© 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 1562-1571 doi:10.1242/dev.108258

RESEARCH ARTICLE

Plk2 regulates mitotic spindle orientation and mammary gland development Elizabeth Villegas1,*, Elena B. Kabotyanski2, Amy N. Shore2, Chad J. Creighton3, Thomas F. Westbrook1,4,5 and Jeffrey M. Rosen1,2,*

ABSTRACT Breast cancer is a heterogeneous disease that can be classified into Disruptions in polarity and mitotic spindle orientation contribute to the distinct subtypes based primarily on the expression pattern of progression and evolution of tumorigenesis. However, little is known estrogen (ER) and progesterone (PR) hormone receptors, as well as about the molecular mechanisms regulating these processes in vivo. the human epidermal growth factor receptor 2 (HER2) (Perou et al., Here, we demonstrate that Polo-like kinase 2 (Plk2) regulates mitotic 2000). Treating individuals with breast cancer presents a significant spindle orientation in the mammary gland and that this might account challenge due to the lack of targeted therapies, especially of triple- for its suggested role as a tumor suppressor. Plk2 is highly expressed negative breast cancer, and the relatively minimal understanding of in the mammary gland and is required for proper mammary gland the signaling networks that regulate each specific subtype (Di development. Loss of Plk2 leads to increased mammary epithelial Cosimo and Baselga, 2010). Therefore, it is imperative to identify cell proliferation and ductal hyperbranching. Additionally, a novel role signaling pathways that contribute to the etiology of breast cancer for Plk2 in regulating the orientation of the mitotic spindle and in an attempt to discover novel therapeutic targets. RNA interference maintaining proper cell polarity in the ductal epithelium was (RNAi) has been used successfully in high-throughput screens to discovered. In support of a tumor suppressor function for Plk2, loss identify potential drug targets (Gargiulo et al., 2013; Liu et al., of Plk2 increased the formation of lesions in multiparous glands. 2013). In particular, RNAi has been used to identify putative tumor Collectively, these results demonstrate a novel role for Plk2 in suppressors in forward genetic screens (Westbrook et al., 2005; regulating mammary gland development. Krastev et al., 2011; Iorns et al., 2012). Recently, our laboratory performed RNAi screens designed to specifically target kinases and KEY WORDS: Plk2, Mammary gland development, Spindle phosphatases, characterizing PTPN12 as a tumor suppressor (Sun et orientation al., 2011). In these same screens, Polo-like kinase 2 (Plk2) was identified as a potential tumor suppressor in epithelial-derived INTRODUCTION cancers. Frequent focal deletion of Plk2 has been reported to occur Mammary gland development is a precisely coordinated process in numerous solid cancers, including breast cancer (Beroukhim et that occurs primarily after birth. Pubertal mouse mammary gland al., 2010). development commences at 3-4 weeks of age and is stimulated by Polo-like kinases are crucial regulators of various aspects of cell estrogen, progesterone and growth hormone. These circulating division, including mitosis, cytokinesis and the centrosome cycle hormones prompt the formation of highly proliferative terminal (Archambault and Glover, 2009). The polo-like kinase family end bud (TEB) structures that invade the stromal fat pad in a consists of five members, Plk1-Plk5, that are each characterized by process termed ductal elongation. The mammary epithelial cells their conserved C-terminal polo box and N-terminal kinase domains (MECs) of the TEBs maintain a carefully regulated balance (Glover et al., 1998; Barr et al., 2004, Andrysik et al., 2010). Plk2 between proliferation and apoptosis to generate hollow ducts (also referred to as serum-inducible kinase, or Snk) was originally composed of a single layer of luminal epithelium surrounded by identified as an early growth response gene whose mRNA myoepithelial cells (Humphreys et al., 1996). The luminal expression increases in response to serum (Simmons et al., 1992). epithelial cells establish apical-basal polarity that is crucial for During cell cycle progression, Plk2 is activated in the early G1 maintaining the integrity and function of the glandular epithelium phase and is required for centriole duplication (Warnke et al., 2004). (St Johnston and Ahringer, 2010). Upon reaching the end of the fat Targeted germline deletion of Plk2 in a mouse model results in pad, the TEBs regress, leaving behind a branched, ductal tree that embryonic growth abnormalities, but does not cause gross remains mostly quiescent until pregnancy (Harris, 2010). morphological phenotypes postnatally, perhaps owing to Disruption of any of these highly regulated developmental compensation from other Plk family members (Ma et al., 2003). processes, including proliferation, apoptosis and polarity, can Plk2 is expressed in a tissue-specific manner, with relatively high influence mammary tumorigenesis. expression levels in the mammary gland, perhaps providing an additional explanation for the paucity of overt abnormalities in the Plk2-null mice (Liby et al., 2001; Winkles and Alberts, 2005). In the 1Program in Developmental Biology, Baylor College of Medicine, Houston, TX 77030, USA. 2Department of Molecular and Cellular Biology, Baylor College of pubertal mammary gland, Plk2 is enriched in TEBs compared with Medicine, Houston, TX 77030, USA. 3Division of Biostatistics, Dan L. Duncan the ductal epithelium, but the function of Plk2 in the developing 4 Cancer Center, Baylor College of Medicine, Houston, TX 77030, USA. Verna and gland is unknown (Kouros-Mehr and Werb, 2006). Marrs McLean Department of Biochemistry and Molecular Biology, Baylor College of Medicine, Houston, TX 77030, USA. 5Department of Molecular and In this study, a germline knockout mouse was employed to Human Genetics, Baylor College of Medicine, Houston, TX 77030, USA. determine the effect of loss of Plk2 on mammary gland development and tumorigenesis. During puberty, Plk2 deletion resulted in *Authors for correspondence ([email protected]; [email protected]) increased proliferation of MECs, increased ductal side branching

Received 22 January 2014; Accepted 5 February 2014 and delayed ductal elongation. In the adult, Plk2-null epithelial ducts Development

