Genetic variability in 3 cooccurring forms of the starfish genus Othilia (= Echinaster). Experientia 36: 923–925. Ward RD, Holmes BH, & O’Hara TD 2008. DNA barcoding discriminates echinoderm species. Mol. Ecol. Resour. 8: 1202–1211. Watts SA, Scheibling RE, Marsh AG, & McClintock JB 1982. Effect of temperature and salinity on larval development of sibling species of Echinaster (Echinodermata: Asteroidea) and their hybrids. Biol. Bull. 163: 348–354. Xia X 2013. DAMBE5: A comprehensive software package for data analysis in molecular biology and evolution. Mol. Biol. Evol. 30: 1720–1728. Xia X & Lemey P 2009. Assessing substitution saturation with DAMBE. phylogenetic Handb. a Pract. approach to DNA protein phylogeny: 615–630. Xia X, Xie Z, Salemi M, Chen L, & Wang Y 2003. An index of substitution saturation and its application. Mol. Phylogenet. Evol. 26: 1–7. Zigler KS & Lessios H a 2004. Speciation on the coasts of the new world: phylogeography and the evolution of bindin in the sea urchin genus Lytechinus. Evolution (N. Y). 58: 1225–1241.

26

Figures and Tables

Fig. 1. Sampling localities of Echinaster (circle) and Henricia (square) species sequenced in this study. E. brasiliensis: 1. Florianópolis/Brazil, 2. Rio de Janeiro/Brazil, E. guyanensis: 3. Vitória/Brazil, E. echinophorus: 4. Arraial d' Ajuda/Brazil, 5. Salvador/Brazil, 6. João Pessoa/Brasil, 7. Pernambuco/Brazil, 8. Galinhos/Brazil, E. paucispinus: 9. Gulf of Mexico/Mexico, E. sentus: 10: Florida Bay-Florida/USA, 11. Florida Straits-Florida/USA, 12. Pinellas County-Florida/USA, E. spinulosus: 13. Horse Key-Florida/USA, 14. Cedar Key-Florida/USA, 15. Baja California/Mexico, E.(E.) sepositus: 16. Mediterranean Sea/Spain, 17. Canary Islands/Spain, E. purpureus: 18. Barr al Hikman/Oman, E. callosus: 19. Faransan Bank/Saudi Arabia, 20. Bokissa Island/Vanuatu E. luzonicus: 21. Bali/Indonesia, 22. Dirk Hatog Island/Australia, 23. Lizard Island, Queensland/Australia, 24. Epi Island/Vanuatu, 25. Papua New Guinea, 26 Yap state, Calorina Island/Federated States of Micronesia, 27. Guam Island/Mariana Island, 28. Saipan Island/Mariana Island, 29. Le-Shima Island, Okinua/Japan, E. farquhari: 30. Cascade/Australia, E. arcystasus: 31. Point Lonsdale, Australia, H. sanginolenta: 32. Gulen/Norway, H. oculata: 33. County Antrim/Ireland, H. compacta: 34. Tasmania/Australia, H. obesa: 35. Tasmania/Australia, H. tahia: 36. Tasman Sea. Colors represent the lineages reconstructed by the phylogenetic trees. Localities for the sequences taken from the GenBank database are not included on the map. 27

Fig. 2. Maximum likelihood tree. Analyses based on the concatenated dataset of three DNA fragments: COI (excluding third codon position), 16S, and 28S (total: 1127 bp), implementing different mutation models for each partition. Bootstrap scores and posterior probabilities obtained from ML and BI, respectively, are shown at the nodes.

28

Table 1. P-values for tree topologies tested by the approximately unbiased (AU) test. obs: the observed log-likelihood difference. au: the p-value of the approximately unbiased test calculated from the multiscale bootstrap. np: the bootstrap probability calculated from the multiscale bootstrap. The p-values that are not significant are emphasized in bold type.

rank obs au np topologies tested 1 -13.4 0.984 0.980 ((Echinaster+Henricia)Othilia) 2 13.4 0.020 0.019 ((Henricia+Othilia) Echinaster) 3 15.1 0.003 0.001 ((Echinaster+Othilia) Henricia)

Table 2. Genetic distances between main clades obtained from the phylogenetic reconstruction based on the Kimura 2-Parameters model. Distance values (bold) are presented below the diagonal. Numbers along the diagonal represent intra-clade variation, and numbers above the diagonal represent the standard error of the genetic distances between clades.

Echinaster clade Othilia clade Henricia clade Echinaster clade 0.113 0.025 0.027 Othilia clade 0.235 0.032 0.033 Henricia clade 0.250 0.284 0.134

29

Supporting Information Table S1. Species analysed, Locality were the species were collected, Institution of origin, and Genbank accession numbers of each gene fragment. * COI sequences donated by the Florida Museum of Natural History-USA. Code used Species Location Institution of origin COI 16S 28S here National Museum-Rio de Echinaster brasiliensis Ebr1 Florianópolis/Brazil KT268118 KT268083 KT268189 Janeiro/Brazil National Museum-Rio de Echinaster brasiliensis Ebr2 São Sebastião/Brazil KT268120 KT268085 KT268191 Janeiro/Brazil National Museum-Rio de Echinaster brasiliensis Ebr3 Rio de Janeiro/Brazil KT268119 KT268084 KT268190 Janeiro/Brazil National Museum-Rio de Echinaster guyanensis Egu1 Vitória/Brazil KT268129 KT268094 KT268200 Janeiro/Brazil National Museum-Rio de Echinaster guyanensis Egu2 Vitória/Brazil KT268130 KT268095 KT268201 Janeiro/Brazil National Museum-Rio de Echinaster guyanensis Egu3 Vitória/Brazil KT268131 KT268096 KT268202 Janeiro/Brazil National Museum-Rio de Echinaster echinophorus Eec1 Arraial d' Ajuda/Brazil KT268123 KT268088 KT268194 Janeiro/Brazil National Museum-Rio de Echinaster echinophorus Eec2 Salvador, Bahia/Brasil KT268127 KT268092 KT268198 Janeiro/Brazil National Museum-Rio de Echinaster echinophorus Eec3 Pernambuco/Brazil KT268126 KT268091 KT268197 Janeiro/Brazil National Museum-Rio de Echinaster echinophorus Eec4 João Pessoa/Brazil KT268125 KT268090 KT268196 Janeiro/Brazil National Museum-Rio de Echinaster echinophorus Eec5 Galinhos/Brazil KT268124 KT268089 KT268195 Janeiro/Brazil Echinaster sentus Ese1 see in GenBank GenBank database - DQ297088 - Pinellas County-Gulf of Florida Museum of Natural Echinaster sentus Ese2 - KT268106 KT268212 Mexico/Flórida History-USA, Florida Museum of Natural Echinaster sentus Ese3 Florida Bay/Florida KT268141* - - History-USA, Monroe County-Florida Florida Museum of Natural Echinaster sentus Ese4 KT268142* - - Keys/Florida History-USA, Instituto de Ciencias del Mar y Echinaster pauciscinus Epa1 Mexico KT268139 KT268104 KT268210 Limnología-México 30

Cedar Key,Levy Instituto de Ciencias del Mar y Echinaster spinulosus Esp1 KT268145 KT268110 KT268216 County/Florida Limnología-México Cedar Key,Levy Instituto de Ciencias del Mar y Echinaster spinulosus Esp2 KT268144 KT268109 KT268215 County/Florida Limnología-México Instituto de Ciencias del Mar y Echinaster tenuispinus Ete1 Baja California/Mexico - KT268111 KT268217 Limnología-México Echinaster sepositus Eso1 Eastern Atlantic University of Barcelona KT268143 - - Echinaster sepositus Eso2 Mediterraneo Sea University of Barcelona KT268146 KT268108 KT268214 Florida Museum of Natural Echinaster luzonicus Elu1 Northern/Mariana Island KT268133* KT268098 KT268204 History-USA, Florida Museum of Natural Echinaster luzonicus Elu2 Northern/Mariana Island KT268132* KT268097 - History-USA, Florida Museum of Natural Echinaster luzonicus Elu3 Bali/Indonésia KT268135 KT268100 KT268206 History-USA, Florida Museum of Natural Echinaster luzonicus Elu4 Shefa Province/Vanuatu KT268134* KT268099 KT268205 History-USA, Le-Shima Florida Museum of Natural Echinaster luzonicus Elu5 KT268137 KT268102 KT268208 Island,Okinua/Japan History-USA, Yap state, Calorina Florida Museum of Natural Echinaster luzonicus Elu6 Island/Federated States of KT268138 KT268103 KT268209 History-USA, Micronesia Lizard Florida Museum of Natural Echinaster luzonicus Elu7 KT268136* KT268101 KT268207 Island,Queensland/Australia History-USA, Florida Museum of Natural Echinaster luzonicus Elu8 Dirk Hatog Island/Austrália KT268153* - KT268213 History-USA, Cape Botiangin/Papua New Florida Museum of Natural Echinaster luzonicus Elu9 KT268152 - KT268203 Guinea History-USA, Florida Museum of Natural Echinaster purpureus Epu1 Barr al Hikman/Oman KT268140* KT268105 KT268211 History-USA, Florida Museum of Natural Echinaster callosus Eca1 Bokissa Island/Vanuatu KT268122* KT268087 KT268193 History-USA, Florida Museum of Natural Echinaster callosus Eca2 Faransan Bank/Saudi Arabia KT268121 KT268086 KT268192 History-USA, Echinaster farquhari Efa1 Cascade/Australia Museum Victoria-Australia KT268128 KT268093 KT268199 Echinaster arcystasus Ear1 Point Lonsdale,Australia Museum Victoria-Australia KT268117 KT268082 KT268188 31

Henricia compacta Hco1 Tasmania/Australia Museum Victoria-Australia KT268147 KT268112 KT268218 Henricia obesa Hob1 Tasmania/Australia Museum Victoria-Australia KT268148 KT268113 KT268219 National Museums of Northern Henricia oculata Hoc1 County Antrim coast/Ireland KT268151 KT268116 - Ireland Henricia oculata Hoc2 see in GenBank GenBank database HM473914 - - Henricia oculata Hoc3 see in GenBank GenBank database - AY652500 - Henricia sanguinolenta Hsa1 see in GenBank GenBank database HM542200 - - Henricia sanguinolenta Hsa2 see in GenBank GenBank database - AY652499 - Henricia sanguinolenta Hsa3 see in GenBank GenBank database - - - Henricia sanguinolenta Hsa4 see in GenBank GenBank database - - AJ225845 National Museums of Northern Henricia sanguinolenta Hsa5 Gulen, Norway KT268150 KT268115 - Ireland Henricia thaia Hth1 Tasman Sea Museum Victoria-Australia KT268149 KT268114 KT268220 Luidia foliolata Lfo1 see in GenBank GenBank database AF217380 EU072952 - Patiria miniata Pmi1 see in GenBank GenBank database HQ231381 HQ231381 HQ231381 Odontaster validus Ova1 see in GenBank GenBank database GQ294385.1 GQ294457.1

Tosia australis Tau1 see in GenBank GenBank database KF176055 EU072961 KF17620

32

Table S2. Primers and PCR program used for DNA amplifications. Gene fragment, Name of the primers used for DNA amplification, Sequence of the primers, PCR conditions for DNA amplification and Reference of the primers.

Gene Primer Sequence PCR Program Reference

5' 3'

TTTCAACTAATCATAAGGACAT 1x (3min at 94°C), 35x COI EchinoF1 Foward (Ward et al. 2008) TGG (94°C for 30sec, 45-50°C TAAACTTCAGGGTGACCAAAA for 1min, 72°C for 1min) (Folmer et al. HCO2198 Reverse AATCA and 72° for 10min 1994) ACTGCCCACGCCCTAGTAATG 1x (3min at 94°C), 35x (Hoareau and COIceF Foward ATATTTTTTATGGTNATGCC (94°C for 30sec, 45-50°C Boissin 2010) ACTGCCCACGCCCTAGTAATG for 1min, 72°C for 1min) (Hoareau and COIceR Reverse ATATTTTTTATGGTNATGCC and 72° for 10min Boissin 2010) 1x (3min at 94°C), 35x 16S E16Sa Foward TCTTAGTACGAAAGGACCAGA (Smith et al. 1993) (94°C for 30sec, 45-50°C for 1min, 72°C for 1min) E16Sb Reverse GACGAGAAGACCCTATCGAGC (Smith et al. 1993) and 72° for 10min 1x (3min at 94°C), 35x 16SarL Foward CGCCTGTTTATCAAAAACAT (Palumbi 1994) (94°C for 30sec, 45-50°C GCTTACGCCGGTCTGAACTCA for 1min, 72°C for 1min) 16SAN-R Reverse (Zanol et al. 2010) G and 72° for 10min AGAAACTAACMAGGATTCCYY 1x (3min at 94°C), 35x 28S 28SF Foward (Foltz et al. 2007) TAGTA (94°C for 30sec, 50°C for 45sec, 72°C for 1min) 28SR Reverse ACTTTCCCTCAYGGTACTTGT (Foltz et al. 2007) and 72° for 10min

Table S3. Characteristics of the sequences. Pi = parcimony informative sites, si = Transitionsal Pairs,sv = Transversional Pairs, R = si/sv, Nucleotide composition (%).

