Expression, Purification and Characterization of Human DNA Polymerase Alpha

Thesis by

Amani Al-Amodi

In Partial Fulfillment of the Requirements

For the Degree of

Master of Science

King Abdullah University of Science and Technology Thuwal, Kingdom of Saudi Arabia

April, 2021

EXAMINATION COMMITTEE PAGE

The thesis of Amani Al-Amodi is approved by the examination committee.

Committee Chairperson: Samir Hamdan. Committee Members: Magdy Mahfouz, Stefan Arold.

ABSTRACT Expression, Purification and Characterization of Human DNA Polymerase Alpha Amani Al-Amodi

DNA replication is a fundamental process in all living organisms. It is a semi- discontinuous process in which the leading strand is synthesized continuously and the lagging strand is synthesized discontinuously as short Okazaki fragments (OF). The initiation of DNA synthesis requires DNA polymerase α (Pol α/primase) in complex with the primase to form a complex of four subunits. Pol α/primase is the only enzyme that can perform de novo DNA synthesis on single-stranded DNA. The catalytic subunit of the primase (PRIM1) synthesizes RNA primers that are approximately nine nucleotides long.

The synthesized RNA primers are then passed intramolecularly to the polymerase active site (POLA1), which is thought to be mediated by the C-terminal domain of the primase large subunit (PRIM2-C) to synthesize dNTPs of approximately 20 nucleotides. The aim of this project was to optimize the expression and purification of Pol α/primase. The insect codon optimized POLA1 was C-terminally Strep tagged and transposed into the baculovirus genome. The other subunits of Pol α/primase, POLA2, PRIM1 and PRIM2 were cloned and expressed in E. coli cells. The cell lysates from Sf9 insect cells and E. coli cells were then mixed and purified by immunoaffinity chromatography and size-exclusion chromatography. This helped us achieve a pure Pol α/primase containing all the four subunits with a good total yield. The identity of all the protein bands were verified by mass spectroscopy. Furthermore, the protein demonstrated primer extension activity on multiple primer/template substrates. We also characterized the effect of the human replication protein A (RPA) on the DNA polymerization activity of Pol α/primase. 5

ACKNOWLEDGEMENTS

First and above all, I praise ALLAH, the almighty, for providing me this opportunity and granting me the capability to proceed successfully. I would like to thank Professor Hamdan for allowing me to undertake this research in his lab, providing me with helpful insight where needed and encouraging me at the various stages of my project. I would also like to thank Dr. Muhammed Tehseen and Dr. Masateru Takahashi for their patience in teaching me the necessary skills to complete this project. This project would not have been a success without the valuable information, time and help they provided me with. I would also like to extend my thanks to Yujing for introducing me to the flow stretching assay, teaching me all of the necessary detailed steps and for his insightful discussions. I would like to thank the remaining members of Professor Hamdan’s lab for the assistance they have provided me with throughout this project and for creating such a wonderful working environment.

Finally, I would like to extend a huge thank you to my family and friends for their continued support and prayers each and everyday.

TABLE OF CONTENTS

EXAMINATION COMMITTEE PAGE ………………………………………2 COPYRIGHT PAGE…………………………………………………………….3 ABSTRACT………………………………………………………………………4 ACKNOWLEDGEMENTS……………………………………………………..5 TABLE OF CONTENTS………………………………………………………. 6 LIST OF ABBREVIATIONS…………………………………………………...8 LIST OF ILLUSTRATIONS…………………………………………………..10 LIST OF TABLES…………………………………………...…………………11

Chapter 1: Introduction …………………………………………………….….11 1.1 General introduction ………………………………………….…,…..11 1.2 SV40 System ………………………………………………………...12 1.3 Organization of the Human Pol α/primase…………………………..14 1.4 Aim of the project ………………………………………………..…17

Chapter 2. Materials and Methods…………………………………………….18 2.1 Molecular Biology 2.1.1 Polymerase Chain Reaction ……………………………….18 2.1.2 DNA Agarose Gel Electrophoresis ………………………..18 2.1.3 DNA Gel Extraction ………………………………………18 2.1.4 The construction of plasmids …………………………….. 19 2.1.5 E.coli Transformation ……………………………………..20 2.1.6 Quick Plasmid DNA Mini-Preparation…………………….20 2.2 Baculovirus System 2.2.1 Transformation into DH10YFP E.coli cells ……………….21 2.2.2 Extraction of Bacmid genomic DNA………………………22 2.2.3 Baculovirus amplification and Insect cell expression ……..22 2.3 Proteins Expression and Purification 2.3.1 Human Pol α/primase ……………………………………..23 2.3.2 Human Replication protein A (RPA)………………………25 2.3.3 SDS-PAGE analysis ……………………………………....27 2.4 Mass Spectrometry 2.4.1 In-gel Tryptic Digestion …………………………………...27 2.4.2 Extraction and Desalting Purification ……………………..28 2.5 Biochemical Assays 2.5.1 DNA Substrates …………………………………………...29 2.5.2 Primer Extension Assays…………………………..………30 2.5.3 Polymerase assay on primed-M13 ssDNA………………...31 2.5.4 Activity of RPA - Electrophoretic mobility shift assay……32

Chapter 3. Results………………………………………………………………33 3.1 Molecular Cloning and plasmid construction 3.1.1 Insertion of Strep-tag coding sequence into POLA1………33 3.1.2 Generation of recombinant baculovirus……………………34 7

3.1.3 Cloning POLA2 into pRSF1b E. coli ……………………..34 3.2 Expression and purification 3.2.1 Expression and purification of double …………………….36 His-and Strep-tagged Pol α/primase. 3.2.4 Expression and purification of His-tagged RPA …………..39 3.3 Biochemical Assays 3.3.1 Primer extension assay of DNA Pol α/primase……………41 3.3.2 Electrophoretic mobility shift assay……………………….43 3.3.3 Effect of RPA on Pol α/primase primer extension activity..44

Chapter 4. Discussion ……………………………………………….………....46 4.1 Challenges associated with Pol α/primase expression and purification……………………………....46 4.2 Future work…………………………………………………..50

Supplementary Data……………………………………………………………52

References……………………………………………………………………….54

LIST OF ABBREVIATIONS

BME β-Mercaptoethanol Cdc6 Cell division cycle 6 Cdt1 Chromatin licensing and DNA replication factor CMG complex Cdc45-Mcm2-7, GINS CTD C-terminal domain DNA Deoxyribonucleic Acid dsDNA Double-Stranded DNA DTT Dithiothreitol dNTP Deoxynucleoside triphosphate FEN1 Flap Endonucalease1 IPTG Isopropyl β-d-1-thiogalactopyranoside LB Lysogeny Broth Ltag Large T antigen NTD N-terminal domain OF Okazaki fragments ORC Origin recognition complex OB Oligonucleotide/oligosaccharide binding domain Kb Kilobases PCNA Proliferating cell nuclear antigen PDE Phosphodiesterase Pol α/primase DNA Polymerase alpha Pol δ DNA Polymerase delta Pol ε DNA Polymerase epsilon RPA Replication protein A RF-C Replication factor C PMSF Phenylmethylsulfonyl fluoride ssDNA Single-stranded deoxyribonucleic acid SV40 Siman Virus 40 SOC Super optimal broth SDS Sodium dodecyl sulfate

LIST OF ILLUSTRATIONS

Figure 1. Human Pol α/primase domain organization………………………..….16 Figure 2. Human Pol α/primase hetero-tetramer………..……………………….17 Figure 3. Insertion of Strep into POLA1………………………………………...33 Figure 4. Transfection of Sf9 cells……………………………………………….34 Figure 5. Cloning POLA2 into pRSF1b. ………………………………………..35 Figure 6.1. Pol α/primase purification …………………………………………..37 Figure 6.2 Pol α/primase size exclusion chromatography. ……………………...38 Figure 7. RPA purification ……………………………………………...………40 Figure 8. Primer extension assays of DNA Pol α/primase………………………42 Figure 9. Electrophoretic mobility assay of RPA.……………………………….43 Figure 10. Effect of RPA on Pol α/primase primer extension activity.………….44 Supplementary Figure 1. Small scale expression………………………………..52 Supplementary Figure 2. Modified Pol α/primase size exclusion chromatography………………………………………………………………….53

LIST OF TABLES

Table 1. Oligonucleotides used in this study…………………………………….30 Table 2. Proteins identification using Mass spectrometer……………………….39

Chapter 1. Introduction

1.1 General Introduction:

DNA replication in eukaryotes is accomplished by highly conserved multi-subunit

DNA polymerases: Polymerase alpha (Pol α/primase), Polymerase delta (Pol δ) and

Polymerase epsilon (Pol ε) (1,2,3,4). These polymerases belong to the B-family of DNA polymerases and their catalytic subunits exhibit a right-hand fold, a classical palm that has catalytic residues for dNTP addition and finger and thumb subdomains characteristic of this family (5-9). During DNA synthesis, two new strands are synthesized differently according to their template strand directionality. The leading strand is synthesized in a continuous manner as it supports the 5’ – 3’ DNA polymerization activity, while the lagging strand is synthesized discontinuously by elongation of Okazaki fragments (OF)

(10-13). Pol α/primase initiates DNA replication from the chromosomal origins at the start of the leading strand and each of OF. Elongation of the leading strand and OFs then occurs by the processive replicative polymerases, Pol ε and Pol δ, respectively. However, this could be more promiscuous than initially thought as Pol δ may also replicate the leading strand with Pol ε (14).

In humans, Pol α/primase is a heterodimer composed of a catalytic subunit

(p180/POLA1) and a regulatory subunit (p70/POLA2) (15,16). The primase contains a small catalytic subunit (p49/PRIM1) and a regulatory subunit (p58/PRIM2) (17). Each subunit is essential for viability in yeast (18-20). The primase subunit synthesizes a 7-12 mer RNA primer which is intramolecularly handed over to the catalytic site of Pol

α/primase for a subsequent extension by dNTPs (about 20 nt) (21-23). Pol α/primase synthesizes up to 20% of the lagging strand; this is made up of 165 bp of OFs and 30-35 12 nt of RNA:DNA primers (24,25). However, during the maturation of OFs, the RNA section and part of the DNA primer are removed by the flap endonucalease1 (FEN1) and

Pol δ. The PCNA clamp coordinates this to form a continuous DNA strand (26). In total,

1.5% of the mature genome is synthesized by Pol α/primase (27). The RNA:DNA primer regions are removed because they are considered mutation hotspots (27). This is due to the low fidelity of Pol α/primase, which lacks the 3’ 5’ exonuclease proofreading domain.

Therefore, it is more error-prone than the other B-family replicative polymerases (Pol δ and Pol ε) (28).

