Macrophage Migration Inhibitory Factor Mediates Proliferative GN Via CD74

BASIC RESEARCH www.jasn.org

Macrophage Migration Inhibitory Factor Mediates Proliferative GN via CD74

† ‡ † † Sonja Djudjaj,* Hongqi Lue, Song Rong, Marios Papasotiriou,* † † † † Barbara M. Klinkhammer,* Stephanie Zok, Ole Klaener,* Gerald S. Braun, | Maja T. Lindenmeyer,§ Clemens D. Cohen,§ Richard Bucala, Andre P. Tittel,¶ † † † Christian Kurts,¶ Marcus J. Moeller, Juergen Floege, Tammo Ostendorf, ‡ † Jürgen Bernhagen, and Peter Boor* **

*Department of Pathology, †Department of Nephrology and Immunology, and ‡Institute of Biochemistry and Molecular Cell Biology, RWTH Aachen University, Aachen, Germany; §Division of Nephrology and Institute of Physiology, University of Zürich, Zürich, Switzerland; |Department of Internal Medicine, Yale University School of Medicine, New Haven, Connecticut; ¶Institute of Molecular Medicine and Experimental Immunology, University of Bonn, Bonn, Germany; and **Institute of Molecular Biomedicine, Comenius University, Bratislava, Slovakia

ABSTRACT Pathologic proliferation of mesangial and parietal epithelial cells (PECs) is a hallmark of various glomerulonephritides. Macrophage migration inhibitory factor (MIF) is a pleiotropic cytokine that mediates inflammation by engagement of a receptor complex involving the components CD74, CD44, CXCR2, and CXCR4. The proliferative effects of MIF may involve CD74 together with the coreceptor and PEC activation marker CD44. Herein, we analyzed the effects of local glomerular MIF/CD74/CD44 signaling in proliferative glomerulonephritides. MIF, CD74, and CD44 were upregulated in the glomeruli of patients and mice with proliferative glomerulonephritides. During disease, CD74 and CD44 were expressed de novo in PECs and colocalized in both PECs and mesangial cells. Stress stimuli induced MIF secretion from glomerular cells in vitro and in vivo, in particular from podocytes, and MIF stimulation induced proliferation of PECs and mesangial cells via CD74. In murine crescentic GN, Mif-deficient mice were almost completely protected from glomerular injury, the development of cellular crescents, and the activation and proliferation of PECs and mesangial cells, whereas wild-type mice were not. Bone marrow reconstitution studies showed that deficiency of both nonmyeloid and bone marrow–derived Mif reduced glomerular cell proliferation and injury. In contrast to wild-type mice, Cd74-deficient mice also were protected from glomerular injury and ensuing activation and proliferation of PECs and mesangial cells. Our data suggest a novel molecular mechanism and glomerular cell crosstalk by which local upregulation of MIF and its receptor complex CD74/CD44 mediate glomerular injury and pathologic proliferation in GN.

J Am Soc Nephrol 27: 1650–1664, 2016. doi: 10.1681/ASN.2015020149

Macrophage migration inhibitory factor (MIF) is a Received February 10, 2015. Accepted August 24, 2015. fl pleiotropic, proin ammatory cytokine involved in J.B. and P.B. are both senior authors. the pathogenesis of various inflammatory diseases Published online ahead of print. Publication date available at including sepsis, rheumatoid arthritis, atheroscle- www.jasn.org. rosis, and GN.1–6 Depending on the target cell and Correspondence: Dr. Peter Boor, Department of Pathology, inflammatory context, MIF can signal via three re- RWTH Aachen University, Pauwelsstr. 30, 52074 Aachen, Germany, ceptors: the chemokine receptors CXCR2 and or Dr. Jürgen Bernhagen, Institute of Biochemistry and Molecular Cell Biology, RWTH Aachen University, Pauwelsstr. 30, 52074 3,7 CXCR4, and CD74. Whereas CXCR2 and CXCR4 Aachen, Germany. Email: [email protected] or jbernhagen@ also bind various chemokines, MIF and its homolog ukaachen.de D-dopachrome tautomerase are the only ligands of Copyright © 2016 by the American Society of Nephrology

1650 ISSN : 1046-6673/2706-1650 JAmSocNephrol27: 1650–1664, 2016 www.jasn.org BASIC RESEARCH

CD74.8 The proinflammatory actions of MIF, e.g., leukocyte re- up to fivefold in microdissected human glomeruli of patients cruitment, induction of the expression of cytokines, chemo- with mesangioproliferative IgA nephropathy (IgAN) and even kines, and adhesion molecules, are predominately mediated by significantly higher (up to 12-fold) in rapidly progressive GN CXCR2 and CXCR4,3 while CD74 is instrumental in MIF’spro- (RPGN) (Figure 1A). Using immunofluorescence in healthy proliferative and cell survival activities.9 human kidneys, MIF was detected at a low intensity in some Inthehealthyhuman kidney,MIFisconstitutivelyexpressed in glomerular cells, in particular podocytes and PECs, but also in tubular epithelial cells, endothelial cells, mesangial cells, and mesangial cells (Figure 1, B–B99). In RPGN, MIF was detected podocytes.8 Upon glomerular injury, increased MIF expression in resident glomerular cells and its expression was increased in occurs in resident renal and infiltrating inflammatory cells.10 podocytes and PECs, in particular those forming crescents MIF inhibition by neutralizing antibodies led to reduced glomer- (Figure 1, C–C99). In IgAN, MIF expression was increased in ular injury in experimental murine IgA nephritis and in rats with particular in podocytes, PECs, and also in other resident glo- crescentic GN.11–14 In experimental lupus nephritis, both genetic merular cells (Figure 1, D–D99). The patients with IgAN are Mif deficiency and inhibition using a small-molecule inhibitor significantly different from those with RPGN in terms of renal were renoprotective.12,15 These effects were mainly ascribed to excretory function and proteinuria, both of which may have the proinflammatory, recruitment-related activities of MIF. In had an impact on the staining pattern and thereby the differ- vitro, MIF also exerted proinflammatory effects in podocytes ences compared with healthy kidneys. The upregulation of via the CD74 receptor.16 Apart from this, there are no data on CD44 in resident glomerular cells and the de novo expression the possible direct effects of MIF on glomerular cells and the in PECs during glomerular diseases was previously documen- potential receptors involved. ted by us and others.19,29,30 We extend these data herein by CD74 is a type II transmembrane protein that functions quantitative analyses of CD44 mRNA expression in microdis- intracellularly as an MHC class II chaperone, and was recently sected glomeruli showing a significant, up to eightfold, upre- shown to have a role as a signaling molecule.9 MIF binding to gulation of CD44 in RPGN and IgAN (Supplemental Figure CD74 induces cell proliferation and inhibition of apoptosis in 1B). monocytes/macrophages, B cells, tumor cells, or during angio- CD74 mRNA was significantly elevated in RPGN, whereas in genesis.7,9 These effects appear to require the coexpression of IgAN CD74 was only slightly increased (Figure 1F). Immunohis- CD44,8 ahyaluronicacid–binding cell surface glycoprotein that tochemical and fluorescence analyses of CD74 showed low acts as a signaling coreceptor and sensitive marker of parietal expression in healthy human glomeruli, mostly localized to po- epithelial cell (PEC) activation.17–19 Only a single study to date docytes and endothelial cells (Figure 1, G and G9, Supplemental has analyzed the role of CD74 in renal disease, specifically its Figure 1, A–A9999), in line with a single previous report.16 In potential involvement in diabetic nephropathy.16 crescentic GN, de novo expression of CD74 was found on Extracapillary proliferation leading to cellular crescents, as PECs, and, similarly to MIF, particularly on cells forming the well as mesangial cell proliferation, are well established crescents (Figure 1, H and H9). In IgAN, increased expression histologic features of a number of glomerular diseases, in of CD74 was observed in both PECs and podocytes. particular of rapidly progressive and mesangioproliferative Taken together, both MIF and its receptor CD74 are highly glomerulonephritides. These lesions reflect an aggressive and upregulated in human proliferative glomerular diseases and in progressive course in a variety of glomerular diseases.20,21 We part expressed de novo by intrinsic glomerular cells. previously showed using extensive lineage-tracing and marker expression studies that glomerular PECs, when activated, con- Expression of MIF and CD74 in Murine Renal Tissue tribute centrally to the formation of cellular crescents in both In healthy mice, we found no detectable glomerular expression patients and experimental animals.22–24 The signaling path- of CD74 by immunohistochemistry (Figure 2B), with only ways involved in PEC activation are yet unknown, albeit para- some positive interstitial cells, presumably dendritic cells. crine signaling from injured podocytes might be the likely In a murine model of crescentic GN, the nephrotoxic-serum initiating trigger for such activation.25,26 nephritis (NTN) model, CD74, was expressed de novo in me- Here, we analyzed the regulation and the involvement of sangial cells and PECs, particularly in those forming the cres- MIF and its receptor CD74 in glomerular cell proliferation in cents (Figure 2C). vitro and in vivo. Using immunohistochemistry, the CD74 coreceptor CD44 was virtually absent in healthy murine glomeruli (Figure 2E). During NTN, an increase in CD44 expression occurred on RESULTS activated PECs and mesangial cells (Figure 2F). Staining of consecutive slides supported the coexpression of CD74 and MIF and CD74 Expression in Human Kidney Tissue CD44 in both PECs and mesangial cells during disease (Figure Previous reports characterized human renal expression of MIF 2, C and F). Immunofluorescence staining for CD44 and in glomerular diseases.8,10,27,28 Here we extend these findings, CD74 confirmed these results (Figure 2, G–I, Supplemental showing that compared with controls (time-zero biopsy of Figure 2, A–A999) and showed their colocalization, with CD44 living donor kidneys), MIF mRNA expression was increased being expressed on cell membranes only, whereas CD74 was

J Am Soc Nephrol 27: 1650–1664, 2016 MIF/CD74/CD44 in Proliferative GN 1651 BASIC RESEARCH www.jasn.org

Taken together, in a murine NTN model of crescentic GN, MIF, CD74, and CD44 were greatly upregulated and in part expressed de novo, in particular in PECs. The expression pattern largely mirrored that of patients with glomerular diseases and crescentic GN.

