Lncrna TTN‑AS1 Promotes Endometrial Cancer by Sponging Mir‑376A‑3P

ONCOLOGY REPORTS 44: 1343-1354, 2020

LncRNA TTN‑AS1 promotes endometrial cancer by sponging miR‑376a‑3p

LONGDE SHEN1*, YINYIN WU2*, AILU LI1, LICHUN LI1, LONGYUAN SHEN3, QIUXIA JIANG4, QIUXIA LI5, ZHIFEN WU1, LIJI YU1 and XIAOHONG ZHANG1

1Department of Gynecology and Obstetrics, Quanzhou First Hospital Affiliated to Fujian Medical University, Quanzhou, Fujian 362000; 2Department of Gynecology and Obstetrics, Jinjiang Traditional Chinese Medicine Hospital, Jinjiang, Fujian 362200; Departments of 3Anesthesiology and 4Ultrasound, Quanzhou Women's and Children's Hospital; 5Department of Gynecology and Obstetrics, Quanzhou Guangqian Hospital, Quanzhou, Fujian 362000, P.R. China

Received January 13, 2020; Accepted April 29, 2020

DOI: 10.3892/or.2020.7691

Abstract. Increasing research has demonstrated that Introduction lncRNAs participate in the development of multiple cancer types. However, the role of TTN‑AS1 in endometrial cancer Endometrial cancer (EC) is the sixth most common malignant (EC) remains unknown. The present study aimed to explore tumor in females, accounting for ~76,000 deaths each year the function of titin‑antisense RNA1 (TTN‑AS1) in EC worldwide (1). The incidence of EC increases as women get progression and the underlying mechanisms. qRT‑PCR was older, and the prognosis is poor (2). performed to assess the TTN‑AS1 expression patterns in Long noncoding RNAs (lncRNAs) are a subclass of EC tissues and cell lines. Loss of function experiments were non‑coding RNAs that are longer than 200 nucleotides (3). carried out to estimate the effects of TTN‑AS1 on EC cell Recently, increasing studies have revealed that lncRNAs proliferation, migration and invasion. To reveal the under- participate in a series of biological processes, including tumor lying mechanisms, informatics tools were used to predict the initiation, growth and metastasis at chromatin, genomic, tran- targets. Rescue experiments were performed to investigate the scription and post‑transcription levels (4,5). In EC, a number TTN‑AS1‑regulated miR‑376a‑3p/pumilio homolog 2 (PUM2) of lncRNAs have been revealed to be dysregulated and to axis involved. The results of the present study revealed that participate in the pathogenesis of this disease (6,7). Although a TTN‑AS1 was highly expressed in both EC tissues and cell series of lncRNAs have been identified as having oncogenic or lines, and TTN‑AS1 knockdown inhibited EC cell prolifera- antitumor roles in EC development, there is still a large number tion, migration and invasion. With respect to the mechanisms, of lncRNAs which may contribute to the progression of EC but miR‑376a‑3p was revealed to be targeted by TTN‑AS1, and have not been explored in‑depth (6). Thus, investigating the reversed the effects on EC development induced by TTN‑AS1. roles of important lncRNAs in EC progression may contribute In addition, PUM2 was positively regulated by TTN‑AS1, and to improving the early diagnosis rate and therapeutic effect. miR‑376a‑3p mediated the regulation between them. Furtherly, microRNAs (miRNAs) are noncoding RNAs, with a in vivo experiments confirmed the results. Collectively, length of ~22 nt. They suppress the target gene expression TTN‑AS1 enhanced EC cell proliferation and metastasis by by recognizing and binding to the 3'UTR of target mRNAs targeting the miR‑376a‑3p/PUM2 axis, which may shed light and thereby leading to mRNA degradation (8). miRNAs are on EC diagnosis and treatment. known to function in multiple biological processes, including cancer initiation and development (9,10). With regard to EC, a series of miRNAs have been reported to be dysregulated and involved in its progression (11). For example, miR‑1271, miR‑361 and miR‑124‑3p inhibited EC development (12‑14), whereas miR‑944, miR‑205 and miR‑130b promoted EC Correspondence to: Dr Ailu Li, Department of Gynecology progression (15‑17). Therefore, miRNA‑related diagnosis and and Obstetrics, Quanzhou First Hospital Affiliated to Fujian therapy may be promising for EC treatment. Medical University, 250 DongJie Street, Quanzhou, Fujian 362000, P. R. Ch i na lncRNA titin‑antisense RNA1 (TTN‑AS1), transcribed E‑mail: [email protected] from the antisense strand of TTN, is located on chromosome 2q12.2. Increasing studies have reported the upregulation and *Contributed equally oncogenic function of TTN‑AS1 in multiple cancer types, including hepatocellular carcinoma, esophageal, prostate Key words: lncRNA TTN‑AS1, endometrial cancer, miR‑376a‑3p, and papillary thyroid cancer (18‑21). However, the expres- PUM2, cell proliferation sion profile and specific effects of TTN‑AS1 in EC remain unknown. In the present study, the expression of TTN‑AS1 was explored in tissues from EC patients and the detailed 1344 SHEN et al: lncRNA TTN-AS1 PROMOTES ENDOMETRIAL CANCER participation of TTN‑AS1 in EC cell proliferation, migration was added to each well. Cells were incubated for 20 min in and invasion was determined. Moreover, an attempt was made the dark. The apoptosis of cells was then analyzed by a flow to elucidate the underlying mechanisms. cytometer.