Pi si sv R %T %C %A %G

COI 180 31.00 39.00 0.81 27.2 27.9 27.6 17.3

1st 9.00 1.00 6.56 23.0 24.0 25.2 28.0

2nd 1.00 0.00 14.12 42.0 29.5 11.8 16.9

3rd 22.00 38.00 0.59 17.0 30.2 45.7 6.9

16S 214 44.00 43.00 1.03 33.8 13.2 27.2 25.8

28S 52 8.00 12.00 0.66 16.4 28.8 19.8 34.9

33

Table S4. The number of synonymous substitutions per synonymous site (dS), the number of non-synonymous substitutions per non-synonymous site (dN) and the ratio of non- synonymous to synonymous sites (dN/dS) among species for COI sequence using the Pamilo-Bianchi-Li model. Standard error estimates are shown above the diagonal. dS 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1. E.arcystasus 0.736 0.336 0.630 0.798 0.622 0.323 0.780 0.350 0.881 0.405 0.794 0.734 0.935 0.614 0.899 0.464

2. E.(O.) brasiliensis n/c 0.496 0.022 0.449 0.007 0.359 0.039 0.313 0.037 0.385 0.043 0.566 0.582 0.407 0.339 0.554

3. E.callosus 1.095 1.377 0.549 0.342 0.547 0.107 0.591 0.115 0.560 0.129 0.454 0.677 0.651 0.277 0.509 0.152

4. E.(O.)echinophorus n/c 0.071 1.391 0.505 0.020 0.410 0.038 0.341 0.036 0.429 0.046 0.664 0.680 0.458 0.356 0.630

5. E.farquhari 1.719 1.365 1.148 1.354 0.472 0.413 0.464 0.406 0.536 0.271 0.586 0.154 0.095 0.080 0.100 0.541

6. E.(O.)guyanensis n/c 0.012 1.386 0.058 1.398 0.395 0.038 0.334 0.036 0.421 0.043 0.692 0.625 0.442 0.363 0.604

7. E.luzonicus 1.181 1.274 0.663 1.328 1.414 1.284 0.404 0.039 0.442 0.098 0.342 0.633 0.467 0.443 0.265 0.156

8. E.(O.)paucispinus n/c 0.168 1.413 0.163 1.394 0.155 1.321 0.330 0.014 0.573 0.034 0.774 0.666 0.417 0.557 0.681

9. E.purpureus 1.098 1.102 0.693 1.128 1.300 1.109 0.214 1.152 0.373 0.086 0.273 0.522 0.492 0.409 0.261 0.267

10. E.(O.)sentus n/c 0.169 1.495 0.169 1.490 0.158 1.329 0.040 1.216 0.627 0.033 0.653 0.629 0.480 0.533 0.653

11. E.(E.)sepositus 1.158 1.133 0.726 1.185 1.146 1.153 0.536 1.322 0.499 1.423 0.448 0.699 0.574 0.646 0.494 0.238

12. E.(O.)spinulosus n/c 0.211 1.206 0.230 1.523 0.205 1.216 0.134 1.078 0.147 1.217 0.629 0.499 0.495 0.378 0.527

13. H.compacta 1.573 1.432 1.560 1.491 0.717 1.518 1.475 1.605 1.254 1.513 1.545 1.441 0.041 0.096 0.045 0.433

14. H.obesa 2.239 1.468 1.508 1.504 0.624 1.510 1.468 1.505 1.325 1.529 1.363 1.451 0.118 0.090 0.029 0.386

15. H.oculata 1.479 1.459 1.232 1.459 0.559 1.486 1.516 1.671 1.362 1.396 1.724 1.610 0.527 0.614 0.103 0.317

16. H.sanguinolenta 2.081 1.245 1.467 1.261 0.660 1.278 1.266 1.421 1.116 1.481 1.315 1.337 0.215 0.152 0.667 0.307

17. H.tahia 1.088 1.333 0.726 1.371 1.365 1.360 0.706 1.403 0.756 1.411 0.751 1.235 1.118 1.134 1.159 1.083 dN 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1. E.arcystasus 0.013 0.009 0.012 0.008 0.011 0.006 0.015 0.008 0.017 0.010 0.016 0.011 0.012 0.009 0.015 0.022

2. E.(O.) brasiliensis 0.010 0.001 0.012 0.001 0.009 0.001 0.011 0.001 0.012 0.001 0.018 0.018 0.010 0.016 0.026

3. E.callosus 0.025 0.024 0.011 0.007 0.011 0.004 0.012 0.005 0.011 0.005 0.010 0.009 0.011 0.007 0.011 0.015

4. E.(O.)echinophorus n/c 0.001 0.024 0.013 0.001 0.010 0.001 0.011 0.001 0.013 0.001 0.021 0.021 0.011 0.016 0.028

5. E.farquhari 0.013 0.032 0.016 0.032 0.012 0.007 0.012 0.007 0.012 0.008 0.013 0.008 0.006 0.004 0.007 0.020

6. E.(O.)guyanensis n/c 0.001 0.023 0.001 0.031 0.010 0.000 0.011 0.000 0.013 0.000 0.021 0.019 0.011 0.016 0.027

7. E.luzonicus 0.015 0.029 0.009 0.029 0.014 0.028 0.010 0.001 0.010 0.004 0.010 0.013 0.011 0.007 0.010 0.017

34

8. E.(O.)paucispinus n/c 0.001 0.025 0.001 0.032 0.000 0.029 0.013 0.000 0.015 0.000 0.024 0.022 0.011 0.021 0.031

9. E.purpureus 0.019 0.036 0.010 0.036 0.014 0.035 0.001 0.040 0.013 0.004 0.011 0.012 0.011 0.007 0.010 0.020

10. E.(O.)sentus n/c 0.001 0.025 0.001 0.032 0.000 0.028 0.000 0.039 0.015 0.000 0.021 0.021 0.012 0.021 0.030

11. E.(E.)sepositus 0.025 0.033 0.010 0.033 0.019 0.032 0.006 0.032 0.006 0.032 0.013 0.017 0.013 0.009 0.014 0.018

12. E.(O.)spinulosus n/c 0.001 0.024 0.001 0.031 0.000 0.028 0.000 0.038 0.000 0.032 0.022 0.016 0.012 0.016 0.028

13. H.compacta 0.018 0.045 0.014 0.046 0.014 0.045 0.024 0.049 0.023 0.049 0.032 0.049 0.000 0.008 0.003 0.027

14. H.obesa 0.024 0.044 0.021 0.044 0.013 0.043 0.027 0.048 0.027 0.047 0.029 0.046 0.000 0.007 0.003 0.022

15. H.oculata 0.019 0.031 0.020 0.032 0.009 0.031 0.016 0.035 0.017 0.031 0.018 0.034 0.020 0.021 0.008 0.017

16. H.sanguinolenta 0.028 0.049 0.025 0.050 0.019 0.049 0.033 0.051 0.033 0.051 0.033 0.050 0.004 0.006 0.027 0.019

17. H.tahia 0.044 0.055 0.038 0.054 0.041 0.054 0.048 0.059 0.047 0.059 0.043 0.059 0.064 0.054 0.046 0.056

dN/dS 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1. E.arcystasus

2. E.(O.) brasiliensis n/c

3. E.callosus 0.023 0.017

4. E.(O.)echinophorus n/c 0.020 0.017

5. E.farquhari 0.007 0.023 0.014 0.023

6. E.(O.)guyanensis n/c 0.052 0.017 0.015 0.022

7. E.luzonicus 0.012 0.022 0.014 0.022 0.010 0.022

8. E.(O.)paucispinus n/c 0.004 0.018 0.005 0.023 0.000 0.022

9. E.purpureus 0.018 0.033 0.015 0.032 0.011 0.032 0.007 0.035

10. E.(O.)sentus n/c 0.004 0.017 0.005 0.021 0.000 0.021 0.000 0.032

11. E.(E.)sepositus 0.022 0.029 0.014 0.028 0.016 0.028 0.011 0.024 0.012 0.022

12. E.(O.)spinulosus n/c 0.003 0.020 0.004 0.020 0.000 0.023 0.000 0.036 0.000 0.026

13. H.compacta 0.011 0.031 0.009 0.031 0.019 0.030 0.016 0.031 0.018 0.033 0.021 0.034

14. H.obesa 0.011 0.030 0.014 0.029 0.020 0.029 0.018 0.032 0.020 0.031 0.021 0.032 0.000

15. H.oculata 0.013 0.022 0.017 0.022 0.016 0.021 0.011 0.021 0.013 0.022 0.010 0.021 0.038 0.034

16. H.sanguinolenta 0.014 0.040 0.017 0.039 0.028 0.038 0.026 0.036 0.030 0.034 0.025 0.038 0.021 0.039 0.040

17. H.tahia 0.040 0.042 0.052 0.040 0.030 0.040 0.068 0.042 0.062 0.042 0.058 0.048 0.058 0.048 0.040 0.052

35

36

Fig. S1. Maximum likelihood tree based on COI fragments. Bootstrap value obtained are shown on the nodes.

37

Fig. S2. Maximum likelihood tree based on COI sequences without the third codon position. Bootstrap values are shown at the nodes

38

Fig. S3. Maximum likelihood tree based on 16S fragments. Bootstrap value obtained are shown on the nodes.

39

Fig. S4. Maximum likelihood tree based on 28S fragments. Bootstrap value obtained are shown on the nodes.

40

Fig. S5. Maximum likelihood tree. Analyses based on the concatenated dataset of three DNA fragments: COI (including third codon position), 16S, and 28S (total: 1292 bp), implementing different mutation models for each partition. Bootstrap scores and posterior probabilities obtained from ML and BI, respectively, are shown at the nodes.

41

Capítulo 2

Incipient speciation revealed by morphological, morphometric and genetic approaches: a study case in sea stars Echinaster (Othilia) along the Brazilian coast

42

Incipient speciation revealed by morphological, morphometric and genetic approaches: a study case in sea stars Echinaster (Othilia) along the Brazilian coast

Elinia Medeiros Lopes1,2, Paulo Cesar de Paiva3, Carlos Renato Rezende Ventura2,*

1 Biodiversity and Evolutionary Biology Graduate program of the Federal University of Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil.

2 Laboratory of Echinodermata, Department of Invertebrates, National Museum/Federal University of Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil.

3 Laboratory of Polychaeta, Department of Zoology, Institute of Biology - CCS/Federal University of Rio de Janeiro, Rio de Janeiro, Rio de Janeiro, Brazil.

*author for correspondence: Email: [email protected] Phone: 55 21 3938-1183

Keywords: Asteroidea, Echinasteridae, mtDNA, phylogeograhpy, population genetics, species delimitation.

43

Abstract

Sea stars of the genus Echinaster are common and widely distributed across different marine ecosystems along the Brazilian coast, where three species are currently recognized: E. (Othilia) guyanensis, E. (Othilia) echinophorus, and E. (Othilia) brasiliensis. Controversy surrounds the taxonomic classification of these species, inhibiting species identification. This study used morphological, morphometric and molecular techniques to evaluate the taxonomic status of these species, and to understand their evolutionary history on the Brazilian coast, analyzing variation at population and species levels. Our results revealed considerable morphological variability within and between populations, which did not support there being three species. Only two lineages were recognized by mtDNA analysis (COI and 16S fragments); one distributed in the Northeast of Brazil (North group) and the other distributed from the Northeast to southern Brazil (South group). However, the lineages were not reciprocally monophyletic. The phylogenetic tree showed the North group embedded within the widely distributed South group. Despite the low variation among the overall population, significant genetic structure was obtained within the two groups.

Finally, demographic analysis and population genetic diversity indicated that two lineages had undergone historical population expansion. No clear morphological diagnostic characters could be recognized between the lineages, with the observed variation possibly the result of phenotypic plasticity. Therefore, our results suggest ongoing incipient speciation between two Echinaster lineages from the Brazilian coast.

Introduction

Species are the most important units in all biological subjects such as ecology, evolution, paleontology, physiology, systematics and conservation. However, species

44

delimitation is controversial and poses a challenge for biologists. The literature on species concepts is extensive and definitions are based on many different criteria

(Mallet 2007; Hausdorf 2011). According to De Queiroz (2007), all modern species concepts implicitly or explicitly acknowledge that species are segments of population- level lineages (General Lineage Concept). However, it is unclear how to classify populations connected by restricted gene flow. Thus, the General Lineage Concept changes the problem from a “species” definition to a “population” definition, and has limitations with regard to applicability as a species concept (Hausdorf 2011). Because of disagreements over species concepts, Padial et al. (2010) proposed that "taxonomy needs to be pluralistic and integrate new approaches for species delimitation to become a modern evolutionary discipline". Therefore, integration of molecular, morphological, geographic and ecological characters, as well as different concepts and methods of population genetic, phylogeographic and phylogenetic analyses, should greatly enhance taxonomy. Studies combining population genetic, phylogeographic and phylogenetic approaches provide insights into patterns and processes at multiple levels in species history (Avise 2000; Funk & Omland 2003).

Sea stars of the genus Echinaster Müller & Troschel are commonly found from the intertidal zone to mid-shelf. They are associated with rocky shores, and sandy bottom or coral reef regions (Turner 2013). They reproduce sexually, developing a short-lived lecithotrophic brachiolaria larva (Turner 2013; Lopes & Ventura in press).

Currently, three Echinaster species are recognized from the Brazilian coast: E. (Othilia) guyanensis Clark, 1987, which is distributed from the Gulf of Mexico to Espírito Santo

(Brazil); E. (Othilia) echinophorus Lamarck,1816, which is distributed from the east coast of United States to northeast Brazil; and E. (Othilia) brasiliensis Müller &

Troschel, 1840, which is distributed from Cabo Frio (Brazil) to the Gulf of San Mathias

45

(Argentina) (Clark & Downey 1992). The Cabo Frio region is considered to be the southern distribution boundary of E. (O.) guyanensis, and the northern distribution boundary for E. (O.) brasiliensis (Hopkins et al. 2003). Another five species of

Echinaster have been ascribed to Brazil－Echinaster antonioensis Bernasconi, 1955,

Echinaster sentus Bernasconi, 1956, Echinaster spinulosus Bernasconi, 1956,

Echinaster densispinulosus Tommasi, 1970 Echinaster nudus Tommasi, 1970－but all of these are considered synonyms of E. (O.) brasiliensis (Clark & Downey 1992).

Morphological variation in Echinaster is widely recognized in the literature

(Atwood 1973; Scheibling & Lawrence 1982; Avila-Pires 1983; Campbell & Turner

1984; Clark 1987; Clark & Downey 1992; Hopkins et al. 2003). Some cryptic morphotypes of Echinaster have been differentiated into species from differences in growth rate, body size, reproductive strategy, larval development and genetic studies

(Atwood 1973; Tuttle & Lindahl 1980; Scheibling 1982; Scheibling & Lawrence 1982).

The controversy surrounding the number of species within the Echinaster genus can be attributed to the lack of good diagnostic characters (Fontanella & Hopkins 2003).

Morphological variation is found among the three Echinaster (Othilia) species from the

Brazilian coast, especially among the Cabo Frio and Espírito Santo populations where morphotypes are recognized (Avila-Pires 1983; Clark & Downey 1992; Hopkins et al.

2003). In fact, populations from Espírito Santo are considered to be comprised of E.

(O.) echinophorus and E. (O.) brasiliensis hybrids due to the extensive overlap in morphological characters (Avila-Pires 1983). Consequently, hybrid individuals were identified as E. (O.) guyanensis by Clark 1987. The first molecular phylogeny of the genus Echinaster reconstructed two lineages from the Brazilian coast and highlighted a sister relationship between Brazilian and Caribbean species (Lopes et al. unpublished).

46

Here, we used a combination of morphological, phylogenetic, phylogeographic and population genetic analyses to address the following questions: (1) Given the considerable morphological variability and the problems in species delimitation, are the currently-accepted Echinaster (Othilia) species appellations from Brazil valid? (2) Are morphological and molecular (DNA) data congruent? (3) How does genetic diversity vary within populations and different evolutionary units along the Brazilian coast? (4)

What is the level of genetic structure along the Brazilian coast? (5) What can we tell about the populations’ history?