1562 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258 have reached the end of the mammary fat pad; however, the transient (Fig. 1B). Whole-mount analysis of Plk2−/− mammary increased proliferation and hyperbranching phenotypes persist. glands also revealed a hyperbranched phenotype observed at all Expression profiling of Plk2-null MECs revealed disrupted stages of development (Fig. 1C). Quantitative analysis showed a expression of genes that regulate mitotic spindle assembly. significant increase in side branching in the Plk2-null mammary Accordingly, loss of Plk2 led to misorientation of the mitotic spindle glands beginning at 6 weeks of age (Fig. 1D). At 8 weeks of age, and loss of apical-basal polarity in the luminal epithelium, as well the Plk2-null glands showed a 2.1-fold increase in branchpoints per as luminal filling, suggesting that Plk2 is required to maintain proper millimeter of epithelial duct compared with control glands. This cell division and polarity in the mammary luminal epithelial hyperbranched phenotype persisted in the glands of 12-week-old compartment. Additionally, loss of Plk2 resulted in an increase in Plk2−/− mice. Taken together, these data suggest that Plk2 is an the formation of lesions in the mammary glands of multiparous important regulator of ductal elongation and branching mice. Collectively, these results show that Plk2 is required for morphogenesis in the mammary gland. proper mammary gland development. Loss of Plk2 leads to increased proliferation of mammary RESULTS epithelial cells without a concomitant increase in apoptosis Deletion of Plk2 results in a delay in ductal elongation and Next, we sought to determine whether the increase in branching increased branching observed in Plk2−/− mammary glands was due to alterations in To elucidate the role of Plk2 in mammary development and breast proliferation. To quantify proliferation, mice were injected with cancer, we characterized a Plk2 germline knockout mouse model BrdU at several time points throughout mammary gland (Inglis et al., 2009) for defects in mammary gland development and development as a measure of cells in S phase. Notably, there was a homeostasis. PCR was performed to confirm deletion of the Plk2 substantial increase in proliferation at 8 weeks of age in Plk2−/− gene in Plk2−/− compared with Plk2+/+ mice (supplementary TEBs (Fig. 2A,B,G). At 10 and 12 weeks of age, when the epithelial material Fig. S1A). To detect morphological defects, mammary ducts of the control mammary glands had reached the ends of the glands were harvested at 6, 8, 10 and 12 weeks of age and analyzed mammary fat pad (Fig. 1B), the Plk2+/+ ductal epithelial cells initially as whole mounts. A reduction in ductal elongation through exhibited very low levels of proliferation, as expected (Fig. 2E,G). the mammary fat pad in the Plk2-null glands was observed Conversely, the Plk2-null glands showed significantly increased beginning at 6 weeks of age that persisted through 10 weeks of age levels of proliferation at 10 weeks of age when compared with (Fig. 1A). To quantify the defects in ductal elongation, the controls. By 12 weeks of age, the Plk2-null epithelium had filled the percentage of the fat pad occupied by epithelium (% fat pad filled) mammary fat pad (Fig. 1B); however, the Plk2−/− ductal epithelial was quantified. Throughout development, Plk2−/− mammary glands cells continued to proliferate, as evidenced by the presence of ~10% showed a reduced percentage of fat pad filled by epithelium BrdU-positive cells. The Plk2+/+ control glands had no detectable compared with the Plk2+/+ mammary glands (Fig. 1B). However, by BrdU-positive cells at 12 weeks of age (Fig. 2E,F). Interestingly, the 12 weeks of age, Plk2−/− ducts reached the ends of the mammary fat increase in proliferation in the absence of Plk2 was maintained at 16 pad, indicating that the impairment in ductal elongation was weeks of age (Fig. 2G). To further confirm the proliferative

Fig. 1. Plk2 loss leads to delayed ductal elongation and increased branching. (A) Carmine stained whole- mount analyses during virgin mammary gland development at 8, 10 and 12 weeks of age denote a delay in ductal elongation in Plk2−/− compared with Plk2+/+. The red line indicates the distance from the lymph node to the leading end bud. (B) Plk2−/− mammary glands exhibit a transient delay in development, appearing from 6 to 10 weeks of age. At 10 weeks of age, the Plk2+/+ mammary glands have reached the end of the fat pad. Plk2−/− reach the end of the fat pad at 12 weeks of age. (C,D) Plk2−/− mammary glands display increased branching that appears as early as 6 weeks of age and persists throughout development. Scale bars: 10 mm. Statistical significance was determined by Student’s t-test. *P<0.01, **P<0.001, ***P<0.0001. Error bars represent s.e.m. with a sample size n>3. Development

1563 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258

Fig. 2. Increase in proliferation in Plk2−/− mammary glands. (A,B) Immunofluorescence for BrdU incorporation on paraffin-embedded sections of mammary glands at 8 weeks of age (E,F) and 12 weeks of age demonstrates that loss of Plk2 causes an increase in proliferation during puberty as well as in a mature virgin mammary gland (G). Immunofluorescence on 8-week-old mammary gland sections using cleaved caspase 3 (C,D) showing Plk2 had no significant effect on apoptosis (H). Scale bars: 40 μm. Statistical significance was determined by Student’s t-test. *P<0.01, **P<0.001. Error bars represent s.e.m. with a sample size n>3.

phenotype, we stained for pH3 (phosphorylated histone 3) a marker of apoptosis was employed. TUNEL assays on 8-week mammary for chromatin condensation, which is a key process during mitosis. glands from Plk2+/+ and Plk2−/− revealed similar results with no Not surprisingly, a similar increase of proliferation at 8, 10, 12 and significant difference in apoptosis (supplementary material Fig. 16 weeks of age was observed indicating that the increase in S2B-D). These data demonstrate that Plk2 loss leads to hyper- proliferation is not due to cells prolonged in S phase, as previously proliferation without a concomitant increase in apoptosis, and reported (Matthew et al., 2007) (supplementary material Fig. S2A). suggest that Plk2 regulates mammary gland homeostasis. These data suggest that Plk2 negatively regulates proliferation in Accordingly, Plk2 loss may potentiate mammary hyperplasia. mammary epithelial cells, and that loss of Plk2 leads to a hyperproliferative phenotype. Loss of Plk2, specifically in the mammary epithelial cells, Many oncogenic insults that increase proliferation also result in a recapitulates the delay in ductal elongation, the compensatory increase in apoptosis (Debnath et al., 2002). To test hyperbranching and increased proliferation whether the elevated proliferation in Plk2−/− glands lead to a Plk2 expression was detected by immunohistochemistry in both the concomitant increase in apoptosis, immunofluorescent detection of basal and luminal compartments of the TEBs and ducts cleaved caspase 3(CC3), a marker for apoptosis was performed. (supplementary material Fig. S1B). To determine whether the Consistent with normal developmental timing, we observed higher mammary epithelial cell defects were cell-autonomous or due to levels of apoptosis during ductal elongation at 6 and 8 weeks of age, Plk2 loss in the stromal compartment and/or secondary systemic as epithelial cells in the TEBs undergo apoptosis to form the lumen. effects, mammary epithelial transplants were performed. Plk2+/+ and However, there were no significant differences in apoptosis between Plk2−/− MECs were injected into the contralateral fat pads of wild- Plk2-null mammary glands and controls at these time points or later type mice that were cleared of endogenous epithelium and the

in development (Fig. 2C,D,H). An additional method for detection resultant outgrowths were analyzed 6 and 8 weeks post- Development