MIF Receptor Expression in Glomerular Cells In Vitro Toanalyze the regulation and cellular effects of CD74 and MIF, we used our recently developed primary cultures of murine podocytes and PECs with proven origin31 and the well established cultures of primary mesangial cells.32,33 Flow-cytometric analyses of the primary cultures showed that PECs, podocytes, and mesangial cells expressed CD74, whereas only PECs and mesangial cells coexpressed CD44 (Figure 3A), confirming our in vivo immunohisto- chemic data. None of the cell types showed Figure 1. MIF and its receptor CD74 are upregulated in human glomerulonephritides. detectable CXCR2 expression and only Reat-time qRT-PCR results obtained from microdissected glomeruli of patients with faint CXCR4 levels. RPGN (n=9), IgAN (n=10), and controls (pretransplant allograft biopsies [LD], n=7) showed a significant upregulation of (A) MIF and (F) CD74 in glomerulonephritides MIF Secretion Following Glomerular compared with controls. mRNA expression levels for each gene are shown as ratios In Vitro In Vivo calculated against GAPDH. (B–B99) In healthy controls, only minimal expression of MIF Cell Stress and (pink/Alexa-647, nuclei counterstained with blue/DAPI) in podocytes (arrows), PECs To analyze the regulation and secretion of (arrowheads), and mesangial cells (asterisks) was observed. (C–C99) In RPGN, over- MIF in injured glomerular epithelial cells, expression of MIF in cells forming the crescent was found. (D–D99) Interestingly, in we induced podocyte stress by stimulation IgAN MIF was not only upregulated in mesangial cells (asterisks), but also in PECs with 0.1% nephrotoxic sheep serum (NTS, (arrowheads) and podocytes (arrows). (G, G9) CD74 was only minimally expressed in used for the induction of NTN), 5 ng/ml healthy human kidneys by some podocytes (arrows) and mesangial cells (asterisks). (H, TGFb or 25 mg/ml adriamycin (ADR). 9 9 1 H )InRPGNand(I,I) IgAN, CD74 expression increases in podocytes and was de novo Both NTS and ADR led to substantial – 99 9 expressed by PECs (arrowheads). (E E ,J/J) Negative controls demonstrated spec- MIF protein secretion after 24 hours of ificity of the staining. The second row in panels B–E shows overlay of immunofluo- stimulation (Figure 3B), which further in- rescence and light microscopy. The second row of panels G–J and third row in panels – fi 3 creased over time. A less pronounced secre- B E shows digital enlargement of the lower area. Original magni cations 200 ,scale b bars represent 50 mm. Each dot represents one patient and red bars represent means. tion of MIF was observed following TGF 1 *P,0.05 versus LD; **P,0.01 versus LD; ##RPGN versus IgA, P,0.01. only detectable at 48 hours. Incubation with NTS induced increased MIF secretion localized both to cell membranes and intracellular compart- also in mesangial cells and PECs. Both cell types secreted MIF ments (Figure 2I). Costaining with proliferation marker Ki67 also in the steady state without stimulation (Supplemental or proliferating cell nuclear antigen (PCNA) confirmed the Figure 3). expression of CD74 in proliferating PECs in injured murine At the mRNA level, stimulation of podocytes with ADR and (Supplemental Figure 2, B–B999) and human glomeruli (Sup- NTS led to a significant increase in Mif after 24 hours (Figure plemental Figure 2, C–C999), respectively. 3C). In accordance with the Western blotting data, TGFb1 We next analyzed the mRNA expression of Mif, Cd74,and stimulation induced only a slight increase in Mif transcript Cd44 over the time course of NTN. Mif was upregulated already number. The increased MIF expression was confirmed using on day 3 after disease induction by approximately 80% and re- immunofluorescence staining of podocytes (Figure 3D). mained increased thereafter (Figure 2M). Cd74 expression in- To address the in vivo relevance of MIF upregulation in glo- creased even more dramatically, with a peak at day 7 (30-fold merular cells, we next tested the effects of a single intravenous increase) and a sustained upregulation during the later course injection of ADR in healthy mice on the expression of MIF in (15-fold increase; Figure 2N). The expression of Cd44 showed a isolated glomeruli. One day after ADR injection, we found a sig- similar pattern as Cd74 with a peak at day 7 (110-fold increase; nificant upregulation of MIF expression in the glomeruli when Figure 2O). compared with vehicle-injected mice (Figure 3E).

1652 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1650–1664, 2016 www.jasn.org BASIC RESEARCH

Taken together, glomerular cells, in particular podocytes, upregulated their MIF expression and secretion upon stress both in vitro and in vivo.

MIF Induces Proliferation of Parietal Epithelial and Mesangial Cells via CD74 Compared with vehicle-exposed cells, mesangial cells stimulated with recombinant murine MIF (rmMIF) demonstrated a sig- niﬁcantly higher mitogenic response (Figure 4A). Similarly, PECs treated with rmMIF exhibited a signiﬁcantly increased cell proliferation rate (Figure 4C). This effect was additive to that of the well described mitogenic PDGF-BB in both PECs and mesangial cells (Figure 4, B and D). On the other hand, podocytes were not responsive to rmMIF (Sup- plemental Figure 4A). Based on the expression data shown above and previous reports suggesting that CD74 prominently mediates proliferative effects of MIF in nonrenal cells,5,8,9,34,35 we hypothe- sized that CD74 is responsible for the proliferative effects of MIF. Preincubation of PECs with a neutralizing anti-CD74 inhibitory

by PECs (arrowheads) and mesangial cells (asterisk) in NTN. Negative controls were completely negative for both antibodies (A, D). CD44 and CD74 (C, F) were performed on consecutive slides demonstrating coexpression on PECs and mesangial cells. Double immunoﬂuorescence staining forCD44 (green/ Alexa-488; G, G9) and CD74 (red/Alexa-555; H, H9) in NTN revealed a coexpression (yellow/ merged) of both receptors on cells inside the glomerulus (dashed circle), mostly on cells of the crescent (arrowheads; I, I9). CD74 (green/ Alexa-488; J, J9) was additionally expressed by F4/80+ (red/Alexa-555; K, K9) immune cells surrounding the glomerulus (arrow). PECs were only CD74-positive, as expected (arrowheads; L, L9). The second row in panels G–L shows digital enlargement of the lower area. Original magniﬁcations 4003, scale bars represent 25 mm. Real-time qRT-PCR analyses of Mif (M), Cd74 (N), and Cd44 (O) during the NTN time Figure 2. MIF and CD74 are upregulated in murine kidneys after glomerular injury. In course (days 3, 7, 14, and 21) showed a signif- healthy murine kidneys, CD74 was only expressed by some interstitial, presumably icant increase of all three genes corresponding dendritic cells (arrows) (B). Upon induction of NTN, CD74 was massively upregulated to immunohistochemistry (healthy kidneys set and de novo expressed by mesangial cells (asterisk) and PECs (arrowheads) (C). Im- as one dashed orange line, n=5 for each munohistochemistry staining for CD44 revealed a similar expression pattern. In group). Data are means6SD *P,0.05 versus healthy glomeruli, CD44 was completely absent (E), but like CD74, de novo expressed healthy.

J Am Soc Nephrol 27: 1650–1664, 2016 MIF/CD74/CD44 in Proliferative GN 1653 BASIC RESEARCH www.jasn.org

antibody 1 hour prior to stimulation of the cells with rmMIF abolished the MIF-induced proliferative response of PECs, whereas anti- CD74 alone had no effect (Figure 4E). MIF stimulation of PECs induced the expression of CD44, suggesting that MIF might directly lead to PEC activation and contributes to upregulation of its own coreceptor in a self-amplifying loop (Sup- plemental Figure 4C). With regard to proin- ﬂammatory phenotypic changes of PECs, stimulation with rmMIF led to a signiﬁcant, however only slight, increase in Ccl2 chemokine expression 24 hours after stimulation, while this effect was lost 48 hours after stimulation. Ccl5 expression in PECs was not changed 24 and 48 hours after stimulation with MIF (Supplemental Figure 4B). MIF stimulation had no effect on the expression of Pdgfb and its receptor Pdgfrb in PECs (Supplemental Figure 4, D and E).

