------
Diss. ETH No. 14543
COMPARISON OF THE TWO FUNCTIONAL GENE
CLUSTERS FOR DEGRADATION OF CHLOROCATECHOLS
PRESENT ON PLASMID P JP4 IN R. eutropha JMP134
A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH for the degree of DOCTOR OF NATURAL SCIENCES
presented by CAROLINE MA YA LAEMMLI Dipl. Natw. ETH Zurich born May 11, 1971 citizen of Winznau (Solothum)
accepted on the recommendation of Prof. Dr. A. J.B. Zehnder, examiner Prof. Dr. W. Reineke, co-examiner Dr. J. R. van der Meer, co-examiner
February, 2002 MERCI! Je remercie de tout coeur toutes les personnes qui, d'une maniere ou d'une autre, ont contribue a la realisation de ce doctorat et qui ont permis cette experience d'etre fructueuse et agreable. En particulier j'aimerais remercier Jan Roelof pour m'avoir supervise tout au long de ces quatres annees. C'est avec son grand devouement pour son travail, ses bonnes idees et son enthousiasme pour le monde des bacteries qu'il m'a profondement impressionnee et motivee. Un grand merci aussi a Sascha Zehnder pour son support et les inoubliables "beaujolais nouveau parties". J'aimerais remercier Walter Reineke pour avoir ete mon co- examinateur et pour les quatres jours enrichissants passes aWuppertal. Je remercie aussi Michael Schlomann et Ursula Schell pour m'avoir permi de profiter de leur experience dans la preparation des extraits cellulaires et dans les essais enzymatiques qui ont ete essentiels amon travail. Je remercie non seulement le departement de microbiologie de l'EAWAG pour l'ambiance de travail agreable et les chouettes pauses cafe, mais aussi celui de chimie et d'informatique qui ont ete indispensables a la reussite de ce travail. Je remercie Marc Suter et particulierement Rene Schonenberger pour les analyses de mes echantillons au HPLC et au MS, tout comme Raoul Schaffner et Philippe Perisset pour leur support informatique. Merci Raoul aussi pour ta patience lors de la production de "A case for all". Mais c 'est surtout avec le groupe de Jan Roel of que j 'ai passe le plus de temps. Merci Christoph pour ton aide a tout moment et les hons rires. Merci Roald et Kirsten pour avoir partage le labo avec moi. Et merci Vladimir pour avoir ete mon partenaire de danse. Tina, je te remercie de tout coeur pour ton amitie qui j'espere durera encore longtemps, pour les bonnes rigolades, les discussions et ta comprehension. TABLE OF CONTENTS
SUMMARY I
ZUSAMMENFASSUNG IV
CHAPTER 1 1
GENERAL INTRODUCTION
CHAPTER2 26
CHARACTERIZATION OF A SECOND TFD GENE CLUSTER FOR CHLOROPHENOL
AND CHLOROCA TECHOL METABOLISM ON PLASMID P JP4 IN RALSTON/A
EUTROPHA JMP134 (PJP4)
CHAPTER3 53
TFDDn, ONE OF THE TWO CHLOROMUCONATE CYCLOISOMERASES OF
RALSTON/A EUTROPHA JMP134 (PJP4), IS A BOTTLENECK IN CONVERSION
OF 3-CHLOROCATECHOL AND EFFICIENT 3-CHLOROBENZOATE METABOLISM
CHAPTER4 85
ROLE OF THE TWO GENE CLUSTERS FOR CHLOROCATECHOL METABOLISM,
TFD1 AND TFD11 , OF R. EUTROPHA JMP134 (PJP4) DURING GROWTH ON 2,4-
DICHLOROPHENOXY ACETIC ACID
CHAPTERS 116
CONCLUDING REMARKS AND OUTLOOK
REFERENCES 121
CURRICULUM VITAE 137 SUMMARY Ralstonia eutropha JMPI34 (pJP4) was used to study evolutionary mechanisms of formation of chlorocatechol pathways. This strain has adapted to use the herbicides 2,4-dichlorophenoxyacetic acid (2,4-D) and 2-methyl-4-chloro-1-phenoxyacetic acid (MCPA) as sole carbon and energy source. The chloroaromatic substrates are metabolized through a chlorocatechol pathway, which is a modification of the regular ortho- cleavage pathway. Interestingly, R. eutropha JMP134 harbors two sets of homologous genes encoding chlorocatechol and chlorophenol degrading enzymes (i.e., tfdCDEF and tfdB, and tfdD1,C11E 11F Tl and tfdB11). The tfdD11CTlE11F11 and tfdB11 genes, which is part of a transposable element, were acquired during a recent evolutionary process. In order to study the possible selective advantages for this gene acquisition, we focused on characterizing and identifying the function of these genes.
Chapter 2 describes the identification of the tfdD1,CuEuFu and tfdB11 genes within the 5.9-kb region between the tfdR and tfdK genes on plasmid pJP4.
The percentage of identity among the peptides encoded by the tfd11 cluster and their counterparts in the tfd1 cluster is relatively low (15 to 62 % at amino acid level). By overexpression of each individual ORF in
Escherichia coli it could be confirmed that tfdD 11 codes for a chloromuconate cycloisomerase, tfdC11 for a chlorocatechol 1,2- dioxygenase, tfdEu for a dienelactone hydrolase, tfdFu for a maleylacetate reductase and tfdB11 for a chlorophenol hydroxy lase. Dot blot hybridizations and primer extension analysis of mRNA isolated from R. eutropha
JMP134, revealed that the tfdD1,CuEuF11 and tfdBu genes are all expressed upon induction with 2,4-D and transcribed as one single transcript.
I Analysis of the role of the tfdCDEF and tfdDuCuE11F11 genes during growth on 3-chlorobenzoate (3-CBA) (Chapter 3) revealed differences between the counterparts. R. eutropha containing the tfdDuCuE1/?u cluster alone or hybrid clusters with tfdDu as sole chloromuconate cycloisomerase was impaired in growth on 3-CBA. Spectral conversion assays with cell extracts from these strains showed accumulation of a compound with a similar UV spectrum as 2-chloromuconate from 3-chlorocatechol, whereas no accumulation was observed for conversion of 4-chlorocatechol.
Furthermore, enzyme activities for TfdD11 and TfdEn were very low and relatively high for TfdFn in R. eutropha induced with 3-CBA. LC/MS analysis of in vitro assays, in which each individual step in 3-chloro- and 4- chlorocatechol conversion was reproduced by sequentially adding cell extracts of E. coli expressing one Tfd enzyme only, demonstrated that
TfdD11 is unable to convert 2-chloromuconate. From these results we concluded that TfdD11 is a bottleneck in conversion of 3-chlorocatechol and therefore in efficient metabolism of 3-CBA.
The role of the tfdCDEF and tjdD11C"E"Fn genes with respect to 2,4-D and MCPA degradation was studied in Chapter 4. For this purpose, the genes tfdD, tfdE, tfdF and tfdDu were individually inactivated in the wild-type strain JMP134 by the insertion of a kanamycin gene. The growth behaviour of these mutants on 2,4-D, MCPA and 3-CBA was determined and the results allowed us to categorize the inactivated genes with respect to their function into essential, not essential or redundant. To our surprise, tfdE turned out to be the most essential gene of the set. Inactivation of tfdE abolished growth completely on all three substrates tested (2,4-D, 3-CBA and MCPA). We found evidence that the tfdE" gene is transcribed but not translated in R. eutropha JMP134. tfdD was also essential, but only for growth on 3-CBA (as shown in Chapter 3). Mutation of tfdD still allowed
II growth on 2,4-D and MCPA, since the tfdDll gene product was sufficient to overcome the lack of TfdD. The tfdF gene was non-essential for growth on 2,4-D and MCPA and even redundant for growth on 3-CBA. The least essential gene seemed to be tfdDu- It was redundant for growth on 2,4-D and 3-CBA and not essential for MCP A. The results obtained in the present study have helped to elucidate subtle functional differences in the role of the tfdCDEF and tfdDuC"E11Fu genes. However, the observed differences mostly argue against a selective advantage of keeping the tfdu cluster. Although we could not obtain a tfdFu knockout, we speculate that the genes of the tjd1 cluster (together with tfdA and tfdB) are sufficient to allow growth on 3-CBA, 2,4-D and MCPA
(except for a slight growth enhancement when tfdD11 is present). Finally, we conclude that the reason for keeping the configuration of two tfd clusters mostly lies in a selective disadvantage upon its deletion. Deletion (through the easiest recombination between the ends of the IS-elements) would result in loss of the regulatory genes, which is probably far worse for effective chloroaromatic degradation.
III ZUSAMMENFASSUNG Anhand von Ralstonia eutropha JMP134 (pJP4) wurden die evolutionaren Mechanismen, welche zur Bildung der Abbauwege filr Chlorocatechol gefiihrt haben, studiert. Dieser Stamm kann die zwei Herbizide 2,4- Dichlorophenox yessig sa ure (2,4-D) und 2-Methyl-4-Chloro- Phenoxyessigsaure (MCPA) als einzige Kohlenstoff- und Energiequelle verwenden. 2,4-D und MCPA werden in Chlorocatechole umgewandelt, die anschliessend via den modifizierten ortho-cleavage Abbauweg metabolisiert werden. R. eutropha JMP134 besitzt interessanterweise zwei
Kluster homologer Gene (tfdCDEF-tfdB und tfdD11C11EuF1rtfdB11), die filr chlorocatechol- und chlorophenol-abbauende Enzyme kodieren. Wir haben festgestellt, dass die tfdD11C11E11F11 und tfdB11 Gene auf einem Transposon liegen und durch einen evolutionaren Prozess erworben wurden. Daraus ergibt sich die Frage, wieso diese zwei homologen Genkluster zusammengebracht worden sind? Um die Vorteile dieser Konfiguration zu studieren, haben wir gezielt die Gene charakterisiert und ihre Funktion analysiert.
Die tfdD11CuE11Fu und t/dBu Gene wurden auf pJP4 in der 5.9-kb Region zwischen tfdR und tfdK lokalisiert. Obwohl die Homologie zwischen den entsprechenden Genen der zwei Kluster relativ tief ist (15-62% auf Ebene der Aminosaure), konnten die folgenden Funktionen IV tfdBu Gene alle durch Induktion mit 2,4-D exprimiert und als ein Transkript transkribiert werden. Die Rolle der tfdCDEF und tfdDuCuEnFn Gene beim Wachstum auf 3- Chlorobenzoesiiure (3-CBA) wurde untersucht und es stellte sich heraus, dass Unterschiede zwischen den homologen Genen existieren. So ist die Expression des tfdDuCuEnFn Klusters allein, oder desjenigen Hybrid Klusters, der tfdDu als einzige Chloromuconate Cycloisomerase enthiilt, nicht ausreichend for das Wachstum von R. eutropha auf 3-CBA. Weiter wurde bei der Umwandlung von 3-Chlorocatechol mit Zellextrakten dieser Stiimme ein UV Spektrum beobachtet, das iihnlich zu demjenigen von 2- Chloromuconat war. Im Gegensatz dazu konnte bei der Umwandlung von 4-Chlorocatechol keine solche Akkumulation beobachtet werden. Diese Zellextrakte zeigten sehr tiefe Enzymaktivitiiten von TfdDn und TfdE11 , wogegen die Aktivitat von TfdFn relativ hoch war. Wenn E. coli Zellextrakte kombiniert wurden, welche jeweils nur ein Tfd Enzym exprimierten, konnte jeder Schritt im Abbau von 3-Chloro- und 4- Chlorocatechol ausgefiihrt werden. Diese in vitro Assays wurden im LC/MS analysiert und es stellte sich heraus, dass TfdDn 2-Chloromuconat nicht umwandeln kann. Aufgrund dieser Resultate schliessen wir, dass TfdDn zu einem Stau im Metabolismus von 3-Chlorocatechol fiihrt und dadurch eine effiziente Umwandlung von 3-CBA nicht erlaubt. Weiter wurde auch die Rolle der tfdCDEF und tfdD1j;uEnFn Gene im Abbau von 2,4-D und MCPA studiert. Zu diesem Zweck wurden die Gene tfdD, tfdE, tfdF und tfdDu einzeln im Wildtyp R. eutropha JMP134 inaktiviert, indem ein Kanamycin-Gen eingefilgt wurde. Das Wachstumsverhalten der Mutanten auf 2,4-D, MCPA und 3-CBA wurde untersucht und erlaubte die Einteilung der inaktivierten Gene aufgrund ihrer Funktion in essentielle, nicht essentielle und iiberfliissige Gene. v Zusammengefasst wurde gezeigt, dass tfdE das wichtigste Gen ist. 1st es inaktiviert, ist das Wachstum auf den drei getesteten Substraten (2,4-D, MCPA und 3-CBA) unmoglich. Wir vermuten daher, dass tfdEu in R. eutropha nicht korrekt transkribiert wird. Fiir W achstum auf 3-CBA ist tfdD ebenfalls essentiell, nicht aber fiir das Wachstum auf 2,4-D und MCPA. Das tfdF Gen ist auch nicht essentiell fiir das Wachstum auf 2,4-D und MCPA und sogar iiberfliissig fur das Wachstum auf 3-CBA. Das ,,unwichtigste" Gen ist tfdDu, da es iiberfliissig ist fiir das Wachstum auf 2,4-D und 3-CBA und nicht essentiell fiir MCPA. Die Resultate dieser Studie haben dazu beigetragen, die subtilen Unterschiede in der Rolle der tfdCDEF und tfdDIICuEuF11 Gene herauszufinden. Zusammengefasst konnen wir sagen, VI CHAPTER! General introduction Only two hundred years ago, it was still believed that the world's living organisms do not change (evolve) over time (Keeton and Gould 1993). But evidence was found that changes appear constantly in a process called evolution. The main driving force for evolution, as proposed by Charles Darwin (1809-1882) is "natural selection". In other words "the fittest individuum survives". His theory remains valid today and predicts that organisms with new characteristics are selected under changing environmental conditions. Although 'natural selection' is the driving force for those organisms, the essential basis of the evolutionary hypothesis is the continuous occurrence of spontaneous or induced genetic changes in the hereditary material of organisms. This creates pools of genetic variations from which novel characteristics can be selected. Unknown to Darwin at the time, but more recently discovered, it is now assumed that genetic changes are created by various cellular processes such as DNA replication errors, recombination and transposition events and that DNA can even travel between species by conjugation, transformation and transfection processes (van der Meer, et al. 1992; van der Meer 1997). Unfortunately, though, evolution is a relatively slow process and difficult to discern in organisms with generation times of years (like most vertebrates). It is therefore more apropriate to study evolutionary processes in organisms with very short generation times, such as microorganisms. Many studies in the past twenty years or so have indeed been able to demonstrate the fast evolutionary response (i.e., timescale of a few years) of microorganisms to changing conditions. Although 'changing conditions' and consequently a selective pressure for microorganisms in the laboratory can be achieved easily, several studies also pointed out that, unwillingly, mankind has created new selective conditions for microorganisms in the 2 environment. Such conditions are, for example, the use of antibiotics in human and animal health, and the widespread release of synthetic chemicals into the environment. The types of changing conditions posed by the usage of synthetic chemicals are basically twofold: (i) many chemicals are toxic, and, therefore, organisms are selected which have acquired better resistance mechanisms and (ii) synthetic chemicals present a useful (in many cases unique) carbon, nitrogen and/or energy source for those microorganisms, which have acquired the capability to degrade them most efficiently. Indeed, careful observations have revealed that microbial communities can adapt to metabolizing synthetic chemicals introduced by humans into the environment. Such examples included adaptation to chloro- and nitrobenzenes, to chlorinated herbicides and to atrazine. Isolation of 'adapted' bacteria, mostly from contaminated sites in the environment directly, showed that the adaptational changes, which were necessary in order to metabolize a compound, were often visible in the genetic constitution of the organism. In many cases, mobile DNA elements were associated with the gene clusters encoding the metabolic pathways for degradation of the synthetic compounds and individual member genes of such clusters displayed different genetic lineages. This suggested that horizontal gene transfer played an important role for adaptation, as it provided a mechanism to bring together gene fragments from different organisms into one new host. One of such adapted organisms is the bacterial strain Ralstonia eutropha JMP134 (pJP4). This strain is capable of using the herbicides 2,4- dichlorophenoxyacetic acid (2,4-D) and 2-methyl-4-chloro-1- phenoxyacetic acid (MCP A) as sole carbon and energy sources. As we will present in this thesis, the organization of the genes involved in the 3 metabolism of 2,4-D (located on plasmid pJP4) gives several hints indicating that the genes were assembled together in a recent evolutionary process. In this introductory chapter, some strategies used by microorganisms for genetic adaptation will be discussed with focus on the ortho-cleavage pathway, since its involvement in degradation of aromatic compounds is undebatable. In addition, the genetics and the biochemistry of 2,4-D metabolism by the organism used in this study, R. eutropha JMP134 (pJP4), will be summarized. The problematic of 2,4-D, its mode of action, its application and as well as some examples of other 2,4-D degraders will be presented. Finally, the aim of this thesis will be described. EVOLUTION OF METABOLIC PATHWAYS "The strategy" of microbial evolution becomes evident by comparing the gene sequences and organizations for different metabolic pathways. Clusters of similar genes (sometimes called gene cassettes) seem to become rearranged and combined with gene functions from other organisms to form clusters encoding new variants of metabolic pathways. When looking at the diversity of pathways in microorganisms capable of using aromatic substrates, one often sees the use of a central pathway (for example, for catechol degradation) common to most organisms, but in combination with different so-called peripheral upper pathways (such as, aromatic ring dioxygenases or monooxygenases). Examples of central (lower) pathways are the ortho-cleavage, the gentisate, the meta-cleavage (Dagley 1986), or the modified ortho-cleavage pathway (Schlomann 1994). The products of the lower pathways are acetate, acetylaldehyde, succinate and pyruvate. These are further metabolized in a metabolic pathway, such as the tricarboxylic acid cycle. Organisms expressing more than one 'upper 4 pathway' can channel different substrates into one common central metabolic pathway. Also, different microbes may carry different peripheral pathways (for a common substrate), yet the same lower pathway. Comparisons of gene sequences and gene structures for such peripheral and lower pathways between different microorganisms suggested that new peripheral (upper) pathways have arisen more often than the central ones. The degradation pathway of the herbicide 2,4-dichlorophenoxyacetic acid used by R. eutropha JMP134 is an example of a pathway composed of a peripheral part and a central part. In the peripheral part, 2,4-D is transformed to 3,5-dichlorocatechol by a dioxygenase and a hydroxylase. 3,5-Dichlorocatechol is then funneled through a modified ortho-cleavage pathway. THE MODIFIED ORTHO·CLEAV AGE PATHWAY The modified ortho-cleavage pathway refers to a pathway for chlorocatechol degradation that is similar but not identical to the widely distributed ortho-cleavage pathway among microorganisms degrading aromatic compounds (Harwood and Parales 1996). The four enzymes of the modified ortho-cleavage pathway consist of a chlorocatechol 1,2- dioxygenase, a chloromuconate cycloisomerase, a dienelactone hydrolase and a maleylacetate reductase. Two of the enzymes (chlorocatechol dioxygenase and chloromuconate cycloisomerase) are closely related to those of the normal ortho-cleavage pathway, but specifically convert chlorinated substrates more efficiently than the enzymes from the normal ortho-cleavage pathway (Harwood and Parales 1996). Both the modified and normal ortho-cleavage pathways convert at the point of 3-oxoadipate (or beta-ketoadipate). Very often bacteria which perform a modified ortho- cleavage pathway also express a normal ortho-cleavage pathway, since the 5 final two steps in the complete degradation of chlorinated catechols are catalyzed by the last two steps of the normal ortho-cleavage pathway (Fig. 1). H:DOHCl H~DOH H:VOHCl """" I """" I Cl """" I Catechol Chlorocatechol Chlorocatechol ~ 1,2-dioxygenase i 1,2-dioxygenase i 1.2-dtoxygenase Cl i (type I) (type II) (type II) HOOC HUOOCCl H~OOC ?:o"r COOH COOH 1 1 r:YCI ~ ::,,,,._ ::,,,,._ Cl I Muconate Chloromuconate Chloromuconate i-' cycloisomerase cycloisomerase cycloisomerase YCJ HOOC~O I Muconate 1-' isomerase HOOC\___. Fl (Chloro)maleylacctate Chlommaleylacetate y reductase reductase 0 90 Figure l Comparison of normal ortho- and modified ortho-cleavage pathways. Compound: A catechol, B 3-chlorocatechol, C 4-chlorocatechol, D 3,5- dichlorocatechol. 6 The first enzyme involved in the modified ortho-cleavage pathway, the chlorocatechol 1,2-dioxygenase (CC1,2D), is a ferric-iron containing enzyme, which catalyzes the incorporation of oxygen into chlorocatechol to form chloromuconates. The aromatic ring is thereby cleaved in ortho position. The percentage of amino acid sequence identity between the CC1,2D and the 'normal' Cl,2D is only between 25-35% (Nakai, et al. 1995). The next enzyme is the chloromuconate cycloisomerase, which catalyzes the dechlorination and formation of (chloro-) dienelactone from chloromuconates. The amino acid sequences of chloromuconate and muconate cycloisomerases display 40% amino acid identity (Harwood and Parales 1996). The chloro-dienelactone hydrolase catalyzes the conversion of dienelactone to maleylacetate. Finally, maleylacetate is reduced to oxoadipate by a maleylacetate reductase. In the case of chlorinated maleylacetate the reaction is performed in two steps: first a dechlorination to maleylacetate and second a reduction to oxoadipate. Both steps are catalyzed by the same enzyme maleylacetate reductase (Kaschabek and Reineke 1992; Muller, et al. 1996; Seibert, et al. 1993). No dienelactone hydrolase and maleylacetate reductase counterparts, with significant percentages of amino acid sequence identity, have been found in normal ortho cleavage pathways. Although the modified ortho-cleavage pathway is found in many bacteria capable of degrading chlorinated aromatic substrates, considerable variation is visible when the genetic organizations are compared among different microorganisms (Fig. 2). The strongest conservation is found between the regulatory genes, which encode LysR-type transcriptional regulators (McFall, et al. 1998), as for example ClcR (Parsek, et al. 1994), TfdR (Matrubutham and Harker 1994) and TcbR (Leveau, et al. 1994). The 7 inducer molecules are cis,cis-muconate and 2-chloro-cis, cis-muconate. In most cases, the gene order of regulatory gene and chlorocatechol 1,2- dioxygenase gene is conserved. On the contrary, the chloromuconate cycloisornerase, the dienelactone hydrolase and the rnaleylacetate reductase genes are not systematically found in the same order and combination. The 1 kb A B c D E F ~I G H I J Figure 2 Organization of gene clusters harboring genes encoding modified ortho- cleavage pathway enzymes in various bacteria. The arrows indicate the size and direction of transcription of genes. The boxes represent uncomplete open reading frames. r- chlorocatechol l,2-dioxygenase, chloromuconate cycloisomerase, • dienelactone hydrolase, a maleylacetate reductase. A. Burkholderia sp. NK8 (assession No AB050198), B. Variovorax paradoxus (AB028643), C. Delftia acidovorans MCI (AFl 76244), D. Burkholderia cepacia (AF029344), E. Rhodojerax sp. P230 (AF176243), F. Achromobacter xylosoxidans subsp. denitrificans (U32188), G. Ralstonia eutropha NH9 (ABOl 9032), H. Pseudomonas sp. strain P5 l (M57629), I. Pseudomonas putida (pAC27) (M16964, L06464), J. Ralstonia eutropha JMP134 (pJP4) (Ul6782, M35097). 8 most similar clusers are those of the clc, tfd and tcb genes, which are believed to have diverged from a common ancestral pathway already adapted to chlorocatechol catabolism (Eulberg, et al. 1998). Interestingly, R. eutropha JMP134 (pJP4) harbors two clusters encoding modified ortho- cleavage pathways. Both clusters encode the four enzymes of the modified ortho cleavage pathway, as well as a LysR-type regulator. RALSTON/A EUTROPHA JMP134 AND THE TFD·GENES R. eutropha JMP134 (pJP4) was isolated from an unspecific soil sample in Australia for its ability to use the herbicide 2,4-D as sole carbon and energy source. It was first described in 1979 by John M. Pemberton and his colleagues (Pemberton, et al. 1979). R. eutropha JMP134 (pJP4) was initially identified as a strain of Alcaligenes eutrophus, but its name was changed, as A. eutrophus was transferred to a new genus (Yabuuchi, et al. 1995). Apart from 2,4-D, R. eutropha JMP134 (pJP4) can metabolize other haloaromatic compounds such as 2-methylphenoxyacetic acid (2MPA), 4- chloro-2-methylphenoxyacetic acid (MCPA) (Pieper, et al. 1988), 3- chlorobenzoate (Pieper, et al. 1993), phenol (Leonard, et al. 1999), 2- chloro-5-nitrophenol (Schenzle, et al. 1999), 2,4-dichlorophenol (Koh, et al. 1997), 2,4,6-trichlorophenol (Padilla, et al. 2000), as well as trichloroethylene (TCE) (Harker and Kim 1990). R. eutropha JMP134 harbors the plasmid pJP4, which confers resistance to mercuric chloride, phenyl mercury acetate and merbromin and carries the tfd genes for 2,4-D degradation. pJP4 belongs to the IncP-~ incompatibility group (Don and Pemberton 1981; Smith and Thomas 1987) and is self- transmissible to various bacterial strains including Escherichia coli, Agrobacterium tumefaciens, Rhizobium sp., Pseudomonas putida, P. fluorescens, and Acinetobacter calcoaceticus (Don and Pemberton 1981). 9 A physical map of the 80-kb-sized pJP4 is available for the restriction enzymes BamHI, EcoRI, HindIII (Don and Pemberton 1985) and XbaI (You and Ghosal 1995). Fifteen genes, which are involved in the degradation of 2,4-D, have been identified within a 22-kb region on pJP4. These genes have been given the prefix tfd, which stands for 2,4-D (1wo- four-d). The genetic organization of the tfd genes and the degradation pathway of 2,4-D is depicted in Fig. 3. Since 1985 the tfd genes have been identified and studied one by one. Functions can be assigned today to all of them. The five genes tfdB, tfdC, tfdD, tfdE, tfdF were localized on pJP4 by transposon mutagenesis using Tn5 and Tnl 771 by Don et al. (Don, et al. 1985). The respective functions, which were assigned to the enzymes are a 2,4-dichlorophenol hydroxylase, a chlorocatechol 1,2-dioxygenase, a chloromuconate cycloisomerase and a dienelactone hydrolase. No function could be assigned to tfdF, although it was initially suggested that it might encode a trans-chlorodienelactone isomerase. The complete nucleotide sequence of tfdB and tjdCDEF was presented five years after their discovery by Perkins et al. (Perkins, et al. 1990). Strangely enough, the tfdu cluster (tfdD11CuE uF 11B u) was not identified with the transposon mutagenesis studies performed by Don et al. and no hints revealed its possible presence. The only hint had been the fact that inactivation of tfdF did not prevent strain JMP134 from growing on 2,4-D and 3-CBA, which suggested the presence of a second tfdF-like gene. tfdA was found by mutagenesis with transposon Tn5 only two years later (Streber, et al. 1987). It was supposed that tfdA encoded a 2,4-dichlorophenoxyacetate monooxygenase (Streber, et al. 1987; Perkins and Lurquin 1988) until 1993 when Fukumori and Hausinger 10 A I kb B OCH2CDO; a-ketoglutarate succinate 4-D Tfd OH Cl ~ Cl I # 2,4-DCP "o~:~:a FY'hi"t,~,,=(oY'o y y Hoo_-~ .. Cl Cl CDL Cl 2,4-DCM iTfdE(ll) succinate TfdF(ll) TfdF(ll) + +-- +-- acetyl-CoA er7 c;a ~0 0 0 3-0A 9MA CMA Figure 3 A Organization of the tfd genes on plasmid pJP4 of R. eutropha JMP134. Arrows indicate the sizes and orientations of all tfd genes currently known. The rectangle between tfdA and tfdS represents a remnant of IS-element ISJP4. B Degradation pathway of 2,4-D by the Tfd enzymes from R. eutropha JMP134 (pJP4). TfdA, a-ketoglutarate l ,2-dioxygenase, TfdB 11 overexpressed tjdA in E. coli and showed evidence that TfdA was in fact an a-ketoglutarate-dependent dioxygenase. TfdA could be purified and the complete enzymatic reaction was identified. The TfdA enzyme is ferrous- ion dependent, a-ketoglutarate is the preferred co-substrate among the a- ketoacids and the highest affinity and highest catalytic efficiency is obtained with 2,4-dichlorophenoxyacetate (Fukumori and Hausinger 1993a; Fukumori and Hausinger 1993b). During the reaction catalyzed by TfdA, 2,4-D is converted to 2,4-DCP and glyoxylate, and a-ketoglutarate is converted to succinate and carbon dioxide. The next genes to be discovered were the regulatory genes tjdR in 1989 (Harker, et al. 1989) and tfdS in 1990 (Kaphammer and Olsen 1990). It turned out that tjdR and tfdS were identical copies. Several contradicting reports proposing the involvement of TfdR and TfdS in regulation of the tfd genes were published. By now its known that TfdR is a LysR-type transcriptional activator, which binds upstream of tjdA, tjdD11 (Matrubutham and Harker 1994) and tfdC (Leveau and van der Meer 1996) and that all the tfd genes (except tfdR/tjdS) are expressed in concert upon 2,4-D induction (Leveau, et al. 1999). The inducer molecules were suggested to be the pathway intermediate 2,4-dichloromuconate (Filer and Harker 1997) or 2- chloromuconate (McFall, et al. 1998). The open reading frame of an original tfdT encoding another potential regulatory protein was suggested to be interrupted by insertion of the insertion element ISJP4 (since tjdT no longer encodes a functional regulatory protein). On the basis of its predicted amino acid sequence, TfdT is similar to the LysR-type regulators TcbR, ClcR and TfdR (Leveau and van der Meer 1996). The insertion element ISJP4 is 0.9-kb long and belongs to the IS5 group of the IS4 family of bacterial insertion elements (Leveau and van der Meer 1997). 