NRF2 Intensifies Host Defense Systems to Prevent Lung Carcinogenesis, but After Tumor Initiation Accelerates Malignant Cell Growth

Published OnlineFirst March 28, 2016; DOI: 10.1158/0008-5472.CAN-15-1584 Cancer Tumor and Stem Cell Biology Research

NRF2 Intensiﬁes Host Defense Systems to Prevent Lung Carcinogenesis, but After Tumor Initiation Accelerates Malignant Cell Growth Hironori Satoh1,2, Takashi Moriguchi1, Daisuke Saigusa3, Liam Baird1, Lei Yu1, Hirofumi Rokutan2, Keiko Igarashi2, Masahito Ebina4, Tatsuhiro Shibata2, and Masayuki Yamamoto1

Abstract

Nrf2 activation promotes resistance to chemical carcinogenesis derived from Keap1-kd mice and transplanted into nude mice in animal models, but activating mutations in Nrf2 also confer exhibited higher tumorigenicity compared with cells derived from malignant characters to human cells by activating antioxidative/ wild-type mice. To identify the factors contributing to the tumor detoxifying enzymes and metabolic reprogramming. In this study, growth phenotype in the transplantation model, we performed a we examined how these contradictory activities of Nrf2, cancer microarray analysis and found that many antioxidative stress chemoprevention and cancer cell growth enhancement, can be genes were upregulated in the Keap1-kd–derived tumors. There- reconciled in an established mouse model of urethane-induced fore, we suggest that Nrf2 activation in cancer cells enhances their lung carcinogenesis. Using Keap1-knockdown (kd) mice, which tumorigenicity, but global Nrf2 activation, as in Keap1-kd mice, express high levels of Nrf2, we found that urethane was rapidly simultaneously enhances anticancer immunity, thereby suppres- excreted into the urine, consistent with an upregulation in the sing the growth potential of Keap1-kd tumors. Our findings expression of urethane detoxification genes. Consequently, ure- provide relevant insight into the dual role of Nrf2 in cancer and thane-induced tumors were significantly smaller and less frequent warrant further studies of Nrf2 function during different stages of in Keap1-kd mice than in wild-type mice. In contrast, tumor cells carcinogenesis. Cancer Res; 76(10); 1–9. 2016 AACR.

Introduction reductase (Nqo1), heme oxygenase 1 (Ho-1), and glutamate-cysteine ligase catalytic subunit (Gclc), are induced. These cytoprotective The transcription factor Nrf2 plays important roles in the enzymes contribute to the cellular protection against oxidative protective response against environmental stresses, particularly and electrophilic insults. against oxidative and electrophilic insults (1, 2). In unstressed Urethane (ethyl carbamate) is a prototypic carcinogen that conditions, Nrf2 is bound by Keap1 and subjected to degradation induces lung adenoma and adenocarcinoma (3). Upon admin- through the ubiquitin–proteasome pathway. Upon exposure to istration of urethane to mice, adenomas often develop in the lung, oxidative or electrophilic stresses, reactive cysteine residues of which later give rise to adenocarcinomas (4). Cytochrome P450 Keap1 are chemically modified. Thereafter, the Keap1-mediated 2E1 (Cyp2e1)-mediated oxidization converts urethane into degradation of Nrf2 is eliminated, leading to Nrf2 accumulation vinyl carbamate epoxide (VCE), which serves as a potent carcin- in the nucleus. Subsequently, Nrf2 dimerizes with one of the small ogen by inducing DNA- and protein–adduct formation (5). VCE Maf proteins (sMaf) and binds to the specific DNA sequence is converted into 1, 2-dihydroxyethyl carbamate by microsomal referred to as antioxidant/electrophile response element, through epoxide hydrolase (mEH), and subsequently the product is sub- which a variety of target genes, such as NAD(P)H quinone oxido- jected to Gstp1/p2–mediated glutathione conjugation. There- after, the conjugate is excreted into the urine (6). As the mEH and Gstp1/p2 genes are targets of NRF2 (1, 7, 8), the detoxifica- 1Department of Medical Biochemistry, Graduate School of Medicine, tion pathway of urethane appears to be under the influence of 2 Tohoku University, Sendai, Japan. Division of Cancer Genomics, Nrf2 activity. Many studies have demonstrated that Nrf2-deficient National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan. – 3Department of Integrative Genomics, Tohoku Medical Megabank, mice are susceptible to a variety of carcinogens (9 12). In contrast, Tohoku University, Aoba-ku, Sendai, Japan. 4Department of Respira- Nrf2 activation in cancer cells has also been shown to contribute tory Medicine, Pulmonary Center, Tohoku Pharmaceutical University to the promotion of tumor growth in many forms of cancer Hospital, Miyagino-ku, Sendai, Japan. (13, 14). These two rather contradictory aspects of Nrf2 function Note: Supplementary data for this article are available at Cancer Research have been referred to as the "Double-Edged Sword of Nrf2" Online (http://cancerres.aacrjournals.org/). (15, 16). We have previously demonstrated that Nrf2 activity Corresponding Authors: Masayuki Yamamoto, Tohoku University Graduate exhibits bidirectional stage-specific effects in urethane-induced School of Medicine, 2-1 Seiryo-machi, Aoba-ku, Sendai 980-8575, Japan. Phone: lung carcinogenesis (17). Specifically, Nrf2-deficient mice exhib- 812-2717-8084; Fax: 812-2717-8090; E-mail: [email protected]; ited more abundant microtumor nodules than wild-type mice and Takashi Moriguchi, [email protected] at early stages (4–8 weeks) after urethane administration. In doi: 10.1158/0008-5472.CAN-15-1584 contrast, in the later stages (16 weeks after urethane treatment), 2016 American Association for Cancer Research. wild-type mice showed large, malignant lung tumors with

www.aacrjournals.org OF1

Satoh et al.