Most of our initial understanding of the eukaryotic DNA replication process has arisen from studying the Simian Virus 40 (SV40) replication system in vitro (29-31). SV40 requires a single viral protein, T-antigen, and hijack the rest of the replication proteins from the host. Purification of these proteins allows the reconstitution of the system in vitro (32-

37), which has given great insights into the eukaryotic DNA replication mechanism (38-

40). The difference between the SV40 replication system and chromosomal replicative machinery will be discussed later.

1.2 The SV40 System:

Simian Virus 40 (SV40) belongs to the polyomavirus family and has been extensively studied for being an excellent model of eukaryotic DNA replication and its regulation (41-44). The genome of SV40 is arranged into three regions: a non-coding control region containing the origin of replication, the early genes that encode the small and large T-antigens (L-tag), and the late genes code for the capsid and the agno protein

(45-47). The leading strand initiation occurs at the viral origin of replication and can be 13 reconstituted in vitro using the multifunctional viral helicase (large tumor antigen, or T- antigen), the cellular topoisomerase I, Pol α/primase and the eukaryotic ssDNA-binding protein, RPA. The main difference between eukaryotic chromosomal DNA replication and

SV40 replication is that L-tag activity does not require factors that are necessary for eukaryotic cellular DNA replication, such as the CMG complex (Cdc45-Mcm2-7, GINS), the helicase loading factors Cdc6 and Cdt1 and the origin recognition complex (ORC) (48-

50). Additionally, the leading- and lagging-strand synthesis in the SV40 system is carried out by DNA polymerase δ, whereas in the eukaryotic cellular DNA replication, it is shared between Pol δ on the lagging strand and Pol ε on the leading strand (48-50). Therefore, this makes SV40 a good model to understand the complex eukaryotic replication system.

SV40 replication is initiated by recognizing and binding the L-Tag to the core origin, which contains the early palindrome, an AT rich sequence, and the L-Tag-binding site 2 (46). In an ATP-dependent manner, L-Tag forms a double hexamer. Following this, the intrinsic helicase activity of L-Tag double hexamers bidirectionally unwinds the double helix in an ATP hydrolysis-dependent manner (51-52). The double helix's further unwinding may dissociate the double hexamers from each other due to a phosphorylation event on specific residues. This causes the two L-Tags to move in a 3’ to 5’ direction on the leading strand and the separated two ssDNA to be threaded through the L-Tag’s hexameric channels (51-53). The exposed ssDNA is protected from nucleases by RPA, which is recruited with the help of L-Tag (45, 54-57). Topoisomerase I is required to relieve the stress caused by L-Tag during unwinding, enhancing the initiation of DNA replication

(58,59). L-Tag then orchestrates RPA displacement by the Pol α/primase complex, which synthesizes a short RNA primer on the origin of DNA replication by the primase subunit. 14

The polymerase active site of Pol α/primase then extends the primer with dNTPs until it reaches the unit length of about 20 nucleotides (48,60). In the subsequent step, the

RNA:DNA hybrid is recognized by DNA replication factor C (RF-C) and the proliferating cell nuclear antigen (PCNA), allowing the hand-off of the primed template from Pol

α/primase to Pol δ for the progressive synthesis of the leading strand (61-66).

In contrast to the leading strand where initiation occurs only once, the discontinuous synthesis of the lagging strand requires multiple initiations of OFs catalyzed by Pol

α/primase complexed with L-Tag on RPA saturated ssDNA (67-70). The subsequent step is similar to the leading strand synthesis, which switches from Pol α/primase to Pol δ to create a continuous strand through interaction with PCNA, which is loaded with the help of RFC onto the DNA. Upon ATP hydrolysis RFC changes its conformation leading to its dissociation from PCNA and DNA. PCNA then recruits Pol δ via its PCNA-interacting peptide (PIP) boxes forming a holoenzyme (102). Pol δ strand displaces the previous OF creating a 5’ flap structure which is recognized and cleaved by FEN1 generating a nick that is sealed by DNA Ligase 1 (48,49,71,72).

1.3 Organization of the Human Pol α/primase

Human Pol α/primase is comprised of a 166 kDa catalytic subunit (POLA1) and a

66 kDa accessory subunit (POLA2), which are connected by the POLA1 C-terminal domain (POLA1C) (15,16). Unlike the replicative polymerases (Pol δ and Pol ε), Pol

α/primase lacks the 3’ to 5’ intrinsic exonuclease proofreading domain, making it more error-prone. This is due to the evolutionary substitution of the catalytic amino acid residues in the exonuclease active site (73). It also explains why synthesis can only occur at the 15 initiation site of the leading strand and each OF, which can serve as a primer for the replicative polymerases. POLA1 is composed of three parts; the N terminus domain

(NTD), the catalytic core and the C-terminal domain (CTD) (Figure 1). The catalytic subunit of Pol α/primase has an evolutionary conserved C-terminal domain found in both yeast and humans (POLA1C). POLA1C is connected to the catalytic core by a flexible 15- residue linker, which contains two metal-binding domains occupied by zinc modules that are coordinated by four cysteines (Figure 2) (74,75). Zn modules are involved in interactions with the POLA2 subunit (75,76). The NTD is thought to be poorly folded and has no conserved motifs necessary in DNA polymerization. However, the structural information is limited for this region. Structure-function studies have shown that the CTD of POLA1 anchors both the POLA2 subunit and the PRIM2 of the primase heterodimer in the complex (70,75). All three eukaryotic B-family DNA polymerases share the accessory subunit (POLA2, also known as p68 or B subunit). The first crystal structure that provided insights into the 3D organization of the B subunit is the Pol δ in complex with the p66 N- terminal domain (77). The regulatory subunit, POLA2 is composed of a globular NTD, an oligonucleotide/oligosaccharide binding domain (OB) and a catalytically inactive phosphodiesterase (PDE) (Figure 1). A common feature of B-family DNA Polymerases is that the OB domain is embedded into the PDE domain (78). The globular NTD is connected with the PDE domain by an 80-residue-long flexible linker and can interact with other

DNA replication proteins and recruitment of Pol α/primase to the replication fork (74,79).

The Human primase enzyme contains a 50 kDa small catalytic subunit (PRIM1) and a 59 kDa regulatory subunit (PRIM2) (17) (Figure 1). Both subunits are crucial for the primase activity and they can be expressed and purified independently of the polymerase 16 heterodimer. In vitro biochemical studies have shown that the primase enzyme has low processivity and can extend up to 10 nucleotides (nt) by frequent cycles (80-82). PRIM2 has two subdomains: the all helical C-terminal domain (PRIM2C) and the mixed α/β-fold

N-terminal domain (PRIM2N), that are linked via an 18-residue linker that is relatively mobile (Figure 2) (83). Deletion of the linker has been shown to affect the initiation and elongation steps in primer synthesis (83). The two subdomains of PRIM2 also have a small interaction interface which is formed mainly by hydrophilic contacts between helices α1,

α2 of PRIM2N and α17, α20 of PRIM2C (83). Similar to yeast primase (80), PRIM2C has an iron-sulfur cluster (4Fe-4S) which is coordinated by four buried cysteines that is important for PRIM2C folding (Figure 2) (70, 84). Biochemical data indicates that

PRIM2C contributes to primase activity, with most of the structural elements contributing to substrate binding being located on PRIM2C (85). The N-terminal part of the primase acts as a platform for the interactions with PRIM1 and Pol α/primase (86) and has some role in the orientation of PRIM2C relative to PRIM1.

Figure 1. Human Pol α/primase domain organization. The Grey lines indicate inter- subunit interaction and the orange lines indicate cysteine residues coordinating the 4Fe-4S cluster or Zn. This Figure is adapted from (87). 17

Figure 2. Human Pol α/primase hetero-tetramer. A. Schematic representation of the crystal structure of the human Pol α/primase domains. The positions of the linkers, POLA2C/p58C and POLA1/p180 core vary depending on the primer synthesis step. It consists of an inactive exonuclease domain (Exo*), a phosphodiesterase (PDE) domain, and an oligonucleotide/oligosaccharide binding domain B (OB).The purple spheres represent catalytic aspartates. The Figure is adapted from (88)

1.4 Project Aim

The overall aim of this project was to purify human Pol α/primase and demonstrate its activity in primer synthesis. In particular,

1. The use of different affinity-tags to generate different constructs, i.e,

tagging different subunits of Pol α/primase to improve the purity of

the protein. These constructs were then expressed in either bacteria

(BL21 DE3) or insect cells (Sf9) using the Baculovirus expression

system. The purpose is to identify which system gave better

expression. Finally, multiple purification strategies were performed

using various previously published purification schemes.

2. The use of in-vitro assays, such as primer extension using different

substrates derived from the literature, to test protein activity. 18

Chapter 2. Material and Methods

2.1 Molecular Biology

2.1.1 Polymerase Chain Reaction

All Polymerase Chain Reaction (PCR) reactions were carried out using the

KOD Hot Start DNA Polymerase System (Novagen) unless otherwise

stated. A typical PCR cycle involved an initial denaturation at 95 °C for 2

min followed by 35 cycles at 95 °C for 20 secs, 60 °C for 10 sec and then

extension at 72 °C. The extension time was dependent on the size of the

amplicon to be amplified and typically, 30 sec per Kb was used. Following

PCR, Dpn1 digestion (2 µl) was performed for each PCR reaction and

incubated overnight in a water bath at 37°C.

2.1.2 DNA Agarose Gel Electrophoresis

DNA fragments were visualized using 0.7% agarose gel electrophoresis. To

visualize the DNA under UV illumination, ethidium bromide was added to

the agarose gel mix at a final concentration of 250 ng/ml. DNA samples

were loaded after adding 6x Gel Loading Dye Purple (Qiagen) and fragment

sizes were determined using a 1Kb DNA ladder (NEB).

2.1.3 DNA Gel Extraction

Following agarose gel electrophoresis, DNA fragments were cut from the

gel and purified using a ZymocleanTM gel DNA recovery kit or Wizard® 19

SV Gel and PCR Clean-Up System (Promega) according to the

manufacturer’s instructions. The DNA was eluted from the column with 20

μl of distilled H2O. DNA concentrations were determined using a Nanodrop

(Nd-1000) spectrophotometer.

2.1.4 The construction of plasmids

Standard molecular biology techniques were used for cloning. Insect cell

optimized sequence of full-length POLA1 was cloned into pACEBac1

plasmid using Gibson assembly technology (pMT_POLA1). The Strep

sequence was inserted at the C terminus of the POLA1 by PCR using

primers (1595 & 1597), detailed in Table 1. Following DNA agarose

electrophoresis, the POLA1-Strep (7.29 kb) was gel extracted and purified.

