© 2015 Nature America, Inc. All rights reserved. 6 Membranes et des Nano-objets (CBMN), Pessac, France. University of Munich, Munich, Germany. 1 decrease observable no but activity antimicrobial of loss a in results example, a C-terminally truncated version of the apidaecin 1b peptide tides are likely to use additional modes of action to inhibit growth. For of PrAMPs properties antimicrobial for affinity increased DnaK thus leading to the development of improved PrAMP derivatives with manner, in a chaperone stereospecific shown to bind to bacterial this such as oncocin, drosocin, pyrrhocoricin or apidaecin were previously inhibition for candidate prime the as DnaK protein heat-shock of the tification treatment of ordelivery cerebral drug infections for brain-specific tively target brain cells, thus further highlighting their potential for antimicrobials. the existing to Interestingly, some alternative PrAMPs can cross the blood-brain attractive barrier to selec an therefore and have PrAMPsdetected, been are considered generally to be nontoxic proteins eukaryotic intracellular with interactions limited only and Given that such transport mechanisms are absent in mammalian cells, bacteria negative into the cytoplasm by specialized transporters, such as SbmA in Gram- transported are PrAMPs membrane, cell their disrupting by bacteria antibiotics classical to resistance bacterial in increase rapid the countering of means possible a as tion organisms multicellular all of response immune innate the of part as are produced that molecules of group diverse a form peptides Antimicrobial Stefan Arenz A Carolin Seefeldt complex initiation the destabilizing and by blocking translation inhibits Onc112 peptide antimicrobial proline-rich The nature structural & molecular biology molecular & structural nature Received 26 February; accepted 22 April; published online 18 May 2015; the We exit thermophilus of antibiotic antimicrobial The These These authors contributed equally to this work. should Correspondence be addressed to C.A.I. ( Institut Européen de Chimie et Biologie, Université de Bordeaux, Pessac, France.

Initial efforts to locate bacterial targets to for Initial efforts locate bacterial PrAMPs led to the iden action

elongation show increasing tunnel

8 has 1

biochemically development. . Short proline-rich peptides (of 18–20 amino acids (aa)) (aa)) acids amino 18–20 (of peptides proline-rich Short . . . Among these, PrAMPs have garnered considerable atten

and

remained

70S peptides

3

phase. prevalence extends 4 , , K Kishore Inampudi , 5

, where they inhibit specific intracellular targets. targets. intracellular specific inhibit they where , ribosome 1

Our ,

2

(PrAMPs)

unclear. ,

toward

6 that PrAMPs 9– , , Fabian Nguyen

of findings 1

2 at

. . However, subsequent studies into the

the multidrug-resistant

a 2

the

,

4 Here 3

resolution

binding Université Université de Bordeaux, CNRS, Institut de Polytechnique Bordeaux, UMR 5248, Institut de Chimie et Biologie des . Unlike many peptides that kill kill that peptides many Unlike . from display 1 3

have suggested that these pep that these have suggested provide peptidyl

we

the

potent 1 of have

, oncocin 2

of , Céline , DouatCéline a

Onc

3 transferase

5 ,

basis 6 Center Center for Integrated Protein Science Munich (CiPSM), University of Munich, Munich, Germany. 3. advance online publication online advance determined , , Stéphanie Antunes

1 1 11 activity

pathogenic Å

2 for family

by

blocks

the X-ray

center, against

interact

future do a

and

1 structure crystallography. i:10.1038/nsmb.303 7 bacteria , . 4

, Gilles , GuichardGilles 6 - - - -

where

Gram-negative

destabilizes

2 development INSERM INSERM U869, Bordeaux, France.

with tion by targeting the ribosomal exit tunnel. exit ribosomal the by targeting tion transla inhibit that peptidomimetic, or peptidic either compounds, will provide an excellent basis for the design of improved antibacterial it activity. for is Weantimicrobial essential findings that these believe binding, ribosome for dispensable is Onc112 of portion C-terminal the of truncation although that demonstrated translation-elongation we Moreover, the phase. into subse ribosomes prevents affected thus of and entry quent complex initiation the destabilizes this, but with initiate to translation Consistently allows Onc112 center. that biochemically showed we transferase peptidyl the at tRNA tunnel, exit ribosomal the overlapping the binding of site for the CCA region end of an aminoacyl (A)-site upper the to bind Onc112 of fasciatus oncocin family of PrAMPs produced by the milkweed bug ( tRNA deacylated bound the of mophilus structure crystallography X-ray resolution determined. been not far so has translation inhibit they which translation inhibit and ribosome the to bind to ribosome the namely cell, the bacterial PrAMPs within have target that these an additional the to the inhibit growth of a found were derivatives Api137) and (Api88 apidaecin and Onc112) uptake or cellular binding in DnaK ee w st u t ades hs su b otiig 3.1-Å- a obtaining by issue this address to out set we Here,

is 1 it dnaK of

,

the 4

making overlaps

, the 6 , , Natacha Pérébaskine

) [email protected] 70S ribosome ( 70S ribosome -containing -containing parental strain ribosome

1

the 5

Onc The . The structure reveals that the N-terminal residues 1–12 1–12 residues N-terminal the that reveals structure The . 4

of

bacteria

current initiation

11 Onc with this 1 , 2 4

, , Daniel N Wilson to class 11 peptide

the 1

antibiotics inhibit 4 2 and . Although such PrAMPs have been shown shown been have PrAMPs such Although .

Tth complex, peptide binding

dnaK i of Met ) ) or D.N.W. (

thus

70S) 70S) in complex with a (P)-site– peptidyl

potent 3 in and Onc112, a representative of the the of representative a Onc112, and Gene Gene Center, Department of Biochemistry,

translation, -deletion strain as efficiently as that ofas strain efficiently -deletion

complex

represent

binds site

obsolete.

1 1 thus

1 3 antimicrobial , [email protected] 4 2 . Similarly, oncocin (Onc72 and (Onc72 . Similarly, oncocin

. Further investigation revealed . investigation Further revealed , , Michael Graf for

within preventing

with 3 an

,

but 5 an

& C Axel Innis Proline-rich aminoacyl-tRNA.

avenue the

1 their the 4 , the mechanism by mechanism the , s e l c i t r a

Thermus Thermus

agents. ribosomal

entry mode hru ther Thermus

for 3 , Oncopeltus

into

).

1

, 2  - - -

© 2015 Nature America, Inc. All rights reserved. activity antimicrobial of loss a to leads Onc72 in alanine by Lys3 especially ( structures other in site this at present is that ion magnesium hydrated a displacing cavity, charged negatively a into extends Lys3 2 the or G2553 of atoms N2 and N1 the and Asp2 of acid between carboxylic chain possible side the are bonds hydrogen additional Three C2573. of O3 its via two rRNA; 23S the of nucleotides with bonds hydrogen three form can Onc112 Val1 of ( interactions hydrogen-bond potential eight encompasses of the 23S rRNA ( interactions the between 10 N-terminal aa of Onc112 and nucleotides ( Pro12 beyond peptide the model Val1–Pro8 and weaker after became Pro10, thus to it making difficult tunnel. ribosomal center and for transferase the within behavior dynamic peptidyl their known generally are that nucleotides rRNA 23S several involving fit induced an by chain accompanied is nascent ribosome the to ErmBL Onc112 of the binding of presence the in previously observed that to conformation similar a adopting Onc112, for space coli Escherichia vacant a of a structure the in adopts modeled that to similar structures, position defined crystal many in flexible very ribosome is which the U2585, of site A the to aminoacyl-tRNAofbinding upon observed that to similarposition a ( to ribosome the of Onc112 binding change upon of 23S the rRNA a undergo conformational nucleotides featuring ribosome tRNA the of Comparison Interaction 6% specifically, PPII random and 30% 54% coil, 6% helix, poly(Pro)II of conformation, stretches random short with essentially an adopts peptide Onc112 the ( DnaK with complex in oncocin for previously observed that from bound to the ribosome is extended, in a manner similar to but distinct tunnel ribosomal the within visualized been have that chains polypeptide the of location nascent of path the with extents the varying to overlaps peptide Onc112 orientation, reversed the Despite L22. proteins and L4 ribosomal by formed constriction the the into toward extending tunnel exit terminus C its and center transferase the near peptidyl located chain terminus N its with polypeptide i.e., growing synthesis, protein the during to relative orientation reversed a peptide Onc112 ( the of two-thirds N-terminal the to attributed be and mRNA we but that Onc112, clear density see could could lacking of comprising a model refinement after ( mRNA tRNA deacylated P-site–bound a with complex in denotes r which in the soaking 19-aa Onc112 peptide (VDKPPYLPRPRPPRrIYNr-NH as to referred herein structure the Weobtained Onc RESULTS s e l c i t r a  both Supplementary Fig. 2 Fig. Supplementary Fig. Fig. Fig. 2 Fig. Electron density for the Onc112 peptide was strongest for was strongest residues for peptide density the Onc112 Electron ′ atom of C2507; and one via its carbonyl oxygen to the N4 atom atom N4 the to oxygen carbonyl its via one and C2507; of atom 11 in vitro in 1 16– ). Interestingly, the peptide is bound inside the tunnel with with tunnel the inside bound is peptide the Interestingly, ). c 2 1 ) and U2493 (not shown). Substitution of Val1, Asp2 and and Asp2 Val1, of Substitution shown). (not U2493 and ) 0 Table