Genetic Mif Deficiency Ameliorates Glomerular Injury in NTN To address the in vivo relevance of the above 2 2 findings, we compared Mif / and wild-type (WT) littermates with NTN. Proteinuria was 2 2 significantly reduced in Mif / compared with WT mice. On day 14, the values ob- 2 2 served in Mif / mice were nearly identical to values prior to disease induction (Fig- 2 2 ure 5A). Compared with WT mice, Mif / mice also had significantly lower BUN and serum creatinine levels (Figure 5, B and C). 2 2 Mif / mice exhibited a significant reduction in the number of extracapillary prolifer- ates (crescents) by 87% compared with WT littermates (Figure 5D). Compared with 2 2 WTs, Mif / mice had a less dramatic but highly significant reduction of glomerular necrosis by 50% (Figure 5E). Compared with WTs, a significantly reduced proliferation of cells within the glomerulus was found 2 2 in Mif / mice (Figure 5F). Furthermore, Figure 3. MIF receptors are expressed on primary isolated glomerular cells and MIF is 2/2 upregulated and secreted following glomerular stress. (A) Mesangial cells (upper row), Mif mice showed prominent reduction a podocytes (middle row), and PECs (lower row) were isolated and analyzed for MIF in the expression of glomerular -smooth receptorsbyFACSinpassagefive. CD74 (first panel) was expressed by all glomerular muscle actin (a-SMA), a marker of activated cells, whereas CXCR2 (third panel) was not and CXCR4 (fourth panel) was only minimally expressed. CD44 was expressed on mesangial cells and PECs, but not on podocytes (second panel). Stimulation of primary murine podocytes with ADR (25 mg/ml) Western blot was analyzed by measurement of and NTS (0.1%) for 24 and 48 hours (B) induced MIF secretion and increased (C) MIF band densitometry normalized to GAPDH. mRNA and (D) MIF protein, whereas TGFb1 (5 ng/ml) had only minimal effect. In- Values of unstimulated (unstim.) cells were set travenous injection of ADR (25 mg/kg body wt) into the tail vein of WT mice (n=3) as 1. Data are means6SD *P,0.05 versus followed by isolation of glomeruli by ferric oxide 24 hours later (Scheme) led to a clear unstim. Original magnifications, 3200. Scale upregulation of MIF protein in glomeruli compared with untreated WT mice (n=3). (E) bars represent 50 mm.

1654 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1650–1664, 2016 www.jasn.org BASIC RESEARCH

basement membrane (Supplemental Figure 5, A and B), suggesting that Mif deﬁciency had no effect on disease induction. We next analyzed the expression of the three MIF receptors using quantitative real- time RT-PCR (qRT-PCR). Cd74 and Cxcr4 2 2 were signiﬁcantly downregulated in Mif / compared with WT mice (–54% and –60%, respectively), while Cxcr2 expression showed no difference between both groups, corrob- orating our in vitro data (Supplemental Figure 5F).

Deficiency of Nonmyeloid and Bone Marrow–Derived MIF Reduces Glomerular Injury in NTN To address the role of infiltrating inflammatory cell–derived versus nonmyeloid MIF, we performed bone marrow reconstitution experi- 2 2 ments in WT and Mif / mice with NTN. We compared WT recipients with bone marrow from WT donors (WTBM/WT), WT 2 2 recipients with bone marrow from Mif / do- 2 2 2 2 nors (Mif / BM/WT), and Mif / recipients with bone marrow from WT donors (WTBM 2 2 /Mif / ). Prior to NTN induction, all mice had similar proteinuria (data not shown). Compared with WTBM/WT mice, mice lack- 2 2 ing bone marrow (Mif / BM/WT) or 2 2 Figure 4. MIF induces cell proliferation of PECs and mesangial cells via CD74. Stimulation nonmyeloid MIF (WTBM/Mif / ) had signif- with 100 ng/ml rmMIF (black bars) increased cell doubling of (A) mesangial cells and (C) icantly and similarly reduced indices of renal PECs compared with unstimulated controls (white bars). PDGF-BB (light gray bars), as injury as shown for renal function parameters a potent growth factor, induced cell doubling of (B) mesangial cells and (D) PECs to proteinuria (–83% and –84%, respectively), a higher extent than MIF (black bars), but the proliferative effects of MIF were additive to – – fi BUN ( 13% and 19%, respectively), and se- the PDGF-BB effects (dark gray bars). (E) 5-Bromo-2-deoxyuridine assay con rmed the – – proliferative effect of rmMIF (black bars) on PECs compared with unstimulated controls rum creatinine ( 23% and 17%, respectively; – (white bars) or cells incubated with inhibitory anti-CD74 antibody (12 mg/ml) alone (light Figure 6, A C). This was mirrored by a signif- gray bars) and demonstrated a CD74-dependent MIF effect (dark gray bars). All experi- icant reduction in the extent of glomerular ments were performed three times as triplicates. Data are means6SD. *P,0.05 versus necrosis (–60% and –59%, respectively), the unstim.; **P,0.01 versus unstim.; ***P,0.001 versus unstim. number of glomerular crescents (–54% and –61%, respectively), the extent of pathologic and expanded mesangial cells (Figure 5G). The proliferation of glomerular cell proliferation using PCNA staining and pathologic PECs, analyzed outside of cellular crescents, was strongly and sig- cell activation shown by CD44 and CD74 staining (Figure 6, D–J). 2 2 nificantly reduced (Figure 5H). Quantification of activated, i.e., Interestingly, compared with the Mif / BM/WT group, WTBM/ 2 2 CD44-positive PECs, demonstrated their intense activation in Mif / mice had significantly more reduced indices of pathologic WT mice with NTN, whereas CD44 was virtually absent in the cell proliferation and activation. Compared with WTBM/WTmice, 2 2 2 2 2 2 PECs of Mif / mice(Figure5I).Inlinewiththelatterfinding, both Mif / BM/WTand WTBM/Mif / mice also had significantly 2 2 CD74 expression in PECs was also significantly lower in the Mif / reduced interstitial and periglomerular immune cell infiltrates an- animals (Figure 5J). alyzed by staining for F4/80, ErHr3, and CD3 (Supplemental Fig- Interstitial immune cell infiltration, including periglomerular ure 6, A–C). The decrease in body weight during NTN was similar infiltrates staining positively for F4/80, ErHr3, and CD3 (Sup- in all groups (data now shown). 2 2 plemental Figure 5, C–E), were significantly reduced in Mif / compared with WT mice. Glomerular immune cell infiltrates Genetic CD74 Deficiency Ameliorates Glomerular were rather rare and similar in both groups (data not shown). Injury in NTN The decrease in body weight during NTN was similar in To address the functional role of the CD74 receptor in 2 2 both groups, as was the binding of sheep IgG to the glomerular proliferative GN, we compared Cd74 / mice with WT

J Am Soc Nephrol 27: 1650–1664, 2016 MIF/CD74/CD44 in Proliferative GN 1655 BASIC RESEARCH www.jasn.org

littermates. We first assessed whether 2 2 Cd74 / mice develop a spontaneous renal phenotype. In healthy mice, we found no pathologic changes in the kidneys and found no difference in functional or his- 2 2 tologic parameters between Cd74 / and WT mice (Supplemental Figure 7, A–H). 2 2 Next, we induced NTN in Cd74 / and WTmice. Compared with WTmice, Cd74 2 2 / mice were significantly protected from glomerular injury shown by reduced proteinuria (–38%), BUN (–27%) and serum creatinine (–8%;Figure7,A–C). Histologic assessment of renal injury showed a significant reduction of glomerular necrosis (–57%), the number of crescents (–40%), and the extent of glomerular cell proliferation and activation (Figure 7, D–H). Staining with CD74- specific antibody showed no signal in 2 2 Cd74 / mice, supporting the specificity of our staining and the genetic knockout 2 2 (Figure 7J). Cd74 / mice had also fewer interstitial and periglomerular immune cell infiltrates (Supplemental Figure 8, A–C). The 2 2 protective effect observed in Cd74 / mice 2 2 was very similar to that found in Mif / mice, albeit numerically lower.

DISCUSSION

A number of glomerular diseases are characterized by pathologic cell proliferation. We have shown previously that PEC activation and proliferation is crucial in the formation of cellular crescents and thereby for the development and progression of crescentic glomerulonephritides.17,36,37 Mesangial cell proliferation is a relatively common pathologic finding in various glomerular diseases including lupus nephritis, IgAN, and to some degree in diabetic nephropathy. In par- 2 2 Figure 5. MIF deficiency attenuates glomerular injury in vivo. Mif / mice (white bars, ticular, in IgAN, the extent of mesangial pro- n=13) exhibited preserved renal function compared with WT mice (gray bars, n=6) liferation is an important indicator of disease with less (A) proteinuria, (B) BUN level, and (C) serum creatinine. Also, glomerular progression.20 Here, we identified MIF and 2 2 injury was decreased at day 14 after NTN induction in Mif / versus WT animals its receptor complex CD74/CD44 as a novel analyzed by scoring of (D) PAS and (E) fibrinogen. (F) Evaluation of PCNA-positive cells molecular pathway mediating intrinsic 2/2 within the glomerular tuft revealed a decreased proliferation in Mif mice compared glomerular cell crosstalk leading to patho- a fi with WT. (G) Morphometric evaluation of glomerular -SMA showed signi cantly re- logic proliferation of cells involved in duced activation and expansion of mesangial cells. In addition, PECs proliferated less 2 2 in (H) Mif / and showed reduced activation as assessed by expression of (I) CD44- and (J) CD74-positive PECs compared with WTs. Diagrams on the right show data that immunostained positively. Data represent obtained by scoring or computer-based morphometric analyses on day 14 after in- means6SD. *P,0.05 versus WT; **P,0.01 duction of NTN. Values indicate the mean of scoring or the relative area (in %) of tissue versus WT; ***P,0.001 versus WT.