increased Nrf2 accumulation, whereas Nrf2-deficient mice rarely Urethane-induced lung carcinogenesis experiments developed such malignant cancers (17). These results indicate that Urethane (ethyl carbamate; 1 g/kg body weight) was intraper- Nrf2 prevents cancer initiation in the early stages, whereas Nrf2 itoneally administered. At 8 weeks, 16 weeks, and 8 months after accelerates cancer progression in the advanced stages of urethane- the administration, the mice were euthanized. The lungs were induced lung carcinogenesis. dissected and the total number of lung surface tumors was Given the above results from the Nrf2-deficient mice, we counted macroscopically. The diameter of the tumors was mea- next wanted to address whether constitutive Nrf2 activation sured using an electronic caliper. affects cancer incidence and malignancy. To this end, we explo- ited Keap1-knockdown (Keap1-kd) mice that show constitutive Gene expression analysis Nrf2 accumulation due to a systemic decrease in Keap1 expres- Surface lung tumors were dissected, and surrounding tissues sion (18). The Keap1-kd mice survive to adulthood and exhibit were carefully removed under a stereoscopic microscope. Tu- resistance against oxidative and electrophilic insults (19, 20). mors and nontumor tissues in lungs of urethane-administered Therefore, the Keap1-kd mice serve as an excellent model of mouse were pooled and subjected to a whole-mouse genome genetic Nrf2 induction. microarray analysis (4 44 k; Agilent Technologies). Expres- Considering that Nrf2-deficient mice show increased suscepti- sion array data were analyzed with GeneSpring software (Sil- bility to urethane and develop many micronodules in the early icon Genetics). Heatmaps were generated utilizing Cluster 3.0 stage (17), we hypothesized that Keap1-kd mice could be resis- (http://bonsai.hgc.jp/~mdehoon/software/cluster/) and JAVA tant against urethane-induced lung carcinogenesis, due to the Treeview 159 (http://jtreeview.sourceforge.net/). The classifica- constitutive activation of stress-responsive genes. To address this tions of the selected genes according to their biologic and hypothesis, we utilized the urethane carcinogenesis model in toxicologic functions were performed using Ingenuity Pathway Keap1-kd mice. We found that the Keap1-kd mice developed a Analysis (IPA) software (Ingenuity system). P value, represented significantly lower number of urethane-induced lung tumors than as the negative log ratio of the IPA results, is calculated by the the wild-type mice. In contrast, when transplanted into nude mice, Fisher exact test. the Keap1-kd mice–derived tumor cells showed more vigorous growth than the wild-type mice–derived tumor cells. These results Statistical analyses demonstrate that systemic activation of Nrf2 prevents urethane- The data are described as the mean SD. The statistical induced lung carcinogenesis, whereas Nrf2 activation confers significance in differences was calculated by the Student t test or tumorigenicity on the cancer cells. the Mann–Whitney U test. The values for the incidence of lung tumors were analyzed with the Fisher exact probability Materials and Methods test. P values < 0.05 were considered significant. Experimental animals Keap1-kd mice (5–9 weeks) and age-matched Keap1-wt mice Results with ICR genetic background were used (18, 21). The mice were Keap1-kd mice express Nrf2 and its target genes at high levels maintained in a facility free of specific pathogens. Nude mice (8–9 Urethane acquires carcinogenic activity through conversion weeks) were purchased from CLEA Japan. We mainly used male into the electrophilic metabolite, vinyl carbamate epoxide mice in this study to exclude gender biases. All animal experi- (VCE; Fig. 1A). We previously found that intraperitoneal ments were performed under the approval of the Tohoku Uni- injection of urethane (1 g/kg body weight) increased Nrf2 versity Animal Care Committee. protein level and expression of Nrf2 target genes in the lung of Keap1-wt mice (17). It has previously been shown that Transplantation of tumors into nude mice Keap1-kd mice are highly resistant to the damaging effects of Urethane-induced lung tumors of approximately equal sizes oxidants due to the high expression level of Nrf20s cytopro- (f ¼ 0.5–1.5 mm) from Keap1-kd and Keap1-wt mice were trans- tective target genes (19, 20). In this study, we found that a planted subcutaneously into the backs of nude mice. The tumor number of genes that directly participate in the detoxifica- diameters were measured each month using a digital caliper. The tion of urethane, that is, Cyp2e1, mEH, Gstp1,andGstp2,were tumor volumes were calculated using the following formula: induced in the lung of Keap1-kd mice compared with Keap1-wt length (mm) width (mm) height (mm) 0.5 (22). mice(Fig.1B).Intheliver,mRNAexpressionofmEH and Gstp2 was also higher in Keap1-kd mice when compared with Quantitative RT-PCR Keap1-wt mice (Supplementary Fig. 1). These results indicate Total RNA was extracted from the tissues using ISOGEN that the expression of urethane detoxification genes is en- (Nippon Gene). First-strand cDNA was synthesized from the hanced in Keap1-kd mice. total RNA using random hexamers and Superscript III Reverse- The constitutive activation of the urethane detoxification Transcriptase (Invitrogen). Real-time RT-PCR was performed system in Keap1-kd mice suggests that urethane is efficiently using 2X SYBR Green PCR Master Mix (Invitrogen) and the ABI detoxified in Keap1-kd mice. It has previously been reported PRISM 7300 sequence detector system (PE-Applied Biosystems). that urethane metabolites are mainly excreted into the urine Sequences of primers and TaqMan probes were described pre- (23). Therefore, we examined the concentration of urethane viously (17). Following primers were newly prepared; Ppargc1a: and its metabolite in plasma and urine of Keap1-kd and Keap1- forward ACAGCTTTCTGGGTGGATTG, reverse TCTGTGAGAA- wt mice after intraperitoneal injection of urethane. We collected CCGCTAGCAA. Catalase: forward GCTTCAAGTTGGTTAATGC- plasma and urine samples one day after the injection of AG, reverse GGCAATTTTTGATGCCCTGG, and TaqMan probe urethane (1 g/kg body weight) and subjected them to LC/ AGAGGCAGTCTATTGCAAG. MS-MS analyses. A selected reaction monitoring (SRM)