12 Only one complete copy of ISJP4 exists on pJP4, but additionally a 71-bp duplication of the ISJP4 right-hand extremity is found in the tfdA-tfdS intergenic region. It could be shown that two complete copies of the ISJP4 as well as one copy plus its tfdA-tfdS intergenic remnant can mobilize a piece of DNA which they flank (Leveau and van der Meer 1997). Although preliminary evidence had been obtained that another set of genes for chlorocatechol degradation might be present ( Ghosal and You l 988a; Matrubutham and Harker 1994), it was only in 1997 that the 'missing' region on pJP4 carrying the tfdu-genes was sequenced. This showed that another set of six tfd genes (tjdDuCnEuFu tfdBu and tfdK) were present within the borders given by the ISJP4 transposable element. Sequence comparisons suggested that the two gene clusters were acquired from different origins, because the actual percentage of identical amino acids among the counterparts was rather low (15 to 62%) and the G + C content of the tjdDuCuE uFu genes was significantly higher than that of the tfdCDEF genes (Laemmli, et al. 2000). According to the current hypothesis, ISJP4 was involved in the transposition of the DNA region containing the tfd11 gene cluster into a region of pJP4 containing tfdT (Leveau and van der Meer 1997). The finding that the genes of the tfdu cluster encode functional modified ortho-cleavage pathway enzymes when expressed in E. coli (Laemmli, et al. 2000) and that all the tfd genes were expressed in R. eutropha JMP134 (pJP4) during growth on 2,4-D (Leveau, et al. 1999) led to the question as to why two genes clusters with identical functions existed within one strain. 13 STATE OF THE KNOWLEDGE ON THE CHLOROPHENOL DEGRADING ENZYMES OF PJP4 The 2,4-dichlorophenol hydroxylases (TfdBmi> Liu and Chapman were the first to purify a 2,4-dichlorophenol hydroxylase from strain JMP134, already in 1984 (Liu and Chapman 1984). The purification was later repeated by Farhana et al (Farhana and New 1997). They could demonstrate that the 2,4-dichlorophenol hydroxylase from strain JMP134 was the gene product of tfdB. The holo-hydroxylase enzyme is a homotetramer of TfdB subunits (Farhana and New 1997). The enzyme catalyzes the conversion of various chloro-, nitro- or fluorosubstituted phenols to the corresponding catechols and uses NAD(P)H as cofactor. tfdBmi has been described to encode a dichlorophenol hydroxylase (Laemmli, et al. 2000), but the enzyme has not been purified. The chlorocatechol 1,2-dioxygenases (TfdCull) The chlorocatechol 1,2-dioxygenases of pJP4 (TfdC0lJ) have never been purified, therefore the enzymatic properties including the substrate specificity have not been studied. But comparison of their predicted amino acid sequence with other chlorocatechol 1,2-dioxygenases allows clustering with TfdC11 of pJP4, ClcA of pAC27, TcbC of pP51, TfdC of pEST4011 (Eulberg, et al. 1998) and TfdCNKs from Burkholderia sp. strain NK8 (Liu, et al. 2001). Enzyme activities of the polypetides encoded from tfdC and tfdCu have been measured in E. coli for different mono- and dichlorocatechols (van der Meer, et al. 1991; Laemmli, et al. 2000). Both enzymes have the highest specific activity towards 3,5-dichlorocatechol. 14 The chloromuconate cycloisomerases (TfdD,11i) Probably three muconate cycloisomerizing enzymes exist in strain JMP134. One of these enzymes was induced during growth on benzoate and had high activity with cis,cis-muconate (Kuhm, et al. 1990). The second is induced during growth on 2,4-D, but has high activity with 2,4- dichloromuconate as substrate and very poor activity with cis,cis-muconate (Kuhm, et al. 1990). N-terminal sequencing of the purified protein with chloromuconate cycloisomerase activity revealed that it was identical to the predicted amino acid sequence of TfdD. The active chloromuconate cycloisomerase bolo-enzyme is composed of 6-8 TfdD subunits and 2 requires Mn + ions and thiol groups for activity (Kuhm, et al. 1990). The third chloromuconate cycloisomerase is encoded by the tfdDu gene. The enzyme has not been purified, but its activity could be demonstrated by overexpressing the tfdDu gene in E. coli. The enzyme showed higher activity with 2,4-dichloromuconate than 3-chloromuconate as substrate. Activity with 2-chloromuconate as substrate was low (Laemrnli, et al. 2000). The reaction mechanism of cycloisomerization has been studied in great detail and it could be established that several classes of muconate cycloisomerases exist which differ in type of product formation (Kuhm, et al. 1990; Vollmer, et al. 1994; Vollmer and Schlomann 1995; Vollmer, et al. 1998; Vollmer, et al. 1999; Kaulmann, et al. 2001). The first class is formed by the muconate cycloisomerases of gram-negative bacteria (such as from Pseudomonas putida PRS2000, Acinetobacter calcoaceticus ADPl or Pseudomonas sp. strain B 13). Muconate cycloisomerases (MCL1) normally catalyze isomerization of cis,cis-muconate to (4S)- muconolactone. When incubated with 2-chloro-cis,cis-muconate, this is 15 converted in a reversible reaction to mixtures of (+ )-2-chloro- and ( +)-5- chloromuconolactone by carrying out both 1,4- and 3,6- cycloisomerizations of the substrate (Vollmer, et al. 1994) (Fig. 4A). At equilibrium, both substrate (2-chloro-ds,cis-muconate) and products (+ )-5- chloromuconolactone and ( + )-2-chloromuconolactone are detectable (Vollmer, et al. 1994). The second class consists of the chloromuconate cycloisomerases (CMCL). Representatives of this class are the enzymes encoded by tfdD or clcB (Vollmer, et al. 1998). The chloromuconate cycloisomerases also first produce a mixture of (+)-2-chloro- and (+)-5- chloromuconolactone from 2-chloro-cis,cis-muconate (although they seem to favor the 3,6-cycloisomerization to (+)-5-chloromuconolactone), which, in contrast to muconate cycloisomerases, is followed by a dehalogenation of ( +)-5-chloromuconolactone to trans-dienelactone (Kuhm, et al. 1990; Vollmer and SchlOmann 1995) (Fig. 4A). The third class is exemplified by muconate cycloisomerases (MCLu) of the gram-positive bacterium Rhodococcus erythropolis strain lCP. Enzymes of this class convert 2- chloro-cis,cis-muconate to (+ )-5-chloromuconolactone as the only product and are unable to dehalogenate it to trans-dienelactone (Solyanikova, et al. 1995) (Fig. 4A). Differences between the classes of cycloisomerase exist as well with respect to 3-chloro-cis,cis-muconate convertion. Chloromuconate cycloisomerases convert 3-chloro-cis,cis-muconate to cis-dienelactone, while usual muconate cycloisomerases (class 1) transform the same substrate to the bacteriotoxic protoanemonin (Blasco, et al. 1995; Kaulmann, et al. 2001) (Fig. 4B). Analysis of the mechanism of chloride elimination from 3-chloro and 2,4-dichloro-cis,cis-muconate has shown that of chloride abstraction from the enol/enolate intermediate ((+)-4- 16 chloromuconolactone) is rate determinating (Fig. 4B). Chloride elimination must occur before protonation to form cis-dienelactone. Figure 4 Reactions catalyzed by muconate cycloisomerases (MCLI and MCLII) and chloromuconate cycloisomerases (CMCL) during metabolism of A 2-chloro-cis,cis- muconate, B 3-chloro-cis,cis-muconate. CMCL? indicates that for chloromuconate 17 cycloisomerases it is not clear whether cis-dienelactone is formed directly or via (+ )-4- chloromuconolactone as intermediate. The dienelactone hydrolases (TfdE(11) Dienelactone hydrolases catalyze the transformation of (chloro)dienelactones to (chloro)maleylacetates. They can also transform protoanemonin to cis-acetylacrylate (Fig. 5), as it has been shown for the dienelactone hydro lase from strain B 13 (Briickmann, et al. 1998). This reaction allows detoxification of protoanemonin. In contrast to chlorocatechol 1,2-dioxygenases and chloromuconate cycloisomerases, dienelactone hydrolases are rather dissimilar, they only share around 20% identity at amino acid level (Eulberg, et al. 1998). The maleylacetate reductases (TfdFull) Maleylacetate reductase activity was purified from strain JMP134. N- terminal sequencing of the purified protein revealed perfect identity to the gene product of the tfdFu gene, rather than tfdF (Seibert, et al. 1993). All attempts to purify TfdF directly from R. eutropha JMP134 failed. TfdFn showed broad substrate specificity. It reduces maleylacetate and various substituted maleylacetates with NADH as cofactor to 3-oxoadipate. With 2-chloromaleyacetate (or other halogenated maleylacetates at the 2 position), maleylacetate reductase seems to perform a double reduction (Seibert, et al. 1993; Muller, et al. 1996). In a first step the chloride is eliminated from 2-chloromaleyacetate to yield maleylacetate, which is then reduced again by maleylacetate reductase to oxoadipate (Kaschabek and Reineke 1995). This double reaction requires 2 mol of NADH per mol 2- chloromaleylacetate. Apart from TfdF and TfdF11 maleylacetate reductases, the existence of a chromosomally encoded maleylacetate has been reported (Kukor, et al. 1989). 18 0 HOOC~ 0 OH -+ H;Cy •• :£~ Oz 0 cis-acetylacrylate Figure 5 Conversion of protoanemonin by the dienelactone hydrolase of Pseudomonas sp. B 13. Under acidic conditions cis-acetylacrylate is present in a cyclic form (Brlickmann, 1998). 2,4-D AND 2,4-D DEGRADERS The selective herbicides 2,4-D and MCPA belong to the family ofphenoxy herbicides. 2,4-D was introduced on the market in 1946, and rapidly became the most widely used herbicide in the world. A selective herbicide is one that controls weeds in a crop without damaging that crop. The major uses of 2,4-D in agriculture are on wheat and small grains, sorghum, com, rice, sugar cane, low-till soybeans, rangeland, and pasture. It is also used on roadsides, non-crop areas, forestry, lawn and turf care, and on aquatic weeds. 2,4-D has a relatively short half-life: the average half-life in grass is 6 to 7 days and is rather immobile in the soil (The Industry Task Force II (http://www.24d.org). Thus, 2,4-D is considered a biodegradable compound. More recent studies confirmed that 2,4-D has moderate to low acute toxicity. The LD50 for rats ranges from 699 mg (2,4-D acid form) per kg of body weight to >1000 mg/kg for 2,4-D-ester and -amine formulations. From an LD50 standpoint, 2,4-D is less toxic than caffeine and slightly more toxic than Aspirin®. At the concentrations which occur in the environment, 2,4-D is highly unlikely to present a threat to wildlife. Subchronic effects are generally limited to those cases in which exposure 19 to very high doses occurs (The Industry Task Force II (http://www.24d.org). Bacteria capable of degrading 2,4-D have been isolated from 2,4-D contaminated sites around the world as well as from sites that had no prior history of 2,4-D application (Kamagata, et al. 1997). Table l gives a selection of 2,4-D degraders (this table is an updated version of Table 1.1 from Leveau 1998). In many strains the genes involved in 2,4-D metabolism are located on plasmids, which seems to facilitate the horizontal transfer of the tfd genes between microorganisms. In fact, plasmids with genes for 2,4-D degradation can even be captured from the environment by using specific recipient strains (Top, et al. 1995). Several studies have looked at the natural transfer rates of the pJP4 plasmid or other plasmids for 2,4-D degradation from the original host strain to other recipients (Newby, et al. 2000b; Neilson, et al. 1994; Friedrich, et al. 1983; DiGiovanni, et al. 1996; Top, et al. 1998; Newby, et al. 2000a; Top, et al. 1995), and the transfer can even be used to enhance 2,4-D degradation rates in soils where degradation activity is low (Dejonghe, et al. 2001). 2,4- D degrading genes are found with various degrees of similarity and are spread all around the world (Fulthorpe, et al. 1995; Vallaeys, et al. 1999). Table 1: A selection of 2,4-D degrading bacteria ISOLATE PLASMID2 GENES3 ORIGIN4 REFERENCE PROTEOBACTERIA a SUBDIVISION Rhodopseudornonas Ml A(B)G French Fulthorpe, et al. l 995 palustris Polynesia Sphingomonas K1443 pBS3 A(B)G Michigan, Holben, et al. 1992 paucirnobilis soil Sphingomonas sp. B6-5 ABG Ontario Pulthorpe, et al. 1995 Sphingomonas sp. EML146 A(B)C Oregon idem 20 Sphingomonas sp. B6-10 A8G Ontario idem Sphingomonas sp. TFD44 A(B)G Montana idem PROTEOBACTERIA ~SUBDIVISION Alcaligenes AXDI A(B) France Vallaeys, etal. 1996 xylosoxidans Alcaligenes CH2Dll A& France idem xylosoxidans Alcaligenes D2D9 A(B) France idem xylosoxidans Alcaligenes POD3 A(B) France idem xylosoxidans Alcaligenes TFD95 A(B)(C) Saskatchewan Fulthorpe, et al. 1995 xylosoxidans Alcaligenes sp. CS! yes (A)(B)(C) Devon, UK Smejkal, et al. 2001 23 soil 6 Burkholderia cepacia 2a pIJB Xia, et aL l 996 Burkholderia cepacia 6 CSV90 pMABl'BC India, Bhat, et al. 1994 industrial effluent 6 Burkholderia cepacia PCD4 Indonesia Vallaeys, et al. 1996 8 9 Burkholderia ma/lei TFD6 · (A)BC Michigan Matheson, et al. 1996 Burkholderia mallei E2WI (A)BC Puerto Rico Fulthorpe, et al. 1995 Burkholderia sp. EML15910 pEML- ABC Oregon, Amy, et al. 1985 159 activated sludge 11 Burkholderia sp. RASC (A)(B)G Oregon, Suwa, et al. 1996 sewage sludge 12 Burkholderia sp. TFD2 (A)(B)G Michigan Fulthorpe, et al. 1995 Burkholderia s . TFD39ro yes ABC Saskatchewan idem 13 0 Ralstonia eutropha JMP134t pJp41• ABC Australia Don and Pemberton soil 1981 13 14 Ralstonia eutropha JMPl35 pJP5 ABC idem idem 13 Ralstonia eutropha JMP144 pJp91s idem Don and Pemberton 1981 13 Ralstonia eutropha TFD41 16 yes ABC Michigan Fulthorpe. et al. 1995 17 5 18 Ralstonia pickettii K712 pKA4 A(B)(C) Michigan, Holben, et al. 1992; soil Fulthorpe, et al. 1995 Ralstoniasp. CS2 yes (A)(B)(C) Devon, UK Smejkal, et al. 200 l soil 19 Rhodoferax fermentans B6-9 yes (A)&(C) Ontario Fulthorpe. et al. 1995 Rhodoferax fermentans TFD23 yes A(B)(C) Michigan idem 21 Rhodoferax fermentans TFD31 19 yes (A)BG Saskatchewa idem n 24 Rhodofer ax sp. P230 no ABCD Building Ehrig, et al. 1997; material Muller. et al. 200 l Variovorax paradoxus 281 lP pKA218 A Michigan, Ka and Tiedje 1994 20 agricultural soil Variovorax paradoxus JMP116 pJPl Australia Fischer, et al. 1978 20 Variovorax paradoxus JMP130 pJP2lS Australia, Don and Pemberton 20 soil 1981; Ghosal and You l988b Variovorax paradoxus JMP!33 pJp31• ABC idem Don and Pemberton 20 1981 Variovorax paradoxus TVl19 (A)(B) France V allaeys. et al. 1996 20 24 Comamonas MCl yes BCD Building Muller and Babel acidovorans material 1999, MUiier, et al. 2001 PROTEOBACTERIA g SUBDIVISION Acinetobacter sp. England, Beadle and Smith 1982 garden soil 19 member of the family 1-18 (A) Oregon Maltseva, et al. 1996 Halomonadaceae Pseudomonas putida EST4021 pEST Estonia, Mae, et al. 1993 4011 21 soil GREEN SULPHUR BACTERIA Flavobacterium sp. 50001 pRCI022 Florida Chaudhry and Huang 1988 1 Not included in this table are 2,4-D-dcgrading members of the so-called BANA group of the a subdivision of Proreobacter.ia: these are oligotrophic. slow-growing bacteria isolated from pristine soils (Kamagata et al.• 1997). Also not listed are most strains described in a study by Ka et al. ( l 994a), which demonstrated the diversity of 2.4-D degrading microbes in soils with different rates of 2.4-D application. Moreover, the pEMT plasmids (Top et al., 1995; Top et al.. 1996) have not been included: these plasmids were captured from soil by helper strains and their original hosts are unknown. pEMTl contains genes that are highly similar to tfdA, lfdB. and tfdC of pJP4 (Top et al., 1995). 2 If the strain harbors a plasmid which has been shown to confer the 2,4-D' phenotype and/or carries tfd(-like) genes, either the name of that plasmid is written. or 1yes1 when no name has been assigned. An empty line means no data are available. 22 3 Shown is whether the strain harbors [ i] genes that are identical or highly similar to tfdA, tfdB, or tfdC of pJP4 (indicated as A, B, or C, respectively); [ii] genes that are different from but similar to tfdA, tfdB, or tfdC of pJP4 (indicated as (A), (B), or (C), respectively); or [iii] no genes that have similarity to tfdA, tfdB or tfdC (indicated as A, a, or ~. respectively), The criteria for the classification [i], [ii]. or [iii] were the following: [i] the nucleotide sequence of isolated genes was >90% identical to those of tfdA, tfdB, or tfdC on pJP4, or total DNA gave a positive hybridization signal with a probe against the tfdA. tfdB or tfdC gene at high stringency (indicating >90% DNA sequence identity), or the size and restriction fragment length polymorphism (RH,P) of a PCR product on total DNA with primers for tfdA or tfdB were identical to those of JMP!34; [ii] nucleotide sequence between 60 and 90% identical, or positive hybridization at medium or low stringency only (indicating 60 to 90% identity). or different PCR-RFLP pattern; [iii] no hybridization, no PCR amplification. Data were gathered from comparative studies by Fulthorpe el al. (1995) and Vallaeys el al. (1996) and from individual references. As we know now, pJP4 harbors besides the tfdB and tfdC genes also the heterologous tfdB" and tfdCu (van der Meer and Leveau, 1997). Gene tftlB11 lies on the same EcoRl-2 fragment of pJP4 as tfdB, and therefore was not detected separately in the study by Fulthorpe era/. (1995). Gene tfdC,, lies on another EcoRI fragment than tfdC, but its resemblance to lftlC is probably too low to be detected by hybridization at low stringency. However, tfdC11 could be detected at low stringency with a probe against clcA of plasmid pAC27 (Frantz and Chakrabarty, 1987). In the study by Vallaeys el al. (1996), primers against the tfdB gene were designed such (in retrospect) that they would not amplify tfdBu. 4 Given is ejther the state (US), province (Canada) or country. plus the ecosystem (insofar known) in and from which the strain was originally isolated, respectively. 5 Strains TFD9 and K712 are phylogenetically different, but probably carry the same plasmid (Fulthorpe el al., 1995). 6 Formerly Pseudonwnas cepacia. 1 Plasmid pMAB l harbors genes identical to 1/dBCDEF of pJP4 23 22 Plasmid pRC IO hybridizes with pJP4 fragments containing ifd genes. 23 Both plasmids CS! and CS2 hybridized under low stsingeney with ifd gene probes derived from the 2,4-D- degrading Variovorax paradoxus TV L The plasmid CS I showed positive hybridization under medium-stringency conditions, as well, using the lfdA and rjdC gene probes. 24 !fil-like gene fragments were detected by PCR using degenerated PCR primers derived from genes lfdA and tfdB (Vallaeys. et al. 1996), tfdC (Kleinsteuber, et al. 1998) and lfdD (Schllfer, et al. 1998). The partial ifdCD sequence of strain P230 shows 99% identity (935 nucleotides), that of strain MCI 100% identity to the the homologous region of the cbnABCD R. eutropha strain pENH9 I. Strain MC I harbors as well a partial ifdC sequence with 94% amino acid sequence identity to rjdC,, of pJP4 and 59% to tfdC of pJP4. AIM OF THIS THESIS The objective of this thesis was to gain more insight in the evolutionary mechanisms of formation of the chlorocatechol pathway of R. eutropha JMP134 (pJP4). This strain and the 2,4-D degradative pathway were supposed to be of pavticular evolutionary interest, because genetic information suggested two homologous gene clusters present on plasmid pJP4 encoding chlorocatechol degrading enzymes. Furthermore, several irregularities in gene order, insertion elements and interrupted open reading frames suggested relatively recent evolutionary processes in the tfd pathway genes. The two main questions to be answered in this study were: (i) what are the specificities of both gene clusters for chlorocatechol degradation and (ii) what could be the specific advantages or reasons for the present configuration of tfd genes on pJP4. We focused on the characterization and identification of genes in the tfdu gene cluster in order to determine their activity. The tfd11 genes were first cloned and overexpressed individually in E. coli, which revealed that the tfdu genes encode functional modified ortho-cleavage pathway enzymes (Chapter 2). Then their function with respect to 3- and 4-chlorocatechol degradation was studied by introducing tfd1, and tfdu gene clusters on plasmids in a pJP4 free R. eutropha strain (Chapter 3). And finally, the role of the tfd1 and tfdu genes in metabolism of 2,4-D was investigated in the 24 original strain R. eutropha JMP134 (pJP4) by constructing tfdD, tfdD11, tfdE and tfdF mutants (Chapter 4). The outcome of our studies indicated that both gene clusters tjd1 and tfd11 encode functional modified ortho- cleavage pathway enzymes. Furthermore, all the tfd genes are transcribed during growth on 2,4-D. However, interesting specificity differences between the enzymes were found with respect to intermediate metabolism. This partly leads to redundancies in metabolism of chlorocatechols. In other cases, however, the specific characteristics of the individual Tfd enzymes rather seem to give a disadvantage (Chapter 4) during growth on chloroaromatic substrates and may even have been inactivated in R. eutropha, although differences in specificity and expression exist between the counterparts. 25 CHAPTER2 CHARACTERIZATION OF A SECOND TFD GENE CLUSTER FOR CHLOROPHENOL AND CHLOROCATECHOL METABOLISM ON PLASMID PJP4 IN RALSTON/A EUTROPHA JMP134 (PJP4) Within the 5.9-kb DNA region between the tfdR and the tfdK genes on the 2,4- dichlorophenoxyacetic acid (2,4-D) catabolic plasmid pJP4 from Ralstonia eutropha JMP134, five open reading frames (ORFs) were identified, with significant homology to the genes for chlorocatechol and chlorophenol metabolism (tfdCDEF and tfdB) already present elsewhere on pJP4. The five ORFs were organized and assigned as follows: tfdD,f::11EuFu and tfdBn (in short ifd11-cluster), by analogy to tfdCDEF and tfdB (the ifdrcluster). Primer extension analysis of mRNA isolated from 2,4-D-grown R. eutropha JMP134 identified a single transcription start site in front of the first gene of the cluster, tfdD11, suggesting an operon-like organization for the ifd11 genes. By expressing each individual ORF in Escherichia coli the following functions could be confirmed: ifdDu coded for a chloromuconate cycloisomerase, tfdC11 for a chlorocatechol 1,2-dioxygenase, tfdEu for a dienelactone hydrolase, tfdF11 for a maleylacetate reductase, and tfdBu for a chlorophenol hydroxylase. Dot blot hybridizations of mRNA isolated from R. eutropha JMPl34 showed that both tfd1 and ifd11 genes are transcribed upon induction with 2,4-D. Thus, the functions encoded by 26 the tjd11 genes seem to be redundant with respect to those of the tfd1 cluster. One reason why the tjd11 genes do not disappear from plasmid pJP4 might be the necessity for keeping the regulatory genes for the 2,4-D pathway expression tfdR and tjdS. Published in The Journal of Bacteriology (August 2000) by Laemmli, C. M., Leveau, J. H.J., Zehnder, A. J., and van der Meer, J. R. 27 INTRODUCTION Ralstonia eutropha JMP134 (pJP4) was originally isolated in Australia from an unspecified soil sample by selection for its ability to use 2,4- dichlorophenoxyacetic acid (2,4-D) as sole carbon and energy source (Don and Pemberton 1985). The necessary genes for the metabolism of 2,4-D are located on a 22-kb DNA fragment of plasmid pJP4 (Don and Pemberton 1985) (Fig. 1). Among these, tfdA (Streber, et al. 1987), tfdB and tfdCDEF (Don, et al. 1985; Perkins, et al. 1990) were the first genes to be identified. TfdA catalyzes the conversion of 2,4-D to 2,4-dichlorophenol (2,4-DCP) (Fukumori and Hausinger 1993a; Fukumori and Hausinger 1993b), and TfdB the conversion of 2,4-DCP to 3,5-dichlorocatechol (3,5-DCC) (Farhana and New 1997). The TfdCDEF enzymes catalyze the transformation of 3,5-DCC via 2,4-dichloromuconate (2,4-DCM) to 3- oxoadipate (Farhana and New 1997). Expression of the tfd pathway genes is regulated by the two identical LysR-type regulatory proteins TfdR and TfdS (Harker, et al. 1989; Kaphammer, et al. 1990; Leveau and van der Meer 1996; Matrubutham and Harker 1994; You and Ghosal 1995). TfdT was long suspected to be a regulatory protein of the pathway as well but is actually a non-functional regulator due to a C-terminal deletion caused by insertion of the IS-element ISJP4 (Leveau and van der Meer 1996). Plasmids for 2,4-D degradation such as pJP4 form a paradigm for the evolution of new catabolic pathways. The current hypothesis is that existing sets of genes from different organisms can be assembled into new structures, processes often catalyzed by mobile DNA elements (Fulthorpe, et al. 1995). Indeed, mobile DNA elements associated with 2,4-D degradative genes are found in a number of plasmids like pUB 1 and pJP4 28 (Don and Pemberton 1985; You and Ghosal 1995). In case of plasmid pJP4, the insertion element ISJP4 is thought to have been responsible for inserting a larger gene cassette containing (among others) the genes tfdR and tfdS (Fig. 1). Preliminary evidence had been obtained that another set of genes for chlorocatechol degradation might be present within this transposable element (Ghosal and You 1988a; Matrubutham and Harker 1994), which was just recently confirmed (Perez-Pantoja, et al. 2000), although this second cluster had not been previously detected by transposon mutagenesis studies (Don, et al. 1985). In addition, one novel function (tjdK) was discovered recently within this region (Leveau, et al. 1997). Located adjacent to ISPJ4, tfdK codes for an active transporter of 2,4-D at low millimolar concentrations. This demonstrated that the 2,4-D pathway of R. eutropha JMP134 was even more complex than expected until then. Here, we report the identification of a set of five genes in the 5.9-kb tfdR- tfdK intergenic region on plasmid pJP4. We provide evidence that this gene cluster, tfdm is actively transcribed in its host R. eutropha JMP134 and that it encodes the enzymes for a complete conversion of 2,4-dichlorophenol into 13-ketoadipate. Although similar in structure and function, tfd11 is not simply a duplication of the tfdCDEF-B (in short: tfd1) gene cluster. Its role in 2,4-D degradation is subtle, redundant and imperative as well, all of which seems to be the consequence of the past insertion of the ISJP4- flanked mobile element. 