, whereas, as expected, a D2E mutant of Onc112 retained retained Onc112 of mutant D2E a expected, as whereas, , binds 1 2 8 0 (

, and it interacts with the backbone phosphates of A2453 phosphates backbone the with , and it interacts between and and Supplementary Fig. 1 Fig. Supplementary 1

′ 70S ribosome 70S in -OH of C2507. The positively charged side chain of of chain side charged positively The C2507. of -OH ). Using a minimally biased biased minimally a Using ). Fig. Fig. 2

in vivo in a

Tth reverse d

-arginine) into crystals of of crystals into -arginine) Onc b 70S–Onc112 structure with that of a a of that with structure 70S–Onc112 ). Our CD studies suggest that, in solution, solution, in that, suggest studies CD Our ). ). ). The first set involves aa 1–3 of Onc112 and activity ( activity i Met α 11 -amine to the N3 atom of C2573 and the the and C2573 of atom N3 the to -amine

orientation bound to the P site 2 2 2

. In addition, A2062 shifts to provide provide to shifts A2062 . In addition, and 20 Supplementary Fig. 4 Fig. Supplementary , Fig. Fig. 2

β 1 ). The conformation of Onc112 Onc112 of conformation The ). 23S Fig. 2 Fig. . In the presence of Onc112, Onc112, of presence the In . -sheet ( -sheet 1 Tth

). We observed three sets of sets three We ). observed rRNA within a 70S ribosomes, tRNA ribosomes, 70S ). U2506 shifts to occupy to occupy shifts ). U2506 Supplementary Fig. 3 Fig. Supplementary F o

of − − 1

9 the Tth reveals that several

Tth the F Tth c

i map calculated calculated map 70S–Onc112 by 70S–Onc112 exit Met 70S ribosomes ribosomes 70S

exit 70S ribosome ribosome 70S and a short short a and

). The K3A K3A The ). tunnel

Fig. Fig. 2b advance online publication online advance tunnel 2 3 α . Thus, Thus, . Tth -helix, -helix, 70S 70S i , Met c 1 ). 2 ). ). 0 ,

site site of is Onc112 of consistent with the antimicrobial broad spectrum tion of the 23S rRNA nucleotides that comprise the ribosome-binding ( ribosome the with interaction a defined for than rather peptide the of properties electrostatic overall the for important be could it that suggesting thus residue, this of chain side inhibitory peptide and the of affinity properties binding ribosome the reduces also Onc72 of base the and ( Onc112 C2610 of Arg9 of group guanidino the between ( Onc112 of motif ( tion transla on activity inhibitory of retention in resulted environment, which would the Onc112 to preserve hydrophobiccyclohexylalanine, translation on inhibitory activity of loss complete a in results and 7 of factor a by affinity alanine of substitution residue either in binding Onc72 reduces the that ribosome shown have experiments mutagenesis because tunnel the to peptide Onc112 the anchoring in key be to likely is Leu7 and ( U2506 with bonds two hydrogen forms of Leu7 backbone the Tyr6, whereas of moiety phenol the against packs which Onc112, of Leu7 of chain side the accommodates also chain side Tyr6 the by occupied cavity hydrophobic The U2504. and C2452 of atoms O2 the phosphate and U2506 of backbone the by coordinated is that ion undetermined of an hydroxyl chain with Tyr6side the In addition, hydrogen-bonds a lishes ( Onc112 of Leu7 (IC a by concentration inhibitory affinity half-maximal the lowered and binding 4.3 of factor ribosome its reduced Onc72 in substitution B No. atoms R No. reflections Resolution (Å) Refinement Redundancy Completeness (%) I R Resolution (Å) Cell dimensions Space group Data collection Table 1 a r.m.s. deviations Structure determinedfromasinglecrystal. / Supplementary Fig. 4 Fig. Supplementary factors work merge Ligand/ion Protein / RNA Ligand/ion Protein / RNA Bond Bond angles (°) Bond lengths (Å) α a Additional interactions with the ribosome encompass the PRPRP PRPRP the encompass ribosome the with interactions Additional of Tyr6chains side and the involves of interactions set second The σ , , , , 50 I b / β in vitro in , , ) for for ) , , R c γ free (Å) (°)

π Fig. 2b Fig. i. 2 Fig. Data Data collection and refinement statistics -stacking interaction with C2452 of with C2452 the 23S interaction rRNA -stacking ( in vitro in but unexpectedly led to a loss of antimicrobial activity activity antimicrobial of loss a to led unexpectedly but e , ). Although substitution of Arg11 with alanine in in alanine with Arg11 of substitution Although ). d translation more than 18-fold than more translation ). The compact hydrophobic core formed by Tyr6 by formed core hydrophobic compact The ). Fig. 2b Fig.

i. 2 Fig. nature structural & molecular biology molecular & structural nature ). in vitro in , d 1 b 4 ). The aromatic side chain of Tyr6 estab Tyr6 of chain side aromatic The ). ) and include a a include and ) , we observed very little density for the the for density little very observed we , 1 4 . In contrast, mutation of Leu7 in in Leu7 of mutation contrast, In . 209.30, 209.30, 452.29, 624.12 Fig. Fig. 91,758 91,758 / 195,737 Tth 25.5% 25.5% (166.4%) 90.0, 90.0, 90.0, 90.0 π 64.81 64.81 / 63.15 23.08 / 27.13 1 99.1 99.1 (98.8) 5.47 (0.95) -stacking interaction interaction -stacking 3,999,403 70S–Onc112 ). The high conserva ). high The 3.8 3.8 (3.6) P 50 50 (3.1) 1 4 51.31 2,333 0.809 0.015 2 . 3.1 1 2 1 2 1 a Fig. Fig. 2 d ). ). - - -

© 2015 Nature America, Inc. All rights reserved. An uncharacterized ion is shown in gray.in shown is ion uncharacterized An ( tunnel exit ( pocket CCA-binding A-site the from (yellow) nucleotides rRNA 23S with (orange) ( Onc112 of aa 12 first the (blue) conformation Onc112-free their with (orange) Onc112 of presence the in (yellow) ( 2 Figure a loss namely peptide, Onc112 of the concentrations increasing with assay toe-printing the performing when results similar We observed codon initiation the following directly aminoacyl-tRNA first the of accommodation and/or delivery prevent antibiotics these because codon down to and not could the isoleucine codon translate the start at accumulated ribosomes thiostrepton, or clindamycin antibiotics the of presence the In mix. translation the from omitted was leucine iso because codon isoleucine downstream the on trapped became they but frame, AUGreading open the the through at translate and initiate codon start to able were ribosomes antibiotic, or Onc112 1 Set Data ( mRNA the on ribosomes loca the of the tion monitored and synthesis protein cell-free performed we end. CCA its of transferase center via Watson-Crick peptidyl base-pairing with nucleotide C75 the at tRNA site A the stabilizes normally that loop, A the termed rRNA, 23S the of H92 helix within located residue a G2553, ( center A site transferase of at the ribosomal occlusion the peptidyl steric via aminoacyl-tRNA incoming an of end CCA the of accommodation prevent would ribosome to the of Onc112 binding the that indicated Tth the of Comparison Onc of range a against PrAMPs bacteria Gram-negative related and this by displayed activity biased Minimally (orange). peptide Onc112 the for site binding the of tunnel exit the of section Transverse 1 Figure nature structural & molecular biology molecular & structural nature Onc112 peptide relative to the complete 70S ribosome. 70S complete the to relative peptide Onc112 the display to chosen view the shows Inset green. in shown is P site the tRNA Initiator underlined). and bold are 1–12 residues ( Onc112 of acids amino 12 first +3.0 at contoured map difference a 1 a ) Comparison of the conformation of 23S rRNA nucleotides nucleotides rRNA 23S of conformation the of ) Comparison In order to determine the step of translation that Onc112 inhibits, inhibits, Onc112 that of translation step the determine to In order 2 70S ribosome in the preattack state of peptide-bond formation peptide-bond of state preattack the in ribosome 70S 11 U2585 2

3 i. 3 Fig. Interactions between Onc112 and the ribosome. ribosome. the and Onc112 between Interactions ribosome. the of tunnel exit the within site Onc112-binding