OF2 Cancer Res; 76(10) May 15, 2016 Cancer Research

Genetic Nrf2 Activation in Chemical Lung Carcinogenesis

Figure 1. Urethane metabolism in Keap1-kd mice. A, bioactivation and detoxification pathway of urethane (ethyl carbamate). B, RT-qPCR analysis of urethane detoxification enzymes in the lung of Keap1-wt-mice and Keap1-kd-mice. mRNA abundance is normalized with b-actin level. SRM chromatogram of urethane or VCE with urethane-d5 (deuterium-labeled urethane as an internal standard) as a control in plasma (C) and urine (D). Quantification of plasma urethane (E) and urinary VCE (F) by LC-/MS-MS in the Keap1-wt-mice and Keap1-kd-mice after vehicle (V) or urethane (U) treatment is depicted. Plasma urethane level and urinary VCE level are both lower in the Keap1-kd mice than in the Keap1-wt mice. The data are presented as the mean SD. The significant differences determined by Student t test are indicated (, P < 0.05; , P < 0.01; n ¼ 4 in each group).

chromatogram of urethane and its positive control urethane- Keap1-kd mice are resistant against urethane-induced d5 (deuterium-labeled urethane as an internal standard) in tumorigenesis plasma are shown in Fig. 1C and a SRM chromatogram of To address the question of whether the susceptibility to ure- VCE and urethane-d5 in urine are shown in Fig. 1D. thane is altered in Keap1-kd mice, we applied the urethane- The urethane level in the plasma was significantly induced carcinogenesis methodology to the Keap1-kd and lower in Keap1-kd mice compared with Keap1-wt mice one Keap1-wt mice. We analyzed the effects of urethane treatment day after the urethane injection (Fig. 1E). Similarly, the under four different experimental conditions: short-term obser- level of VCE in the urine was also lower in the Keap1-kd vation (8 weeks), mid-term observation (16 weeks), long-term mice than in the Keap1-wt mice(Fig.1F).Theseresults observation (8 months), and long-term observation (8 months) indicate that urethane and its metabolite VCE is efficiently with multiple administrations of urethane. detoxified and excreted by Keap1-kd mice, presumably by We found that in the short-term observation after a single virtue of the enhanced activity of the urethane detoxifi- urethane administration, 100.0% (4/4) of the urethane-treated cation pathway. Keap1-wt mice developed macroscopic (f>0.5 mm) lung

www.aacrjournals.org Cancer Res; 76(10) May 15, 2016 OF3

Satoh et al.

again and examined the total number and diameter of urethane-induced tumors 8 months after a single administration of urethane. The total number of surface tumors (f>1.0 mm) per mouse was significantly increased in the Keap1-wt mice at 8 months (Fig. 3A and B; Table 1C). In contrast, the numbers of surface tumors did not significantly increase in the Keap1-kd mice even at this late time point (Fig. 3A and B; Table 1C). By determining the average diameter of all of the tumors in both genotypes, we found that Keap1-kd mice also developed much smaller tumors when compared with the Keap1-wt mice (Fig. 3C). These results indicate that constitutive induction of Nrf2 through the knockdown of Keap1 expression strongly restricts the growth of urethane-induced lung tumors. To examine whether an increased amount of urethane and its metabolites could increase urethane-mediated tumorigenesis in Keap1-kd mice, we conducted a tumorigenesis experiment using multiple injections of urethane. Both Keap1-kd and Keap1- wt mice were injected weekly with urethane for four consecutive weeks, subsequently the mice were examined 8 months after the first urethane administration (Fig. 3D). Surprisingly, the initiation of tumorigenesis was not dramatically enhanced by this treatment, and the number of surface tumors was still significantly lower in Keap1-kd mice than in Keap1-wt mice (Fig. 3E; Table 1D). Interestingly, using this experimental pro- cedure, the diameter of Keap1-kd tumors became similar to that of Keap1-wt mice (Fig. 3F). In addition, Keap1-kd tumors con- tained an increased number of Ki67-positive cells compared with similar sized Keap1-wt tumors (top panels in the Supple- mentary Fig. S2A), whereas the tumor bearing Keap1-kd lung tissue harbored a higher number of infiltrating inflammatory cells than the Keap1-wt lung (bottom panels in the Supplemen- Figure 2. tary Fig. S2B). These results indicate that the Keap1-kd tumors Short-term and mid-term urethane-induced lung carcinogenesis. A, have a high tumorigenic potential, but the increased number mouse lungs were examined at 8 weeks after urethane administration. of inflammatory cells might attenuate the tumor growth in the Representative gross observations of surface lung tumors in Keap1-wt and Keap1-kd mice (top). Arrowhead, the surface tumor. Scale bar, 5 mm. Keap1-kd lung tissue. Representative hematoxylin and eosin–stained sections. Scale bar, 100 mm (bottom). B, number of surface lung tumors in Keap1-wt (n ¼ 4) and Cancer-resistant host microenvironment is activated in Keap1- Keap1-kd (n ¼ 10) mice. Each dot represents total number of macroscopic kd mice tumors (f>0.5 mm) in an individual mouse. The color of the dots We previously found that systemic Nrf2 activation in Keap1-kd indicates the size of the largest tumor in each mouse lung. C, mice generates a cancer-resistant host immune environment representative hematoxylin and eosin–stained sections in Keap1-wt and Keap1-kd-miceat16weeks.Scalebar,100mm. D, numbers of surface by attenuating the activity of myeloid-derived suppressor cells tumors (f>1.0 mm) in Keap1-wt (n ¼ 4) and Keap1-kd (n ¼ 6) mice. Data (MDSC), a potent cancer immunosurveillance cell type (24). are presented as the mean SD. The significant differences by Student Intracellular accumulation of reactive oxygen species (ROS) þ t test are indicated ( , P < 0.01). in MDSCs (ROS-in-MDSC) leads to the suppression of CD8 T-cell–mediated cancer immunity, hence the ROS level serves as a good indicator of MDSCs activity (24, 25). There- surface tumors, compared with only 20% (2/10) of the fore, we hypothesized that an increase in Nrf2 activity will Keap1-kd mice (f>0.5 mm; Fig. 2A and B; Table 1A). This decrease the ROS-in-MDSCs level in tumor-bearing Keap1-kd result suggests that the induction of Nrf2 in Keap1-kd mice mice, thereby attenuating the activity of MDSCs, leading to the prevents urethane-induced lung tumorigenesis during the generation of a cancer-resistant host immune environment in early phase. Keap1-kd mice. We extended the observation time and examined the total To test this hypothesis, we conducted tumor cell transplan- number and diameter of lung surface tumors 16 weeks after tation studies into immunodeficient nude mice, a gold stan- urethane administration. The total number of lung surface dard experiment to evaluate the tumorigenicity of cancer cells tumors (f>1.0 mm) per mouse was significantly increased without the influence of host-environment interactions (26). during this extended period in the Keap1-wt mice (Fig. 2C and We dissected lung tumors of approximately equal sizes (f ¼ D; Table 1B). There also exists the possibility that Keap1-kd 0.5–1.5 mm) from the Keap1-wt and Keap1-kd mice 8 months tumor cells may grow vigorously during the later stages of the after a single urethane administration, transplanted them into urethane-induced tumorigenesis, as Nrf2 shows potent onco- nude mice, and evaluated their tumorigenicity. Notably, during genic activity in many types of human cancers (13, 22). To the 5-month observation period, tumor cells from Keap1-kd examine this possibility, we extended the observation term mice grew much more aggressively than tumor cells from