29 A ?CHzCOOH . Cl HOOC~C! llOOC Cl HOOC) HOOC coo.. 11 coo I - 'I - -! - r? TfdA y TfdC(ll) TfdE(lI) . TfdF(Il) ~ TfdF(IJ) V y .ffdD(II) I II Ci - Cl 0 0 0 2,4-D 2,4-DCP 3,'i-DCC 2,4-DCM CDL CMA MA OA ~ ~ Figure 1 A Overview of the steps in 2,4-D degradation_ Enzymes catalyzing the different steps: TfdA, 2,4-D a-ketoglutarate dioxygenase; TfdB(ll)• chlorophenol hydroxylase; TfdC(II)> chlorocatechol 1,2-dioxygenase; TfdD(IJ)- chloromuconate cycloisomerase; TfdE(II)> dienelactone hydrolase; TfdF(II)• (chloro)maleylacetate reductase. B Organization of the tfd genes on plasmid pJP4. Arrows indicate the sizes and orientations of all tfd genescurrently known_ The solid line represents noncoding DNA regions of pJP4. The regtangle bewteen tfdK and tfc!T represents the IS element ISJP4; black triangles depict the inverted repeats (not to scale). Positions of promoters regulated by TfdR(S) are indicated above the gene structure. All sites of the restrictim enzymes BamHI and EcoRl are indicated. Not all positions of the other depicted restri.ctim enzymes are given. Abbreviations not gives in the text: CDL, cis-DL; CMA, chloromaleylacetate; MA, maleylacetate; OA, 3-oxoadipale. MATERIALS AND METHODS Bacterial strains and growth conditions. R. eutropha JMP134, carrying plasmid pJP4, is able to use 2,4-D and 3- chlorobenzoate (3-CBA) as sole carbon and energy source (Don and Pemberton 1985; Don and Pemberton 1981). Escherichia coli DH5a (Sambrook, et al. 1989) was used for routine cloning purposes. E. coli BL2l(DE3)(pLysS) (Studier and Moffatt 1986) which carries the T7 RNA polymerase gene under control of the lacUV5 promotor, was used for the T7-directed expression of pRSET6a derived plasmids (Schoepfer 1993). E. coli cultures were grown in Luria Bertani (LB) medium supplemented with 100 µg/ml ampicillin. R. eutropha cultures were grown in Nutrient Broth (Biolife, Italy) or in Pseudomonas mineral medium (Gerhardt, et al. 1981) supplemented with 10 mM fructose. Induction experiments were carried out with R. eutropha JMP134 (pJP4) cultivated in a 1.5 l chemostat 1 on 10 mM fructose at a dilution rate of 0.05 h- • Induction of the 2,4-D pathway was achieved by addition of 2,4-D to the chemostat to a final concentration of 0.1 mM (Leveau, et al. 1999). DNA manipulations, PCR and sequence analysis. Plasmid DNA isolations, transformations and other DNA manipulations were carried out according to established procedures (Sambrook, et al. 1989). Restriction enzymes and other DNA modifying enzymes were obtained from Amersham Pharmacia Life Science (Cleveland Ohio, USA) or GIBCO/BRL Life Technologies Inc. (Gaithersburg, Md.) and used according to the specifications of the manufacturer. Oligonucleotides for 31 the PCR were obtained from Microsynth GmbH (Balgach, Switzerland). PCR mixtures contained 200 pmol of each primer per ml, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 0.05% (v/v) W-1, 2 mM MgC12, 0.25 mM of each deoxynucleotide and 30 U of Taq DNA polymerase (Life Technologies). DNA sequencing was performed on double-stranded DNA templates with a Thermo Sequenase cycle sequencing kit with 7-deaza-dGTP (Amersham). For sequencing of the tfd11-gene cluster, suitable overlapping subclones were generated which were used as templates in sequencing reactions. Primers for sequencing were labeled with fluorescent dyes IRD- 800 or IRD-700 at the 5' end and were purchased from MWG Biotech (Ebersberg, Germany). Fragments were separated on an automated DNA sequencer model 4200 IR2 (LI-COR Inc., Lincoln, NE, USA). Sequence assembly and computer analysis of the DNA sequences was done with the DNASTAR software (DNASTAR Inc., Madison, WI, USA). The sequence of the tfdu-gene cluster was deposited in GenBank under accession number U16782. RNA isolation and primer extension analysis. RNA was isolated from chemostat-grown cultures of R. eutropha JMP134 (pJP4), either under uninduced conditions (10 mM fructose) or induced with O. lmM 2,4-D as described previously (Baumann, et al. 1996). DNasel-treated RNA samples were spotted on Hybond N+ membranes (Amersham) and hybridized with biotin-labeled antisense RNAs for each of the tfdu-ORFs, as described elsewhere (Leveau, et al. 1999). Primer extension reactions were carried out as follows: 1 µg total RNA from induced R. eutropha was annealed with I pmol IRD800-labeled primer (for tfdD11 : 5' CACGCTGCTCTGATGCTTGG 3') in annealing buffer 32 (Amersham) in a total volume of 5 µl. This amount was covered with one drop of mineral oil (Sigma), heated for 5 min at 68°C and then cooled to 42°C. The reverse transcription reaction was started by addition of 3 µl of a mix containing AMY reaction buffer (Amersham), 6U of AMY reverse transcriptase (Amersham) and 1.6 mM of each deoxynucleotide. Reverse transcription reactions were incubated for 1 h at 42°C, then heated for 3 min at 95.5°C and cooled on ice immediately. Samples of 1 µI from the reverse transcriptase reaction were mixed with 0.5 µI of formamide loading buffer and loaded onto denaturing sequencing gel as above. DNA sequencing reactions were prepared with the same !RD-labeled primer on double stranded plasmid DNAs with the corresponding cloned pJP4 regions. Regions tested for cDNA synthesis on total RNA from induced R. eutropha cultures included tfdDm tfdC11 , tfdB11, tfdK, and tfdC. Plasmids. Plasmid pUC28 (Benes, et al. 1993) was used as general cloning vector. pRSET6a (Schoepfer 1993) is a plasmid with a pBluescript backbone (Stratagene, La Jolla, CA) containing the specific expression elements of the pET3 vectors (Studier and Moffatt 1986) and a newly designed multiple cloning site (MCS) to facilitate cloning. Translational fusions of each of the genes of the efd11-cluster individually were constructed by fusing the ATG triplet of the Ndel site located in the MCS downstream of the T7 promoter and ribosome binding site on pRSET6a to the start codon of the respective ifd gene. DNA fragments containing either the tfdCm tfdDu or ifdEu open reading frames (ORFs) were tailor-made amplified by PCR, thereby introducing a Ndel site at the start codon and a BamHI site downstream of the stop codon of each gene. 33 ( The obtained PCR fragments were first cloned into NdeIJBamHI of pUC28 I and sequenced to confirm their identity with the original nucleotide I sequence. The fragments were then reisolated and cloned into pRSET6a cut with Ndel and BamHI. This resulted in the plasmids pCBA192 (tfdC11), Ii pCBA165 (tjdD11), pCBA202 (tjdEu). For cloning the tfdFu gene, first a 240-bp fragment was amplified by PCR from plasmid pCBA83IV. The I PCR-derived fragment was digested with Ndel and BamHI and directly cloned to pRSET6a. A plasmid with the proper insert determined by sequencing was named pCBA179. To complete the ORF of tjdFu, a 1.3-kb EcoRI fragment of pCBA88 was cloned into the EcoRI-site of pCBAl 79 to give rise to plasmid pCBA184. The tjdB11 gene was cloned as follows: first, a 620-bp fragment was amplified from plasmid pCBA84IV using primers 981203 (5'-CGA TAA GGA GAC CAT ATG AACG 3'; tfdBu sequence) and 931011 (5'-TGA GCG GAT AAC AAT TT 3'; pUC18 sequence), digested with Nde1/EcoR1 and ligated into pUC28 cut with the same enzymes. After transformation, this resulted in plasmid pCBA174. The insert of pCBAl 74 was sequenced to confirm its identity. In a three- point ligation, the Ndel-EcoRI fragment of pCBA174 and the EcoRI-Pstl fragment of pCBA90 were ligated to pRSET6atfdD (U. Schell, Department of Microbiology, University of Stuttgart) cut with Ndel and Pstl to give pCBA180 (Table 1). We then prepared frameshift mutations in each of the ORFs of the individually cloned tfdu-genes. For this purpose, the plasmids pCBA199 (tjdCu), pCBA165 (tfdDu), pCBA202 (tfdEu), pCBA184 (tfdFu), and pCBA180 (tfdBu) were each digested with a unique restriction site located in the respective tfdu gene, treated with Kienow DNA polymerase and religated (Table 1). By analogy, the truncated genes were named tfdCw1, 34 tfdD11'1, tfdEu'1, tfdFud and tfdBu'1, and the corresponding plasmids are pCBA200, pCBA196, pCBA201, pCBA197 and pCBA198, respectively (Table 1). Table 1: Plasmids constructed in this work. PLASMID DESCRIPTION pCBA83IV pGEM-5Zf carrying the 870 bp NcoI-BamHI fragment of pJP4 containing tfdE11, Ap' pCBA841V pUC19 carrying the 1.3 kb BamHI-EcoRI fragment of pJP4 containing part of tfdF11 and tfdB11, Ap' pCBA89 6.9 kb Sad fragment of pJP4 in pUC pCBA90 pUCl9 carrying the 1.4 kb EcoRl"Pstl fragment of pJP4 containing part of tfdB11 and tfdK, Ap' pCBA122 I kb Saeli fragment of pCBA89, contains (fdC11 pCBA174 pUC28 carrying tbe 550 bp Ndel-EcoRI fragment amplified with primers 981203 and 931011 from pCBA84JV, contains part of tfdB11, Ap' pCBA179 pRSET6a carrying the 100 bp Ndel-BamHI fragment amplified with primers 981202 and 931011 from pCBA83IV, contains part of tfdFu. Ap' pCBAI65 pRSET6a carrying the L2 kb NdeI-BamHI fragment amplified with primers 971202 and 980707 from pCBA89, contains ifdD,,, Ap' pCBA180 pRSET6a carrying fragment Ndd-EcvRI from pCBA 174 and fragment EcoRl"Pstl from pCBA90, contains complete tfdB11• Ap' pCBA184 pCBAI79 with the l.3 kb EcoRI fragment from pCBA88. contains tfdF11 , Ap' pCBA192 pUC28 carrying the 800 bp Ndei"BamHI fragment amplified with primers 990504 and 990505 from pCBA 122, contains tfdC11 , Ap' pCBAI96 pCBAJ65 with deletion of the Ncol-site, contains frameshift mutation in tfdD11 , Ap' pCBAl97 pCBAl84 with deletion of the BsrEII-site, contains frameshift mutation in tfdF,,, Ap' pCBA198 pCBA l 80 with deletion of the EcoRI"site, contains frameshift mutation in tfdB11, Ap' pCBAJ99 pRSET6a carrying the 800 bp Ndei"BamHI fragment of pCBA 192, contains tfdC"' Ap' pCBA200 pCBAl99 with deletion of the BstXI-site, contains frameshift mutation in ifdC11, Ap' pCBA201 pCBA202 with deletion of the Xhol-site, contains frameshift mutation in tfdE11, Ap' pCBA202 pRSET6a carrying the 700 bp Ndel-BamHI fragment amplified with primers 981002 and 981003 from pCBA89, contains tfdEu, Ap' Expression in E. coli. E. coli BL2l(DE3)(pLysS) strains harboring pRSET6a-derived plasmids were grown in 50 ml LB at 37°C to an optical density at 546 nm of between 0.5 and 0.6. To achieve induction, isopropyl-13-D- thiogalactopyranoside was added to the medium at a final concentration of 0.4 mM and strains were incubated at 30°C for an additional 2.5 h. Cells 35 were then centrifuged for 15 min at 5,300 rpm (4°C), washed with 20 ml of washing buffer (containing 20 mM Tris-HCl (pH 7.5) supplemented with 1 mM MnS04 in the case of E. coli expressing tfdDu), and resuspended in 1 ml of the washing buffer. Samples of 50 µl were taken from these cell suspensions for analysis by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE), which was performed according to the method of Laemmli (Laemrnli 1970). Disruption of the remainder of the cell suspensions was performed by sonification (Branson Sonifier 450, SCAN AG, Basel, Switzerland). One-ml cell suspensions were sonified 5 x 15 sec on ice at an output of 30-40 W, with 1 min pause between each pulse. Subsequently, suspensions were centrifuged at 4°C for 30 min at 15,000 x g. The resulting supematants, referred to as cell extracts, were used in enzyme assays. Protein concentrations in the cell extracts were determined as described by Bradford (Bradford 1976), by using bovine serum albumine as a standard. Enzyme assays. All enzyme assays were performed by spectrophotometric methods in 0.5- ml quartz cuvettes at room temperature. Extinction coefficients were taken from Dom and Knackmuss (Dom and Knackmuss 1978). Chlorocatechol 1,2-dioxygenase activity was measured by determining product formation at 260 nm. Substrates tested included 3,5-DCC (£2•4.ocM 1 1 1 1 = 12,000 M- cm- ), 3-chlorocatechol (CC) (£2.cM = 17,100 M- cm- ) or 4- 1 1 CC (£3.cM = 12,400 M- cm- ). Reaction mixtures contained 40 mM Tris- HCl (pH 7.5), 0.3 mM EDTA and 0.1 mM substrate. The reaction was started by adding cell extract (0.01-0.2 mg of protein). 36 Chloromuconate cycloisomerase activity was measured by determining disappearance rate of substrate at 260 nm. Substrates used were 2- chloromuconate (CM), 3-CM or freshly made 2,4-DCM (see below). Reaction mixtures contained 30 mM Tris-HCl (pH 7.5), 1 mM MnS04 and 0.1 mM substrate. Cycloisomerization of chloromuconates was assayed in the presence of an excess of dienelactone hydrolase to avoid accumulation of 4-carboxymethylenebut-2-en-4-olides. For the conversion of 2,4-DCM an extinction coefficient of 5,800 M- 1 cm- 1 was used (Kuhm, et al. 1990). The reaction was started by adding cell extract (0.01-0.2 mg of protein). Dienelactone hydrolase activity was measured at 280 nm by determining the disappearance rate of substrate (cis-dienelactone (DL) (EoL = 17,000 M- 1 1 cm- ) or trans-DL). Reaction mixtures contained 10 mM Histidin-HCl (pH 6.5) and 0.1 mM substrate. The reaction was started by adding cell extract (0.01~0.2 mg of protein). Maleylacetate reductase activity was measured by determining maleylacetate-dependent NADH oxidation at 340 nm. Reaction mixtures contained 50 mM Tris-HCl (pH 7), 0.4 mM NADH and cell extract (0.01- 0.2 mg protein). After the unspecific oxidation rate of NADH (ENAoH=6300 1 1 M- cm- ) was determined, the reaction was started by adding 0.4 mM of freshly prepared maleylacetate (see below). 2,4-Dichlorophenol dioxygenase was measured by determining 2,4- dichlorophenol-dependent NADPH oxidation at 340 nm. Reaction mixtures contained 60 mM phosphate buffer (pH7.6), 0.03 mM flavin adenine dinucleotide, 0.3 mM NADPH and cell extract (0.01-0.2 mg protein). After the unspecific oxidation rate of NADPH (ENAoPH=6300 M- 1 cm-') was determined, the reaction was started by adding 0.05 mM of 2,4- dichlorophenol. 37 Chemicals. 3-CC was a kind gift of Barbara Jakobs, GFB, Braunschweig, Germany. 4- CC and 3,5-DCC were purchased from Promochem GmbH (46469 Wesel, Germany). 3-CM, cis- and trans-DL were a kind gift of Dr. Walter Reineke, Bergische Universitiit-Gesamthochschule Wuppertal, Wuppertal, Germany. 2,4-DCM was prepared by incubation of a solution of 1 mM 3,5-DCC in 30 mM Tris-HCI (pH 8) with cell extract of E. coli BL21 (pCBAl 99) expressing tfdCu. The formation of 2,4-DCM was followed spectrophotometrically at 260 nm. After 20 min the reaction mixture was centrifuged through a Centricon-10 (Amicon, Inc., Beverly, MA 01915 USA) filter at 5000 x g. Maleylacetate was prepared by alkaline hydrolysis of cis-DL, as described elsewhere (Evans, et al. 1971), by mixing 1 ml of 5 mM cis-DL with 7.5 µl of 2N NaOH and incubating for 15 min at room temperature. 2,4-Dichlorophenol was purchased from Fluka Chemie AG (Buchs, Switzerland). Digital imaging. Sequence images were exported as TIFF-files. Autoradiographic films and protein gels were scanned on a laser densitometer (Molecular Dynamics, Sunnyvale, Cal.), and exported as TIFF-files. All TIFF-files were imported into Adobe Photoshop (version 4.0, Adobe Systems, Inc., Cal.), cropped to the appropriate size, enhanced whenever necessary for reproduction, saved as grayscale TIFF-files and placed into Adobe Illustrator (version 8.0) for text additions. 38 RESULTS Identification of a second gene cluster for chlorophenol and chlorocatechol metabolism on pJP4. In the tfdR-tfdK intergenic region of plasmid pJP4, we located five open reading frames (ORFs) with significant homology to genes for the metabolism of chlorinated phenols and catechols. The ORFs were arranged serially and in an orientation opposite to that of the tfdR gene (Fig. 1). To signify their resemblance to genes from the tfdCDEFB cluster on pJP4, the ORFs were sequentially labeled tfdDu, tfdCII, tfdEu, tfdF11 and tfdBu. The percentages of amino acid identity between the predicted polypeptides from the tfdu genes and their counterparts from the tfdCDEFB genes varied substantially (Table 2). For example, TfdEn had only 15% predicted identical amino acids with TfdE, whereas TfdCn and TfdC shared 60% amino acid identity. The evolutionary relationships of the Tfdn and Tfd1 gene products with other related proteins have been clearly pointed out elsewhere (Eulberg, et al. 1998). These sequence comparisons indicated quite well that the tfdII genes were not simply a duplication of the tjd1 cluster, or vice versa, but had a different evolutionary origin. This became also evident from a comparison of the gene organization of both clusters. In the tfdu cluster the tjdD11 ORF preceded that of tfdCu whereas in the tjd1 cluster this is opposite. Furthermore, no ORFs overlapped in the tfdll cluster, whereas two cases of translational coupling occur in the tfd1 cluster (i.e., tfdCD and tjdEF). The {fd" cluster showed highest percentages of identity to a set of tfd genes on plasmid pEST4011 of P. putida and of Variovorax paradoxus (Xia, et al. 1998), although smaller deletions or 39 frameshift mutations must have occurred there. For example, the first 131 bp of the tfdDu ORF had 74% sequence identity to a region upstream of the tfdC gene of pEST4011 but no complete tfdD ORF exists. TfdC11 had only 60% identical amino acids with TfdC, whereas it carried 83.5% identity with TfdC of pEST4011 (Mae, et al. 1993). TfdEi1 carried 79.6% identical amino acid residues with the predicted polypeptide encoded by tfdE from V. paradoxus. Interestingly, the TfdE polypeptide predicted from tfdE on pEST4011 (Mae, et al. 1993) had no significant similarity with TfdEn except for the first 22 amino acids, although the DNA sequence identity along the total 708 bp region in common was 77.4%. However, introducing a two basepair frameshift into the tfdE ORF 66 bp downstream of the ATG start codon on pEST401 l would again result in a theoretical polypeptide with 79.6% similarity to TfdE11 and 100% identity to TfdE of V. paradoxus. Finally, TfdBu carried 90.8% amino acid identity to TfdB of pEST4011. Table 2: Features of the ORFs of the tjd, and tfdu gene cluster bp Ribosome between Predicted Pairwise Location on Length of ORF binding RBS and Start codon molecular identity sequence{/ ORF(bp) site start mass (kDa) (o/o)b codon tfdC GGAGG 4 GTG 337-1104 765 28.3 60 tfdCu GAAGAG 8 ATG 2856-3617 759 28.1 tfdD GGGGG 7 GTG 1101-2213 1,110 39.7 35 tfdD,/ -/GAAGCG -19 ATG/GTG 1610/ 1694-2659 l,047/963 36.9 tfdE GGAG 7 ATG 2288-2992 702 25.4 15 tjdE11 GAAGG 7 ATG 3639-4346 705 25.4 tfdF GAAGG 7 ATG 2989-4053 l,062 37.9 45 tfdF11 GGGGG 5 GTG 4348-5427 1.077 37.5 tfdB GGAGG 5 ATG 4398-6193 1,794 65.4 62 tfdBu GGAG 5 ATG 5495-7255 l,758 64.4 a GeneBank accession no. M35097 (tfdCDE'F) nnd UI6782 (tfd11 cluster). b Calculated at amino acid level. c The slash indicates that there is no ribosome binding site corresponding to the ATG codon. 40 A ifdA S R Du CuEu Fu B!f K TC F B ~ .. ~~ ~~ ISJP4- art .. B (!) ~ ~"' o ifdr-cluster •Ifdu-cluster Figure 2 G + C content of the tfd region on plasmid pJP4. The graph was created using the programm Curvelt (ICGEB, Triest, Italy) with a window of JOO bp. Dotted lines indicate the average G + C content for distinct fragments. B Codon usage of the tfd1 and tfdu gene clusters. The black and white bars represent the fraction of usage of a certain codon among all possible codons for a certain amino acid. Addition of all fractions of all possible codons for a certain amino acid gives a total fraction of 1. The codons are ordered by G + C content and wobble base, rich G + C content (left) to poor G + C content (right). 41 The codon usage among genes of the tfdu genes differed slightly from that of tfd1: the two lysine codons TTA and TCT, the two serine codons TCT and AGT, and the two stop codons TAG and TAA did not occur in any of the tfdu genes, whereas all possible codons occurred at least once in the tfd, genes (Fig. 2B). This difference in codon usage may have effects on relative translation efficiency of the tfd11- or tfd,-mRNAs, for example, when codon demand does not coincide with specific tRNA abundance in the cell (You and Ghosal 1995). Both clusters tended to use the codons containing a G or C wobble base more abundantly than those with A or T (Fig. 2B). This bias was reflected in the high average GC content of both gene clusters; for tfdCDEFB, however, the %GC was remarkably lower (56%) than that for the tfdu cluster (66%) (Fig. 2A). Expression of each of the tfd11 genes in E. coli. Cell extracts of E. coli BL21 cultures overexpressing each tfdu gene individually were analyzed by SDS-PAGE (Fig. 3), and assayed for enzyme activities from the chlorocatechol and chlorophenol oxidative pathway (Table 3). As negative controls, induced cultures of each of the E. coli strains containing the plasmids with mutated tfdu ORFs were used, and E. coli BL21 without any pRSET plasmid. In total cell extract of E. coli BL21(pCBA165) expressing the tfdDu gene from its ATG start, we detected an overproduced polypeptide of about 42 kDa (Fig. 3, lane 5) which was absent in extracts of E. coli BL21(pCBA196) harboring a frameshift mutation in tfdD 11 (Fig. 3, lane 4). Chloromuconate cycloisomerase activity with 2,4-DCM and 3-CM as substrates was indeed detected in cell extracts of E. coli cultures harboring pCBA165 (Table 3). Significantly lower values were obtained when using 2-CM as substrate. 42 Table 3: Specific enzyme activities encoded by the tfd11 genes and the measured in cell extracts of E.coli. BL21 SPECIPIC ACTIVITY (mU/mg protein)° Gene Plasmid CC 1,2-D• CMc• DLH" MAR" 2,4-DPH" 3,5-DCC 3-CC 4-CC 2,4-DCM 2-CM 3-CM cis-DL trans-DL MA 2,4-DCP ifdC11 pCBAJ99 103 0.8 x IO·' 0.6 x IO' tfdC11t1' pCBA200 2 4 2 ,, 3 1 tfdD11 pCBAl65 - 4.4 x 10 60 2 x 10 tfdDuC. pCBAl96 -3 -I 6 ifdE11 pCBA202 2.6 x 103 2x 10' ifdE11C. pCBA20l 17 4 tfdF11 pCBAl84 3.6 x IO' tfdF11C. pCBAl97 37 tfdB11 pCBAl80 7 tfdB11C. pCBAJ98 2 None 1.1 1.7 I.I 31 11 l U = I µmol of substrate disappearance or product formation per min. Shown arc representative values from one activity assay. Assays were performed at least in independent replicates, b CC l.2-D. chlorocatechol 1,2~d1oxygcnase; CMC, chloromuconate cydolsomcrase: DHL, dienelactone bydrolase; MAR. maleylacetate reductase; 2,4~DPH, 2,4-dichiorophenol hydroxylase; DCC, dichlorocatechol; CC, chloroca1echol; DCM. dichloromucomue: CM, chloromuconate; DL, dienclactone; MA, maleylaceta.te: DCP. dichlorophenol i: Frameshift in tfdC11 rl - , not mea.'lured In cell extracts from cultures expressing the tjdD11 frameshift mutant, however, no activity was found. Chlorocatechol 1,2-dioxygenase activity was clearly present in cell extracts from cultures expressing the tjdC11 gene, with either 3,5-DCC, 3-CC- or 4-CC as substrates (Table 3). The predicted molecular mass of the polypeptide encoded by this ORF (28.1 k:Da) fitted well with the 27 k:Da protein band determined by SDS-PAGE (Fig. 3, lane 2). No activity was detected in extracts of E. coli BL21 harboring the truncated gene tfdCu/J.. The observed peptide of 27 kDa in cell extracts of E. coli expressing ifdCu/J. is caused by the frameshift at the BstXI-site, accidentally resulting in a peptide of the same size as TfdC11 • With cis- and trans-dienelactone as substrates, dienelactone hydrolase activity was clearly detected in cell extracts from cultures expressing tfdEu. This activity coincided with the production of a 25-k:Da protein (Fig. 3, lane 8). 43 size 4 6 IO 11 12 13 size (kDa) (kDa) 97.4 97.4 68 68 43 43 29 29 18.4 18.4 14.3 14.3 Figure 3 SDS-polyacrylamide gel of total cell extracts of !PTO-induced E. coli BL2l(DE3)(pLysS) strains harboring pRSET6a-derived plasmids carrying one of the tfd 11 genes or its truncated derivative. Lanes: l, pCBA200 (tfdCw1); 2, pCBA199 (tfdC11); 3, molecular size marker; 4, pCBA196 (tfdDu/J.); 5. pCBA165 (tfdD11 ); 6, molecular size marker; 7, pCBA201 (tfdE11/J.); 8, pCBA202 (tfdE11); 9, pCBA197 (tjdFu/J.); l 0, pCBA 184 (tfdF11); 11, molecular size marker; 12, pCBA 198 (tfdBu/J.); 13, pCBA 180 (tfdBu). Positions of molecular masses are indicated on the left and right. The arrow in lane I 0 points to the putative TfdFn protein. (Digital image was recorded as a TIFF file; background was enhanced for reproduction in Adobe Photoshop.) In contrast, we found no such polypeptide (Fig. 3, lane 7) and also no hydrolase activity with cells expressing tfdE11A from plasmid pCBA201. Maleylacetate reductase activity was detected in cell extracts of E. coli BL21 harboring tfdF11 by monitoring the maleylacetate-dependent oxidation of NADH (Table 3). In these cell extracts a protein with an apparent mass of about 37 kDa was observed by SDS-PAGE, which is close to the theoretically predicted mass of 37.5 kDa (Fig. 3, lane 10). This protein band was absent in total cell extracts of E. coli BL2l(pCBA197), carrying a frameshift mutation in tfdF11 (Fig. 3, lane 9). Both E. coli BL21 (pCBA184) and E.coli (pCBA197) strongly produced a 27 kDa protein, which might be the result of a translational fusion protein starting at nucleotide position 3844 (numbering according to GenBank U16782) and continuing in pRSET6a. A slight background activity was found with cell 44 extracts expressing a frameshift mutated tjdFu and in cell extracts from E. coli without any pRSET-type plasmid (Table 3). We suppose, therefore, this low activity to be due to native proteins from E. coli itself. Finally, the activity of TfdB 11 was determined in cell extracts of E.coli BL21 harboring tjdBu and compared to that in cell extracts of E. coli BL21 containing the frameshift mutated tfdBw1. The activities measured for TfdBu were relatively low compared to the other Tfd11-enzymes but still higher than the activities measured in the negative control. The molecular mass of the TfdB 11 protein in cells harboring pCBA180 was of the predicted size (65 kDa) (Fig. 3, lane 13). In E. coli (pCBA198) containing a frameshift mutation in tfdBu gene, a protein of 24 kDa was observed, which is the size of the generated truncated TfdB11Li protein (Fig. 3, lane 12). Based on these results, we conclude that the Tfdu-enzymes catalyzed the transformations expected from their similarities to the Tfdi-counterparts. Expression of the tfdII genes in R. eutropha JMP134 (pJP4). Since enzyme assays in extracts from R. eutropha JMPl 34 do not allow to distinguish between activities from the tjd1 cluster and the corresponding ones from the tfdu cluster, we relied on specific mRNA analysis to determine if transcription from the tfdn genes occurred. Induction of transcription was shown by hybridizing total RNA, isolated from a continuous culture at different time points after addition of 0.1 mM 2,4-D to the medium, with probes for the different tfd11 genes. Immediately after addition of 2,4-D, levels of mRNA of the tjdCu gene went up rapidly, shortly followed by those of tjdEu, tfdBu and tjdK (Fig. 4). Maximum levels of mRNA were reached 14 minutes after induction, after which there was a decrease in mRNA to a stable level that remained unchanged for 45 over 10 hours. We observed a similar pattern of gene induction for the tfdA and the tfdCD genes (Fig. 4}. Expression of tfdR, as well as that of the gene for 16S rRNA remained essentially unchanged upon addition of 2,4-D (Fig. 4). -278 -245 -130 2.00 8.0 14.0 20.0 30.0 40.0 50.0 652 688 Time(min) Figure 4 Dot blot hybridization of total RNA isolated from a chemostat-grown culture of R. eutropha JMPL34 before and after induction with 2,4-D. Antisense RNA probes are indicated on the left. Times at which the samples were taken from the chemostat are indicated on the bottom. 