4 allows e , y sn tepitn assays toe-printing using by ), ), as distinguished by different background colors. colors. background different by distinguished as ), 5 a ). Indeed, Asp2 of Onc112 directly interacts with with interacts directly Onc112 of Asp2 Indeed, ).

translation 6 c ), A-site crevice ( crevice A-site ), 7 Tth 8 10 U2506 b 70S–Onc112 structure with that of the the of that with structure 70S–Onc112 , ) and interactions of Onc112 Onc112 of interactions ) and 2 4 9 Uninduced .

to Tth VDKPPYLPRPRP 1

σ 9 initiate 70S–Onc112 (blue) is observable for the the for observable is (blue) . . ( 10 A2062 b – Tth d 11 e ) and upper ribosomal ribosomal upper ) and ) Overview of ) Overview 70S

Fig. 3 Fig. Tth but 12 70S ribosome showing the the showing ribosome 70S

blocks 25 b b PRrIYNr-NH , 2 and and 6

Val1 . In the absence of of absence the In . advance online publication online advance

i

Asp2 Met elongation Supplementary Supplementary pocket (Asite)

bound at bound

CCA-binding

2 ;

Lys3 F

Pro4 o −

F c

A-site crevice 2 2 7 0 - - . Tyr6

d at the start codon in the presence of edeine ( edeine of presence the in codon start at the formation complex fMet-tRNA of binding stable the with interferes which edeine, as such inhibitor, ( the at aminoacyl-tRNA A first site, as the suggested of by steric accommodation overlap prevents between Onc112but and an complex A-site initiation 70S tRNA the of formation and joining subunit allows at indicate that accumulating Onc112 findings the These codon. start ribosomes isoleucine the to the corresponding band at the in increase an stalled and codon ribosomes to corresponding band the of Pro5 i. 3 Fig. 30S P 50 Pro5 S Arg9 a ). This contrasts with a bona fide translation-initiation translation-initiation fide bona a with contrasts This ). Leu7 Pro8

Upper tunnel C2452 Tyr6 i Met A2451 Pro10 Arg9 A2453 O2 to the 30S subunit and thus prevents 70S initiation- 70S prevents thus and subunit 30S the to P-tRN 30S P 2 50S 8 A Arg11 , in agreement with the lack of a toe-print band band of a toe-print lack the with agreement , in Pro4 Pro5 Lys3 O2 Leu7 G2061 U2504 Pro12 Asp2 e c C terminus Val1 C2573 C2610 Pro8 30S 50S A2453 Arg11 P Pro12 OP 30S 50S P 1 O3 N3 N terminus Pro10 Arg9 ′ Fig. 3 Fig. N NZ N4 U2506 Val1 Tyr6 Pro10 C2507 2 s e l c i t r a Leu7 b ′ -O ). N3 N2 H Lys3 O2 O N1 N Pro4 Asp2 Pro8 G2553 A2062 A2602 Leu7 

© 2015 Nature America, Inc. All rights reserved. was performed in duplicate, with the plotted points representing the mean value. The growth or luminescence measured in the absence of peptide was was peptide of absence the in measured luminescence or growth The value. mean the representing points plotted the with duplicate, in performed was BW25113 or (blue) BW25113 ( BL21(DE3) Onc112 derivatives Onc112 truncated C-terminally and (red) Onc112 4 Figure antibiotic macrolide with which erythromycin, acts the synergistically ErmBL the polypeptide of presence the in translation performed ( Onc112 of presence the in formed complex translation-initiation the of stability the investigate mRNA ErmBL a tion upon translating dicistronic forma disome monitor to gradients sucrose sterically used we Consequently, would ( moiety peptide Onc112 fMet the of Leu7 and Tyr6 the residues with of clash group formyl the that such in the same manner as in the would expect fMet-tRNA peptide. Onc112 the from away Å ~3.4 it tions posi that change conformational a undergoes residue A76 terminal In the Onc112 may also perturb the placement of fMet-tRNA cin or thiostrepton ( in consistently the weaker than presence of observed those clindamy were Onc112 of presence the in codon start the at bands toe-print the that noticed We initiation Onc sequence. Onc112 ( presence of 20 or absence ( formation with sucrose gradients in the presence ( ErmBL mRNA that was used to monitor disome ( toe-printing assay is in graphically. The uncropped gel image for the complex) are included for reference, as illustrated the isoleucine codon (blue, stalled elongation AUG start codon (green, initiation complex) or (arrows) when ribosomes accumulate at the sequence surrounding the toe-print bands Sequencing lanes for C, U, A and G and the 50 100 of increasing concentrations (1 assay performed in the absence (−) or presence binding site of Onc112 (orange). ( fMet-tRNA of Phe-tRNA initiation complex. ( Figure 3 s e l c i t r a  cases. all in 100% as assigned c

a – g

Growth (%) µ ) Schematic ( M edeine (Ede) or 100 100 120 140 160 µ 11 20 40 60 80 M) of Onc112, 50 0 Tth 2

1 Onc112 blocks and destabilizes the g Characterization of Onc112, its C-terminally truncated derivatives and its membrane transporter in Gram-negative bacteria. ( bacteria. Gram-negative in transporter membrane its and derivatives truncated C-terminally its Onc112, of Characterization

destabilizes i ). In 70S–Onc112 structure, the P-site tRNA is uncharged, and its A

Met complex e , absorbance. Phe a ) of 20 in the P site (green) ) and the luminescence resulting from the the from resulting luminescence the ) and (blue) in the A site and c µ , SD denotes the Shine-Dalgarno M thiostrepton ( c ) showing the dicistronic a µ ) Structural comparison M erythromycin (Ery) or the Fig. Fig. 3 Supplementary Data Set 1

Onc112 the µ M clindamycin (Cli), 10 µ i Met b

M thiostrepton (Ths). translation- and data not shown), thus that suggesting ∆ ( µ to bind to the peptidyl transferase center Tth µ sbmA f M, 10 Onc112 Onc112 Onc112 M) i. 3c Fig. ) or 100 b 2 ) Toe-printing 0 70S 70S ribosome preattack complexes with the (orange). In In (orange).

µ ∆ ∆ M and C9 C7 – µ g M ). As a positive control, we we control, positive a As ). 100

d

) .

a b and and Relative luminescence (%) vivo In 5 A-tRNA e c a 100 120 140 160 in in vitro ′ 20 40 60 80 A nm 0 254 in vitro in c SD 0.1 i , error bars represent mean mean represent bars , error control ErmBL WT Met Onc112 , however, we we however, , at the P site. , , in order to translation of Fluc ( Fluc of translation advance online publication online advance Fig. 3 Fig. P-tRNA ∆ 1 a 2 C7 (green) and Onc112 Onc112 and (green) C7 70S 0 ). ). Onc112 - - - ,

Disomes tion and sucrose density) used in the disome assay. disome the in used density) sucrose and tion from the under ribosome the conditions nonequilibrium (centrifuga onto fMet-tRNA encroaches Onc112 peptide the because presumably unstable, are Onc112 of presence the in formed complexes initiation 70S the that suggest to us leads 100 In contrast, the presence of even Onc112, at concentrations as high as ( elongation strepton, which allows 70S initiation-complex formation but prevents mRNA the ( from ORF and were released short the translated rapidly ribosomes the because erythromycin of ously ( gradient sucrose a on visualized be that could disomes of formation the to led mRNA single a on ribosomes specific a at mRNA the on site translation stall to tunnel ribosomal the within chain b Sucrose M K A E S L I ( µ M) G G G G U U U U C C C U A A A A A A A A A µ 16 b M, resulted in only a small increase in disomes ( disomes in increase small a only in resulted M, 1 ). ( ). 0 ± , 2 s.d. for triplicate experiments, whereas the experiment in in experiment the whereas experiments, triplicate for s.d. f 3 U C c . We observed negligible disome formation in the absence absence the in formation disome negligible We . observed A nm

) Effect of Onc112 on overnight growth of of growth overnight on Onc112 of ) Effect 254 SD 20 ErmBL WT Fig. 3 Fig. µ M Ths G A ∆ 100 b 2 C9 (purple) on overnight growth of of growth overnight on (purple) C9

9 ), also led to efficient disome formation ( formation disome to efficient led also ), . Because the mRNA was dicistronic, two stalled stalled two dicistronic, was mRNA the Because . nature structural & molecular biology molecular & structural nature – c Growth (%) 70S 1 1 100 120 Onc112 20 40 60 80 0 Disomes 0.1 0 100 BW25133 BW25113 Sucrose µ Cli M 3 ′ Ede i ∆ Met d g sbm