Ligation was then performed to join the sticky ends. The ligation mixture

was transformed into TOP10 competent E. coli cells and plated onto LB

agar plates supplemented with Gentamycin (7 μg/ml) for growth overnight

at 37 ˚C. Single colonies were screened for those containing the inserted

Strep coding sequence. Following quick plasmid DNA preparation, the

samples were sequenced and aligned using Clustal Omega.

For cloning of POLA2 into pRSF1b, Gibson assembly master mix (NEB)

was used according to the manufacturer’s instructions. Gibson reactions

were incubated at 50 °C for 2 hours before transformation into competent

E. coli. 20

Human PRIM1 and PRIM2 expression vectors, pET11a, was already cloned

by a previous phD student in Hamdan’s lab, Manal Zaher. PRIM2 was

tagged on its N-terminal with double histidine and followed with the

tobacco etch virus protease recognition site (ENLYFQ). This plasmid was

co-transformed with POLA2 into BL21 (DE3) cells.

2.1.5 E.coli Transformation

10 μl of the DNA ligation reaction or 2 μl of the Gibson assembly mixture

was incubated with competent E. coli cells (strain TOP10) for 10 mins on

ice. Cells were heat-shocked at 42°C for 1 min and then transferred back

onto the ice for 2 mins. SOC growth media was added to the mixture and

incubated for 1 hour at 37 °C. The transformation mixture was then plated

on LB plates supplemented with the appropriate antibiotic at 37°C until the

transformants appeared.

2.1.6 Quick Plasmid DNA Mini-Preparation

Single E. coli colonies were used to inoculate 15 ml of LB media

supplemented with the appropriate antibiotic and the culture was incubated

overnight at 37°C. The cells were centrifuged at 5,000 rpm for 10 mins. The

supernatant was discarded and the pellet was re-suspended in 250 μl of

buffer P1 (50 mM Tris-HCl (pH 8.0); 10 mM EDTA; 100 μg/ml RNase A)

and transferred into an eppendorf tube. 250 μl of buffer P2 (200 mM NaOH,

1% SDS (w/v)) was added and the tubes were inverted several times to mix

thoroughly to lyse the cells. Following a 5 mins incubation at room 21

temperature, 300 μl of buffer P3 (3.0 M potassium acetate, pH 5.5) was

added and the contents were mixed thoroughly and centrifuged at 14,000

rpm for 10 mins. 700 μl of supernatant was transferred into a fresh

eppendorf tube and 700 μl of isopropanol was added. After a 10 min

incubation on ice, the sample was transferred into the column and

centrifuged at 14,000 rpm for 1 min. The flow-through was discarded and

the column was washed by adding 500 μl of buffer PB. Following

centrifugation for 1 min, the column was washed with 600 μl of buffer PE

and centrifuged twice at 14,000 rpm for 1 min to remove residual wash

buffer. The DNA was eluted by adding 200 μl of buffer EB (10mM Tris.

HCl, 1mM EDTA pH 8.0). The final concentration of isolated plasmid was

determined using the Nanodrop spectrophotometer.

2.2 Baculovirus System

2.2.1 Transformation into DH10EMBacY E. coli cells

The DH10EMBacY derivative of the Multibac bacmid was used because it

expresses the yellow fluorescence protein coding gene (YFP) and can be

used to monitor the viral titer. 1 μl of the purified DNA plasmid was added

in DH10EMBacY competent cells and incubated on ice for 10 min. The

cells were heat shocked at 42°C for 1 min and then transferred back on to

the ice for 2 mins. SOC growth media was added and the mixture was

incubated for 4 hours at 37 °C. The transformation mixture was plated on

LB plates supplemented with Bluo gal (100 μg/ml), IPTG (40 μg/ml),

Kanamycin (50 μg/ml), Gentamycin (7 μg/ml) and tetracycline (10 μg/ml) 22

at 37 °C for 48 hours for blue-white screening. The single white colonies

were re-streaked onto plates supplemented with the same antibiotics to

confirm the phenotype.

2.2.2 Extraction of Bacmid genomic DNA

Single colonies were grown overnight in 10 ml LB at 37 °C in appropriate

antibiotics. Cells from an overnight culture were pelleted by centrifugation

and re-suspended in 250 μl of buffer P1 and transferred into an eppendorf

tube. 250 μl of buffer P2 was added and the tubes were inverted several

times to mix thoroughly. Following a 5 mins incubation at room

temperature, 300 μl of P3 was added, the contents were mixed thoroughly

and then incubated on ice for 5 mins. Following centrifugation at 14,000

rpm, 4 °C, 10 mins, 0.6 ml of the supernatant was transferred to 0.6 ml

isopropanol and incubated on ice for 40 mins. The DNA was pelleted by

centrifugation for 10 mins and then washed in 0.6 ml of 75% ethanol twice.

The genomic DNA was then dried and re-suspended in 200 μl Elution

buffer.

2.2.3 Baculovirus amplification and Insect cell expression

1x106 Sf9 insect cells were transfected with 3 μg of bacmid gDNA using

the FuGENE® HD reagent (Promega) transfection protocol (Promega

Corporation). The resulting supernatant was collected as P1 virus then

amplified to obtain P2 virus stock, which was then further amplified,

generating a P3 virus stock for large scale expression using Sf9 suspension 23

culture at a density of ~2x106 cells/mL. For expression of Pol α/primase, 3

L cultures of Sf9 cells at ~1.8-2x106 cells/mL were transfected with 1.02

mL of P3 amplified baculovirus for 48 hours, then harvested and snap-

frozen in liquid nitrogen and stored at -80 °C.

2.3.1 Proteins expression and purification

2.3.1 Human Pol α/primase

POLA1-Strep construct P3 virus was transfected in 3L cultures of

baculovirus Sf9 cells ~1.8-2x106 cells/mL for 48 hours at 27 °C and

harvested by spinning down at 5,500 rpm for 10 mins. The cell pellet was

re-suspended in 3 mL per 1 g of wet cells in lysis buffer [1% Np40, 1 mM

phenylmethane sulfonyl 68- fluoride (PMSF), 50 mM Tris-HCl (pH 8.0),

300 mM NaCl, 20 mM Imidazole, 10 mM β-mercaptoethanol (BME) and

two tablets of EDTA-free protease inhibitor cocktail (Roche)] then flash-

frozen in liquid nitrogen. The cells were thawed and sonicated at 30%

amplitude for 2 min and 15 secs (10 secs on, 15 secs off) on ice. The

sonicated lysates were spun in a Beckman Optima L90-K ultracentrifuge in

a Ti45 rotor for 1 hour, 40,000 rpm at 4 °C. The cleared lysates were

collected and filtered using a 0.45 μm filter.

POLA2, PRIM1 and PRIM2 subunits plasmids were co-transformed into E.

coli BL21(DE3) cells. Single E. coli colonies were used to inoculate 10 L

2YT culture media supplemented with ampicillin (100 μg/ml) and

kanamycin (50 μg/ml). Cells were grown at 24 °C at 180 rpm to OD600 of 24

0.6 and then induced with 0.2 mM IPTG and incubated further for 19 hrs at

16o C. The cells were harvested by centrifugation (5,500 rpm, 10 mins,

4⁰C). The resulting pellets were resuspended in 3 ml/1g of wet cells in lysis buffer [50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 20 mM Imidazole, 10 mM BME, 1% NP-40, 1 mM PMSF, and 4 tablets of EDTA-free protease inhibitor cocktail (Roche)] and finally snapped frozen in liquid nitrogen, before being stored at -80 ̊C. The cells were thawed and lysed enzymatically by adding 2 mg/ml lysozyme and mechanically by sonication. Cell debris was removed by centrifugation for 1 hr, 25,000 rpm at 4°C. The cleared lysates were collected and filtered using a 0.45 μm filter.

The cleared lysate from POLA1-Strep insect cell expression and POLA2-

PRIM1-His-TEV-PRIM2 E. coli expression were then mixed and directly loaded onto HisTrap HP 5 ml (GE Healthcare) column pre-equilibrated with buffer A [50 mM Tris-HCl (pH 8.0), 300 mM NaCl, 20 mM Imidazole, 5% glycerol v/v, 5 mM BME]. The bound proteins were washed extensively with buffer A and buffer A + 40 mM Imidazole followed by elution gradient with 10 CVs using buffer B [50 mM Tris-HCl (pH 8), 300 mM NaCl, 500 mM Imidazole, 5 mM β-Mercaptoethanol and 5% Glycerol]. The elution fractions were checked by running on 4-20 % precast polyacrylamide gel

(Bio-Rad). The fractions that contained all four subunits were pooled and loaded onto a StrepTrap XT 5 ml column (GE Healthcare) pre-equilibrated with buffer C [100 mM Tris-HCl (pH 8.0), 300 mM NaCl, 5% glycerol v/v and 5 mM BME]. The bound proteins were eluted with a linear gradient of 25

buffer D [100 mM Tris-HCl (pH 8.0), 300 mM NaCl, 5% glycerol v/v, 50

mM Biotin and 5 mM BME]. The fractions containing all four subunits of

Pol α/primase were collected and incubated with TEV protease at 4 °C

overnight to remove the His-tag. Cleavage was confirmed by running an

SDS-PAGE gel. The cleaved Pol α/primase was then concentrated to 1 ml

using 50 K amicon ultra-15 centrifugal filter units and loaded onto HiLoad

Superdex-200 pg size exclusion column pre-equilibrated with buffer E

[50 mM Tris-HCl (pH 8.0), 10% glycerol, 200 mM NaCl and 1 mM

dithiothreitol (DTT)]. Fractions containing the Pol α/primase were

collected, concentrated and flash frozen in small aliquots.

2.3.2 Human RPA

The expression vector encoding the full-length human RPA was a gift from

Professor Marc S. Wold. Briefly, the plasmid was transformed into BL21

(DE3) E. coli cells and positive transformants selected on LB agar

supplemented with ampicillin (100 μg/ml) and incubated overnight at 37

°C. Single E. coli colonies were used to inoculate 10 L 2YT media

supplemented with ampicillin (100 μg/ml) and the culture was incubated

overnight at 37 °C without shaking. Shaking was started the next morning

at 180 rpm to OD600 of 0.7. The culture was then induced with 0.25 mM

IPTG for 4 hours at 37 °C. The cells were harvested by centrifugation (5,500

xg, 10 mins, 4 ⁰C). The resulting pellet was resuspended in 3 ml/1 g of wet

cells in lysis buffer [50 mM Tris-HCl (pH 7.5), 750 mM NaCl, 30 mM 26

Imidazole, 10 % (v/v) glycerol, 10 mM BME and 4 tablets of EDTA-free protease inhibitor cocktail] 3 ml/1 g and finally snap frozen in liquid nitrogen, and stored at -80 ̊C.