Material and Methods

Samples

This study analysed 354 Echinaster (Othilia) sea stars sampled in 12 localities along 4,000 km of the Brazilian coast (Table 1). Specimens were preserved in 96% ethanol and have been deposited in the collections of the National Museum, Federal

University of Rio de Janeiro, Brazil.Collection access numbers are supplied in Table 1.

The São Sebastião/SP population were not included in morphometric analysis.

Sampled populations were taken from different habitats: sea stars from

Galinhos/RN were sampled in an estuarine region with salinity of 34-41; sea stars from

Ilha de Itamaracá/PE were also sampled from an estuary, but with greater salinity variation (28-44); sea stars from João Pessoa/PB and Arraial d'Ajuda were sampled in a coral reef with salinity of 34-35; sea stars from Salvador/BA were sampled in an estuarine region with salinity of 33.5-35.4t; and sea star from the Southeast and South populations (Vitória/ES to Florianópolis/SC) were sampled on a rocky coast and on a sand bottom, respectively, with salinity between 33.5-34.

47

Geometric morphometrics

Differences in sea star shape were evaluated using geometric morphometric analysis. Nine homologous landmarks (LMs) were tagged on digital images of each specimen using ImageJ software (Fig. 1A): LM1 represents the apex of the arm; LM2 and LM3 represent the fifth superomarginal spine on each side of the arm; LM4, LM5,

LM 6, LM7 and LM8 represent the inter-radius between arms; and LM9 represents the central disc.

Landmarks were aligned and superimposed to a common coordinate system using Generalized Procrustes Analysis (GPA) (Rohlf & Slice 1990), as implemented in the software PAST 3.07 (Hammer et al. 2001). This procedure minimizes the distance between landmark configurations and removes non-shape variation (position, orientation and scale) (Zelditch et al. 2004). The GPA coordinates were used to draw

‘Thin-Plate Spline Deformation Grids’ and to compute uniform and non-uniform components (partial warps). Partial warps are not related to size and can be used as variables in multivariate analysis (Zelditch et al. 2004).

Shape diversity amongst individuals was analyzed using Principal Components

Analysis (PCA) (Chatfield & Collins 1980), and Canonical Variate Analysis (CVA)

(Campbell & Atchley 1981) was performed to evaluate the inter-population variation using the software PAST 3.07 (Hammer 2011).

Morphological character analysis

Morphological analysis was based on taxonomic characters according to the descriptions of Clark & Downey (1992). Individuals from each locality were evaluated regarding the range length and shape of arms, distribution and size of spines, shape of the madreporite, and organization and form of skeletal plates. To this end, individuals

48

were measured by a digital caliper (0.01 mm precision) using the arm to the right of the madreporite as reference. We measured the range of radius (R), range of inter-radius (r), sizes of abactinal (Cab) and adambulacrals (Cad) spines, arm width at a distance of ¼ of the radius (L1) and the arm width at a distance of ½ of the radius (L2). L1 and L2 were used in a mathematical expression [(L1-L2 / L1)] to determine the proportionality of arm tapering. In addition, presence of secondary spines and numbers of papulae were recorded.

Individuals were subsequently treated with sodium hypochlorite to remove soft tissue and to expose the skeletal structure. The shape of plates (flattened or mammiform), the number of longitudinal series of plates (abactinal and marginal), the distinctness of the primary disc pentagon, and the organization of secondary plates were recorded for each individual.

DNA extraction, polymerase chain reaction (PCR), sequencing and alignment

Total DNA from tissues fixed in ethanol 95-100% was extracted using DNAeasy

Tissue Kit (Qiagen). Two fragments of mitochondrial DNA (mtDNA) were amplified:

607bp of the 16S and 668bp of the cytochrome oxidase subregion I (COI) genes. The

16S fragment was amplified using the forward primer 16SarL

(CGCCTGTTTATCAAAAACAT) (Palumbi 1994) and the reverse primer 16SAN-R

(GCTTACGCCGGTCTGAACTCAG) (Zanol et al. 2010). The COI fragment was amplified using the forward primer EchinoF1

(TTTCAACTAATCATAAGGACATTGG) (Ward et al. 2008) and the reverse primer

HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) (Folmer et al. 1994).

Amplification was performed in a total volume of 25μl reaction mixture containing 5μl green buffer, 1 μl of 0.4uM of the primer pair mix, 1 μl of DNA template, 3mM of

49

MgCl2, 0.2 mM of each dNTP and 1U Taq DNA Polymerase (Promega). The PCR reaction for the 16S fragment involved an initial denaturation at 94 °C (3 min), followed by 35 cycles of 94 °C (denaturation, 30 s), 50°C (annealing, 1 min), and 72 °C

(extension, 1 min), and a final extension step of 72 °C (10 min). The 16S protocol was modified slightly for COI, with initial denaturation at 94 °C (3 min), followed by five cycles of 94 °C (30 s), 48°C (1 min), 72 °C (1 min), 30 cycles at 94 °C (30 s), 50 °C (1 min), 72 °C (1 min), and a final extension step of 72 °C (10 min). PCR products were purified and sequenced by Macrogen Inc. (South Korea) and the Molecular Biodiversity

Laboratory, Federal University of Rio de Janeiro. Sequences were aligned using the

CLUSTALW algorithm in MEGA5.05 software (Tamura et al. 2011) following default parameters. A total of 196 sequences of 668 pb for the COI gene and 122 sequences of

607pb for the 16S gene were obtained for Brazilian coast. All haplotypes have been deposited in GenBank (Accession numbers KU235496-KU235548).

Phylogenetic analysis and genetic distance

Bayesian inference (BI) and maximum likelihood (ML) methods were used to examine the phylogenetic relationship among haplotypes. To avoid using sites unsuitable for phylogenetic analysis, we conducted a Gblock run in SeaView version 4

(Gouy et al. 2010) with less stringent selection to exclude some sites. A total of 496 pb for the COI gene and 444 pb for the 16S gene (after 8.8% Gblock cutoff) were retained.

We concatenated alignments to generate 35 sequences with a total length of 940 bp. The species Henricia obesa Sladen, 1889 and Henricia oculata Pennant, 1777

(Echinasteridae family), Coscinasterias tenuispina Lamarck, 1816, (Asteriidae family);

Tosia autralis Gray, 1840 (Goniasteridae family); and Patiria miniata Brandt, 1835

(Asterinidae family) were used as outgroups. The best-fit DNA substitution models for

50

COI (K2P+G model) and 16S (HKY+I model) were estimated using jModelTest 0.1.1

(Posada 2008) based on the Akaike information criterion (AIC).

Bayesian phylogenetic trees were constructed using MrBayes 3.1.2 (Ronquist &

Huelsenbeck 2003). Posterior probabilities were obtained with a Markov Chain Monte

Carlo (MCMC) algorithm with two independent runs of four chains for 10 million generations sampled every 1,000th iteration. Tracer v1.5 (Drummond & Rambaut 2007) was used to summarize the results of Bayesian analysis and to assess the convergence of the MCMC output by visually checking the effective sample sizes (ESS). The two runs were combined and 25% of the initial trees were discarded as burn-in. Maximum

Likelihood analysis was carried out using RAxML BlackBox (Stamatakis et al. 2008) on a partitioned dataset in the CIPRES Science Gateway (Miller et al. 2010). Support was assessed using a non-parametric bootstrap (BSP) with 1,000 resampling replicates.

Genetic distances among lineages were estimated using the Kimura two- parameter model (Kimura 1980) as implemented in MEGA 5.05 (Tamura et al. 2011).

Phylogeographic analysis

Haplotype networks for each fragment were estimated using the PEGAS package (Paradis 2010) in the statistical program R (R Core Team 2011) in order to provide an estimate of possible relationships among specimens. To estimate the genetic structure among and within populations and haplotype groups, fixation indices (FST) were calculated (Weir & Cockerham 1984) and genetic partitioning was estimated using an analysis of molecular variance (AMOVA) (Excoffier et al. 1992) implemented in

ARLEQUIN version 3.5.1.2 (Excoffier et al. 2005). A sequential Bonferroni correction

(Rice 1989) was used to determine significance levels for pairwise FST tests after applying 10,000 permutations.

51

Population and demographic analysis

The haplotype and nucleotide diversity values (Haplotype number [H], nucleotide diversity [p], haplotype diversity [Hd], and number of variable sites [S]) were calculated using ARLEQUIN version 3.5.1.2 (Excoffier et al. 2005). The same program was used to assess the history of effective population size by means of

Tajima's D (Tajima 1989) and Fu's Fs (Fu 1997) neutrality tests. In addition, the sum of squared deviations of mismatch distribution (SSD) were assessed under a population expansion model by 1000 random samples in order to have a broader view of the demographic history (Slatkin & Hudson 1991). The mismatch distributions were plotted using DNASP 5.0 (Librado & Rozas 2009). The analyses were carried out for each population and for the main haplotype groups recovered by analyses.

Results

Morphometric geometrics

The principal component analysis (PCA) (Fig. 2B) did not show clear separations amongst the morphological groups, instead presenting large overlaps and only individuals from Galinhos/RN being slightly differentiated (Fig.2B). The PCA showed that a large proportion of the variation is contained in few dimensions. Principal component 1 (PC1) explained 79.1% of the variation and contributed significantly to differentiation amongst the conformations. PC2 and PC3 explained 8.1% and 4.7% of the variation amongst conformations, respectively, but only PC1 was significant using a

Broken-Stick model criterion of random distribution. Thin-Plate Spline deformation grids showed that the variation observed on the PC1 axis was mainly related to distribution of spines along the arms (Fig. 2A). Individuals with negative scores on the

52

PC1 axis had large and sparsely distributed spines, and wider and shorter arms.

Individuals with positive scores on the PC1 axis had long and slender arms and shorter, more densely distributed spines. Intermediate conformations were found close to the mean of the PC1 axis. Individuals sampled from the Northeast (Galinhos/RN, João

Pessoa/PB, Salvador/BA and Arraial d'Ajuda/BA) all presented negative scores for the

PC1 axis, while individuals from other localities (Ilha de Itamaracá-PE, Vitória/ES,

Florianópolis/SC, Macaé/RJ, Búzios/RJ, Angra/RJ and Ilha Rasa-Arq. Cagarras/RJ) were distributed throughout the PC1 axis.

The canonical variation analysis (CVA) also showed large overlaps (Fig. 2C).

However, a MANOVA test showed that some localities were significantly different, with Galinhos/RN being the most differentiated population (Table S1).

Morphological analysis

Morphological analysis was not able to delimit the three originally-described species from the Brazilian coast. Considerable variation both within and among localities was observed for the characters used to discriminate Echinaster species, such as number and size of spines, form of the plates, arm thickness and number of papules.

Measurements for individuals from different populations are found in Table S2.

The largest individuals from the South and Southeast populations (Vitória/ES to

Arvoredo/SC) had long and tapering arms, small and densely-distributed spines (many secondary spines) and a flatted plate (Fig 3-5) (morphotype 1). However, another morphotype could be recognized in south and southeast (morphotype 2), particularly at

João Fernandes-Búzios/RJ. This morphotype was less common and had fewer secondary spines, slightly mammiform plates, larger spines and wider arms than the commonest morphotype (morphotype 1) (Fig. 4). Individuals from the Northern region

53

tended to have shorter arms that were proportionally wider from base to tip, larger sparsely-distributed spines (few or absence of secondary spines) and mammiform plates

(Fig 5-7). However, each Northern locality presented particular traits.

Individuals from Arraial d'Ajuda/BA (Fig. 5) and Salvador/BA (Fig. 6) were more similar to morphotype 2 of southern Brazil, having slightly mammiform plates.

Individuals from João Pessoa/PB (Fig. 7) had robust skeletons with highly mammiform plates, short and fat arms with large spines. Plates covered with spines did not have glass tubercles. Individuals from Ilha de Itamaracá/PE (Fig. 6) had long and slender arms, and all primary plates were covered with long spines. Individuals from

Galinhos/RN (Fig. 7) were small, had a delicate skeleton and few plates that were covered with slender spines. For both of these last two sampling sites, plates covered with spines were mammiform and glass tubercles were absent, and plates without spine were flat and glass tubercles were present.

All individuals presented a series of 11 longitudinal skeletal plates in the arms: ambulacrals, adradials, superomarginals, inferomarginals, adambulacrals on each side of the arms and one carinal on top of the arms. Transversal abradial plates appeared between adradial and superoradial plates, linking secondary plates as a discontinuous row, but were lacking in some individuals. The organization of the secondary plates varied among individuals from all populations. The secondary plates appear as a unique row or V-shaped of transversal plates, with or without linkage between abradial plates

(Fig. 3-7).

Phylogenetic analysis

The phylogenetic trees reconstructed by Maximum Likelihood (ML) (ln= -

4341.467) and Bayesian Inference (BI) using concatenated COI and 16S sequences (940

54

pb) showed that the three recognized species for the Brazilian coast are not reciprocally monophyletic (Fig 8). A well-supported clade included E.(O.) echinophorus from

Galinhos/RN, Ilha de Itamaracá/PE and João Pessoa/PB (North group). However, this clade was embedded in a major clade that included individuals of E.(O.) echinophorus,

E.(O.) guyanensis and E.(O.) brasiliensis from all other localities (South group) (Fig.

8). The K2P distance between sites from the North and South groups ranged from about 1.6-2.1% for COI and about 1.2-1.7% for 16S. The K2P distances among sites within each group varied from 0.1-0.4% for COI and 0.1-0.6% for 16S (Table S3).

Phylogeographic analysis

The statistical haplotype network analysis based on COI and 16S sequences reconstructed two haplotype groups; one that included sites from the North group

(Galinhos/RN, João Pessoa/PB and I. Itamaracá/PE) and another including localities from the South group (Salvador/BA, Arraial d'Ajuda/BA, Vitória/ES, Florianópolis/SC,

Macaé/RJ, Jõao Fernandes-Búzios/RJ, Angra/RJ, Ilha Rasa-Arq. Cagarras/RJ and São

Sebastião/SP) (Fig. 9). The two groups were separated by eight mutational steps for

COI, four mutational steps for 16S and did not share any haplotypes. Pairwise Fst values for both COI and 16S amongst the populations indicated strong population structuring between the North and South groups (Table S4). After pooling sampling sites according to the main groups, an AMOVA showed that the largest portion of the genetic variation observed for COI and 16S was within populations (Table 2).

Nevertheless, the results indicate significant variation between the North and South groups. The variance component was not significant only for the 16S analysis within the

North group.

55

Population and demographic analysis

Given the differentiation found between the two main groups, demographic analysis was performed considering each group (i.e. the North and South groups) as panmictic metapopulations.