1564 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258 transplantation. A delay in ductal elongation was observed in Plk2−/− whether Plk2 inactivation led to defects in spindle orientation in outgrowths 6 weeks post-transplantation with only ~20% of the fat ductal luminal epithelial cells in vivo. In most epithelia, planar cell pad occupied, in contrast to 80% of the fat pad filled in Plk2+/+ division and proper mitotic spindle orientation are necessary to outgrowths (supplementary material Fig. S3A,B,G). Whole-mount maintain the organization of the epithelial monolayer and tissue analysis showed that both wild-type and Plk2-null MECs completed integrity. In the mammary gland, mitotic spindle orientation has not mammary gland development 8 weeks post-transplantation been well-studied, but in vitro studies in three-dimensional cultures (supplementary material Fig. S3G). Whole mounts and Hematoxylin have suggested that luminal MECs normally divide within the plane and Eosin staining also showed that Plk2-null outgrowths appeared of the luminal compartment. Upon further examination of ductal hyperbranched compared with contralateral wild-type outgrowths mitotic cells, we frequently observed luminal cells dividing in a non- (supplementary material Fig. S3C-F,H). Branching quantification parallel orientation to the plane of the luminal compartment and into demonstrated that Plk2-null outgrowths had an almost twofold the ductal luminal space in the absence of Plk2. To examine this increase in branch points per millimeter when compared with wild- phenotype further, we treated 10- to 12-week-old wild-type and type outgrowths at 6 and 8 weeks post-transplantation Plk2-null mice with estrogen and progesterone for 2 days to induce (supplementary material Fig. S3F). The proliferative phenotype proliferation of the MECs, thus increasing the number of mitotic observed in the Plk2−/− endogenous mammary gland was further figures for quantification. Plk2+/+ were used as controls to rule out investigated to determine whether it was due to the absence of Plk2 any effect that might occur as a consequence of estrogen and in MECs. Not surprisingly an increase in proliferation in the Plk2−/− progesterone treatment alone. We performed immunofluorescence outgrowths isolated 6 weeks post-transplantation was detected to detect nuclear mitotic apparatus protein 1 (NuMA), a protein that (supplementary material Fig. S4A,B,E). Although an increase in is concentrated at the spindle poles during mitosis, to determine the proliferation was also observed at 8 weeks post-transplantation in orientation of the mitotic spindle in mammary ducts. As expected, Plk2−/− outgrowths, this difference was not statistically significant. in Plk2+/+ mammary glands the orientation of the mitotic spindle Owing to the low levels of proliferation observed in the resultant was parallel to the basement membrane (Fig. 3A), whereas in outgrowths insufficient numbers of mitotic events were detected to Plk2−/− mammary glands the mitotic spindle was altered and most accurately measure spindle orientation. Taken together, these results frequently not parallel to the basement membrane (Fig. 3B), which provide evidence that the delay in ductal elongation, hyperbranching confirms previous observations. Abnormal spindle orientation in and increase in proliferation phenotypes are a direct consequence of Plk2−/− mammary glands was also observed using phosphorylated Plk2 loss in the mammary epithelium. histone 3 (pH3), a marker of condensed chromatin in mitotic cells (supplementary material Fig. S6A,B,E). To quantify the orientation Plk2 inactivation leads to misregulation of genes that of the mitotic spindle in the wild-type and Plk2-null mammary regulate mitotic spindle assembly ducts, the angle between the basement membrane and the plane of To determine how Plk2 may restrain proliferation in the mammary the mitotic spindle was measured and the measurements were gland, gene expression analyses were performed on RNA isolated classified into three categories: 0-10°, 10-45° and 45-90° (Fig. 3I). from Plk2+/+ and Plk2−/− MECs. The Database for Annotation, In control mammary glands, almost 90% of the mitotic cells had Visualization and Integrated Discovery (DAVID) was employed to their spindles oriented parallel to the basement membrane (0-10°), identify cellular processes that are misregulated upon Plk2 loss. whereas only 15% of Plk2-null mitotic cells fell into this category Additionally microarray results were validated using genes known (Fig. 3I). The majority of Plk2-null mitotic cells (almost 80%) to be abundantly expressed in the mammary gland in addition to cell exhibited abnormal spindle orientation with an angle greater than cycle-specific genes (supplementary material Fig. 5B,C). 10° compared with controls (Fig. 3I). Interestingly, Plk2-null Interestingly, many genes involved in cell cycle control were mammary ducts displayed an almost equal distribution of cells with dysregulated in the Plk2-compromised state (supplementary material angles of 10-45° and 45-90°, suggesting a random orientation of the Fig. S5A). Notably, Plk2 inactivation led to dysregulation of many mitotic spindle relative to the control mammary ducts (Fig. 3I). genes involved in proper assembly and integrity of the kinetochore These data suggest that loss of Plk2 results in misorientation of the and mitotic spindle, such as Cenpo (1.63), Dsn1 (1.61) and Spc25 mitotic spindle in luminal epithelial cells. (4.98) (supplementary material Fig. S5A). Spc25 is a component of Proper orientation of the mitotic spindle and the maintenance of the Ndc80 complex, which is a regulator of kinetochore/microtubule polarization are crucial components required to preserve the attachment a process that must be tightly regulated to establish integrity of epithelial tissue. In order to determine whether proper spindle orientation (Tanaka and Desai, 2008; Sun et al., polarization of the epithelium was compromised, the distribution 2010). Interestingly, a threefold increase in Spc25 protein levels was of apical-basal polarity markers in wild-type and Plk2-null observed in the absence of Plk2 (supplementary material Fig. S5D). mammary ducts was analyzed. First immunofluorescent detection In addition, Haus1 (2.50) was significantly upregulated in Plk2-null of phospho-ERM (pERM), which localizes to the apical surface of MECs. Haus1 is involved in microtubule nucleation, which is luminal epithelial cells, as shown in the wild-type mammary ducts crucial for the assembly of the mitotic spindle and is also a regulator was performed (Fig. 3C). Surprisingly, Plk2−/− mammary ducts of NuMA, a key protein involved in spindle orientation (Bowman showed an almost complete loss of pERM staining (Fig. 3D). To et al., 2006; Lawo et al., 2009) (supplementary material Fig. S5A). further investigate a defect in apical polarity, the Golgi apparatus These results suggest that Plk2 inactivation may be important for marker GM130, which is restricted to the apical surface of luminal regulating the assembly, and hence orientation of the mitotic spindle epithelial cells in the mammary gland was also employed. As in the mammary epithelium. expected, Plk2+/+ mammary ducts showed a well-aligned, continuous layer of GM130 staining localized to the apical surface Plk2 is required for proper orientation of the mitotic spindle of luminal cells (Fig. 3E). Conversely, GM130 was randomly and polarization of the epithelium distributed in the Plk2−/− mammary ducts (Fig. 3F). Lastly, Our results suggest Plk2 regulates proper assembly and function of immunofluorescence was performed for ZO-1, a tight junction

the mitotic spindle in the mammary epithelium. Thus, we tested protein localized apically on luminal cells. A lack of ZO-1 staining Development

1565 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258

Fig. 4. Plk2 deletion disrupts lumen formation and stromal architecture. (A,B) H&E staining denoting the increase in branching as well as lack of lumens (C,D) in 12-week-old Plk2−/− mammary glands. (E,F) Immunofluorescence using K5 (myoepithelial) and K8 (luminal) markers shows an increase in luminal cells that leads to a lack of ductal lumen. Scale bars: 40 μm.

required to maintain proper luminal apical-basal polarity in the mammary gland. To determine whether the loss of apical polarity was due to, or accompanied by, a loss of cell-cell adhesion, we performed Fig. 3. Plk2 is required for proper spindle orientation and proper immunofluorescence to detect alterations in E-cadherin localization. formation of the polarized epithelium. (A,B) Nuclear mitotic apparatus E-cadherin is crucial for maintaining cell-cell contacts in epithelial protein 1 (NuMA) staining showing the disruption of spindle orientation upon Plk2 loss. The red line indicates the proper plane of cell division and the tissues and localizes to adherens junctions as shown in wild-type yellow arrows denote the actual plane of division occurring. The angle mammary ducts (Fig. 3G). Loss of Plk2 did not affect the between the basement membrane and plane of cell division was measured localization of E-cadherin (Fig. 3H), suggesting that the disrupted for Plk2+/+ and Plk2−/− mitotic epithelial cells (I). The majority of Plk2−/− apical polarity in Plk2-null luminal epithelium is not due to the epithelial cells undergoing cell division portrayed an angle greater than 10°, inability of the luminal cells to maintain proper cell-cell contact. indicating that the cells were dividing perpendicular to the basement Collectively, these data suggest that loss of Plk2 results in alterations membrane (I). (C-F) Immunofluorescence of paraffin embedded mammary gland sections using the apical marker phosphorylated ERM and GM130 (a of spindle orientation and compromises the integrity of the Golgi marker), both of which display the disruption of apical polarization in epithelium by disrupting polarization. Plk2−/− mammary glands. (G,H) No alterations in E-cadherin staining on 8- week-old mammary gland sections. Scale bars: 40 μm. Statistical Plk2-null mammary glands show disrupted lumen formation significance was determined by Student’s t-test. *P<0.01, **P<0.001. Error Do these alterations in spindle orientation and polarization have bars represent s.e.m. with a sample size n>3. further consequences on tissue architecture? Hematoxylin and Eosin (H&E) staining performed on mammary sections from Plk2−/− and was observed in our Plk2−/− mammary glands (supplementary control glands confirmed the hyperbranched phenotype observed by material Fig. S6C,D). To rule out a non- cell autonomous effect, whole-mount analysis and further revealed a luminal filling the outgrowths from the previously mentioned transplantation phenotype in the Plk2−/− mammary glands (Fig. 4A-D). To studies also were analyzed for pERM levels and not surprisingly a determine whether the failure to form lumens was accompanied by significant decrease in pERM staining in Plk2−/− outgrowths was a disruption in the luminal and/or myoepithelial layer organization, observed (supplemental material Fig. S4C,D). Disruption of the immunofluorescent staining using antibodies against keratin 8 (K8;

distribution of these apical polarity markers suggests that Plk2 is Krt8 – Mouse Genome Informatics) and keratin 5 (K5; Krt5 – Development