After thawing the cell pellet, the cells were lysed enzymatically by adding

2 mg/ml Lysozyme at 4 ̊C for 30 mins followed by sonication (On: 10 secs,

Off: 15 or 20 secs, 37 % amplitude, 2 mins). The lysate was cleared by centrifugation at 20,000 rpm, 4 ⁰C for 30 mins. The cleared lysate containing RPA was directly loaded onto HisTrap HP 5 ml (GE Healthcare) column pre-equilibrated with buffer A [50 mM Tris-HCl (pH 7.5), 750 mM

NaCl, 30 mM Imidazole, 10 % (v/v) glycerol and 10 mM BME]. The bound proteins were eluted with a linear gradient of buffer B [50 mM Tris-HCl

(pH 7.5), 150 mM NaCl, 250 mM Imidazole, 10 % (v/v) glycerol and 10 mM BME]. The elution fractions were checked by running on 4-20 % precase polyacrylamide gel (Bio-Rad). The fractions that contained all the three RPA subunits were pooled and loaded onto a HiTrap Blue 5ml column

(GE healthcare) pre-equilibrated with buffer C [50 mM Tris-HCl (pH 7.5),

100 mM NaCl, 30 mM Imidazole, 10 % (v/v) glycerol and 10 mM BME].

The bound proteins were washed extensively with buffer C and buffer C +

1 M NaCl followed by elution gradient with 10 CVs using buffer D [50 mM

Tris-HCl (pH 7.5), 1.5 M NaSCN, 30 mM Imidazole, 10 % (v/v) glycerol and 10 mM BME]. The fractions containing all the three subunits of RPA were then concentrated to 1.5 ml using 50 K amicon ultra-15 centrigual 27

filert units and loaded onto a HiLoad Superdex-200 pg size exclusion

column pre-equilibrated with buffer E [50 mM Tris-HCl (pH 7.5), 10 %

glycerol, 1 mM DTT, 500 mM NaCl and 0.1 mM EDTA]. Fractions

containing all the RPA subunits were collected, concentrated and flash

frozen in small aliquots.

2.3.3 SDS-PAGE analysis

Samples were prepared with 2x SDS Sample Buffer for a final composition

of 50 mM Tris pH 6.8, 2 % SDS, 0.1 % Bromophenol blue, 10 % glycerol,

and 5 % BME. All proteins were separated on pre-cast 4-20 %

polyacrylamide Mini-Protean gels (Bio-Rad). The gels were run on the

BioRad Mini-Protean system at 200 V, for 43 mins. The protein gels were

visualized with Coomassie blue staining.

2.4 Mass Spectrometry

2.4.1 In-gel Tryptic Digestion

The excised protein bands were de-stained to remove the Coomassie blue

using 50 mM NH4HCO3/50 % Acetonitrile (ACN) (v/v) and mixed at 37 °C

for 3 mins, 1000 rpm. The supernatant was then discarded and 100% ACN

was added, mixed at 37 °C for 3 mins, 1000 rpm. These steps were repeated

until the gel piece was white in color. After discarding the supernatant and

drying the sample using a vacuum concentrator, the samples were reduced

using 10 mM DTT in 100 mM NH4HCO3. The samples were vortexed and 28

incubated at 37 °C for 30 mins. The supernatant was then discarded, and the

samples were subjected to alkylation by adding 55 mM Iodoacetamide

(IOA) in 100 mM NH4HCO3. The samples were covered with aluminum

foil and incubated at room temperature for 1 hr. The supernatant was then

discarded and the sample was washed to remove any residual reducing and

alkylating agents in 100 mM NH4HCO3 and mixed at 37 °C for 3 mins,

1000 rpm. The supernatant was then discarded and was washed in 100%

ACN. The last two washing steps were repeated twice and the samples were

completely dried in a vacuum concentrator for 10-15 mins. The gel pieces

were then covered with 12.5 ng/μl trypsin and incubated overnight at 37 °C.

2.4.2 Extraction and Desalting Purification

The digested peptides were extracted using 5 % acetic acid and 50 % ACN

by vortexing the samples and collecting the supernatant. 0.1 %

trifluoroacetic acid (TFA) in 75 % ACN was then added to the samples,

vortexed and the supernatant was collected. These two steps were repeated

twice to collect all of the digested peptides. The collected supernatant was

then dried in a centrifugal vacuum concentrator. The dried samples were re-

suspended in 0.1 % TFA. The samples were then cleaned to remove any

salts that would interfere with the peptide detection during MS analysis

using Zip-TipR pipette tips (C18). The column was equilibrated by

withdrawing 100 % ACN and discarding it. To wet the column, 0.1 % TFA

was withdrawn and discarded. The sample was then withdrawn slowly, and 29

this allowed the peptides to bind to the column. The bound peptides were

then washed in 0.1 % TFA. Finally the peptides were eluted in 0.1 % TFA

and 75 % ACN and dried completely in a vacuum concentrator. The dried

samples were then re-suspended in 0.1 % formic acid and were subjected to

the Mass spectrometer (Orbitrap Fusion Lumos, Thermo Fisher Scientific)

in the Proteomics department of the core labs. The data was analyzed using

the Mascot tool.

2.5 Biochemical Assays

2.5.1 DNA substrates

DNA oligos were synthesized and HPLC purified from IDT or The Midland

Co as shown in Table XX. The template was annealed to the 5’ Cy5 labeled

primer by mixing 1:1 molar ratio in TE-100 buffer (50 mM Tris-HCl (pH

8.0), 1 mM ethylenediaminetetraacetic acid (EDTA) and 100 mM NaCl)

and heating at 95°C for 5 min followed by slow cooling to room

temperature. The substrates were then loaded onto 10% non-denaturing

polyacrylamide gel electrophoresis (PAGE) after mixing with glycerol

(final concentration 2 %). The annealed substrate was purified from the gel

by the crush and soak method in TE-100 buffer and incubated for 30 mins

at 16 °C. Finally, the crushed gel was separated from the DNA substrate by 30

centrifugation and the supernatant containing the substrate was stored at -

20°C.

Table 1. Oligonucleotides used in this study.

2.5.2 Primer Extension Assays

The activity of Pol α/primase was tested in a 10 μl reaction that contained a

5 nM template pre-annealed with DNA primers. The reactions were

assembled on ice by adding the primer/template to the buffer containing 20

mM Tris-HCl, pH 7.5, 2 mM DTT, 0.2 mg/ml BSA, 10 mM MgCl2, 50 mM

NaCl, followed by the addition of dNTPs (100 μM) or rNTPs (100 μM) as

indicated in the Figure 8A. The mixture was incubated for 1 min at 37 °C,

and the reaction was initiated by adding 100 nM of the enzyme (or as

indicated in Figure 8B and incubated for 10 mins (or as indicated in Figure

8C) at 37 °C. T4 DNA polymerase (Promega; stock concentration 25 nM)

was used as a control. When indicated, RPA was added at various

concentrations (1, 20, 40, 60 and 80 nM) one minute after Pol α/primase

addition. The reactions were quenched by 100 mM EDTA. Proteinase K

was then added to the quenched reaction and incubated at 50 °C for 15 mins.

The reaction products were mixed with formamide loading buffer (100% 31

DMF and 50 mM EDTA) and heated at 95 °C for 4 mins. The reaction

products were resolved by 20% urea-PAGE (UreaGel System (19:1

acrylamide/bisacrylamide); for 30 mins at 12W. The reaction products were

visualized by the Typhoon 9410 imager (emission of fluorescence at 645

nm).

2.5.3 Polymerase assay on primed-M13 ssDNA

A 30 μl reaction that contained a 4 nM M13ssDNA template pre-annealed

with a fluorescently labelled DNA primer. The reactions were assembled

on ice by adding the primer/template to the buffer containing 30 mM Tris-

HCl, pH 7.5, 1 mM DTT, 0.1 mg/ml BSA, 7 mM magnesium acetate, 4 mM

ATP, 50 mM NaCl and 30 nM of Pol α/primase. The mixture was incubated

for 1 min at 37 °C, and the reaction was initiated by adding 1 mM dNTPs

and various concentrations of RPA as indicated in Figure 10B. T7 DNA

polymerase (50 nM) was used as a control. Reactions were incubated for 45

mins and were quenched by 100 mM EDTA. Proteinase K was then added

to the quenched reaction and incubated at 50 °C for 10 mins. The reaction

products were mixed with alkaline loading buffer (50 mM NaOH, 1 mM

EDTA and 7.5 % Ficoll) and heated at 75 °C for 5 mins. The reaction

products were separated on 1 % agarose gels for 10 hrs at 10V. The reaction

products were visualized by the Typhoon 9410 imager (emission of

fluorescence at 645 nm).

2.5.4 Electrophoretic mobility shift assays (EMSAs)

Reactions (in 10 μL) were carried out in buffer [30 mM Tris-HCl pH 7.5,

1 mM DTT, 0.1 mg/ml BSA, 5 mM MgCl2, 100 µM MnCl2, 250 µM dNTP,

50 mM NaCl, 15 mM KCl, 2.5% glycerol and 2.5 nM ssDNA 52-mer

(/5Cy5/GGGGGTACCCGGTCTCCCATGGTTTTTACATGTCCGGCG

CGCCTCTAGAGGG-3’)] and the indicated concentration of RPA. The

reaction was incubated for 5 mins at room temperature in the absence of

DNA and then incubated for 20 mins at 25 °C. The reactions were loaded

in a 6 % TBE gel at 100V for 25 mins. The reaction products were visualized

by a phosphorimager (Typhoon 9410, GE Healthcare).

Chapter 3. Results

3.1 Molecular cloning and plasmid construction

3.1.1 Insertion of Strep-tag coding sequence into POLA1

Due to the undetectable expression of POLA1, a Strep-tag was added to its C-

terminus domain using the primers detailed in Table 1 (1595 & 1597). A schematic

diagram of the primer design is shown in Figure 3A. The band size corresponded

to the size of the amplified POLA1-Strep (Figure 3B). The insertion of the Strep-

tag was confirmed by Sanger sequencing (hereafter called POLA1-Strep).

Figure 3. Insertion of Strep into POLA1. A) Illustration of the PCR process. B) An agarose gel showing the fragments of the PCR amplified POLA1_Strep in pACEBAC1 vector.

3.1.2 Generation of recombinant baculovirus

The successfully transformed cells displayed white colonies on X-gal and

IPTG plates. White colonies indicate that the inserted DNA disrupted the

lacZα gene which as a result, does not produce functional β-galactosidase

that can metabolize X-gal. Consequently, following the transfection of Sf9

insect cells, virus production was monitored using fluorescence microscopy

and Trypan blue staining as shown in Figure 4.

Figure 4. Transfection of Sf9 cells. Brightfield (a) and YFP fluorescence of (b) Sf9 suspension cells transfected with EMBacY (POLA1-Strep construct) , day 5 post- transfection; transfection was performed with Fugene.

