bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 Alzheimer’s Disease risk modifier genes do not impact tau aggregate uptake, seeding or 2 maintenance in cell models. 3 4 Sourav Kolay and Marc I. Diamond 5 Center for Alzheimer’s and Neurodegenerative Diseases 6 Peter O’Donnell Jr. Brain Institute 7 University of Texas Southwestern Medical Center 8 Dallas, TX 9 USA 10 11 Corresponding Author: 12 Marc Diamond 13 Center for Alzheimer’s and Neurodegenerative Diseases 14 NL10.120 15 6000 Harry Hines Blvd. 16 Dallas, TX 75390 17 Email: [email protected] 18 Phone: 214-648-8857 19 20 Short title: Alzheimer’s Disease risk genes don’t affect prion mechanisms

1 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

22 ABSTRACT 23 Alzheimer’s disease (AD) afflicts millions of people worldwide, and is caused by 24 accumulated amyloid beta and tau pathology. Progression of tau pathology in AD may 25 utilize prion mechanisms of propagation in which pathological tau aggregates released 26 from one cell are taken up by neighboring or connected cells and act as templates for 27 their own replication, a process termed “seeding.” In cultured cells we have modeled 28 various aspects of pathological tau propagation, including uptake of aggregates, 29 induced (naked) seeding by exogenous aggregates, seeding caused by Lipofectamine- 30 mediated delivery to the cell interior, and chronic maintenance of aggregates in cells 31 through mother-to-daughter transmission. The factors that regulate these processes are 32 not well understood, and we hypothesized that AD risk modifier genes might play a role. 33 We identified 22 genes strongly linked to AD via meta-analysis of genome-wide 34 association studies (GWAS). We used CRISPR/Cas-9 to individually knock out each in 35 gene in HEK293T cells, and verified disruption using genomic sequencing. We then 36 tested the effect of gene knockout in tau aggregate uptake, naked and Lipofectamine- 37 mediated seeding, and aggregate maintenance in cultured cell lines. GWAS gene 38 knockouts had no effect on these models of tau pathology. With obvious caveats due to 39 the model systems used, these results imply that these 22 AD risk modifier genes do 40 not directly modulate tau uptake, seeding, or aggregate maintenance. 41 42 INTRODUCTION 43 Tauopathies are neurodegenerative diseases characterized accumulation of tau protein 44 in ordered assemblies . Tauopathy progresses according to predictable patterns in 45 patients(1) and has been proposed to involve brain networks(2,3). Our initial studies 46 described the diversity of self-propagating fibrillar conformations in vitro(4), and the 47 ability of tau aggregates to propagate pathology from the outside to the inside of a cell, 48 and between cells(5). Concurrent work from the Tolnay group demonstrated that 49 inoculation of mouse brain with tau aggregates induced local pathology in a transgenic 50 mouse model(6). This led us initially to propose that tau had properties similar to the 51 prion protein, PrP(7). In subsequent work, we propagated distinct tau strains in cultured 52 cells that we used to create transmissible tauopathy in mouse models, with faithful, 53 inter-animal propagation of defined pathology(7). This was the first evidence that an 54 infectious form of tau created in vitro, would faithfully transmit unique conformations 55 between animals, and we henceforth referred to tau as a prion. This idea remains 56 controversial(8,9). Nonetheless, similar results from multiple groups (10-12) and the 57 effectiveness of immunotherapies against tau in mouse models(13) have now led to a 58 general recognition of the idea that transcellular propagation of pathology could underlie 59 pathogenesis of tauopathies and other amyloidoses. The precise mechanisms are 60 unknown. 61 62 Genome-wide association studies (GWAS) have been used to identify risk modifying 63 genes in AD(14). Thousands of individuals with AD have been evaluated, and a 64 relatively small number of genes have been consistently identified (15,16). We 65 hypothesized that one explanation for increased AD risk could be modulation of 66 transcellular propagation of tau pathology. This is very labor-intensive to study in 67 cultured neurons or animal models. Consequently, we have developed cell-based