For the COI fragment, the North group presented 49 sequences with eight polymorphic sites (S) distributed on nine haplotypes (H) (Hd=0.427 and Pi=0.0008) and the South group presented 147 sequences with 27 polymorphic sites (S) distributed in

24 haplotypes (H) (Hd=0.784 and Pi=0.0028). For 16S, the North group presented 33 sequences with three polymorphic sites (S) distributed on four haplotypes (H)

(Hd=0.176 and Pi=0.0003) and the South group presented 89 sequences with 15 polymorphic sites (S) distributed in 16 haplotypes (H) (Hd=0.726 and Pi=0.002). All diversity indices and values are shown in Table 3.

Values of Tajima's D and Fu’s Fs obtained from neutrality tests were significantly negative for both groups and for both gene fragments (COI and 16S)

(Table 3). Negative values for these metrics are predicted for populations that have undergone recent increases in size or have been subjected to selective sweep. Fu’s Fs values for COI and 16S sequences were significant for both the North and South groups.

Tajima’s D value for COI sequences was significant for both the North and South groups, but the value for the 16S fragment was significant only for the North group

(Table 3). Unimodal mismatch distributions were observed for COI and 16S both in the

North and South groups (Fig. 10). These mismatch distributions were not significantly different from a population expansion model for the two groups (SSD p-value > 0.05,

Table 3).

56

Discussion

The three named species of Echinaster found on the Brazilian coast were not clearly delimited by the morphological and molecular analyses employed in this study.

Broad and overlapping morphological variation was recorded among the same localities and this variability did not match mtDNA data. Lopes et al. (unpublished) highlighted similar incongruence with respect to Caribbean Echinaster species, with E.(O.) sentus and E.(O.) paucispinus not being reciprocally monophyletic. Discrepancies between morphological and molecular data have been widely reported for marine organisms

(Knowlton 2000; Howes & Jones 2002; Kvist et al. 2013; Pérez-Portela et al. 2013;

Lemer et al. 2014; Michonneau et al. 2015; Egea et al. 2016). As morphology is a complex and non-neutral marker, morphological taxonomy can lead to under/overestimation of biodiversity (Knowlton 1993).

Individuals morphologically defined as belonging to E. (O.) echinophorus

(Salvador/BA and Arraial d'Ajuda/BA) and E.(O.) guyanensis (Vitória/ES) were not genetically distinct from populations comprised of individuals defined as E.(O.) brasiliensis. Furthermore, the different lineages discriminated by mitochondrial markers did not exhibit exclusive morphological characters. For instance, short and slightly tapering arms and a robust skeleton are generally used to characterize E. (O.) echinophorus (Clark & Downey 1992; Hopkins et al. 2003). However, these characters were not observed in all populations of the North lineage, which only includes individuals originally referred to as E. (O.) echinophorus. Instead, these characters were present in some individuals from the South lineage, which includes putative E. (O.) brasiliensis. Additionally, the following characters were observed in individuals from both lineages: mammiform plates and large spines (typical of E. (O.) echinophorus), and secondary plates forming a “T” (typical of E.(O.) guyanensis) (Clark & Downey

57

1992). In short, the diagnostic characters typically used to discriminate Echinaster species proved insufficiently robust to discriminate species when many individuals and populations were analyzed.

Organisms can present different phenotypes in response to distinct environment conditions through phenotypic plasticity (Pigliucci 2001). Environmental factors can affect species parameters such as growth rate, size, reproduction and body morphology directly (Fernandez & Boudouresque 1997; Pigliucci 2001; Miner & Vonesh 2004;

Stoletzki & Schierwater 2005; Forsman 2015). Noticeable patterns were observed for the mammiform plates and skeletal robustness characters. Mammiform plates were more frequently observed in regions with warm water (Northeast Brazil), very delicate skeletons were observed in individuals from regions of higher salinity (Galinhos/RN), and robust skeletons were observed in individuals from coral reef ecosystems (João

Pessoa/PB and Arraial d'Ajuda/BA). Thus, it is pertinent to factor in the environmental conditions of the sampling sites in this study. There is a water temperature gradient along the Brazilian coast. As a consequence, the populations from Galinhos/RN to

Arraial d'Ajuda (Northeast Brazil) are under the influence of warmer sea waters compared to those from Vitória/ES to Florianópolis/SC (the Southeast and South of

Brazil). Fontanella & Hopkins (2003) related the difficulty in discriminating Echinaster species to the high phenotypic plasticity displayed by these sea stars. Therefore, the high morphological variability in Echinaster from Brazil is likely to be due to this phenotypic plasticity. Phenotypic plasticity influences the performance and ecological success of populations and species (Pigliucci 2001), but it is a challenge to understand how the mechanisms of plasticity act in species evolution (Via et al. 1995; Piersma &

Lindström 1997; Piersma & Drent 2003; Pigliucci 2005; St Juliana & Janzen 2007;

Forsman 2015).

58

Paraphyly and polyphyly in a gene tree might represent a transition stage in the speciation process before daughter lineages have resolved into reciprocally monophyletic species (Grahame & Avise 1995; Avise & Wollenberg 1997; Avise 2000;

Barraclough & Nee 2001; Funk & Omland 2003; De Queiroz 2007; Hörandl & Stuessy

2010). Our phylogenetic trees revealed a geographically-isolated subgroup (the North group), whose monophyletic set of haplotypes were embedded within a widely distributed and paraphyletic parental group (the South group). Low genetic divergences were obtained between the two allopatrically distributed lineages from the Brazilian coast, but no haplotypes were shared. The paraphyly revealed by our mtDNA trees might reflect retention of ancestral polymorphism in Brazilian Echinaster species with subsequent loss by the divergent North lineage. This phylogenetic pattern could indicate that the North group is diverging from the South group through an incipient speciation process (Avise 2000; Funk & Omland 2003; Hörandl & Stuessy 2010).

The distribution limits of the two lineages are located between the Salvador/BA

(12°57'21.09"S/38°39'33.51"W) and Ilha de Itamaracá/PE (7°42'1.42"S/34°51'19.67"W) sampling sites. The bifurcation of the South Equatorial Current into the Brazil and

North Equatorial Brazil currents occurs around 10°S and 31°W (Stramma et al. 1990) and may act as a barrier to gene flow, isolating these two lineages. Additionally, marked variation in sea levels during Pleistocene glacial cycles and variability in the

Brazil Current during the Holocene may have contributed to isolation of lineages and contributed to the speciation process (Jackson & Sheldon 1994; Palumbi 1994, 1996;

Rogers 1995; Rocha 2003).

The results of demographic analysis for both COI and 16S genes indicate that both the North and South lineages have undergone population expansion. Additionally, the low nucleotide diversity and the high haplotype variability in the South group

59

(H>0.5, Pi<0.005) are features of lineages that have undergone expansion from a small effective population size due to rapid growth and retention of new mutations (Grant &

Bowen 1998). The low nucleotide diversity and the low haplotype variability in the

North group (H<0.5, Pi<0.005) are features of lineages which have undergone a recent population bottleneck or a founder effect influenced by a single or a few mitochondrial lineages (Grant & Bowen 1998). Therefore, these features raise the possibility that the

South group underwent an expansion process with subsequent diversification of the

North group by a founder effect. Recent range expansion has also been suggested for E.

(O.) spinulosus along the Florida coast (Fontanella 2015).

Despite low genetic divergence and low variance among the populations within the North and South groups, significant genetic structure was obtained in each group, indicative of restricted gene flow along the coast. The pelagic larval phase of Echinaster species is relatively short (less than 3 days) (Atwood 1973; Turner 2013; Lopes and

Ventura, in press). The length of the planktonic period is often related to geographic range extent of species (Shanks et al. 2003). However, the relationship between planktonic period and geographic range may not be significant for some species, and other intrinsic attributes, such as larval behavior, site and time of gamete/larval release, adult dispersal and ocean currents, can have a more profound influence over dispersal capacity (Paulay & Meyer 2006). According to Lopes & Ventura (in press), the relationship between short planktonic larval development and a wide geographic range of distribution is not proven for Echinaster species on the Brazilian coast, as also speculated for E. (E.) sepositus from the Mediterranean Sea (Chatti et al. 2012). Chatti et al. (2012) found no significant degree of genetic differentiation among populations of

E. (E.) sepositus geographically separated by the Siculo-Tunisian strait, which has been recognized as an important barrier to gene flow in this region. Lack of geographic and

60

genetic structuring has also been reported for E (O.) spinulosus associated with a

‘‘Gulf-Atlantic’’ discontinuity along each side of the Florida coast (Fontanella 2015).

That author suggested that the main source of panmixia in this species was contemporary larval mixing. Despite the low genetic diversity observed here for

Echinaster and its wide geographic distribution, our results suggest that the short larval period seems to influence levels of genetic structure in the Echinaster populations of both North and South lineages of the Brazilian coast.

Conclusion

Our results suggest that morphological characters are not robust enough to discriminate Echinaster species, and observed variability in sea star morphology is probably due to phenotypic plasticity.

Our phylogenetic trees and demographic analyses provide insights into the evolutionary history of these sea stars. Most likely, an ancestral lineage from the

Brazilian coast underwent population expansion. Subsequently, a geographically restricted subgroup (the North group) randomly lost ancestral alleles by genetic drift and new alleles were formed by mutation, but ancestral polymorphism was maintained by the South group. This study points to a very recent ongoing speciation process in

Echinaster along the Brazilian coast, but without establishment of clear morphological diagnostic characters between the lineages.

Acknowledgments

This paper is part of the DS requirements of E.M.L. at the Biodiversity and

Evolutionary Biology Graduate program of the Federal University of Rio de Janeiro.

61

This manuscript was edited for proper English language, grammar, punctuation, spelling, and overall style by qualified native English John O' Brien. We are grateful to the "Projeto Coral Vivo" team for providing samples. We are grateful to CNPq (Process

483481/2012-2 Edital Universal 14/2012 to CRRV, Process 443900/2014-0 and

405411/2012-0 to PCP), CAPES-DGU Brazil-Spain Scientific Cooperation Program, the Spanish Government projects (CTM2010-22218 and CTM2013-48163 to CRRV,

EML, PCP) and FAPERJ (Process E-26/11-.015/2010d toPCP). Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio) provided the permits to collect the specimens in Brazilian coast.

References

Atwood, D.G. (1973) Larval development in the Asteroid Echinaster echinophorus. Biol Bull, 144, 1–11. Avila-Pires, T.C.S. (1983) Contribuição ao estudo do gênero Echinaster Müller & Troschel, 1840 (Echinodermata:Asteroidea) no litoral Brasileiro. An. Academia Brasileira de Ciências 55, 4, 431–448. Avise, J.C. (2000) Phylogeography: The history and formation of species. Harvard University Press, Cambridge, Massachusetts. Avise, J.C. & Wollenberg, K. (1997) Phylogenetics and the origin of species. Proceedings of the National Academy of Sciences of the United States of America, 94, 7748–55. Barraclough, T.G. & Nee, S. (2001) Phylogenetics and speciation. Trends in Ecology & Evolution, 16, 391–399. Campbell, D.B. & Turner, R.L. (1984) Echinaster graminicola, A new species of spinulosid sea star Echinodermata Asteroidea from the West coast of Florida. Proceedings of The Biological Society of Washington, 97, 167–178. Campbell, N.A. & Atchley, W.R. (1981) The Geometry of Canonical Variate Analysis. Systematic Zoology, 30, 268. Chatfield, C. & Collins, A.J. (1980) Introduction to Multivariate Analysis. Chapman & Hall, London. Chatti, N., Zitari-Chatti, R., Attia, M.H., Khadra, Y. Ben & Said, K. (2012) Very low mitochondrial diversity and genetic homogeneity in the starfish Echinaster sepositus along the Tunisian coast. Biochemical genetics, 50, 45–51. Clark, A.M. (1987) Notes on Atlantic and other Asteroidea-Echinasteridae. Bulletin of

62

the British Museum Natural History (Zoology), 53, 65–78. Clark, A.M. & Downey, M.E. (1992) Starfishes of the Atlantic. Chapman and Hall, London. Drummond, A.J. & Rambaut, A. (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC evolutionary biology, 7, 214. Egea, E., David, B., Choné, T., Laurin, B., Féral, J.P. & Chenuil, A. (2016) Morphological and genetic analyses reveal a cryptic species complex in the echinoid Echinocardium cordatum and rule out a stabilizing selection explanation. Molecular Phylogenetics and Evolution, 94, 207–220. Excoffier, L., Laval, G. & Schneider, S. (2005) Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1, 47–50. Excoffier, L., Smouse, P.E. & Quattro, J.M. (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics, 131, 479–491. Fernandez, C. & Boudouresque, C. (1997) Phenotypic plasticity of Paracentrotus lividus (Echinodermata:Echinoidea) in a lagoonal environment. Marine Ecology Progress Series, 152, 145–154. Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular marine biology and biotechnology, 3, 294–299. Fontanella, F.M. (2015) Mitochondrial DNA panmixia in the little brown seastar Echinaster spinulosus suggests a recent population expansion. Mitochondrial DNA, 1736, 1–7. Fontanella, F.M. & Hopkins, T.S. (2003) Preliminary phylogeny of Echinaster (Othilia) from the Gulf of Mexico based on morphological characters (Echinodermata: Asteroidea). Echinoderm Research 2001, 91–95. Forsman, A. (2015) Rethinking phenotypic plasticity and its consequences for individuals, populations and species. Heredity, 115, 276–284. Fu, Y.X. (1997) Statistical tests of neutrality of mutations against population growth, hitchhiking and background selection. Genetics, 147, 915–925. Funk, D.J. & Omland, K.E. (2003) Species-level paraphyly and polyphyly: frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annual Review of Ecology, Evolution, and Systematics, 34, 397–423. Gouy, M., Guindon, S. & Gascuel, O. (2010) SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Molecular Biology and Evolution, 27, 221–224. Grahame, J. & Avise, J.C. (1995) Molecular markers, natural history and evolution. Grant, W.S. & Bowen, B.W. (1998) Shallow population histories in deep evolutionary lineages of marine fishes: Insights from sardines and anchovies and lessons for conservation. Journal of Heredity, 89, 415–426. Hammer, Ø. (2011) PAST - PAleontological STatistics reference manual. Natural

63

History, 1–205. Hausdorf, B. (2011) Progress toward a general species concept. Evolution, 65, 923–931. Hopkins, T.S., Fontanella, E.M. & Ventura, C.R.R. (2003) Morphological diagnosis of three Brazilian sea stars of the genus Echinaster (Sub-genus Othilia). Echinoderm Research 2001, 1, 97–103. Hörandl, E. & Stuessy, T.F. (2010) Paraphyletic groups as natural units of biological classification. Taxon, 59, 1641–1653. Howes, L. & Jones, R. (2002) Interactions between zona pellucida glycoproteins and sperm proacrosin/acrosin during fertilization. Journal of reproductive immunology, 53, 181–92. Jackson, J.B.C. & Sheldon, P.R. (1994) Constancy and Change of Life in the Sea [and Discussion]. Philosophical Transactions of the Royal Society B: Biological Sciences, 344, 55–60. Kimura, M. (1980) A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111–120. Knowlton, N. (2000) Molecular genetic analyses of species boundaries in the sea. Hydrobiologia, 420, 73–90. Knowlton, N. (1993) Sibling Species in the Sea. Annual Review of Ecology and Systematics, 24, 189–216. Kvist, J., Wheat, C.W., Kallioniemi, E., Saastamoinen, M., Hanski, I. & Frilander, M.J. (2013) Temperature treatments during larval development reveal extensive heritable and plastic variation in gene expression and life history traits. Molecular ecology, 22, 602–19. Lemer, S., Buge, B., Bemis, A. & Giribet, G. (2014) First molecular phylogeny of the circumtropical bivalve family Pinnidae (Mollusca, Bivalvia): Evidence for high levels of cryptic species diversity. Molecular Phylogenetics and Evolution, 75, 11– 23. Librado, P. & Rozas, J. (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25, 1451–1452. Mallet, J. (2007) Concepts of Species. Encyclopedia of Life, 1–15. Michonneau, F., McPherson, S., O’Loughlin, P.M. & Paulay, G. (2015) More than meets the eye: diversity and geographic patterns in sea cucumbers. BioRxiv, 1-26. Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES science gateway for inference of large phylogenetic trees. In: 2010 Gateway Computing Environments Workshop, GCE 2010. . Miner, B.G. & Vonesh, J.R. (2004) Effects of fine grain environmental variability on morphological plasticity. Ecology Letters, 7, 794–801. Padial, J.M., Miralles, A., Riva, I. de la & Vences, M. (2010) The integrative future of taxonomy. Frontiers in zoology, 7, 1–14. Palumbi, S.R. (1994) Genetic divergence, reproductive isolation, and marine speciation. Annual Review of Ecology and Systematics, 25, 547–572.