A nm A nm Ths

, thus causing it to dissociate , it thus causing to dissociate 254 254 1 100 ErmBL WT 20 ErmBL WT A Fig. 3 Fig. Onc112 Fig. 3 Fig. µ µ lle fMet M Ery 5 5 M Onc112 ′ ′ Stalled elongationcomplex e ). As expected, thio ). As expected, ( d µ E. coli E. M) E. coli E. ), as shown previ shown as ), a 1 70S , 0 Initiation complex b 70S ) Effect of ) Effect Fig. 3 Fig. strain strain strain strain Disomes Disomes Fig. 3 Fig. Sucrose g Sucrose ). This This ). b

100 3 3 f ′ ′ ). ). ­ - - © 2015 Nature America, Inc. All rights reserved. illustrate the illustrate contribution of binding Arg11 and to ribosome efficient results These Onc112. full-length of that than greater magnitude of of Onc112 that than greater times 16 was which ∆ Onc112 the contrast, In determinants. binding ribosome major the comprise residues that these prediction ent our with structure-based only six times greater than that of Onc112, full-length a result consist consisting of residues 1–12 of Onc112 had an IC Onc112 the Specifically, Onc112. full-length of that to ( system translation with displayed the some activity Onc112 peptides inhibitory contrast to their lack of chloramphenicol antimicrobial as activity ( such inhibitors well- for translation used was characterized system same the when reported that to similar IC an with Fluc of translation iting As expected, the full-length peptide displayed excellent activity, inhib Onc112 or the truncated Onc112 full-length either of concentrations increasing of presence the in translation of min 60 after luminescence measuring by (Fluc) monitored we translation, inhibit and ribosome the to bind still could peptides Onc112 cated 100 above centrations con at even activity, inhibitory of loss complete a to led Onc112 of previously MIC an with growth ing inhibit activity, good displayed Onc112 full-length the As expected, of Onc112 those truncated with the it compared and Onc112 full-length of presence the (MIC concentration inhibitory half-minimal the determined Wethen respectively. aa, 9 Onc112 peptide, of versions this we truncated of prepared region Onc112, C-terminal the of role the be assess to order In activity. antimicrobial for nevertheless necessary may it that suggested conservation of degree its yet high binding, ribosome for dispensable is region this that hinted 13–19) (residues Onc112 of terminus C the for density of lack The Onc (purple) chloramphenicol inhibitors translation (green) clindamycin well-characterized of those with compared ribosome, the on (orange) Onc112 of position binding ( uptake. impaired to owing presumably (5), activity antimicrobial its reduces Onc112 of truncation C-terminal (4), transporter SbmA the using by membrane cell bacterial the penetrate efficiently can Onc112 full-length Although fMet-tRNA the of dissociation to leading thus destabilized, is complex initiation The (3) center. transferase peptidyl the of site A the at (aa-tRNA) aminoacyl-tRNA the of accommodation prevents but complex translation-initiation a of formation allows Onc112 (2) chain. polypeptide nascent a to relative orientation reverse a with ribosome the of tunnel exit the within binds Onc112 (1) Onc112. of action of mechanism the for ( ribosome. the of subunit large the target that antibiotics with Onc112 of 5 Figure nature structural & molecular biology molecular & structural nature previously reported as inhibition, translation C9 peptide consisting of aa 1–10 of Onc112 had an IC an had Onc112 of 1–10 aa of consisting peptide C9 11 2

Mechanism of action and overlap overlap and action of Mechanism C 1

4 terminus . In contrast, truncation of 7 or . 9 truncation In aa C from the contrast, terminus i Met b ∆ ) Relative Relative ) 3 C7 and Onc112 Onc112 and C7 from the P site. site. P the from 3 Fig. 4 Fig. 50 , tiamulin (yellow) tiamulin ,

is ) for the growth of of growth the for ) µ

∆ needed M ( M 50 C7 and Onc112 Onc112 and C7 ∆ b of 10 10 of C7 and Onc112 C7 and Onc112 ), albeit with a reduced efficiency relative relative efficiency reduced a with albeit ),

Fig. 4 Fig. n vitro in

for µ

a M, a value similar to that reported reported that to similar value a M, a ) Model Model )

). To ascertain whether the trun the whether To ). ascertain ∆

translation of firefly luciferase luciferase firefly of translation

uptake, 50 C9, which lacked the last 7 and and 7 last the lacked which C9, 3

4 of 0.8 0.8 of

and erythromycin (blue) erythromycin and

E. coli E.

∆ ∆ C9 derivatives ( derivatives C9

C9 derivatives ( C9 derivatives not Fig. 4 1 µ 4 . 50

strain BL21(DE3) in in BL21(DE3) strain M ( M

∆ ribosome a of 5 advance online publication online advance C7 and two orders orders two and C7 a Extracellular Fig. 4 Fig. ), both truncated 2 Cytoplasm Periplasm µ milieu M, M, which was postinitiation ∆ 50 complex Inactive C7 peptide peptide C7 b of 80 80 of

), a value value a ), binding P Fig. 4 Fig. Fig. 4 Fig. in in vitro A 32 3 0 µ , 3 . In . M, M, b 3 a 4 + as well as an A site–bound Phe-tRNA site–bound A an as well as Onc112 N + ). ). ). ). – - - - - - N + aa-tRNA +

EF-Tu + + + ++ overlaps with the binding sites for a majority of the antibiotics antibiotics the ( of ribosome the majority of subunit a large the for target that sites binding the with overlaps function. antimicrobial and binding ribosome its for important are that Onc112 of residues the many of share which apidaecin, and pyrrhocoricin drosocin, as such PrAMPs, other for same the be to likely is action of mechanism this ( ribosome the to peptide this targeting for responsible are residues Onc112 of moiety N-terminal whereas the from cell, the into Onc112 of uptake SbmA-mediated length of the Onc112 sequence are fornecessary ensuring the efficient entire the along distributed residues charged positively that suggest fMet-tRNA of dissociation inducing by complex postinitiation the destabilizes ( site A the into aminoacyl-tRNA the of accommodation prevents but plex of com formation exit allows the 70S tunnel initiation the ribosomal ( inhibit translation oncocin as such PrAMPs which by mechanism the to explain model a propose we data, biochemical and structural our From DISCUSSION of of entire the group action mechanism in the of PrAMPsthe ther support for the proposition that the SbmA transporter is involved of uptake the such as into Onc112 for bacteria, Gram-negative necessary indeed is SbmA that indicate findings with 100 ∆ ( strain BL21(DE3) the with to that observed MIC an with growth inhibiting SbmA-containingstrain, parental susceptible the against lent activity Onc112 ( parental strain BW25113 in the presence of increasing concentrations the growthof of an In order to assess the role of SbmA in the(refs. uptake of Onc112, we compared PR39 and Bac7 PrAMPs eukaryotic the of uptake the for responsible + Sbm C C sbmA The binding site for Onc112 within the ribosomal exit tunnel tunnel exit ribosomal the within Onc112 for site binding The Although the inner-membrane protein SbmA has been shown to be A 1 4 Initiation complex strain displayed increased resistance to Onc112, such that even Fig. 5 Fig. , 5 µ C ), the only insect PrAMP tested so far was apidaecin Ib apidaecin was far so tested PrAMP insect only the ), Fig. 4 P

M Onc112, growth was reduced by only 20% ( N i Met Fig. Fig. a , steps 1 and 2). Additionally, we propose that Onc112 Onc112 that propose we Additionally, 2). and 1 steps , c from the P site ( P site the from ). As expected, the full-length Onc112 displayed excel E. E. coli Onc112 5 5 a + N + ). We have shown that the binding of Onc112 to to Onc112 of binding the that Weshown ). have + N + strain lacking the C C

∆ C7 3 Fig. 5 Fig. 70S Phe Fig. 5 Fig. 50 (ref. (ref. of 8 8 of a , steps 4 and 5). We believe that that We 5). and 4 believe steps , a 2 , step 3). Finally, our data also also Finally, data our 3). , step µ 0 sbmA M ( M b ). Clindamycin Chloramphenicol Erythromycin Fig. 4 Fig. Fig. 4 Fig. E. E. coli gene ( Phe-tRNA Fig. 5 Fig. (A site) s e l c i t r a a c , , and provide fur ), a value similar similar value a ), ). ). In the contrast, ∆ b sbmA Ph Fig. 4 ), such as the the as such ), e Onc112 ) ) with the c ). These Tiamulin 4 . 32 , 3 3 4  , - - - .