2 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

68 assays to study various steps in tau propagation: uptake(17),(18) conversion of 69 intracellular tau to an aggregated state(17), (19) and maintenance of intracellular 70 aggregates through mother-daughter transmission in dividing cells (7,20). We therefore 71 tested the impact of AD GWAS genes through systematic genetic knockout via 72 CRISPR/Cas-9. 73 74 75 MATERIALS AND METHODS 76 77 Generation of CRISPR/Cas9 knockout cells and lentiviral transduction 78 Two human gRNA sequences per gene were selected from the optimized GeCKO 79 version 2(26) or Brunello libraries (27). DNA oligonucleotides were synthesized (IDT), 80 and cloned into the lentiCRISPR v2 vector (26) for lentivirus production. Lentivirus was 81 created as described previously (28). For transduction, a 1:30 dilution of virus 82 suspension was added to the cells. After 24h infected cells were treated with 1μg/ml 83 puromycin (Life Technologies) and cultured for 2 days, followed by passaging 1:5 and a 84 second round of virus and puromycin application. The cells were cultured at least 10 85 days after the first lentiviral transduction before using them for experiments. 86 87 88 Confirmation of gene editing by TIDE 89 Two gRNAs for each gene were used to produce knockout cell lines for analysis by 90 TIDE to confirm the presence of indels in predicted DNA regions as established by 91 Brinkman et al. Genomic DNA was extracted (Qiagen DNeasy Blood & Tissue Kit). 92 DNA concentration was determined by spectrophotometer (DeNovix DS-11 FX+). PCR 93 primers were designed around the region of expected CRISPR/Cas 9 cut site according 94 to the protocol for TIDE. PCR was performed using 100ng of genomic DNA with 2x 95 TaqPro Red Complete Polymerase (Denville Scientific). PCR conditions were at 95 °C, 96 then 30X (15s at 95°C, 15s at 60°C, 1min at 72°C) and 10 min at 72°C. The PCR 97 product was run on a 1% agarose gel to verify the product size and gel-extracted using 98 the QIAquick gel extraction kit (Qiagen). Purified PCR samples were Sanger 99 sequenced at the sequencing core facility at UT Southwestern Medical Center. 100 Sequencing files were used for TIDE. Analysis was performed according to the 101 software instructions. The presence of aberrant sequence signal, R2 value and the 102 knockout efficiency were considered to evaluate the results(22). One gRNA was 103 selected for each gene based on its gene knockout efficacy (Table 1). 104 105 Uptake assay 106 HEK293T cells were plated at 15000 cells per well in a 96-well plate. Fluorescently 107 labeled tau aggregates were sonicated (QSonica) for 30s at a setting of 65 108 (corresponding to ∼80 watts) and were applied to cell media for 4h as per prior studies 109 (18). For positive control in uptake inhibition, fibrils were preincubated overnight at 4°C 110 in media containing heparin at 100 μg/ml. Cells were harvested with 0.05% trypsin and 111 suspended in flow cytometry buffer (HBSS plus 1% FBS and 1 mM EDTA) before 112 quantitation by flow cytometry (LSRFortessa SORP, BD Biosciences). Aggregate 113 internalization was quantified by measuring median fluorescence intensity (MFI) per