64

Palumbi, S.R. (1996) What can molecular genetics contribute to marine biogeography? An urchin’s tale. Journal of Experimental Marine Biology and Ecology, 203, 75– 92. Paradis, E. (2010) pegas: an R package for population genetics with an integrated- modular approach. Bioinformatics, 26, 419–420. Paulay, G. & Meyer, C. (2006) Dispersal and divergence across the greatest ocean region: Do larvae matter? Integrative and comparative biology, 46, 269–81. Pérez-Portela, R., Almada, V. & Turon, X. (2013) Cryptic speciation and genetic structure of widely distributed brittle stars (Ophiuroidea) in Europe. Zoologica Scripta, 42, 151–169. Piersma, T. & Drent, J. (2003) Phenotypic flexibility and the evolution of organismal design. Trends in Ecology & Evolution, 18, 228–233. Piersma, T. & Lindström, Å. (1997) Rapid reversible changes in organ size as a component of adaptive behaviour. Trends in Ecology & Evolution, 12, 134–138. Pigliucci, M. (2005) Evolution of phenotypic plasticity: where are we going now? Trends in ecology & evolution, 20, 481–6. Pigliucci, M. (2001) Phenotypic Plasticity: Beyond Nature and Nurture,. Johns Hopkins University Press, Baltimore, Maryland. Posada, D. (2008) jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution, 25, 1253–1256. De Queiroz, K. (2007) Species concepts and species delimitation. Systematic biology, 56, 879–86. R Core Team (2011) R: A Language and environment for statistical computing. R Foundation for Statistical Computing, 409. Rice, W.R. (1989) Analyzing tables of statistical tests. Evolution, 43, 223–225. Rocha, L.A. (2003) Patterns of distribution and processes of speciation in Brazilian reef fishes. Journal of Biogeography, 30, 1161–1171. Rogers, A.R. (1995) Genetic evidence for a pleistocene population explosion published. Evolution, 49, 608–615. Rohlf, F.J. & Slice, D.E. (1990) Extensions of the Procustes methods for the optimal superimposition of landmarks. Systematic Zoology, 39, 40–59. Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. Scheibling, R.E. (1982) Differences in body size and growth rate between morphs of Echinaster (Echinodermata:Asteroidea) from the eastern Gulf of Mexico. International Echinoderms Conference, 291–298. Scheibling, R.E. & Lawrence, J.M. (1982) Differences in reproductive strategies of morphs of the genus Echinaster (Echinodermata: Asteroidea) from the Eastern Gulf of Mexico. Marine Biology, 70, 51–62. Shanks, A.L., Grantham, B. a. & Carr, M.H. (2003) Propagule dispersal distance and the size and spacing of marine reserves. Ecological Applications, 13, 159–169.

65

Slatkin, M. & Hudson, R.R. (1991) Pairwise comparisons of mitochondrial DNA sequences in stable and exponentially growing populations. Genetics, 129, 555– 562. St Juliana, J.R. & Janzen, F.J. (2007) Can natural phenotypic variances be estimated reliably under homogeneous laboratory conditions? Journal of Evolutionary Biology, 20, 1406–1414. Stamatakis, A., Hoover, P. & Rougemont, J. (2008) A rapid bootstrap algorithm for the RAxML Web servers. Systematic biology, 57, 758–771. Stoletzki, N. & Schierwater, B. (2005) Genetic and color morph differentiation in the Caribbean sea anemone Condylactis gigantea. Marine Biology, 147, 747–754. Stramma, L., Ikeda, Y. & Peterson, R.G. (1990) Geostrophic transport in the Brazil current region north of 20°S. Deep Sea Research Part A. Oceanographic Research Papers, 37, 1875–1886. Tajima, F. (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123, 585–595. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011) MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony method. Molecular Biology and Evolution, 28, 2731–2739. Turner, R.L. (2013) Echinaster. In: J.M. Lawrence (Ed) Starfish: Biology & Ecology of the Asteroidea (pp. 200–214). The Johns Hopkins University Press, Baltimore. Maryland. Tuttle, R.D. & Lindahl, R. (1980) Genetic variability in 3 cooccurring forms of the starfish genus Othilia (= Echinaster). Experientia, 36, 923–925. Via, S., Gomulkiewicz, R., De Jong, G., Scheiner, S.M., Schlichting, C.D. & Van Tienderen, P.H. (1995) Adaptive phenotypic plasticity: consensus and controversy. Trends in ecology & evolution, 10, 212–217. Ward, R.D., Holmes, B.H. & O’Hara, T.D. (2008) DNA barcoding discriminates echinoderm species. Molecular ecology resources, 8, 1202–11. Weir, B.S. & Cockerham, C.C. (1984) Estimating F-statistics for the analysis of population structure. Evolution, 38, 1358–1370. Zanol, J., Halanych, K.M., Struck, T.H. & Fauchald, K. (2010) Phylogeny of the bristle worm family Eunicidae (Eunicida, Annelida) and the phylogenetic utility of noncongruent 16S, COI and 18S in combined analyses. Molecular Phylogenetics and Evolution, 55, 660–676. Zelditch, M.L., Swiderski, D.L., Sheets, H.D. & Fink, W.L. (2004) Geometric morphometrics for biologists: a primer. Elsevier Academic Press, San Diego, CA.

66

Figures

Fig. 1. A. Distribution of homologous landmarks (LMs) recorded. B. Superimposed LMs of all individuals represented in a Cartesian plan.

67

Fig. 2. Morphometric analysis. A- Deformation grids of the different forms obtained by the Thin-Plate Spline function, B- Principal Component Analysis (PCA) with two extreme morphotypes represented by photos, C- Canonical Variate Analysis (CVA). Ellipses represent 95% significance.

68

Fig. 3. Representative specimens from the Arvoredo/SC (A-G) and São Sebastião/SP (H-O) localities: A/H Abactinal view, B/I Actinal view, C/J Lateral view of the arm, D/L Abactinal skeletal view, E/M Actinal skeletal view, F/N Lateral view of the arm skeleton, G/O Pentagon skeleton in detail.

69

Fig. 4. Representative specimens of the two morphotypes (more common Morphotype 1 A-G and Morphotype 2 H-O) from the Jõao Fernandes-Búzios/RJ locality: A/H Abactinal view, B/I Actinal view, C/J Lateral view of the arm, D/L Abactinal skeletal view, E/M Actinal skeletal view, F/N Lateral view of the arm skeleton, G/O Pentagon skeleton in detail.

70

Fig. 5. Representative specimens from the Vitória/ES (A-G) and Arraial d'Ajuda (H-O) localities: A/H Abactinal view, B/I Actinal view, C/J Lateral view of the arm, D/L Abactinal skeletal view, E/M Actinal skeletal view, F/N Lateral view of the arm skeleton, G/O Pentagon skeleton in detail.

71

Fig. 6. Representative specimens from the Salvador/BA (A-G) and Ilha de Itamaracá/PE (H-O) localities: A/H Abactinal view, B/I Actinal view, C/J Lateral view of the arm, D/L Abactinal skeletal view, E/M Actinal skeletal view, F/N Lateral view of the arm skeleton, G/O Pentagon skeleton in detail.

72

Fig. 7. Representative specimens from the João Pessoa/PB (A-G) and Galinhos/RN (H- O) localities: A/H Abactinal view, B/I Actinal view, C/J Lateral view of the arm, D/L Abactinal skeletal view, E/M Actinal skeletal view, F/N Lateral view of the arm skeleton, G/O Pentagon skeleton in detail.

73

Fig. 8. Phylogenetic analysis. Maximum likelihood tree based on the concatenated dataset of two mtDNA fragments from the COI and 16s genes (total: 940 bp), implementing different mutation models for each partition. Bootstrap scores and posterior probabilities obtained from the ML and BI, respectively, are shown on the nodes.

74

Fig. 9. Haplotype network based on COI and 16S sequences. The main reconstructed groups (named as the North and South groups) are indicated in haplotype networks and mapped to the Brazilian coast showing sampled localities. Sizes of haplotype circles are proportional to the number of individuals with that haplotype. Crossbars indicate the number of mutations between the two groups.

75

Fig. 10. Mismatch histograms based on the COI and 16S fragments of the North and South groups. Observed pairwise substitution differences (black line) are compared with values simulated under a population expansion model (dashes line).

76

Tables Table 1. Numbers of individuals sampled in each locality (City/State) along the Brazilian coast, geographic coordinates and collection assess number. [The Southeast geopolitical region of Brazil is represented by Vitória/ES to São Sebastião/SP locality, the Northeast geopolitical region of Brazil is represented by Galinhos/RN to Arraial d'Ajuda, and the South geopolitical region of Brazil is represented by Florianópolis/SC locality]

Colection sites Latitude Longitude Collection Number N

Florianópolis/Santa Catarina -27.2977 -48.3016 EQMN3895/3897 12

São Sebastião/São Paulo -23.754 -45.412 EQMN4064 20

Angra dos Reis/Rio de Janeiro -22.9269 -44.4475 EQMN4071 44

Ilhas Cagarras/Rio de Janeiro -23.0111 -43.1955 EQMN4093 44

João Fernandes-Búzios/Rio de Janeiro -22.7481 -41.8813 EQMN4060/4061 44

Macaé/Rio de Janeiro -22.4527 -41.7035 EQMN4095 40

Vitória/Espirito Santo -20.3135 -40.2837 EQMN4073 38

Arraial d'Ajuda/Bahia -16.4927 -39.0737 EQMN4066 6

Salvador/Bahia -12.8622 -38.5762 EQMN4070 30

João Pessoa/Paraíba -7.76893 -34.3016 EQMN4065 12

Ilha de Itamaracá/Pernambuco -7.16843 -34.9352 EQMN4073 30

Galinhos/Rio Grande do Norte -5.08734 -36.454 EQMN4068 34

77

Table 2. Analysis of molecular variance (AMOVA) for the COI and 16S sequences of the two reconstructed groups (North and South groups).

16S

North group

Source of variation d.f. Sum of squares Variance components Percentage of variation

Among localities 2 0.186 0.00021 Va 0.23

Within localities 30 2.727 0.09090 Vb 99.77

Total 32 9.739 0.09111

Fixation Index FST: 0.00234 P-value = 0.45748+0.01252

South group

Source of variation d.f. Sum of squares Variance components Percentage of variation

Among localities 8 15.874 0.14523 Va 20.76

Within localities 80 44.353 0.55442 Vb 79.24

Total 88 60.228 0.69965

Fixation Index FST: 0.20758 P-value = 0.00000+-0.00000

COI

North group

Source of variation d.f. Sum of squares Variance components Percentage of variation

Among localities 2 1.026 0.02676 Va 12.38

Within localities 46 8.713 0.18942 Vb 87.62

Total 48 9.739 0.21618

Fixation Index FST: 0.12380 P-value = 0.00782+-0.00280

South group

Source of variation d.f. Sum of squares Variance components Percentage of variation

Among localities 8 30.846 0.19953 Va 22.14

Within localities 138 96.821 0.70160 Vb 77.86

Total 146 127.667 0.90113

Fixation Index FST: 0.22142 P-value = 0.00000+-0.00000

78

Table 3. Genetic diversity and results of locality genetic tests for the North and South groups.

SSD Hd Pi Theta_S Theta_pi Tajima's Tajima's FS p- N H S FS SSD p- (SD) (SD) (SD) (SD) D D p-value value value 16S

0.726 0.002 2.964 1.486 South group 89 16 15 -1.401 0.061 -8.672 0.000 0.004 0.634 (0.043) (0.001) (1.038) (1.004) 0.176 0.0003 0.739 0.181 North group 33 4 3 -1.728 0.039 -3.542 0.001 0.0001 0.517 (0.088) (0.0004) (0.463) (0.268) COI

0.784 0.0028 4.852 1.908 South group 147 24 27 -1.748 0.010 -14.425 0.000 0.006 0.591 (0.024) (0.083) (1.418) (1.210) 0.427 0.0008 2.018 0.585 North group 49 9 9 -1.995 0.004 -7.130 0.000 0.0009 0.452 (0.087) (0.0006) (0.852) (0.531) N, number of individuals; H, number of haplotypes; Hd, haplotype diversity; S, polymorphic sites; Pi, nucleotide diversity; (SD) standard deviation; SSD, sum of squared deviations of mismatch distribution from predictions under a population expansion model. Significant P-values are in bold type.