Materials and methods Transwell assays. Transwell chambers (Corning, Inc.) were used to assess the migration and invasion of cells. For the migra- Clinical samples. Forty‑five paired EC tissue samples and tion assay, transfected cells were seeded in the upper chamber adjacent normal ones were obtained from patients who (2.5x104 cells) containing RPMI‑1640 medium (Hyclone; GE received surgical resection at Quanzhou First Hospital Healthcare). Complete medium (RPMI‑1640 containing 10% Affiliated to Fujian Medical University from February 2017 FBS) was added to the bottom chamber. Twenty‑four hours to August 2019. None of them had received chemotherapy later, the cells were washed away. Then, 20% methanol and or radiotherapy. All patients were diagnosed as EC by 0.5% crystal violet were added to the bottom chamber for histopathological evaluations. Informed written consent was 20 min at room temperature. A light microscope (X7; Nikon obtained from all the patients. The protocol for the use of Corporation) was used to obtain images and migration cells human samples of this study was approved by the Ethics were counted from 5 randomly‑selected fields. For the inva- Committee of Quanzhou First Hospital Affiliated to Fujian sion assay, except for the 50‑µl of Matrigel that was added Medical University. Clinical characteristics of EC patients to the upper chamber, the other steps were the same as the are listed in Table I. migration assay.

Cell culture. EC cell lines (HEC1B, KLE, HEC1A and Targets prediction. Starbase 2.0 software (http://starbase. Ishikawa), human endometrial stromal cells (ESC; SHT290) sysu.edu.cn/starbase2/index.php) was used to predict poten- and 293T cells were obtained from ATCC. Cells were cultured tial miRNA targets of lncRNA TTN‑AS1 (23). TargetScan in DMEM containing 10% FBS (both from Gibco; Thermo Software (http://www.targetscan.org/mamm_31/) was used to Fisher Scientific, Inc.) at 37˚C in a humidified atmosphere of predict potential targets of miR‑376a‑3p.

5% CO2. Luciferase reporter assay. Sequences containing wild‑type Transfection. Specific siRNA against TTN‑AS1 (si‑TTN‑AS1), or mutant sites were inserted into pGL3 luciferase reporter miR‑376a‑3p inhibitor, miR‑376a‑3p mimics and their corre- vector (Promega Corporation), forming plasmids: TTN‑AS1 sponding negative controls (si‑NC, miR‑NC and miR‑NC wt, TTN‑AS1 mut, PUM2 3'UTR wt and PUM2 3'UTR mimics) were purchased from Sangon Biotech Co., Ltd. mut. TTN‑AS1 wt or TTN‑AS1 mut was co‑transfected Sequences are presented in Table SI. Plasmids were trans- with miR‑376a‑3p mimics or miR‑NC mimics. Luciferase fected into HEC1A and Ishikawa using Lipo3000 (Invitrogen; activity was measured after 48 h. In the same manner, PUM2 Thermo Fisher Scientific Inc.), according to the manufacturer's 3'UTR wt or PUM2 3'UTR mut was co‑transfected with instructions. miR‑376a‑3p mimics or miR‑NC mimics, and luciferase activity was analyzed 48 h later with Renilla as normaliza- RNA extraction and quantitative real‑time PCR. TRIzol tion control. (Invitrogen; Thermo Fisher Scientific Inc.) was used to extract total RNA from cells or tissues. cDNA was synthesized from RNA immunoprecipitation (RIP). RIP was carried out using 1 µg RNA each sample by MML‑V (Promega Corporation) Imprint RNA Immunoprecipitation kit (Sigma‑Aldrich; Merck and used as templets for qPCR. qPCR thermocycling condi- KGaA). In brief, cell lysates were incubated with beads supple- tions were as follows: 95˚C for 1 min and 45 cycles of 94˚C for mented with IgG or Ago2 antibody at 4˚C overnight. The beads 15 sec, 55˚C for 20 sec, and 72˚C for 30 sec. qPCR was carried were collected for western blotting and qPCR. out via SYBR Premix Ex Taq (Takara Bio, Inc.). β‑actin was used as an internal control for TTN‑AS1 and pumilio Western blotting. Proteins were isolated from tissues or cells homolog 2 (PUM2), while U6 was used for miR‑376a‑3p. All using RIPA (Sigma‑Aldrich; Merck KGaA). After quantifica- data were analyzed using 2‑ΔΔCq method (22). The sequences of tion with a BCA Assay Kit (Thermo Fisher Scientific, Inc.), the primers are presented in Table II. equal proteins (10 µg) of each sample were loaded and separated by 10% PAGE and transferred onto PVDF membranes (EMD CCK‑8 assay. Transfected cells were seeded into 96‑well Millipore). The membranes were blocked with 5% non‑fat milk plates at a density of 5x103 cells/well. At each time‑point for 1 h and then incubated with primary antibodies against (24, 48, 72 and 96 h), 8 µl of CCK‑8 solution (Dojindo Ago2 (1:500; product code ab186733; Abcam), PUM2 (1:500; Molecular Technologies, Inc.) was added in each well. product code ab92390; Abcam), cleaved caspase‑3 (1:500; After 2 h, the absorbance was measured at 450 nm on a product no. 9662; Cell Signaling Technology, Inc.), cleaved microplate reader. PARP (1:500; product no. 5625; Cell Signaling Technology, Inc.) and GAPDH (1:2,000; cat. no. D190090‑0200; Sangon Flow cytometry. The apoptosis of cells was detected by Biotech Co., Ltd.) at 4˚C overnight. After washing three times, Apoptosis Detection kit (Sigma‑Aldrich; Merck KGaA). the protein blots were treated with an HRP‑conjugated strep- Forty‑eight hours after transfection, the cells (2x105 cells/well) tavidin secondary antibody (1:1,000; cat. no. D111054; Sangon were harvested from 6‑well plates. Binding buffer (100 µl), Biotech Co., Ltd.) for 1 h at room temperature. An ECL 5 µl of Annexin V‑FITC reagent and 5 µl of a PI solution detection kit (Beyotime Institute of Biotechnology) was used ONCOLOGY REPORTS 44: 1343-1354, 2020 1345

Table I. Characteristics of endometrial cancer patients.

TTN‑AS1 expression ------Characteristics N=45 High (n=30) Low (n=15) P‑value

Age (years) ≥50 33 24 9 0.523 <50 12 6 6 Tumor size (cm) ≥4 26 18 8 0.013a <4 19 12 7 FIGO stage III‑IV 18 11 7 0.024a I‑II 27 19 8 Lymph‑node metastasis Yes 21 15 6 0.019a No 24 15 9 Histological grade Well 25 15 10 0.521 Moderately/poorly 20 15 5 aP<0.05 represents a statistically significant difference.