3 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

114 cell. Technical triplicates were carried out in each condition, and a minimum of 5000 115 single cells were analyzed per replicate. We determined the average MFI of the 116 replicates for each condition and normalized to aggregate uptake of control sample. 117 Data analysis was performed using FlowJo version 10 software (Treestar, Inc.) and 118 GraphPad Prism version 8 for Windows. 119 120 Seeding assay 121 A stable monoclonal FRET biosensor cell line overexpressing tau RD(P301S)-C/R was 122 created by selection and amplification of a single cell after viral transduction and culture 123 in puromycin. Biosensor cells were plated at a density of 10,000 cells/well in a 96-well 124 plate. Recombinant tau fibrils were sonicated for 30s at a setting of 65. Aggregates 125 were applied to the cells in volumes of 50μl per well, and incubated for an additional 126 48h. Tau (50nM) was added directly to the cells after sonication. Alternatively 127 Lipofectamine 2000 (Thermo Fisher Scientific) was used to transduce tau (5nM). After 128 48h cells were harvested with 0.05% trypsin, fixed in 2% paraformaldehyde for 10 min 129 and then resuspended in flow cytometry buffer (HBSS plus 1% FBS and 1 mM EDTA). 130 We quantified FRET as described previously using the LSRFortessa (29) except that we 131 identified single cells that were both mClover and mRuby positive and subsequently 132 quantified FRET-positive cells within this population. For each data set, three 133 independent experiments with three technical replicates were performed. For each 134 experiment, a minimum of ∼5000 single cells per replicate were analyzed. Data analysis 135 was performed using FlowJo version 10 software and GraphPad Prism version 8. 136 137 Seed maintenance assay 138 A stable monoclonal LM 39-9 cell line overexpressing tau RD (P301L/V337M) tagged to 139 cyan and yellow fluorescent proteins was used for the tau seed maintenance 140 experiment. These cells had previously been developed for their ability to stably 141 propagate aggregates that enable detection by FRET, as distinct from the first 142 description of the tau RD(P301L/V337M)-YFP cells described previously(7,20). LM 39-9 143 cells were plated at 10000 cells per well in a 96-well plate. After transduction with virus 144 encoding appropriate gRNA, cells were maintained for 2 weeks prior to analysis. Cells 145 were harvested with 0.05% trypsin and fixed in 2% paraformaldehyde for 10min, and 146 then resuspended in flow cytometry buffer (HBSS plus 1% FBS and 1 mM EDTA). The 147 LSRFortessa SORP (BD Biosciences) was used to perform FRET flow cytometry. FRET 148 was quantified as described previously(23) with the following modification; we identified 149 single cells that were YFP- and CFP-positive and subsequently quantified FRET- 150 positive cells within this population. For each data set, three independent experiments 151 with three technical replicates were performed. For each experiment, a minimum of 152 ∼5000 single cells per replicate were analyzed. Data analysis was performed using 153 FlowJo version 10 software (Treestar Inc.) and GraphPad Prism version 7 for Windows. 154 155 156 RESULTS 157 158 Knockout of 22 AD GWAS candidates