© 2015 Nature America, Inc. All rights reserved. Reprints and permissions information is available online at at online available is information permissions and Reprints The authors declare no competing interests.financial C.A.I. experiments, designed interpreted data and wrote the manuscript. S. Arenz performed disome assays. K.K.I. prepared tRNA ionization high-resolution MS experiments. M.G. performed toe-printing assays. and C.D. synthesized the peptides and CD performed NMR, and electrospray F.N. performed growth and N.P.ribosomes. and crystallized and X-rayC.A.I. collected data. crystallography A.C.S. performed structure solution, model building and analysis. N.P. prepared gratefully acknowledged. Région Aquitaine (S. Antunes) and INSERM and Région Aquitaine (A.C.S.) are D.N.W.). Predoctoral fellowships from the Direction de Générale l’Armement and the Deutsche Forschungsgemeinschaft (FOR1805, andWI3285/4-1 GRK1721 to European Union (PCIG14-GA-2013-631479 to C.A.I.), the CNRS (C.D.) and to C.A.I.), the Fondation pour la Recherche Médicale (AJE201133 to C.A.I.), the to 14-CE09-0001 C.A.I., G.G. and D.N.W.), Région Aquitaine (2012-13-01-009 was supported by grants from the Agence Nationale pour la Recherche (ANR- screening. We also thank C. Mackereth for discussions and advice. This research Institut Européen de Chimie et Biologie for help freezing and with crystal ID-29) for help during data andcollection B. Kauffmann and S. Massip at the We thank the staff at the European Synchrotron Radiation Facility (beamline version of the pape Note: Any Supplementary Information and Source Data files are available in the code accession under Bank Data Protein the in ited Accession codes. the in ver available are references associated any and Methods M antimicrobials. future of development the for avenue exciting an represents bacteria negative as such peptides, on based range of a against Gram- diverse activity potent that display Onc112, scaffolds new produce to ability The linezolid. by oxazolidinone the as exemplified scaffolds, new entirely or or developing linezolid-sparsomycin) macrolide-chloramphenicol chi meric antibiotics from drugs designing with adjacent binding sites involve (for example, strategies Other improved efflux. solubility, reduced and uptake increased pathways, degradation or fication modi drug evade to ability the ribosomes, modified or mutated for affinity better including that properties, antimicrobial compounds enhanced possess semisynthetic create to antibiotics existing fying ribosome the of tunnel exit the been have pursued to design improved or entirely new strategies antimicrobials that target Several therapeutics. new of development the for resource untapped vast, a that represent peptides likely antimicrobial appears such it PrAMPs, other several ( with Onc112 presumably with and interact that tunnel the of regions the and antibiotics these for sites binding the between exists that overlap tial exit tunnel the chain ribosomal through polypeptide nascent the of movement the with interfering by lation well as the macrolides (for example, erythromycin), which abort trans as tRNA substrates, of the positioning correct the by preventing tion mides (for example, clindamycin), which inhibit peptide-bond forma chloramphenicols, pleuromutilins (for example, tiamulin) and lincosa s e l c i t r a  1. reprints/index.htm C AU A

ckn O

ethods T MP ag G. Wang, 123–150 (2015). 123–150 sion of the pape the of sion H o O ET w R R C ING FINANCIA ING le O dgm t al. et N T r l RIBU . . niirba ppie i 2014. in peptides Antimicrobial e Coordinates and structure factors have been depos n r t . T s I O L in vitro NS IN TE –translation inhibition assays. S. Antunes R E S 3 T 1 . One approach consists of modi of consists approach One . S 2 7 . Given the substantial . spa Given the substantial hraetcl (Basel) Pharmaceuticals i Met http://www.nature.c . . G.G., D.N.W. and 4Z E R . advance online publication online advance Fig. 5 Fig. online online

online om/

b 8 ------) ,

34. 33. 32. 31. 30. 29. 28. 27. 26. 25. 24. 23. 22. 21. 20. 19. 18. 17. 16. 14. 13. 12. 11. 10. 9. 8. 7. 6. 5. 4. 3. 2. 15.

Schlünzen, F., Pyetan, E., Fucini, P., Yonath, A. & Harms, J.M. Inhibition of peptide the of Structures J.H. Cate, & A.S. Mankin, L., Xiong, J.A., Dunkle, several of structures T.A.the Steitz, Revisiting & G. Blaha, C.A., Bulkley,Innis, D., Wilson, D.N. Ribosome-targeting antibiotics and mechanisms of bacterial resistance. A.L. Starosta, key The A.S. Mankin, & K. Kannan, D., Klepacki, H., Ramu, N., Vázquez-Laslop, G. Dinos, inhibitors. translation bacterial of A–Z The D.N. Wilson, A.L. Starosta, of analysis inhibition Extension L. Gold, & R. Traut, D.S., McPheeters, D., Hartz, D. Knappe, Arenz, S. B.S. Schuwirth, Schmeing, T.M., Huang, K.S., Strobel, S.A. & Steitz, T.A. An induced-fit mechanism aminoacyl-tRNA couple to wire proton A C.A. Innis, T.A.& Y.S.,Steitz, Polikanov, ribosome-associated minimal a of L. Reconstitution Jenner, R.S. Hegde, & S. Shao, ribosome the for basis Molecular R. Beckmann, & O. Berninghausen, L., Bischoff, S. Arenz, Krizsan, A. Krizsan, analogs related and 1b apidaecin of uptake Cellular R. Hoffmann, & N. Berthold, M. Zahn, M. Zahn, D. Knappe, P. Czihal, L. Otvos, S. Stalmans, Hansen,A.,Schäfer, I.,Knappe, D.,Seibel, P. Hoffmann,& IntracellularR. toxicity of G. Runti, M. Mattiuzzo, W. Li, P.,Casteels, F.,Jacobs, C., Ampe, Tempst,Vaeck,& M. P. antibacterial Apidaecins: Schneider, M. & Dorn, A. Differential infectivity of two of infectivity Differential A. Dorn, & M. Schneider, niiig atra poen rnlto a te 0 ribosome. Engl. Ed. S 70 the at translation protein bacterial inhibiting proline-rich for peptides. antimicrobial mechanism antibacterial novel reveals bacteria Gram-negative in Bac7. bactenecin sheep DnaK. chaperone the to peptides complex. oncocin–DnaK the of structure high–resolution the on based activities antibacterial and stabilities (2012). 1281–1291 pathogens. Gram-negative multidrug-resistant with infections Biochemistry peptides. peptidepenetratin. (1–35). Bac7 proline-rich antimicrobial peptide peptides shuttled antimicrobial into mammalian the cells by the cell-penetrating importing Bacteriol. J. for required transporter peptides. proline-rich of bacteria. antibiotic-resistant (2004). Deinococcus radiodurans from subunit ribosomal 50S the of structure the pleuromutilins: by formation bond action. drug of spectra coli ribosome. (2010). 17158–17163 bacterial the to bound antibiotics Microbiol. Rev. Nat. inhibition. drug influences macrolides to response peptide. the ribosomal nascent the in residue rRNA modified and conserved a of function P-site regulate C795 and binding. RNA G693 residues conserved universally the pactamycin: Biol. site. stall the of upstream (2014). 10711–10719 context sequence the by complexes. initiation translation (2010). 5240–5247 pathogens. human Gram-negative against optimized peptide peptide. leader ErmBL the of translation Science peptidyl-tRNA. of hydrolysis exclude and formation Nature bond peptide promote to ribosome. Biol. the on formation peptide-bond and accommodation (2013). synthesis. protein during tigecycline factors. purified with pathway ubiquitination an as functioning perturbation. site bug, milkweed the in Hemiptera). response immune the peptides from honeybees. from peptides iooe ih niitc bud er h ppiy taseae etr explain center transferase peptidyl the near bound antibiotics with ribosome

44 21

438 t al. et

, 393–433 (2009). 393–433 , (2014). 787–793 , 310

et al. et et al. et al. et Protein Pept. Lett. Pept. Protein et al. et t al. et 53 t al. et t al. et t al. et t al. et , 520–524 (2005). 520–524 , et al. et

et al. et J. Invertebr. Pathol. Invertebr. J. t al. et

, 827–834 (2005). 827–834 , 195 , 12236–12239 (2014). 12236–12239 , rln-ih niirba ppie: oeta teaetc against therapeutics potential peptides: antimicrobial Proline-rich et al. et 39 et al. et Mol. Cell Mol. Interaction between heat shock proteins and antimicrobial peptides. antimicrobial and proteins shock heat between Interaction Molecular basis for erythromycin-dependent ribosome stalling during Drug sensing by the ribosome induces translational arrest via active via arrest translational induces ribosome the by sensing Drug t al. et t al. et Functional characterization of SbmA, a bacterial inner membrane inner bacterial a SbmA, of characterization Functional Structural identification of DnaK binding sites within bovine and within sites binding DnaK of identification Structural tutrl tde o te owr ad ees bnig oe of modes binding reverse and forward the on studies Structural p8 i a oe atbceil einr etd t tet systemic treat to peptide designer antibacterial novel a is Api88 iscig h rbsml niiin ehnss f die and edeine of mechanisms inhibition ribosomal the Dissecting , 14150–14159 (2000). 14150–14159 , Insect-derived proline-rich antimicrobial peptides kill bacteria by bacteria kill peptides antimicrobial proline-rich Insect-derived tutrl ai fr oet niioy ciiy f h antibiotic the of activity inhibitory potent for basis Structural , 5343–5351 (2013). 5343–5351 , t al. et Oncocin (VDKPPYLPRPRPPRRIYNR-NH2): a novel antibacterial novel a (VDKPPYLPRPRPPRRIYNR-NH2): Oncocin Mol. Cell Mol. ainl ein f noi drvtvs ih ueir protease superior with derivatives oncocin of design Rational l Blood-brain barrier transport of short proline-rich antimicrobial proline-rich short of transport barrier Blood-brain Antimicrob.AgentsChemother. -tryptophan sensor. -tryptophan Role of the of Role

nepa bten h rbsml unl nset hi, and chain, nascent tunnel, ribosomal the between Interplay rnltoa saln a plpoie tece i modulated is stretches polyproline at stalling Translational 12 EMBO J. EMBO nature structural & molecular biology molecular & structural nature tutrs f h bceil iooe t . A resolution. A 3.5 at ribosome bacterial the of Structures