Table II. Primers of qRT‑PCR.

Gene Primers

TTN‑AS1 Forward 5'‑CGGGAACAAGCCCTGTG‑3' Reverse 5'‑CCGGCCCAAAGATGATG‑3' miR‑376a‑3p Stem-loop 5'‑GTCGTATCCAGTGCAGGGTCCGAGG RT primer TATTCGCACTGGATACGACTAGTAT‑3' Forward 5'‑TGCACCTAAAAGGAG‑3' Reverse 5'‑GTGCAGGGTCCGAGGT‑3' PUM2 Forward 5'‑AGGACTTGCACAAGCAGAAC‑3' Reverse 5'‑GTTGGCGTACACGGGCGGCT‑3' β‑actin Forward 5'‑AGCCACATCGCTCAGACAC‑3' Reverse 5'‑GCCCAATACGACCAAATCC‑3' U6 Forward 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' Reverse 5'‑CGCTTCACGAATTTGCGTGTCAT‑3'

TTN‑AS1, titin‑antisense RNA1; PUM2, pumilio homolog 2.

to visualize the signals. ImageJ software (V1.8.0; National Animal model establishment. Female BALB/C nude mice Institutes of Health) was used for densitometry. (4 weeks old, ~16 g) were provided by Shanghai Experimental Animal Center of the Chinese Academy of Sciences. Mice were Immunohistochemical staining. Tumor tissue was sectioned into maintained at ~22˚C in a relative humidity of 40‑70% with a 6‑µm thick slices and treated with antibody against Ki‑67 (1:1,000; 12‑h light/dark cycle and access to food and water ad libitum. product code ab15580; Abcam) at 4˚C overnight. Followed by HEC1A cells (1x106) stably transfected with sh‑TTN‑AS1 multiple washes, the samples were incubated with avidin‑labeled or sh‑NC were injected into the right flanks of nude mice HRP (Cell Signaling Technology, Inc.) for 2 h at room tempera- (5 mice each group). The tumor size was monitored weekly for ture. The EnVision system (Dako; Agilent Technologies, Inc.) 5 weeks. Thirty‑five days after injection of transfected HEC1A was used to visualize the immunostaining signals. Each sample cells, the mice were anesthetized by intraperitoneal injection was analyzed from five randomly‑selected visual fields. with 10% chloral hydrate (300 mg/kg), and then euthanized 1346 SHEN et al: lncRNA TTN-AS1 PROMOTES ENDOMETRIAL CANCER

Figure 1. Upregulation of TTN‑AS1 in EC tissues and cell lines. (A) TTN‑AS1 expression levels in EC tissues (n=45) and corresponding normal tissues (n=45) were determined by qRT‑PCR. (B) The expression levels of TTN‑AS1 in EC cell lines (HEC1B, KLE, HEC1A and Ishikawa) and ESC were determined by qRT‑PCR. (C) Association between TTN‑AS1 expression and overall survival of EC patients was analyzed by Kaplan‑Meier curve test. **P<0.01. TTN‑AS1, titin‑antisense RNA1; EC, endometrial cancer; ESC, endometrial stromal cells.

by cervical dislocation. A total of 10 mice were used for experiments. si‑TTN‑AS1 or negative control (si‑NC) this experiment (5 mice/group), and all the 10 mice were was transfected into the HEC1A and Ishikawa cell lines. euthanized. Before euthanasia, no mouse was found dead. No Functional experiments revealed that depletion of TTN‑AS1 mouse exhibited signs of peritonitis following the administra- resulted in reduced cell proliferation (Fig. 2B), migration tion of 10% chloral hydrate. Death was confirmed by cardiac (Fig. 2E) and invasion (Fig. 2F). In addition, flow cytometric arrest and pupil enlargement. Subsequently, the tumors were experiments demonstrated that knockdown of TTN‑AS1 removed for weight measurement as well as other assessments. increased the cell apoptotic rate (Fig. 2C), and western blot- The protocol involving the use of animals was authorized by ting revealed that cleaved caspase‑3 and cleaved PARP were the Ethics Committee of Quanzhou First Hospital Affiliated to also upregulated upon TTN‑AS1 depletion (Fig. 2D). The Fujian Medical University. results indicated that TTN‑AS1 promoted EC cell growth and metastasis in vitro. Statistical analysis. Data are expressed as the mean ± standard error of the mean (SEM) and each experiment was repeated TTN‑AS1 directly interacts with miR‑376a‑3p. To explore at least three times. Differences between two groups were the underlying mechanism, StarBase 2.0 was used to find the analyzed by Student's t‑test and comparisons among more potential binding sites between TTN‑AS1 and miR‑376a‑3p than two groups were analyzed by one‑way ANOVA followed (Fig. 3A). In the present, 16 miRNAs were predicted as poten- by the Bonferroni post hoc test. The correlations between tial targets of TTN‑AS1 by StarBase software (Table SII), TTN‑AS1 and miR‑376a‑3p, miR‑376a‑3p and PUM2, and the predicted top 10 miRNAs were verified by luciferase TTN‑AS1 and PUM2 were analyzed by Pearson's correlation reporter activity assay, and it was revealed that 6 miRNAs analysis. Kaplan‑Meier and log‑rank testing were performed including miR‑376a‑3p were significantly regulated by for survival analysis. P<0.05 was considered to indicate a TTN‑AS1 (data not shown). Subsequently, luciferase reporter statistically significant difference. assay revealed significantly reduced luciferase activity of TTN‑AS1 wild‑type (TTN‑AS1 wt) vector, confirming Results the prediction (Fig. 3B). miR‑376a‑3p was increased with TTN‑AS1 knockdown, while TTN‑AS1 was decreased with Expression patterns of TTN‑AS1 in EC tissues and cell lines. miR‑376a‑3p overexpression (Fig. 3C and D). Additionally, To elucidate the role of TTN‑AS1 in EC, its expression file was anti‑Ago2 RIP assay demonstrated that TTN‑AS1 and assessed. Both in EC tissues and cell lines, TTN‑AS1 exhib- miR‑376a‑3p directly interacted in the Ago2 complex ited higher expression levels compared with that in normal (Fig. 3E). In vivo, the expression profile of miR‑376a‑3p in groups (Fig. 1A and B). In addition, it was revealed that a high tissues was assessed, and the results revealed that the level of level of TTN‑AS1 was associated with shorter overall survival miR‑376a‑3p was lower in EC tissues than in normal tissues (Fig. 1C), as well as tumor size, FIGO stage and lymph‑node (Fig. 3F). Furthermore, the relationship between TTN‑AS1 metastasis (Table I). and miR‑376a‑3p was investigated, and the results revealed that miR‑376a‑3p was negatively correlated with TTN‑AS1 Effects of TTN‑AS1 in EC cell proliferation and metas‑ in EC tissues (Fig. 3G). tasis. To determine whether TTN‑AS1 exerted a promoting function in EC development, functional experiments were miR‑376a‑3p mediates TTN‑AS1‑regulated EC develop‑ perform using siRNAs. It was demonstrated as revealed ment. Whether TTN‑AS1 modulated EC cell behavior by Fig. 2A that transfection of siRNAs (si‑TTN‑AS1#1 through miR‑376a‑3p was furtherly explored. As revealed and si‑TTN‑AS1#2) suppressed TTN‑AS1 expression in in Fig. 4A, miR‑376a‑3p inhibitor significantly knocked HEC1A and Ishikawa cells. Since si‑TTN‑AS1#2 exhibited down the miR‑376a‑3p expression level. Subsequently, a higher inhibitory effect it was selected for the following miR‑376a‑3p inhibitor or miR‑NC was co‑transfected with ONCOLOGY REPORTS 44: 1343-1354, 2020 1347