3.1.3 Cloning POLA2 into pRSF1b E. coli

Initially, POLA2 was cloned into the acceptor vector, pACEBac1.

However, due to low expression, the gene was cloned into the pRSF1b E.

coli vector by the Gibson assembly strategy using the primers detailed in

Table 2 (1589 – 1592). This method relies on an exonuclease that produces

single-stranded DNA 3’ overhang by chewing back from the DNA from the

5’ end. This allows annealing of the overhang regions of the adjacent 35

ssDNA fragment. The polymerase then incorporates the nucleotides to fill

the gaps in the annealed DNA fragments and DNA ligase seals the resulting

nicks. A schematic diagram for the primer design is shown in Figure 5. The

band size corresponded to the amplified pRSF1b and POLA2 are shown in

Figure 5b. Cloning of POLA2 sequence into pRSF1b was confirmed by

Sanger sequencing (hereafter called POLA2-pRSF1b)

Figure 5. Cloning POLA2 into pRSF1b. A) Illustration of the Gibson assembly. B) A 0.8% agarose gel showing fragments after PCR amplification.

3.2 Expression and Purification

3.2.1 Expression and purification of double His-and Strep-tagged DNA Pol

/primase

To simplify the purification, two subunits of Pol  were tagged, the N-

terminal of PRIM2 was tagged with a double His- followed by cleavable

TEV and POLA1 was tagged on its C-terminal using Strep. The PRIM1,

PRIM2 and POLA2 were co-expressed in E. coli and POLA1 was expressed

in Sf9 insect cells using the baculovirus system. The expression and

purification are detailed in the Material and Methods section (2.3.1). The

protein complex was eluted at 32 % of buffer B i.e., 160 mM imidazole.

This purification step relies on an affinity between the tagged N-terminus

His- and the immobilized nickel ion. However, as shown, many

contaminants were also eluted, but most of these contaminants were

removed in the second column (Figure 6.1B). The second column relies on

a specific interaction between the Strep-tag and immobilized Strep-Tactin.

To further improve the stoichiometry of the protein complex, size exclusion

chromatography was performed (Figure 6.2). The protein complex was

eluted isocratically by using a single buffer without gradient. As shown in

Figure 6.2, four peaks are seen, each peak has a different protein species.

The only peak that had all the target proteins was the second peak. The other

peaks mainly had the overly-expressed PRIM subunits and the smallest

peak had the PRIMs and the TEV protease. The band at 160 kDa is the result

of proteolytic cleavage of POLA1. The identity of all the protein bands was 37

verified by mass spectroscopy by cutting them out from the gel (see table

2). All protein bands corresponded to the expected sizes, but the smallest

band at 41 kDa was identified as PRIM1 with 70 % coverage and Chaperone

DnaJ with 45 %.

Figure 6.1. Pol α/primase purification. A. Pol α/primase His-Trap HP affinity column. An SDS-PAGE gel with fractions from washing step (G3 – G14) and elution step (G15 – H10). B. Pol α/primase Strep-Trap XT affinity column. An SDS-PAGE gel with fractions from flow-through (A7 and A10), washing (B10) and elution (B11 – B15). The arrows indicate the target proteins: POLA1, POLA2, PRIM1, and PRIM2 which correspond to 180 kDa, 70 kDa, 49 kDa and 58 kDa, respectively. A pageRule Prestained Protein ladder 10-180 kDa was used and all samples were analyzed using 4-20 % SDS-PAGE and visualized by Coomassie blue staining

3rd peak

2nd peak st 1 peak 4th peak

B C D E

Figure 6.2 Pol α/primase size exclusion chromatography. A chromatogram of Pol α/primase (top) with fractions from the 1st , 2nd , 3rd and 4th peak. The arrows indicate the target proteins: POLA1, POLA2, PRIM1, and PRIM2 which correspond to 180 kDa, 70 kDa, 49 kDa and 58 kDa, respectively. A pageRule Prestained Protein ladder 10-180 kDa was used and all samples were analyzed using 4-20 % SDS-PAGE and visualized by Coomassie blue staining.

Sample ID Protein Identity

A Human POLA1

B Human POLA2

C Human PRIM2

D Human PRIM1

E E. coli Chaperone DnaJ

Table 2. Proteins identification using a Mass spectrometer. Letters refer to Figure 6.2.

3.2.2 Expression and purification of His-tagged RPA

The RPA was expressed and purified as previously described (2.3.2) (89) to

be used in the assays of DNA Pol . The C-terminal region of RPA1 (70

kDa) was tagged with 6x His and first purified over a His-Trap HP column

(Figure 7.1). The protein complex that contained all three subunits of RPA

(70, 32 and 14 kDa) was eluted in 30 % of buffer B i.e 75 mM imidazole.

The lower molecular weight band (12 kDa) is not shown in the gel due to

pro-long running time, which resulted in the loss of this band. These

fractions (D7  E3) were pooled and loaded onto a Hi-Trap Blue column

(Figure 7.2). The protein was eluted in 450 mM NaSCN. As shown in the

chromatogram, the first peak (Figure 7.2) is mostly contaminants removed

by washing extensively using 1 M NaCl. The stoichiometry of the RPA

complex was achieved (Figure 7.3) in the final column. The yield of the

protein complex was 1.040 mg/ml 40

Figure 7. RPA purification. (A) RPA His-Trap HP affinity column. An SDS-PAGE with fractions from flow-through (B14), washing step (D7) and elution step (D9- E3). (B) RPA Hi-Trap Blue HP column. An SDS-PAGE with fractions from flow-through (A5), washing (A13) and elution (C5 – D3). (C) RPA size exclusion chromatography SDS-PAGE. The arrows indicate the target protein subunits: RPA1 (70 kDa), RPA2 (32 kDa), and RPA3 (14 kDa). A pageRule Prestained Protein ladder 10-180 kDa was used and all samples were analyzed using 4-20 % SDS-PAGE and visualized by Coomassie blue staining. 3.3 Biochemical Assays: 41

3.3.1 Primer Extension assay of DNA Pol /primase

The polymerase activity of the purified Pol  was tested as detailed in the

Materials and Methods section (2.5.2) using substrates detailed in Table 1.

In the absence of Pol no extension was noted (Figure 8A, 8B, 8C, 8D,

lane1). However, in the presence of Pol  and dNTPs (Figure 8A, lane 4),

a partial extension was achieved while full extension was achieved with the

control T4 DNA polymerase (Figure 8A, lane 3). Pol  was capable of

differentiating between dNTPs and rNTPs (Figure 8A, lane 5), as no

extension was observed when supplied with rNTPs alone. This made us

conclude that Pol  participates in primer extension only in the presence of

dNTPs (Figure 8A, lane 6). Pol  activity was also tested using a polydT70

primed template (Figure 8D), which resulted in an increase in the product

size as the concentration of Pol  increased (Figure 8D, compare lane 9 with

3). The effects of Pol  concentration and reaction time on DNA primer

extension were examined (Figure 8B and 8C, respectively) by denaturing

gel electrophoresis. As shown in Figure 8B, the extension of DNA primers

was Pol  concentration dependent; higher concentration was capable of

producing the full-length product (100 nM to 25 nM, i.e., lanes 3-5 in Figure

8B). However, at lower concentrations, Pol  failed to reach the full-length

product, this shows the low processivity of the enzyme. Similarly, the 42

reaction time enhanced the size and amount of the reaction products (Figure

8C)

Figure 8. Primer extension assays of DNA Pol α/primase. (A) Extension of DNA primer using a short template/primer (85-mer/29-mer) (B) The extension of Pol α/primase at various concentrations (1.5 to 100 nM). (C) The extension of Pol α/primase at different time points (1-10 mins). (D) Extension of RNA primer using a polyT70 template. Reactions were carried out as described in the Materials and Methods section. Products were analyzed by 20 % Urea-PAGE (A, B and C) and 15 % sequencing Urea-PAGE gel (D) and visualized by Typhoon. 43

3.3.2 Electrophoretic mobility shift assays (EMSAs)

The ssDNA binding affinity of the human RPA was measured using EMSA

as detailed in the Material and Methods section. As shown in Figure 9,

increasing the concentration of RPA from 0.2 nM to 12 nM resulted in a

massive shift compared to the control (lane 1) and a reduction in the

intensity of the substrate. This shows that most of the substrate formed a

complex with RPA, which resulted in lower electrophoretic mobility as the

size became larger compared to the unbound substrate. This confirmed the

activity of the purified RPA.

Figure 9. Electrophoretic mobility assay of RPA. A gel showing the shift in free DNA at different concentrations of RPA (0.2 – 12 nM).

3.3.3 Effect of RPA on Pol α/primase primer extension activity

As shown in Figure 10A, increasing the concentration of RPA from 1 nM

to 100 nM resulted in an inhibitory effect of Pol α/primase primer extension

activity. Gp5 (lane 2) showed full length primer extension. Pol α/primase

showed partial extension in the absence of RPA (lane 3). However, the

extension was completely reduced at 100 nM of RPA (lane 9) and this is

likely because RPA occupies the template and competed with the binding

of Pol α/primase to the primer/template DNA. We next tested the extension

of Pol α/primase using M13 ssDNA annealed to a labeled primer. As shown

in Figure 10B, in the absence of RPA (lane 3), there is a pausing site.

However, as RPA was added (lane 4-6), the pausing disappeared showing

the stimulation of RPA on pol α/primase processivity.

Figure 10. Effect of RPA on Pol α/primase primer extension activity. (A) A Urea-PAGE gel showing the inhibitory effect of RPA (1 – 100 nM) on Pol α/primase primer extension on a short primer/template structure (19-mer/53-mer). (B) A 1% alkaline agarose gel showing the effect of RPA (20 – 400 nM) on Pol α/primase primer extension on a circular M13 ssDNA annealed to a labeled primer.

Chapter 4. Discussion

The main objective of this project was to express and purify Pol α/primase and test its activity. This was achieved by tagging two subunits, POLA1 and PRIM2, of Pol

α/primase to simplify the process of purification.

4.1 Challenges associated with Pol α/primase expression

and purification

Initially, the insect optimized sequence of POLA1 was cloned into the

acceptor vector (pACEBac1). Despite multiple attempts to purify the full

complex of Pol α/primase, a pure protein with proper stoichiometry was not

achieved. In the first trial, all of the genes encoding the Pol

α/primase subunits; POLA1, POLA2, PRIM1, and PRIM2 were expressed

together in insect cells using the MultiBac expression system. In this

construct, the N-terminal region of PRIM2 was tagged with 6x His tag.

However, purification of the complex over a His-Trap HP column followed

by a Hi-trap column was not successful. The expression of all the subunits

was very low, and there were many host protein contaminants from the

endogenous Sf9 insect cells.