4 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

159 We first identified the candidate genes based on the reported GWAS of AD (14). Meta- Gene Normalized gRNA Sequence Knockout Expression Efficiency Level 1 APOE 0.3 AGCTGCGCCAGCAGACCGAG 87.9% 2 BIN1 1.2 TGAGGCAAACAAGATCGCAG 80.7% 3 CLU 17.6 AATTCAAAATGCTGTCAACG 93.7% 4 HLADRB1 1.7 TCTGCAGTAGGTGTCCACCG 97.5% 5 HLADRB5 1.1 CAGAGACATCTATAACCAAG 94.2% 6 PTK2B 0.2 GCAGTACGCCTCGCTCAGGG 96.2% 7 INPP5D ND CGATCACGTAAATGTCATGG 90.1% 8 MEF2C 2.9 GGAGGTCGATGTGTTACACC 90.5% 9 CD33 ND TGGGGTGATTATGAGCACCG 88.7% 10 PICALM 8.2 TGATATACCAGACCTTTCAC 80.6% 11 SORL1 0.8 ACGCTTATGCCCAGTACCTC 90.0% 12 ABCA7 2.1 GAGGCCACAGCAATTCGACC 79.6% 13 FERMT2 4.9 CATTGGACCTTAGATAAGTA 90.4% 14 CASS4 0.1 CATCATGGACTGTGCGCCCA 94.2% 15 CD2AP 13.6 TACTTCACCTATACCTTCTC 91.6% 16 ZCWPW1 1.1 ACTGAAATCTCTTGAGTATG 89.0% 17 SLC24A4 0.7 CTCCCGTCCTTGCTGACCCG 91.8% 18 CELF1 17.7 CGGGAACTCTTCGAACAGTA 92.9% 19 CR1 ND GTCAATGCAATGCCCCAGAA 86.3% 20 MS4A6A ND TATCAATCGCCACAGAGAAA 88.2% 21 EPHA1 ND GGAGGCTTCCCGCGTCCACG 84.5% 22 NME8 ND AAAACGAGAAGTCCAGTTAC 88.3% 160 analysis of different GWAS has confirmed the importance of 22 genes as AD risk 161 modifiers (Table 1) (16). We targeted each gene individually with two independent guide 162 RNAs (gRNAs). The gRNAs were cloned into a lentivirus construct (21), and transduced 163 into cultured cells. Cells were cultured for 10 days in the presence of puromycin to 164 select for stable integration of the virus and presumed genetic disruption. We confirmed 165 genetic disruption of each gene using Tracking of Indel by DEcomposition (TIDE), a 166 method based on sequencing the target genes to detect disruption of the sequence 167 through insertion/deletion (indel) at the site of gRNA binding(22). This confirmed high 168 frequency indels at each of the genes targeted by our constructs (see Table 1; 169 Supplementary data- Fig S1 for an example). We selected the gRNAs with high indel 170 efficiency (>80%) in TIDE analysis (Table 1) and used those gRNAs for subsequent 171 assays. We noted that 6 genes are reportedly expressed at very low or undetectable 172 levels in HEK293 cells (Table 1), but carried these through in our analyses nonetheless. 173 174 Table 1: gRNAs used in this study. The knock out efficiency of gRNAs was verified 175 using TIDE. Published expression patterns in HEK293 cells from the Human Protein 176 Atlas are also listed. NX refers to normalized expression levels. 177 178

5 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

179 180 AD GWAS gene disruption does not affect tau uptake 181 We have previously determined that heparan sulfate proteoglycans (HSPGs) play a 182 critical role in binding tau aggregates, mediating their uptake and seeding activity (17), 183 (18). Compounds such as heparin or similar small molecules, which bind tau 184 assemblies and compete for their binding to HSPGs, block tau uptake (18). We tested 185 the role of GWAS genes by evaluating HEK293T cells in which we had individually 186 disrupted each. As a positive control, we knocked out NDST1, which we have 187 previously determined to be required for proper HSPG sulfation and to mediate tau 188 uptake (18). We prepared full-length (2N4R) fibrils and labeled them using Alexa Fluor 189 647 via succinimidyl ester amine reaction. We applied labeled tau fibrils to cultured cells 190 for 4h, followed by washing, trypsin treatment (to digest extracellular tau and release 191 cells from the culture plate), and analysis by flow cytometry according to prior methods 192 (17). We observed no effect of GWAS gene knockout on tau uptake, whereas heparin 193 treatment reduced uptake approximately 90%, and NDST1 knockdown reduced uptake 194 approximately 50% (Fig. 1). 195 196 Figure 1: Knockout of GWAS genes does not modify uptake of tau. 197 GWAS Genes were individually targeted in HEK293T cells using CRISPR/Cas9 to 198 create polyclonal knockout cell lines. The cell lines were then tested for internalization of 199 fluorescently labeled tau aggregates by measuring MFI per cell with flow cytometry. 200 None of the gene knockouts changed tau uptake. Data were collected in triplicate and 201 normalized to uptake from control cells treated with scrambled gRNA. The X-axis 202 indicates the targeted genes, and the Y-axis indicates tau uptake relative to scrambled 203 gRNA. Heparin and NDST1 were used as positive controls for uptake inhibition. Error 204 bars indicate the SEM. 205 206 AD GWAS gene disruption does not affect tau seeding 207 An exogenous tau assembly that gains entry to the cytoplasm acts as a template to 208 convert endogenous tau to a fibrillar form, a process termed “seeding.” Seeding is 209 initiated by application of relatively low concentrations of tau assemblies to the cell 210 media. In the absence of additional reagents, these assemblies bind HSPGs, are 211 internalized, and initiate seeding reactions. This type of seeding, which we have termed 212 “naked,” is relatively inefficient, and typically results in conversion of approximately 1- 213 5% of the cells to an aggregated state. When the tau repeat domain containing a single 214 disease-associated mutation (P301S) is fused to mClover3 (C) or mRuby3 (R) (or a 215 similarly compatible fluorescent protein pair), aggregation enables fluorescence 216 resonance energy transfer (FRET) induced by proximity of the fluorescent proteins. This 217 allows quantitation of seeding activity by flow cytometry. 218 219 As an alternative, incubation of tau seeds with Lipofectamine (or a similar reagent) 220 enables transduction of seeds with very high efficiency, approximately 100-fold more 221 than naked seeding. We expressed tau RD(P301S)-C/R in HEK293 cells to form a 222 monoclonal “biosensor” line with high sensitivity to exogenous tau aggregates, similar to 223 a line previously reported (23). To test the role of GWAS genes in the tau seeding 224 process, we knocked out each in the biosensor cells. These were treated with