1656 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1650–1664, 2016 www.jasn.org BASIC RESEARCH

mesangioproliferative and crescentic lesions, and thereby leading to an aggressive and progressive course of glomerulonephritides. The first major and novel finding was that MIF exerted direct proliferative effects on local glomerular cells expressing the CD74/CD44 receptor complex. Our in vitro data suggest that whereas CXCR2 and CXCR4 are not or only weakly expressed on glomerular cells, CD74 and CD44 are strongly expressed by PECs and mesangial cells, i.e., the cells most often reacting with pathologic proliferation during glomerular injury. Consequently, PECs and mesangial cells showed strong proliferative effects but with only a slight increase in the production of a single proinflammatory cytokine at a single time point upon MIF stimulation. Our data are well in line with specific receptor effects of MIF, in which leukocyte recruitment and proinflammatory effects are mediated by CXCR2 and CXCR4, whereas proliferative effects are predomi- nantly mediated by CD74.8 Our in vivo data further support these findings given that 2 2 2 2 both Mif / mice and chimeric Mif / mice with WT bone marrow exhibited significantly fewer extracapillary proliferative lesions and reduced activation and proliferation of both PECs and mesangial cells. In addition, the pathologic glomerular cell proliferation was significantly more reduced in mice with nonmyeloid versus bone-marrow MIF deficiency. To date, only scarce data exist on the potential molecular mechanisms of PEC activation and our data suggested MIF–CD74/CD44 as a novel and important pathway. Our study identified MIF as a novel potent molecule involved in mesangial cell proliferation. Importantly, this effect was comparable and additive to PDGF- BB, one of the strongest mitogenic factors for mesangial cells.38–41 Whether MIF-mediated Figure 6. Deficiency of nonmyeloid and bone marrow–derived MIF similarly reduced glomerular injury in NTN. Compared with WT recipients with bone marrow from WT pathologic glomerular cell proliferation 2 2 donors (WTBM/WT; gray bars, n=5), WT recipients with bone marrow from Mif / might be due to functional interactions 2 2 2 2 donors (Mif / BM/WT; gray bars with white dots, n=5) and Mif / recipients with bone with other potent mitogenic signaling 2 2 marrow from WT donors (WTBM/Mif / ; white-gray striped) had reduced (A) proteinuria, (B) BUN, and (C) serum creatinine. Accordingly, less glomerular injury was found in mice deficient for nonmyeloid or bone marrow Mif analyzed by (D) number of CD44- and (J) CD74-positive PECs compared crescents and (E) scoring of fibrinogen-positive glomerular necrosis. (F) Evaluation of with WTBM/WT. Diagrams on the right show PCNA-positive cells within the glomerular tuft revealed a decreased proliferation in data obtained by scoring or computer-based 2 2 2 2 Mif / BM/WT and WTBM/Mif / mice compared with WTBM/WT. (G) Morphometric morphometric analyses. Values indicate the evaluation of glomerular a-SMA showed only very slight increase in mesangial cell mean of scoring or of the positively stained 2 2 activation in all groups. (H) In addition, PECs proliferated less in Mif / BM/WT and area (in %). Data represent means6SD 2 2 WTBM/Mif / mice, and showed reduced activation as assessed by expression of (I) *P,0.05; **P,0.01; ***P,0.001.

J Am Soc Nephrol 27: 1650–1664, 2016 MIF/CD74/CD44 in Proliferative GN 1657 BASIC RESEARCH www.jasn.org

pathways, such as those mediated by PDGF or EGF receptors, remains to be shown. We showed that the effects of MIF on proliferation of PECs and mesangial cells are additive to PDGF stimulation. This result suggests that the effects of MIF might be independent of the PDGF signaling pathway. In support of this interpretation, we found that MIF did not influence Pdgfrb or Pdgfb mRNA expression in PECs and have shown previously that PDGFR protein levels in vascular smooth muscle cells are not altered by MIF, although it had a biphasic time-dependent effect on PDGF-induced migration. Interestingly, MIF had no effect on proliferation of vascular smooth muscle cells, suggesting cell- and tissue-specific effects.42 Scarce data are available on potential interactions of MIF with the EGFR signaling pathway. In neural progenitor cells and breast cancer cells, MIF-induced proliferation and survival was associated with increased expression of Egfr.43,44 The second major and novel finding was that the MIF receptor CD74 was highly upregulated and expressed de novo in injured glomerular cells, in particular PECs. Similar to MIF, CD74 showed a comparable regulation in mice and humans. The only study that has analyzed CD74 in kidneys so far reported an intracellular and cell membrane localization of CD74 in cultured podocytes in vitro and in diabetic nephropathy in vivo.16 We also found CD74 to be expressed on podocytes and noted an upregulation upon podocyte injury in our models. Furthermore, our immunofluorescence staining for CD74 also showed both membranous and intracellular staining, whereas its coreceptor CD44 was expressed exclusively on the cell surface. CD74 that is localized on the cell membrane can undergo proteolytic cleavage Figure 7. Cd74 deficiency attenuates glomerular injury in NTN. Compared with WT and the intracellular cytoplasmatic domain 2 2 (gray bars, n=5), Cd74 / mice (white bars, n=4) had significantly less (A) proteinuria, shuttles into the nucleus to activate gene 2 2 (B) BUN, and (C) serum creatinine. Glomerular injury was also reduced in Cd74 / transcription, e.g.,ofMCP-1.45 In line versus WT animals as shown for the extent of (D) glomerular crescents and (E) necrosis. with this, stimulation of PECs with MIF 2/2 Compared with WT, Cd74 mice had (F) decreased proliferation analyzed by the induced MCP-1 expression in vitro. number of PCNA-positive cells within the glomerular tuft, (G) reduced activation and The third novel finding of our study was 2 2 2 2 expansion of mesangial cells analyzed by morphometric evaluation of glomerular that Cd74 / mice,46 similarly to Mif / a-SMA, (H) reduced proliferation of PECs analyzed by counting of PCNA-positive mice, were significantly protected from PECs, and (I) reduced activation of PECs assessed by number of CD44-positive PECs. 2 2 (J) Cd74 / had no signal in immunohistochemistry for CD74, confirming the CD74 glomerular injury and pathologic glomer- deficiency of these mice and CD74 antibody specificity. Diagrams on the right show ular cell proliferation and activation during data obtained by scoring or computer-based morphometric analyses. Values indicate crescentic GN. These data further support the mean of scoring of the positively stained area (in %). Data represent means6SD. the relevance of the MIF–CD74/CD44 *P,0.05 versus WT; **P,0.01 versus WT; ***P,0.001 versus WT. pathway in proliferative glomerular diseases.

1658 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1650–1664, 2016 www.jasn.org BASIC RESEARCH

2 2 2 2 2 2 Similar to healthy Mif / mice, healthy Cd74 / mice showed used Mif / mice to analyze also the local effects of MIF in no pathologic renal phenotype. This suggested that both MIF the kidney. Surprisingly, genetic deletion of MIF led to a nearly and CD74 are dispensable for normal kidney development and complete protection of mice from NTN, despite a similar in- physiologic functions, but become relevant during glomerular duction of the disease in both WT and knockout animals. disease. Importantly, the protective effect of genetic Mif deletion was The fourth major finding of our study was that MIF was characterized by a prominent reduction of PEC and mesangial upregulated and secreted fromvirtually all intrinsic glomerular cell proliferation and activation. Bone marrow transplantation cells under stress. In particular, MIF was secreted de novo from experiments further showed that deficiency in both the non- injured podocytes both in vitro and in vivo. Importantly, our myeloid and bone marrow–derived Mif is protective during data showed a similar manner of regulation in human disease NTN. Further in support of our hypothesis of local glomerular and in a relevant animal model, supporting the translational MIF effects are our in vitro data, the extent of the protective relevance of these findings. Our data also point to an intensive effect in our in vivo models, and a previous study showing that crosstalk between podocytes and PECs and mesangial cells local overexpression of MIF in podocytes led to the develop- during glomerular diseases (Supplemental Figure 9). Al- ment of mesangial sclerosis.57 though inflammatory cells are considered the most prominent In conclusion, we found that the MIF–CD74/CD44 axis is source of circulating MIF upon inflammation, MIF is also upregulated and in part de novo expressed in resident glomer- secreted in response to various stress stimuli by different cells ular cells in humans and animals, and crucially involved in in the body, including endothelial cells, platelets, and certain the pathologic proliferation of glomerular cells. Our data organ-resident parenchymal cells.47–51 In renal cells, no data suggest a novel mechanism of injury in proliferative glomer- on MIF secretion existed, albeit increased MIF expression was ular diseases. found in tubular cells after stimulation with angiotensin II and in mesangial cells after stimulation with IgA from patients with IgAN or with various inflammatory cytokines.28,50,52–54 CONCISE METHODS Our bone marrow reconstitution experiments support the idea that both bone marrow, i.e.,inflammatory cell-derived, Real-Time qRT-PCR of Renal Biopsies with Diverse MIF as well as local MIF are involved in the pathogenesis of Human Kidney Diseases proliferative GN. Human kidney biopsies were collected in a multicenter study Studies of markers for PEC activation helped us to un- (European Renal cDNA Bank-Kroener-Fresenius Biopsy Bank; see derstand their biology and their involvement in disease Cohen et al.58 for participating centers) and were obtained from pa- conditions such as crescentic GN or FSGS.19,23,55 The fifth tients after informed consent and with approval of the local ethics major and novel finding of our study was that the de novo committees. Following renal biopsy, the tissue was transferred to expression of CD74 in PECs during glomerulonephritides RNase inhibitor and microdissected into glomerular and tubular might serve as a novel sensitive marker of PEC injury and fragments. Total RNA isolation from microdissected glomeruli and activation. real-time qRT-PCR were performed as reported earlier.59 Predevel- It was previously shown that CD44 is a necessary coreceptor oped TaqMan reagents were used for human MIF (NM_002415.1), for MIF signaling via CD74.56 Our data support these findings CD74 (NM_001025158.2), and CD44 (NM_000610.3), as well as the because only cells that expressed both receptors proliferated reference genes 18S rRNA and glyceraldehyde 3-phosphate dehydro- upon MIF stimulation, whereas podocytes, which only ex- genase (GAPDH) (Applied Biosystems). The expression of the candidate pressed CD74, did not. It should be mentioned that previous gene was normalized to the reference genes. The mRNA expression was studies found no evidence for MIF binding to CD44,8 suggest- analyzed by standard curve quantification. Demographic data are given ing that both receptors are required for MIF-induced cell proin Table 1. liferation, but that only CD74 binds MIF. Accordingly, the addition of CD74-neutralizing antibody was sufficient to Animal Experiments completely abolish the proliferative effects of MIF in renal All animal experiments were approved by the local and government cells. We previously showed that CD44 is a specific and early review boards. The animals were held in cages with constant marker of activated PECs.17,18 Our present data extend these temperature and humidity with ad libitum access to tap water and findings and suggest a functional involvement of CD44 in standard chow. 2 2 glomerular lesions characterized by PEC and mesangial cell Mif / mice were characterized previously and showed no obvious proliferation, acting as a crucial coreceptor of CD74. renal phenotype (see Harper et al.,60 Bozza et al.,61 Satoskar et al. 62,and 2 2 Our in vivo data showed effects of genetic Mif and Cd74 data not shown). We used Mif / mice to focus on local MIF effects in deletion in NTN. These data extend the previous studies the kidney, whereas previous studies using MIF inhibitory antibodies showing the renoprotective effects of MIF inhibition in cres- rather analyzed the effects of systemic and/or circulating MIF. 2 2 centic GN and are the first data on functional role of CD74 in NTN was induced in 13-week-old male Mif / (n=13) and C57Bl/ kidneys.12,14 The administration of inhibitory antibodies 6N (n=6) WT littermates by intraperitoneal injection of 750 mlNTS blocks primarily the circulating MIF; therefore, here we and 40 mg CpG-oligonucleotide.