1566 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258

Mouse Genome Informatics), which are well-established markers for luminal and myoepithelial compartments, respectively, was performed. In Plk2+/+ mammary glands a single layer of K8+ luminal cells surrounded by a continuous, single layer of K5+ myopeithelial cells was observed, as expected (Fig. 4E). In Plk2−/− mammary ducts, the K8+ luminal compartment was multi-layered and revealed K8+ cells accumulating in the lumen. No alterations were detected in the myoepithelial cell layer in Plk2−/− mammary glands (Fig. 4F). These data suggest that Plk2 is required for proper lumen formation during ductal morphogenesis.

Increase in lesions in the absence of Plk2 in parous gland The phenotypes observed in the Plk2-null mammary gland, including hyperproliferation, disrupted luminal polarity and luminal filling, are also common features of early mammary tumorigenesis. To determine whether Plk2 functions as a tumor suppressor, nulliparous Plk2+/+ and Plk2−/− females were aged for 12-15 months and monitored for tumor formation. In the absence of any other genetic changes, such as alterations in p53 to provide a sensitized background, Plk2−/− mice failed to develop palpable mammary tumors and whole-mount analysis also revealed an absence of macroscopic lesions. This result was not unexpected as C57Bl/6 mice are known to be a low incidence mammary tumor strain. Pregnancy and involution results in significant increases in proliferation and apoptosis of MECs, respectively, thus potentially increasing their susceptibility to mutagenic events. To determine whether there was an effect of parity on tumorigenesis, Plk2+/+ and Plk2−/− female mice were mated and allowed to progress through several rounds of pregnancy and lactation followed by complete involution. Again, Plk2-null mice did not develop palpable mammary tumors. However, macroscopic lesions were detected by whole-mount analysis of mammary glands from parous females following involution. Although there were lesions present in both Plk2+/+ and Plk2−/− mammary glands, the Plk2-null mice showed a twofold increase in the number of lesions per mammary gland when compared with parous age-matched wild-type mice (Fig. 5A,B,G). In addition, Plk2-null lesions appeared to have decreased epithelial organization in H&E stained sections of parous mammary glands Fig. 5. Increase in lesions upon Plk2 loss in parous glands. (Fig. 5C,D). Interestingly, Plk2−/− parous mammary glands (A,B) Carmine stained whole-mount analysis of parous Plk2+/+ and Plk2−/− contained a twofold increase in keratin pearls, indicating that the mammary glands revealed the existence of lesions (yellow arrows). H&E mammary ductal epithelium had undergone squamous (C,D) and Masson’s Trichrome staining (E,F) on paraffin-embedded differentiation (Fig. 5E,F; supplementary material Fig. S7A). To mammary gland sections of parous lesions illustrates the process of keratinization occurring indicated by yellow arrowheads. Quantitative better visualize alterations in the stroma, we stained parous sections analysis of lesions indicates an increase in lesions in Plk2−/− parous glands with Masson’s Trichrome and found that there was abundant (G). Scale bars: 10 mm in A,B; 40 μm in C-F. Statistical significance was collagen deposition in both Plk2+/+ and Plk2−/− lesions (Fig. 5E,F). determined by Student’s t-test. **P<0.001. Error bars represent s.e.m. with a These data suggest that absence of Plk2 cooperates with parity, sample size n>3. resulting in an increased number of lesions. were positive for K8 and K5 (supplementary material Fig. S7B). Plk2-null lesions are less differentiated and exhibit Collectively, these results suggest that lesions that arise as a decreased expression of estrogen and progesterone consequence of Plk2 loss appear less differentiated, perhaps as an receptors expansion of a multipotent progenitor population. To further characterize the lesions in Plk2+/+ and Plk2−/− parous Because loss of estrogen and progesterone often is associated with mammary glands, K8 and K5 immunofluorescent staining was used a less differentiated status of mammary epithelium (Lapidus et al., to examine organization of the luminal and basal epithelial layers. 1998) the estrogen receptor (ER) and progesterone receptor Plk2+/+ lesions displayed intact K5+ myoepithelial cell layers (PR) status of the parous lesions was investigated by surrounding the K8+ luminal compartments, indicating the proper immunohistochemical staining. The Plk2+/+ lesions maintained organization of the two epithelial compartments (Fig. 6A). In stark expression of ER and PR in the luminal epithelial cells (Fig. 6C,E), contrast, Plk2−/− lesions lacked proper epithelial organization. Both whereas Plk2−/− lesions showed a prominent decrease of ER K5+ cells, as well as cells that were double-positive for K8+/K5+ expression and a decrease in the number of cells expressing PR were observed, within the lumens of the ducts (Fig. 6B). (Fig. 6D,F; supplementary material Fig S7C,D). These data further Quantitation of Plk2+/+ revealed there were no double-positive cells suggest that lesions that arise as a consequence of Plk2 loss exhibit −/− present in lesions and Plk2 had 4% of total cells in lesions that a less differentiated phenotype. Development