6 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

225 exogenous tau fibrils alone, or with Lipofectamine(19). We measured seeding activity by 226 quantitative flow cytometry. We observed no consistent significant effect of GWAS 227 gene knockout upon naked seeding (Fig. 2) or after Lipofectamine-mediated aggregate 228 delivery (Fig. 3). 229 230 Figure 2. Knockout of AD GWAS genes does not modify naked tau seeding. 231 GWAS Genes were individually targeted in HEK293T RD(P301S)-C/R biosensor cells 232 using CRISPR/Cas9 to create polyclonal knockout cell lines, which were cultured for 2 233 weeks in the presence of puromycin. Recombinant tau fibrils were added to those cells 234 to induce seeding. Seeding was quantified using FRET, and the percentage of FRET- 235 positive cells was normalized to the scrambled gRNA. Data were collected in triplicate. 236 The X-axis indicates the targeted genes, and the Y-axis indicates normalized seeding 237 activity. None of the genes modified the seeding efficiency. Heparin and NDST1 were 238 positive controls for uptake inhibition. Error bars indicate the SEM. 239 240 Figure 3. Knockout of AD GWAS genes does not modify Lipofectamine-mediated 241 tau seeding. 242 AD GWAS genes were individually targeted in HEK293T RD(P301S)-C/R biosensor 243 cells using CRISPR/Cas9 to create polyclonal knockout cell lines, which were cultured 244 for 2 weeks in the presence of puromycin. Recombinant tau fibrils were mixed with 245 Lipofectamine to facilitate direct delivery to the cytoplasm. Seeding was quantified using 246 FRET, and the percentage of FRET-positive cells was normalized to the scrambled 247 gRNA. Data were collected in triplicate. The X-axis indicates the targeted genes, and 248 the Y-axis represents normalized seeding activity. No knockout modified seeding 249 efficiency. Error bars indicate the SEM. 250 251 GWAS gene disruption does not affect tau aggregate maintenance 252 We have previously observed that dividing cells propagate tau aggregates of distinct 253 conformation, termed strains, that transmit pathology between animals, and specify 254 unique pathologies(7,20). Studies of yeast prions indicate that aggregate propagation 255 requires accessory factors, e.g. Hsp104(24), and thus we hypothesized AD GWAS 256 genes might affect this process. We created a cell line that propagated a distinct tau 257 strain, termed LM39-9. These cells constitutively express aggregates of tau RD 258 containing two disease-associated mutations (P301L/V337M) that are fused to cyan and 259 yellow fluorescent proteins (which constitute a FRET pair). LM39-9 cells exhibit high 260 aggregate transmission efficiency (~99%), which can be easily tracked over time by flow 261 cytometry. We used lentivirus to individually disrupt each of the AD GWAS genes, 262 cultured the LM39-9 cells for 2 weeks, and then quantified the percentage of cells 263 containing aggregates using flow cytometry. We observed no loss of aggregation 264 following disruption of any GWAS gene (Fig. 4), indicating none was critical to 265 aggregate maintenance in this cell model. 266 267 Figure 4. Knock out of AD GWAS genes does not modify tau aggregate 268 maintenance. 269 AD GWAS genes were individually targeted in LM39-9 cells using CRISPR/Cas9 to 270 create polyclonal knockout cell lines, which were cultured for 2 weeks in the presence of