, 35–48 (2014). 35–48 , Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. Protein Pept. Lett. Pept. Protein 13 in complex with tiamulin. ChemBioChem Mol. Microbiol. Mol. Protein Pept. Lett. Pept. Protein EMBO J. EMBO

, 113–124 (2004). 113–124 , 56

Amino Acids Amino 21

, 446–452 (2014). 446–452 , 29 Escherichia coli Escherichia , 399–406 (2014). 399–406 ,

Methods Enzymol. Methods 78 , 3108–3117 (2010). 3108–3117 , J. Mol. Biol. Mol. J.

, 135–140 (2001). 135–140 , 8 Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. , 2387–2391 (1989). 2387–2391 , Chem. Biol. Chem. Cell Reports Cell

12 66

Nat. Commun. Nat. 46

, 874–876 (2011). 874–876 , 21 , 151–163 (2007). 151–163 ,

21 , 2287–2294 (2014). 2287–2294 , Mol. Cell Mol. , 391–398 (2014). 391–398 ,

, 407–412 (2014). 407–412 , rc Nt. cd Si USA Sci. Acad. Natl. Proc. 425 SbmA in the antimicrobial activity antimicrobial the in SbmA

56

noets fasciatus Oncopeltus Mol. Microbiol.

17 , 2463–2479 (2013). 2463–2479 , 107 164 , 5194–5201, (2012). 9 , 469–475 (2014). 469–475 , , 504–514 (2010). 504–514 ,

55 , 17152–17157 (2010). 17152–17157 , , 419–425 (1988). 419–425 , Pseudomonas

5 uli Ais Res. Acids Nucleic Crit. Rev. Biochem. Mol. Biochem. Rev. Crit. , 880–890 (2014). 880–890 , , 3501 (2014). 3501 , C Ce. Biol. Chem. ACS . e. Chem. Med. J. ne. hm Int. Chem. Angew.

110 a. tut Mol. Struct. Nat.

54 , 3812–3816 , , 1287–1294 species and species Escherichia (Insecta:

107

42 53

7 , , , ,

© 2015 Nature America, Inc. All rights reserved. [M + 2H] [M + H] 598.35 [M + 4H] ( HRMSESI min); 10 in HPLCRP yield);(10% mg 24 scale): mmol ( synthesis is as follows: in cycles 0.1 N HCl solution freeze dried, and TFA was exchanged with HCl by two repetitive freeze-drying by min) semipreparative 20 of in B RP-HPLC.(10–30% compounds The were Et of presence the in TFAsalts concentrated under reduced pressure. The crude products were precipitated as at room temperature. The resin was then filtered off, and the TFA solution was by performed was TFA/TIS/Hprepared freshly a of mL 5 with Cleavage treatment DCM. with times three washed was pep resin the synthesis, tide the of completion After s. W, 50 35 °C, 90 then s 15 for with a was performed solution of 20% in piperidine DMF at 75 °C with 155 W were couplings acid amino Other s. performed first at 90 °C, 170 W, 1,500 115 s then at for 90 °C, 30 W, microwaves 110 s. Fmoc removal without °C 25 Coupling of DMF)). (in Oxyma M 1.0 and DMF) (in DIC M 0.5 with DMF) (in solution a five-fold excess of reagents for the coupling step (0.2 M Mass (UMS 3033–IECB), the Pessac, France ( from Exactive Thermo Biology and a Chemistry InstituteEuropeanof the at Laboratory Spectrometry on out carried were analyses ESI-MS QNP for MHz 400 atoperating magnet narrow-bore/ultrashield 9.4T vertical a with Biospin) (Bruker spectrometer (CEM synthesizerSystem Blue automated anLiberty onconducted were peptides of (21250×mm, 5 column C18ec 100–5 VP250/21 Nucleodur Macherey-Nagel a with GX-281 TFA-CH 0.1% and TFA-H(v/v) 0.1%composedof mobilewasphase The °C. at50 3 mm, 100 × (4.6 column NucleodurNagel Macherey- a with U3000SD Dionex a on performed were RP-HPLCanalyses and MilliQ water were used for RP-HPLC analyses and purification. Analytical PolyPeptide laboratories. RP-HPLC–quality acetonitrileBiotech. (CH and all standard PolyPeptideLaboratories.from acid (TFA) were purchased from Alfa Aesar. Rink amide PS resin was purchased quality grade) was purchased from Carlo Erba, and purification. piperidine and trifluoroaceticwithout synthesis. Peptide ONLINE doi: [M + 3H] min);ESI1010–50% ( ofin HRMS B mg 6.9 scale): (0.05-mmol L7Cha Arg-( [M + 3H] ( HRMSESI min); 10 in B of10–50% HPLC RP yield); (10% mg 11.6 scale): (0.05-mmol D2E Arg-( [M + 2H] ( (19% yield); RP HPLC mol g (1,180.42 yield); RP HPLC (1,433.73 g mol d m/z -Arg)-Ile-Tyr-Asn-( Onc112 L7Cha. D2E. Onc112 Onc112 Onc112 Onc112 their concerning details and study this for prepared peptides of list The with mmol/g) (0.79 resin PS Amide Rink on synthesized were peptides All 10.1038/nsmb.3034 ): [M + H] d d 1 H/ -Arg)-Ile-Tyr-Asn-( -Arg)-Ile-Tyr-Asn-( µ + WavesS.A.S.). N calcd for C 13 3+ 3+ 2+ 2+ -Fmoc-cyclohexylalanine-OH (Fmoc-Cha-OH) was purchased from H-Val-Asp-Lys-Pro-Pro-Tyr-Leu-Pro-Arg-Pro-Arg-Pro-Pro-Arg- .

∆ C/ METHODS and 478.61 [M + 3H] and 608.36 [M + 4H] and 601.86 [M + 4H] 590.84 and [M + 3H] N C7. 31 ∆ -Fmoc–protected -Fmoc–protected + −1 P/ C9. N H-Val-Asp-Lys-Pro-Pro-Tyr-Leu-Pro-Arg-Pro-Arg-Pro-NH H-Val-Glu-Lys-Pro-Pro-Tyr-Leu-Pro-Arg-Pro-Arg-Pro-Pro- calcd for C t 4+ −1 µ R ). Synthesis of Onc112 -Fmoc–protected H-Val-Asp-Lys-Pro-Pro-Tyr-Cha-Pro-Arg-Pro-Arg-Pro-Pro- 19 3.54 min (gradient 10–50% of B in 10 min); ESI HRMS ( m)at flowa rate of 20mLmin , and 478.88 [M + 5H] . ytei of Synthesis ). 3 H-Val-Asp-Lys-Pro-Pro-Tyr-Leu-Pro-Arg-Pro-NH omrily vial raet wr ue throughout used were reagents available Commercially F probeF withgradient capabilities ( CN (solvent B). Purification was performed on a Gilson a on performed was Purification B). (solvent CN 67 d H t R -Arg)-NH N 1 108 m/z 4.78 min (gradient 10–50% of B in 10 min); ESI HRMS H NMR spectra were recorded on a DPX-400 NMR DPX-400 a on recorded were spectra NMR H , N d H d 56 dmtyfraie DF ppie synthesis– peptide (DMF, -dimethylformamide 3 -Arg)-NH ): found 1,195.70 [M + 2H] + found[M):1,195.70 -Arg)-NH 20 5 H . O 2 89 O and purified with the appropriate gradient gradient appropriate the with purified and O l- N 15 3+ 4+ 4+ 3+ H 2 , , 1,433.83758 found 1,433.84017, with 717.42 (2,389.85 g mol and ( N l 1 . . 394.23. . 15 Onc112 Onc112 6% yield); RP HPLC RP yield); 6% Supplementary Fig. 5 H observation by means of a 5-mm direct 5-mm a of means by observation H and ′ O -diisopropylcarbodiimide (DIC), Oxyma (DIC),-diisopropylcarbodiimide m/z m/z 2 2 13 (2,403.88 g mol d (2,429.92 g mol ∆ d , 1,180.63370 found 1,180.68368, with -arginine-OH -arginine-OH was performed twice at 5+ ): found): 2H] 1,252.18+ [M ): found 1316.70 [M + 2H] + found[M 1316.70): amino acids were purchased from Iris C7 (0.15-mmol scale): 79.4 mg (37% . t ∆ R µ 4.11 min (gradient 10–50% of B (gradientof10–50%min 4.11 C9. m) at a flow rate of 1 ml min ml 1 of rate flow a at m) 01mo sae: 26 mg 22.6 scale): (0.1-mmol −1 −1 . The. solid-phase syntheses ). Synthesis of Onc112 (0.1- −1 SupplementaryFig.5 −1 2 2+ 0 solution for 240 min min 240 for solution 0 ). Synthesis of Onc112 ). Synthesis of Onc112 t t N R , 797.47 [M +3 H] +3 [M 797.47 , R ). 3 5.28 min (gradient min 5.28 CN, Sigma-Aldrich) 5.75 min (gradient min 5.75 -Fmoc–amino -Fmoc–amino acid 2 O (solventO A) 2+ 2+ , 840.14 , , 822.80, m/z 3+ −1 ). ): 2 2 - ,