1567 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258

MECs showed alterations in key genes involved in regulating the mitotic spindle. Moreover, we found that Plk2 is required to maintain the integrity of the ductal epithelium, as loss of Plk2 led to mitotic spindle misorientation and disruption of apical-basal polarity in the luminal epithelium. Finally, we observed an increased number of lesions in multiparous Plk2-null mammary glands, providing evidence for the role of Plk2 in suppression of mammary tumorigenesis. We identified a novel role for Plk2 in regulating the orientation of the mitotic spindle. Previous data suggested that Plk2 is important for the G1/S transition of the cell cycle and in the DNA damage response (Warnke et al., 2004; Matthew et al., 2007). Plk2 has also been reported to be crucial for centriole duplication during the G1/S transition. Interestingly, no defect in pericentrin and γ-tubulin centrosomal staining was observed in vivo in the absence of Plk2 (supplementary material Fig. S8A-D), but we cannot completely rule out the possibility that defective centriole duplication and/or function is involved in the mechanism by which Plk2 regulates spindle orientation due to the inability to stain centrioles in mammary gland tissue. Our studies use a genetically engineered mouse model with germline ablation of Plk2, and therefore, nontransformed mammary epithelial cells are being examined in the context of the microenvironment. Thus, it is not surprising that some functions of Plk2 may differ from those observed in previous in vitro studies performed using transformed U2OS osteosarcoma cells with genetic alterations such as the loss of p16 and cultured in the presence of serum (Warnke et al., 2004; Cizmecioglu et al., 2012). Here, we report for the first time a potential role for Plk2 during Fig. 6. Plk2−/− lesions are less differentiated, have lost detectable early mitosis in organizing the proper orientation of the mitotic estrogen receptor expression and have decreased progesterone spindle in non-transformed mammary epithelial cells. We observed receptor levels. (A,B) Immunofluorescence of paraffin-embedded mammary that in the absence of Plk2, the plane of the mitotic spindle in gland sections using K5 and K8 indicates a less differentiated lesion in luminal epithelial cells was most frequently perpendicular to the Plk2−/− parous mammary gland (arrows). Epithelial cells positive for K5 and basement membrane, leading to cells dividing into the ductal lumen −/− −/− K8 were identified in Plk2 lesions indicated by white arrows. Plk2 parous and a luminal filling phenotype. This result provides a new area of lesions have lost detectable ER expression (C,D) and have a marked investigation to elucidate Plk2 function during mitosis. One crucial decrease in PR (E,F). Scale bars: 40 μm. question that remains is how does Plk2 regulate the orientation of the mitotic spindle? One possibility is that Plk2 regulates the mitotic DISCUSSION spindle by influencing the expression of key mitotic spindle genes In this study, we identified a novel role for Plk2 in regulating that are important for key processes during spindle assembly, such mammary gland development. In the absence of Plk2, we observed as Spc25 and Haus1, most likely by an indirect mechanism. Spc25 increased proliferation of MECs, hyperbranching of the ductal tree and Haus1 mRNAs were both significantly upregulated in Plk2-null and a transient delay in ductal elongation. Levels of apoptosis were MECs and although this could be explained by the increase in not significantly altered and hyperplastic lesions or tumors were not proliferation, this possibility is unlikely because we did not observe observed in virgin mice, despite the increase in proliferation in a proliferation signature upon DAVID analyses. Spc25 is a key Plk2−/− mammary glands. This indicates that any increase in cell component important in the assembly of the kinetochore, and it is number that might occur due to the increase in proliferation is likely that upregulation of Spc25 could result in mislocalization of possibly compensated for by removal of cells from ductal lumens Spc25 protein and resulting alterations in kinetochore assembly sometime after 16 weeks and prior to lactation, as has been observed (Cheeseman et al., 2008). Establishing a correctly oriented mitotic in several other knockout mice models by an unknown mechanism spindle depends on initial key processes such as orientation of the (Mailleux et al., 2007; Moraes et al., 2009). We were able to centrosomes to opposite poles and proper microtubule nucleation, recapitulate the ductal elongation, hyperbranching and proliferative Haus1 is a component of the Augmin complex, a key regulator of phenotypes in transplantation studies into wild-type fat pads, microtubule nucleation (Lawo et al., 2009). Disruption of the indicating that the alterations in ductal elongation, increase in previously mentioned processes can ultimately alter spindle branching and increase in proliferation are a consequence of Plk2 assembly dynamics. Previous studies have shown important loss specifically in the epithelium. Additionally, we find that the regulators of spindle orientation in other epithelial tissues, such as proliferative phenotype is observed in transplants during pubertal ABL1 in the skin, IFT20 in the kidney and APC in colon cancer development and although there are more proliferating cells in (Jonassen et al., 2008; Fleming et al., 2009; Matsumura et al., 2012). Plk2−/− upon completion of development, these differences were not We describe for the first time that Plk2 possibly acts as a tumor statistically significant. The maintenance of proliferation in post- suppressor to regulate the orientation of the mitotic spindle in the pubertal development in the endogenous gland may be due to developing mammary gland. The analysis of somatic copy number alterations in systemic hormonal regulation present only in the alterations from over 3000 cancer specimens belonging to 26

germline knockout. Interestingly, expression profiling of Plk2-null histological types has identified focal loss of Plk2 as a frequent Development