79

Supplementary material Table S1. Sequential Bonferroni-corrected p-values obtained by MANOVA analysis. Bold number represent significant values. GA: Galinhos/RN, JP: João Pessoa/PB, AJ: Arraial d'Ajuda/BA, VI: Vitória/ES, JF: João Fernandes-Búzios/RJ, AG: Angra dos Reis/RJ, AR: Florianópolis/SC, SA: Salvador/BA, PE: I. Itamaracá/PE, MA: Macaé/RJ, RA:Ilhas Cagarras/RJ.

VI AR AJ JP GA MA AG JF RA SA

VI

AR 0.352 AJ 0.808 NA JP 0.296 NA NA

GA 0.000 0.004 0.197 0.015

MA 0.139 0.640 0.368 0.088 0.000

AG 0.001 0.406 0.151 0.033 0.000 0.049

JF 0.169 0.684 0.402 0.117 0.000 0.963 0.060

RA 0.027 0.586 0.281 0.101 0.000 0.653 0.107 0.642

SA 0.572 0.381 0.939 0.676 0.036 0.030 0.001 0.028 0.015 PE 0.627 NA NA NA 0.001 0.645 0.079 0.558 0.338 0.575

80

Table S2. Traditional morphology measurements taken from 10 individuals from each localities. GA: Galinhos/RN, JP: João Pessoa/PB, AJ: Arraial d'Ajuda/BA, VI: Vitória/ES, JF: João Fernandes-Búzios/RJ, AG: Angra dos Reis/RJ, AR: Florianópolis/SC, SA: Salvador/BA, PE: I. Itamaracá/PE, MA: Macaé/RJ, RA:Ilhas Cagarras/RJ, SS: São Sebastião/SP. (L1-L2 / L1) Number of Abactinal spine Abactinal spine Adambulacral R (cm) % arm tapering papules length (cm) width (cm) spine length (cm) AR 45.09 (33.5-60.9) 41.1 (27.1-55.1) 9-19 1.12 (0.87-1.24) 0.50 (0.46-0.6) 1.03 (0.8-1.3) SS 53.8(55.0-71.0) 48.7 (30.7-66.6) 15 -20 1.3 (1.1-1.5) 0.73 (0.6-0.9) 1.03 (0.8-1.3) AG 50.1 (38.7-67.3) 37.2 (11.7-46.05) 15-20 1.32 (0.9-2.27) 0.50 (0.31-0.71) 1.09 (0.8-1.27) JF 50.5 (35.6-70.1) 35.3 (11.7-47.2) 16-20 1.7 (0.8-2.9) 0.60 (0.33-0.97) 1.08 (0.8-1.35) RA 48.3 (40.2-65.4) 40.3 (15.7-43.2) 16-20 1.7 (0.85-1.9) 0.60 (0.30-0.94) 1.07 (0.7-1.4) MA 50.3 (41.2-69.5) 35.3 (13.6-40.5) 16-20 1.7 (0.8-2.1) 0.60 (0.34-0.98) 1.09 (0.8-1.5) VI 54.3 (40.7-73.6) 37.8 (13.2-50.2) 9 -14 1.85 (1.49-2.22) 0.72 (0.58-0.92) 1.13 (0.78-1.49) AJ 39.9 (33.3-44.4) 28.3 (22.7-33.1) 12-19 1.83 (1.7-2.0) 0.72 (0.7-0.81) 0.98 (0.8-1.09) SA 39.4 (34.0-44.0) 33.5 (25.0-42.8) 14-16 2.0 (1.5-2.2) 0.84 (0.7-1.3) 1.04 (0.8-1.5) PE 46.2 (37.0-59.0) 42.1 (30.0-57.1) 16-20 1.73 (0.9-2.3) 0.74 (0.6-0.9) 0.97 (0.9-1.2) JP 47.7 (37.2-53.2) 25.2 (14.8-38.4) 15-27 2.78 (2.6-3.0) 0.93 (0.89-1.01) 1.22 (1.06-1.45) GA 29.80 (20.7-38.8) 29.0 (10.8-38.8) 9-25 1.86 (1.7-2.6) 0.69 (0.55-0.96) 0.87(0.7-1.07)

81

Table S3. Pairwise K2P distances among localities for 16S and COI sequences. Standard error estimates are shown above the diagonal. GA: Galinhos/RN, JP: João Pessoa/PB, AJ: Arraial d'Ajuda/BA, VI: Vitória/ES, JF: João Fernandes-Búzios/RJ, AG: Angra dos Reis/RJ, AR: Florianópolis/SC, SA: Salvador/BA, PE: I. Itamaracá/PE, MA: Macaé/RJ, RA:Ilhas Cagarras/RJ, SS: São Sebastião/SP.

16S AR AJ GA JP JF RA SA SS VI MA AG PE AR 0.001 0.004 0.004 0.002 0.001 0.001 0.001 0.002 0.001 0.001 0.004 AJ 0.004 0.005 0.005 0.002 0.001 0.001 0.002 0.003 0.001 0.001 0.005 GA 0.013 0.015 0.001 0.004 0.004 0.005 0.004 0.005 0.004 0.005 0.000 JP 0.016 0.017 0.003 0.004 0.004 0.005 0.004 0.005 0.004 0.005 0.001 JF 0.004 0.005 0.013 0.015 0.002 0.002 0.001 0.001 0.002 0.002 0.004 RA 0.004 0.004 0.013 0.015 0.003 0.001 0.001 0.002 0.001 0.001 0.005 SA 0.003 0.003 0.013 0.016 0.004 0.002 0.001 0.002 0.001 0.000 0.005 SS 0.004 0.006 0.013 0.015 0.004 0.003 0.003 0.002 0.001 0.001 0.004 VI 0.004 0.007 0.014 0.016 0.003 0.004 0.004 0.004 0.002 0.002 0.005 MA 0.003 0.004 0.012 0.015 0.004 0.003 0.002 0.003 0.004 0.001 0.004 AG 0.003 0.003 0.013 0.015 0.004 0.002 0.001 0.003 0.004 0.002 0.005 PE 0.014 0.016 0.001 0.003 0.013 0.014 0.014 0.013 0.014 0.013 0.013 COI AJ GA JP AR JF RA MA AG SS VI SA PE AJ 0.005 0.006 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.001 0.006 GA 0.020 0.001 0.005 0.005 0.005 0.005 0.005 0.005 0.005 0.005 0.001 JP 0.021 0.002 0.005 0.005 0.005 0.005 0.005 0.005 0.005 0.005 0.001 AR 0.004 0.018 0.020 0.002 0.001 0.001 0.001 0.001 0.001 0.001 0.005 JF 0.004 0.017 0.018 0.003 0.001 0.001 0.001 0.001 0.001 0.002 0.005 RA 0.003 0.018 0.019 0.003 0.003 0.001 0.001 0.001 0.001 0.001 0.005 MA 0.004 0.018 0.020 0.003 0.003 0.003 0.001 0.001 0.001 0.001 0.005 AG 0.004 0.018 0.020 0.003 0.003 0.003 0.004 0.001 0.001 0.001 0.005 SS 0.004 0.017 0.019 0.003 0.002 0.003 0.003 0.003 0.001 0.001 0.005 VI 0.004 0.016 0.018 0.003 0.002 0.003 0.003 0.003 0.002 0.002 0.005 SA 0.002 0.019 0.021 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.005 PE 0.021 0.001 0.002 0.019 0.017 0.019 0.019 0.019 0.018 0.017 0.020

82

Table S4. Pairwise Fst values for COI and 16S mtDNA fragments based on Tamura– Nei distances among localities of Echinaster along the Brazilian coast. GA: Galinhos/RN, JP: João Pessoa/PB, AJ: Arraial d'Ajuda/BA, VI: Vitória/ES, JF: João Fernandes-Búzios/RJ, AG: Angra dos Reis/RJ, AR: Florianópolis/SC, SA: Salvador/BA, PE: I. Itamaracá/PE, MA: Macaé/RJ, RA:Ilhas Cagarras/RJ, SS: São Sebastião/SP. Values in bold represent statistical significance (p<0.05). Negative Fst values are depicted as 0.

COI AJ JF AS MA RA AG SS AR VI JP PE GA AJ 0 JF 0.522 0 AS 0 0.579 0 MA 0.134 0.228 0.185 0 RA 0.133 0.165 0.181 0.019 0 AG 0 0.434 0.017 0.068 0.070 0 SS 0.223 0.056 0.274 0 0.006 0.152 0 AR 0.137 0.110 0.185 0 0 0.080 0 0 VI 0.787 0 0.821 0.443 0.360 0.670 0.227 0.296 0 JP 0.983 0.883 0.986 0.884 0.876 0.951 0.850 0.865 0.940 0 PE 0.982 0.883 0.985 0.884 0.876 0.950 0.850 0.865 0.939 0.004 0 GA 0.984 0.897 0.986 0.896 0.889 0.957 0.865 0.879 0.947 0.006 0.013 0 16S AJ JF AS MA RA AG SS AR VI JP PE GA AJ 0 JF 0.633 0 AS 0 0.681 0 MA 0.202 0.238 0.256 0 RA 0.230 0.186 0.283 0 0 AG 0.017 0.499 0.068 0.065 0.094 0 SS 0.337 0.052 0.390 0 0 0.202 0 AR 0.254 0.112 0.306 0 0 0.120 0 0 VI 0.861 0 0.885 0.445 0.385 0.722 0.225 0.297 0 JP 0.967 0.869 0.973 0.838 0.844 0.924 0.816 0.825 0.933 0 PE 0.965 0.868 0.971 0.838 0.843 0.923 0.816 0.825 0.932 0 0 GA 0.984 0.897 0.986 0.867 0.870 0.946 0.846 0.853 0.953 0 0 0

83

Capítulo 3

Development of the sea star Echinaster (Othilia) brasiliensis (Asteroidea:Echinasteridae): a comparative analysis making inference about the evolution of developmental modes and skeletal plates in Asteroidea.

84

Development of the sea star Echinaster (Othilia) brasiliensis (Asteroidea:Echinasteridae): a comparative analysis making inference about the evolution of developmental modes and skeletal plates in Asteroidea.

Authors: Elinia Medeiros Lopes1 and Carlos Renato Rezende Ventura1*

1 Departamento de Invertebrados, Laboratório de Echinodermata

Museu Nacional / Universidade Federal do Rio de Janeiro (UFRJ)

Quinta da Boa Vista, s/no, São Cristóvão

Zip code: 20940-040

Rio de Janeiro, RJ, Brazil

*author for correspondence: [email protected]

Keywords: Brachiolaria larva; lecithotrophic development; juvenile skeleton; Echinasteridae; homology.

Abstract

We describe the initial development and juvenile morphology of the sea star Echinaster

(Othilia) brasiliensis to explore about evolutionary developmental modes and skeletal homologies.

This species produces large buoyant eggs 0.6±0.03mm diameter and has a typical lecithotrophic brachiolaria larva. The planktonic brachiolaria larva is formed around 2-4 days after fertilization, when cilia cover the surface. Early juveniles are completely formed by 18 days of age and initial growth is supported by maternal nutrients while the stomach continues to develop until 60 days after fertilization, when the juveniles reach about 0.5 mm of radius length. The madreporite was observed

85

at 88 days after fertilization. In the earliest E. (O.) brasiliensis juvenile skeleton, the madreporite and odontophore are homologous to those of other recent non-paxillosid asteroids and follow the Late

Madreporic Mode. The emergence of plates related to ambulacral system follows the Ocular Plate

Rule. The development and juvenile skeletal morphology of this species are similar to that of the few other species in the genus Echinaster already studied. This study corroborates the notion that the mode of development, with a short-lived lecithotrophic brachiolaria larva, in all Echinaster species shares the similar pattern and it might be conserved throughout the evolutionary history of the group.

Introduction

The reproductive strategies in the Asteroidea are associated with different traits such as egg size, parental investment, type of larva, time of embryonic development, duration of the larva and fecundity (McEdward and Janies, 1993, 1997; McEdward and Miner, 2001). These traits are important to understand the variations in the life-history patterns of these species and the evolutionary processes involved (McEdward, 2000). Differences in reproductive strategy, mode of reproduction, embryology and larval morphology are used to distinguish cryptic species of sea stars such as the genus Patiriella, Tosia, Asterias and Echinaster (Scheibling, 1982; Watts et al., 1982;

Hart et al., 2003, 2006; Harper and Hart, 2005; Naughton and O’Hara, 2009). In addition, understanding the arrangement of the skeletal primary structures during the early post-metamorphic stages of the Asteroidea allows identifying true homologies and ontogenetic patterns inferred from evolutionary models (the Ocular Plate Rule and the Madreporite Mode Appearance) (Mooi and

David, 2000; Gale, 2011).

Sea stars have a great variety of reproductive strategies. During the life cycle, sea stars can develop either one type of larva (brachiolaria or bipinnaria) or two types of larva (bipinnaria + brachiolaria) (Byrne, 2006). Their larvae can be feeding or non-feeding and can develop either in a planktonic or in a benthic habitat, or have intragonadal development (brooding) (McEdward and

Miner, 2001). Sizes of eggs and the amount of energy present in them influence the type of larval development, the habitat where they develop and the dispersal potential (McEdward, 2000). The diversity in life history varies among sea stars. In the family Asterinidae, for example, displays a great variety of reproductive strategies with up to five different initial modes of development (Byrne,

86

2006). The evolution of larval development may have greatly influenced the speciation of this group.

The species of Echinasteridae already studied have a similar lecithotrophic brachiolaria larvae developement (Chia, 1966; Atwood, 1973; Siddall, 1979; McEdward and Chia, 1991; Mercier and

Hamel, 2008; Eernisse, 2010). However, only a couple of species of the Henricia and Echinaster in this family have been studied regarding development and life-cycle (Mercier and Hamel, 2008;

Eernisse, 2010; Turner, 2013; Masterman, 1902)

Echinaster (Othilia) brasiliensis Müller and Troschel, 1842 can be found from Cabo Frio

(Brazil) to the Gulf of San Matias (Argentina). Habitat destruction, pollution, global climatic changes, population reduction and fisheries (ornamentation and aquarium trade) have put this species on the official Red List of Threatened Species of Brazil (Amaral and Leite, 2008). Along the

Brazilian coast, two other species of Echinaster (Othilia) are present: E. (O.) guyanensis Clark,

1987, which can be found from the Gulf of Mexico to the coast of Espírito Santo (Brazil) and E. (O.) echinophorus (Lamarck,1816), which can be found from the East coast of the United States to the

Southeastern coast of Brazil. However, the taxonomic categorization of these species is controversial because of the great variation in morphological features, which makes identification difficult (Clark and Downey, 1992). This study of the development of Echinaster (Othilia) brasiliensis shall contribute to elucidate differences among these species.