7 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

271 puromycin. The cell lines were tested for the loss of tau aggregates using FRET flow 272 cytometry. The X-axis indicates the targeted genes, and the Y-axis represents 273 percentage of FRET-positive cells. None of the genes inhibited aggregate maintenance 274 within the LM-39-9 cell lines. Error bars indicate the SEM. 275 276 DISCUSSION 277 The mechanisms that govern prion activities of tau are largely unknown. AD GWAS 278 genes are putative modifiers of pathogenesis, and are thus of interest. Consequently in 279 this work we tested the hypothesis that AD GWAS genes would impact uptake, seeding, 280 or aggregate maintenance of tau, which may play a critical role in neurodegeneration. 281 We confirmed each of the 22 gRNAs we studied in fact disrupted their target genes at 282 high frequency. We then studied the effects of the knockouts across a range of putative 283 steps in pathogenesis for which we have previously developed quantitative cell-based 284 assays. We did not observe any impact on knockout in any of the fundamental events of 285 tau aggregate propagation that we can measure in simple cell systems. 286 287 AD and related dementias involve progressive accumulation of tau assemblies in 288 neurons and glia. If tau propagation underlies these disorders, it is conceivable that 289 many cellular mechanisms could be specific to cells of the brain. In this case, modeling 290 these processes in simple cultured cell systems as we have done here might not be 291 particularly productive. And, indeed, this may explain why we did not observe any effect 292 of GWAS genes on the fundamental mechanisms of tau pathology we measured in 293 HEK293T cells. 6 of the genes studied (INPP5D, CD33, CR1, MS4A6A, EPHA1, NME8) 294 are reportedly not expressed at high levels in these cells, and thus cannot be 295 completely excluded as important for tau prion propagation (although they are clearly 296 not required for this process to occur in HEK293T cells). 297 298 Due to the impracticality of optimizing detection methods to measure expression levels 299 of multiple proteins, we confirmed the function of our knockout vectors with sequencing 300 of endogenous genes. Future studies in neurons, which present additional challenges to 301 screening studies we have performed here, would be helpful in this regard. However the 302 HEK293T models have previously proven very useful in defining modes of cell uptake of 303 pathological tau assemblies, seeding, and strain maintenance that have translated well 304 to primary neurons and mouse models (7,17,18). Similarly, these simple systems have 305 readily propagated unique tau strains derived from recombinant fibrils and human 306 tauopathy brains that can be transmitted and propagated in animal models (7,25). We 307 fully recognize that without extension of findings derived from simple systems such as 308 these into animal or even human studies it will be difficult to know how these simple 309 models reflect actual events in the brain. 310 311 The relationship of GWAS to AD pathogenesis is complex, as hits may involve genes 312 that are not directly involved in the hypothetically critical process of tau propagation. For 313 example, genes associated with microglial function, such as TREM2, would not be 314 expected to score positive in these studies. Nonetheless, we hope our work will serve 315 as an important reference for those interested in using reductionist cell models to study 316 the role of genes involved in fundamental events of tau propagation.

8 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

317 318 ACKNOWLEDGEMENTS 319 The study was supported by the Rainwater Charitable Foundation and the Crowley 320 Foundation. 321 322 REFERENCES 323 1. Lee VM, Goedert M, Trojanowski JQ. Neurodegenerative tauopathies. Annu Rev 324 Neurosci. 2001;24(1):1121–59.

325 2. Braak H, Braak E. Neuropathological stageing of Alzheimer-related changes. Acta 326 Neuropathol. 1991;82(4):239–59.