2,4-D was introduced into the chemostat at time zero. Panels for each hybridization were obtained in independent hybridization experiments; therefore, signal intensities cannot be directly compared between different probes. In addition, spot densities were not corrected for small differences among total RNA amounts spotted at each position. Note the distinct and immediate strong induction of all markers except tfdR and EUB (=16S rRNA). (Digital image was obtained by scanning of original autoradiograms; individual TIFF files were compiled in Adobe Photoshop.) 46 To map transcriptional start sites of the tfdu gene cluster, we performed primer extension analysis on total RNA that was isolated from chemostat grown cells of R. eutropha JMP134 (pJP4) under uninduced and induced (i.e., with 2,4-D) conditions. Using a primer positioned in the tjdDu gene, we were able to detect a specific cDNA transcript which was not observed from an uninduced culture (Fig. 5). The product identified a single transcription start site at a G residue at position -82 relative to the putative GTG or +3 relative to the postulated ATG translation start codon of tfdDn (Fig. 5). This makes the GTG a more likely candidate for the translation start codon of the tfdD11 gene (Fig. 5). We found no primer extension products from primers positioned in the reading frames of any of the other genes of the tfdu cluster, including tfdK. These results suggest an operon- like organization for the genes tfdDu to tfdK. From the location of the transcriptional start site, we propose a TTAGAC/TAGACT promoter sequence for tfdDu (Fig. 5). Control primer extension reactions with a primer complementary to tfdC resulted in transcription starts at T and G (nucleotides 286 and 287), 4 nucleotides downstream of the -10 region proposed by Perkins (Perkins, et al. 1990) (not shown). A ACOT -35 -lO CCCGCTGCCGGAGAGCCATACCGATCCCGTATCGCTCGCGCTGATGGAAGGT TCGTCGATCTGCCGCTGCGCCGCATCCAGCAGTTCGCCCGCCTGGGCGCCAAGCATCAGAGCA -+++---;,..-l'+'f--'t--...... -r---+---+--+-+--+-+--+--tl760 A AGCAGCTAGACGGCGACGCGGCGTAGGTCGTCAAGCGGGCGGACCCGCGGTTCGTAGTCTCGT V % V D L P L A R I Q 0 F A R L G A K H 0 $ ~------tfdD11 ------ 47 Figure 5 A Digital image from the gel region showing the size of the transcript synthesized from the tfd11 mRNA and the sequence derived with the same primer. (Image recorded as a TIFF file on a LI-COR IR2 sequencer; background enhanced for reproduction purposes in Adobe Photoshop). The arrow points to the specific transcript observed under induced (with 2,4-D) conditions. B Relevant part of the DNA sequence upstream of the tfd11 ORF. Translation of tfdDu is shown from the second possible start (Val at position 1694). The dotted line represents continuation of the ORF in the upstream direction. The first start codon (ATG at position 1612), however, was identified as the position of the transcription start (indicated with +1). Possible promoter elements and the TfdR binding site are indicated. The shaded region represents the sequence shown in the digital image. DISCUSSION Further exploration of the ISJP4-flanked transposable element on pJP4 led us to discover five ORFs, potentially encoding the metabolism of chlorocatechols and of chlorophenols. The ORFs were designated tfdD11, tfdC11, tfdE11 , tfdF11 and tfdBu by analogy to the tfdCDEF-B genes on pJP4. We demonstrated by expressing each individual ORF in E. coli that the ORF designated tfdDu codes for a chloromuconate cycloisomerase, tfdCu for a chlorocatechol 1,2-dioxygenase, tfdE11 for a dienelactone hydrolase, tfdF11 for a maleylacetate reductase and tfdB11 for a chlorophenol hydroxylase. Together with the previously characterized tfd genes, this adds up to a total of 8 genes, which are presently included in the transposable DNA, namely: tjdS and tfdR, tfdD11CuEuFuBuK. Substantial evidence leads us to believe that the tjd1 and tjd11-genes were acquired from different origins rather than evolved by duplication and divergence within one host. First of all, the actual percentages of identity among counterparts in the tfdr and the tjd11-cluster were rather low (15% to 62% at amino acid level). Secondly, the G+C content of the tjd11 genes is significantly higher (Fig. 2). Since tfdS and tfdR are fully identical, and perhaps themselves the result of a duplication event, we suppose that at one point a DNA fragment 48 containing tfdR, tfdDuCuEuFrrBuK flanked by ISJP4 was mobilized into an ancestor pJP4 plasmid. The results obtained with expression in E. coli showed that the tfdu genes can encode 2,4-DCP metabolizing enzymes. Furthermore, we showed that the tfdu genes are transcribed in R. eutropha when cells are exposed to 2,4- D. Although we could not directly demonstrate that the tfdn genes are indeed translated into functional enzymes in R. eutropha JMP134, it seems rather unlikely that they would not be. First of all, all the tfdu genes are transcribed and induced upon exposure of the cells to 2,4-D, and as strongly as the genes from the cluster tfdr (Fig. 5). Secondly, at least three gene products from the tfducluster are synthesized during growth on 2,4-D. These are TfdR, the regulatory protein of all the pathway genes, TfdK, a transporter protein for 2,4-D and TfdF11 , the maleylacetate reductase (Kaphammer, et al. 1990; Leveau and van der Meer 1996; Leveau, et al. 1997; Matrubutham and Harker 1994; Seibert, et al. 1993). Accidentally, the purified active enzyme catalyzing 2-chloromaleylacetate reduction in R. eutropha JMP134 turned out to be TfdF11 , which was proven by NH2- terminal sequencing of the purified protein (Seibert, et al. 1993). Moreover, it was recently demonstrated that R. eutropha strains with a plasmid containing the tfdu gene cluster could actually grow on 3-chlorobenzoate (Perez-Pantoja, et al. 2000). This makes it unlikely that the tfdu genes would not be translated in R. eutropha JMP134, although especially the tfdDuORF has a very poor ribosome binding site. Strangely enough, the tfdu genes were not detected along with the tfd1 genes in the original transposon mutagenesis studies performed by Don (Don, et al. 1985). We can at least rule out that the tfdu cluster was inserted on pJP4 after analysis by Don, since the physical map of plasmid pJP4 as drawn by Don in 1985 49 (Don and Pemberton 1985) is identical to the presently known map from DNA sequencing data. At this point, the question arises why the present day configuration of the tfd genes with two sets of homologous genes is kept on plasmid pJP4 as it is. One answer is that at least some of the functions encoded within the tfdu cluster are favorable for growth on 2,4-D. Such a function might indeed be the chloromaleylacetate reductase TfdFn. Since TfdF transposon mutants grew poorly on 2,4-D but well on 3-CBA (Don, et al. 1985), this suggests that not TfdF but TfdFn is actually catalyzing the dechlorination of 2- chloromaleylacetate during growth on 2,4-D. Another function specific for the tfdu cluster is TfdK, a transporter protein which favorizes uptake of 2,4- D at low extracellular concentrations. However, TfdK does not seem to be indispensable for growth (Leveau, et al. 1997). A more important function, however, is carried by the regulatory protein TfdR (or its identical twin TfdS). Since TfdR is the transcriptional activator for tfdA expression and for both the tfd1 and the tfdu genes (Kaphammer, et al. 1990; Leveau and van der Meer 1996; Matrubutham and Harker 1994), its loss would abolish 2,4-D pathway induction. Most likely, if the tfdu cluster were to become lost from pJP4, this would occur through recombination of homologous regions or activity of the ISJP4 element. Recombination between the right end partial copy of ISJP4 (located in between tfdS and tfdA) and ISJP4 (downstream of tfdK), would lead to loss of the regulatory genes. An alternative, perhaps more seldom, recombination between tfdT and tfdR would lead to loss of the tfdu cluster, but could still restore the regulatory function. At least one plasmid with this type of recombination seems to exist, i. e., pMABl. Restriction analysis of pMABl suggests identical tfdCDEF genes as on pJP4, but a recombination between tfdT and tfdR 50 (Bhat, et al. 1994). This again points to the importance of maintaining proper regulation of the tfd pathway genes. Therefore, it seems as if the current configuration is locked into a semi-stable state, due to the presence of the current regulatory genes within the tfdu cluster and the inactivated original regulatory gene (tjd1) laying in the tfd1 cluster. A Pseudomonas putida (pEST40ll) [U32188] B Figure 6 A Comparison of the genetic organizations of the tfdu clusters of R. eutropha JMPI34, V. paradoxus (Valleys, unpublished), and P. putida (pEST401 l) (Koiv 1996). Connecting lines point to regions of high sequence identity among the different gene clusters. Percentages of sequence identity are given between the gene maps. The striped areas indicate regions deleted from the tfdu cluster of R. eutropha compared to the others. GenBank accession numbers are given in panel A. B Sequence alignment of the intergenic regions directly upstream of tfdR in the direction of tfdD,, (for R. eutropha) or tfdC (for V. paradoxus and pEST401 l). Boxed regions point to the conserved TfdR binding motif and the -35 and -10 promoter sequences. The asterik indicates the mapped transcription start site for the R. eutropha tfd,, operon. We can speculate a little on the genealogy of the tfdu cluster, since at least two other genetic systems for 2,4-D degradation are known which carry tfd-type genes with higher identities to the tfdll cluster of pJP4 than to the tfd1 cluster (Fig. 6). One of these occurs on plasmid pEST401 l, which is a derivative of a plasmid (pEST4002) originally isolated in P. putida strain EST4002 from 2,4-D treated soils in Estonia (Ausmees and Heinaru 1990). 51 One region on this plasmid contains tfdu type genes, although in a configuration tfdR-tfdC-(tjdE)-tfdB, without tfdD11, tfdF11, or tfdK (Koiv, et al. 1996). Regulatable expression of chlorocatechol 1,2-dioxygenase and chlorophenol hydroxylase activities were demonstrated for this region of plasmid pEST4011 (Mae, et al. 1993). The other system from V. paradoxus is basically identical to the tfd-genes of pEST4011, although more sequence information is available on regions upstream of tfdR and downstream of tfdB (Xia, et al. 1998). This indicated that a tfdK-like gene was downstream of tfdB and a tfdD-like gene further upstream of tfdR (Fig. 6). Interestingly, in at least one region (in between tfdR and tfdC) a deletion has occurred which removed part of the tfdDu ORF on pEST401 l, leaving only 131 bp of the tfdDu ORF and the intergenic region between tfdR and tfdDu (Fig. 6A). This part, however, might be still important for a proper regulation of tfd gene expression, since it carries the TfdR binding site (Fig. 6B). At least in the V. paradoxus system, a complete tfdD gene copy exists, which, however, has a higher percentage sequence identity to tfdD1 (64.2) than to tfdDu (55.2). In between tjdC-tfdB a 708-bp sequence exists with 77.4% identity with tfdEu, but a frameshift hinders the production of a TfdEu-like polypeptide. This frameshift is not present in the V. paradoxus sequence. Curiously, no traces of the tfdFu gene can be found in the V. paradoxus or pEST4011 sequences. This suggests that this region of pEST401 l and of V. paradoxus was derived from a tfdu-like cluster and points to a wider distribution of the tfdu-type cluster among soil microorganisms rather than a single occurrence on pJP4. 52 CHAPTER3 TFDDn, ONE OF THE TWO CHLOROMUCONATE CYCLOISOMERASES OF RALSTON/A EUTROPHA JMP134 (PJP4), IS A BOTTLENECK IN CONVERSION OF 3-CHLOROCATECHOL AND EFFICIENT 3-CHLOROBENZOATE METABOLISM Ralstonia eutropha JMP134 (pJP4) harbors two gene clusters for the degradation of chlorocatechols, i.e. tfdCl)EF (in short tfd,) and tfdD11C11EuFu (in short: tfd11), which are both present on the catabolic plasmid pJP4. In this study, we compared the function of both gene clusters for degradation of chlorocatechols, by constructing isolated and hybrid tfdrtfdu clusters on plasmids in R. eutropha, by activity assays of Tfd enzymes and by HPLC/MS of individual enzymatic catalytic steps in chlorocatechol conversion. R. eutropha containing the tfdu cluster alone or hybrid tfd-clusters with tfdD11 as sole gene for chloromuconate cycloisomerase were impaired in growth on 3-chlorobenzoate. Enzyme activities for TfdDu and for TfdEi1 were very low in R. eutropha when induced with 3-chlorobenzoate. llli contrast, a relatively high enzyme activity was found for TfdFu. Spectral conversion assays with extracts from R. eutropha strains expressing tfdD11 all showed accumulation of a compound with a similar UV spectrum as 2-chloro- cis,cis-muconate from 3-chloro- but not from 4-chlorocatechol. HPLC/MS analysis of 53 in vitro assays in which each individual step in 3-chloro- or 4-chlorocatechol conversion was reproduced by sequentially adding cell extract of an Escherichia coli expressing one Tfd enzyme only, demonstrated that TfdDu was unable to cause conversion of 2-chloromuconate. From these results we conclude that at least TfdD11 is a bottleneck in conversion of 3-chlorocatechol and, therefore in efficient metabolism of 3-chlorobenzoate. This study showed the subtle functional and expression differences between similar enzymes of the !fd-encoded pathway and demonstrated that extreme care has to be taken when inferring functionality from sequence data alone. C.M. Laemmli, R. Schonenberger, M.J.-F. Suter, A.J.B. Zehnder and J.R.van der Mef)r. TfdD11 , one of the two chloromuconate cycloisomerases of Ralstonia eutropha JMP134 (pJP4), cannot efficiently convert 2-chloro- cis,cis-muconate to trans-dienelactone to allow growth on 3- chlorobenzoate. 2002. Arch. Microbiol. DOI l0.1007/s00203-002-0417-3. 54 INTRODUCTION Ralstonia eutropha JMP134 (pJP4) was originally isolated in Australia from an unspecific soil sample. It can use 2,4-dichlorophenoxyacetic acid (2,4-D) and 3-chlorobenzoate (3-CBA) as sole carbon and energy sources (Don, et al. 1985; Don and Pemberton 1985). Fifteen genes are involved in 2,4-D degradation (the tfd genes), which are located within a 22-kb DNA fragment on plasmip pJP4. Among these are tfdA, encoding a a - ketoglutarate-depend~nt dioxygenase (Streber, et al. 1987) which is the first enzyme to atta~k 2,4-D, and tfdB, encoding a 2,4-dichlorophenol hydroxylase catalyztng the conversion of 2,4-dichlorophenol to 3,5- dichlorocatechol (3,5·DCC). A cluster of four genes, tfdCDEF was shown to code for enzyme~ of a so-called modified ortho cleavage pathway, catalyzing the conv1:1rsion of 3,5-DCC to 3-oxoadipate (Perkins, et al. 1990). Degradation qf 3-CBA proceeds similarly, although the first two steps are not encoded by genes on plasmid pJP4. 3-CBA is first oxidized at the 1,2 or 1,6 positiqns by a benzoate dioxygenase (Pieper, et al. 1993). Secondly, a dehydrogenase oxidizes the dihydrodiol to form 3- chlorocatechol (3-CC) and 4-chlorocatechol (4-CC). Approximately two- thirds of 3-CC and one-third of 4-CC are formed from 3-CBA (Pieper, et al. 1993). Further m~tabolism of the generated chlorocatechols is then thought to proceed similarly as for 2,4-D through a modified ortho cleavage pathway, erncoded on plasmid pJP4. Expression of all tfd! genes is regulated by the two identical LysR-type regulatory proteins, TfdR and TfdS (Harker, et al. 1989; Kaphammer, et al. 1990; Leveau and van der Meer 1996; Matrubutham and Harker 1994; You and Ghosal 1995). Tltis does not complete all tfd genes. Another gene was 55 found, called tjdK, which codes for an active 2,4-D transporter at low- micromolar con:centrations of 2,4-D (Leveau, et al. 1997). The tfdR, tfdS and tfdK genes 'lie within a 10.5-kb region flanked by one complete and one partial copy of the IS element ISJP4 (Leveau and van der Meer 1997). Recently, five other genes, named tfdD11C11E 11F 11Bu were discovered between tfdR and tfdK (Laemmli, et al. 2000). Expression studies in Escherichia coli showed that tfdDu codes for a chloromuconate cycloisomerase, tfdC11 for a chlorocatechol 1,2-dioxygenase, tfdEu for a dienelactone hydrolase and tfdFu for a maleylacetate reductase (Laemmli, et al. 2000). This showed that two equivalent sets of genes encoding enzymes for the degradation of chlorocatechols are present on pJP4. Sequence comp:arisons suggested that the two gene clusters were acquired from different origins, because the actual percentage of identical amino acids among the counterparts was rather low (15 to 62%) and the G + C content of the tjdDuCuEuFu genes was significantly higher than that of the tfdCDEF genes (Laemmli, et al. 2000). This raised some questions as to what molecular1 events led to the current situation of two paralogous gene clusters and wh~ch advantages - if any - are presented by the current gene configuration. Previously, we presented evidence suggesting that the genes for the 2,4-D pathway on pJP4 were composed of two different gene fragments of unrelated origin (Laemmli, et al. 2000) by the action of the ISJP4 insertiondement (Leveau and van der Meer 1997). It was suspected that a previously complete regulatory gene tfdT, necessary for activation of transcription fr0m the tfdCDEF genes, was inactivated by the insertion of ISJP4 (Leveau land van der Meer 1996). Therefore, there seems to be a selective advanitage for keeping the current situation, because deletion of the region flan~ed by the ISJP4 copies would lead to loss of tfdR and tfdS, 56 the present regulatory genes for the tfd pathway genes (Laemmli, et al. 2000). We also suspe¢ted that there might be subtle functional differences between the tfdCDEF (in short tfd1) and tfdD,,C,,E,,F,, (in short tfd,,) counterparts. The objective of this s~udy was to compare the function of both tfd1 and tfd11 gene clusters with re~pect to chlorocatechol degradation in R. eutropha. For this purpose, the tfdCDEF genes, the tfdD,,C,,E,,F11 genes and three hybrid gene clusters \\(ere cloned separately into R. eutropha JMP289. With the help of in vivo growth experiments as well as in vitro enzyme reactions, we provide evidence that TfdDn is unable to catalyze the conversion of 2- chloro-cis ,cis-muconate (2-CM) to trans-dienelactone (trans-DL), in contrast to TfdD. As a consequence, four different phenotypes with respect to growth on 3-CBA were observed among the R. eutropha JMP289 derivatives. 57 MATERIALS AND METHODS Bacterial strains and growth conditions R. eutropha JMP134 (pJP4) can use 2,4-D and 3-CBA as sole carbon and energy source {Don, et al. 1985; Don and Pemberton 1985; Don and Pemberton 1981). R. eutropha JMP289 (Don and Pemberton 1985) is a rifampin resistant derivative of R. eutropha JMP134 (pJP4) which was cured of plasmid pJP4. It was used as recipient strain in filter matings with E.coli DH5a (Sambrook, et al. 1989) harboring pKT230-derived plasmids and E. coli HB 101 (pRK2013) as helper strain (Ditta, et al. 1980). E.coli BL21 (DE3) (pLysS) (Studier and Moffatt 1986), which carries the T7 RNA polymerase gene under control of the lacUV5 promoter, was used for the T7-directed expression of pRSET6a-derived plasmids (Schoepfer 1993). E.coli aultures were grown at 37°C in Luria-Bertani (LB) medium supplemented with the appropriate antibiotic (at 100 µg/ml). R. eutropha cultures were grown at 30°C in nutrient broth (Biolife, Milan, Italy) or in Pseudomonas mineral medium (MM) (Gerhardt, et al. 1981) supplemented with 10 mM frl!lctose, l, 3 or 5 mM 3-CBA plus the appropriate antibiotic (at 100 µg/ml). Growth was followed by measuring the optical density at 546 nm (OD 546 ~. In order to correct for the dark color produced by some strains during irowth on 3-CBA, culture samples were centrifuged for 1 min at 13'000 rpm and the OD546 of the supernatant was subtracted from the total OD546 value. 58 DNA manipulatio;ns Plasmid DNA isolatjons, transformations and other DNA manipulations were carried out according to established procedures (Sambrook, et al. 1989). Restriction enzymes and other DNA modifying enzymes were obtained from Amersham Life Science (Cleveland Ohio, USA) or GIBCO/BRL Life 'Technologies Inc. (Gaithersburg, Md.) and used according to the specifications of the manufacturer. Oligonucleotides for the polymerase chain reaction (PCR) were obtained from Microsynth GmbH (Balgach, Switzerland). The PCR mixtures contained 200 pmol of each primer per ml, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 0.05% (v/v) of W-1, 2 mM MgCl2 , 0.25 mM of each deoxynucleoside triphosphate and 30 U of Taq DNA polymerase (Life Technologies) per mL DNA sequencing was performed as described previously (Ravatn, et al. 1998b). Computer analysis of the DNA sequences was done with the DNASTAR software (DNASTAR Inc., Madison, WI, USA). Plasmids The most relevant plasmids constructed in this work are depicted in Fig. I. Plasmids pUC18, pUC19 (Yanisch-Perron, et al. 1985), pUC28 (Benes, et al. 1993), pGEM®-T Easy, pGEM-7Zf(+) (Promega, Madison, Wis., USA) and the expression v¢ctor pET3c (Studier and Moffatt 1986) were used as general cloning vectors. Plasmid pKT230 (Bagdasarian, et al. 1981) is a mobilizable, broad-host-range vector. All fragments amplified by using the PCR were sequenced to exclude undesired mutations. For in vivo expression studies, we constructed several pKT230-derived plasmids with different combinations of the tfd genes from pJP4. Plasmid pCBA59 contains the hybrid regulon tfdR-CDEF as described previously 59 (Leveau and van der Meer 1996). In order to clone the cluster tfdR- D1iCuEuFu intoipKT230, a 6.9-kb Sacl fragment of pJP4 was first cloned into pUC, whiqh resulted in plasmid pCBA89. A 6.5-kb HindIII-Bglll fragment was retrieved from pCBA89 and cloned into pKT230 cut with HindIII and BamHI, yielding plasmid pCBA93. The tfdR-D1iCuEuFu cluster was extended with tfdD as follows. The tfdD gene was amplified by using the Jl>CR with the forward primer (980104, 5 ' - CGGGTACCCAGGCGGGGGCAAACC-3') and the reverse primer (980103, 5'-TTGGCTAGCTGACGCGTGCGTATTGG-3') and subsequently clctmed into pGEM®-T Easy. This resulted ini plasmid pCBA127. The Kpnl-Nhel fragment of pCBA127 (containing tfdD) was retrieved and cloned into Kpnl-Nhel-digested pCBA93. This yielded plasmid pCBA129 containing the tfdR-D1iCuEuFu regulon extended with the tfdD gene. The tfdDu gene on pCBA129 was knocked out by digesting pCBAl 18 with Saeli. Religation resulted in plasmid pCBA217 in which the 230-bp Saeli fragment at the end of tfdD11 was missing. The Xbal-Bglll fragment of pCBA129 was then replaced with the Xbal-Bgll~ fragment of pCBA217, which resulted in plasmid pCBA220. Four other hybrid regulons were constructed, in which the tfdD gene of tfdR-CDEF was replaced by different variants of tfdD11 (Fig. 1). First of all, the tfdC and tjdD11 open reading frames were linked together. This was achieved by cn~ating an Ndel site at the 3' end of the tfdC gene. For this purpose, the end of tfdC was custom amplified with primers 980501 ( 5 ' - GCGGAATTdCGTTGACCACGCAGT ACTACTTCG-3 ') and 980502 (5 '-GCGCAT ATGTCACGGGTTTGCCCCCGCCGTC-3 ') using plasmid pCBA4 (Leveau and van der Meer 1996) as template, cut with EcoRI and 60 I kb (ifdB[/) Hindlil ~Sad (BglH/B(lfnHI pCBA59 L·_·_·] ifdR ~'23ll ifdFJ (1/dBl) pCBA135 Hindlll w~1:1~-- ifdR (fdFJ pCBA136 '- ---~ I pCBA141 pCBA150 Bg!!I Xbt1I Nt:ol Sad! ~coRI m~Dll) I I (fdCIT IL~:!!.Jr;ub9 pCBA217 BgfH pCBA220 {Bt1mHl!Bglll) Xbul NroI Saeli EcnRt 1 ~~(-lfd_B_II_)~-'r"-"~lfi-i!D-J~-1'f e1 r_-_-_-""I _lfi_i!_R ~, ·, (tj~Dlli I ifdCf[ ifdEII lfdFI/ I I .. fiii<"T230 Figure 1 Maps of the most relevant plasmid constructs used in this study. All plasmids depicted here except pC8A59 were constructed as described in Materials and Methods. pCBA59 was constructttd previously (Leveau and van der Meer 1996). For each plasmid the vector as well as the restriction sites relevant to the construction are indicated. The boxes rcp:resent genes, whereas the dashed boxes point to non-coding pJP4 DNA. A gene nam<1 in brackets indicates that the gene is uncomplete. Restriction sites in brackets indicate sites destroyed during cloning, 61 Ndel and ligated with pUC28, cut with the same enzymes (yielding pCBA133). Sectmdly, an Ndel site was created at the start of the tfdDu open reading fra:me and a BamHI site at the end of the tfdDu fragment. The different PCR frragments were then digested with Ndel and BamHI and cloned into Ndel-BamHI of pCBA133. This resulted in pCBA134, pCBA145, pCBA164 and pCBA149. Fig. 2A depicts the sequences of the links between the tfdC and tfdDu open reading frames. The tfdDu-fragment of pCBA134 was amplified with primers 971202 and 971201, that of pCBA145 and pCBA164 with 971202 and 980707, and that of pCBA149 with 971203 an.ct 980707 (Fig. 2B). Additionally, the tfdD11 fragments of pCBA164 and pCBA149 contain a frameshift mutation due to an additional cytosin introduced by the PCR using primer 981004 (Fig. 2B). One complete hybrid regulon was then assembled from pCBAl34, by first cutting with MluI and HindIII and ligating the MluI-HindIII fragment containing tfdEF and part of ({dB from pCBA4. This yielded pCBA135. A three-point ligation including the HindIII-ScaI fragment of pCBA59, the Seal-Sad fragment of pCBA135 and pUC19, cut with Hindlll and Sad, resulted in pCBA136, in which tfdR-tfdCDuEF and part of tfdB were combined (Fig.1). ln order to be able to create the hybrid regulons with the other tfdD11 fragments, we first created pCBA141 from pCBA136 by digesting with Xbal, Kienow DNA polymerase treatment, digestion with SacI and recovering the resulting tfdR-CDu fragment. This was ligated with pGEM7Z(+), which was digested similarly (yielding pCBA141). The Ndel-Xbal (fdDu fragment from pCBA145 was then used to replace the Ndel-Xbal fragment (yielding pCBA147). Finally, the SacI-Xbal tfdR-CD11 fragment from pCBA136 was replaced with the SacI-XbaI from pCBA147 resulting in pC~A146. From pCBA146 the tfdR-CDllEF SacI fragment was 62 A a Nqei 5 -CCCGCGCGTGCGCAGGCGGGGGCAAACCCGTGACAT~TGCTCACAGAAAAAGCCATTGCCGACAGCCCC-3 ---- j------+ +------p A R A Q A G A N P M L T E K A A D S P ------tJi!C . __---=:::J tfdD!l-1 b Ndei 5 -CCCGCGCGTGCGCAGGCGGGGGCAAACCCGTGACATATGCAGATCGAAGCGATCGAAACGGTGATCGTC-3 -----+-----+------· - ---+ --+------+------p A R A Q A G A N P M Q I E A I E T V I V ------@(: -====-J 1----- tf"dDTf-2 B ~9~71=2=02~-- CA'T'-----.,_ GGCATTTCTAGACTACCGCC~TGCTCACAGAAAAAGCCATTGCCGACAGCCCCAACGGCGGCGACGCCGAT +------+------+------+ --+ CCGTAAAGATCTGATGGCGGTACGAGTGTCTTTTTCGGTAACGGCTGTCGGGGTTGCCGCCGCTGCGGCTA M L T E K A A D S P N G G D A D I MLTEKA ADSPNGGDAD2 3 981004 971203 CATAT -4-----C I CGCAAGGCGGCGCAGATCG~GCGATCGA TGCATCGATCGAGTCGCTGCCTACGGGGGCGA ------+-----+------[... ] --+-----+------+---- GCGTTCCGCCGCGTCTAGCT,TCGCTAGCT ACGTAGCTAGCTCAGCGACGGATGCCCCCGCT R K A A Q E A I E A S I E S L P T G A I R K A A Q I E A I E A S I E S L PT iGl G IE12 V K I D A I E s T v p s L p F L_g_J c W3 ------A-G---9~7~1=20~1 AGTCATCGGGCCCTTGCTGATCGAGGAGGACCTGTGCGAAGTCCCCGCGGTCTACAAGGAACATGCCCTGT +-----+------+------+--- -I + TCAGTAGCCCGGGAACGACTAGCTCCTCCTGGACACGCTTCAGGGGCGCCAGATGTTCCTTGTACGGGACA K S S G P C , v~P"lL Lr EE ol:LJc E v!PIA v Y KEH AILlw L l!