were flash frozen in liquid nitrogen and kept at −80 °C. concentrationFor final mg/mL.storage,26–32 a of yield to HEPES-KOH, pH 7.5, 50 mM KCl, 10 mM previously NH described as Purification of 6% following assessment for the Onc112 peptide: 54% random coil, 30% helix-PPII, tion with respect to the experimental spectrum β mentssimulateda annealingcombinationalgorithmbest theget to of tides of known length, secondary structure and CD spectra. The program imple (alternatedhydrophobic leucine and hydrophilic/charged lysine residues) pep structure ( canonicalobtainedunpublished).foreach standard program curves Thisuses Chimie de et Biologie Institut des 5248 Membranes UMR et des Nano-objets Bordeaux, de (CBMN); available Polytechnique upon Institut request), CNRS, Bordeaux, (Universitéde Dufourc E. Verne)and Jules Picardie Universitéde CNRS- 6022 UMR Cellulaire, et Enzymatique Génie de (Unité Buchoux (S. CDFriend program deconvolution the with spectra CD the from estimated wasproportion Secondary-structure runs. two overaveraging mm) 1 110-QS 180 and 280 nm with a rectangular quartz cell with a pathatfourdifferent concentrations lengthphosphatebetween mM)in 10 7.6, buffer(pH of 1 mm (Hellma ellipticity in deg cm molar total of terms in expressedare Data France).(Jasco spectropolarimeter spectroscopy. CD replacement performed with Phaser with performed replacement refinement. and building Model unit containing two copies of the asymmetric an and Å 625 × Å 450 × Å around210dimensions unit-cell with XDS Initial data processing, including integration and scaling, were performed with 100 K with a wavelength of 0.97625 Å from multiple regions of the same crystal. at collected data oscillation 0.1° mergingbyobtained was completeset dataA ID29 of the European Synchrotron Radiation Facilityprocessing. and (ESRF)collection Data in Grenoble, France. data collection. Crystals were then flash frozen in a nitrogen °C. cryostream at 80 20 K for atsubsequent overnight solution cryoprotection final the in dissolved Onc112 of Mg(CH Tris-HCl, pH 7.6, 2.9% (v/v) PEG 20000, 50 mM KCl,mM 100 10wascryoprotection compositionduring ionicmM The (v/v).NH 40% of tion concentra final stepwisea amanner yieldtoincreasedtrationin wasMPD of 100 × 100 × ~1,000to grew and d 2–3 appearedwithin Crystals arginine. mM 175 and MPD (v/v) 7–10% of reservoir solution containing 100 mM Tris-HCl, pH 7.6,(refs. 2.9% (v/v) PEG 20000, °C 20 atsitting-drop trays in diffusion vaporconditionsby crystallization ing Crystallization. pH 7.6, 50 mM KCl, 10 mM NH HEPES-KOH, mM 5 were conditions buffer final The crystallization. for use before briefly complexescentrifugedwere All min. 15 temperatureleast atfor complexesthe for crystallizationwere sample the used, incubatedwas at room tRNA 10 and deacylated tRNA Complex formation. in codon followed by several additional codons. Eurogentec. This mRNA contains a Shine-Dalgarno sequence and an AUG start 5 tRNA and mRNA of Preparation ′ -sheet, helix-II and random coil that exhibits the lowest normalized r.m.s. devia -GGC AAG GAG GUA AAA AUG CGU UUU CGU-3 UUU AUG CGU GUAGAGAAA AAG -GGC E. coli µ α M mRNA and incubating at 55 °C for 10 min. For the next step, 20 step, next the For min. 10 for °C 55 at incubating and mRNA M 4 -helix and 6% 20 1 i Met . All of the data collected could be indexed in the in indexed be could collected data the of All . 3 , 3 HB101 cells and purified as described previously COO) was added, and the mixture was incubated at 37 °C for 10 min. Before 9 α ). Crystallization drops consisted of 3 -helix, 2 T. thermophilus . Published conditions were asstartinga used point for screen Tth β D pcr o ppie wr rcre o a -1 Jasco J-815 a on recorded were peptides of spectra CD β 2 70S–Onc112 complexes were obtained by soaking 10–20 -sheet, helix-polyproline type II and random coil) with L dmol -sheet content. i A ternary complex containing Met nature structural & molecular biology molecular & structural nature was formed by mixing of 5 3 −1 9 and resuspended in buffer containing 5 mM mM 5 containing buffer in resuspended and . CD spectra for the Onc112 peptide were acquired µ m within 7–8 d. Ford.cryoprotection, 7–8within concenm the 70S ribosomes. 4 Cl and 10 mM Mg(CH Tth Diffraction data were collected at beamline beamline at collected were data Diffraction Initial phases were obtained by molecular molecular by obtained were phases Initial i Met 70S ribosome. 4 2 . The search model was obtained from obtained was model search The . . Synthetic mRNA with the sequence sequence the with mRNA Synthetic E. coli 4 36– µ

Cl, and 10 mM Mg(CH Tth l of ternary complex and 3–4 3 tRNA 8 70S ribosomes were purified . The algorithm yielded the µ Tth M Tth 3 70S ribosomes, mRNA i COO) Met 4 P 0 ′ was obtained from obtained was 2 . 70S ribosomes with was overexpressed 1 Tth 2 1 2 2 4 70S ribosomes 70S . 1 Cl and 10 mM space group,space 3 α COO) -helix, µ µ i M M µ K 2 ------l j