J Am Soc Nephrol 27: 1650–1664, 2016 MIF/CD74/CD44 in Proliferative GN 1659 BASIC RESEARCH www.jasn.org

One day prior to NTS injection and one day prior to euthanizing, Renal Morphology and Immunohistochemistry the mice were placed in metabolic cages for 24-hour, stoolfree urine Tissue for light microscopy and immunohistochemistry was fixed in collection for biochemical analyses. Standard blood and urine methyl Carnoy’s solution or formalin and embedded in paraffin. The parameters were measured. sections (1-mm thickness) were stained with periodic acid–Schiff’s 2 2 The bone marrow reconstitution experiments in Mif / and WT reagent (PAS) and counterstained with hematoxylin. littermates were performed as described previously using a well es- In the PAS-stained sections the percentage of glomeruli exhibiting tablished protocol and in line with this a reconstitution rate of 96%6 crescent formation was calculated from all glomeruli per section 2% was reached.3,63–65 For bone marrow transplantation, 10-week- (range 85–179) as described previously.66 2 2 old female Mif / (n=5) and C57Bl/6N (n=10) WT littermates were All stainings except for MIF were done in methyl Carnoy’s fixed 2 2 used as recipients and 10-week-old male Mif / (n=3) and C57Bl/6N renal tissues. The sections (1-mm thickness) were processed as de- (n=4) WT littermates as donors. Recipients were irradiated with 6.8 scribed previously.66,67 Primary antibodies included a murine mAb Gy for 8 minutes two times with a pause of 4 hours. Bone marrow (clone 1A4) to a-SMA conjugated with alkaline phosphatase (Sigma- cells (23106) obtained from the femur and tibia of donor mice were Aldrich), rabbit anti-human fibrinogen polyclonal Ab (Dako), rat injected via the tail vein in recipient mice 6 hours after the first irra- anti-mouse F4/80 (Serotec AbD), rat anti-mouse ErHr3 (BMA Bio- diation. All mice were treated with sulfadoxinum and trimethopri- medicals), rat anti-human CD3 (Serotec AbD), rat anti-human Ly6G mum via drinking water for 2 weeks. After an additional 2 weeks, i.e., (BD Pharmingen), rabbit anti-human CD44 (BD Pharmingen), and 4 weeks after bone marrow transplantation, mice were injected with rat anti-mouse CD74 (BD Pharmingen) plus appropriate negative NTS (150 ml per 20 g body wt) and analyzed on day 10 after disease controls as described previously.68 The evaluation of immunohisto- induction. One day prior to NTS injection and one day prior to chemistry was performed using the ImageJ v1.48 software (http:// euthanizing, the mice were placed in metabolic cages for 24 hours imagej.nih.gov/ij/). Glomerular necrosis score was calculated in 50 for stoolfree urine collection for biochemical analyses. Standard consecutive glomeruli exhibiting fibrinogen-positive area (score blood and urine parameters were measured using an autoanalyzer. 0=0%–5%; 1=5%–25%; 2=25%–50%; 3=50%–75%; 4=75%– 2 2 Healthy male Cd74 / (n=5) and C57Bl/6N (n=5) WT littermates 100%). Glomerular injury score was calculated in 50 consecutive were analyzed at the age of 20 weeks.46 NTN was induced in 10-week-old glomeruli in PAS staining by rating glomerular sclerosis, mesangial 2 2 male Cd74 / (n=4) and C57Bl/6N (n=5) WT littermates by intraper- expansion, or increased cell number (score 0=no jury; 1=1%–25%; itoneal injection of 150 ml NTS. Kidneys and renal function were ana- 2=25%–50%; 3=50%–75%; 4=75%–100%). The percentage of pos- lyzed 10 days after NTS injection as in the other experiments. itively stained area (F4/80 and a-SMA) in each tissue was calculated For isolation of glomeruli from ADR-treated animals, C57Bl/6N separately for 50 glomeruli and in 20 interstitial fields representing mice (n=3) were injected intravenously with ADR (25 mg/kg body almost the whole cortical area. To assess the number of infiltrating wt) and euthanized after 24 hours. Mice were euthanized by exsan- immune cells, CD3-, ErHr3-, and Ly6G-positive cells (for glomeruli: guination via abdominal aorta in ketamine (100 mg/kg body wt) and in 100 consecutive glomeruli; for interstitium: in 20 interstitial fields) xylazine (10 mg/kg body wt) intraperitoneal anesthesia. The kidneys were counted. PCNA-positive cells were counted separately within were taken and immediately processed for further analyses. All sam- the glomerular tuft or on the Bowman’s capsule but excluding the ples, if not analyzed immediately, were stored at –80°C. crescents in 100 glomeruli per animal. For analysis of CD44- and CD74-positive PECs, 50 consecutive glomeruli were scored (score – – – . Isolation of Glomerular Fraction 0=0% 5%; 1=5% 25%; 2=25% 50%; 3= 50%) All histomorpho- Mice were anesthetized using ketamine/xylazine, euthanized by exsangui- logic analyses were done in a blinded manner. nation via the abdominal aorta, and directly perfused via the left ventricle with Fe3O4 (Sigma-Aldrich) diluted in 20 ml 0.9% NaCl. The kidneys were Immunofluorescence and Double Staining then transferred into RPMI 1640 medium (Life Technologies) containing MIF staining was done on formalin-fixed tissue with heat-induced 1% penicillin/streptomycin and cut into small fragments. Afterward, frag- antigen retrieval in citrate buffer (pH 6.0); all other stainings were ments were treated for 30 minutes at 37°C with 1 mg/ml collagenase type performed on methyl Carnoy’s fixed renal tissues. Primary antibodies IV (Worthington Biochemical Corporation). The small kidney fragments included a rabbit anti-rat MIF (Life Technologies, Darmstadt, Germany), were gently sieved through a 100-mm strainer, centrifuged and resuspen- rat anti-mouse CD44 (BD Pharmingen), rabbit anti-human CD74 ded in PBS. Glomeruli containing Fe3O4 were separated using a magnetic (Sigma-Aldrich), rat anti-mouse CD74 (BD Pharmingen), rabbit anti- particle concentrator (DynaMag TM-2, Life Technologies). human Ki67 (Abcam, Inc.), mouse anti-human CD31 (Dako), and rat

Table 1. Clinical data of the patients (all RPGN ANCA-positive small vessel vasculitis) Gender Age Creatinine Proteinuria eGFR (MDRD) Hypertension n=Biopsies (Male/Female) (Years) (mg/dl) (g/24 h) (ml/min per 1.73 m2) (Yes/Controlled) LD 7 4/2 49616 ,1.1 ,0.2 .60 0 RPGN 9 5/4 55611 1.7461.1 0.9660.6 56.7636 4/2 IgAN 10 7/2 44617 3.0761.6 3.761.7 29.3613.1 5/3 MDRD, modiﬁcation of diet in renal disease; LD, living donor.