____g__!'J F V L A D T lb S H E L!'J L E I R D Y E LkJ Q GGCTCCCCGAAGGCCCGGGCCTCGGAATCCGACTCGACGAGAACCAGGTGCGGCGCTTCGCGCGTGCTTCG CCGAGGGGCTTCCGGGCCCG,GAGCCTTAGGCTGAGCTGCTCTTGGTCCACGCCGCGAAGCGCGCACGAAGC L fPl E fGl P [GJ L IGJ I R [L D E_J N Q IV"lfl R F ~-R A [Sl. V L!'J T LJ;J V Ji_ H lJ; M T b___JL_Jl_ D K l_\l____JU Q Y i_A__ JU V W. ------cc 980707 TCCCAGCGCATCGATCGTCACAGCGCCTGAGCGCCACATCCACCCGATTCATCTTTTTTGAAGAGAAAGCA ----+- 1-- -+- AGGGTCGCGTAGCTAGCAGTGTCGCGGACTCGCGGTGTAGGTGGGCTAAGTAGAAAAAACTTCTCTTTCGT Figure 2 DNA sequences of the links between the open reading frames of tfdC and tfdDu. A Link of plasmid pCBA150 and pCBAJ61 (upper part) and plasmid pCBA168 (lower part). B Part of the sequence of tfdDu showing the location of the primers used to construct the different 'tfdD 11 fragments (GeneBank accession number no. Ul6782). Amino acid translations are given below the DNA sequence for the wild-type TfdDn (n°1), TfdDn with frame shift mutation at position 2629 (n°2) and for wild-type TfdD (n°3, GenBank accession number no. M35097). The boxes surround identical amino acids between TfdDn with frame shift mutation and TfdD from the point of mutation onwards. 63 introduced in the Sacl site of vector pKT230 (yielding pCBA150). Similarly, pCBA 161 and pCBA 168, containing a tfdDu fragment with different start site and start site plus frameshift at the end (Fig. 2), respectively, were constructed. Filter mating pKT230-derived plasmids were transferred to R. eutropha JMP289 by conjugation. Overnight cultures of the E. coli strains harboring the pKT230-derived plasmids, the helper strain E.coli HBlOl (pRK2013) and the recipient strain R. eutropha JMP289 were mixed in a ratio 5/1/1, respectively. 500 µl of the mixture was centrifuged for 1 min at 5,500 rpm and 400 µl of the supernatant were removed. The 100 µl left were used to resuspend the cells and were pipetted onto a 0.45-µm-pore-size cellulose nitrate filter (Sartorius AG, Gottingen, Germany), which was placed on an LB-Agar plate. The plates were then incubated at 30°C overnight. Subsequently, the cells were washed from the filters with 1 ml MM by vortexing. 100 flll suspensions of appropriate dilutions were plated on MM- agar plates sup~lemented with 10 mM fructose, rifampicin (25 µg/ml) and either streptomycin or kanamycin (at 100 µg/ml) to select for the presence of the pKT230-derived plasmid in R. eutropha. Colonies of potential transconjugants were inoculated in nutrient browth plus antibiotics and subsequently purified by streaking on selective agar plates. Plasmid DNA was isolated and analyzed by gel electrophoresis. Induction of tfd gene expression R. eutropha JMP289 strains harboring pKT230-derived plasmids were grown in 50 ml MM supplemented with 10 mM fructose to an OD546 of 64 between 0 .8 and 0 .9. To induce expression of the tfd genes, 3-CBA was added to a final conoentration of 1 mM and strains were incubated for an additional 2 h. RNA was then isolated from 1.5 ml samples as described previously (Baumann, et al. 1996). DNasel-treated RNA samples were spotted on Hybond N+ membranes and hybridized with biotin-labeled antisense RNAs for e~ch of the tfdu genes, as described elsewhere (Leveau, et al. 1999). Spot densities were measured by using the program METAVIEW (Version 4.1, Universal Imaging Corporation, Visitron Systems, Germany), subtracted with the background density obtained in hybridizations with RNA from R. eutropha JMP289, normalized for differences in total amount of RNA, and expressed relative to a dilution series of plasmid DNA (plasmid pCBA59 for antisense probes tfdCD and tfdF; plasmid pCBA93 for antisense probes tfdCu and tfdFu). From the same cultures, 50 ml were centrifuged for 15 min at 5'300 rpm at 4°C, washed with 50 1ml 20 mM Tris-HCI pH 7 and resuspended in 1 ml 20 mM Tris-HCI pH 7. The cell suspensions were sonified (Branson Sonifier 450, SCAN AG, Basel, Switzerland) five times for 15 s each on ice, at an output of 30 to 40 W, with at least 1 min pause between each repetition. Subsequently, the suspensions were centrifuged at 4 °C for 30 min at 15'000 rpm. The resulting supernatants, referred to as cell extracts, were used in enzyme assays and in conversion experiments (see below). Enzyme assays for chlorocatechol 1,2-dioxygenase, chloromuconate cycloisomerase, dienelactone hydrolase and maleylacetate reductase were performed by spectrophotometric methods as described previously (Laemmli, et al. 2000). As substrates we used 3-CC, 3-CM, cis-DL and maleylacetate (MA) respectively. No additional dienelactone hydro lase was added to assay cycloisomerisation of muconates. 65 Expression in E.coli. The preparation of cell extracts of E. coli BL21 (DE3) (pLysS) strains harboring pRSET6a-derived plasmids and enzyme assays were carried out as described previously (Laemmli, et al. 2000). The sole difference was that the washing buffer contained 20 mM ammonium acetate and 1 mM MnC1 2 • Extinction coefficients were taken from Dorn and Knackmuss (Dorn and Knackmuss 1978). Protein concentrations were determined as described by Bradford (Bradford 1976), using bovine serum albumin as a standard. Conversion reactions with R. eutropha cell extracts Conversion of 3-CC and 4-CC by cell extracts of R. eutropha JMP289 strains harboring pKT230-derived plasmids was followed spectrophotometrically in 0 .5 ml quartz cuvettes. Reaction mixtures contained 20 mM Tris-HCI pH 7, 1 mM MnS04 and 0.1 mM substrate. The conversion reaction was started by the addition of cell extract (containing between 0.05 and 0.2 mg of protein). Spectral changes were monitored by scanning the absorption of the reaction mixtures between 200 and 350 nm at different time intervals. Preparation of samples for HPLC /MS analysis In order to study the stepwise conversion of 3-CC and 4-CC by the Tfd1 and Tfdu enzymes, the following reactions were setup. Different combinations of cell extracts of E. coli BL21 (DE3) (pLysS) strains harboring pRSET6a-derived plasmids were added to reaction mixtures containing 20 mM ammonium acetate (pH 7), 1 mM MnC1 2 and 1 mM of substrate (3-CC or 4-CC) in a final volume of 0.5 ml. An amount of 50 µl 66 of each cell extract was added which corresponded to about 0.1 to 0.7 mg of protein. Subsequently, the samples were incubated with shaking at 200 rpm for 2 hat 30°C. The reactions were then stopped by the addition of 30 µl hydrochloric acid (37%), which led to precipitation of all proteins, and centrifuged at 13'000 rpm for 15 min at 4°C. The supernatants were transferred into clean vials and analyzed immediately by HPLC I MS. HPLC/UV/MS As standards I mM 2-chloro-cis,cis-muconate (2-CM) and I mM 3-chloro- cis,cis-muconate (3-CM), acidified by the addition of 30 µl hydrochloric acid (37%) to 0.5 ml substrate, were used. All solvents were HPLC-grade (Scharlau, Barcelona, Spain) and filtered before use (0.2 µm). The HPLC used for LC/MS was a Hewlett Packard Series I 100 (Hewlett Packard Schweiz AG, Urdorf, Switzerland) with a variable wavelength UV detector, set to 268 nm. The HPLC column (125x2 mm) used was a Nucleosil 120-3, with 3 µm particles (Macherey Nagel AG, Oensingen, Switzerland). Eluent A was 12 mM phosphate buffer, pH 2.3, and eluent B methanol. The eluents were degassed using an on-line degasser DG4 from Henggeler Analytic Instruments (Riehen, Switzerland). The column was conditioned for 5 min with eluent of initial composition (80% A). The initial conditions were kept for the first 15 min of the run and then changed to 0% A in 5 min. These conditions were kept for IO min. The initial conditions were then reestablished within 5 min and the column reequilibrated for another 5 min, giving a total running time of 40 min. The flow rate through the column was 150 µl/min. The column was kept at 32°C. 50 µl sample volumes were injected. 67 Mass Spectrometry (MS) All mass spectra were acquired on a Platform LC single quadrupole mass spectrometer, using electrospray ionization (Micromass UK Ltd., Manchester, UK). Full scan spectra were acquired in negative ion mode, scanning from m/z 50 - 400 at 1 s/scan. The mass range was calibrated and the sensitivity of the instrument tested using 2.5 mM NaN03 infused at a flow rate of 70 µI/min. The electrospray interface temperature was set to 150°C, and the nitrogen gas flow to 500 l/h. The needle and cone voltages were optimized to give maximum signal intensity for the target analyte signal and were -5kV and - IOV, respectively. The so-called "pepper pot" was used as counter electrode for all experiments. Low and High Mass Resolution of the quadrupole was set to 12.0 and 16.5, respectively, and the Ion Energy to 1, giving roughly unit mass resolution over the whole mass range. The multiplier was operated at 750 V. Chemicals 3-CC (purity 99%) and 4-CC (purity 95-99%) were purchased from Promochem (Wesel, Germany). 2-CM, 3-CM, cis- and trans-dienelactone (cis-DL, trans-DL) were a kind gift of Dr. Walter Reineke (Bergische Universitlit-Gesamthochschule Wuppertal, Wuppertal, Germany). Maleylacetate was prepared by alkaline hydrolysis of cis-DL (Evans, et al. 1971) by mixing 1 ml of 5 mM cis-DL with 7.5 µl of 2N NaOH and incubating for 15 min at room temperature. 68 RESULTS TfdDm but not TfdD, is limiting growth on 3·chlorobenzoate by R. eutropha JMP289 tfd-derivatives Surprisingly, independent expression of the homologous gene clusters tfd1 and tfdn in R. eutropha JMP289 revealed two opposite phenotypes with respect to growth on 3-CBA. Whereas introduction of plasmid pCBA59 (tfd1) into R. eutropha JMP289 allowed growth on 5 mM 3-CBA (Fig. 3A), R. eutropha JMP289 expressing the tfdn gene cluster from plasmid pCBA93 was unable to use 3-CBA as sole carbon and energy source for growth (Fig. 3B). This phenotype was partially overcome by adding tfdD at the end of the tfdu gene cluster. Expression of the resulting hybrid gene cluster tfdR-D11CuE11F1,(B11)D in R. eutropha JMP289 (pCBAI29) allowed the strain to use up to 3 mM 3-CBA as growth substrate (Fig. 3D). Surprisingly, the lag phases observed during growth of this strain on 3 mM 3-CBA varied between 30 and 120 h (data not shown). No growth was obtained with 5 mM 3-CBA. Addition of tfdD had a positive effect on growth with 3-CBA indicating that the inability of the tfdu cluster to allow growth on 3-CBA has, at least partially, to do with TfdD11 • When the tfdD gene within the tfd1 cluster was exchanged for tfdDu (i.e., tfdR-CD11EF(B)) R. eutropha JMP289 (pCBAl50) could still grow with I mM 3-CBA (Fig. 3C), but not with 3 or 5 mM 3-CBA. This suggested that the chloromuconate cycloisomerase encoded by tfdDn was not as efficient as that encoded by tfdD in converting 2-CM or 3-CM, the intermediates arising from 3-CBA. Knocking out tfdDu on plasmid pCBA129 (i.e., tfdR- C11EnF11( Bu)D) as in plasmid pCBA220, allowed growth of R. eutropha 69 JMP289 on 1 mM 3-CBA, but no longer on 3 mM (Fig. 3E). This difference suggested at least some supportive role of TfdDn. 0.8 A o.s 0.7 0.7 c 0.6 ··~··. . • 0.6 ~ 0.5 ~ 0.5 ;s 0.4 0.4 0 § 0.3 0.3 0.2 0.2 0.1 0.1 •oo Q Q -6------< ~ 0 0 <>e:::e:: 0 50 JOO 150 200 250 0 50 100 150 200 250 Time(h) Time(h) 0.8 0.8 0.7 B 0.7 D 0.6 0.6 ~ 0.5 ~ 0.5 ;s 0.4 ;s 0.4 0 0 0.3 0.3 02 . . 0.2 . O.l O.l I ,1 . . CJ'9•Qe< .,... DD 0 0 II a a a D 0 50 100 150 200 250 0 50 100 150 200 250 Time(h) Time(h) 0.8 0.7 E 0.6 ~ 0.5 § 04 0.3 0.2 0.1 • r :t ~ • ~ ~ 0 .iP~ 11 a 0 50 JOO 150 200 250 Time(h) Figure 3 Growth of R. eutropha JMP289 tfd-derivatives on 3-CBA. A strain R. eutropha JMP289 (pCBA59), B strain R. eutropha JMP289 (pCBA93), C strain R. eutropha JMP289 (pCBA150), D strain R. eutropha JMP289 (pCBA129) and E strain R. eutropha JMP289 (pCBA220). The data points represent the average of at least three independent exp~riments (except for pCBA59; duplicate and pCBA129, one representative curve). Error bars on the x-axis represent the time range differences, whereas those on ~he y-axis show the minimum and maximum OD546 measured within the given time range. Symbols: 4, 5 mM 3-CBA, e, 3 mM 3-CBA, •. 1 mM 3-CBA, D, no 3-CBA. 70 Expression patterns of the tfd genes in the R eutropha JMP289 tfd derivatives In order to measure if any of the enzymes involved in chlorocatechol metabolism was impaired, cell extracts from all R. eutropha JMP289 tfd derivatives were assayed for chlorocatechol 1,2-dioxygenase, chloromuconate cycloisomerase, dienelactone hydrolase and maleylacetate reductase activity. Cell extracts of R. eutropha JMP289 and R. eutropha JMP134 induced with 3-CBA were used as negative and positive controls, respectively. The specific enzyme activities, after induction with 3-CBA, revealed two distinct enzyme patterns for the expression of the tfd1 cluster and the tfdu cluster (Fig. 4). Strains expressing only the tfd1 cluster generally displayed relatively high levels of chlorocatechol 1,2- dioxygenase, chlorornuconate cycloisomerase and dienelactone hydrolase compared to maleylacetate reductase. For example, R. eutropha JMP289 (pCBA59) expressed 38 mU·(mg·protein)"1 chlorocatechol 1,2- dioxygenase, 27 mU·(mg·protein)"1 chloromuconate cycloisomerase, 112 mU·(mg·protein)"1 dienelactone hydrolase but only 1 mU·(mg·protein)"1 maleylacetate reductase activity. On the other hand, strains expressing the tfdu cluster displayed low activities of chlorocatechol 1,2-dioxygenase, chloromuconate cycloisomerase and dienelactone hydrolase compared to relatively high maleylacetate reductase activities. For example, only 10 mU·(mg·protein)"1 chlorocatechol 1,2-dioxygenase, 6.4 mU·(mg·protein)"1 chloromuconate cycloisomerase and 6 mU·(mg·protein)"1 dienelactone hydrolase activity was measured in R. eutropha JMP289 (pCBA93), 1 whereas maleylacetate reductase activity measured 285 mU·(mg·protein)" , and was thereby higher than that encoded by the tfdrcluster. Clearly, all measured enzyme activities were absent in strain JMP289 itself and the 71 A 310 260 210 160 110 60 pCBA220 -40 (tfdR-CDuEF) (tfdR·C/lE/lF/[11) pCBAl29 JMP289 JMPl34 (tfdR-DuCuEuF11/1) B tfd(:D tfdF pCBA59 pCBAl29 JMPl34 pCBA93 pCBA 150 JMP289 c 1.2 1.0 ] 0.8 = ·~ 0.6 -~ 0.4 ~ "' 0.2 0 -0.2 pCBA59 pCBAl50 -0. (tfdR·CDEF) (tfdR-CDuEF) 4 pCBA93 JMP289 JMP134 (tfdR-DuCuEuFu) 72 Figure 4 A Specific enzyme activity encoded by the tfd genes as measured in total cell extracts of R. eutropha JMP289 tfd derivatives. I mU corresponds to I nmol of substrate disappearance or product formation per min. Open bars, chlorocatechol l ,2- dioxygenase activity, stippled bars, chloromuconate cycloisomerase, hatched bars dienelactone hydrolase and black bars, maleylacetate reductase activity. B Transcription of the tfd genes of the different R. eutropha strains after induction with 3- chlorobenzoate. Antisense mRNA probes used for hybridization are indicated on the left. Note that the tfdC11 probe partially overlaps with the tfdD 11 gene. C Average expression levels normalized to a plasmid DNA standard and to differences in total RNA amounts. Relative levels of tfdCD to tfdF and of tfdC11 and tfdF11 can be compared between the different strains. Open bars, tfdCD probe, black bars, tfdF probe, grey bars, tfdC11 probe, black and white striped bars, tfdF" probe. Error bars in panels A and C indicate the average deviation from the average in three independent experiments. activity pattern measured in cell extracts of R. eutropha JMP134 was more or less a combination of both tfdr and tfd1rtype patterns (Fig. 4), The expression patterns of the tfd1 and the ~fdu hybrid clusters showed only few apparent changes compared to the wild-type clusters, thereby not directly revealing the reasons for the observed growth differences. For example, strains JMP289 (pCBA129) and JMP289 (pCBA220) showed the same enzyme activity pattern as R. eutropha JMP289 (pCBA93) (Fig. 4), although their phenotypes with respect to 3-CBA differed considerably (Fig. 3D, E). The activity pattern of strain JMP289 (pCBA150) strongly resembled that of JMP289 (pCBA59) (i.e., the tfd1 cluster), except for its 4.4 times higher ohlorocatechol 1,2-dioxygenase activity. With 166 1 mU·(mg·proteinY , JMP289 (pCBA150) had the highest chlorocatechol 1,2-dioxygenase activity of all strains. We presume that this high activity is the result of an accumulation of the inducer 2-CM, leading to overexpression of the tfdCDuEF genes (Fig. 4B). Accumulation of 2-CM probably takes place, because TfdDn is not converting it at measurable rates (see below). The high chlorocatechol 1,2-dioxygenase activity explains the fact that this strain was not accumulating chlorocatechols and becoming brown, although having difficulties to grow on 3-CBA. 73 Conversion of 3- and 4-chlorocatechol by cell extracts of R. eutropha JMP289 derivatives Since metabolism of 3-CBA by R. eutropha JMP134 and JMP289 leads to a mixture of 3~CC and 4-CC (Pieper, et al. 1993), it was necessary to consider both degradation pathways individually, when analyzing the function of the Tfd1 and Tfd11 enzymes during 3-CBA degradation. Therefore, in vitro assays were setup, in which the turnover of 3- and 4-CC by total cell extracts of the R. eutropha JMP289 ifd-derivatives was followed over time with a spectrophotometer. Incubation of 3-CC with cell extracts of R. eutropha JMP289 (pCBA59) or R. eutropha JMP134 led both first to the appearance of a peak at 260 nm, which later disappeared (Fig. 5A, D), although the spectra were not identical. These changes were indicative for complete disappearance of 3-CC. Incubation of R. eutropha JMP289 (pCBA150) with 3-CC produced a peak with maximum at 260 nm within 4 min, which remained constant overnight (Fig. 5C). This spectrum resembled strongly that of 2-CM. Similarly, but with slower rate, a peak appeared at 260 nm during incubation of cell extracts of R. eutropha JMP289 (pCBA93), R. eutropha JMP289 (pCBA129) and R. eutropha JMP289 (pCBA220) with 3-CC (Fig. 5B, E, F, respectively). Although this peak disappeared slowly again it was still visible in the overnight spectra. Seemingly, a c<:>mpound with a maximum at 260 nm, which we propose to be 2-CM, the only compound in the 3-CC degradation pathway with an absorption maximum at 260 nm, was accumulated in R. eutropha JMP289 (pCBA150), R. eutropha JMP289 (pCBA93), R. eutropha JMP289 (pCBA129) and R. eutropha JMP289 (pCBA220). These strains all expressed TfdDn as sole chloromuconate cycloisomerase except for R. eutropha JMP289 (pCBA129), which additionally expressed TfdDI' 74 Therefore, it seems that TfdDn unable or very inefficient in catalyzing conversion of 2-CM. No such difference was observed between both chloromuconate cycloisomerases with respect to 3-CM turnover (data not shown). 1.5 A E j 0 1.5 B D F 0 200 240 275 310 350 200 240 275 310 350 200 240 275 310 350 Wavelength (nm) Wavelength (nm) Wavelength (nm) Figure 5 Turnover of 3-chlorocatechol by total cell extracts of R. eutropha JMP289 tfd- derivatives, as observed from UV spectra recorded after different incubation times. The characteristic absorption maxima (A.max) of possible intermediates are as follows: 2- CM, 267 nm (Dorn and Knackmuss 1978), 3-CM, 259 nm (Dorn and Knackmuss 1978), trans-DL, 274 nm (Blasco 1995), protoanemonin, 260 nm (Blasco 1995) and maleylacetate, 243 nm (Blasco 1995). AR. eutropha JMP289 (pCBA59), BR. eutropha JMP289 (pCBA93), CR. eutropha JMP289 (pCBA150), DR. eutropha JMP134, ER. eutropha JMP289 (pCBA129), FR. eutropha JMP289 (pCBA220). Incubation times are indicated for each spectrum; o/n, overnight incubation. TfdD11 is the bottleneck during conversion of 3-CC As shown above, the conversion of 3-CC by all R. eutropha JMP289 tfd- derivatives except JMP289 (pCBA59) led to the accumulation of a 75 compound with a UV spectrum resembling that of 2-CM, but did not allow identification of this compound. We therefore relied on HPLC/mass spectrometry (LC/MS), for step-by-step analysis of the products formed during degradation of 3- and 4-CC by cell extracts of E. coli BL21 expressing each of the tfd1 and tfdfl genes individually. The standard 3-CC was detected by HPLC as a peak eluting at 19 .25 min (Fig. 6A). Strangely, the 2-CM preparation resulted in two peaks (9.98 min and 15.87 min), both with a molecular mass of 175 (Fig. 6B) and an isotope pattern clearly indicating the presence of one chlorine atom (data not shown). One of them may correspond to ( + )-2-chloro-cis,trans-muconate, a compound formed spontaneously from 2-CM under acidic conditions (pH below 1) (M. Schlomann, Universitiit Freiberg, Germany, pers. communication). After incubation of cell extracts of E. coli BL21 expressing either tfdC or tfdC11 with 3-CC, two peaks with a molecular mass of 175 were detected similar to those obtained by the standard 2-CM (Fig. 6C and 60, spectra a). In both cases, further addition of cell extracts of E.coli BL21 expressing tfdD led to disappearance of the 2-CM peaks and appearance of a peak eluting around 6 min (Fig. 6C, spectrum band 6E). Unfortunately, this peak could not be identified by HPLC due to unavailability of an appropriate standard. Its molecular mass of 17 5 and its isotope pattern suggest that this peak corresponds to ( + )-5-chloromuconolactone. On the other hand, after incubation of 3-CC with cell extracts of E. coli BL21 expressing tfdC or tfdCu and cell extracts of E. coli BL21 expressing tfdD11 the two 2-CM peaks remained (Fig. 60, spectrum b and 6F, spectrum a). When E. coli cell extract containing TfdO was added to this mixture, the two peaks indicative for 2-CM disappeared and a peak at 6.18 min was detected (Fig. 6G, spectrum a). Both dienelactone hydrolases, TfdE and TfdEn, were able 76 100% 15.87 B '00] lA 9.98 0 0 10 20 Time [min] 0 20 Time [min] 10.08 9.77 .7 6.54 100% c 100% D a 4.76 9.96 E 100% 4.7 F 100%u '" ======~==== 00 10 20 Time [min] 10 20 Time [min] 4.69 100% G H 100%l 6.18 ~~,...... ,...,..,.~,,_.,...... ,...... ,...,..,._.,.;;a 4.79 o~?J/02:>: ''""'/ > <·><.>§:/ Ot==,,.c;co~~======O ~10 20 Time [min] 0 10 20 Timi;! [min] Figure 6 Product analysis of 3-CC transformations by cell extracts of E. coli BL21 expressing tfd1 and tfd11 genes individually analyzed by LC/MS. Shown are the reconstructed ion chromatograms (RIC) for a molecularmass of 175, except for panel A, where the RIC for a molecular mass of 241 is displayed. 100% peak height is a relative value different for each spectrum and should not be compared between spectra. The peak at 4.8 min is caused by the LC/MS matrix. Panels A 3-CC; B 2-CM; C incubation of 3-CC with cell extracts of E.coli BL21 expressing TfdC (spectrum a), TfdC plus TfdD (spectrum b), TfdC, TfdD plus TfdE (c); D incubation with TfdCu alone (a), TfdCu plus TfdDu (b), TfdCu, TfdDu plus TfdEu (c); E incubation with TfdCu plus TfdD; F incubation with TfdC plus TfdDn (a), TfdC, TfdDu plus TfdE (b); G incubation with TfdCu, TfdDu plus TfdD (a), TfdCu, TfdDu, TfdD plus TfdE (b); H incubation with TfdC, TfdD plus TfdEu. 77 to catalyze a transformation leading to disappearance of this '6 min' peak (Fig. 6G, spectrum b, 6H). However, adding TfdE or TfdEn to the preparation with TfdC and TfdD11 or TfdCu and TfdD11 , respectively, did not result in any change of the 2-CM peaks (Fig. 6F, spectrum band 6D, spectrum c). In contrast to 3-CC no accumulation was observed for the transformation of 4-CC by the Tfd1 and Tfdu enzymes (data not shown). These results confirmed the spectral observations that TfdDn was not able to efficiently catalyze transformation of 2-CM, and confirmed our hypothesis that TfdDn was a bottleneck in 3-CC degradation. TfdD11 is comparably shorter than TfdD Interestingly, close inspection of both open reading frames of tfdDu and tfdD, and comparison of the encoded peptides indicated that tfdDu has a relatively poor ribosome binding site and an internal frameshift compared to tfdD (Fig. 2B). To determine if changing the start site and correcting the frameshift would produce chloromuconate cycloisomerases more active with 2-CM, we constructed plasmids pCBA161 and pCBA168 and introduced them into R. eutropha JMP289. However, no differences were observed between R. eutropha JMP289 (pCBA150) and R. eutropha harboring pCBA161 or pCBA168, with respect to growth on 5 mM 3-CBA and activity of the tfd pathway enzymes (data not shown). Similarly, overexpression of both TfdDu variants in E. coli BL21 did not result in increase of chloromuconate cycloisomerase activity on 2-CM (data not shown). Therefore, we concluded that the internal frameshift in tfdDu compared to tfdD could not be the reason for the observed specificity differences. 