OF4 Cancer Res; 76(10) May 15, 2016 Cancer Research

Genetic Nrf2 Activation in Chemical Lung Carcinogenesis

Table 1. Summary of urethane-induced lung carcinogenesis experiments A. Short-term observation (8 weeks) after single urethane administration in Keap1-wt and Keap1-kd mice Average number of lung surface tumors per Incidence of lung surface tumors mouse Tumor size (mm) f>0.5 f>0.5 Keap1-wt (n ¼ 4) 4/4 (100.0%) 2.5 1.3 Keap1-kd (n ¼ 10) 2/10 (20.0%)a 0.2 0.4a

B. Mid-term observation (16 weeks) after single urethane treatment in Keap1-wt and Keap1-kd mice Average number of lung surface tumors per Incidence of lung surface tumors mouse Tumor size (mm) f>1.0 f>1.0 Keap1-wt (n ¼ 4) 4/4 (100.0%) 6.0 3.7 Keap1-kd (n ¼ 6) 1/6 (16.7%)a 0.2 0.4a

C. Long-term observation (8 months) after single urethane treatment in Keap1-wt and Keap1-kd mice Average number of lung surface tumors per Incidence of lung surface tumors mouse Tumor size (mm) f>1.0 f>3.0 f>1.0 f>3.0 Keap1-wt (n ¼ 7) 7/7 (100.0%) 7/7 (100.0%) 12.7 6.1 3.1 2.4 Keap1-kd (n ¼ 8) 7/8 (87.6%) 2/8 (25.0%)a 1.8 1.5a 0.4 0.7a

D. Long-term observation (8 month) after four times urethane treatment in Keap1-wt and Keap1-kd mice Average number of lung surface tumors per Incidence of lung surface tumors mouse Tumor size (mm) f>1.0 f>3.0 f>1.0 f>3.0 Keap1-wt (n ¼ 3)b 3/3 (100.0%) 3/3 (100.0%) 47.0 23.1 9.3 9.1 Keap1-kd (n ¼ 7) 7/7 (100.0%) 4/7 (57.1%) 10.9 4.6a 1.3 1.4c aP < 0.01 compared with wild-type mice. bThree of Keap1-wt mice dropped out during the experimental term. cP < 0.05 compared with wild-type mice.