Figure 2. Depletion of TTN‑AS1 restrains EC cell proliferation, migration and invasion. (A) TTN‑AS1 expression was detected by qRT‑PCR with transfection of si‑RNAs (si‑TTN‑AS1#1 and si‑TTN‑AS1#2). After transfection with si‑TTN‑AS1 or negative control (si‑NC), (B) a CCK‑8 assay was performed to assess the cell viability, (C) flow cytometry was used to evaluate the apoptotic rate and (D) western blotting was performed to detect the protein expression levels of cleaved caspase‑3 and cleaved PARP. (E and F) Transwell assays were performed to assess the cell migration and invasion abilities. **P<0.01. TTN‑AS1, titin‑antisense RNA1; EC, endometrial cancer.

si‑TTN‑AS1 or si‑NC. Rescue experiments revealed that Moreover, the increased apoptotic rate, cleaved caspase‑3 miR‑376a‑3p inhibitor could reverse the si‑TTN‑AS1‑in- expression and cleaved PARP expression induced by duced inhibitory effects on cell proliferation (Fig. 4B), si‑TTN‑AS1 could also be mitigated by miR‑376a‑3p migration (Fig. 4E and G) and invasion (Fig. 4F and G). inhibitor (Fig. 4C, D and G). 1348 SHEN et al: lncRNA TTN-AS1 PROMOTES ENDOMETRIAL CANCER

Figure 3. TTN‑AS1 sponges miR‑376a‑3p. (A) Starbase 2.0 revealed the interacting sequences of TTN‑AS1 and miR‑376a‑3p. (B) A luciferase reporter assay was carried out to validate the binding sites. (C) miR‑376a‑3p expression was assessed by qRT‑PCR with si‑TTN‑AS1 transfection. (D) TTN‑AS1 expression was assessed by qRT‑PCR with miR‑376a‑3p overexpression. (E) Anti‑Ago2 RIP was used to detected the direct interactions between TTN‑AS1 and miR‑376a‑3p. (F) miR‑376a expression in EC tissues and normal tissues was assessed by qRT‑PCR. (G) Correlation analysis of the relationship between miR‑376a‑3p and TTN‑AS1 expression in EC tissues. **P<0.01. TTN‑AS1, titin‑antisense RNA1. miR‑376a‑3p targets PUM2 directly. TargetScan was used to reporter activity assay, and 3 miRNAs including PUM2 were predict potential targets of miR‑376a‑3p. PUM2 ranked third revealed to be downregulated by miR‑376a‑3p (data not shown). among the numerous predicted genes presented in Table SIII, Fig. 5A presents the interacting sequences of miR‑376a‑3p which indicated it was more likely to be the real target gene. and PUM2, and a luciferase reporter assay was carried The predicted top 5 miRNAs were verified by luciferase out to verify this interaction (Fig. 5B). In addition, PUM2 ONCOLOGY REPORTS 44: 1343-1354, 2020 1349

Figure 4. miR‑376a‑3p mediates the suppressive effects on EC cells induced by si‑TTN‑AS1. (A) qRT‑PCR was used to assess miR‑376a‑3p expression with miR‑376a inhibitor transfection. si‑TTN‑AS1 was co‑transfected with miR‑376a‑3p inhibitor or negative control (miR‑NC), and then (B) a CCK‑8 assay was performed to assess the cell viability, (C) flow cytometry was used to evaluate the apoptotic rate and (D) western blotting was performed to detect the protein expression levels of cleaved caspase‑3 and cleaved PARP. (E and F) A Transwell assay was carried out to assess the cell migration and invasion abilities. (G) Quantitative analysis of C‑F, respectively. **P<0.01 vs. the si‑NC+miR‑NC group; ##P<0.01 vs. the si‑TTN‑AS1+miR‑NC group. TTN‑AS1, titin‑antisense RNA1. 1350 SHEN et al: lncRNA TTN-AS1 PROMOTES ENDOMETRIAL CANCER

Figure 5. PUM2 is targeted by miR‑376a‑3p. (A) TargetScan revealed the interacting sequences of miR‑376a‑3p and PUM2. (B) A luciferase reporter assay was carried out to validate the binding sites. PUM2 expression was assessed by (C) qRT‑PCR and (D) western blotting with miR‑376a‑3p overexpression. (E) PUM2 expression in EC tissues and normal tissues was assessed by qRT‑PCR. (F) Correlation analysis of the relationship between PUM2 and miR‑376a‑3p expression in EC tissues. **P<0.01. PUM2, pumilio homolog 2; EC, endometrial cancer.