327 3. Seeley WW, Crawford RK, Zhou J, Miller BL, Greicius MD. Neurodegenerative 328 diseases target large-scale human brain networks. Neuron. Elsevier; 2009 Apr 329 16;62(1):42–52.

330 4. Frost B, Ollesch J, Wille H, Diamond MI. Conformational diversity of wild-type Tau 331 fibrils specified by templated conformation change. J Biol Chem. American 332 Society for Biochemistry and Molecular Biology; 2009 Feb 6;284(6):3546–51.

333 5. Frost B, Jacks RL, Diamond MI. Propagation of tau misfolding from the outside to 334 the inside of a cell. J Biol Chem. American Society for Biochemistry and Molecular 335 Biology; 2009 May 8;284(19):12845–52.

336 6. Clavaguera F, Bolmont T, Crowther RA, Abramowski D, Frank S, Probst A, et al. 337 Transmission and spreading of tauopathy in transgenic mouse brain. Nat Cell 338 Biol. 2009 Jul;11(7):909–13.

339 7. Sanders DW, Kaufman SK, Devos SL, Sharma AM, Mirbaha H, Li A, et al. Distinct 340 tau prion strains propagate in cells and mice and define different tauopathies. 341 Neuron. 2014 Jun 18;82(6):1271–88.

342 8. Surmeier DJ, Obeso JA, Halliday GM. Selective neuronal vulnerability in 343 Parkinson disease. Nat Rev Neurosci. Nature Publishing Group; 2017 Jan 344 20;18(2):101–13.

345 9. Walsh DM, Selkoe DJ. A critical appraisal of the pathogenic protein spread 346 hypothesis of neurodegeneration. Nat Rev Neurosci. 2016 Apr;17(4):251–60.

347 10. Guo JL, Lee VM-Y. Seeding of normal Tau by pathological Tau conformers drives 348 pathogenesis of Alzheimer-like tangles. J Biol Chem. 2011 Apr 349 29;286(17):15317–31.

350 11. Iba M, Guo JL, McBride JD, Zhang B, Trojanowski JQ, Lee VM-Y. Synthetic tau 351 fibrils mediate transmission of neurofibrillary tangles in a transgenic mouse model 352 of Alzheimer's-like tauopathy. J Neurosci. Society for Neuroscience; 2013 Jan 353 16;33(3):1024–37.

9 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

354 12. Woerman AL, Aoyagi A, Patel S, Kazmi SA, Lobach I, Grinberg LT, et al. Tau 355 prions from Alzheimer's disease and chronic traumatic encephalopathy patients 356 propagate in cultured cells. Proc Natl Acad Sci USA. 2016 Dec 357 13;113(50):E8187–96.

358 13. Gallardo G, Holtzman DM. Antibody Therapeutics Targeting Aβ and Tau. Cold 359 Spring Harb Perspect Med. 2017 Oct 3;7(10):a024331.

360 14. Cuyvers E, Sleegers K. Genetic variations underlying Alzheimer's disease: 361 evidence from genome-wide association studies and beyond. Lancet Neurol. 362 2016 Jul;15(8):857–68.

363 15. Lambert JC, Ibrahim-Verbaas CA, Harold D, Naj AC, Sims R, Bellenguez C, et al. 364 Meta-analysis of 74,046 individuals identifies 11 new susceptibility loci for 365 Alzheimer's disease. Nat Genet. 2013 Dec;45(12):1452–8.

366 16. The genetic landscape of Alzheimer disease: clinical implications and 367 perspectives. 2016 May;18(5):421–30.

368 17. Holmes BB, Devos SL, Kfoury N, Li M, Jacks R, Yanamandra K, et al. Heparan 369 sulfate proteoglycans mediate internalization and propagation of specific 370 proteopathic seeds. Proc Natl Acad Sci USA. National Acad Sciences; 2013 Aug 371 13;110(33):E3138–47.