1568 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258 event, and this has been confirmed specifically in basal-like breast required to identify additional substrates that may be targeted to cancers using the TCGA web portal (Beroukhim et al., 2010) (C. restore Plk2 function. The reagents necessary to perform these Shaw, C. Perou and J. M. Rosen, unpublished observations). experiments are currently under development. Interestingly, several tumor suppressors have been reported to alter the orientation of the mitotic spindle, such as APC, E-cadherin and MATERIALS AND METHODS VHL. These proteins also regulate epithelial polarity and Mouse strain microtubule dynamics, which suggests that these processes are not For mammary gland developmental studies, we used a Plk2+/+ and Plk2−/− mutually exclusive (Pease and Tirnauer, 2011). Although C57BL6/129s mixed background germline knockout obtained from Elan misoriented spindles do not necessarily directly result in Pharmaceuticals (Inglis et al., 2009). These mice were maintained in a tumorigenesis, they do contribute to several aspects of tumor mixed genetic background (C57BL6/129s). For transplantation experiments, biology such as tissue hypertrophy and metastasis (Pease and we used SCID/beige purchased from Harlan Laboratories (Houston, TX, USA). All animals were housed and maintained in accordance with Tirnauer, 2011). Collectively, our studies suggest an important role guidelines of the Institutional Animal Care and Use Committee of Baylor for Plk2 in regulating both spindle orientation and consequently College of Medicine. All experiments were performed with age-matched epithelial tissue integrity. littermates. A role for Plk2 in regulating embryonic polarity in C. elegans by directly binding key polarity proteins via the polo box domains was Tissue harvest identified previously (Nishi et al., 2008). Here, we report a role for The fourth pair of mammary glands was harvested at 6, 8, 10 and 12 weeks Plk2 in the maintenance of proper apical polarization in mammary of age for the developmental studies. Additionally, we harvested the fourth gland ductal epithelium. Plk2 could be participating in the pair of glands from multiparous females post natural involution. BrdU was maintenance of polarity by directly interacting with polarity proteins injected two hours prior to tissue harvest at a concentration of 10 μl/g of as reported in other model systems. Alternatively, the loss of apical total body weight from a stock of (3 mg/ml); this allowed for proliferation polarity could also be explained by the increased proliferation of analysis. luminal MECs. These cells are initially restricted to the single- layered luminal compartment, but as they proliferate the layer is Whole-mount and branching analysis For mammary gland whole-mount analysis, tissue was mounted on glass disrupted and the MECs enter the luminal space, thus disrupting slides, fixed in Carnoy’s fixative, stained with carmine red then dehydrated apical polarization. Although it would be interesting to determine and cleared in xylene. Plk2+/+ control mammary glands were isolated at 6 whether the loss of polarization is a cause or consequence of altered weeks (n=4), 8 weeks (n=5), 10 weeks (n=3), 12 weeks (n=4) and 16 weeks mitotic spindle orientation, unfortunately these two phenomenon are (n=3), and Plk2−/− mammary glands were also isolated at 6 weeks (n=3), 8 observed simultaneously, which makes it difficult to decipher which weeks (n=3), 10 weeks (n=4), 12 weeks (n=7) and 16 weeks (n=3). These arises initially. glands were analyzed for percent fat pad filled and branching analysis. To Previous studies have correlated the chromosomal loss of Plk2 evaluate the percent fat pad filled 0.71× images, and for branching with both ER-negative and the basal subtype of breast cancer quantitation 1.6× images were analyzed using a Leica MZ16F stereoscope. (Weigman et al., 2012). Interestingly, in our studies we observed that Following these analyses all mammary glands were paraffin embedded. in the absence of Plk2, multiparous mice develop an increased Proliferation, apoptosis and polarity experiments were performed using a minimum of three animals per group. Multiparous studies were performed number of less differentiated lesions, as indicated by the using Plk2+/+ (n=6) and Plk2−/− (n=8) parous animals. disorganized epithelial compartments, the increase in K8+/K5+ double-positive cells and the decreased expression of ER and PR. Primary mammary epithelial cell isolation and transplantation We cannot rule out the possibility that the increase in lesions could Primary mammary epithelial cells (MECS) were isolated from 8-week-old be due to an increase in cellularity as a result of increased mice for transplantation experiments. MECS were isolated from #3, #4 and proliferation. Collectively, these studies suggest that Plk2 may #5 mammary glands by mincing freshly isolated glands into 1 mm3 function as a putative tumor suppressor in mammary tumorigenesis. fragments using a Vibratome Series 800-Mcllwain Tissue Chopper. The However, other genetic and epigenetic changes are most likely tissue fragments were digested in DMEM/F12, which contained 2 mg/ml required for the development of palpable tumors. collagenase A (Roche Applied Science) for 1 hour at 37°C shaking at Based upon previous studies performed in vitro in U2OS cells, 120 rpm. The adipocytes were removed from the organoids by centrifuging our expectations when these studies were initiated were that Plk2 at 357 g for 5 minutes following this centrifugation step, the remaining stromal cells were removed by sequential centrifugation at 357 g for 5 loss in the mammary gland would cause defective centriole seconds. The organoids were then subjected to trypsinization by duplication that would result in monopolar spindles, decreased resuspending them in 0.25% Trypsin-EDTA for 5 minutes at 37°C then proliferation and increased apoptosis compromising outgrowth washing and filtering using a 0.40 μm cell strainer to obtain a single cell potential, as has been reported to occur in cells with compromised suspension. Single cells were resuspended in DMEM/F12 containing 20% spindles (Cho et al., 2006; Pan et al., 2008; Xu et al., 2011). Matrigel at a concentration of 20,000 cells/μl and kept on ice until Contrary to these expectations, we observed hyper-proliferation, transplantation. For transplants, 200,000 cells were injected into cleared increased branching, altered spindle orientation, ductal luminal contralateral fat pads of 3-week-old SCID/Beige host mice. Mammary filling and hyperplastic lesions. These unexpected results provide glands were harvested 8 weeks post-transplantation and whole mount as well novel insight into the functional role of Plk2 in vivo during postnatal as histological analyses were performed. mammary gland development. Although these studies suggest that Plk2 may be an important tumor suppressor in breast cancer, direct Immunostaining proof of this hypothesis may require studying Plk2 function in a Sections (5 μm) were cut from paraffin embedded tissue, deparafinized and rehydrated through a graded series of ethanols. Antigen retrieval was sensitized genetic background, such as Balb/c mice expressing a performed by boiling 10 nM sodium citrate buffer for 20 minutes. Washes mutant p53, which display an increased susceptibility to breast were performed with 1×PBS and primary antibodies were incubated at 4°C cancer. The original genetic screen in which Plk2 was identified overnight in a humidified chamber. All primary antibodies were diluted in employed HMECs that overexpress Myc, so the role of Plk2 may 5% BSA, 0.5% Tween-20 blocking buffer. For immunofluorescence BrdU