mRNA and protein were downregulated upon miR‑376a‑3p As revealed in Fig. 7A, tumors in the TTN‑AS1‑depleted mice overexpression (Fig. 5C and D). In vivo, the expression level were smaller than those in the control group. Consistently, of PUM2 was higher in EC tissues than in normal tissues tumors in sh‑TTN‑AS1 injected mice were lighter than those (Fig. 5E). Furthermore, PUM2 was negatively correlated with in the sh‑NC injected mice (Fig. 7B). The protein expression miR‑376a‑3p in EC tissues (Fig. 5F). levels of cleaved caspase‑3 and cleaved PARP were also increased in TTN‑AS1‑depleted mice (Fig. 7C). Additionally, PUM2 is upregulated by TTN‑AS1 via miR‑376a‑3p. the expression levels of miR‑376a‑3p, PUM2 and Ki67 were miR‑376a‑3p inhibitor or miR‑NC was co‑transfected with also detected. Results demonstrated that miR‑376a‑3p was si‑TTN‑AS1, and the expression level of PUM2 was detected. upregulated upon TTN‑AS1 depletion (Fig. 7D), while PUM2 As revealed in Fig. 6A, depletion of TTN‑AS1 induced a was downregulated (Fig. 7E). Ki67, a marker of cell prolifera- significant downregulation of the mRNA expression level tion, was also decreased by TTN‑AS1 depletion (Fig. 7F). All of PUM2, while miR‑376a‑3p inhibitor partially reversed these results were consistent with the in vitro findings. this reduction. A similar result was observed in the protein expression level of PUM2 (Fig. 6B and C). In vivo, PUM2 was Discussion positively correlated with TTN‑AS1 in EC tissues (Fig. 6D). Increasing evidence has demonstrated that lncRNAs are Depletion of TTN‑AS1 restrains tumor growth in vivo. An involved in the development of EC. For example, Zhang et al in vivo study was performed by establishing xenograft models. revealed that overexpressed H19 markedly promoted EC cell HEC1A cells stably transfected with sh‑TTN‑AS1 or sh‑NC proliferation by competing with miR‑612 thereby regulating were inoculated into female nude mice. After the tumor size HOXA10 (24). Wang et al determined that NR2F‑AS1 posi- was measured weekly for 5 weeks, the mice were sacrificed tively modulated SOX4 to regulate EC progression by sponging for tumor weight measurement as well as other assessments. miR‑363 (25). Yu et al demonstrated that low expression of ONCOLOGY REPORTS 44: 1343-1354, 2020 1351

Figure 6. TTN‑AS1 regulates PUM2 by targeting miR‑376a‑3p. si‑TTN‑AS1 was co‑transfected with miR‑NC or miR‑376a‑3p inhibitor, and then (A) qPCR was performed to determine the mRNA expression level of PUM2. (B and C) Western blotting was used to determine the protein expression level of PUM2. (D) Correlation analysis of relationship between PUM2 and TTN‑AS1 expression in EC tissues. **P<0.01 vs. si‑NC+miR‑NC group; ##P<0.01 vs. the si‑TTN‑AS1+miR‑NC group. TTN‑AS1, titin‑antisense RNA1; PUM2, pumilio homolog 2; EC, endometrial cancer.

Figure 7. Depletion of TTN‑AS1 restrains tumor growth via the miR‑376a‑3p/PUM2 axis in vivo. sh‑TTN‑AS1 or sh‑NC transfected HEC1A cells were injected into nude mice, and (A) the tumor size was assessed weekly. (B) The tumor weight was assessed 5 weeks after treatment. (C) The protein expression levels of cleaved caspase‑3 and cleaved PARP were determined by western blotting. (D) miR‑376a‑3p was assessed by qRT‑PCR. (E) PUM2 protein level was assessed by western blotting. (F) Ki‑67 was detected by immunohistochemical staining. **P<0.01. TTN‑AS1, titin‑antisense RNA1; PUM2, pumilio homolog 2. 1352 SHEN et al: lncRNA TTN-AS1 PROMOTES ENDOMETRIAL CANCER