1660 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1650–1664, 2016 www.jasn.org BASIC RESEARCH anti-mouse F4/80 (Serotec AbD). Alexa647-coupled donkey anti-rabbit, for 10 seconds, and centrifuged at 10,000g for 15 minutes at 4°C. Alexa555-coupled goat anti-rat, and Alexa488-coupled goat anti-rat were Supernatants containing cellular proteins were collected and protein used as secondary antibodies. concentrations determined by bicinchonic acid protein assay with BSA standard (Interchim). RNA Extraction and Real-Time qRT-PCR Secreted proteins were precipitated using TCA and subsequently Total RNAwas collected from renal cortex using the RNAeasy Mini Kit analyzed by immunoblotting. Confirmation of active secretion (Qiagen, Hilden, Germany). RNA purity determination and cDNA without cell death was proven by negative detection of GAPDH synthesis were performed as described previously.69 For the normal- (data not shown). ization of the data, the standard DCTmethod was used with GAPDH Denatured protein samples were separated by electrophoresis in as the housekeeping gene. The expression of genes of interest was 10% SDS-polyacrylamide gel, transferred to nitrocellulose mem- calculated as relative expression units in comparison to WTor control branes, blocked with 2% (w/v) BSA in PBS, washed with tris-buffered group (arbitrarily set as 1). The sequences of primers used for real- saline with tween, and incubated with primary antibodies diluted in time qRT-PCR are shown in Table 2. tris-buffered saline with tween overnight at 4°C. The following antibodies were applied: mouse anti-human GAPDH (Novus Biologi- In Vitro Stimulation Assays cals), rabbit anti-rat MIF (Sigma-Aldrich), and rat anti-mouse Primary podocytes and PECs were isolated and cultured as described CD44 (BD Pharmingen). Primary antibodies were detected using previously.31 For stimulation, mesangial cells, PECs and podocytes horse radish peroxidase-conjugated antibodies and visualized by en- were seeded into six-well plates and incubated with 5 ng/ml recombi- hanced chemiluminescence (Roche Diagnostics). GAPDH quantifi- nant human TGFb1 (R&D Systems), 25 ng/ml ADR, 100 ng/ml cation was performed on the same nitrocellulose blots to normalize rmMIF, and 0.1% NTS, or vehicle for the indicated time periods. for loading incongruities. Band intensities were quantified by Scion Afterward, supernatants were taken for TCA precipitation and cells Image software. harvested for protein lysates. FACS Analyses Cell Proliferation Assays Cells were treated with fluorochrome-conjugated antibodies against For the analysis of cell proliferation, mesangial cells, PECs, and CXCR2, CXCR4, and CD74 for 30 minutes at room temperature along podocytes were seeded into 24-well plates and growth-synchronized with the respective isotype controls, and analyzed by flowcytometry as by serum deprivation for 24 hours before stimulation with 100 ng/ml described previously.34 For CD44, a rat anti-mouse antibody and a rmMIF or vehicle. Manual cell counting in Neubauer chambers was fluorochrome conjugate secondary antibody was used. performed at daily intervals following stimulation. To quantitatively analyze cell proliferation, 5-bromo-2-deoxyuridine Statistical Analyses assay was performed according to the manufacturer’sprotocol(Roche All values are expressed as means6SD. Comparison of groups was Diagnostics). Briefly, cells were seeded into 96-well plates and growth- performed using the Mann–Whitney U test. Statistical significance synchronized by serum deprivation for 24 hours. One hour prior to was defined as P,0.05. stimulation with 100 ng/ml rmMIF or vehicle, cells were incubated with neutralizing CD74 antibody (BD Pharmingen). ACKNOWLEDGMENTS Lysate Preparation and Western Blotting Analysis Cells were lysed in RIPA buffer (50 mM Tris-HCl, 150 mM Nonidet This work was supported by financial research grants of the Else-Kröner P-40, 1 mM sodium deoxycholate, 1 mM EDTA, and 1 mM sodium Fresenius Foundation (EKFS 2012_A216) to P.B. and J.B., by grants of orthovanadate) containing complete protease inhibitor cocktail the German Research Foundation (Deutsche Forschungsgemeinschaft) (Roche Diagnostics) at 4°C for 15 minutes, sonicated three times to P.B. (BO 3755/1-1 and B.O. 3755/2-1), to J.F. and T.O. (FL 178/4-1)

Table 2. List of primers used for real-time qRT-PCR (all genes were murine) Gene Sequence (Sense) Sequence (Antisense) Probe Mif 59-CGTGCCGCTAAAAGTCATGA-39 59-GCAAGCCCGCACAGTACAT-39 Sybrgreen Cd74 59-ATGACCCAGGACCATGTGATG-39 59-CCCTTCAGCTGCGGGTACT-39 Sybrgreen Cxcr2 59-GCCTTGAATGCTACGGAGATTC-39 59-GAGAAGTCCATGGCGAAATTTC-39 Sybrgreen Cxcr4 59-CAGTCTATGTGGGCGTCTGGA-39 59-GCTGACGTCGGCAAAGATG-39 Sybrgreen Cd44 59-TCCGAATTAGCTGGACACTC-39 59-CCACACCTTCTCCTACTATTGAC-39 Sybrgreen Gapdh 59-GGCAAATTCAACGGCACAGT-39 59-AGATGGTGATGGGCTTCCC-39 Sybrgreen Ccl2 59-TGGCTCAGACAGATGCAGT-39 59-ATTGGGATCATCTTGCTGGTG-39 Sybrgreen Ccl5 59-AGTGCTCCAATCTTGCAGTCG-39 59-CACTTCTTCTCTGGGTTGGCA-39 Sybrgreen Pdgfrb 59-GAGGCTTATCCGATGCCTTCT-39 59-AAACTAACTCGCCAGCGCC -39 CCTGTGGCTCAAGGACAACCGTACCTT Pdgfb 59-CCATCCGCTCCTTTGATGAT-39 59-AAGTCCAGCTCAGCCCCAT -39 CGCCTGCTGCACAGAGACTCCGTA