78 DISCUSSION The finding that the second set of chlorocatechol degrading genes (tfdu- genes) was transcribed in R. eutropha JMP134 during growth with 2,4-D (Leveau, et al. 1999) and encoded functional chlorocatechol degrading enzymes (Perez-Pantoja, et al. 2000; Laemmli, et al. 2000), demonstrated that two functional pathways for degradation of chlorophenols and chlorocatechols existed in R. eutropha JMP134. At this point the question arose as to what the specific nature and use of each of the tfd genes for growth on chlorinated substrates could be. Previous studies (Leveau, et al. 1999; Laemmli, et al. 2000; Perez-Pantoja, et al. 2000) led us to believe that the tfd1 and tfdu clusters are fully isofunctional, even though the sequence differences are substantial (Laemmli, et al. 2000). However, the results of this work indicate that this is not completely correct. As expected, expression of the tfd1 cluster in R. eutropha JMP289 allows growth on 3-CBA, whereas cells with the tfdu cluster cannot grow. These results differ from those obtained by Perez-Pantoja (Perez-Pantoja, et al. 2000) who described that both clusters allowed growth of R. eutropha on 3-CBA, although they also observed that expression of the tfd1 cluster resulted in more efficient growth on 3-CBA. Furthermore, they observed that plasmids with the tfdu cluster did not allow growth on 3-CBA in P. putida. They proposed that the TfdDn and/or TfdEn enzymes were responsible for the rate-limiting steps during degradation of 3-CBA by the tfdu cluster, due to their low activity with 2-CM and cis-DL, respectively. Our results confirm the hypothesis that TfdDn is less efficient than TfdD, or perhaps even completely unable to catalyze the transformation of 2-CM, and is therefore a rate-limiting factor during degradation of 3-CBA. 79 We concluded this from the substrate incubations with cell extracts of E. coli and subsequent LC/MS analysis, which clearly demonstrated that 2- CM is accumulated during the conversion of 3-CC in the presence of · TfdCn or TfdC and TfdDn. The two distinct peaks which were detected in the reactions corresponded to the two peaks obtained with our standard 2- CM preparation. Since both compounds have a molecular mass of 175 as determined by mass spectrometry and 2-CM is known to spontaneously form 2-chloro-cis,trans-muconate under mild acidic conditions (M. Schlomann, pers. communication) we assume that one peak corresponds to 2-CM and the other to 2-chloro-cis,trans-muconate. No such accumulation was seen with 4-CC and 3-CM. This suggests that TfdDn is unable to dehalogenate 2-CM to trans-DL (Fig. 7), but can convert 3-CM to cis-DL. Normal chloromuconate cycloisomerases like TfdD (Kuhm, et al. 1990; Schmidt and Knackmuss 1980), ClcB of P. putida and TcbD can dehalogenate both 2-CM and 3-CM (Vollmer, et al. 1994; Solyanikova, et al. 1995). In contrast to chloromuconate cycloisomerases, muconate cycloisomerases, such as those of Acinetobacter calcoaceticus ADPl, P. putida PRS2000 and Pseudomonas sp. strain B13 convert 2-CM to a mixture of (+)-2-chloro and (+)-5-chloromuconolactone (Vollmer, et al. 1994) and 3-CM to protoanemonin (Blasco, et al. 1995), but cannot dehalogenate the chloromuconolactones. The chloromuconate cycloisomerase (ClcB) from Rhodococcus erythropolis lCP on the other hand, converts 2-CM to (+ )-5-chloromuconolactone only (Solyanikova, et al. 1995) and 3-CM and 2,4-DCM correctly to their corresponding dienelactones (Solyanikova, et al. 1995). From this we conclude that TfdDn is similar in function to ClcB from R. erythropolis 1CP, although its 80 sequence similarity is much higher to the group of normal muconate cycloisomerases (Solyanikova, et al. 1995; Eulberg, et al. 1998). HOOC ~oxoadipate 81 Figure 7 Proposed pathway for the metabolism of 3-CBA by R. eutropha JMP134 and R. eutropha JMP289 tfd derivatives. The reactions are catalyzed by the following enzymes: benzoate dioxygenase and dihydrodiol dehydrogenase (reaction A), chlorocatechol 1,2-dioxygenase (B), chloromuconate cycloisomerase (C), dienelactone hydrolase (D), maleylacetate reductase (E). The dashed arrows represent possible reactions catalyzed by muconolactone isomerase (F) (Prucha 1996) and muconate cycloisomerase (G) (Vollmer 1998; Bruckmann 1998), which are expressed in the presence of benzoate. As a consequence of the inefficiency of TfdDu to catalyze the conversion of 2-CM to trans-DL, different phenotypes with respect to growth on 3- CBA were observed among the R. eutropha JMP289 derivatives. The phenotypes could be divided into four categories: (i) no growth, (ii) growth with up to 1 mM 3-CBA, (iii) growth with up to 3 mM 3-CBA and (iv) growth with 5 mM 3-CBA. We assume that the no growth phenotype observed for R. eutropha JMP289 (pCBA93), expressing the tfdu cluster, can only be partially due to the inefficiency of TfdD11 in catalyzing the conversion, since strain R. eutropha JMP289 (pCBA150) expressing tfdR- CDuEF, was able to grow with 3-CBA, although tfdD was not present here. Furthermore, the better 3-CBA phenotype of R. eutropha JMP289 (pCBA129) harboring tfdR-DuCuEuF1P in comparison to R. eutropha JMP289 (pCBA220) expressing tfdR- CuEuF1P indicated that expression of tfdDu had a positive contribution on growth. This could mean that also TfdEu is a bottleneck in R. eutropha, as was previously suggested by Perez-Pantoja (Perez-Pantoja, et al. 2000), since activities of dienelactone hydrolase measured in R. eutropha carrying tfdu plasmids were around our detection limit. Interestingly, dienelactone hydrolase activity was clearly measurable from tfdEu in E. coli (Laemmli, et al. 2000), suggesting that this gene is very poorly expressed in its native configuration in R. eutropha. We assume that (i) the level of tfd enzyme activity and (ii) the 82 ratio between the individual tfd enzyme activities are the two major factors affecting growth on 3-CBA. The inability to grow on 5 mM 3-CBA was overcome by lowering the initial 3-CBA concentration. A similar observation was made previously for R. eutropha JMP134 (Pieper, et al. 1993), where accumulation of 2-CM was overcome by adding 3-CBA stepwise to a continuous R. eutropha JMP134 culture. In this way apparently the rate of 2-CM formation was reduced and no 2-CM could accumulate. Perhaps slowing down 2-CM formation allows the cells to metabolize the chlorocatechols via 4-CC before 2-CM accumulation leads to a toxic effect. Or perhaps alternative pathways are induced and used. For example, there is some evidence for dechlorination of (+ )-5-chloromuconolactone to cis-dienelactone catalyzed by a muconolactone isomerase induced in benzoate grown cells of R. eutropha JMP134 (Prucha, et al. 1996b; Prucha, et al. 1996a). However, expression of benzoate-degrading enzymes leads to protonation of 3-CM and formation of the toxic product protoanemonin (Blasco, et al. 1995; Kaulmann, et al. 2001). No accumulation of protoanemonin was observed during the metabolism of 4-CC by the Tfd enzymes, therefore, we assume that 3-CM is correctly converted to cis-DL. In summary, we can conclude that there are no obvious enzymatic reasons as to the necessity for R. eutropha JMP134 (pJP4) to harbor two sets of chlorocatechol degrading enzymes, at least during growth on 3-CBA. It has been suggested previously that TfdFn might play an essential role, even in 3-CC and 4-CC conversion (Perez-Pantoja, et al. 2000). Indeed, the maleylacetate reductase enzyme activity detected for TfdFn largely exceeds that of TfdF, however, this did not influence the observed growth behavior on 3-CBA. The differences in substrate specificity, exemplified between 83 TfdD and TfdD11 , may indicate that the presence of both clusters is essential to allow metabolism of a broader variety of chlorinated compounds. Unfortunately, no other compounds as 3-CBA could be tested with the R. eutropha JMP289 derivatives constructed for this work. 84 CHAPTER4 ROLE OF THE TWO GENE CLUSTERS FOR CHLOROCATECHOL METABOLISM, TFD1 AND TFDn, OF R. EUTROPHA JMP134 (PJP4) DURING GROWTH ON 2,4-DICHLOROPHENOXYACETIC ACID. Mutants of R. eutropha JMP134, in which the gene tfdD, tfdE, tfdF or tfdD11 was inactivated, were constructed in order to study the function of both gene clusters for the modified ortho-cleavage pathway (tfd1 and tfd11 of strain JMPI 34) with respect 2,4- dichlorophenoxyacetic acid (2,4-D), 3-chlorobenzoate (3-CBA) and 2-methyl-4-chloro- phenoxyacetic acid (MCPA) degradation. In comparison to the growth behavior of the wild type strain JMP134, three distinct phenotypes were observed for the knockout mutants and allowed us to categorize the inactivated genes with respect to their function into essential, not essential and redundant genes. In addition, the expression of the tfd genes in the knockout mutants was analyzed by RNA hybridizations and enzyme activity measurements. Finally, the conversion of 3,5-dichlorocatechol by cell extracts of the mutants was analyzed by liquid chromatography coupled with a mass spectrometer (LC/MS) and by cell extracts of R. eutropha carrying either tfd1 or tfd11 cluster by spectral conversion. The outcome of our studies was that tfdE is the most essential gene, since its disruption abolished growth on all three substrates tested (3- 85 CBA, 2,4-D and MCPA). The results let us suppose that tfdE11 is not properly transcribed in R. eutropha and can therefore not replace tfdE. As shown previously (Chapter 3), tfdD is essential for growth on 3-CBA but not for growth on 2,4-D and MCPA. tfdF is redundant for growth on 3-CBA but useful during growth on 2,4-D and MCPA. The least essential gene seemed to be tfdD11 • Interestingly, tfdD 11 knockouts grew even more consistently then the wild type strain on 3-CBA. 86 INTRODUCTION Ralstonia eutropha JMPl 34 (pJP4) was originally isolated from an unspecific soil sample for its ability to use the herbicide 2,4- dichlorophenoxyacetic acid (2,4-D) as sole carbon and energy source (Don and Pemberton 1981; Don and Pemberton 1985). The strain can grow on various other haloaromatic compounds, such as 3-chlorobenzoate (3-CBA) (Don, et al. 1985) and 2-methyl-4-chloro-1-phenoxyacetic acid (MCPA) (Pieper, et al. 1988). The initial degradation steps of 2,4-D and MCPA involve an oxidation at the acetyl group by means of an a-ketoglutarate dependent dioxygenase (encoded by the tfdA gene), which leads to the release of glyoxylate and the formation of 2,4-dichlorophenol and 4- chloro-2-methylpheno), respectively. The chlorophenols are then oxidized by a hydroxylase (encoded by the tfdB and possibly also tfdBll gene) to form 3 ,5-dichloro- and 3-methyl-5-chlorocatechol, respectively. 3-CBA is oxidized at the 1,2- or 1,6-position by a benzoate dioxygenase and then reduced by a dehydrogenase to form approximately two-thirds of 3-chloro- and one-third of 4-chlorocatechol (Pieper, et al. 1993). The tfdA and tfdB genes are located on the plasmid pJP4, but the genes for chlorobenzoate conversion are presumed to be chromosomally located. Although different enzymes are used in the initial degradation steps, 2,4-D, MCPA and 3- CBA are all transformed into chloro-(methyl-) catechols. Metabolism of chlorocatechols proceeds by the so-called modified ortho-cleavage pathway enzymes, which are also encoded on plasmid pJP4. Interestingly, pJP4 harbors two homologous sets of genes encoding modified ortho- cleavage pathway enzymes. These genes are called tfdCDEF (in short the ifd1 cluster) and ifdDuCuEuFu (in short ifdu). Previous studies have revealed 87 that the genes tfdC and tfdCu code for chlorocatechol 1,2-dioxygenases, tfdD and tfdDu for chloromuconate cycloisomerases, tfdE and tfdEu for dienelactone hydrolases and tfdF and tfdFu for maleylacetate reductases (Perkins, et al. 1990; Laemmli, et al. 2000; Perez-Pantoja, et al. 2000). Because the percentage of identical amino acids among counterparts of the tfd1 and tfdu clusters is rather low (15-62%), because the G + C content of the tfdu genes is significantly higher than that of the tfd1 genes (Laemmli, et al. 2000) and because the tfdu genes are located within a transposable element (Leveau and van der Meer 1997), it has been suggested that the two gene clusters had been acquired from different origins. The transposable element containing the tfdD1~uEuFu genes is actually 10.5-kb long and also includes the regulatory genes tfdR and tfdS (Harker, et al. 1989; Kaphammer, et al. 1990; Kaphammer and Olsen 1990; Leveau and van der Meer 1996; Matrubutham and Harker 1994), the 2,4-D transporter gene tfdK (Leveau, et al. 1997) and the tfdBu gene (Leveau, et al. 1999). The two identical LysR-type regulatory proteins TfdR and TfdS regulate the expression of all the tfd genes (Leveau, et al. 1999). All tfd genes lie within a 22-kb DNA region on plasmid pJP4 (Fig 1, Chapter 2). The discovery of the second gene cluster (tfdu) has spurred several studies in order to understand what the role and selective advantage of the tfdu cluster might be for R. eutropha JMP134 (pJP4) (Perez-Pantoja, et al. 2000; Laemmli, et al. 2000). Several hypotheses were launched. One reason for keeping the present configuration of tfd genes could be the presence of the regulatory genes, which would be lost if the transposable region was deleted. Another reason could be that subtle functional differences exist between the tfd1 and tfdu counterparts, which provides a growth advantage on chlorinated compounds. Indeed, it could be shown 88 that enzymes encoded by the tfd 11 cluster do not have the same specificity as those of the tfd1 cluster (Perez-Pantoja, et al. 2000; Laemmli, et al. 2000) and R. eutropha strains without the pJP4 plasmid but with either tfdu or tfd1 genes on a plasmid have different growth rates and yields on 3-CBA. This difference was largely attributed to the inability of TfdDu to convert 2- chloromuconate. One disadvantage of the studies with the separately cloned tfd clusters in R. eutropha was that only functional differences with respect to 3-CBA and its central intermediates 3-chloro- and 4-chlorocatechol could be investigated. The objective of the underlying study was therefore to compare the function of both gene clusters for the modified ortho cleavage pathway with respect to metabolism of 2,4-D and MCPA. This would reveal if functional differences exist in the metabolism of 3,5-dichloro- and 5-chloro-3-methylcatechol. ln order to achieve this, mutants of R. eutropha JMP134 were constructed by inactivating several selected tfd genes of the modified ortho-cleavage pathways. The growth behaviour of these mutants on 2,4-D, 3-CBA and MCPA was determined. In addition, the expression of the tfd genes in the knockout mutants was analyzed by RNA hybridizations and by enzyme activity measurements. Finally, the conversion of 3,5-dichlorocatechol by cell extracts of R. eutropha carrying either tfd1 or tfdn cluster was analyzed by spectroscopy and liquid chromatography coupled with mass spectrometry (LC/MS). 89 MATERIALS AND METHODS Bacterial strains and cultivation conditions R. eutropha JMP134 (pJP4) can use 2,4-D, 3-CBA and MCPA as sole carbon and energy source (Don and Pemberton 1981; Don and Pemberton 1985). R. eutropha cultures were grown at 30°C in nutrient broth (Biolife, Milan, Italy) or in Pseudomonas mineral medium (Gerhardt, et al. 1981) supplemented with either 10 mM fructose, 2 mM 2,4-D, 3 mM 3-CBA or 3 mM MCPA and the appropriate antibiotic (kanamycin 100 µg/ml, tetracycline 10 µg/ml). Growth was monitored by measuring the optical density of the culture at 546 nm against water. Escherichia coli DH5a (Sambrook, et al. 1989) was used for cloning purposes. E. coli cultures were grown in Luria-Bertani (LB) medium supplemented with ampicillin (100 µg/ml), kanamycin (100 µg/ml) or tetracycline (10 µg/ml). DNA manipulations Plasmid isolations, transformations and other DNA manipulations were carried out according to established procedures (Sambrook, et al. 1989). Restriction enzymes and other DNA modifying enzymes were obtained from Amersham Life Science (Cleveland Ohio, USA) or GIBCO/BRL Life Technologies Inc. (Gaithersburg, Md.) and used according to the specifications of the manufacturer. Oligonucleotides for the polymerase chain reaction (PCR) were obtained from Microsynth GmbH (Balgach, Switzerland). The PCR mixtures contained 200 pmol of each primer per ml, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 0.05% (v/v) W-1, 2 mM MgC12 , 0.25 mM of each deoxynucleoside triphosphate and 30 U of Taq 90 DNA polymerase (Life Technologies) per ml. DNA sequencing was performed as described previously (Ravatn, et aL l 998a). Computer analysis of the DNA sequences was done with the DNAST AR software (DNASTAR Inc., Madison, WI, USA). Southern blotting of plasmid DNA isolated from R. eutropha JMP134 and its mutants, was performed by hydrochloric acid depurination and vacuum transfer as described by the manufacturer of the VacuGene™ XL blotting system (Pharmacia, Uppsala, Sweden). RNA was isolated from cell pellets of R. eutropha JMPl 34 and its mutants as described previously (Baumann, et al. 1996). Cultures for RNA isolation were grown on 10 mM fructose at 30°C to an optical density at 546 of 0.8- 0 .9 and induced by adding 3-CBA to a final concentration of l mM and further incubated for 2 h, after which the cells were immediately recovered by centrifugation. Dnase I-treated RNA samples were spotted on Hybond N+ membranes (Amersham) and hybridized with biotin-labeled antisense RNAs for each of the tfd open reading frames (ORFs) except tfdA and tfdDu as described elsewhere (Leveau, et al. 1999). Plasmids For each gene knockout mutant a plasmid was constructed containing the gene to be interrupted and an antibiotic resistance gene (kanamycin or tetracycline) within it. These plasmids are depicted in Fig. l. At least 300 bp of the target gene was included on each side of the antibiotic resistance gene in order to allow efficient recombination. Plasmid pCBA219 contains a 1.2-kb HindIII fragment of pRMEl with the kanamycin resistance gene cloned into the HindIII restriction site of tfdD in 91 pCBA 127. pCBA 127 is based on the pGEM®-T Easy vector (Promega, Madison, Wis., USA) and carries the tfdD gene amplified by using the PCR with the forward primer (980104) and the reverse primer (980103). The Aval tfdE fragment was cloned into the Aval A 1 kb B Kpnl Hindlll pCBA219 -4·; 1 kb pCBA227 Ndel (Xhol/Sali) (XhoI!Sall) 1 pCBA226 ~l!li'l: I !\j;\j\\~~i Ndei BamHl pCBA228 Sphl, Aatll, Apal, Ncol BamHl, (Xbal/Spel) .. .Nsil pCBA229 pCBA230 part of tfdBn Figure 1 A Organization of the tfd genes on plasmid pJP4 of R. eutropha JMPl34. B Maps of the plasmids used in this study for construction of the R. eutropha JMP134 knockout mutants. All plasmids depicted were constructed as described in Materials and Methods. For each plasmid the vector is indicated as well as the restriction sites relevant to the construction. The boxes represent genes: gray boxes, interrupted tfd genes; black boxes kanamycin gene cassette. Restriction sites in brackets indicate sites destroyed during cloning. The sequence indicated below pCBA228 and pCBA229, shows the site of insertion, as determined by sequencing, of the kanamycin gene within tfdD11 and tfdE11 , respectively. The boxed sequence are duplicated nucleotides, which occurred during the transposition. 92 site of vector pUC28 (Promega, Madison, Wis., USA) to give pCBA225. Plasmid pCBA226 was constructed by ligating the recovered 1.2-kb KpnI kanamycin resistance gene fragment of pRMEl with pCBA225 cut with the same enzyme. The tfdF gene was amplified by the PCR using the forward primer (000605) and the reverse primer (000606) and cloned into pGEM®-T Easy. The resulting plasmid pCBA221 was cut with XhoI and used as vector to clone the kanamycin resistance gene of pRMEl which was recovered as a 1.2-kb Sall fragment, yielding pCBA227. Table I: PCR primers Primer Characteristic Nucleotide sequence TfdE For lfdE 5' TGGTCGCTITGGTGCCTAC 3' 000702 RevkmR 5'CCCGTTGAATATGGATCCTAACAC3' 970403 For tfdD11 5' GCATTTCTAGACTACCGCCATGC 3' 010127 Rev 971204 For tfdD11 5'ATCGAACATATGATCGTCGATCTGC3' 971201 Rev 1fdD11 5' GGACTTCGCACGGATCCTCCTCG 3' pCBA228 and pCBA229 were constructed using the EZ::TN 93 Kienow into the Mlul site of pCBA88, which was treated with Kienow DNA polymerase as well. pCBA88 harbors the 1.6-kb EcoRI fragment of pJP4 (containing parts of tfdF11 and tfdB11) in pUC19. Construction of gene knockout mutants of R. eutropha JMP134 All gene knockout plasmids were transformed individually into R. eutropha JMP134 by electroporation. Kanamycin or tetracycline resistant R. eutropha transformants were screened for double recombination events between the introduced plasmid DNA and the corresponding DNA fragments on pJP4. To obtain electrocompetent R. eutropha JMP134, the strain was grown in 5 ml SOB-Mg overnight. From this culture, 0.25 ml were used to inoculate 50 ml nutrient broth. The strain was grown at 30°C to an optical density at 546 nm of 0.8. Subsequently, the cells were placed on ice for 30 min and centrifuged for 15 min at 4,300 rpm (4°C), washed twice with 10% (vol/vol) ice cold glycerol/demineralized water solution (first 40 ml, then 20 ml) and resuspended in 200 µI 10% ice cold glycerol. 40 µI competent cells were mixed with 2 µI plasmid DNA (0.03-0.1 µg) and placed on ice for 1 min prior to electroporation. The settings for the electroporation were 25 µF, 200 Q and 2.3 kV. Immediately following the pulse 1 ml nutrient broth was added to the cells, and the cell suspension was removed from the cuvette, transferred to a 12 ml sterile vial and incubated at 30°C shaking. One third of the cell suspension was plated on nutrient agar containing the appropriate antibiotic for selection after 2 h and the rest after overnight incubation. To allow plating on one or two plates, the suspensions were centrifuged for 2 min at 4000 rpm and resuspended in 200 µI nutrient broth. Colonies appeared after 36 hours at 30°C. Single and double recombinants were differentiated by checking for 94 presence or absence of the vector DNA by screening for ampicillin resistance or sensitivity. The mutants were checked by Southern blotting and by the PCR. The PCR primers used are listed in Table 1. For unknown reasons, no recombinants were obtained with the tfdFu, nor with the tfdE11 construct. Induction of tfd gene expression in R. eutropha JMP134 strains R. eutropha JMP134 and its mutants were grown at 30°C in Pseudomonas minimal medium supplemented with 10 mM fructose to an optical density at 546 nm of 0.8-0.9. Induction was achieved by adding 3-CBA, 2,4-D or MCPA to a final concentration of 1 mM, and strains were incubated for an additional 2h at 30°C. Cells were then centrifuged for 15 min at 5'300 rpm (4°C), washed with 40 ml washing buffer (washing buffer is 20 mM Tris- HCl at pH7) and resuspended in 1 ml washing buffer. Disruption of the cell suspensions was performed by sonication (Branson Sonifer 450; SCAN AG, Basel, Switzerland). One-milliliter cell suspensions were sonicated (eight times for 5 s each) at an output of 30 to 40W, with at least a 1-min pause between pulses. Cell suspensions were then centrifuged for 30 min (4°C) at 15,000 x g. The resulting supernatants, referred to as cell extracts, were transferred to a fresh tube and used in enzyme activity assays. Protein concentrations in the cell extracts were determined as described by Bradford (Bradford 1976), using bovine serum albumin as standard. The enzyme assays were performed by spectrophotometric methods as described previously (Laemmli, et al. 2000). The substrates tested included 3-chlorocatechol (3-CC) for chlorocatechol 1,2-dioxygenase, 3- chloromuconate (3-CM) for chloromuconate cycloisomerase, cis- 95 dienelactone for dienelactone hydrolase and maleylacetate for maleylacetate reductase. Preparation of samples for ffPLC/MS analysis. The following reactions were setup, in order to screen for accumulation of intermediates during 2,4-D, 3-CBA or MCPA degradation. The reaction mixtures containing 20 mM ammonium acetate (pH 7), I mM MnC1 2 and 0.1 mM of substrate (2,4-D, 3-CBA or MCPA) in a final volume of 1 ml, to which 100 µ1 cell extract of R. eutropha JMP134 or of a JMP134 mutant was added. The cell extracts were prepared as described above and contained about 0.6 and 2.5 mg protein per ml solution. Subsequently, the samples were incubated with shaking at 200 rpm for 6 h at 30°C. The reactions were then stopped by the addition of 50 µl hydrochloric acid (37%), which led to precipitation of all proteins, and stored at -20°C until further analysis. For analysis by HPLC I MS, the supernatants were thawed, centrifuged at 13'000 rpm for 15 min at 4°C, filtered and transferred into clean vials. HPLC/MS analysis was carried out as described elsewhere (Chapter 3). Conversion reactions with cell extracts of R. eutropha JMP289 derivatives Conversion of 3 ,5-dichlorocatechol (3 ,5-DCC) by cell extracts of R. eutropha JMP289 strains harboring pKT230-derived plasmids (Chapter 3) was followed spectrophotometrically in 0.5 ml quartz cuvettes. Reaction mixtures and cell extracts were prepared as described previously (Chapter 3). Spectral changes were monitored by scanning the absorption of the reaction mixtures between 200 and 350 nm at different time intervals. 96 Chemicals 3-Chlorocatechol (purity 99%) and 3 ,5-dichlorocatechol (purity 99%) were purchased from Promochem GmbH (46469 Wesel, Germany). 3- Chloromuconate, cis- and trans-dienelactone were a kind gift of Dr. Walter Reineke, Bergische Universitat-Gesamthochschule Wuppertal, Wuppertal, Germany. Maleylacetate was prepared by alkaline hydrolysis of cis- dienelactone (Evans, et al. 1971) by mixing 1 ml of 5 mM ds-dienelactone with 7.5 µl of 2N NaOH and incubating for 15 min at room temperature. 2,4-D, 3-CBA and MCPA were purchased from Fluka Chemie AG (Buchs, Switzerland). 97 RESULTS Growth on 3-CBA, 2,4-D and MCPA by tfd knockout mutants of strain JMP134 (pJP4) In order to study possible differences and redundancies in the enzymes of the two modified ortho-cleavage pathways encoded by the tfd genes, we inactivated the tfdD, tfdE, tfdF and tfdDu genes on the plasmid pJP4 in R. eutropha JMP134 (pJP4) by gene replacement with a kanamycin resistance gene. In all four cases, the replacement occurred by double recombination and the final insertion was verified by PCR and Southern hybridization (not shown). We also tried to inactivate tfdFu and tfdEm but were not successful in obtaining double recombinants. The four obtained mutants were analyzed for growth on 3-CBA, 2,4-D or MCPA as sole carbon and energy source. Growth of the wild type strain JMP134, which can use all three compounds as sole carbon and energy source, was used as reference. Inactivation of the tfdD gene led to strain JMPI34::219 (tfdD::km'}, which was unable to use 3-CBA as sole carbon and energy source (Fig. 2A). In contrast, JMP134::228 (tfdD11 ::km') in which tfdDu was inactivated grew very well and even more consistently on 3-CBA (Fig. 2D) than the wild type strain JMP134 (Fig. 2E). This suggested that the presence of TfdDn alone is not sufficient to allow metabolism of 2- and 3-CM, which arise during growth on 3-CBA and may even give rise to inhibitory effects in the wild-type strain. As shown previously, this is due to the inability of TfdD11 to catalyze the conversion of 2-chloromuconate (Chapter 3). The interruption of tfdD affected growth on 2,4-D and MCPA as well, although less pronounced. Strain JMP134::219 (tfdD::km') was still able to grow on 98 0.5 A 0.5 D 0.45 0.45 0.4 OA + +++;!;;!;.,. + + 0.35 0.35 x x ""....,., 0.3 .,.,""... 03 + ,.xxx x 025 025 5 02 5 02 >i.. 0.15 0.15 + x OJ 0.1 0.05 A 0.05 <>llfllOu:>J! £1>1! g e D ~- 0 0 + 0 20 40 60 80 JOO 120 140 160 180 200 0 20 40 60 80 JOO 120 140 160 180 200 Time (h) Time (h) 0.5 B 0.5 E 0.45 0.45 0.4 0.4 D 0.35 0.35 D oo«f> 0 p A ~ 0.3 0.3 0 '°... 0 :i:D "'" 8 0.25 8 0.25 D 0 0.2 0 0.2 "' 0 0.15 0.15 "' " 0.1 OJ o D a 0.05 "' 0.05 ot>{o~ !