CCAT1 in EC tissues and cell lines may promote EC cell that miR‑376a‑3p may be involved in TTN‑AS1‑regulated EC proliferation and invasion by targeting miR‑181a‑5p (26). development. In addition, rescue experiments were performed, These studies indicated that lncRNAs usually exhibited onco- and it was determined that transfection of miR‑376a‑3p inhib- genic or antitumor roles by sponging miRNAs in EC. Previous itor could partially reverse the TTN‑AS1 induced inhibitory studies have revealed that TTN‑AS1 promoted cell prolifera- effects on EC cell proliferation, migration and invasion. tion in various cancers. For instance, TTN‑AS1 was expressed Moreover, miRNAs are known to function by targeting at a high level in hepatocellular tissues and could aggravate mRNAs. miR‑376a‑3p was revealed to exhibit anticancer hepatocellular carcinoma by sponging miR‑127 and regulating effects in a series of cancers via targeting mRNAs. For example, the Wnt/β‑catenin signaling pathway (27). TTN‑AS1 enhanced miR‑376a‑3p inhibited cell proliferation and metastasis in breast lung cancer progression by regulating the PTEN/PI3K/AKT cancer by targeting neuropillin‑1 NR (39). Other tumor‑related signaling pathway (28). TTN‑AS1 upregulation was revealed to genes, which were regulated by miR‑376a‑3p, included c‑Myc drive gastric cancer progression by targeting miR‑376b‑3p (29). in lung cancer, IGF‑1 in melanoma and H3K9 hepatocellular Additionally, TTN‑AS1 was reported to promote the prolifera- carcinoma (37,40,41). Thus, we predicted the target genes of tion of esophageal squamous cell carcinoma, cervical cancer miR‑376a‑3p by TargetScan and focused on PUM2. We were and papillary thyroid cancer (18,19,30). In the present study, the interested in PUM2 for the following three reasons: Firstly, upregulated expression levels of TTN‑AS1 in EC tissues was PUM2 ranked third among the numerous predicted genes, which first assessed. Consistently, the TTN‑AS1 expression was also indicated it was more likely to be the real target gene. Secondly, observed to be highly expressed in EC cell lines, compared the predicted top 5 miRNAs were verified by luciferase reporter with that in normal endometrial cells. Moreover, high levels activity assay, and 3 miRNAs including PUM2 were revealed of TTN‑AS1 were revealed to be associated with poor clini- to be downregulated by miR‑376a‑3p. Thirdly, PUM2 was copathological characteristics and survival rate. Furthermore, reported to promote cell proliferation and metastasis in several functional experiments demonstrated that knockdown of cancer types (38,42). However, the other 2 miRNAs were not TTN‑AS1 suppressed EC cell proliferation both in vitro and reported to be involved in cancer pathology and were therefore in vivo. In addition, TTN‑AS1 knockdown inhibited the migra- not selected. PUM2, is an RNA binding protein. Approximately tion and invasion of EC cells. These observations indicated 1,000 different mRNAs were identified containing the core that TTN‑AS1 may play an oncogenic role in EC progression. PUM2 binding motif, which indicated that PUM2 acted as Subsequently, the mechanisms of TTN‑AS1‑regulated EC a regulator in a wide range of areas, including cell prolifera- progression were explored. A previous review study revealed tion (43). Zhang et al revealed that PUM2 could downregulate that lncRNAs exert effects by sponging corresponding hundreds of mRNAs by binding with their 3'UTRs, thus regu- microRNAs (31). In the present study, 16 miRNAs were lating cell proliferation, differentiation and invasion (44). PUM2 predicted as potential targets of TTN‑AS1 by StarBase software, enhanced the stemness of breast cancer cells by interacting with and miR‑376a‑3p was selected for further study. miR‑376a‑3p NRP‑1 (38). Knockdown of PUM2 suppressed the proliferation instead of other potential targets was selected for the following and invasion of glioblastoma cells by regulating BTG1 expres- two reasons: Firstly, the predicted top 10 miRNAs were veri- sion (42). Moreover, PUM2 has also been revealed to be involved fied by luciferase reporter activity assay, and it was revealed in the progression of osteosarcoma (45). However, the role of that 6 miRNAs including miR‑376a‑3p were significantly PUM2 in EC has not been demonstrated. In the present study, regulated by TTN‑AS1. Secondly, miR‑376a‑3p has been iden- evidence was provided that PUM2 was a target of miR‑376a‑3p tified as a tumor suppressor in a series of cancer types (32‑34). using TargetScan and luciferase reporter assay. Furthermore, However, the other 5 miRNAs have not been reported to be qPCR revealed that PUM2 was positively associated with related in the development of multiple cancer types. Based TTN‑AS1 in EC tissues. Additionally, TTN‑AS1 could posi- on these aforementioned reasons, miR‑376a‑3p was selected tively regulate PUM2 via miR‑376a‑3p, indicating the involved for investigation. As an important miRNA, miR‑376a‑3p has mechanism of the TTN‑AS1/miR‑376a‑3p/PUM2 axis. been revealed to function as a tumor suppressor in renal tumor In the present study, the upregulation of TTN‑AS1 in EC development by targeting SGK3 (32). miR‑376a‑3p was lowly tissues was demonstrated and the oncogenic effects of TTN‑AS1 expressed in osteosarcoma cell lines, and inhibited cell prolif- on EC cell proliferation, migration and invasion were studied. eration and invasion by silencing FBXO11 expression (34). With the help of informatics tools, miR‑376a‑3p was revealed Serum miR‑376a‑3p expression was revealed to be markedly to be targeted by TTN‑AS1 and this was confirmed via RIP higher in ovarian cancer patients in comparison with that in assay. In addition, miR‑376a‑3p was revealed to target PUM2 healthy ones, and miR‑376‑3p was identified as a biomarker using TargetScan. Therefore, it was speculated that TTN‑AS1 of ovarian cancer diagnosis and treatment (33). In addition, may promote the development of EC by upregulating PUM2 overexpression of miR‑376a‑3p could aggravate tumor devel- via sponging of miR‑376a‑3p. opment in prostate cancer, giant cell tumor of bone, melanoma In summary, the present study demonstrated that and breast cancer (35‑38). Although the tumor suppressive TTN‑AS1 was overexpressed and acted as an oncogene in EC. effects of miR‑376a‑3p have been reported in multiple cancers, TTN‑AS1 could upregulate PUM2 expression via sponging the role of miR‑376a‑3p in EC has not been explored. In the of miR‑376a‑3p, thus promoting EC progression. This finding present study, it was revealed that TTN‑AS1 acted as a ceRNA may provide a novel approach for EC therapy. for miR‑376a‑3p, and TTN‑AS1 was negatively correlated with miR‑376a‑3p in EC tissues. Moreover, it was observed that Acknowledgements miR‑376a‑3p was lowly expressed in EC tissues, compared with that in adjacent non‑cancer tissues. Thus, it was speculated Not applicable. ONCOLOGY REPORTS 44: 1343-1354, 2020 1353