J Am Soc Nephrol 27: 1650–1664, 2016 MIF/CD74/CD44 in Proliferative GN 1661 BASIC RESEARCH www.jasn.org and within the SFB/Transregio 57 “Mechanisms of organ fibrosis” to P.B., factor-beta 1 expression in experimental IgA nephropathy. Nephrol J.F., M.J.M., T.O., and J.B. Further support came from the In- Dial Transplant 19: 1976–1985, 2004 ’ terdisciplinary Centre for Clinical Research within the Faculty of Med- 12. Hoi AY, Hickey MJ, Hall P, Yamana J, O Sullivan KM, Santos LL, James WG, Kitching AR, Morand EF: Macrophage migration inhibitory factor icine at the RWTH Aachen University to T.O. and J.F. (E7-2) and to P.B. deficiency attenuates macrophage recruitment, glomerulonephritis, (K7-3). C.D.C. and M.T.L. are supported by the Else-Kröner Fresenius and lethality in MRL/lpr mice. JImmunol177: 5687–5696, 2006 Foundation. R.B. is supported by the US National Institutes of Health. 13. Lan HY, Bacher M, Yang N, Mu W, Nikolic-Paterson DJ, Metz C, The technical assistance of Cherelle Timm, Claudia Gavranic, and Meinhardt A, Bucala R, Atkins RC: The pathogenic role of macrophage Simon Otten is gratefully acknowledged. We thank all participating migration inhibitory factor in immunologically induced kidney disease in the rat. JExpMed185: 1455–1465, 1997 centers of the European Renal cDNABank–Kroener–Fresenius Biopsy 14. Yang N, Nikolic-Paterson DJ, Ng YY, Mu W, Metz C, Bacher M, Bank and their patients for their cooperation. Active members at the Meinhardt A, Bucala R, Atkins RC, Lan HY: Reversal of established rat time of the study are listed in Martini et al., JAmSocNephrol25: crescentic glomerulonephritis by blockade of macrophage migration 2559–2572, 2014. inhibitory factor (MIF): potential role of MIF in regulating glucocorticoid production. Mol Med 4: 413–424, 1998 15. Leng L, Chen L, Fan J, Greven D, Arjona A, Du X, Austin D, Kashgarian M, Yin Z, Huang XR, Lan HY, Lolis E, Nikolic-Paterson D, Bucala R: A DISCLOSURES small-molecule macrophage migration inhibitory factor antagonist J.B. and R.B. are coinventors on patents describing anti-MIF–based thera- protects against glomerulonephritis in lupus-prone NZB/NZW F1 and peutic strategies. All other authors declare no competing interests. MRL/lpr mice. JImmunol186: 527–538, 2011 16. Sanchez-Niño MD, Sanz AB, Ihalmo P, Lassila M, Holthofer H, Mezzano S, Aros C, Groop PH, Saleem MA, Mathieson PW, Langham R, Kretzler M, Nair V, Lemley KV, Nelson RG, Mervaala E, Mattinzoli D, Rastaldi MP, Ruiz- REFERENCES Ortega M, Martin-Ventura JL, Egido J, Ortiz A: The MIF receptor CD74 in diabetic podocyte injury. JAmSocNephrol20: 353–362, 2009 1. Bendrat K, Al-Abed Y, Callaway DJ, Peng T, Calandra T, Metz CN, 17. Sicking EM, Fuss A, Uhlig S, Jirak P, Dijkman H, Wetzels J, Engel DR, Bucala R: Biochemical and mutational investigations of the enzymatic Urzynicok T, Heidenreich S, Kriz W, Kurts C, Ostendorf T, Floege J, activity of macrophage migration inhibitory factor. Biochemistry 36: Smeets B, Moeller MJ: Subtotal ablation of parietal epithelial cells in- 15356–15362, 1997 duces crescent formation. JAmSocNephrol23: 629–640, 2012 2. Bernhagen J, Calandra T, Mitchell RA, Martin SB, Tracey KJ, Voelter W, 18. Smeets B, Uhlig S, Fuss A, Mooren F, Wetzels JF, Floege J, Moeller MJ: Manogue KR, Cerami A, Bucala R: MIF is a pituitary-derived cytokine Tracing the origin of glomerular extracapillary lesions from parietal that potentiates lethal endotoxaemia. Nature 365: 756–759, 1993 epithelial cells. J Am Soc Nephrol 20: 2604–2615, 2009 3. Bernhagen J, Krohn R, Lue H, Gregory JL, Zernecke A, Koenen RR, Dewor 19. Smeets B, Stucker F, Wetzels J, Brocheriou I, Ronco P, Gröne HJ, M, Georgiev I, Schober A, Leng L, Kooistra T, Fingerle-Rowson G, Ghezzi P, D’Agati V, Fogo AB, van Kuppevelt TH, Fischer HP, Boor P, Floege J, Kleemann R, McColl SR, Bucala R, Hickey MJ, Weber C: MIF is a non- Ostendorf T, Moeller MJ: Detection of activated parietal epithelial cells cognate ligand of CXC chemokine receptors in inflammatory and athero- on the glomerular tuft distinguishes early focal segmental glomerulo- genic cell recruitment. Nat Med 13: 587–596, 2007 sclerosis from minimal change disease. Am J Pathol 184: 3239–3248, 4. Kleemann R, Hausser A, Geiger G, Mischke R, Burger-Kentischer A, 2014 Flieger O, Johannes FJ, Roger T, Calandra T, Kapurniotu A, Grell M, 20. Roberts IS, Cook HT, Troyanov S, Alpers CE, Amore A, Barratt J, Finkelmeier D, Brunner H, Bernhagen J: Intracellular action of the cy- Berthoux F, Bonsib S, Bruijn JA, Cattran DC, Coppo R, D’Agati V, tokineMIFtomodulateAP-1activityandthecellcyclethroughJab1. D’Amico G, Emancipator S, Emma F, Feehally J, Ferrario F, Fervenza Nature 408: 211–216, 2000 FC, Florquin S, Fogo A, Geddes CC, Groene HJ, Haas M, Herzenberg 5. Mitchell RA, Bucala R: Tumor growth-promoting properties of macro- AM, Hill PA, Hogg RJ, Hsu SI, Jennette JC, Joh K, Julian BA, Kawamura phage migration inhibitory factor (MIF). Semin Cancer Biol 10: 359– T, Lai FM, Li LS, Li PK, Liu ZH, Mackinnon B, Mezzano S, Schena FP, 366, 2000 Tomino Y, Walker PD, Wang H, Weening JJ, Yoshikawa N, Zhang H; 6. Morand EF, Bucala R, Leech M: Macrophage migration inhibitory fac- Working Group of the International IgA Nephropathy Network and the tor: an emerging therapeutic target in rheumatoid arthritis. Arthritis Renal Pathology Society: The Oxford classification of IgA nephropathy: Rheum 48: 291–299, 2003 pathology definitions, correlations, and reproducibility. Kidney Int 76: 7. Leng L, Metz CN, Fang Y, Xu J, Donnelly S, Baugh J, Delohery T, Chen 546–556, 2009 Y, Mitchell RA, Bucala R: MIF signal transduction initiated by binding to 21. Jennette JC, Olson JL, Silva FG, D’Agati V: Heptinstall’s Pathology of CD74. JExpMed197: 1467–1476, 2003 the Kidney, Philadelphia, PA, Lippincott Williams & Wilkins, 2014 8. Sanchez-Nino MD, Sanz AB, Ruiz-Andres O, Poveda J, Izquierdo MC, 22. Smeets B, Angelotti ML, Rizzo P, Dijkman H, Lazzeri E, Mooren F, Selgas R, Egido J, Ortiz A: MIF, CD74 and other partners in kidney Ballerini L, Parente E, Sagrinati C, Mazzinghi B, Ronconi E, Becherucci disease: tales of a promiscuous couple. Cytokine Growth Factor Rev 24: F, Benigni A, Steenbergen E, Lasagni L, Remuzzi G, Wetzels J, 23–40, 2013 Romagnani P: Renal progenitor cells contribute to hyperplastic lesions 9. Starlets D, Gore Y, Binsky I, Haran M, Harpaz N, Shvidel L, Becker- of podocytopathies and crescentic glomerulonephritis. JAmSoc Herman S, Berrebi A, Shachar I: Cell-surface CD74 initiates a signaling Nephrol 20: 2593–2603, 2009 cascade leading to cell proliferation and survival. Blood 107: 4807– 23. Fatima H, Moeller MJ, Smeets B, Yang HC, D’Agati VD, Alpers CE, 4816, 2006 Fogo AB: Parietal epithelial cell activation marker in early recurrence of 10. Lan HY, Mu W, Yang N, Meinhardt A, Nikolic-Paterson DJ, Ng YY, FSGS in the transplant. Clin J Am Soc Nephrol 7: 1852–1858, 2012 Bacher M, Atkins RC, Bucala R: De Novo renal expression of macro- 24. Shankland SJ, Smeets B, Pippin JW, Moeller MJ: The emergence of the phage migration inhibitory factor during the development of rat cres- glomerular parietal epithelial cell. Nat Rev Nephrol 10: 158–173, 2014 centic glomerulonephritis. Am J Pathol 149: 1119–1127, 1996 25. Bariéty J, Bruneval P, Meyrier A, Mandet C, Hill G, Jacquot C: Podocyte 11. Leung JC, Chan LY, Tsang AW, Liu EW, Lam MF, Tang SC, Lai KN: Anti- involvement in human immune crescentic glomerulonephritis. Kidney macrophage migration inhibitory factor reduces transforming growth Int 68: 1109–1119, 2005

1662 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1650–1664, 2016 www.jasn.org BASIC RESEARCH