¥>., i!i a a "~~a 0 a "'"' "' 0 0 20 40 60 80 !00 120 140 160 180 200 0 20 40 60 80 100 120 140 160 180 200 Time(h) Time (h) 0.5 c 0.45 0.4 0.35 0 0.3 ~ "",,.,... '0 09:'> :i:" a 0 0.25 0 0.2 0 "" 0.15 0 "' 0.1 0 0.05 #'->ff' a " 0 "' a 0 20 40 60 80 JOO 120 140 160 180 200 Time(h) Figure 2 Batch growth of R. eutropha JMP134 and R. eutropha JMP134 mutants on 3 mM 3-CBA. A strain R. eutropha JMP134::219 (\fdD::km,), B R. eutropha JMP134::226 (tfdE::km.,), C R. eutropha JMP134::227 (tfdF::krn,), DR. eutropha JMPl34::228 (tfdD11::km,) and ER. eutropha JMP134 (pJP4). The data points represent independent experiments. 99 0.4 A 0.4. D 0.35 o.35' "t~~H 0.3 03) ;): 0.25 o.2sJ x 0.2 0c: 0.15 0.1 o.il + i" 0.05 0.05* + 0 ++ o~------~0 20 40 60 80 100 120 140 160 180 200 0 20 40 60 80 JOO 120 140 160 180 200 Time(h) Time(h) OA B 0.4 E 0.35 0.35 0.3 0.3 a a :i' 0.25 ~ 0.25 IS 0.2 IS 0.2 if. 0 0 0.15 0.15 : 0.1 0.1 r1 o.o5 0.05 ~WM ~a II~ xax ./: x o.__ir ______0 o~--=-20-=--40--60,-:8-:-0-1""'"00--,12_0_140_1_60-l8-0-200 0 20 40 60 80 100 120 140 160 180 200 Time(h) Time (h) 0.4 c 0.35 0.3 0.25 ~ 0.2 a o a 0c: 0 a {J. 0.15 a $ 0 0.1 Ch a5 ° x xx x 0.0 ¢00¢0«1> xx x ;( x :t'. :t'. x 0 0 20 40 60 80 JOO 120 140 160 180 200 Time(h) Figure 3 Batch growth of R. eutropha JMPI 34 and R. eutropha JMPl 34 mutants on 2 mM 2,4-D. A strain R. eutropha JMP134::219 (ifdD::km,), BR. eutropha JMP134::226 (ifdE::km,), C R. eutropha JMPl34::227 (tfdF::km,), DR. eutropha JMP134::228 (tfdD11::km,) and ER. eutropha JMPI 34 (pJP4). The data points represent independent experiments. 100 0.71 A 0.7' D i 0.6 0.6 0.5 0.5 '° 0.4 0.4 § 0.3 DD § ~ 0.2 ;r::tU::t: :t: D 0.2 xx ,.H """' x D x x ,,LO.l 0.1 l!lllill x >:;'> • .,t.i. &mii!'lilll!lll:il "' 0 ~'if;+++ 0 0 50 100 150 200 250 300 350 0 50 100 150 200 250 300 350 Time (h) Time (h) B 0.7, E ::: I 0.61 0.5 0.5 I l!ll \:i !'Cl l'.'l D ODD ~ ~ 'I'\ Q Q"' 0 0.3 0 OA~0.3 D 0.2 0.2 .,f" " ! 0.1 0.1 -- "'i'lil'i!flll!:ltc:te.~"' 0 0 ~~~~- 0 50 100 150 200 250 300 350 0 50 100 150 200 250 300 350 't Time(h) Time(h) 0.71 c 0.6 0.5 ~ 0.4 Q 0 0.3 0.2 "' " :<:o:"' 0.1 .:"' '!]:,;~"""""""' "'"' 0 0 50 100 150 200 250 300 350 Timc(h) Figure 4 Batch growth of R. eutropha JMP134 and R. eutropha JMP134 mutants on 3 mM MCPA. A strain R. eutropha JMP134::219 (t/dD::km,}, B R. eutropha JMP134::226 (tfdE::km,), C R. eutropha JMP134::227 (tfdF::km,), DR. eutropha JMPI 34::2:28 (tfdD11::km,) and ER. eutropha JMPI34 (pJP4). The data points represent independent experiments. 2,4-D (Fig. 3 A), but its final culture density and growth rate were significantly lower than that of JMP 134 (OD546 of 0 .25 and 0 .35, 101 respectively; Fig. 3 E). Strain JMP134::228 (tfdD11::km') was also not affected in growth with 2,4-D (Fig. 3 D and E), but was retarded in growth on MCPA (Fig. 4D). This suggested that both TfdD and TfdDu contribute to efficient growth on MCPA in the wild-type strain. The strongest growth effects were seen when tfdE was interrupted (strain JMP134::226 (tfdE::km')). This mutant could no longer grow on any of the offered chlorinated substrates 3-CBA, 2,4-D or MCPA (Fig. 2B, 3B and 4B). This result was somewhat unexpected, since it had previously been shown that expression of tfdE11 in E. coli led to an active dienelactone hydrolase (Laemmli, et al. 2000). Finally, strain JMP134:227 (tfdF::km'), in which tfdF was inactivated, was not affected in growth on 3-CBA compared to the wild-type strain (Fig. 2 C), although its growth was retarded and ineffective on 2,4-D and MCPA (Fig. 3 C and 4C). The lag phases ranged between 40 and 80 hours and the maximum OD546 reached on 2,4-D was 1.8 times lower than that of the wild-type strain. Expression of the tfd genes upon induction with 3-CBA In order to determine whether expression of the tfd genes within the JMP134 mutants was impaired by the insertion of the kanamycin gene, we analyzed the abundance of tfd mRNA in the different mutants after induction with 3-CBA by dot blot hybridization of total RNA with anti- sense RNA probes for each of the tfd genes, except tfdD11 , tfdA and tfdR/S (Fig. 5). Hybridization signals of different RNA dilutions and after different exposure times revealed that the insertion of the kanamycin gene did not largely effect expression of the tfd genes and that mostly all tfd genes in the knockout mutants were expressed upon induction with 3-CBA like in the wild-type (Fig. 5). Very few clear expression differences were 102 Ill 1110 11100 59 93 Ill 1110 __!{!_()Q_ 59 93 .------be --b--c --b--c --b--cabc be JMP134 ., • • • • • 1$ illl •••••• ® • ifdD::kmr • • • • • • $ $ •••••• ifdE::kmr ••• ., •• • €1 • • • • • ® • $) ifdF::kmr • • • • • • '® • !Ii •••• ifdDu::kmr • • • e e • 411 • €1 ifdCD • Ii •••• *' • 411 ifdCII JMP134 • 9 €1 • • •••••••••• ifdD::kmr ••• • • It • • • • • • • $) 1$ ifdE::kmr •••••• • ••••••• ifdF::kmr •••••• • ••••• ifdDu::km' • e • • I'.. • llfli 411 !JI! ifdE •••••••• ill tfdEII JMP134 •••• • • $) • • • • • • • ifdD::km' •®t@lill®I ifdE::km' • • • •• .. .. ifdF::km' •••••• . ifdDu::kmr • • • • • • 411 !@ ifdF • Iii • • • • ifdFII JMP134 • Ii $) i® $ i!ll'I 1i111 '111 IV ifdD::kmr '111 ifdE::kmr Iii $) ifdF::kmr $). .. $i ifdDu::kmf • iii • €1 tfdB • • ifdBII =--==---""-.:.::::.:.'"'"""-_:;;;::c---_:.__:_~.o::;:;::___J~======"~• • • • • • €1!\!1}€11#®® • • • • " • $) :: $i • • • • • • • ifdK Figure 5 Dot blot hybridization of total RNA isolated from batch cultures of R. eutropha JMP134 and R. eutropha JMP134 mutants after induction with 3-CBA. The antisense RNA probe used for that particular hybridization is indicated in the bottom right comer of each blot. The strains from which the RNA was isolated are indicated on the left. a, b, c represent individual replicates, dilutions of the total RNA samples are indicated above. Plasmids dilutions, used for comparison between blots are in lanes marked 59 (for plasmid pCBA59 harboring the tfdR-CDEFB genes) and 93 (plasmid pCBA93 harboring the tfdR-D11C11E11F11 genes). The dilutions of the plasmid DNA from top to bottom are 1110, 1/30, 11100, 1/300, respectively. The signal intensities may not be directly compared between the different strains, since the raw data were not corrected for differences in amount of total RNA. (Digital image was obtained by scanning the original exposed films) 103 seen, such as a relatively poor tfdF expression in strain JMP134::219 (tfdD::km'). However, these expression differences could not directly be attributed to insertion of the kanamycin resistance gene, since the expression of tfdE in strain JMP134::219 (tfdD::km') did not seem to be influenced. Activity of the Tfd1 and Tfdu gene products in mutants of strain JMP134 The activities of the chlorocatechol pathway enzymes were measured in cell extracts of all the knockout strains as well as of JMP134 upon induction with 3-CBA, 2,4-D or MCPA. The three induction substrates were chosen for comparison to the substrates used in the growth experiments. No significant differences in induction level were observed with respect to the induction substrate (3-CBA, 2,4-D or MCPA) used (Fig. 6), although 3-CBA tended to be the least efficient inducer. However, differences were observed between the strains. In all cell extracts tested, the chlorocatechol 1,2-dioxygenase activity varied between 100 to 300 mU·(mg·proteinr' and the maleylacetate reductase activity between 150 to 400 mU(mg·proteinr' depending on the strain and the induction substrate used. Strain JMP134::228 (tfdD11::km') had the overall highest chloromuconate cycloisomerase and dienelactone hydrolase activities of around 80 mU·(mg·proteinr' and 200-250 mU·(mg·proteinr', respectively, but was somewhat reduced for maleylacetate reductase activity compared to the others. In contrast, one mutant strain displayed surprisingly low chloromuconate cycloisomerase and dienelactone hydrolase activity when compared to the others. Cell extracts of this strain, JMP134::226 (tfdE::km'), contained chloromuconate cycloisomerase activities ranging 104 between 16 and 21 mU'(mg·protein)'1 and no significant dienelactone hydrolase activities (at the level of our detection limit). The absence of dienelactone hydrolase activity would imply that tfdEu was either not translated or produced a disfunctional protein, since TfdEu-activity had been measured before in E.coli (Laemmli, et al. 2000). 700 600 500 200 100 It; 0 ~ ~ ... ~ u tfdD::kmr I tfdE::kmr"' 1 efdF::km' ifdD[[::km' I 134 I I3CBA 2,4-D MCPA 3CBA 2,4-D MCPAI 3CBA 2,4-D MCPJ 3CBA 2,4-D MCPA 3CBA 2,4-D MCPA Figure 6 Specific enzyme activities encoded by the tfd1 and tfd11 genes measured in cell extracts of R. eutropha JMP134 and R. eutropha JMP134 mutants. l mU corresponds to 1 nmol of substrate disappearance or product formation per min. Open bars, chlorocatechol 1,2-dioxygenase, stippled bars, chloromuconate cycloisomerase, hatched bars, dienelactone hydrolase and black bars, maleylacetate reductase. Conversion of 3-CBA, 2,4-D and MCPA by cell extracts of JMP134 mutants Conversion assays were carried out with cell extracts of each JMP134 mutant and 3-CBA, 2,4-D or MCPA as substrate. The reaction mixtures were analyzed by LC/MS, to screen for any changes in and accumulation of intermediates, which could be due to the respective missing Tfd enzyme. 105 We used a procedure, which had been previously optimized for the detection of chlorocatechols and chloromuconates (Chapter 3). Unfortunately, dienelactone and maleylacetate could not be detected under these conditions. In assays containing cell extracts of JMP134::219 A B 100% 12.23 20 Time c D 100% 133 195 6.45 min peak 293 391 335 0 ~~~~,._,,~~_.....~,__...... -L,m/z 100 200 300 400 273 100% 133 8.74 min peak 211 371 100 200 300 273 273 100% 12.23 min peak 100% 11.65 min peak 371 371 175 2i1\ 275 177 215 373 0 ~~--...... -~~-~-._,m!z 0 ~--~~20-...--~2~3-8----~---.miz 100 200 300 400 100 200 300 400 Figure 7 3-CBA transformation by total cell extracts of R. eutropha JMP134 and R. eutropha strain JMPl 34::227 (tfdF::km') analyzed by LC/MS. Shown in panels A and Bare the reconstructed ion chromatograms (RIC) for the molecular mass 175 obtained after incubation of AR. eutropha strain JMP134::227 (tfdF::km') and B R. eutropha JMP134 (pJP4) with 3-CBA. 100% peak height is a relative value different for each figure. Therefore the peak heights may not be compared. C and D show the mass spectra for each of the peaks obtained in A and B, respectively. 106 (ifdD::km'), JMP134::226 (tfdE::km') or JMP134::228 (tfdDu::km'), incubated for 6h with 3-CBA, 2,4-D or MCPA, no intermediates accumulated to sufficiently high levels to be detected by LC/MS (data not shown). This was surprising, since strain JMP134::219 (tfdD::km') was unable to grow on 3-CBA and retarded on 2,4-D and MCPA and, therefore, was expected to show accumulation of chloromuconates. No dienelactone accumulation in incubations with extracts of strain JMP134::226 (tfdE::km') could have been detected by the LC/MS protocol we used. No intermediates were detected in incubations with cell extracts of JMP134::227 (tfdF::km') or JMP134 and 2,4-D or MCPA (Fig. 7 A and 7 B, panels b and c). Interestingly, however, several peaks were detected after incubation of JMP134 wild-type and strain JMP134::227 (ifdF::km') with 3-CBA (Fig. 7). Mass spectroscopy revealed that the 12.23 min peak obtained with cell extracts of JMP134::227 (tfdF::km') (Fig. 7 A, panel a) and the 11.65 min peak in incubations with cell extracts of JMP134 were identical (Fig. 7 B, panel a). Comparison of the mass spectra suggested that these two peaks consisted of ( +)-2-chloromuconolactone. The 8.74 min peak obtained with cell extracts of JMPl 34::227 (tfdF::km') during conversion of 3-CBA (Fig. 7 A, panel a) corresponded to 2- chloromuconate. The 6.45 min peak could not be identified by direct comparison with a standard compound, but its mass spectra was similar to that of the "6 min" peak detected in previous studies after conversion of 3- CC by E.coli cell extracts expressing TfdC (or TfdC11) and TfdD. Both the 8.74 and 6.45 peaks were not detected with cell extracts of JMP134 wild type strain. 107 Conversion of 3,5-DCC by cell extracts of R. eutropha JMP289 derivatives. Since the LC/MS analysis did not detect (chloro)dienelactones and (chloro)maleylacetates, we followed spectral conversions in time of 3,5- DCC incubated with cell extracts of R. eutropha derivatives carrying plasmids with either the tfd1, tfd,, or a hybrid tfdrtfd,, cluster (Fig. 8). These R. eutropha JMP289 tfd-derivatives did not carry any pJP4 plasmid. We used 3,5-DCC since this is an intermediate in 2,4-D degradation. Any difference in specificity or activity of the Tfd1 and Tfd11 enzymes would therefore possibly show up as different (combination) spectra during time. As positive control, incubations with cell extracts from JMP134 were used. Conversion of 3,5-DCC with cell extracts of JMP134 and R. eutropha JMP289 carrying plasmid pCBA93, pCBA150, pCBA220 and pCBA129, revealed a temporarily occurring peak at 265 nm, except for pCBA93 where the intermediate peak was at 280 nm. These peaks are indicative for chlorodienelactone O"max=ca. 280 nm) and 2,4-dichloromuconate ((/"max=ca. 260). Furthermore, two types of final spectra were observed. The first type (type I), obtained by incubation of cell extracts of JMP134 and R. eutropha JMP289 (pCBA150) was a relatively broad peak with absorption maximum at 245-250 nm. This peak has been observed before by Kaschabek (1995) and might be indicative for chlorohydroxymuconate, the enol form in a pH-dependent equilibrium with chloromaleylacetate (Kaschabek and Reineke 1995). Since our assays were not specifically amended with NADH as cosubstrate maleyacetate may have not been further transformed to oxoadipate by the maleylacetate reductase due to lack of NADH. The second spectrum type (type II), observed in incubations with cell extracts of R. eutropha JMP289 carrying plasmid 108 pCBA93, pCBA129 and pCBA220 (Fig. 8A, D and E), was composed of a narrower peak at 250 nm, a shoulder at 220 nm and broad peak at 300 nm. Since cells with plasmids pCBA93, pCBA220 and pCBA129 lack dienelactone hydro lase activity, we would have expected a final spectrum with a peak at 280 nm indicative for accumulation of chlorodienelactone and not at 250 nm, which resembles more the spectrum of maleylacetate. The observed type II final spectra, however, may be the result of a chemical (none enzymatic) hydrolyis of chlorodienelactone and yielding maleylacetate, which occurs under alkaline conditions (pH 8-12), as described by Kaschabek (Kaschabek and Reineke 1995). The observed shoulder at 220 nm in the type II final spectra may represent a byproduct of alkaline hydrolysis, since a similar shoulder at 210 nm is described after the alkaline hydrolysis of trans-5-fluorodienelactone to 5- fluoromaleylacetate (Kaschabek 1995). l.5 B O' D l" 0 1.5 A c ' ·i" O' ' iii ~ o/n 0 200 250 300 350 200 250 300 350 200 250 300 350 Wavelength (nm) Wavelength (nm) Wavelength (nm) 109 Figure 8 Turnover of 3,5-dichlorocatechol by cell extracts of R. eutropha JMP289 carrying plasmids with either the tfd1 or tfd11 or hybrid gene cluster, grown on fructose and induced with 3-CBA as observed from UV spectra recorded after different incubation times. The characteristic absorption maxima of some possible intermediates are as follows: 2-CM, !max= 267 nm (Dorn and Knackmuss 1978), 3-CM, A.max= 259 nm (Dorn and Knackmuss 1978), trans-DL, A.max = 274 nm (Blasco 1995), protoanemonin, A.max = 260 nm (Blasco 1995) and maleylacetate, A.max = 243 nm (Blasco 1995). o/n stands for overnight. AR. eutropha JMP289 (pCBA93), tfdR- D1iC11E11F11, BR. eutropha JMP289 (pCBAl50), tfdR-CD11EF, CR. eutropha JMP134, D R. eutropha JMP289 (pCBA129), tfdR-DuCuE11F11D, ER. eutropha JMP289 (pCBA220), tfdR-t1D1p 11EuF1p. 110 DISCUSSION It is still not completely understood what the possible advantages could be for R. eutropha JMP 134 (pJP4) to harbor two homologous gene clusters for the degradation of chlorophenol and chlorocatechols (i.e., tfd1 and tfdu), which both are present on plasmid pJP4. Previously it had been demonstrated that differences exist between the tfd1 and tfdu genes with respect to their expression and the substrate specificity of their gene products (Laemmli, et al. 2000; Leveau, et al. 1999; Perez-Pantoja, et al. 2000). However, most of the previous studies focused on analyzing the function of the tfd1 and tfdu genes with respect to 3-CBA degradation (Perez-Pantoja, et al. 2000; Chapter 3). The results of these studies were that the TfdD11 enzyme was incapable of converting 2-CM, which arises as one of the possible intermediates in metabolism of 3-CC. Furthermore, it was shown that TfdEu had very low activity in R. eutropha. The goal of this work was to study the role of the tfd1 and tfdu genes during degradation of 2,4-D, which was the original substrate for selection of the strain in the environment. We speculated that perhaps on 2,4-D and the related herbicide MCPA specificities of the Tfd1 and Tfd11 enzymes would be different than seen on 3-CBA. In order to study any functional differences, we could not use the previously practised approach, which consisted of cloning either the tfd1 or tfdu cluster (or hybrid clusters) on a plasmid in a pJP4-free strain of R. eutropha. With these strains it was only possible to test intracellular conversion of 3-CC- and 4-CC, which would be formed by growing them on 3-CBA. Therefore we constructed mutants of the wild-type strain JMP134 by interrupting several of the tfd genes on pJP4 by homologous 111 recombination and gene replacement with a kanamycin resistance gene. Fortunately, double recombination turned out to be very effective in R. eutropha JMP134, although we finally only obtained four (tfdD, tfdE, tfdF and tfdD11 ) of the initially planned six gene knockouts (i.e., tfdEJJ and tfdFJl). The knockout strains were tested for their ability to grow on 2,4-D, as well as on 3-CBA and MCPA, as sole carbon and energy sources. In comparison to the growth behaviour of the wild type strain JMP134, three distinct phenotypes were observed for the knockout mutants, (i) no growth, (ii) not optimal growth and (iii) (more) optimal growth. These results allowed us to categorize the inactivated genes tfdD, tfdE, tfdF and tfdD11 with respect to their function for metabolism of 2,4-D, 3-CBA and MCPA into essential, not essential and redundant genes (Table 2). The outcome of our studies was that tfdE is the Table 2: Phenotype of the JMP134 mutants and gene function of the inactivated gene 2,4-D 3-CBA MCPA Inactivated Pheno- Gene Pheno- Gene Pheno- Gene Strain 2ene tvoe function tvru> function I""" function JMPl34::219 (lfdD::km'} + + lfdD not essential essential not essential JMPl34::226 (lfdE::km') tfdE essential essential essential JMPl34::227 (tfdF::km') + ++ + lfdF not essential redundant not essential JMPl34::228 (lfdDu::km') ++ ++ + tfdD,, redundant redundant not essential ++optimal growth,+ not optimal growth, - no growth 112 most essential gene for the 2,4-D pathway, since its disruption abolished growth on all three substrates. Apparently, the 'counterpart' of tfdE, tfdE" cannot replace the function. No measurable dienelactone hydrolase activity was present in induced cell extracts of R. eutropha with the tfdE interruption, which is in agreement with the lack of observed growth of this strain. Strangely enough, though, tfdEu was shown to be correctly transcribed in this strain. Furthermore, we had previously shown that expression of tfdE11 in E. coli (from an optimal promoter and translational fusion system) results in a functional dienelactone hydrolase able to catalyze the conversion of cis- and trans-dienelactone (Laemmli, et al. 2000). This suggests that for some reason the tfdE11 mRNA is not translated in R. eutropha. Inspection of the proposed ribosome binding site (GAAGG) in front of the native start codon of tfdEll, however, revealed no special poor binding sequence. We further found that tfdD is also an essential gene, but only for growth on 3-CBA, which is in agreement with previously obtained results (Chapter 3). TfdDn was found to be unable to catalyze the conversion of 2-CM, an intermediate in 3-CBA metabolism, to trans-dienelactone and therefore seems to inhibit growth on 3-CBA (Chapter 3). When tested on 2,4-D and MCPA, the tfdD gene was not essential for growth, but only led to growth retardation and lower yields. Apparently, the tfdD 11 gene product is sufficient to allow growth on 2,4-D and MCPA. The tfdF gene also turned out to be non-essential for growth on 2,4-D and MCPA, although leading to growth retardation as well. The least essential gene seemed to be tfdDu with respect to growth on 2,4-D and 3-CBA, although some growth retardation was observed with MCPA. This showed that TfdDn has some supportive role during growth on MCPA. Interestingly, tfdDu knockouts 113 grew even more consistently than the wild-type strain on 3-CBA, which indicates that the presence of TfdDn during metabolism of 3-CBA is inhibitory to the cells, even when TfdD is active. The gene tfdF appeared to be fully redundant with respect to growth on 3-CBA but useful during 2,4-D metabolism, which corroborates findings of Don et al. (Don, et al. 1985), who showed that tfdF knockout mutants grew well on 3-CBA but poorly on 2,4-D. The reason for this is unclear, since it has been shown previously that the purified maleyacetate reductase from R. eutropha JMP134 (which is TfdFu) can catalyze the transformation of maleylacetate, but also of 2-chloromaleyacetate, to 3-oxoadipate (Seibert, et al. 1993). Furthermore, TfdFn is well expressed in R. eutropha (Fig. 6). Unfortunately, TfdF has not been purified and characterized, and no specific other function has been assigned to it, which would help us to understand its loss by the inactivation of tfdF. Further research will therefore be necessary to conclude the functions of TfdFn and, in particular, TfdF during metabolism of 2,4-D and explain our ambiguous results. The results of the present study have helped to elucidate subtle differences in the role of the tfd1 and tfdu genes in degradation of 2.4-D in R. eutropha JMP134 (pJP4). Evolutionary seen, the presence of two homologous genes clusters on the same plasmid is interesting and is always assumed to have some selective advantage. Summarizing all data obtained until now, one can say that indeed some functional differences exist, which however, mostly argue against keeping the tfdu cluster. Although we could not obtain a tfdFu knockout, we speculate that the genes of the tfd1 cluster (together with tfdA and tfdB) are sufficient to allow growth on 3-CBA, 2,4-D and MCPA. Therefore, we conclude that the reason for keeping the 114 configuration of two tfd clusters mostly lies in a selective disadvantage upon the deletion of tfdu. Deletion (through the easiest recombination between the ends of the IS-elements) would result in loss of the regulatory genes, which is probably far worse for efficient chloroaromatic degradation. 115 CHAPTERS CONCLUDING REMARKS AND OUTLOOK 116 The present work describes the discovery and characterization of a second gene cluster (tfdu) for chlorocatechol metabolism in R. eutropha JMP134 (pJP4). The primary aim of our work was to get a better understanding of evolutionary mechanisms of adaption by looking at recently assembled gene clusters in bacteria. The tfd genes for 2,4-D degradation in R. eutropha were to our opinion a good example of a recently combined gene cluster. One of the reasons for assuming this was that the tfd gene region is composed of two homologous gene clusters for chlorophenol and chlorocatechol degradation. One of these, the tfdu gene cluster, seemed to have been acquired on plasmid pJP4 by the action of insertion element ISJP4. By this acquisition and recombination process, two modified ortho- cleavage pathways were combined on plasmid pJP4 of R. eutropha JMP134. In our simple selectionist view, we were convinced that the presence of two homologous gene clusters on pJP4 must provide some selective advantage for the strain. In order to investigate what the selective advantages of keeping two gene clusters for the same pathway might be, the functions of the tfd 1 and tfd11 genes were thoroughly characterized using three different approaches: heterologous expression, enzyme activity studies and direct mutant construction in R. eutropha JMP134. i) Heterologous expression in E. coli of each of the tfdu ORF's individually permitted to measure the enzyme activity of the encoded polypeptides in E. coli cell extracts without any of the background of R. eutropha. The results revealed that all of the tfdu ORF's encode functional modified ortho-cleavage pathway enzymes (Chapter 2). ii) By introducing plasmids carrying the tfd1 or the tfdu or a hybrid tfd/tfdu gene cluster into the plasmid free R. eutropha strain JMP289, we could analyze whether the introduced gene clusters encoded the 117 necessary functions to metabolize a mixture of 3-CC and 4-CC arising during growth on 3-CBA (Chapter 3). Interestingly, these experiments revealed that differences among the two pathway enzymes existed with respect to 3-CC conversion in R. eutropha. This was surprising, since we had shown that the tfd1 and tfdu genes can encode functional modified ortho-cleavage pathway enzymes in E.coli (Chapter 2). In particular, it turned out that TfdD11 was unable to catalyze the conversion of2-chloro-cis,cis-muconate to trans-dienelactone. iii) Finally, the role of the tjd1 and tfdu genes in metabolism of 2,4-D and MCPA was studied in the wild-type strain R. eutropha JMP134 (pJP4). These studies revealed that not only between TfdD and TfdDn but also between the counterparts TfdE/TfdE11 and TfdF/TfdF11 functional differences existed (Chapter 4). This led us to suggest that tfdEu is not translated in R. eutropha and that TfdDn is redundant with respect to 2,4-D degradation. Interestingly, TfdF11 could not completely replace TfdF to allow growth on 2,4-D, although previous characterization and purification of TfdF11 from strain JMPI34 had shown that tfdF11 is a functional chloromaleyacetate reductase (Seibert, et al. 1993). Our work on the tfd genes of R. eutropha demonstrated that apparently it is not sufficient to characterize genes only by individual overexpression in a heterologous host in order to completely understand their function. Organisms are complex systems, where many factors work together to ensure proper functioning of the cell. Since many of these factors are unknown and their function therefore unpredictable, it is necessary to combine in vivo and in vitro experiments to obtain the best information. Despite our efforts, not all of the questions on the functional differences between the tfd1 and tfd11 clusters have been solved. First of all, the reasons ll8 for the severe growth inhibition on 3-chlorobenzoate of R. eutropha strains carrying tfdDll as sole chloromuconate cycloisomerase are still not obvious. Since 3-chlorobenzoate is converted to a mixture of both 3-CC and 4-CC, and only 3-CC leads to production of 2-chloromuconate, this would only lead to a lower growth yield but not per se to growth inhibition. Secondly, the mechanism of silencing of tfdEll in R. eutropha is curious. Apart from the exact mechanisms of achieving apparently translational silencing, the reasons as to why there were selective disadvantages for keeping an active tfdEn are mysterious. Thirdly, not specifically targeted here, is the second gene for tfdBu. a potential dichlorophenol hydroxylase. Further aspects, which would be interesting to investigate and which would contribute to a better understanding of the fate of newly aquired DNA is: how do cells deal with a sudden increase in genetic information? Namely, one big problem for the cell will be to ensure a proper and independent expression of the newly acquired genes. Another consequence of newly recombined DNA (with, as the case for the tfdu cluster, a different G+C content) might be a disruption of 'local DNA equilibrium'. Some authors have speculated that a DNA equilibrium consists of local sequence elements such as short repeats and might become 'disturbed' by the introduction of new DNA fragments (Schaaper, et al. 1986; Gerischer and Ornston 1995). It is believed that the disturbance of local DNA structures triggers faster divergence of the nearby DNA because a new equilibrium must be reached (Ornston 1990). R. eutropha JMP134 (pJP4) would be an ideal model to use to study these questions. First of all, R. eutropha JMP134 has acquired a 8.7 kb DNA fragment in a recent evolutionary process, which disturbed the local DNA sequence and inactivated the regulator TfdT. And second, a large amount of information on the genes 119 within the DNA rearrangements (the tfd genes) is available. The further study of such evolutionary aspects would contribute to our increasing understanding of molecular evolution of metabolic pathways in bacteria and deserves to be given further attention. 