Funding 9. Iorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Casalini P, Taccioli C, Volinia S, Liu CG, Alder H, et al: MicroRNA signa- tures in human ovarian cancer. Cancer Res 67: 8699‑8707, 2007. The present study was supported by the QuanZhou Municipal 10. Yonemori K, Kurahara H, Maemura K and Natsugoe S: Science and Technology Plan Project (grant no. 2018Z058). MicroRNA in pancreatic cancer. J Hum Genet 62: 33‑40, 2017. 11. Stope MB, Koensgen D, Weimer J, Paditz M, Burchardt M, Bauerschlag D and Mustea A: The future therapy of endome- Availability of data and materials trial cancer: microRNA's functionality, capability, and putative clinical application. Arch Gynecol Obstet 294: 889‑895, 2016. The datasets used during the present study are available from 12. Dong P, Xiong Y, Yue J, Xu D, Ihira K, Konno Y, Kobayashi N, Todo Y and Watari H: Long noncoding RNA NEAT1 drives the corresponding author upon reasonable request. aggressive endometrial cancer progression via miR‑361‑regulated networks involving STAT3 and tumor microenvironment‑related Authors' contributions genes. J Exp Clin Cancer Res 38: 295, 2019. 13. Lv Y, Chen S, Wu J, Lin R, Zhou L, Chen G, Chen H and Ke Y: Upregulation of long non‑coding RNA OGFRP1 facilitates AL designed the whole research and revised the manuscript. endometrial cancer by regulating miR‑124‑3p/SIRT1 axis and LDS and YW performed the experiments and wrote the draft by activating PI3K/AKT/GSK‑3β pathway. Artif Cells Nanomed Biotechnol 47: 2083‑2090, 2019. manuscript. LL, LYS, QJ and QL analyzed the experimental 14. Tian Y, Chen YY and Han AL: MiR‑1271 inhibits cell prolifera- results. ZW and LY analyzed the sequencing data and devel- tion and metastasis by targeting LDHA in endometrial cancer. oped analysis tools. XZ assisted with the Illumina sequencing. Eur Rev Med Pharmacol Sci 23: 5648‑5656, 2019. 15. He Z, Xu H, Meng Y and Kuang Y: miR‑944 acts as a prognostic All authors read and approved the manuscript and agree to be marker and promotes the tumor progression in endometrial accountable for all aspects of the research in ensuring that the cancer. Biomed Pharmacother 88: 902‑910, 2017. accuracy or integrity of any part of the work are appropriately 16. Jin C and Liang R: miR‑205 promotes epithelial‑mesenchymal transition by targeting AKT signaling in endometrial cancer investigated and resolved. cells. J Obstet Gynaecol Res 41: 1653‑1660, 2015. 17. Li BL, Lu C, Lu W, Yang TT, Qu J, Hong X and Wan XP: Ethics approval and consent to participate miR‑130b is an EMT‑related microRNA that targets DICER1 for aggression in endometrial cancer. Med Oncol 30: 484, 2013. 18. Lin C, Zhang S, Wang Y, Wang Y, Nice E, Guo C, Zhang E, Yu L, Informed written consent was obtained from all the patients. Li M, Liu C, et al: Functional role of a novel long noncoding The protocol for the use of human samples of this study RNA TTN‑AS1 in esophageal squamous cell carcinoma progres- was approved by the Ethics Committee of Quanzhou First sion and metastasis. Clin Cancer Res 24: 486‑498, 2018. 19. Cui Z, Luo Z, Lin Z, Shi L, Hong Y and Yan C: Long non‑coding Hospital Affiliated to Fujian Medical University. The protocol RNA TTN‑AS1 facilitates tumorigenesis of papillary thyroid involving the use of animals was authorized by the Ethics cancer through modulating the miR‑153‑3p/ZNRF2 axis. J Gene Committee of Quanzhou First Hospital Affiliated to Fujian Med 21: e3083, 2019. 20. Luo JF, Xu J and Zheng JZ: Long non‑coding RNA TTN‑AS1 Medical University. promotes cell proliferation and inhibits cell apoptosis in pros- tatic cancer by sponging miR‑193a‑5p. Eur Rev Med Pharmacol Patient consent for publication Sci 23: 7816‑7825, 2019. 21. Wang H, Meng F, Zhang B, Jiang P, Hu M, Yu X and Cao H: Long non‑coding RNA TTN‑AS1 aggravates carcinogenesis Not applicable. through Wnt/β‑catenin signaling pathway by sponging miR‑1271 in hepatocellular carcinoma. Minerva Med: Jul 9, 2019 (Epub ahead of print). Competing interests 22. Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real‑time quantitative PCR and the 2(‑Delta Delta The authors declare that they have no competing interests. C(T)) method. Methods 25: 402‑408, 2001. 23. Li JH, Liu S, Zhou H, Qu LH and Yang JH: starBase v2.0: Decoding miRNA‑ceRNA, miRNA‑ncRNA and protein‑RNA References interaction networks from large‑scale CLIP‑Seq data. Nucleic Acids Res 42 (Database issue): D92‑D97, 2014. 1. Siegel RL, Miller KD and Jemal A: Cancer statistics, 2018. CA 24. Zhang L, Wang DL and Yu P: LncRNA H19 regulates the Cancer J Clin 68: 7‑30, 2018. expression of its target gene HOXA10 in endometrial carcinoma 2. Matsuo K, Ramzan AA, Gualtieri MR, Mhawech‑Fauceglia P, through competing with miR‑612. Eur Rev Med Pharmacol Machida H, Moeini A, Dancz CE, Ueda Y and Roman LD: Sci 22: 4820‑4827, 2018. Prediction of concurrent endometrial carcinoma in women 25. Wang L, Zhao S and Mingxin YU: LncRNA NR2F1‑AS1 is with endometrial hyperplasia. Gynecol Oncol 139: 261‑267, involved in the progression of endometrial cancer by sponging 2015. miR‑363 to target SOX4. Pharmazie 74: 295‑300, 2019. 3. Nagano T and Fraser P: No‑nonsense functions for long 26. Yu J, Jiang L, Gao Y, Sun Q, Liu B, Hu Y and Han X: LncRNA noncoding RNAs. Cell 145: 178‑181, 2011. CCAT1 negatively regulates miR‑181a‑5p to promote endo- 4. Rafiee A, Riazi‑Rad F, Havaskary M and Nuri F: Long noncoding metrial carcinoma cell proliferation and migration. Exp Ther RNAs: Regulation, function and cancer. Biotechnol Genet Eng Med 17: 4259‑4266, 2019. Rev 34: 153‑180, 2018. 27. Huang Y, Ni R, Wang J and Liu Y: Knockdown of lncRNA 5. Quinn JJ and Chang HY: Unique features of long non‑coding DLX6‑AS1 inhibits cell proliferation, migration and invasion RNA biogenesis and function. Nat Rev Genet 17: 47‑62, 2016. while promotes apoptosis by downregulating PRR11 expression 6. Ferlita A, Battaglia R, Andronico F, Caruso S, Cianci A, and upregulating miR‑144 in non‑small cell lung cancer. Biomed Purrello M and Pietro CD: Non‑coding RNAs in endometrial Pharmacother 109: 1851‑1859, 2019. physiopathology. Int J Mol Sci 19: 2120, 2018. 28. Luo J and Liu Z: Long non‑coding RNA TTN‑AS1 promotes 7. Dong P, Xiong Y, Yue J, Hanley SJB, Kobayashi N, Todo Y and the progression of lung adenocarcinoma by regulating Watari H: Exploring lncRNA‑mediated regulatory networks PTEN/PI3K/AKT signaling pathway. Biochem Biophys Res in endometrial cancer cells and the tumor microenvironment: Commun 514: 140‑147, 2019. Advances and challenges. Cancers (Basel) 11: 234, 2019. 29. Dong MM, Peng SJ, Yuan YN and Luo HP: LncRNA TTN‑AS1 8. Friedman JM and Jones PA: MicroRNAs: Critical mediators of contributes to gastric cancer progression by acting as a differentiation, development and disease. Swiss Med Wkly 139: competing endogenous RNA of miR‑376b‑3p. Neoplasma 66: 466‑472, 2009. 564‑575, 2019. 1354 SHEN et al: lncRNA TTN-AS1 PROMOTES ENDOMETRIAL CANCER