Keap1-wt mice. Representative tumors taken from the back of A distinct set of 489 genes was exclusively upregulated in nude mice are shown in Fig. 4A, and the sizes of the tumors the Keap1-kd tumors. Employing IPA analysis, we identified measured every month are depicted in Fig. 4B. These results 20 downstream genes responsible for the enhanced growth indicate that the tumor cells derived from Keap1-kd mice are of Keap1-kd tumors and confirmed their differential expres- more highly proliferative compared with those from the wild- sion patterns between the Keap1-wt and the Keap1-kd tumors type mice when transplanted into an immunodeficient host (Fig.5B).Mostofthegenesencode antioxidant and detoxi- environment. fication enzymes, which are well-known downstream target genes of Nrf2 (Supplementary Table S1; refs. 27–31). Of the Expression profile of cancer-related genes in Keap1-kd tumor 20 genes, Glutathione peroxidase 2 (Gpx2), Catalase (Cat), cells Ppargc1A, Glutathione-S-transferase a4 (Gsta4 ), and Glutathione To explore the mechanisms underlying the enhanced reductase (Gsr) were found to be highly expressed in the Keap1- growth of Keap1-kd cancer cells in nude mice, we conducted kd cancers in comparison with the Keap1-wt cancers (pink dots expression microarray analysis and compared the gene expres- in Fig. 5B), and all five of these genes have been reported to sion profile between Keap1-kd and Keap1-wt tumor cells. For contribute to cancer cell proliferation through eliminating this purpose, we extracted total RNA from tumors and non- cellular ROS level (32–35). We confirmed this change in gene cancerous normal tissue from both Keap1-kd and Keap1-wt expression by means of manual quantitative RT-PCR (Fig. mice 8 months after a single administration of urethane. We 5C). In addition, we noticed an increase in Multidrug resistance selected genes that were induced more than 2-fold in the protein 3 (Mrp3) expression, which contributes to cellular tumors relative to normal lung tissue in both genotypes of multidrug resistance (36). These results suggest that the mice and subjected the expression array data to IPA to identify Keap1-kd cancer cells retain higher level of drug resistance enriched gene ontology terms. From this analysis, the gene set than do the Keap1-wt cancer cells. annotated as "cancer-related genes" was identified and sepa- However, it should be noted that the tumors in Keap1-kd rated into three groups depending on whether they were mice were all small, and that the cancer cells from the commonly or differentially expressed between Keap1-kd and Keap1-kd mice only proliferated vigorously in the micro- Keap1-wt tumors (depicted in the Venn diagram; Fig. 5A). A set environment of the nude mouse. Therefore, these results of 566 genes were found to be commonly upregulated in both demonstrate that, although increased expression of antiox- the Keap1-kd and Keap1-wt cancer tissues, including genes that idant genes contributes to the enhanced proliferation of regulate lung development, such as Sox9, Id2,andFoxa2 (data Keap1-kd cancer cells, the proliferation of these tumors is not shown). These three genes have previously been shown to severely repressed by the anticancer immunity mediated by participate in lung cancer progression under the regulation of the global increase in Nrf2 activity in Keap1-kd mice (sum- Nrf2 (17). marized in Fig. 6).

www.aacrjournals.org Cancer Res; 76(10) May 15, 2016 OF5

Satoh et al.

Figure 3. Long-term urethane-induced lung carcinogenesis. A, experimental protocol for one-shot urethane administration. Mouse lungs were examined 8 months after urethane administration. Representative gross observations of surface lung tumors in Keap1-wt and Keap1-kd-mice are depicted. Arrowheads, the surface tumors. Scale bar, 10 mm. Representative hematoxylin and eosin–stained sections (bottom). Scale bar, 40 mm. B, number of surface lung tumors (f>1 mm) in Keap1-wt (n ¼ 7) and Keap1-kd (n ¼ 8) mice. The color of the dots indicates the size of the largest tumor in each individual mouse of both genotypes. Each dot represents the total number of macroscopic tumors (f>0.5 mm) in an individual mouse. The color of the dots indicates the size of the largest tumor in each mouse lung. C, average tumor diameter in each genotype of mouse. D, experimental protocol for the four consecutive urethane administration experiment. Mouse lungs are examined 8 months after four consecutive administrations of urethane. Representative gross observations of surface lung tumors in Keap1-wt and Keap1-kd-mice. Arrowheads, the surface tumor. Scale bar, 10 mm. Representative hematoxylin and eosin–stained sections (bottom). Scale bar, 40 mm. E, number of surface lung tumors (f>1 mm) in in Keap1-wt (n ¼ 3) and Keap1-kd (n ¼ 7) mice. The color of dots indicates size of the largest tumor in each individual mouse of both genotypes. Each dot represents total number of macroscopic tumors (f>1.0 mm) in individual mouse. The color of dots indicates size of the largest tumor in each mouse lung. F, average tumor diameter in each genotype of mouse. The data are presented as the mean SD. The signiﬁcant differences by Student t test are indicated (, P < 0.05; , P < 0.01).

Discussion It is widely accepted that Nrf2 attenuates toxicities of many oncogenic compounds by inducing the expression of a series of detoxifying and antioxidative stress enzyme genes (1). For example, urethane treatment induces Nrf2 accumulation, and the subsequent induction of detoxifying and antioxidative stress enzymes alleviates the initiation of lung cancers in wild-type mice (17). In this study, we have demonstrated that Keap1-kd mice, which express cytoprotective enzymes at a high level, are significantly resistant to urethane-induced lung carcinogenesis, indicating that the cytoprotective enzymes regulated by Nrf2 are crucial for the prevention of urethane-induced carcinogenesis. Intriguingly, while the number and size of urethane-induced tumors was significantly decreased in the Figure 4. Keap1-kd mice, tumor cells derived from the Keap1-kd mice Keap1-kd mice tumors transplanted into nude mice grow larger than that grew much more vigorously upon transplantation into nude of Keap1-wt mice. A, gross observations of tumors transplanted in mice than the wild-type mouse–derived cancer cells. These nude mice. Scale bar, 0.5 mm. Representative hematoxylin and eosin–stained sections (bottom). Scale bar, 20 m. B, growth curve of results demonstrate that, while the Keap1-kd mouse–derived m Keap1-wt and Keap1-kd tumors transplanted in nude mice. The data cancer cells acquire a strong cue for malignant transformation, are presented as the mean SEM. The statistically significant differences their proliferation ability is severely repressed by the anticancer by Mann–Whitney unpaired U test are depicted (, P < 0.05; n ¼ 6–8 immunity mediated by the global increase in Nrf2 activity in in each group).