26. Moeller MJ, Soofi A, Hartmann I, Le Hir M, Wiggins R, Kriz W, Holzman (EGFR) in the MCF10AT model of breast cancer progression. J Proteome LB: Podocytes populate cellular crescents in a murine model of in- Res 8: 4062–4076, 2009 flammatory glomerulonephritis. J Am Soc Nephrol 15: 61–67, 2004 45. Martín-Ventura JL, Madrigal-Matute J, Muñoz-Garcia B, Blanco-Colio 27. Lan HY: Role of macrophage migration inhibitory factor in kidney dis- LM, Van Oostrom M, Zalba G, Fortuño A, Gomez-Guerrero C, Ortega L, eases. Nephron, Exp Nephrol 109: 79–83, 2008 Ortiz A, Diez J, Egido J: Increased CD74 expression in human athero- 28. Tesch GH, Nikolic-Paterson DJ, Metz CN, Mu W, Bacher M, Bucala R, sclerotic plaques: contribution to inflammatory responses in vascular Atkins RC, Lan HY: Rat mesangial cells express macrophage migration cells. Cardiovasc Res 83: 586–594, 2009 inhibitory factor in vitro and in vivo. J Am Soc Nephrol 9: 417–424, 1998 46. Shachar I, Flavell RA: Requirement for invariant chain in B cell matura- 29. Nikolic-Paterson DJ, Jun Z, Tesch GH, Lan HY, Foti R, Atkins RC: De tion and function. Science 274: 106–108, 1996 novo CD44 expression by proliferating mesangial cells in rat anti-Thy-1 47. Bernhagen J, Calandra T, Bucala R: Regulation of the immune response nephritis. JAmSocNephrol7: 1006–1014, 1996 by macrophage migration inhibitory factor: biological and structural 30. Jun Z, Hill PA, Lan HY, Foti R, Mu W, Atkins RC, Nikolic-Paterson DJ: features. JMolMed(Berl)76: 151–161, 1998 CD44 and hyaluronan expression in the development of experimental 48. Calandra T, Roger T: Macrophage migration inhibitory factor: a regu- crescentic glomerulonephritis. Clin Exp Immunol 108: 69–77, 1997 lator of innate immunity. Nat Rev Immunol 3: 791–800, 2003 31. Kabgani N, Grigoleit T, Schulte K, Sechi A, Sauer-Lehnen S, Tag C, Boor 49. Calandra T, Spiegel LA, Metz CN, Bucala R: Macrophage migration inhibitory P, Kuppe C, Warsow G, Schordan S, Mostertz J, Chilukoti RK, Homuth factor is a critical mediator of the activation of immune cells by exotoxins of G, Endlich N, Tacke F, Weiskirchen R, Fuellen G, Endlich K, Floege J, Gram-positive bacteria. Proc Natl Acad Sci U S A 95: 11383–11388, 1998 Smeets B, Moeller MJ: Primary cultures of glomerular parietal epithelial 50. Simons D, Grieb G, Hristov M, Pallua N, Weber C, Bernhagen J, cells or podocytes with proven origin. PLoS One 7: e34907, 2012 Steffens G: Hypoxia-induced endothelial secretion of macrophage 32. Hanssen L, Alidousty C, Djudjaj S, Frye BC, Rauen T, Boor P, Mertens migration inhibitory factor and role in endothelial progenitor cell re- PR, van Roeyen CR, Tacke F, Heymann F, Tittel AP, Koch A, Floege J, cruitment. J Cell Mol Med 15: 668–678, 2011 Ostendorf T, Raffetseder U: YB-1 is an early and central mediator of 51. Strüßmann T, Tillmann S, Wirtz T, Bucala R, von Hundelshausen P, bacterial and sterile inflammation in vivo. JImmunol191: 2604–2613, Bernhagen J: Platelets are a previously unrecognised source of MIF. 2013 Thromb Haemost 110: 1004–1013, 2013 33. Cortes-Hernandez J, Fossati-Jimack L, Carugati A, Potter PK, Walport 52. Rice EK, Tesch GH, Cao Z, Cooper ME, Metz CN, Bucala R, Atkins RC, MJ, Cook HT, Botto M: Murine glomerular mesangial cell uptake Nikolic-Paterson DJ: Induction of MIF synthesis and secretion by tu- of apoptotic cells is inefficient and involves serum-mediated but bular epithelial cells: a novel action of angiotensin II. Kidney Int 63: complement-independent mechanisms. Clin Exp Immunol 130: 459– 1265–1275, 2003 466, 2002 53. Flieger O, Engling A, Bucala R, Lue H, Nickel W, Bernhagen J: Regu- 34. Heinrichs D, Knauel M, Offermanns C, Berres ML, Nellen A, Leng L, lated secretion of macrophage migration inhibitory factor is mediated Schmitz P, Bucala R, Trautwein C, Weber C, Bernhagen J, Wasmuth HE: by a non-classical pathway involving an ABC transporter. FEBS Lett Macrophage migration inhibitory factor (MIF) exerts antifibrotic effects 551: 78 –86, 2003 in experimental liver fibrosis via CD74. Proc Natl Acad Sci U S A 108: 54. Leung JC, Tang SC, Chan LY, Tsang AW, Lan HY, Lai KN: Polymeric IgA 17444–17449, 2011 increases the synthesis of macrophage migration inhibitory factor by 35. Gore Y, Starlets D, Maharshak N, Becker-Herman S, Kaneyuki U, Leng L, human mesangial cells in IgA nephropathy. Nephrol Dial Transplant Bucala R, Shachar I: Macrophage migration inhibitory factor induces B 18: 36–45, 2003 cell survival by activation of a CD74-CD44 receptor complex. JBiol 55. Smeets B, Te Loeke NA, Dijkman HB, Steenbergen ML, Lensen JF, Chem 283: 2784–2792, 2008 Begieneman MP, van Kuppevelt TH, Wetzels JF, Steenbergen EJ: The 36. Moeller MJ, Smeets B: Novel target in the treatment of RPGN: the parietal epithelial cell: a key player in the pathogenesis of focal seg- activated parietal cell. Nephrol Dial Transplant 28: 489–492, 2013 mental glomerulosclerosis in Thy-1.1 transgenic mice. JAmSoc 37. Smeets B, Kuppe C, Sicking EM, Fuss A, Jirak P, van Kuppevelt TH, Nephrol 15: 928–939, 2004 Endlich K, Wetzels JF, Gröne HJ, Floege J, Moeller MJ: Parietal epi- 56. Shi X, Leng L, Wang T, Wang W, Du X, Li J, McDonald C, Chen Z, thelial cells participate in the formation of sclerotic lesions in focal Murphy JW, Lolis E, Noble P, Knudson W, Bucala R: CD44 is the sig- segmental glomerulosclerosis. J Am Soc Nephrol 22: 1262–1274, 2011 naling component of the macrophage migration inhibitory factor-CD74 38. Boor P, Ostendorf T, Floege J: PDGF and the progression of renal receptor complex. Immunity 25: 595–606, 2006 disease. Nephrol Dial Transplant 29[Suppl 1]: i45–i54, 2014 57. Sasaki S, Nishihira J, Ishibashi T, Yamasaki Y, Obikane K, Echigoya M, 39. Floege J, Burns MW, Alpers CE, Yoshimura A, Pritzl P, Gordon K, Seifert Sado Y, Ninomiya Y, Kobayashi K: Transgene of MIF induces podocyte RA, Bowen-Pope DF, Couser WG, Johnson RJ: Glomerular cell pro- injury and progressive mesangial sclerosis in the mouse kidney. Kidney liferation and PDGF expression precede glomerulosclerosis in the Int 65: 469–481, 2004 remnant kidney model. Kidney Int 41: 297–309, 1992 58. Cohen CD, Lindenmeyer MT, Eichinger F, Hahn A, Seifert M, Moll AG, 40. Floege J, Eitner F, Van Roeyen C, Ostendorf T: PDGF-D and renal Schmid H, Kiss E, Gröne E, Gröne HJ, Kretzler M, Werner T, Nelson PJ: disease: yet another one of those growth factors? JAmSocNephrol14: Improved elucidation of biological processes linked to diabetic ne- 2690–2691, 2003 phropathy by single probe-based microarray data analysis. PLoS One 3: 41. Floege J, van Roeyen C, Boor P, Ostendorf T: The role of PDGF-D in e2937, 2008 mesangioproliferative glomerulonephritis. Contrib Nephrol 157: 153– 59. Cohen CD, Kretzler M: Gene expression analysis in microdissected renal 158, 2007 tissue. Current challenges and strategies. Nephron 92: 522–528, 2002 42. Schrans-Stassen BH, Lue H, Sonnemans DG, Bernhagen J, Post MJ: 60. Harper JM, Wilkinson JE, Miller RA: Macrophage migration inhibitory Stimulation of vascular smooth muscle cell migration by macrophage factor-knockout mice are long lived and respond to caloric restriction. migration inhibitory factor. Antioxid Redox Signal 7: 1211–1216, 2005 FASEB J 24: 2436–2442, 2010 43. Ohta S, Misawa A, Fukaya R, Inoue S, Kanemura Y, Okano H, Kawakami 61. Bozza M, Satoskar AR, Lin G, Lu B, Humbles AA, Gerard C, David JR: Y, Toda M: Macrophage migration inhibitory factor (MIF) promotes cell Targeted disruption of migration inhibitory factor gene reveals its survival and proliferation of neural stem/progenitor cells. JCellSci125: critical role in sepsis. JExpMed189: 341–346, 1999 3210–3220, 2012 62. Satoskar AR, Bozza M, Rodriguez Sosa M, Lin G, David JR: Migration- 44. Lim S, Choong LY, Kuan CP, Yunhao C, Lim YP: Regulation of macro- inhibitory factor gene-deficient mice are susceptible to cutaneous phage inhibitory factor (MIF) by epidermal growth factor receptor Leishmania major infection. Infect Immun 69: 906–911, 2001

J Am Soc Nephrol 27: 1650–1664, 2016 MIF/CD74/CD44 in Proliferative GN 1663 BASIC RESEARCH www.jasn.org

63. Liehn EA, Kanzler I, Konschalla S, Kroh A, Simsekyilmaz S, Sönmez TT, 67. Djudjaj S, Chatziantoniou C, Raffetseder U, Guerrot D, Dussaule JC, Bucala R, Bernhagen J, Weber C: Compartmentalized protective and Boor P, Kerroch M, Hanssen L, Brandt S, Dittrich A, Ostendorf T, Floege detrimental effects of endogenous macrophage migration-inhibitory J, Zhu C, Lindenmeyer M, Cohen CD, Mertens PR: Notch-3 receptor factor mediated by CXCR2 in a mouse model of myocardial ischemia/ activation drives inflammation and fibrosis following tubulointerstitial reperfusion. Arterioscler Thromb Vasc Biol 33: 2180–2186, 2013 kidney injury. JPathol228: 286–299, 2012 64. Wang X, Chen T, Leng L, Fan J, Cao K, Duan Z, Zhang X, Shao C, Wu M, 68. Eitner F, Bücher E, van Roeyen C, Kunter U, Rong S, Seikrit C, Villa L, Tadmori I, Li T, Liang L, Sun D, Zheng S, Meinhardt A, Young W, Bucala BoorP,FredrikssonL,BäckströmG,ErikssonU,OstmanA,FloegeJ, R, Ren Y: MIF produced by bone marrow-derived macrophages con- Ostendorf T: PDGF-C is a proinflammatory cytokine that mediates renal tributes to teratoma progression after embryonic stem cell trans- interstitial fibrosis. JAmSocNephrol19: 281–289, 2008 plantation. Cancer Res 72: 2867–2878, 2012 69. Ostendorf T, Rong S, Boor P, Wiedemann S, Kunter U, Haubold U, van 65. Zernecke A, Schober A, Bot I, von Hundelshausen P, Liehn EA, Möpps Roeyen CR, Eitner F, Kawachi H, Starling G, Alvarez E, Smithson G, Floege J: B, Mericskay M, Gierschik P, Biessen EA, Weber C: SDF-1alpha/CXCR4 Antagonism of PDGF-D by human antibody CR002 prevents renal scarring in axis is instrumental in neointimal hyperplasia and recruitment of experimental glomerulonephritis. JAmSocNephrol17: 1054–1062, 2006 smooth muscle progenitor cells. Circ Res 96: 784–791, 2005 66. Boor P, Konieczny A, Villa L, Kunter U, van Roeyen CR, LaRochelle WJ, Smithson G, Arrol S, Ostendorf T, Floege J: PDGF-D inhibition by CR002 ameliorates tubulointerstitial fibrosis following experimental This article contains supplemental material online at http://jasn.asnjournals. glomerulonephritis. Nephrol Dial Transplant 22: 1323–1331, 2007 org/lookup/suppl/doi:10.1681/ASN.2015020149/-/DCSupplemental.

1664 Journal of the American Society of Nephrology J Am Soc Nephrol 27: 1650–1664, 2016