Therefore, considering the ecological, taxonomic and evolutionary importance of understanding life history, the goal of this study was (1) to describe the development (embryological, metamorphic and post-metamorphic) of E. (O.) brasiliensis in the laboratory, (2) to estimate its initial growth, as well as (3) to make inferences about the evolution of developmental modes of

Echinaster species.

Materials and Methods

Adults of E. (O.) brasiliensis were collected by snorkeling from the shallow subtidal to three meters deep at the João Fernandes Beach – Armação de Búzios/RJ, Brazil (22o 45´ S; 42o 53´ W).

Specimens were acclimated and kept in aquaria in the laboratory at approximately 24°C. Embryos

87

were obtained from spontaneous release of gametes and were transferred to aerated aquaria containing 500 ml of sterilized seawater. A total of nine offspring from different females were monitored and kept in an incubator under a 12-hour light cycle and constant temperature (20oC).

Every three days, seawater from each aquarium was renewed and the salinity was measured using a refractometer and kept constant at 35 ppm. Each developmental stage was observed under the light microscope and documented with digital photographs.

Embryos, larvae, settlers and juveniles were fixed in a solution of 2.5ml of glutaraldehyde in

7.5 cacodylate buffer (0.4M). Some juveniles were treated with sodium hypochlorite to remove organic materials and expose the skeletal plates. The morphological characterization of the developmental stages was carried out using a scanning electron microscope (JEOL JSM-6390LV) after drying by critical-point dried (Morrill, 1986). Juvenile size was measured every two days by recording the length of the radius (R) and the interadius (r) of 10 individuals using the calibrated scale in Image J software. Estimates of the growth rate were conducted according to Gulland and

Holt (1959) using the mathematical model [(L2 - L1) / (t2 - t1)] which expresses the length (L) as a function of the time in day (t). This is a length-based method of von Bertalanffy’s model, where growth parameter k (curvature parameter) was estimated based on the average length of the radius along the days.

Results

The chronology of development of Echinaster (Othila) brasiliensis and its main stages from embryo to early juvenile are illustrated in the Figure 1(A-I) and Table 1.

Some differences in developmental time were recorded among offspring. The eggs are round and dark brown (Fig. 2-A). They have a diameter of 0.6±0.03mm (n = 10) and float on the surface of the sea water. The first cleavage is holoblastic and equal, and begins two hours after fertilization (a.f.).

A wrinkled blastula is formed 14 hours a.f. (Fig. 1-A; 2-B). Six hours later (20 hours a.f.), an oval blastula with an invaginated pore at the vegetal pole (blastopore) appears (Fig. 1-B). The blastula rotates around its longitudinal axis in short circular motions.

88

The embryos undergo a slight longitudinal stretching of the body, which becomes slightly compressed posteriorly, delimiting the subterminal rudiment. At this time, the swimming cilia are already evident and cover the entire surface of the embryo, providing movement along the anterior- posterior body axis. The brachiolaria larva is formed from the second to the fourth day of development (1.02 ±0.08mm, n=10) (Fig. 1-C; 2-C). It is a buoyant, pear-shaped larva with a central blastopore. Brachiolaria have two arms in the middle of the larval body (post-oral) and another on the pre-oral lobe (Fig. 2-D), which is partially divided during the later larval stage. In the later larval body, the hydropore opens to right side of larva (Fig. 2-E). Cilia cover the entire surface, providing movement along the anterior-posterior body axis (Fig. 2-F).

Metamorphosis starts around the sixth day a.f. During metamorphosis, the anterior larval body region extends along its longitudinal axis (c.a. 0.4mm) while the posterior larval region becomes flat laterally. The first two pairs of tube-feet appear in each ray of the starfish rudiment and the adhesive disc appears on the larval body (Fig. 1-D; 3-A; 3-B; 3-C; 3-D). Settlement begins when the following processes occur: regression of larva and activity of podia, gradual stellate shape of the rudiment, indicating the beginning of the pentagonal body (Fig. 1-E). The brachiolariae attach to the substratum by the adhesive disc. In the following days, the ambulacral furrow becomes distinct while the larval body becomes reduced and vestigial. On the oral side of the disk, mouth and spines begin to be formed (Fig. 3-E; 3-F). Approximately fifteen days a.f., settlers have more pronounced pentamerous symmetry, the abactinal and actinal regions become distinct, the dorsal spines become more developed (most numerous in the margins) and the eye-spot are fully formed (Fig. 3-E).

Subsequently, settlers show abactinal and actinal ossicles, the larval body disappears completely, and three pairs of tube-feet in each ray appear.

Spines become abundant and evident in the course of development and may have from one to four tips (Fig. 4-A). Recruits have a well-formed mouth that is delineated by circumoral ossicles

(at approximately 19th days a.f.) (Fig. 4-B). Thereafter, juveniles grow, increasing the number and size of the spines, the size of the body and arms, and the number of pairs of tube-feet (Fig. 1-F; 1-G;

4-C). Sixty days a.f., the month are active and the juveniles are able to evert their stomach (Fig. 1-H;

1-I) and feed on the algae biofilm grown in the aquarium. At this stage, juveniles are already able to

89

feed on marine sponges. Juveniles were monitored up to the 134th day. By this time, juveniles have well-developed ventral spines, especially the adambulacral spines and still have cilia on their bodies

(Fig. 4-D). The formation of the madreporite is observed in juveniles at 88 days a.f. (Fig. 4-E; 4-F).

The well-developed juvenile skeleton is made up of a set of articulated ossicles. There are five plates delimiting a pentagon (primary interradial plates) in the central region of the abactinal surface with one plate in the center of the pentagon (central plate) (Fig. 5-A). The hydropore is formed on one of the primary interradial plates. Early on, the arms are composed of three carinal plates (at the middle portion of abactinal side), one terminal plates (at the end) and two supermarginal plates in both their lateral sides (Fig. 5-A). There are three flat plates on the surface of the arm that support dorsal spines (Fig. 5-B).

On actinal surfaces, there are five sets of plates at the mouth (mouth frame); each set is composed of two oral plates (one on each side of the ambulacral furrow). Each oral plate has an apical spine around the mouth opening. Marginal spines are found between the oral plates (Fig. 5-C).

A set of ambulacral and adambulacral plates delimits each side of the ambulacral furrow and the number of the plates increases according to growth of the number of podia (the number of adambulacral plates is one less than the number of tube-feet) (Fig. 5-C). The odontophore is small and round and is located interradially between mouth angle ossicles on the oral surface (Fig. 5-D)

Juvenile growth (based on radius length) was more pronounced during the first 40 days, followed by a slower growth occurring until the 60th day (K=0.04 mm.day-1) (Fig. 6-A). Afterwards, the R/r ratio increases, indicating that the arms become longer (Fig. 6-B).

Discussion

The reproductive strategy of E. (O.) brasiliensis is associated with the production of large, nutrient-rich eggs. In this study, we did not measure the amount of energy in the eggs, but egg size is considered indicative of the amount of energy allocated by females in each spawning (maternal investment per spawn). In general, species that possess non-feeding larva (lecithotrophic) produce

90

fewer and larger eggs, which have higher energy reserves than those produced by species that produce feeding larvae (planktotrophic) (George et al., 1990; McEdward and Chia, 1991; Bernardo,

1996; George, 1996; Miner et al., 2005; Marshall and Bolton, 2007; McAlister and Moran, 2012).

Even among lecithotrophic species, such differences can also be found. As previously stated

(Scheibling and Lawrence, 1982; Turner, 2013), the lecithotrophic species Echinaster (O.) spinulosus (which produces fewer and larger eggs) has a greater parental investment per egg than the lecithotrophic Echinaster (O.) graminicola, which produces a greater number of smaller eggs.

The proportion of nutrients found in the eggs is another factor that is related to the reproductive strategies of sea stars (Turner and Lawrence, 1979; Scheibling and Lawrence, 1982;

Byrne and Cerra, 2000; Turner, 2013). Among species with lecithotrophic development, some have larger amounts of protein than lipids in the eggs and consequently, the larvae develop on the substratum (benthic lecithotrophic) (Byrne and Cerra, 2000). In contrast, eggs rich in lipids float in the water column, which favors potential dispersal (Byrne and Cerra, 2000). This seems to be the case for some species in the genus Echinaster, which has large and floating eggs. However, the eggs of the E. (O.) brasiliensis (0.6 mm in diameter) and E. (O.) graminicola (0.84-0.88 mm in diameter) with pelagic larva are smaller than those of E. (O.) spinulosus (1.0-1.3 mm in diameter) with benthic larva (This study, Turner, 2013). We observed stomach eversion in 60 day old juveniles, which means that they start feeding later. Thus, the eggs contain enough energy to survive for this period.

Lecithotrophic development is thought to be a derived character in evolutionary history of the Asteroidea (Hart et al., 1997). The same is true for other classes of Echinodermata and many groups of marine invertebrates (Hart, 2000; Wray, 2000). The emergence of lecithotrophy, however, probably occurred independently at various times throughout the evolution of different groups. The transition between planktotrophic and lecithotrophic development involves the loss of functionally specialized structures for the capture of food (ciliary bands) and pulsation of the larval body, which are characteristic of the bipinnaria larval stage. Indeed, for species that have only one brachiolaria

(lecithotrophic) larval stage, such as species of the genus Echinaster and Henricia the initial neurogenic program that controls ciliary beating and feeding is absent (Byrne et al., 2001). This loss, among other equally important losses, made the change from planktotrophy to lecithotrophy irreversible (McEdward and Miner, 2001).

91

The development of skeletal plates related to ambulacral system (adambulacral and ambulacral plates) of the post-metamorphic settler of E. (O.) brasiliensis occurs radially, which is the typical ontogenetic trajectory described for other sea star species of different orders (Chia and

Walker, 1991). It is generally accepted that the terminal plates play an essential role in growth due to the blastema associated with them (Mooi and David, 2000). Radial water canals and ambulacral plates arise from the blastema. Consequently, growth occurs from the proximal to the distal region.

Therefore, the newest ambulacrals are always near the terminal plates, at the end of arms (Hyman,

1955; Mooi and David, 2000). There is a controversial whether adambulacral are formed according to the OPR. As far as we could observe, the ambulacral and adambulacral skeleton elements in earliest juvenile of E. (O.) brasiliensis seem to appear according to the Ocular Plate Rule (OPR).

The madreporic plate in E. (O.) brasiliensis is formed later in development and on a primary interradial plate located more centrally in the disc than in paxillosids, following the Late Madreporic

Mode (LMM) (Gale, 2011). However, madreporite appearance in E. (O.) brasiliensis occurs earlier than in Asterina minor. Komatsu et al. (1979) described madreporite appearance in A. minor juveniles with arm length of 3 mm and seven pairs of tube-feet. In the current study, the first appearance of the madreporite in E. (O.) brasiliensis was recorded in juveniles with five pairs of tube-feet, 1.1 mm arm length. This suggests that there are some differences in the period of appearance of the madreporite between representatives of different orders (Spinulosida and

Valvatida). According to (Gale, 2011), the Late Madreporic Mode seems to be related to the development from a brachiolaria larva, in contrast to the bipinnaria/barrel-shaped larva of paxillosids. Another evolutionarily important structure in the skeleton of sea stars is the odontophore ossicle. Discussion about its origin, form, size and position among asteroids has been going on for decades (Mooi and David, 2000; Gale, 2011). The presence of an internal odontophore in relation to mouth frame ossicles is an apomorphy for recent asteroids (Mooi and David, 2000). There are differences in odontophores among adult specimens of paxillosid and non-paxillosid sea stars: these are relatively large and bear a spine in the former but not in the latter (Gale, 2011). The presence and the position of odontophores in E. (O.) brasiliensis juveniles seem to be congruent with that of other recent non-paxillosid asteroids (Mooi and David, 2000; Gale, 2011).

92

The ontogeny of E. (O.) brasiliensis, from fertilization to the juvenile stage, is similar to that of other studied Echinasteridae species, such as E. (O.) echinophorus, E. (O.) graminicola, E. purpureus, E. (O.) sentus, E. (E.) sepositus, E. (O.) spinulosus, Henricia lisa and Henricia sp.

(Nachtsheim, 1914; Atwood, 1973; Siddall, 1979; Chia and Walker, 1991; Mercier and Hamel,

2008; Turner, 2013). These species have lecithotrophic development with a brief brachiolaria larvae and a similar morphology to that of settlers. However, differences in life strategies are observed in some Henricia species, that produce brooded embryos instead of pelagic embryos (Scheibling and

Lawrence, 1982; Mercier and Hamel, 2008; Eernisse, 2010). Other Echinaster species showed similar variations in the time of initiation and duration of each stage: 1–2 days for embryogenesis, 2–

6 days for the brachiolaria formation, 3-7 days for settlement and 12– 23 days for the opening of the mouth (Turner, 2013). The growth of the E. (O.) brasiliensis juveniles showed similar to those of E.

(O.) echinophorus (Atwood, 1973). Although the growth in E. (O.) echinophorus was faster during the first days (reared at 25°C), both species grew about 0.5 mm in two months. It is known that high temperature can accelerate early development in sea stars and other marine invertebrates (Watts et al., 1982).

In this work, we compare the development pattern of Echinaster (O.) brasiliensis with those of other species of this genus and notice that they are very similar, in general. Egg size, larval morphology and the developmental stages after metamorphosis show no significant difference among species of Echinaster. Therefore, this lecitotrophic development pattern seems to be kept in the lineage of these sea stars.

Biological characteristics of the brachiolaria of E. (O.) brasiliensis, and the capacity of this species for dispersal in the environment, most likely explain its wide distribution range along the southwestern Atlantic. Its brief larval span and the currently large geographical distribution pattern of this species are contradictory, and may be explained by the higher dispersal capacity of adults

(Grantham et al., 2003). However, further information about population genetic structure and gene flow among populations is necessary for a more complete understanding of the biogeographic limits of this species and the effective barrier that separates it from the other two congeneric species.

93

Acknowledgement

This paper is part of the DS requirements of E.M.L. at the Biodiversity and Evolutionary

Biology Graduate program of the Federal University of Rio de Janeiro. We are grateful to Publicase for a review of this manuscript by a professional science editor and to a native English-speaking copy editor who improved the text. We are very thankful to Dr John M. Lawrence and Dr Maria

Byrne for their critical comments which improved the earlier draft of manuscript. We are grateful to

CNPq (Process 483481/2012-2 to CRRV), CAPES-DGU Brazil-Spain Scientific Cooperation

Program, the Spanish Government projects (CTM2010-22218 and CTM2013-48163 to CRRV,

EML). Instituto Chico Mendes de Conservação da Biodiversidade (ICMBio) provided the permits to collect the specimens from Brazil.