OF6 Cancer Res; 76(10) May 15, 2016 Cancer Research

Genetic Nrf2 Activation in Chemical Lung Carcinogenesis

consequently a reduction in both tumor number and size in response to urethane-induced carcinogenesis (summarized in Fig. 6). To clarify the mechanisms underlying the strong proliferative activity of the transplanted Keap1-kd cells, we examined the gene expression signature of the Keap1-kd tumors. Our microarray analysis revealed that a battery of Nrf2 downstream genes is highly expressed in the Keap1-kd tumors. Particularly, expressions of Gpx2, Gsr, Cat, Mrp3, Gsta2, and Ppargc1A genes, all of which have been reported to be regulated by Nrf2, are increased (27–31, 36, 40, 41). Of these antioxidant proteins, Catalase encoded by Cat is known to play a crucial role in the ROS-scavenging system by converting hydrogen peroxide to water (31). A recent study revealed the contribution of Catalase to the enhancement of lung cancer malignancy by reducing ROS level (32). PPAR gamma coactivator-1a (Pgc1a), a transcriptional coactivator encoded by Ppargc1A, also plays important roles in cellular protection against ROS by increasing the expression of antioxidant enzymes (27). In addition, Pgc1a has also been shown to be highly expressed in several types of epithelial cancer where it contributes to ROS scavenging (34). Given these previous reports, our current results indicate that constitutively activated Nrf2 in the Keap1-kd tumor cells contributes to malignant progression by reducing ROS levels through inducing the expression of multiple antioxidant genes. Similarly, treatment of tumor-bearing mice with antioxidants, such as N-acetylcysteine (NAC) and vitamin E, have been shown to reduce intracellular ROS levels and promote cancer progression

Figure 5. Identiﬁcation of the gene expression signature in the Keap1-kd and Keap1-wt tumors. A, Venn diagram depicting the numbers of genes induced more than 2-fold in tumors over nontumor lung tissues of Keap1-wt and Keap1-kd mice. B, heat map comparisons of differentially expressed genes in the lung tumors of Keap1-wt and Keap1-kd mice. Pink dots, Nrf2 target genes that contribute to cancer cell malignancy. C, qRT-PCR analyses of Nrf2 target genes. Statistical signiﬁcance in differences by Student t test is indicated (, P < 0.01).

Keap1-kd mice. Consequently, the size of the tumors is kept small in the Keap1-kd mice. It has been shown that the immunosuppressive activity by MDSCs is primarily regulated by the intracellular ROS level (37) and that the Nrf2-mediated antioxidant system appears to play a crucial role for the reduction of immunosuppressive activity in MDSCs (24, 38). Recently, ex vivo experiment of bone marrow–derived macrophage using Nrf2-deficient mice þ showed that Nrf2 contributes to CD8 T-cell function by regulating g-GCS and xCT (39). We recently reported that the immune microenvironment of Keap1-kd mice leads to resistance against metastasis of lung cancer cells and that activation of Nrf2 by chemical inducers reduces ROS levels in MDSCs, which in turn strengthens host immunity against metastatic Figure 6. cancer cells (38). We found that when Keap1-kd tumors were High-level Nrf2 expression in the Keap1-kd lung cancer cells enhances the transplanted into T-cell–deficient nude mice, they proliferated tumorigenicity through activating antioxidative stress system. Meanwhile, vigorously, supporting the notion that Nrf2-mediated increased level of Nrf2 intensifies carcinogen detoxifying system and enhancement of anticancer immunity is critically important anticancer immunity in the host environment (depicted in the "Host Defense"). Balance between these two aspects of Nrf2 function is a critical to regulate the cancer-resistant host microenvironment. We determinant for tumor growth. In the Keap1-kd mice, the tumor-resistant would postulate that, the genetic induction of Nrf2 by knock- environment dominates the tumorigenicity of the cells, thereby diminishing down of the Keap1 gene results in reduced MDSCs activity, and tumor growth.

www.aacrjournals.org Cancer Res; 76(10) May 15, 2016 OF7

Satoh et al.

in experimental carcinogenesis in multiple tissues (42). These Administrative, technical, or material support (i.e., reporting or organiz- wide-ranging observations suggest that antioxidants may exert ing data, constructing databases): H. Satoh, L. Yu, H. Rokutan, K. Igarashi, accelerating effects on cancer progression at the late stages of M. Ebina, M. Yamamoto Study supervision: M. Yamamoto carcinogenesis. Constitutive activation of Nrf2 in Keap1-kd mice produces Acknowledgments the same positive effect on the proliferation of tumor cells, The authors thank Dr. Yasuhito Arai, Dr. Takanori Hidaka, and Mr. Kohei but as Nrf2 concomitantly activates anticancer immunity, it Tsuchida for the insightful advice and helpful discussions. The authors also does not promote unrestricted tumor growth. Thus, our thank the Biomedical Research Core of Tohoku University Graduate School of results show that the systemic activation of Nrf2 prior to the Medicine for its technical support. administration of carcinogens prevents urethane-induced lung carcinogenesis. Grant Support This work was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology and the Disclosure of Potential Conflicts of Interest Japan Society for Promotion of Science (T. Moriguchi and M. Yamamoto), fi No potential conflicts of interest were disclosed. Scienti c Research on Priority Areas (M. Yamamoto) and Specially Promoted Research (M. Yamamoto). H. Satoh was supported by Research Fellowships of Japan Society for the Promotion of Science for Young Scientists. This study was Authors' Contributions also supported in part by MEXT/JSPS KAKENHI (24249015 and 26111002 Conception and design: H. Satoh, T. Moriguchi, M. Yamamoto to M. Yamamoto; 24590371 to T. Moriguchi; 25870071 and 25870071 fl Development of methodology: H. Satoh, D. Saigusa and 268771 to H. Satoh), AMED-CREST, AMED (chronic in ammation; Acquisition of data (provided animals, acquired and managed patients, M. Yamamoto), P-DIRECT, AMED (M. Yamamoto), and Takeda Science Foun- provided facilities, etc.): H. Satoh, T. Moriguchi, D. Saigusa, L. Baird, L. Yu, dation (M. Yamamoto). T. Shibata The costs of publication of this article were defrayed in part by the payment of Analysis and interpretation of data (e.g., statistical analysis, biostatistics, page charges. This article must therefore be hereby marked advertisement in computational analysis): H. Satoh, T. Moriguchi, D. Saigusa, L. Baird, L. Yu, accordance with 18 U.S.C. Section 1734 solely to indicate this fact. T. Shibata, M. Yamamoto Writing, review, and/or revision of the manuscript: H. Satoh, T. Moriguchi, Received June 15, 2015; revised February 10, 2016; accepted February 26, D. Saigusa, L. Baird, T. Shibata, M. Yamamoto 2016; published OnlineFirst March 28, 2016.