120 REFERENCES Amy, P. S., Schulke, J. W., Frazier, L. M., and Seidler, R. J. (1985). Characterization of aquatic bacteria and cloning of genes specifying partial degradation of 2,4-dichlorophenoxyacetic acid, Appl Environ Microbiol 49, 1237-1245. Ausmees, N. R., and Heinaru, A. L. (1990). New plasmids of herbicide 2,4-dichlorophenoxyacetic acid biodegradation, Genetika 26, 770-772. Bagdasarian, M., Lurz, R., Riickert, B., Franklin, F. C., Bagdasarian, M. M., Frey, J., and Timmis, K. N. (1981). Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas, Gene 16, 237-247. Baumann, B., Suozzi, M., Zehnder, A. J., and van der Meer, J. R. (1996). Dynamics of denitrification activity of Paracoccus denitrificans in continuous culture during aerobic-anaerobic changes, J Bacteriol 178, 4367-4374. Beadle, C. A., and Smith, A. R. (1982). The purification and properties of 2,4-dichlorophenol hydroxylase from a strain of Acinetobacter species, Eur J Biochem 123, 323-332. Benes, V., Hostomsky, Z., Arnold, L., and Paces, V. (1993). M13 and pUC vectors with new unique restriction sites for cloning, Gene 130, 151- 152. Bhat, M.A., Tsuda, M., Horiike, K., Nozaki, M., Vaidyanathan, C. S., and Nakazawa, T. (1994). Identification and characterization of a new plasmid carrying genes for degradation of 2,4-dichlorophenoxyacetate from Pseudomonas cepacia CSV90, Appl Environ Microbiol 60, 307-312. 121 Blasco, R., Wittich, R.-M., Mallavarapu, M., Timmis, K. N., and Pieper, D. H. (1995). From xenobiotic to antibiotic, formation of protoanemonin from 4-chlorocatechol by enzymes of the 3-oxoadipate pathway, J Biol Chem 270, 29229-29235. Bradford, M. M. (1976). A rapid and sensitive method for the determination of microgram quantities of protein utilizing the principle of protein-dye binding., Anal Biochem 72, 248-254. Briickmann, M., Blasco, R., Timmis, K. N., and Pieper, D. H. (1998). Detoxification of protoanemonin by dienelactone hydrolase, J Bacteriol 180' 400-402. Chaudhry, G. R., and Huang, G. H. (1988). Isolation and characterization of a new plasmid from a Flavobacterium sp. which carries the genes for degradation of 2,4- dichlorophenoxyacetate, J Bacteriol 170, 3897-3902. Dagley, S. (1986). Biochemistry of aromatic hydrocarbon degradation in pseudomonads, Vol 10, Academic Press, Inc. edn (New York). Dejonghe, W., Boon, N., Seghers, D., Top, E. M., and Verstraete, W. (2001). Bioaugmentation of soils by increasing microbial richness: missing links, Environ Micro biol 3, 649-657. DiGiovanni, G.D., Neilson, J. W., Pepper, I. L., and Sinclair, N. A. (1996). Gene transfer of Alcaligenes eutrophus JMP134 plasmid pJP4 to indigenous soil recipients, Appl Environ Microbiol 62, 2521-2526. Ditta, G., Stanfield, S., Corbin, D., and Helinski, D. R. (1980). Broad host range DNA cloning system for gram-negative bacteria: construction of a gene bank of Rhiwbium meliloti, Proc Natl Acad Sci U S A 77, 7347- 7351. 122 Don, R.H., and Pemberton, J.M. (1981). Properties of six pesticide degradation plasmids isolated from Alcaligenes paradoxus and Alcaligenes eutrophus, J Bacteriol 145, 681-686. Don, R.H., and Pemberton, J.M. (1985). Genetic and physical map of the 2,4-dichlorophenoxyacetic acid degradative plasmid pJP4, J Bacteriol 161, 466-468. Don, R.H., Weightman, A. J., Knackmuss, H.·J., and Timmis, K. N. (1985). Transposon mutagenesis and cloning analysis of the pathways for degradation of 2,4-dichlorophenoxyacetic acid and 3-chlorobenzoate in Alcaligenes eutrophus JMP134 (pJP4), J Bacteriol 161, 85-90. Dorn, E., and Knackmuss, H.-J. (1978). Chemical structure and biodegradability of halogenated aromatic compounds. Substituent effects on 1,2-dioxygenation of catechol, Biochem J 174, 85-94. Ehrig, A., Millier, R.H., and Babel, W. (1997). Isolation of phenoxy herbicide-degrading Rhodoferax species from conatminated building material., Acta Biotechnol 17, 351-320. Eulberg, D., Kourbatova, E. M., Golovleva, L. A., and SchlOmann, M. (1998). Evolutionary relationship between chlorocatechol catabolic enzymes from Rhodococcus opacus 1CP and their counterparts in proteobacteria: sequence divergence and functional convergence, J Bacteriol 180, 1082-1094. Evans, W. C., Smith, B. S. W., Fernley, H. N., and Davies, J. I. (1971). Bacterial metabolism of 2,4-dichlorophenoxyacetate, Biochem J 122, 543- 55 l. Farhana, L., and New, P. B. (1997). The 2,4-dichlorophenol hydroxylase of Alcaligenes eutrophus JMP134 is a homotetramer, Can J Microbial 43, 202-205. 123 Fellay, R., F'rey, J ., and Krisch, H. (1987). Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram- negative bacteria, Gene 52, 147-154. Filer, K., and Harker, A. R. (1997). Identification of the inducing agent of the 2,4-dichlorophenoxyacetic acid pathway encoded by plasmid pJP4, Appl Environ Microbiol 63, 317-320. Fischer, P.R., Appelton, J., and Pemberton, J.M. (1978). Isolation and characterization of the pesticide-degrading plasmid pJP l from Algaligenes paradoxus, J Bacteriol 135, 798-804. Friedrich, B., Meyer, M., and Schlegel, H. G. (1983). Transfer and expression of the herbicide-degrading plasmid pJP4 in aerobic autotrophic bacteria, Arch Microbiol J34, 92-97. Fritz, H., Reineke, W ., and Schmidt, E. (1991). Toxicity of chlorobenzene on Pseudomonas sp. strain RHOl, a chlorobenzene- degrading strain, Biodegradation 2, 165-170. Fukumori, F., and Hausinger, R. P. (1993a). Alcaligenes eutrophus JMP134 "2,4-dichlorophenoxyacetate monooxygenase" is an alpha- ketoglutarate-dependent dioxygenase, J Bacteriol J 75, 2083-2086. Fukumori, F., and Hausinger, R. P. (1993b). Purification and characterization of 2,4-dichlorophenoxyacetate/alpha- ketoglutarate dioxygenase, J Biol Chem 268, 24311-24317. Fulthorpe, R.R., McGowan, C., Maltseva, O. V., Holben, W. E., and Tiedje, J. M. (1995). 2,4-Dichlorophenoxyacetic acid-degrading bacteria contain mosaics of catabolic genes, Appl Environ Microbiol 61, 3274- 3281. Gerhardt, P., Murray, R. G. E., Costilow, R. N., Nester, E.W., Wood, W. A., Krieg, N. R., and Briggs Phillips, G. (1981). Manual of methods 124 for general bacteriology (Washington, D.C., American Society for Microbiology). Gerischer, U., and Ornston, L. N. (1995). Spontaneous mutations in pcaH and -G, structural genes for protocatechuate 3,4-dioxygenase in Acinetobacter calcoaceticus, J Bacteriol 177, 1336-134 7. Ghosal, D., and You, 1.-S. (1988a). Nucleotide homology and organization of chlorocatechol oxidation genes of plasmids pJP4 and pAC27, Mol Gen Genet 211, 113-120. Ghosal, D., and You, I. S. (1988b). Gene duplication in haloaromatic degradative plasmids pJP4 and pJP2, Can J Microbiol 34, 709-715. Harker, A. R., and Kim, Y. (1990). Trichloroethylene degradation by two independent aromatic-degrading pathways in Alcaligenes eutrophus JMP134, Appl Environ Microbiol 56, 1179-1181. Harker, A. R., Olsen, R.H., and Seidler, R. J. (1989). Phenoxyacetic acid degradation by the 2,4-dichlorophenoxyacetic acid (TFD) pathway of plasmid pJP4: mapping and characterization of the TFD regulatory gene, tfdR, J Bacteriol 171, 314-320. Harwood, C. S., and Parales, R. E. (1996). The ~-Ketoadipate Pathway and the Biology of Self-Identity, Annu Rev Microbiol 50, 553-590. Holben, W. E., Schroetter, B. M., Calabrese, V. G. M., Olsen, R.H., Kukor, J. K., Biederbeck, V. 0., Smith, A. E., and Tiedje, J.M. (1992). Gene probe analysis of soil microbial populations selected by amendment with 2,4-dichlorophenoxyacetic acid, Appl Environ Microbiol 58, 3941- 3948. Ka, J. 0., and Tiedje, J.M. (1994). Integration and excision of a 2,4- dichlorophenoxyacetic acid- degradative plasmid in Alcaligenes paradoxus 125 and evidence of its natural intergeneric transfer, J Bacterial 176, 5284- 5289. Kamagata, Y ., Fulthorpe, R. R., Tamura, K., Takami, H., Forney, L. J., and Tiedje, J.M. (1997). Pristine environments harbor a new group of oligotrophic 2,4- dichlorophenoxyacetic acid-degrading bacteria, Appl Environ Microbial 63, 2266-2272. Kaphammer, B., Kukor, J. J., and Olsen, R.H. (1990). Regulation of tfdCDEF by tfdR of the 2,4-dichlorophenoxyacetic acid degradation plasmid pJP4, J Bacterial 172, 2280-2286. Kaphammer, B., and Olsen, R.H. (1990). Cloning and characterization of tfdS, the repressor-activator gene of tfdB, from the 2,4- dichlorophenoxyacetic acid catabolic plasmid pJP4, J Bacterial 172, 5856- 5862. Kaschabek, S. R. (1995). Chemische Synthese von Metaboliten des mikrobiellen Chloraromatenabbaus und Untersuchung der Substratspezifitat der Maleylacetat-Reduktase aus Pseudomonas sp. Stamm Bl3, Diss Univ Wuppertal. Kaschabek, S. R., and Reineke, W. (1992). Maleylacetate reductase of Pseudomonas sp. strain Bl3: dechlorination of chloromaleylacetates, metabolites in the degradation of chloroaromatic compounds, Arch Micro biol l 58, 412-7. Kaschabek, S. R., and Reineke, W. (1995). Maleylacetate reductase of Pseudomonas sp. strain Bl3: specificity of substrate conversion and halide elimination, J Bacterial 177, 320-325. Kaulmann, U., Kaschabek, S. R., and SchlOmann, M. (2001). Mechanism of chloride elimination from 3-chloro- and 2,4-dichloro-cis,cis- 126 muconate: new insight obtained from analysis of muconate cycloisomerase variant catb-kl69a, J Bacteriol 183, 4551-4561. Keeton, W. T., and Gould, J. L. (1993). Biological science, 5th ed. edn (New York,N. Y. 10110, W.W. Norton & Company, Inc.). Kleinsteuber, S., Hoffmann, D., Millier, R.H., and Babel, W. (1998). Detection of chlorocatechol 1,2-dioxygenase genes in proteobacteria by PCR and gene probes., Acta Biotechnol 18, 231-240. Koh, S.-C., McCullar, M. V., and Focht, D. D. (1997). Biodegradation of 2,4-dichlorophenol through a distal meta-fission pathway, Appl Environ Microbiol 63, 2054-2057. Koiv, V., Marits, R., and Heinaru, A. (1996). Sequence analysis of the 2,4-dichlorophenol hydroxylase gene tfdB and 3,5-dichlorocatechol 1,2- dioxygenase gene tfdC of 2,4 dichlorophenoxyacetic acid degrading plasmid pEST401 l, Gene 174, 293-297. Kohm, A. E., Schlomann, M., Knackmuss, H.-J., and Pieper, D. H. (1990). Purification and characterization of dichloromuconate cycloisomerase from Alcaligenes eutrophus JMP 134, Biochem J 266, 877- 883. Kukor, J. J., Olsen, R. H., and Siak, J. S. (1989). Recruitment of a chromosomally encoded maleylacetate reductase for degradation of 2,4- dichlorophenoxyacetic acid by plasmid pJP4, J Bacteriol 171, 3385-3390. Laemmli, C. M., Leveau, J. H., Zehnder, A. J., and van der Meer, J. R. (2000). Characterization of a second tfd gene cluster for chlorophenol and chlorocatechol metabolism on plasmid pJP4 in Ralstonia eutropha JMP134(pJP4), J Bacteriol 182, 4165-4172. Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4., Nature 227, 680-685. 127 Leonard, D., Youssef, C. B., Destruhaut, C., Lindley, N. D., and Queinnec, I. (1999). Phenol degradation by Ralstonia eutropha: colorimetric determination of 2-hydroxymuconate semialdehyde accumulation to control feed strategy in fed-batch fermentations, Biotechnol Bioeng 65, 407-15. Leveau, J. H., and van der Meer, J. R. (1997). Genetic characterization of insertion sequence ISJP4 on plasmid pJP4 from Ralstonia eutropha JMP134, Gene 202, 103-114. Leveau, J. H. J. (1998). Bacterial genetics of catabolic adaptation to chloroaromatic compounds, Diss ETH No 12536. Leveau, J. H. J., de Vos, W. M., and van der Meer, J. R. (1994). Analysis of the binding site of the LysR-type transcriptional activator TcbR on the tcbR and tcbC divergent promoter sequences, J Bacteriol 176, 1850- 1856. Leveau, J. H.J., Konig, F., Fiichslin, H., Werlen, C., and van der Meer, J. R. (1999). Dynamics of multigene expression during catabolic adaptation of Ralstonia eutropha JMP134 (pJP4) to the herbicide 2,4- dichlorophenoxyacetate, Mol Microbiol 33, 396-406. Leveau, J. H.J., and van der Meer, J. R. (1996). The tfdR gene product can successfully take over the role of the insertion element-inactivated TfdT protein as a transcriptional activator of the tfdCDEF gene cluster, which encodes chlorocatechol degradation in Ralstonia eutropha JMP134 (pJP4), J Bacteriol 178, 6824-6832. Leveau, J. H.J., Zehnder, A. J.B., and van der Meer, J. R. (1997). The tfdK gene product facilitates the uptake of 2,4-dichlorophenoxyacetate by Ralstonia eutropha JMP134 (pJP4), J Bacteriol JBO, 2237-2243. 128 Liu, S., Ogawa, N., and Miyashita, K. (2001). The chlorocatechol degradative genes, tfdT-CDEF, of Burkholderia sp. strain NK8 are involved in chlorobenzoate degradation and induced by chlorobenzoates and chlorocatechols, Gene 268, 207-214. Liu, T., and Chapman, P. J. (1984). Purification and properties of a plasmid-encoded 2,4-dichlorophenol hydroxylase, FEBS Letters 173, 314- 318. Mae, A. A., Marits, R. 0., Ausmees, N. R., Koiv, V. M., and Heinaru, A. L. (1993). Characterization of a new 2,4-dichlorophenoxyacetic acid degrading plasmid pEST40ll: physical map and localization of catabolic genes., J Gen Microbiol 139, 3165-3160. Maltseva, O., McGowan, C., Fulthorpe, R., and Oriel, P. (1996). Degradation of 2,4-dichlorophenoxyacetic acid by haloalkaliphilic bacteria., Microbiology 142, 1115-1122. Matheson, V. G., Forney, L. J., Suwa, Y., Nakatsu, C.H., Sexstone, A. J., and Holben, W. E. (1996). Evidence for acquisition in nature of a chromosomal 2,4-dichlorophenoxyacetic acid/a-ketoglutarate dioxygenase gene by different Burkholderia spp., Appl Environ Microbiol 62, 2457- 2463. Matrubutham, U., and Harker, A. R. (1994). Analysis of duplicated gene sequences associated with tfdR and tfdS in Alcaligenes eutrophus JMP134, J Bacteriol 176, 2348-2353. McFall, S. M., Chugani, S. A., and Chakrabarty, A. M. (1998). Transcriptional activation of the catechol and chlorocatechol operons: variations on a theme, Gene 223, 257-267. 129 Millier, D., SchlOmann, M., and Reineke, W. (1996). Maleylacetate reductases in chloroaromatic-degrading bacteria using the modified ortho pathway: comparison of catalytic properties, J Bacteriol 178, 298-300. Millier, R.H., and Babel, W. (1999). Separation of two dichlorprop/a- ketoglutarate dioxygenases with enantiospecific properties from Comamonas acidovorans MCI., Acta Biotechnol 19, 349-355. Millier, R.H., Kleinsteuber, S., and Babel, W. (2001). Physiology and genetic characteristics of two bacterial strains utilizing phenoxypropionate and phenoxyacetate herbicides., Microbial Res 156, 121-131. Nakai, C., Horiike, K., Kuramitsu, S., Kagamiyama, H., and Nozaki, M. (1995). Three isozymes of catechol 1,2-dioxygenase (pyrocatechase), aa, a~, and~~, from Pseudomonas arvilla C-1., J Biol Chem 265, 660- 665. Neilson, J. W., Josephson, K. L., Pepper, I. L., Arnold, R. B., Di Giovanni, G.D., and Sinclair, N. A. (1994). Frequency of horizontal gene transfer of a large catabolic plasmid (pJP4) in soil, Appl Environ Microbial 60, 4053-4058. Newby, D. T., Gentry, T. J., and Pepper, I. L. (2000a). Comparison of 2,4-dichlorophenoxyacetic acid degradation and plasmid transfer in soil resulting from bioaugmentation with two different pJP4 donors, Appl Environ Microbiol 66, 3399-3407. Newby, D. T., Josephson, K. L., and Pepper, I. L. (2000b). Detection and characterization of plasmid pJP4 transfer to indigenous soil bacteria, Appl Environ Microbiol 66, 290-296. Padilla, L., Matus, V., Zenteno, P., and Gonzalez, B. (2000). Degradation of 2,4,6-trichlorophenol via chlorohydroxyquinol in Ralstonia eutropha JMP134 and JMP222, J Basic Microbiol 40, 243-249. 130 Parsek, M. R., McFall, S. M., Shinabarger, D. L., and Chakrabarty, A. M. (1994). Interaction of two LysR-type regulatory proteins CatR and ClcR with heterologous promoters: functional and evolutionary implications, Proc Natl Acad Sci US A 91, 12393-12397. Pemberton, J.M., Corney, B., and Don, R.H. (1979). Evolution and spread of pesticide degrading ability among soil micro-organsims (Amsterdam, Elsevier/North-Holland Biomedical Press). Perez-Pantoja, D., Guzman, L., Manzano, M., Pieper, D. H., and Gonzalez, B. (2000). Role of tfdCp1E1F1 and tfdD1iCnEnF11 gene modules in catabolism of 3-chlorobenzoate by Ralstonia eutropha JMP134 (pJP4), Appl Environ Microbiol 66, 1602-1608. Perkins, E. J., Gordon, M. P., Caceres, 0., and Lurquin, P. F. (1990). Organization and sequence analysis of the 2,4-dichlorophenol hydroxylase and dichlorocatechol oxidative operons of plasmid pJP4, J Bacteriol 172, 2351-2359. Perkins, E. J., and Lurquin, P. F. (1988). Duplication of a 2,4- dichlorophenoxyacetic acid monooxygenase gene in Alcaligenes eutrophus JMPl34(pJP4), J Bacteriol 170, 5669-5672. Pieper, D. H., Knackmuss, H.-J., and Timmis, K. N. (1993). Accumulation of 2-chloromuconate during metabolism of 3- chlorobenzoate by Alcaligenes eutrophus JMP134, Appl Microbiol Biotechnol 39, 563-567. Pieper, D. H., Reineke, W., Engesser, K.-H., and Knackmuss, H.-J. (1988). Metabolism of 2,4-dichlorophenoxyacetic acid, 4-chloro-2- methylphenoxyacetic acid and 2-methylphenoxyacetic acid by Alcaligenes eutrophus JMP134, Arch Microbiol 150, 95-102. 131 Prucha, M., Peterseim, A., Timmis, K. N., and Pieper, D. H. (1996a). Muconolactone isomerase of the 3-oxoadipate pathway catalyzes dechlorination of 5-chloro-substituted muconolactones, Eur J Biochem 237, 350-356. Prucha, M., Wray, V., and Pieper, D. H. (1996b). Metabolism of 5- chlorosubstituted muconolactones, Eur J Biochem 237, 357-366. Ravatn, R., Studer, S., Springael, D., Zehnder, A. J. B., and van der Meer, J. R. (1998a). Chromosomal integration, tandem amplification, and deamplification in Pseudomonas putida Fl of 105-kilobase genetic element containing the chlorocatechol degradative genes from Pseudomonas sp. strain B 13, J Bacteriol J 80, 4360-4369. Ravatn, R., Studer, S., Zehnder, A. J., and van der Meer, J. R. (1998b). lnt-Bl3, an unusual site-specific recombinase of the bacteriophage P4 integrase family, is responsible for chromosomal insertion of the 105- kilobase clc element of Pseudomonas sp. strain B 13, J Bacteriol J 80, 5505- 14. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning: a laboratory manual. (Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory). Schaaper, R. M., Danforth, B. N., and Glickman, B. W. (1986). Mechanisms of spontaneous mutagenesis: an analysis of the spectrum of spontaneous mutation in the Escherichia coli Lael gene, J Mol Biol 189, 273-284. Schlifer, M., Lakner, S., Knapp, B., and SchlOmann, M. (1998). Chlorocatechol catabolic genes of Burkholderia sp. strain 3CB-l: not clustered into a single operon., V AAM Congress Frankfurt/Main 22-25 March 1998, Abstract Biospektrum, 126. 132 Schenzle, A., Lenke, H., Spain, J. C., and Knackmuss, H.-J. (1999). Chemoselective nitro group reduction and reductive dechlorination initiate degradation of 2-chloro-5-nitrophenol by Ralstonia eutropha JMPI34, Appl Environ Microlbiol 65, 2317-2323. SchlOmann, M. (1994). Evolution of chlorocatechol catabolic pathways: conclusions to be drawn from comparisons of lactone hydrolases., Biodegradation 5, 301-321. Schmidt, E., and Knackmuss, H. J. (1980). Chemical structure and biodegradability of halogenated aromatic compounds. Conversion of chlorinated muconic acids into maleoylacetic acid, Biochem J 192, 339- 347. Schoepfer, R. (1993). The pRSET family of T7 promoter expression vectors for Escherichia coli, Gene 124, 83-85. Seibert, V., Stadler, F. K., and SchlOmann, M. (1993). Purification and characterization of maleylacetate reductase from Alcaligenes eutrophus JMP134(pJP4), J Bacteriol 175, 6745-6754. Smejkal, C. W., Vallaeys, T., Seymour, F. A., Burton, S. K., and Lappin-Scott, H. M. (2001). Characterization of (R/S)-mecoprop [2-(2- methyl-4-chlorophenoxy) propionic acid]-degrading Alcaligenes sp.CS I and Ralstonia sp. CS2 isolated from agricultural soils, Environ Microbiol 3, 288-293. Smith, C. A., and Thomas, C. M. (1987). Comparison of the organisation of the genomes of phenotypically diverse plasmids of incompatibility group P: members of the IncP beta sub-group are closely related, Mol Gen Genet 206, 419-27. Solyanikova, I. P., Maltseva, 0. V., Vollmer, M. D., Golovleva, L.A., and SchlOmann, M. (1995). Characterization of muconate and 133 chloromuconate cycloisomerase from Rhodococcus erythropolis lCP: indications for functionally convergent evolution among bacterial cycloisomerases, J Bacteriol 177, 2821-2826. Streber, W.R., Timmis, K. N., and Zenk, M. H. (1987). Analysis, cloning, and high-level expression of 2,4-dichlorophenoxyacetate monooxygenase gene tfdA of Alcaligenes eutrophus JMP134, J Bacteriol 169, 2950-2955. Studier, F. W., and Moffatt, B. A. (1986). Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes, J Mol Biol 189, 113-130. Suwa, Y., Wright, A. D., Fukimori, F., Nummy, K. A., Hausinger, R. P., Holben, W. E., and Forney, L. R. A. (1996). Characterization of a chromosomally encoded 2,4 dichlorophenoxyacetic acid alpha ketoglutarate dioxygenase from Burkholderia sp strain rasc, Appl Environ Microbiol 62, 2464-2469. Top, E. M., Holben, W. E., and Forney, L. J. (1995). Characterization of diverse 2,4-dichlorophenoxyacetic acid-degradative plasmids isolated from soil by complementation, Appl Environ Microbiol 61, 1691-1698. Top, E. M., Van Daele, P., De Saeyer, N., and Forney, L. J. (1998). Enhancement of 2,4-dichlorophenoxyacetic acid (2,4-D) degradation in soil by dissemination of catabolic plasmids, Antonie van Leeuwenhoek 73, 87-94. Vallaeys, T., Courde, L., Mc Gowan, C., Wright, A. D., and Fulthorpe, R.R. (1999). Phylogenetic analyses indicate independent recruitment of diverse gene cassettes during assemblage of the 2,4-D catabolic pathway, FEMS Microbiol Ecol 28, 373-382. 134 Vallaeys, T., Fulthorpe, R.R., Wright, A. M., and Soulas, G. (1996). The metabolic pathway of 2,4-dichlorophenoxyacetic acid degradation involves different families of tfdA and tfdB genes according to PCR-RFLP analysis., FEMS Microbiol Ecol 20, 163-172. van der Meer, J. R. (1997). Evolution of novel metabolic pathways for the degradation of chloroaromatic compounds, Antonie van Leeuwenhoek 71, 159-178. van der Meer, J. R., de Vos, W. M., Harayama, S., and Zehnder, A. J. B. (1992). Molecular mechanisms of genetic adaptation to xenobiotic compounds, Microbiol Rev 56, 677-694. van der Meer, J. R., Eggen, R. I. L., Zehnder, A. J. B., and de Vos, W. M. (1991). Sequence analysis of the Pseudomonas sp. strain P51 tcb gene cluster, which encodes metabolism of chlorinated catechols: evidence for specialization of catechol 1,2-dioxygenases for chlorinated substrates, J Bacteriol 173, 2425-2434. Vollmer, M. D., Fischer, P., Knackmuss, ff •• J., and SchlOmann, M. (1994). Inability of muconate cycloisomerases to cause dehalogenation during conversion of 2-chloro-cis.cis-muconate, J Bacteriol 176, 4366- 4375. Vollmer, M. D., Hoier, H., Hecht, H. J., Schell, U., Groning, J., Goldman, A., and SchlOmann, M. (1998). Substrate specificity of and product formation by muconate cycloisomerases: an analysis of wild-type enzymes and engineered variants, Appl Environ Microbiol 64, 3290-3299. Vollmer, M. D., Schell, U., Seibert, V., Lakner, S., and SchlOmann, M. (1999). Substrate specificities of the chloromuconate cycloisomerases from Pseudomonas sp. B13, Ralstonia eutropha JMP134 and Pseudomonas sp. P5 l, Appl Microbiol Biotechnol 51, 598-605. 135 Vollmer, M. D., and SchlOmann, M. (1995). Conversion of 2-chloro- cis,cis-muconate and its metabolites 2-chloro- and 5-chloromuconolactone by chloromuconate cycloisomerases of pJP4 and pAC27, J Bacteriol 177, 2938-2941. Xia, X., Oswiecimska, K., Aathithan, A., Smith, A. R. W., and Bruce, I. J. (1996). Characterization and sequencing of pIJB, a plasmid-encoding 2,4-D dissimilation, Biotech Lab International. Xia, X. S., Aathithan, S., Oswiecimska, K., Smith, A. R. W., and Bruce, I. J. (1998). A novel plasmid pIJBl possessing a putative 2,4- dichlorophenoxyacetic acid degradative transposon Tn5 5 3 0 in Burkholderia cepacia strain 2a, Plasmid 39, 154-159. Yabuuchi, E., Kosako, Y ., Yano, I., Hotta, H., and Nishiuchi, Y. (1995). Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen. nov.: proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973) comb. nov., Ralstonia solanacearum (Smith 1896) comb. nov. and Ralstonia eutropha (Davis 1969) comb. nov., Microbiol Immunol 39, 897- 904. Yanisch-Perron, C., Vieira, J., and Messing, J. (1985). Improved Ml3 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors, Gene 33, 103-119. You, I. S., and Ghosal, D. (1995). Genetic and molecular analysis of a regulatory region of the herbicide 2,4-dichlorophenoxyacetate catabolic plasmid pJP4, Mol Microbiol 16, 321-331. 136 CURRICULUM VITAE Caroline Maya Laemmli Born May 11 1971 in Princeton, NJ, USA 1977 1980 Primary school in Princeton, NJ, USA 1980 1986 Primary school in Geneva, Switzerland 1983 - 1986 Highschool in Onex, GE, Switzerland 1986 1990 Matura Typus C at the College de Saussure in Petit-Laney, GE, Switzerland 1990 - 1996 Undergraduate studies in Environmental Sciences at the Swiss Federal Institute of Technology, Ziirich Titel of diploma work performed at the Swiss Federal Institute for Environmental Science and Technology (EA WAG): Search for a promoter and/or regulatory elements in the upstream region of the tcbAB chlorobenzene dioxygenase gene cluster of Pseudomonas sp. strain PS 1. 1997 2001 Doctoral studies at the Swiss Federal Institute for Environmental Science and Technology (EA WAG) 2001 -2002 Scientific collaborator in the groupe of ecotoxicology at the Swiss Federal Research Station for Agroecology and Agriculture (FAL), Ziirich February 22, 2002 Date of oral examination 137