cooperate with Myc in tumorigenesis. Finally, additional studies are (1:10, BD Biosciences), p-H3 (1:300, Upstate Biotech), cleaved caspase 3 Development

1569 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258

(1:200, Cell Signaling), K5 (1:5000, Covance), K8 (1:250, Developmental validation were from a separate cohort of mice distinct from the samples Studies Hybridoma Bank), pERM (1:500, Cell Signaling), NuMA (1:250, used for microarray analysis accounting for the variability observed. Abcam), Pericentrin (1:500, BD Biosciences), γ-tubulin (1:500, Sigma) and ZO-1 (1:400, Millipore) were employed. MOM block (Vector Laboratories) Estrogen and progesterone treatment was used as a diluent for GM130 (1:150, BD Biosciences) and E-cadherin Estrogen and progesterone treatment was performed on 12-week-old mice (1:1000, Zymed). TUNEL assay was performed as described (Kingsley- as follows. Mice were injected with 100 μl of estrogen and progesterone Kallesen et al., 2002). Plk2 (1:300, Abcam) was used for sesame oil solution with a final concentration of 1 μg of E2 and 1 mg of immunohistochemistry. Estrogen receptor (1:400, Santa Cruz) and progesterone under the skin between the shoulder blades. Mice were injected progesterone receptor (1:100, DAKO) staining was performed by the Lester intraperitoneally with BrdU 2 days post-estrogen and -progesterone and Sue Smith Breast Center, Baylor College of Medicine (Houston, TX, treatment 2 hours prior to sacrificing (Grimm et al., 2002). USA). For immunohistochemistry, Vectastain Elite ABC and diaminobensidine Quantitation of spindle orientation (DAB) substrate kits (Vector Laboratories) were used. Upon detection, Plk2+/+ (n=5) and Plk2−/− (n=5) mice were treated with estrogen and sections were counterstained with Hematoxylin and slides were coverslipped progesterone and used for spindle orientation analysis. Immunofluorescence using Permount (Fisher). was performed for NuMA and p-H3 on paraffin-embedded sections. We measured the angle between the basement membrane and the plane of cell +/+ −/− RNA isolation division of Plk2 (110 events) and Plk2 (115 events) mitotic cells during The fourth pair of mammary glands was isolated from Plk2+/+ and Plk2−/− the stages of metaphase, anaphase and telophase cells. mice, and three mice were used for each genotype. MECs were purified from these glands and total RNA was isolated using Trizol Reagent Protein extraction and immunoblot analysis (Invitrogen) according to manufacturer’s protocols. Additionally, total RNA Protein was isolated using an online protocol (https://www.bcm.edu/rosenlab/ was isolated from whole-gland samples. Total RNA was DNase-treated index.cfm?pmid=12991). Protein was quantified using a colorimetric assay kit (Invitrogen) and purified using RNeasy MinElute Cleanup Kit (Qiagen). (Bio-Rad). SDS-PAGE was employed to separate proteins that were transferred onto a nitrocellulose membrane. Spc25 1:1000 (Abcam) and Gapdh 1:1000 (Cell Signaling) antibodies were employed. Secondary Gene expression profiling antibodies used were IRDye 700 anti-rabbit, IRDye 700 anti-mouse, IRDye Microarray analysis were performed on biological triplicates from Plk2+/+ 800 anti-rabbit and IRDye 800 anti-mouse and were incubated in Odyssey and Plk2−/− on MECs. RNA was isolated and treated as previously described Blocking Buffer (Li-Cor). Protein levels were quantitated using the Odyssey in RNA isolation. RNA samples were used to conduct sample quality checks software. by BCM Genomic and RNA Profiling Core using the Nandrop ND-1000 and Agilent Bioanalyzer Nano Chip. RNA was amplified and labeled with Acknowledgements Cy-3 using Agilent Quick Amp Labeling Kit Protocol Version 6.5. Samples The authors would like to thank the following core laboratories and directors were hybridized to Agilent Sure Print 3 Mouse GE 8×60K Microarrays by ‘Genome-wide shRNA Screening C-BASS’, ‘Dan Liu’, ’Genomic and RNA the BCM Genomic and RNA Profiling Core. Data were quantile normalized, Profiling’, ‘Lisa White’, ‘Integrated Microscopy’ and ‘Michael Mancini’. The authors significantly regulated genes were identified by comparing Plk2+/+ with also thank Li-Yuan Yu-Lee for providing antibodies. Yiqun Zhang provided Plk2−/− using t-test and fold change. False Discovery Rate (FDR) was technical assistance with gene array analyses. We also thank Li-Yuan, Yu-Lee, Dan Medina, Kevin Roarty and Sarah Kurley for critical reading and editing of the estimated using the Storey method for the set of genes with nominal P<0.01, manuscript. Finally, we thank Maria Gonzalez-Rimbau and Alvenia Daniels for lab FDR was estimated at 27% (suggesting ~73% true positives) (Storey and management, and Shirley Small for mouse colony maintenance. Tibshirani, 2003). Data were further analyzed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) to identify Competing interests alterations in biological processes. All gene expression data has been The authors declare no competing financial interests. deposited in Gene Expression Omnibus (GEO) with accession number GSE50003. Author contributions E.V. conceived and performed experiments, and wrote the manuscript; E.B.K. performed experiments. A.N.S. performed experiments and edited the manuscript; Quantitative PCR C.J.C. performed statistical analysis; T.F.W. and J.M.R. contributed important +/+ −/− To validate microarray data RNA was isolated from Plk2 and Plk2 intellectual insight to the development of the study, provided funding for research mice. RNA was isolated using TRIzol (Life Technologies), treated with and wrote the manuscript. DNase using DNA-Free kit (Ambion) and reverse transcribed using the High Capacity RNA to cDNA kit (Applied Biosystems). qPCR was Funding performed on StepOnePlus Real Time PCR System (Applied Biosystems) C.J.C. was supported in part by the National Institutes of Health [NIH P30 CA125123]. This work was supported by the Komen Grant (J.M.R.) (SAC 110031) using SYBR Green as a marker for DNA amplification. Primers to PR and E.V. was supported by a Department of Defense Pre-doctoral Fellowship (mPRf-tgcacctgatctaatcctaaatga, mPRr-ggtaaggcacagcgagtagaa), Lef1 Award [W81XWH-11-1-0079]. Deposited in PMC for release after 12 months. (mLef1f-tcctgaaatccccaccttct, mLef1r-tgggataaacaggctgacct), Elf5 (mElf5f- ggacctagccaccacttgtc, mElf5r-atcagggggtcacagaagg), Plk2 (mPlk2f- Supplementary material catcaccaccattcccact, mPlk2r-tcgtaacactttgcaaatcca), Spc25 (mSPC25f- Supplementary material available online at tttccatgagcataaatgaagc, mSPC25r-gctgaaaaattgttggtcttcc) and Haus1 http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.108258/-/DC1 (mHAUS1f-aaagctgcagaggagcaact, mHAUS1r-atagtctgctcttttaactccgaga) were designed using Universal Probe Library program (Roche). Primers to References Andrysik, Z., Bernstein, W. Z., Deng, L., Myer, D. L., Li, Y. Q., Tischfield, J. A., Gapdh (mGAPDHf – ggagaaacctgccaagtatga, mGAPDHr-tcctcagtgtag - Stambrook, P. J. and Bahassi, M. (2010). The novel mouse Polo-like kinase 5 cccaaga) were obtained from Integrated DNA Technologies. All primer sets responds to DNA damage and localizes in the nucleolus. Nucleic Acids Res. 38, were tested for primer efficiency using a fivefold dilution series containing 2931-2943. Archambault, V. and Glover, D. M. (2009). Polo-like kinases: conservation and five dilutions. To determine relative levels of gene expression, we used the divergence in their functions and regulation. Nat. Rev. Mol. Cell Biol. 10, 265-275. ΔΔCT method. To further validate cell cycle-specific genes we used Spc25 Barr, F. A., Silljé, H. H. and Nigg, E. A. (2004). Polo-like kinases and the orchestration and Haus1 primer sets. RNA was isolated from MECs of ten individual mice of cell division. Nat. Rev. Mol. Cell Biol. 5, 429-441. (Plk2+/+ n=6 and Plk2−/− n=4) and utilized in microarray validation analysis. Beroukhim, R., Mermel, C. H., Porter, D., Wei, G., Raychaudhuri, S., Donovan, J., Barretina, J., Boehm, J. S., Dobson, J., Urashima, M. et al. (2010). The 18SrRNA (18SrRNAf-gagggagcctgagaaacgg, 18SrRNAr-gtcgggagtggg- landscape of somatic copy-number alteration across human cancers. Nature 463, taatttgc) was used as internal reference gene. The samples used for 899-905. Development