References 1. Itoh K, Mimura J, Yamamoto M. Discovery of the negative regulator of Nrf2, in Nrf2-deficient mice upon dextran sulfate treatment. Int J Cancer 2007; Keap1: a historical overview. Antioxid Redox Signal 2010;13:1665–78. 121:1883–91. 2. Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y, et al. An Nrf2/small 12. Iida K, Itoh K, Kumagai Y, Oyasu R, Hattori K, Kawai K, et al. Nrf2 is Maf heterodimer mediates the induction of phase II detoxifying enzyme essential for the chemopreventive efficacy of oltipraz against urinary genes through antioxidant response elements. Biochem Biophys Res bladder carcinogenesis. Cancer Res 2004;64:6424–31. Commun 1997;236:313–22. 13. ShibataT,OhtaT,TongKI,KokubuA,OdogawaR,TsutaK,etal.Cancer 3. Anderson N, Paul SH, Henry M. Induction of pulmonary tumors in mice related mutations in NRF2 impair its recognition by Keap1-Cul3 E3 with ethyl carbamate (Urethane). J Natl Cancer Inst 1943;4:309–19. ligase and promote malignancy. Proc Natl Acad Sci U S A 2008;105: 4. Horio Y, Chen A, Rice P, Roth JA, Malkinson AM, Schrump DS. Ki-ras and 13568–73. p53 mutations are early and late events, respectively, in urethane-induced 14. Shibata T, Kokubu A, Gotoh M, Ojima H, Ohta T, Yamamoto M, et al. pulmonary carcinogenesis in A/J mice. Mol Carcinog 1996;17:217–23. Genetic alteration of Keap1 confers constitutive Nrf2 activation and 5. Ghanayem BI, Hoffler U. Investigation of xenobiotics metabolism, geno- resistance to chemotherapy in gallbladder cancer. Gastroenterology 2008; toxicity, and carcinogenicity using Cyp2e1(-/-) mice. Curr Drug Metab 135:1358–68. 2007;8:728–49. 15. Hayes JD, McMahon M. The double-edged sword of Nrf2: subversion of 6. Kemper RA, Myers SR, Hurst HE. Detoxification of vinyl carbamate redox homeostasis during the evolution of cancer. Mol Cell 2006;21: epoxide by glutathione: evidence for participation of glutathione S- 732–4. transferases in metabolism of ethyl carbamate. Toxicol Appl Pharmacol 16. Ma Q.Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol 1995;135:110–8. Toxicol 2013;53:401–26. 7. Su S, Yang X, Omiecinski CJ. Intronic DNA elements regulate Nrf2 chemical 17. Satoh H, Moriguchi T, Takai J, Ebina M, Yamamoto M. Nrf2 prevents responsiveness of the human microsomal epoxide hydrolase gene initiation but accelerates progression through the Kras signaling pathway (EPHX1) through a far upstream alternative promoter. Biochim Biophys during lung carcinogenesis. Cancer Res 2013;73:4158–68. Acta 2014;1839:493–505. 18. Taguchi K, Maher JM, Suzuki T, Kawatani Y, Motohashi H, Yamamoto M. 8. Hu R, Xu C, Shen G, Jain MR, Khor TO, Gopalkrishnan A, et al. Gene Genetic analysis of cytoprotective functions supported by graded expres- expression profiles induced by cancer chemopreventive isothiocyanate sion of Keap1. Mol Cell Biol 2010;30:3016–26. sulforaphane in the liver of C57BL/6J mice and C57BL/6J/Nrf2 (-/-) mice. 19. Reisman SA, Csanaky IL, Aleksunes LM, Klaassen CD. Altered disposition Cancer Lett 2006;243:170–92. of acetaminophen in Nrf2-null and Keap1-knockdown mice. Toxicol Sci 9. Xu C, Huang MT, Shen G, Yuan X, Lin W, Khor TO, et al. Inhibition of 7,12- 2009;109:31–40. dimethylbenz(a)anthracene-induced skin tumorigenesis in C57BL/6 mice 20. Wu KC, Liu JJ, Klaassen CD. Nrf2 activation prevents cadmium-induced by sulforaphane is mediated by nuclear factor E2-related factor 2. Cancer acute liver injury. Toxicol Appl Pharmacol 2012;263:14–20. Res 2006;66:8293–6. 21. Uruno A, Furusawa Y, Yagishita Y, Fukutomi T, Muramatsu H, Negishi T, 10. Ramos-Gomez M, Kwak MK, Dolan PM, Itoh K, Yamamoto M, Talalay P, et al. The Keap1-Nrf2 system prevents onset of diabetes mellitus. Mol Cell et al. Sensitivity to carcinogenesis is increased and chemoprotective Biol 2013;33:2996–3010. efficacy of enzyme inducers is lost in nrf2 transcription factor-deficient 22. Singh A, Boldin-Adamsky S, Thimmulappa RK, Rath SK, Ashush H, Coulter mice. Proc Natl Acad Sci U S A 2001;98:3410–5. J, et al. RNAi-mediated silencing of nuclear factor erythroid-2-related factor 11. Osburn WO, Karim B, Dolan PM, Liu G, Yamamoto M, Huso DL, et al. 2 gene expression in non-small cell lung cancer inhibits tumor growth and Increased colonic inflammatory injury and formation of aberrant crypt foci increases efficacy of chemotherapy. Cancer Res 2008;68:7975–84.