30. Chen P, Wang R, Yue Q and Hao M: Long non‑coding RNA 38. Zhang L, Chen Y, Li C, Liu J, Ren H, Li L, Zheng X, Wang H TTN‑AS1 promotes cell growth and metastasis in cervical and Han Z: RNA binding protein PUM2 promotes the stemness cancer via miR‑573/E2F3. Biochem Biophys Res Commun 503: of breast cancer cells via competitively binding to neuropilin‑1 2956‑2962, 2018. (NRP‑1) mRNA with miR‑376a. Biomed Pharmacother 114: 31. Chan JJ and Tay Y: Noncoding RNA:RNA regulatory networks 108772, 2019. in cancer. Int J Mol Sci 19: 1310, 2018. 39. Zhang L, Chen Y, Wang H, Zheng X, Li C and Han Z: miR‑376a 32. Fan XR, Zhang ZY, Wang RH, Li Y and Mao QZ: MiR‑376a inhibits breast cancer cell progression by targeting neuropilin‑1 functions as tumor suppressor by targeting SGK3 in renal cell NR. Onco Targets Ther 11: 5293‑5302, 2018. carcinoma. Eur Rev Med Pharmacol Sci 23: 3726‑3732, 2019. 40. Wang Y, Cong W, Wu G, Ju X, Li Z, Duan X, Wang X and 33. Yang L, Wei QM, Zhang XW, Sheng Q and Yan XT: MiR‑376a Gao H: MiR‑376a suppresses the proliferation and invasion of promotion of proliferation and metastases in ovarian cancer: non‑small‑cell lung cancer by targeting c‑Myc. Cell Biol Int 42: Potential role as a biomarker. Life Sci 173: 62‑67, 2017. 25‑33, 2018. 34. Xu Q, Cheng L, Chen J, Lu W and Wang P: miR‑376a inhibits the 41. Zheng Y, Chen H, Yin M, Ye X, Chen G, Zhou X, Yin L, proliferation and invasion of osteosarcoma by targeting FBXO11. Zhang C and Ding B: MiR‑376a and histone deacetylation 9 form Hum Cell 32: 390‑396, 2019. a regulatory circuitry in hepatocellular carcinoma. Cell Physiol 35. Formosa A, Markert EK, Lena AM, Italiano D, Finazzi‑Agro' E, Biochem 35: 729‑739, 2015. Levine AJ, Bernardini S, Garabadgiu AV, Melino G and Candi E: 42. Wang Y, Sun W, Yang J, Yang L, Li C, Liu H, Liu X and Jiao B: MicroRNAs, miR‑154, miR‑299‑5p, miR‑376a, miR‑376c, PUM2 promotes glioblastoma cell proliferation and migration via miR‑377, miR‑381, miR‑487b, miR‑485‑3p, miR‑495 and repressing BTG1 expression. Cell Struct Funct 44: 29‑39, 2019. miR‑654‑3p, mapped to the 14q32.31 locus, regulate prolif- 43. Galgano A, Forrer M, Jaskiewicz L, Kanitz A, Zavolan M and eration, apoptosis, migration and invasion in metastatic prostate Gerber AP: Comparative analysis of mRNA targets for human cancer cells. Oncogene 33: 5173‑5182, 2014. PUF‑family proteins suggests extensive interaction with the 36. Herr I, Sähr H, Zhao Z, Yin L, Omlor G, Lehner B and miRNA regulatory system. PLoS One 3: e3164, 2008. Fellenberg J: MiR‑127 and miR‑376a act as tumor suppressors by 44. Zhang M, Chen D, Xia J, Han W, Cui X, Neuenkirchen N, in vivo targeting of COA1 and PDIA6 in giant cell tumor of bone. Hermes G, Sestan N and Lin H: Post‑transcriptional regulation Cancer Lett 409: 49‑55, 2017. of mouse neurogenesis by Pumilio proteins. Genes Dev 31: 37. Zehavi L, Avraham R, Barzilai A, Bar‑Ilan D, Navon R, Sidi Y, 1354‑1369, 2017. Avni D and Leibowitz‑Amit R: Silencing of a large microRNA 45. Hu R, Zhu X, Chen C, Xu R, Li Y and Xu W: RNA‑binding cluster on human chromosome 14q32 in melanoma: Biological protein PUM2 suppresses osteosarcoma progression via partly effects of mir‑376a and mir‑376c on insulin growth factor 1 and competitively binding to STARD13 3'UTR with miRNAs. receptor. Mol Cancer 11: 44, 2012. Cell Prolif 51: e12508, 2018.

This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0) License.