Literature Cited

Amaral, A., and F. Leite. 2008. Invertebrados aquáticos. In: Livro vermelho da fauna brasileira ameaçada de extinção (A. Machado et al., eds), pp. 156–301. Ministério do Meio Ambiente, Brasilia-DF.

Atwood, D.G. 1973. Larval development in the asteroid Echinaster echinophorus. Biol. Bull. 144: 1–11.

Bernardo, J. 1996. The particular maternal effect of propagule size, especially egg size: patterns, models, quality of evidence and interpretations. Am. Zool. 36: 216–236.

Byrne, M. 2006. Life history diversity and evolution in the Asterinidae. Integr. Comp. Biol. 46: 243–254.

Byrne, M., and A. Cerra. 2000. Lipid dynamics in the embryos of Patiriella species (Asteroidea) with divergent modes of development. Dev. Growth Differ. 42: 79–86.

Byrne, M., P. Cisternas, and D. Koop. 2001. Evolution of larval form in the sea star genus Patiriella: conservation and change in the larval nervous system. Dev. Growth Differ. 43: 459– 468.

Chia, F-S. 1966. The development of two brooding sea star Henricia leviscula and Leptasrerias hexactis. Am. Zool. 6: 331–332.

Chia, F-S., and C.W. Walker. 1991. Echinodermata: Asteroidea. In: Reproduction of marine invertebrates (P. V Giese A, Pearse J, ed), pp. 301–353. Boxwood Press, California.

Clark, A.M., and M.E. Downey. 1992. Starfishes of the Atlantic. Chapman and Hall, London.

Eernisse, D.J. 2010. Zootaxa, Henricia pumila sp. nov.: A brooding seastar (Asteroidea)... Zootaxa 36: 22 – 36.

Gale, A.S. 2011. The phylogeny of post-palaeozoic asteroidea (Echinodermata, Neoasteroidea). Spec. Pap. Paleontol. 5–112.

94

George, S.B. 1996. Echinoderm egg and larval quality as a function of adult nutritional state. Oceanol. Acta 19: 297–308.

George, S.B., C. Cellario, and L. Fenaux. 1990. Population differences in egg quality of Arbacia lixula (Echinodermata: Echinoidea): proximate composition of eggs and larval development. J. Exp. Mar. Biol. Ecol. 141: 107–118.

Grantham, B.A., G.L. Eckert, and A.L. Shanks. 2003. Dispersal potential of marine invertebrates in diverse habitats. Ecol. Appl. 13: S108–S116.

Gulland, J.A., and S.J. Holt. 1959. Estimation of growth parameters for data at unequal time intervals. J. Conserv. CIEM 25: 47–49.

Harper, F.M., and M.W. Hart. 2005. Gamete compatibility and sperm competition affect paternity and hybridization between sympatric Asterias sea stars. Biol. Bull. 209: 113–126.

Hart, M. 2000. Phylogenetic analyses of mode of larval development. Semin. Cell Dev. Biol. 11: 411–418.

Hart, M.W., M. Byrne, and S.L. Johnson. 2003. Patiriella pseudoexigua (Asteroidea: Asterinidae): a cryptic species complex revealed by molecular and embryological analyses. J. Mar. Biol. Assoc. UK 83: 1109–1116.

Hart, M.W., M. Byrne, and M.J. Smith. 1997. Molecular phylogenetic analysis of life-history evolution in asterinid starfish. Evolution (N. Y). 51: 1848–1861.

Hart, M.W., C.C. Keever, A.J. Dartnall, and M. Byrne. 2006. Morphological and Genetic Variation Indicate Cryptic Species within Lamarck’s Little Sea Star, Parvulastra (=Patiriella) exigua. Biol. Bull. 210: 158–167.

Hyman, L.H. 1955. The Invertebrates: Echinodermata, The coelomata bilateria. vol.IV. McGraw- Hill Book Company Inc, New York.

Komatsu, M., Y.T. Kano, H. Yoshizawa, S. Akabane, and C. Oguro. 1979. Reproduction and Development of the Hermaphroditic Sea-Star, Asterina minor Hayashi. Biol. Bull. 157: 258– 274.

Marshall, D.J., and T.F. Bolton. 2007. Effects of egg size on the development time of non-feeding larvae. Biol. Bull. 212: 6–11.

Masterman, A.T. 1902. The early development of Cribrella oculata (Forbes), with remarks on echinoderm development. Trans. R. Soc. Edinburgh Earth Sci. 40: 373–417.

McAlister, J.S., and A.L. Moran. 2012. Relationships among egg size, composition, and energy: a comparative study of geminate sea urchins. PLoS One 7: e41599.

McEdward, L.R. 2000. Adaptive evolution of larvae and life cycles. Semin. Cell Dev. Biol. 11: 403–409.

McEdward, L.R., and F-S. Chia. 1991. Size and energy content of eggs from echinoderms with pelagic lecithotrophic development. J. Exp. Mar. Biol. Ecol. 147: 95–102.

McEdward, L.R., and D.A. Janies. 1993. Life cycle evolution in Asteroids: What is a larva? Biol. Bull. 184: 255–268.

McEdward, L.R., and D.A. Janies. 1997. Relationships among development, ecology, and morphology in the evolution of Echinoderm larvae and life cycles. Biol. J. Linn. Soc. 60: 381–

95

400.

McEdward, L.R., and B.G. Miner. 2001. Larval and life-cycle patterns in echinoderms. Can. J. Zool. 79: 1125–1170.

Mercier, A., and J-F. Hamel. 2008. Depth-related shift in life history strategies of a brooding and broadcasting deep-sea asteroid. Mar. Biol. 156: 205–223.

Miner, B.G., L.A. McEdward, and L.R. McEdward. 2005. The relationship between egg size and the duration of the facultative feeding period in marine invertebrate larvae. J. Exp. Mar. Biol. Ecol. 321: 135–144.

Mooi, R., and B. David. 2000. What a new model of skeletal homologies tells us about asteroid evolution. Am. Zool. 40: 326–339.

Morrill, J.B. 1986. Scanning eletron microscoy of embryos. In: Methods in cell biology, vol. 27 Echinoderm gametes and embryos (T. E. Schroeder, ed), pp. 264-292. Academic Press, Inc., Orlando, Florida.

Nachtsheim, H. 1914. Über die Entwicklung von Echinaster sepositos Gray. Zool. Anz. 44: 600– 606.

Naughton, K.M., and T.D. O’Hara. 2009. A new brooding species of the biscuit star Tosia (Echinodermata:Asteroidea:Goniasteridae), distinguished by molecular, morphological and larval characters. Invertebr. Syst. 23: 348–366.

Scheibling, R.E. 1982. Differences in body size and growth rate between morphs of Echinaster (Echinodermata: Asteroidea) from the Eastern Gulf of Mexico. In: International Echinoderms Conference (J. M. Lawrence, ed), pp. 291–298. Balkema, Rotterdam.

Scheibling, R.E., and J.M. Lawrence. 1982. Differences in reproductive strategies of morphs of the genus Echinaster (Echinodermata: Asteroidea) from the Eastern Gulf of Mexico. Mar. Biol. 70: 51–62.

Siddall, S.E. 1979. Development of ossicles in juveniles of the sea star Echinaster sentus. Bull. Mar. Sci. 29: 278–282.

Sumida, P.Y.G., P.A. Tyler, and D.S.M. Billett. 2001. Early juvenile development of deep-sea asteroids of the NE Atlantic Ocean , with notes on juvenile bathymetric distributions. Acta Zool. 82: 11–40.

Turner, R.L. 2013. Echinaster. In: Starfish: Biology & Ecology of the Asteroidea (J. M. Lawrence, ed), pp. 200–214. The Johns Hopkins University Press, Baltimore. Maryland.

Turner, R.L., and J.M. Lawrence. 1979. Volume and composition of echinoderm eggs: Implications for the use of egg size in life-history models. In: Reproductive Ecology of Marine Invertebrates (S. E. Stancyk, ed), pp. 25–40. University of South Carolina Press, Columbia, SC.

Watts, S.A., R.E. Scheibling, A.G. Marsh, and J.B. McClintock. 1982. Effect of temperature and salinity on larval development of sibling species of Echinaster (Echinodermata: Asteroidea) and their hybrids. Biol. Bull. 163: 348–354.

Wray, G.A. 2000. The evolution of embryonic patterning mechanisms in animals. Semin. Cell Dev. Biol. 11: 385–393.

96

Table 1

Chronology of development of the E. (O.) brasiliensis. Ten individuals were observed on each stage (± standard deviation).

Time SD Stage

14.0 h - Wrinkled blastula

20.0 h - Blastula

2.6 days ±0.70 Brachiolaria larva

3.4 days ±0.86 Hydropore open to right side of larva, preoral lobe and four larval arms differentiated

6.1 days ±1.13 Beginning of metamorphosis

6.6 days ±1.95 Adhesive disc well-developed

6.8 days ±1.23 Settlement

7.0 days ±2.00 Differentiation of first two pairs of tube-feet on each ray

9.3 days ±3.50 Eye-spots appear

10.9 days ±3.23 Larval body absorption begins as it folds towards left side of larva

11.0 days ±4.55 Water ring and radial canals are distinct

13.2 days ±3.56 Spines appear on oral and aboral side

16.3 days ±5.86 Mouth opens

15.7 days ±4.26 Larval body is completely absorbed and third pairs of tube-feet appear on each ray

17.8 days ±4.28 Settlers have more pronounced pentamerous symmetry

23.8 days ±4.97 Juvenile well-developed

30.3 days ±7.81 Formation of fourth pairs of tube-feet on each ray

60.0 days - Eversion of the stomach

67.3 days ±16.01 Formation of fifth pairs of tube-feet on each ray

88 days - Madreporite formation

97

Figure 1 Development of specimens of E.(O.) brasiliensis. All micrographs show living specimens. A- Dividing blastomeres in wrinkled blastula, B- Blastula blastopore, C- Early brachiolaria with juvenile rudiment and brachiolar arms (b), D- Metamorphosing brachiolaria with arms (b) and adhesive disk (d), showing the starfish rudiment with tube-feet (p) and month (m), view from the future oral side of the juvenile, E- Early juvenile with remnants of the larval body (lb), F- Juvenile with abactinal side, G- Juvenile mouth (m) and the odontophore (od), H- Juvenile abactinal side in detail (j), peristome (Pe) and eye-spot (o). I- Juvenile stomach everted (s). Scale bar represents 0.5 mm

98

Figure 2 Development of specimens of E.(O.) brasiliensis. All specimens are scanning electron micrographs. A- Oocyte, B- Wrinkled blastula, C- Lateral (right) side view of the of the brachiolaria blastopore, D- Brachiolaria larva with brachiolar arms (arrow), E- Hydropore detail (arrow), F- Cilia (arrow)

99

Figure 3 A- Metamorphosing brachiolaria with brachiolar arms (b), juvenile podia (p) and adhesive disk (d), B- First podia detail (p), c- Early juvenile with remnants of larval body (arrow), D- Adhesive disk detail (arrow), E- Early juvenile showing spine, podia (p) and eye-spot (o), F- Juvenile mouth formation (arrow).

100

Figure 4 A- Juvenile spine detail, B- Circumoral spine around the mouth (arrow), C- Actinal surface of the juvenile with 4 pairs of podia, D- Juvenile radial water canal showing adambulacral (Sad) spines, E- Abactinal surface of the juvenile showing where madreporite is formed. Arrow shows one of an interrradial plates with a madreporite,, F- Developing madreporite pore.

101

Figure 5 Skeleton of the juvenile treated with KOH solution. A- Abactinal surface showing terminal (Tp), abactinal (Ab), Superomarginal (Sm) and ambulacral (Am) plates, hydropore (h), B- Abactinal surface in detail. Arrow indicate abactinal plates that cover the arms (Ab), C- Actinal surface showing apical spine (As), oral (Or), terminal (Tp) Inferomarginal (Im), ambulacral (Am) and adambulacral (Ad) plates, D- Actinal surface in detail. Arrow indicate the odontophore (Od).

Figure 6 A- Growth rate of the E. (O.) brasiliensis juvenile (parameter k) based on the ray length (R), B- Ray length (R) of the juveniles for 145 days after fertilization * Indicates the beginning of stomach activity. Bars on each value mean the standard deviation.

102

Considerações finais

O presente trabalho apresentou importantes resultados acerca da sistemática, modo de desenvolvimento, potencial de dispersão e evolução das estrelas do mar do gênero Echinaster e fornecem base para pesquisas futuras. O estudo das relações filogenéticas entre as espécies de Echinaster apontaram para o não monofiletismo do gênero. Apesar da relação entre Echinaster (não-Othilia) e Henricia não ter apresentado alto suporte e poucas espécies do gênero Henricia terem sido incluídas nas análises (5% do total), as espécies do subgênero Othilia formaram um grupo monofilético com alto suporte estatístico. Estes resultados corroboram estudos morfológicos anteriores e sugere a revalidação de Othilia como gênero ao invés de subgênero. Novos estudos incluindo mais espécies de Henricia, assim como outros gêneros da família

Echinasteridae, podem ampliar o entendimento da relação entre Echinaster, Othilia e

Henricia.

Os caracteres morfológicos utilizados na diagnose de Echinaster não se mostram robusto para a delimitação das espécies, especialmente para as espécies de E. (Othilia) do Caribe, Golfo do México e Brasil. A distinção morfológica entre os gêneros

Echinaster e Henricia também apresentam ambiguidades, visto que espécies destes gêneros (H. tahia e E. farquhari) parecem estar erroneamente classificadas a nível de gênero de acordo com a análises moleculares. Portanto, a taxonomia destes gêneros deve ser revisitada.

O estudo detalhado das espécies brasileiras aponta uma incongruência entre os dados morfológicos e moleculares. As análises morfológicas e morfométricas não delimitaram as duas linhagens reconstruídas pelas análises moleculares. Os resultados combinados das diferentes abordagens utilizadas sugerem que estas linhagens passaram

103

por uma recente expansão populacional e que um incipiente processo de especiação está em curso entre estas linhagens alopatricamente distribuídas na costa brasileira. Portanto, a variabilidade morfológica encontrada parece ser resultado de plasticidade fenotípica.

O estudo do desenvolvimento larval e juvenil de Echinaster (Othilia) brasiliensis corrobora a hipótese de que as espécies de Echinaster compartilham um similar modo de desenvolvimento, com uma larva lecitotrófica do tipo braquiolária de curta duração no plâncton, e esse padrão parece ser conservado ao longo da história evolutiva do grupo. As placas esqueléticas, odontóforo e madreporito do juvenil de E.

(O.) brasiliensis são homólogos ao descrito para outros Asteroidea não-paxillosida e o desenvolvimento das placas do esqueleto segue as regras "Ocular Plate Rule" e "Late

Madreporic Mode".