Consequently, a paper published by O’Donnel et al. (90) showed successful

expression and purification of yeast Pol α/primase by tagging the POLA1

C-terminus with 3x Flags and expressing them into a yeast vector.

Alternatively, the other three subunits were cloned and expressed in E.coli

vectors. Therefore, this was the strategy that we followed in this project.

POLA1 was tagged with Strep on its C-terminus and the other three subunits 47 were cloned and expressed in E. coli with PRIM2 tagged on its N-terminus with His and TEV cleavable sequences. Initially, a small-scale expression of POLA1 in Sf9 insect cells was achieved, and POLA2, PRIM1, PRIM2 in

E. coli cells. The expression was promising, so a large-scale expression was attempted by mixing the cleared lysates from E. coli and insect cells. These protein-tag strategies and different expression systems enabled the expression of the protein and affinity chromatography columns in a simple way. As shown in Figure 6.1, after the His-tag, many impurities followed the target protein. However, tagging POLA1 with Strep-tag resulted in a significantly improved protein purity, as shown in Figure 6.1B. The specificity in the interaction between Strep-tag and Strep-Tactin allowed efficient separation of the target protein from the host cell proteins, which was easily reversed by adding biotin. This helped in achieving a high purity for all of the subunits (Figure 6.1B).

After passing the fractions through a size exclusion chromatography column, the fractions from different peaks represented different protein species. The first, third and fourth peaks had only PRIM1 and PRIM2 subunits as these subunits interact with each other through the N-terminal subdomain of PRIM2 (15,16,82). They can also be expressed and purified on their own without the polymerase subunits (84). However, the second peak was the only peak with all the four subunits expressed with suitable stoichiometry. The fractions that lack POLA1 also lack POLA2 as there is no interaction between POLA2 and the PRIMs (82). 48

Interestingly, the mass spec results of all the protein bands have shown what was expected, but the smallest band of 40 kDa on the gel (Figure 6.2) was shown as PRIM1 when using the human database. It is most probable that the 40 kDa PRIM1 represents a mutant form that was speculated to be a truncated version. One possibility was that the E. coli cells had expressed both versions of PRIM1 either from the first or the eight Methionine in the amino acid sequence. To rule out this possibility, two different E. coli plasmids with different genes were expressed separately in BL21 (DE3) cells. After induction with IPTG, both E. coli expressing plasmids had the

40 kDa band (Supplementary Figure 1). This shows that this is a host protein and not a truncated version. So, the Mass Spec results were compared against the E. coli database and a Chaperone DnaJ protein was identified, which is 40 kDa in size and corresponds to the band size in Figure 6.2. This protein is not expected as a binding partner to Pol α/primase.

The issue was resolved by reducing the salt concentration from 300 mM to 150 mM, which decreases the hydrophobicity and hinders the binding of the chaperone. Moreover, the expression of POLA1 and POLA2 were significantly improved by expressing them in High-five insect cells as compared to Sf9 and E. coli, respectively (Supplementary Figure 2). The use of this insect cell line was motivated by the fact that they can improve expression of certain proteins, as mentioned in (91,92). Another modification was the removal of the TEV cleavage site from PRIM2. The purpose of this modification was to reduce the proteolytic activity 49 associated with the prolonged incubation time of the TEV cleavage reaction in the original vector. These modifications have allowed us to obtain a significantly pure protein with an appropriate stoichiometry

To ensure that the purified Pol  was active, we measured its activity in incorporating dNTPs into a fluorescently labeled 29-mer oligonucleotide primer annealed to an 85-mer DNA template. As shown in Figure 8, Pol

α/primase exhibited polymerase activity as it was able to extend the primer in the presence of dNTPs. Interestingly, Pol is capable of discriminating between dNTPs and rNTPs (compare Fig 8A lane 4 with lane 5) which is consistent with previous biochemical data (82). Moreover, Pol has low processivity as it failed to extend to the length when compared to the control

T4 DNA polymerase (Fig 8A, lane 3). Few pauses were seen, which could have been due to secondary structures in the template. A control reaction lacking Pol  (Fig 8A, lane 1) generated no product. The extension by the polymerase is not limited to 20 nt, which could be due to the absence of

RFC/PCNA, which may play a role in the RNA-DNA hybrid transfer from

Pol  to Pol δ (64,93). Therefore, the DNA primer is repeatedly elongated by the polymerase activity of Pol α/primase.

It has been suggested that the heterotrimer RPA; enhances the activity of Pol  (94) through interactions between RPA1 (70 kDa) and Pol

/primase subunits (94). To test this, the activity of the purified RPA protein was first tested using the qualitative EMSA assay, which detects the interactions between the protein of interest and nucleic acids. Complex 50

formation was achieved, as shown in Figure 9 which tells us that RPA is

active. Next, the primer extension activity of Pol  in the presence of

various concentrations of RPA was tested (Figure 10). RPA is known to

resolve secondary DNA structures (95), allowing Pol  to extend further

through the template. However, this was not achieved when using the 34-

mer ssDNA substrate. As shown in Figure 10A, the lower the concentration

of RPA, the lower was the inhibitory effect. This suggests that both proteins,

RPA and Pol , are competing and at higher concentrations, RPA binds the

template strand with higher affinity than Pol  resulting in few or no

extension. Next, M13 ssDNA was used as a template to test the effect of

RPA on Pol  primer extension activity. This substrate provides longer

ssDNA for Pol  and RPA either to compete or bind together. The results

obtained using this substrate (Figure 10B) exhibited a stimulation of Pol 

processivity up to certain concentration of RPA. This suggest that Pol 

polymerase activity requires other factors to control its unit length extension

i.e 20 nts. These factors may include RFC loading of PCNA, which binds

to the 3’ end of the RNA-DNA primer displacing Pol  (64,93).

4.2 Future Work:

Polα was the last essential protein in the SV40 model system in Professor

Hamdan’s lab. Therefore, future work should include reconstituting leading

and lagging strand synthesis by SV40. In particular, we would like to use

this system to understand how leading strand synthesis doesn’t outpace 51 lagging strand synthesis despite the continuous interruption of the leading strand by several slow activities during each cycle of OF synthesis. In particular, we would like to use our established single molecule flow stretching assay (96-98) to reconstitute leading strand synthesis and study how Pol α/primase influences leading strand synthesis. Previous work in bacteriophage T7 suggested that leading strand synthesis pauses during the slow primer synthesis or lagging strand synthesis moves at faster rates to keep up with leading strand synthesis (99,100,101,102).

Supplementary Data

Supplementary Figure 1. Small scale expression. Two plasmids; PRIM1- PRIM2-pET11a and POLA2-pRSF1b were induced with 0.2 mM IPTG. B indicates samples before induction. A indicates samples after induction with 0.2 mM IPTG. The arrows indicate the endogenous protein at 40 kDa. A pageRule Prestained Protein ladder 10-180 kDa was used and all samples were analyzed using 4-20 % SDS-PAGE and visualized by Coomassie blue staining.

Supplementary Figure 2. Modified Pol α/primase size exclusion chromatography. A chromatogram of Pol α/primase (top) with fractions from pre-concentration (P), 1st peak (D8), and 2nd peak (D11 – E8). The arrows indicate the target proteins: POLA1, POLA2, PRIM1, and PRIM2 which correspond to 180 kDa, 70 kDa, 49 kDa and 58 kDa, respectively. A pageRule Prestained Protein ladder 10-180 kDa was used and all samples were analyzed using 4-20 % SDS-PAGE and visualized by Coomassie blue staining.

References 1. Waga, S. and Stillman, B., 1998. The DNA replication fork in eukaryotic cells. 2. Johnson, Aaron, and Mike O'Donnell. "Cellular DNA replicases: components and dynamics at the replication fork." Annu. Rev. Biochem. 74 (2005): 283-315. 3. Johansson, E. and MacNeill, S.A., 2010. The eukaryotic replicative DNA polymerases take shape. Trends in biochemical sciences, 35(6), pp.339-347. 4. Johnson, R.E., Klassen, R., Prakash, L. and Prakash, S., 2015. A major role of DNA polymerase δ in replication of both the leading and lagging DNA strands. Molecular cell, 59(2), pp.163-175. 5. Zaher, M.S., Oke, M. and Hamdan, S.M. (2021) In Bell, E. (ed.), Molecular Life Sciences: An Encyclopedic Reference. Springer New York, New York, NY, pp. 1- 22. 6. Coloma, J., Johnson, R.E., Prakash, L., Prakash, S. and Aggarwal, A.K., 2016. Human DNA polymerase α in binary complex with a DNA: DNA template-primer. Scientific reports, 6, p.23784. 7. Lancey, C., Tehseen, M., Raducanu, V.S., Rashid, F., Merino, N., Ragan, T.J., Savva, C.G., Zaher, M.S., Shirbini, A., Blanco, F.J. and Hamdan, S.M., 2020. Structure of the processive human Pol δ holoenzyme. Nature communications, 11(1), pp.1-12. 8. Yuan, Z., Georgescu, R., Schauer, G.D., O’Donnell, M.E. and Li, H., 2020. Structure of the polymerase ε holoenzyme and atomic model of the leading strand replisome. Nature communications, 11(1), pp.1-11. 9. Zheng, F., Georgescu, R.E., Li, H. and O’Donnell, M.E., 2020. Structure of eukaryotic DNA polymerase δ bound to the PCNA clamp while encircling DNA. Proceedings of the National Academy of Sciences, 117(48), pp.30344-30353 10. Olivera, B.M. and Bonhoeffer, F., 1972. Discontinuous DNA replication in vitro: I. Two distinct size classes of intermediates. Nature New Biology, 240(103), pp.233-235. 11. HERRMANN, R., HUF, J. and BONHOEFFER, F., 1972. II. Cross hybridization and rate of chain elongation of the two classes of DNA intermediates. Nature New Biology, 240(103), pp.235-237. 12. Burgers, P.M. and Kunkel, T.A., 2017. Eukaryotic DNA replication fork. Annual review of biochemistry, 86, pp.417-438. 13. Stodola, J.L. and Burgers, P.M., 2017. Mechanism of lagging-strand DNA replication in eukaryotes. DNA Replication, pp.117-133. 14. Dornreiter, I., Erdile, L.F., Gilbert, I.U., Von Winkler, D., Kelly, T.J. and Fanning, E., 1992. Interaction of DNA polymerase alpha‐primase with cellular replication protein A and SV40 T antigen. The EMBO journal, 11(2), pp.769-776. 15. Klinge, S., Núñez‐Ramírez, R., Llorca, O. and Pellegrini, L., 2009. 3D architecture of DNA Pol α reveals the functional core of multi‐subunit replicative polymerases. The EMBO journal, 28(13), pp.1978-1987. 16. Mizuno, T., Yamagishi, K., Miyazawa, H. and Hanaoka, F., 1999. Molecular architecture of the mouse DNA polymerase α-primase complex. Molecular and cellular biology, 19(11), pp.7886- 7896. 17. Copeland, W.C., 1997. Expression, Purification, and Characterization of the Two Human Primase Subunits and Truncated Complexes fromEscherichia coli. Protein expression and purification, 9(1), pp.1-9. 18. Lucchini, G., Francesconi, S., Foiani, M., Badaracco, G. and Plevani, P., 1987. Yeast DNA polymerase‐‐DNA primase complex; cloning of PRI 1, a single essential gene related to DNA primase activity. The EMBO journal, 6(3), pp.737-742. 19. Picvani, P., Francesconi, S. and Lucchini, G., 1987. The nucleotide sequence of the PRII gene related to DNA primase in Saccharomyces cerevisiae. Nucleic acids research, 15(19), pp.7975- 7989. 20. Pizzagalli, A., Valsasnini, P., Plevani, P. and Lucchini, G., 1988. DNA polymerase I gene of Saccharomyces cerevisiae: nucleotide sequence, mapping of a temperature-sensitive mutation, and protein homology with other DNA polymerases. Proceedings of the National Academy of Sciences, 85(11), pp.3772-3776. 55