372 18. Stopschinski BE, Holmes BB, Miller GM, Manon VA, Vaquer-Alicea J, Prueitt WL, 373 et al. Specific glycosaminoglycan chain length and sulfation patterns are required 374 for cell uptake of tau vs. α-synuclein and β-amyloid aggregates. J Biol Chem. 375 2018 May 11;:jbc.RA117.000378.

376 19. Holmes BB, Furman JL, Mahan TE, Yamasaki TR, Mirbaha H, Eades WC, et al. 377 Proteopathic tau seeding predicts tauopathy in vivo. Proc Natl Acad Sci USA. 378 2014 Oct 14;111(41):E4376–85.

379 20. Kaufman SK, Sanders DW, Thomas TL, Ruchinskas AJ, Vaquer-Alicea J, Sharma 380 AM, et al. Tau Prion Strains Dictate Patterns of Cell Pathology, Progression Rate, 381 and Regional Vulnerability In Vivo. Neuron. 2016 Nov 23;92(4):796–812.

382 21. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, et al. 383 Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 384 Jan 3;343(6166):84–7.

385 22. Brinkman EK, Chen T, Amendola M, van Steensel B. Easy quantitative 386 assessment of genome editing by sequence trace decomposition. Nucleic Acids 387 Res. 2014 Dec 16;42(22):e168–8.

388 23. Furman JL, Diamond MI. FRET and Flow Cytometry Assays to Measure 389 Proteopathic Seeding Activity in Biological Samples. Methods Mol Biol. New York, 390 NY: Springer New York; 2017;1523(1):349–59.

10 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

391 24. Chernova TA, Wilkinson KD, Chernoff YO. Prions, Chaperones, and Proteostasis 392 in Yeast. Cold Spring Harb Perspect Biol. 2017 Feb 1;9(2):a023663.

393 25. Kaufman SK, Del Tredici K, Thomas TL, Braak H, Diamond MI. Tau seeding 394 activity begins in the transentorhinal/entorhinal regions and anticipates phospho- 395 tau pathology in Alzheimer's disease and PART. Acta Neuropathol. Springer 396 Berlin Heidelberg; 2018 May 11;521:4339–11.

397 26. Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for 398 CRISPR screening. Nat Methods. 2014 Aug;11(8):783–4.

399 27. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, et al. 400 Optimized sgRNA design to maximize activity and minimize off-target effects of 401 CRISPR-Cas9. Nat Biotechnol. 2016 Feb;34(2):184–91.

402 28. Increased nuclear NAD biosynthesis and SIRT1 activation prevent axonal 403 degeneration. 2004 Aug 13;305(5686):1010–3.

404 29. Furman JL, Holmes BB, Diamond MI. Sensitive Detection of Proteopathic 405 Seeding Activity with FRET Flow Cytometry. J Vis Exp. 2015;(106):e53205–5.

406 407 Supplementary Figure 1: Analysis of gene editing efficiency by Tracking of Indels 408 by DEcomposition (TIDE). 409 (A) Representative image of one of the genes targeted with CRISPR/Cas9. After 410 lentivirus exposure, cells were cultured for 2 weeks in puromycin. DNA was isolated 411 from control (scrambled gRNA treated) and CASS4 KO, and Sanger sequenced. The 412 gRNA sequence used for making the knockout is shown in bold. The predicted Cas 9 413 cut site is shown as a red dotted line. The base pair number is labelled. The 414 insertions/deletions (N) can be seen in the CASS4 KO. (B) Representative image from 415 TIDE analysis of CASS4. Plot shows the overlay of sequence between scrambled 416 control and CASS4. The increase in aberrant sequence after the expected cut site is 417 evident in the CASS4 KO sample, indicating effective gene disruption. (C) Plots 418 represent the spectrum of indels and their frequencies for CASS4. R2 = 0.94. The plot 419 was analyzed and derived from the TIDE web tool (https://tide.deskgen.com/).

11 bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. bioRxiv preprint doi: https://doi.org/10.1101/809137; this version posted October 17, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.