1570 RESEARCH ARTICLE Development (2014) doi:10.1242/dev.108258

Bowman, S. K., Neumüller, R. A., Novatchkova, M., Du, Q. and Knoblich, J. A. Liby, K., Wu, H., Ouyang, B., Wu, S., Chen, J. and Dai, W. (2001). Identification of (2006). The Drosophila NuMA Homolog Mud regulates spindle orientation in the human homologue of the early-growth response gene Snk, encoding a serum- asymmetric cell division. Dev. Cell 10, 731-742. inducible kinase. DNA Seq. 11, 527-533. Cheeseman, I. M., Hori, T., Fukagawa, T. and Desai, A. (2008). KNL1 and the CENP- Liu, Y., K. Marks, G. S. Cowley, J. Carretero, Q. Liu, T. J. Nieland, C. Xu, T. J. H/I/K complex coordinately direct kinetochore assembly in vertebrates. Mol. Biol. Cohoon, P. Gao, Y. Zhang et al. (2013). Metabolic and functional genomic studies Cell 19, 587-594. identify deoxythymidylate kinase as a target in LKB1 mutant lung cancer. Cancer Cho, J. H., Chang, C. J., Chen, C. Y. and Tang, T. K. (2006). Depletion of CPAP by Discov. 3, 870-879. RNAi disrupts centrosome integrity and induces multipolar spindles. Biochem. Ma, S., Charron, J. and Erikson, R. L. (2003). Role of Plk2 (Snk) in mouse Biophys. Res. Commun. 339, 742-747. development and cell proliferation. Mol. Cell. Biol. 23, 6936-6943. Cizmecioglu, O., Krause, A., Bahtz, R., Ehret, L., Malek, N. and Hoffmann, I. Mailleux, A. A., Overholtzer, M., Schmelzle, T., Bouillet, P., Strasser, A. and (2012). Plk2 regulates centriole duplication through phosphorylation-mediated Brugge, J. S. (2007). BIM regulates apoptosis during mammary ductal degradation of Fbxw7 (human Cdc4). J. Cell Sci. 125, 981-992. morphogenesis, and its absence reveals alternative cell death mechanisms. Dev. Debnath, J., Mills, K. R., Collins, N. L., Reginato, M. J., Muthuswamy, S. K. and Cell 12, 221-234. Brugge, J. S. (2002). The role of apoptosis in creating and maintaining luminal Matsumura, S., Hamasaki, M., Yamamoto, T., Ebisuya, M., Sato, M., Nishida, E. space within normal and oncogene-expressing mammary acini. Cell 111, 29-40. and Toyoshima, F. (2012). ABL1 regulates spindle orientation in adherent cells and Di Cosimo, S. and Baselga, J. (2010). Management of breast cancer with targeted mammalian skin. Nat. Commun. 3, 626. agents: importance of heterogeneity. [corrected]. Nat. Rev. Clin. Oncol. 7, 139-147. Matthew, E. M., Yen, T. J., Dicker, D. T., Dorsey, J. F., Yang, W., Navaraj, A. and El- Fleming, E. S., Temchin, M., Wu, Q., Maggio-Price, L. and Tirnauer, J. S. (2009). Deiry, W. S. (2007). Replication stress, defective S-phase checkpoint and increased Spindle misorientation in tumors from APC(min/+) mice. Mol. Carcinog. 48, 592- death in Plk2-deficient human cancer cells. Cell Cycle 6, 2571-2578. 598. Moraes, R. C., Chang, H., Harrington, N., Landua, J. D., Prigge, J. T., Lane, T. F., Gargiulo, G., Cesaroni, M., Serresi, M., de Vries, N., Hulsman, D., Bruggeman, S. Wainwright, B. J., Hamel, P. A. and Lewis, M. T. (2009). Ptch1 is required locally W., Lancini, C. and van Lohuizen, M. (2013). In vivo RNAi screen for BMI1 targets for mammary gland morphogenesis and systemically for ductal elongation. identifies TGF-β/BMP-ER stress pathways as key regulators of neural- and Development 136, 1423-1432. malignant glioma-stem cell homeostasis. Cancer Cell 23, 660-676. Nishi, Y., Rogers, E., Robertson, S. M. and Lin, R. (2008). Polo kinases regulate C. Glover, D. M., Hagan, I. M. and Tavares, A. A. (1998). Polo-like kinases: a team that elegans embryonic polarity via binding to DYRK2-primed MEX-5 and MEX-6. plays throughout mitosis. Genes Dev. 12, 3777-3787. Development 135, 687-697. Grimm, S. L., Seagroves, T. N., Kabotyanski, E. B., Hovey, R. C., Vonderhaar, B. Pan, C., Yan, M., Yao, J., Xu, J., Long, Z., Huang, H. and Liu, Q. (2008). Aurora K., Lydon, J. P., Miyoshi, K., Hennighausen, L., Ormandy, C. J., Lee, A. V. et al. kinase small molecule inhibitor destroys mitotic spindle, suppresses cell growth, and (2002). Disruption of steroid and prolactin receptor patterning in the mammary gland induces apoptosis in oral squamous cancer cells. Oral Oncol. 44, 639-645. correlates with a block in lobuloalveolar development. Mol. Endocrinol. 16, 2675- Pease, J. C. and Tirnauer, J. S. (2011). Mitotic spindle misorientation in cancer—out 2691. of alignment and into the fire. J. Cell Sci. 124, 1007-1016. Harris, J. R. (2010). Diseases of The Breast. Philadelphia, PA: Lippincott Williams & Perou, C. M., Sørlie, T., Eisen, M. B., van de Rijn, M., Jeffrey, S. S., Rees, C. A., Wilkins. Pollack, J. R., Ross, D. T., Johnsen, H., Akslen, L. A. et al. (2000). Molecular Humphreys, R. C., Krajewska, M., Krnacik, S., Jaeger, R., Weiher, H., Krajewski, portraits of human breast tumours. Nature 406, 747-752. S., Reed, J. C. and Rosen, J. M. (1996). Apoptosis in the terminal endbud of the Simmons, D. L., Neel, B. G., Stevens, R., Evett, G. and Erikson, R. L. (1992). murine mammary gland: a mechanism of ductal morphogenesis. Development 122, Identification of an early-growth-response gene encoding a novel putative protein 4013-4022. kinase. Mol. Cell. Biol. 12, 4164-4169. Inglis, K. J., Chereau, D., Brigham, E. F., Chiou, S. S., Schöbel, S., Frigon, N. L., St Johnston, D. and Ahringer, J. (2010). Cell polarity in eggs and epithelia: parallels Yu, M., Caccavello, R. J., Nelson, S., Motter, R. et al. (2009). Polo-like kinase 2 and diversity. Cell 141, 757-774. (PLK2) phosphorylates alpha-synuclein at serine 129 in central nervous system. J. Storey, J. D. and Tibshirani, R. (2003). Statistical significance for genomewide Biol. Chem. 284, 2598-2602. studies. Proc. Natl. Acad. Sci. USA 100, 9440-9445. Iorns, E., Ward, T. M., Dean, S., Jegg, A., Thomas, D., Murugaesu, N., Sims, D., Sun, S. C., Lee, S. E., Xu, Y. N. and Kim, N. H. (2010). Perturbation of Spc25 Mitsopoulos, C., Fenwick, K., Kozarewa, I. et al. (2012). Whole genome in vivo expression affects meiotic spindle organization, chromosome alignment and spindle RNAi screening identifies the leukemia inhibitory factor receptor as a novel breast assembly checkpoint in mouse oocytes. Cell Cycle 9, 4552-4559. tumor suppressor. Breast Cancer Res. Treat. 135, 79-91. Sun, T., Aceto, N., Meerbrey, K. L., Kessler, J. D., Zhou, C., Migliaccio, I., Nguyen, Jonassen, J. A., San Agustin, J., Follit, J. A. and Pazour, G. J. (2008). Deletion of D. X., Pavlova, N. N., Botero, M., Huang, J. et al. (2011). Activation of multiple IFT20 in the mouse kidney causes misorientation of the mitotic spindle and cystic proto-oncogenic tyrosine kinases in breast cancer via loss of the PTPN12 kidney disease. J. Cell Biol. 183, 377-384. phosphatase. Cell 144, 703-718. Kingsley-Kallesen, M., Mukhopadhyay, S. S., Wyszomierski, S. L., Schanler, S., Tanaka, T. U. and Desai, A. (2008). Kinetochore-microtubule interactions: the means Schütz, G. and Rosen, J. M. (2002). The mineralocorticoid receptor may to the end. Curr. Opin. Cell Biol. 20, 53-63. compensate for the loss of the glucocorticoid receptor at specific stages of mammary Warnke, S., Kemmler, S., Hames, R. S., Tsai, H. L., Hoffmann-Rohrer, U., Fry, A. M. gland development. Mol. Endocrinol. 16, 2008-2018. and Hoffmann, I. (2004). Polo-like kinase-2 is required for centriole duplication in Kouros-Mehr, H. and Werb, Z. (2006). Candidate regulators of mammary branching mammalian cells. Curr. Biol. 14, 1200-1207. morphogenesis identified by genome-wide transcript analysis. Dev. Dyn. 235, 3404- Weigman, V. J., Chao, H. H., Shabalin, A. A., He, X., Parker, J. S., Nordgard, S. H., 3412. Grushko, T., Huo, D., Nwachukwu, C., Nobel, A. et al. (2012). Basal-like Breast Krastev, D. B., Slabicki, M., Paszkowski-Rogacz, M., Hubner, N. C., Junqueira, M., cancer DNA copy number losses identify genes involved in genomic instability, Shevchenko, A., Mann, M., Neugebauer, K. M. and Buchholz, F. (2011). A response to therapy, and patient survival. Breast Cancer Res. Treat. 133, 865-880. systematic RNAi synthetic interaction screen reveals a link between p53 and Westbrook, T. F., Martin, E. S., Schlabach, M. R., Leng, Y., Liang, A. C., Feng, B., snoRNP assembly. Nat. Cell Biol. 13, 809-818. Zhao, J. J., Roberts, T. M., Mandel, G., Hannon, G. J. et al. (2005). A genetic Lapidus, R. G., Nass, S. J. and Davidson, N. E. (1998). The loss of estrogen and screen for candidate tumor suppressors identifies REST. Cell 121, 837-848. progesterone receptor gene expression in human breast cancer. J. Mammary Gland Winkles, J. A. and Alberts, G. F. (2005). Differential regulation of polo-like kinase 1, 2, Biol. Neoplasia 3, 85-94. 3, and 4 gene expression in mammalian cells and tissues. Oncogene 24, 260-266. Lawo, S., Bashkurov, M., Mullin, M., Ferreria, M. G., Kittler, R., Habermann, B., Xu, D. R., Huang, S., Long, Z. J., Chen, J. J., Zou, Z. Z., Li, J., Lin, D. J. and Liu, Q. Tagliaferro, A., Poser, I., Hutchins, J. R., Hegemann, B. et al. (2009). HAUS, the (2011). Inhibition of mitotic kinase Aurora suppresses Akt-1 activation and induces 8-subunit human Augmin complex, regulates centrosome and spindle integrity. Curr. apoptotic cell death in all-trans retinoid acid-resistant acute promyelocytic leukemia Biol. 19, 816-826. cells. J. Transl. Med. 9, 74. Development

1571