© 2015 Nature America, Inc. All rights reserved. reaction tubes. Ile-tRNA aminoacylation was further prevented by the use of the performed in the absence of isoleucine at 37 °C for 15 min at 500 additionalagents r.p.m.(nuclease-free water, Onc112or antibiotics). inTranslation 1.5-mL was 0.5 and italics) in sites primer-binding and underlined ORF hns40aa the bold, in TAA codon stop and ATT codon isoleucine catchATG, codon start GTGATAGAATTCTATC GCTGGAAAAATTAGAAGTTGTTGTTAACGAACGTTGGATTTTG TTCGTGCGCAGGCAAGAGAATGTACACTTGAAACGCTGGAAGAAAT AAACAT (5 template: hns40aa mixture,0.5 acid amino translation reaction consisted of 1 system with the PURExpress with a toe-printing assay based on an Toe-printing assay. calculated by defining the growth of samples without antibiotic as 100%. was relativegrowthTecan reader,the plate anda M1000 Infinite in measured ated overnight in a thermomixer (Eppendorf) at 37 °C/350 r.p.m. The OD Onc112 derivative peptide or water was added to ferred eachinto individualwell. wells of Platesa 96-well plate were(Sarstedt). Eitherthen 10 incub diluted 1:100 to an OD BW25113 strain deletion Keio or BW25113 of culture overnight an Specifically, (MIC) of Onc112 was performed as described previously for other antibiotics Growth inhibition assays. without inhibitor as 100%. Relative values were determined by defining the luminescence valueThe luminescence ofwas then themeasured withsample a Tecan Infinite M1000 plate reader. (Promega) into a white 96-well chimney flat-bottom microtiter plate (Greiner). (50 amycin r.p.m.).(1,000shaking with 1 mixed according to the manufacturer’s description and incubated for 1 h inhibitorsat 30 °C coupled assay (RTS100, 5Prime) as described previously for other translational an with assessed was Onc112 by Invitro conformations. wereRamachandranclassifiedas outliers, andfavorablehad94.38% backbone MolProbityserver Further refinement and model validation were carried out in Phenix and on the the of structure resolution Coot and in a minimally biased densitycorresponding toOnc112the peptide wasvisible inside exitthe tunnel After confirming that a single tRNA was bound to the P site and that additional Tth the of copies two the between restraints symmetry Noncrystallographic L9). proteinribosomalterminus of C the subunitand(body,large50S stalk the L1 the small 30S subunit (head, body, spur and helix h44) and three domains from and individual refinementpositionalfollowedmultiple ofrigid-body by of cycles cycle single Phenix with out carried was refinement crystallographic the of structure high-resolution a nature structural & molecular biology molecular & structural nature 70S ribosome in the asymmetric unit were also appliedunitwereasymmetric also during therefinement. in ribosome 70S –translationassay. 4 3 ATG 5 0 . The models for the tRNAformodelsthe ThemRNAand . werehigh-obtained froma . Briefly, 6- Briefly, . µ g/ B AGCGAAGCACTTAAA µ -factor refinement. Rigid bodies comprised four domains from l) and then diluted with 40 40 with diluted then and l) 4 6 The position of the ribosome on the mRNA was monitored , respectively., model,In 0.65% final ofthe protein residues F 600 ′ - µ o ATTAATACGACTCACTATAGGG − L reactions, with or without Onc112/antibiotic were Onc112/antibiotic without or with reactions, L µ of ~0.02, and 200 Determination of the minimal inhibitory concentration L tRNAmixture,1.5 L GTTAATAAGCAAAATTCATTATAACC F The inhibition of firefly luciferase (Fluc) synthesis(Fluc) luciferase firefly inhibitionof The Tth c map, a model for Onc112 was built with Rapper in vitro µ 70S ribosome preattack complex (PDB complexpreattack ribosome 70S L of each reaction was stopped with 7 stoppedwith wasreaction each of L µ E. coli E. L solution A, 0.5 Tth protein synthesis kit (NEB) in vitro 70S ribosome (PDB ribosome 70S . coli E. lysate–based transcription-translationlysate–based ATT µ L of the diluted cells was then trans –coupled transcription-translation ∆ tan L1D3 (Invitrogen), BL21(DE3) strain sbmA CTGAACAACATCCGTACTC µ µ L of luciferase assay substrate assay luciferase of L L solution B, 1 solutionB, L µ (plate 61, well 10E) well 61, (plate L ∆ isoleucine + tryptophan 4 ATATAAGGAGGA 3 and consisted of a of consisted and 4Y4 2 O µ µ 6 . Briefly, each ). Restrained ). L of Onc112, L (0.5 pmol) (0.5 L -3 µ ′ , with with , 1VY 600 L kan L 4 7 TAA was was µ 4 3 4 0 ). L 4 ­ - - .

tion at 154,693 100 mM KOAc, 25 mM Mg(OAc) sucrose-density gradients (in a buffer containing 50 mM HEPES-KOH,10–55% on pH 7.4, analyzed then and °C 30 at h 1 for out Translationscarried were was performed with the Rapid Translation System RTS previously described 100 assay. formation Disome scan the polyacrylamide gel. to used subsequentlywas system Typhoonimaging GE FLA9500 The h. 2 for gel containing 7 M urea. Gel electrophoresis was performed at 40 W and 2,000 V 95 °C for 5 min before being applied onto a 6% polyacrylamide 3.5into dissolved(19:1) then was sequencing concentratorvaporizetosolvent, the used was Alexa647-labeled andDNA the 80 with columns QIAquick the from Nucleotide Removal Kit (Qiagen). The Alexa647-labeled DNA was then eluted 200 neutralized with 0.82 1 of addition by degraded RNA and quenched was transcription Reverse min. 20 andmM)(10mix dNTP0.4 0.5 with performed was transcription Reverse withoutmin. °Cfor shakingincubatedreaction5and at37each to added was labeled NV-1 toe-print primer (5 Alexa647-inhibitorpmolIle-tRNAtranslation,mupirocin.synthetase 2 After 47. 46. 45. 44. 43. 42. 41. 40. 39. 38. 37. 36. 35. generated with PyMOL ( Figure preparation.

Baba, T. graphics. molecular for V.B. tools Chen, model-building Coot: K. Cowtan, & P. Emsley, T.L.Blundell, D.F.& Burke, M.A., P.I.,Bakker,DePristo, de Adams, P.D. A.J. McCoy, W.Xds. Kabsch, X-ray preliminary and Crystallization Y. Mechulam, & S. Blanquet, E., Schmitt, Selmer,M. Dimerization E.J. Dufourc, & F. Aussenac, S., Buchoux, L., Khemtémourian, M.L. Jobin, Jean-François, F. structure Secondary S.K. Srai, & D.C. P.I.,Lee, Haris, B., S.P.,Ramesh, Brazier, mutants: the Keio collection. Keio the mutants: crystallography. Crystallogr. Biol. D Crystallogr. Acta model. all-atom an by solvation Born Generalized the with discrimination field force AMBER the and decoy potential statistical loop of accuracy fragments: polypeptide of solution. structure (2007). 658–674 (1999). formyl-methionyl-tRNAMetf. of analysis curvature. Science membrane by controlled is domain J. Biophys. Eur. transmembrane Neu/Erb2 of cells. cancer for selectivity its of understanding an toward lipids: anionic of presence the interface. in peptide penetrating air-water the at and micelles DPC J. Biophys. Eur. solution, powder, in Cateslytin K rectifier ROMK1. inward channel the of domains membrane-associated putative the of analysis µ µ L PN1 buffer were added to each reaction before treatment with a QIAquick L 10 M NaOH and incubation for at least 15 min at 37 °C and then was then and °C 37 at min 15 least atforincubation NaOHand M 10 L Proteins

313 et al. Escherichia coli Escherichia et al. et et al. g t al. et t al. et , 1935–1942 (2006). 1935–1942 , (SW-40 Ti, Beckman Coulter) for 2.5 h at 4 °C. Construction of t al. et

Acta Crystallogr. D Biol. Crystallogr. Biol. D Crystallogr. Acta 51 Structure of the 70S ribosome complexed with mRNA and tRNA. and mRNA with complexed ribosome 70S the of Structure 36 36 PHENIX: a comprehensive Python-based system for macromolecular et al. Acta Crystallogr. D Biol. Crystallogr. Biol. D Crystallogr. Acta h ehne mmrn itrcin n prubto o a cell a of perturbation and interaction membrane enhanced The Biochem. J. Biochem. oPoiy alao srcue aiain o macromolecular for validation structure all-atom MolProbity: Figures showing electron density and atomic models were 16 Acta Crystallogr. D Biol. Crystallogr. Biol. D Crystallogr. Acta , 21–40 (2003). 21–40 , , 107–112 (2007). 107–112 , (2007). 1019–1027 , hsr rsalgahc software. crystallographic Phaser µ , 2 L of 12 M HCl. 20 Variability in secondary structure of the antimicrobial peptide 3 http://www.pymol.org . Briefly,. The disome formation assay was performed as as performed was assay formation disome The µ methionyl-tRNAMetf formyltransferase complexed with complexed formyltransferase methionyl-tRNAMetf µ L of formamide dye. The samples were heated tosamplesheated wereformamideThe dye. of L ca rsalg. Bo. Crystallogr. Biol. D Crystallogr. Acta L PureL System Buffer and incubated atfor °C 37

Mol. Syst. Biol. Syst. Mol. Escherichia coli Biochim. Biophys. Acta Biophys. Biochim. 335 ′ -GGTTATAATGAATTTTGCTTATTAAC-3 2 invitro and 6 mM , 375–380 (1998). 375–380 ,

60 , 2126–2132 (2004). 2126–2132 , µ translation of2xermBLthe construct L of nuclease-free water. A vacuum vacuum A water. nuclease-free of L µ L toe-print resuspension buffer and β

K-12 in-frame, single-gene knockout 2 -mercaptoethanol) by centrifuga / , 2006.0008 (2006). 2006.0008 , µ ). L of AMV RT (NEB), 0.1 (NEB), RT AMV of L

66

66

1828 , 12–21 (2010). 12–21 , 66 , 125–132 (2010). 125–132 , . pl Crystallogr. Appl. J. doi: , 213–221 (2010). 213–221 , E. coli , 1457–1470 (2013). 1457–1470 , Ab initio Ab 10.1038/nsmb.3034 HY Kit (Roche).

55 construction 332–334 ,

40 µ ′ L + - ) ,