21. Copeland, W.C. and Wang, T.S., 1993. Enzymatic characterization of the individual mammalian primase subunits reveals a biphasic mechanism for initiation of DNA replication. Journal of Biological Chemistry, 268(35), pp.26179-26189. 22. Sheaff, R.J., Kuchta, R.D. and Ilsley, D., 1994. Calf Thymus DNA Polymerase. alpha.-Primase:" Communication" and Primer. cntdot. Template Movement between the Two Active Sites. Biochemistry, 33(8), pp.2247-2254. 23. Kuchta, R.D., Reid, B. and Chang, L.M., 1990. DNA primase. Processivity and the primase to polymerase alpha activity switch. Journal of Biological Chemistry, 265(27), pp.16158-16165. 24. Smith, D.J. and Whitehouse, I., 2012. Intrinsic coupling of lagging-strand synthesis to chromatin assembly. Nature, 483(7390), pp.434-438. 25. Pellegrini, L., 2012. The Pol α-primase complex. In The eukaryotic replisome: a guide to protein structure and function (pp. 157-169). Springer, Dordrecht. 26. MacNeill, S., 2012. Composition and dynamics of the eukaryotic replisome: a brief overview. In The eukaryotic replisome: A guide to protein structure and function (pp. 1-17). Springer, Dordrecht. 27. Reijns, M.A., Kemp, H., Ding, J., de Procé, S.M., Jackson, A.P. and Taylor, M.S., 2015. Lagging-strand replication shapes the mutational landscape of the genome. Nature, 518(7540), pp.502-506. 28. Waga, S. and Stillman, B., 1994. Anatomy of a DNA replication fork revealed by reconstitution of SV40 DNA replication in vitro. Nature, 369(6477), pp.207-212. 29. Li, J.J. and Kelly, T.J., 1984. Simian virus 40 DNA replication in vitro. Proceedings of the National Academy of Sciences, 81(22), pp.6973-6977. 30. Stillman, B., Gerard, R.D., Guggenheimer, R.A. and Gluzman, Y., 1985. T antigen and template requirements for SV40 DNA replication in vitro. The EMBO journal, 4(11), pp.2933-2939. 31. Wobbe, C.R., Dean, F., Weissbach, L. and Hurwitz, J., 1985. In vitro replication of duplex circular DNA containing the simian virus 40 DNA origin site. Proceedings of the National Academy of Sciences, 82(17), pp.5710-5714. 32. Bullock, P.A., Seo, Y.S. and Hurwitz, J., 1991. Initiation of simian virus 40 DNA synthesis in vitro. Molecular and cellular biology, 11(5), pp.2350-2361. 33. Erdile, L.F., Collins, K.L., Russo, A., Simancek, P., Small, D., Umbricht, C., Virshup, D., Cheng, L., Randall, S., Weinberg, D. and Moarefi, I., 1991, January. Initiation of SV40 DNA replication: mechanism and control. In Cold Spring Harbor symposia on quantitative biology (Vol. 56, pp. 303-313). Cold Spring Harbor Laboratory Press. 34. Ishimi, Y., Claude, A., Bullock, P. and Hurwitz, J., 1988. Complete enzymatic synthesis of DNA containing the SV40 origin of replication. Journal of Biological Chemistry, 263(36), pp.19723- 19733. 35. Tsurimoto, T., Melendy, T. and Stillman, B., 1990. Sequential initiation of lagging and leading strand synthesis by two different polymerase complexes at the SV40 DNA replication origin. Nature, 346(6284), pp.534-539. 36. Weinberg, D.H., Collins, K.L., Simancek, P., Russo, A., Wold, M.S., Virshup, D.M. and Kelly, T.J., 1990. Reconstitution of simian virus 40 DNA replication with purified proteins. Proceedings of the National Academy of Sciences, 87(22), pp.8692-8696. 37. Wobbe, C.R., Weissbach, L., Borowiec, J.A., Dean, F.B., Murakami, Y., Bullock, P. and Hurwitz, J., 1987. Replication of simian virus 40 origin-containing DNA in vitro with purified proteins. Proceedings of the National Academy of Sciences, 84(7), pp.1834-1838. 38. Bambara, R.A. and Huang, L., 1995. Reconstitution of mammalian DNA replication. In Progress in nucleic acid research and molecular biology (Vol. 51, pp. 93-122). Academic Press. 39. Bambara, R.A., Murante, R.S. and Henricksen, L.A., 1997. Enzymes and reactions at the eukaryotic DNA replication fork. Journal of Biological Chemistry, 272(8), pp.4647-4650. 40. Dutta, A. and Bell, S.P., 1997. Initiation of DNA replication in eukaryotic cells. Annual review of cell and developmental biology, 13(1), pp.293-332. 41. Challberg, M.D. and Kelly, T.J., 1989. Animal virus DNA replication. Annual review of biochemistry, 58(1), pp.671-713. 42. D'urso, G., Marraccino, R.L., Marshak, D.R. and Roberts, J.M., 1990. Cell cycle control of DNA replication by a homologue from human cells of the p34cdc2 protein kinase. Science, 250(4982), pp.786-791. 56

43. Fanning, E., 1994. Control of SV40 DNA replication by protein phosphorylation: a model for cellular DNA replication?. Trends in cell biology, 4(7), pp.250-255. 44. Hurwitz, J., Dean, F.B., Kwong, A.D. and Lee, S.H., 1990. The in vitro replication of DNA containing the SV40 origin. Journal of Biological Chemistry, 265(30), pp.18043-18046. 45. An, P., Sáenz Robles, M.T. and Pipas, J.M., 2012. Large T antigens of polyomaviruses: amazing molecular machines. Annual review of microbiology, 66, pp.213-236. 46. Fanning, E. and Knippers, R., 1992. Structure and function of simian virus 40 large tumor antigen. Annual review of biochemistry, 61(1), pp.55-85. 47. Fanning, E., Zhao, X. and Jiang, X., 2009. Polyomavirus life cycle. In DNA Tumor Viruses (pp. 1-24). Springer, New York, NY. 48. Burgers, P.M. and Kunkel, T.A., 2017. Eukaryotic DNA replication fork. Annual review of biochemistry, 86, pp.417-438. 49. Stillman, B., 2008. DNA polymerases at the replication fork in eukaryotes. Molecular cell, 30(3), pp.259-260. 50. Stillman, B., 2015. Reconsidering DNA polymerases at the replication fork in eukaryotes. Molecular cell, 59(2), pp.139-141. 51. Wessel, R., Schweizer, J. and Stahl, H., 1992. Simian virus 40 T-antigen DNA helicase is a hexamer which forms a binary complex during bidirectional unwinding from the viral origin of DNA replication. Journal of Virology, 66(2), pp.804-815. 52. Chang, Y.P., Xu, M., Machado, A.C.D., Yu, X.J., Rohs, R. and Chen, X.S., 2013. Mechanism of origin DNA recognition and assembly of an initiator-helicase complex by SV40 large tumor antigen. Cell reports, 3(4), pp.1117-1127. 53. Fanning, E. and Zhao, K., 2009. SV40 DNA replication: from the A gene to a nanomachine. Virology, 384(2), pp.352-359. 54. Chen, J., Le, S., Basu, A., Chazin, W.J. and Yan, J., 2015. Mechanochemical regulations of RPA's binding to ssDNA. Scientific reports, 5, p.9296. 55. Chen, R. and Wold, M.S., 2014. Replication protein A: single‐stranded DNA's first responder: dynamic DNA‐interactions allow replication protein A to direct single‐strand DNA intermediates into different pathways for synthesis or repair. Bioessays, 36(12), pp.1156-1161. 56. Jiang, X., Klimovich, V., Arunkumar, A.I., Hysinger, E.B., Wang, Y., Ott, R.D., Guler, G.D., Weiner, B., Chazin, W.J. and Fanning, E., 2006. Structural mechanism of RPA loading on DNA during activation of a simple pre‐replication complex. The EMBO journal, 25(23), pp.5516-5526. 57. Wold, M.S., 1997. Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism. Annual review of biochemistry, 66(1), pp.61-92. 58. Borowiec, J.A., Dean, F.B., Bullock, P.A. and Hurwitz, J., 1990. Binding and unwinding—how T antigen engages the SV40 origin of DNA replication. Cell, 60(2), pp.181-184. 59. Simmons, D.T., Trowbridge, P.W. and Roy, R., 1998. Topoisomerase I stimulates SV40 T antigen-mediated DNA replication and inhibits T antigen's ability to unwind DNA at nonorigin sites. Virology, 242(2), pp.435-443. 60. Stadlbauer, F., Voitenleitner, C., Brückner, A., Fanning, E. and Nasheuer, H.P., 1996. Species- specific replication of simian virus 40 DNA in vitro requires the p180 subunit of human DNA polymerase alpha-primase. Molecular and Cellular Biology, 16(1), pp.94-104. 61. Waga, S., Bauer, G. and Stillman, B., 1994. Reconstitution of complete SV40 DNA replication with purified replication factors. Journal of Biological Chemistry, 269(14), pp.10923-10934. 62. Fortune, J.M., Stith, C.M., Kissling, G.E., Burgers, P.M. and Kunkel, T.A., 2006. RPA and PCNA suppress formation of large deletion errors by yeast DNA polymerase δ. Nucleic acids research, 34(16), pp.4335-4341. 63. Maga, G., Stucki, M., Spadari, S. and Hübscher, U., 2000. DNA polymerase switching: I. Replication factor C displaces DNA polymerase α prior to PCNA loading. Journal of molecular biology, 295(4), pp.791-801. 64. Mossi, R., Keller, R.C., Ferrari, E. and Hübscher, U., 2000. DNA polymerase switching: II. Replication factor C abrogates primer synthesis by DNA polymerase α at a critical length. Journal of molecular biology, 295(4), pp.803-814. 65. Nethanel, T.A.M.A.R. and Kaufmann, G.A.B.R.I.E.L., 1990. Two DNA polymerases may be required for synthesis of the lagging DNA strand of simian virus 40. Journal of virology, 64(12), pp.5912-5918. 57