OF8 Cancer Res; 76(10) May 15, 2016 Cancer Research

Genetic Nrf2 Activation in Chemical Lung Carcinogenesis

23. Hoffler U, Ghanayem BI. Increased bioaccumulation of urethane in 33. Naiki T, Naiki-Ito A, Asamoto M, Kawai N, Tozawa K, Etani T, et al. GPX2 CYP2E1-/- versus CYP2E1þ/þ mice. Drug Metab Dispos 2005;33: overexpression is involved in cell proliferation and prognosis of castration- 1144–50. resistant prostate cancer. Carcinogenesis 2014;35:1962–7. 24. Satoh H, Moriguchi T, Taguchi K, Takai J, Maher JM, Suzuki T, et al. Nrf2- 34. Salem AF, Whitaker-Menezes D, Howell A, Sotgia F, Lisanti MP. Mitochon- deficiency creates a responsive microenvironment for metastasis to the drial biogenesis in epithelial cancer cells promotes breast cancer tumor lung. Carcinogenesis 2010;31:1833–43. growth and confers autophagy resistance. Cell Cycle 2012;11:4174–80. 25. Nagaraj S, Gabrilovich DI. Tumor escape mechanism governed by mye- 35. Singh S.Cytoprotective and regulatory functions of glutathione S-trans- loid-derived suppressor cells. Cancer Res 2008;68:2561–3. ferases in cancer cell proliferation and cell death. Cancer Chemother 26. Cardoso CC, Bornstein SR, Hornsby PJ. New methods for investigating Pharmacol 2015;75:1–15. experimental human adrenal tumorigenesis. Mol Cell Endocrinol 2009; 36. Maher JM, Dieter MZ, Aleksunes LM, Slitt AL, Guo G, Tanaka Y, et al. 300:175–9. Oxidative and electrophilic stress induces multidrug resistance-associated 27. Baldelli S, Aquilano K, Ciriolo MR. Punctum on two different tran- protein transporters via the nuclear factor-E2-related factor-2 transcrip- scription factors regulated by PGC-1alpha: nuclear factor erythroid- tional pathway. Hepatology 2007;46:1597–610. derived 2-like 2 and nuclear respiratory factor 2. Biochim Biophys Acta 37. Nagaraj S, Gupta K, Pisarev V, Kinarsky L, Sherman S, Kang L, et al. Altered 2013;1830:4137–46. recognition of antigen is a mechanism of CD8þ T cell tolerance in cancer. 28. Harvey CJ, Thimmulappa RK, Singh A, Blake DJ, Ling G, Wakabayashi N, Nat Med 2007;13:828–35. et al. Nrf2-regulated glutathione recycling independent of biosynthesis is 38. Hiramoto K, Satoh H, Suzuki T, Moriguchi T, Pi J, Shimosegawa T, et al. critical for cell survival during oxidative stress. Free Radic Biol Med 2009; Myeloid lineage-specific deletion of antioxidant system enhances tumor 46:443–53. metastasis. Cancer Prev Res 2014;7:835–44. 29. Malhotra D, Portales-Casamar E, Singh A, Srivastava S, Arenillas D, Happel 39. Sha LK, Sha W, Kuchler L, Daiber A, Giegerich AK, Weigert A, et al. Loss of C, et al. Global mapping of binding sites for Nrf2 identifies novel targets in Nrf2 in bone marrow-derived macrophages impairs antigen-driven CD8 cell survival response through ChIP-Seq profiling and network analysis. (þ) T cell function by limiting GSH and Cys availability. Free Radic Biol Nucleic Acids Res 2010;38:5718–34. Med 2015;83:77–88. 30. Singh A, Rangasamy T, Thimmulappa RK, Lee H, Osburn WO, Brigelius- 40. Jung KA, Kwak MK. The Nrf2 system as a potential target for the develop- Flohe R, et al. Glutathione peroxidase 2, the major cigarette smoke- ment of indirect antioxidants. Molecules 2010;15:7266–91. inducible isoform of GPX in lungs, is regulated by Nrf2. Am J Respir Cell 41. Zahlten J, Kim YJ, Doehn JM, Pribyl T, Hocke AC, García P, et al. Strep- Mol Biol 2006;35:639–50. tococcus pneumoniae-induced oxidative stress in lung epithelial cells 31. Vaziri ND. Protective effect of Nrf2 and catalase in maternal diabetes- depends on pneumococcal autolysis and is reversible by resveratrol. induced perinatal hypertension and kidney disease. Diabetes 2012;61: J Infect Dis 2015;211:1822–30. 2400–2. 42. Sayin VI, Ibrahim MX, Larsson E, Nilsson JA, Lindahl P, Bergo MO. 32. Kinnula VL, Paakko P, Soini Y. Antioxidant enzymes and redox regulating Antioxidants accelerate lung cancer progression in mice. Sci Transl Med thiol proteins in malignancies of human lung. FEBS Lett 2004;569:1–6. 2014;6:221ra15.

www.aacrjournals.org Cancer Res; 76(10) May 15, 2016 OF9

NRF2 Intensifies Host Defense Systems to Prevent Lung Carcinogenesis, but After Tumor Initiation Accelerates Malignant Cell Growth

Hironori Satoh, Takashi Moriguchi, Daisuke Saigusa, et al.

Cancer Res Published OnlineFirst March 28, 2016.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-15-1584

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2016/03/26/0008-5472.CAN-15-1584.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2016/04/30/0008-5472.CAN-15-1584. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.