66. Yuzhakov, A., Kelman, Z., Hurwitz, J. and O'Donnell, M., 1999. Multiple competition reactions for RPA order the assembly of the DNA polymerase δ holoenzyme. The EMBO Journal, 18(21), pp.6189-6199. 67. Fanning, E., Klimovich, V. and Nager, A.R., 2006. A dynamic model for replication protein A (RPA) function in DNA processing pathways. Nucleic acids research, 34(15), pp.4126-4137. 68. Arunkumar, A.I., Klimovich, V., Jiang, X., Ott, R.D., Mizoue, L., Fanning, E. and Chazin, W.J., 2005. Insights into hRPA32 C-terminal domain–mediated assembly of the simian virus 40 replisome. Nature structural & molecular biology, 12(4), pp.332-339. 69. Weisshart, K., Förster, H., Kremmer, E., Schlott, B., Grosse, F. and Nasheuer, H.P., 2000. Protein-protein interactions of the primase subunits p58 and p48 with simian virus 40 T antigen are required for efficient primer synthesis in a cell-free system. Journal of Biological Chemistry, 275(23), pp.17328-17337. 70. Vaithiyalingam, S., Warren, E.M., Eichman, B.F. and Chazin, W.J., 2010. Insights into eukaryotic DNA priming from the structure and functional interactions of the 4Fe-4S cluster domain of human DNA primase. Proceedings of the National Academy of Sciences, 107(31), pp.13684-13689. 71. Hübscher, U., Maga, G. and Spadari, S., 2002. Eukaryotic DNA polymerases. Annual review of biochemistry, 71(1), pp.133-163. 72. Hübscher, U., Nasheuer, H.P. and Syväoja, J.E., 2000. Eukaryotic DNA polymerases, a growing family. Trends in biochemical sciences, 25(3), pp.143-147. 73. Pavlov, Y.I., Shcherbakova, P.V. and Rogozin, I.B., 2006. Roles of DNA polymerases in replication, repair, and recombination in eukaryotes. International review of cytology, 255, pp.41- 132. 74. Suwa, Y., Gu, J., Baranovskiy, A.G., Babayeva, N.D., Pavlov, Y.I. and Tahirov, T.H., 2015. Crystal structure of the human Pol α B subunit in complex with the C-terminal domain of the catalytic subunit. Journal of Biological Chemistry, 290(23), pp.14328-14337. 75. Klinge, S., Núñez‐Ramírez, R., Llorca, O. and Pellegrini, L., 2009. 3D architecture of DNA Pol α reveals the functional core of multi‐subunit replicative polymerases. The EMBO journal, 28(13), pp.1978-1987. 76. Dua, R., Levy, D.L. and Campbell, J.L., 1998. Role of the putative zinc finger domain of Saccharomyces cerevisiae DNA polymerase ε in DNA replication and the S/M checkpoint pathway. Journal of Biological Chemistry, 273(45), pp.30046-30055. 77. Baranovskiy, A.G., Babayeva, N.D., Liston, V.G., Rogozin, I.B., Koonin, E.V., Pavlov, Y.I., Vassylyev, D.G. and Tahirov, T.H., 2008. X-ray structure of the complex of regulatory subunits of human DNA polymerase delta. Cell cycle, 7(19), pp.3026-3036. 78. Lao-Sirieix, S.H., Nookala, R.K., Roversi, P., Bell, S.D. and Pellegrini, L., 2005. Structure of the heterodimeric core primase. Nature structural & molecular biology, 12(12), pp.1137-1144. 79. Zhou, B., Arnett, D.R., Yu, X., Brewster, A., Sowd, G.A., Xie, C.L., Vila, S., Gai, D., Fanning, E. and Chen, X.S., 2012. Structural basis for the interaction of a hexameric replicative helicase with the regulatory subunit of human DNA polymerase α-primase. Journal of Biological Chemistry, 287(32), pp.26854-26866. 80. Klinge, S., Hirst, J., Maman, J.D., Krude, T. and Pellegrini, L., 2007. An iron-sulfur domain of the eukaryotic primase is essential for RNA primer synthesis. Nature structural & molecular biology, 14(9), pp.875-877. 81. Weiner, B.E., Huang, H., Dattilo, B.M., Nilges, M.J., Fanning, E. and Chazin, W.J., 2007. An iron-sulfur cluster in the C-terminal domain of the p58 subunit of human DNA primase. Journal of Biological Chemistry, 282(46), pp.33444-33451. 82. Zhang, Y., Baranovskiy, A.G., Tahirov, T.H. and Pavlov, Y.I., 2014. The C-terminal domain of the DNA polymerase catalytic subunit regulates the primase and polymerase activities of the human DNA polymerase α-primase complex. Journal of Biological Chemistry, 289(32), pp.22021-22034. 83. Baranovskiy A.G., Zhang Y., Suwa Y., Babayeva N.D., Gu J., Pavlov Y.I., Tahirov T.H. Crystal structure of the human primase. J. Biol. Chem. 2015;290:5635–5646. doi: 10.1074/jbc.M114.624742 58

84. Agarkar, V.B., Babayeva, N.D., Pavlov, Y.I. and Tahirov, T.H., 2011. Crystal structure of the C- terminal domain of human DNA primase large subunit: implications for the mechanism of the primase-polymerase α switch. Cell Cycle, 10(6), pp.926-931. 85. Vaithiyalingam, S., Arnett, D.R., Aggarwal, A., Eichman, B.F., Fanning, E. and Chazin, W.J., 2014. Insights into eukaryotic primer synthesis from structures of the p48 subunit of human DNA primase. Journal of molecular biology, 426(3), pp.558-569. 86. Baranovskiy, A.G., Zhang, Y., Suwa, Y., Gu, J., Babayeva, N.D., Pavlov, Y.I. and Tahirov, T.H., 2016. Insight into the human DNA primase interaction with template-primer. Journal of Biological Chemistry, 291(9), pp.4793-4802. 87. Baranovskiy, A.G. and Tahirov, T.H., 2017. Elaborated action of the human primosome. Genes, 8(2), p.62. 88. Baranovskiy, A.G., Babayeva, N.D., Zhang, Y., Gu, J., Suwa, Y., Pavlov, Y.I. and Tahirov, T.H., 2016. Mechanism of concerted RNA-DNA primer synthesis by the human primosome. Journal of Biological Chemistry, 291(19), pp.10006-10020. 89. Henricksen, L.A., Umbricht, C.B. and Wold, M.S., 1994. Recombinant replication protein A: expression, complex formation, and functional characterization. Journal of Biological Chemistry, 269(15), pp.11121-11132. 90. Georgescu, R.E., Schauer, G.D., Yao, N.Y., Langston, L.D., Yurieva, O., Zhang, D., Finkelstein, J. and O'Donnell, M.E., 2015. Reconstitution of a eukaryotic replisome reveals suppression mechanisms that define leading/lagging strand operation. Elife, 4, p.e04988 91. Schlaeger, E.J., Stricker, J., Wippler, J. and Foggetta, M., 1995. Investigations of high cell density baculovirus infection using Sf9 and High Five insect cell lines in the low-cost SF-1 medium. In Animal cell technology: Developments towards the 21st century (pp. 313-315). Springer, Dordrecht. 92. Wilde, M., Klausberger, M., Palmberger, D., Ernst, W. and Grabherr, R., 2014. Tna o38, high five and Sf 9—evaluation of host–virus interactions in three different insect cell lines: baculovirus production and recombinant protein expression. Biotechnology letters, 36(4), pp.743- 749. 93. Tsurimoto, T. and Stillman, B., 1991. Replication factors required for SV40 DNA replication in vitro. II. Switching of DNA polymerase alpha and delta during initiation of leading and lagging strand synthesis. Journal of Biological Chemistry, 266(3), pp.1961-1968. 94. Braun, K.A., Lao, Y.E., He, Z., Ingles, C.J. and Wold, M.S., 1997. Role of Protein− Protein Interactions in the Function of Replication Protein A (RPA): RPA Modulates the Activity of DNA Polymerase α by Multiple Mechanisms. Biochemistry, 36(28), pp.8443-8454. 95. Deng, S.K., Chen, H. and Symington, L.S., 2015. Replication protein A prevents promiscuous annealing between short sequence homologies: Implications for genome integrity. Bioessays, 37(3), pp.305-313. 96. Elshenawy, M.M., Jergic, S., Xu, Z.Q., Sobhy, M.A., Takahashi, M., Oakley, A.J., Dixon, N.E. and Hamdan, S.M., 2015. Replisome speed determines the efficiency of the Tus− Ter replication termination barrier. Nature, 525(7569), pp.394-398. 97. Pandey, M., Elshenawy, M.M., Jergic, S., Takahashi, M., Dixon, N.E., Hamdan, S.M. and Patel, S.S., 2015. Two mechanisms coordinate replication termination by the Escherichia coli Tus–Ter complex. Nucleic acids research, 43(12), pp.5924-5935. 98. Jergic, S., Horan, N.P., Elshenawy, M.M., Mason, C.E., Urathamakul, T., Ozawa, K., Robinson, A., Goudsmits, J.M., Wang, Y., Pan, X. and Beck, J.L., 2013. A direct proofreader–clamp interaction stabilizes the Pol III replicase in the polymerization mode. The EMBO journal, 32(9), pp.1322-1333. 99. Lee, J.B., Hite, R.K., Hamdan, S.M., Xie, X.S., Richardson, C.C. and Van Oijen, A.M., 2006. DNA primase acts as a molecular brake in DNA replication. Nature, 439(7076), pp.621-624. 100. Pandey, M., Syed, S., Donmez, I., Patel, G., Ha, T. and Patel, S.S., 2009. Coordinating DNA replication by means of priming loop and differential synthesis rate. Nature, 462(7275), pp.940- 943. 101. Hamdan, S.M. and Richardson, C.C., 2009. Motors, switches, and contacts in the replisome. Annual review of biochemistry, 78, pp.205-243. 102. Hamdan, S.M. and Van Oijen, A.M., 2010. Timing, coordination, and rhythm: acrobatics at the DNA replication fork. Journal of Biological Chemistry, 285(25), pp.18979-18983