Chain Locus Heavy Genomic Organization of the Variable

Home , Genomic organization

Antibody Repertoire Development in Fetal and Neonatal Piglets. XI. The Relationship of Variable Heavy Chain Gene Usage and the Genomic Organization of the Variable Heavy This information is current as Chain Locus of September 27, 2021. Tomoko Eguchi-Ogawa, Nancy Wertz, Xiu-Zhu Sun, Francois Puimi, Hirohide Uenishi, Kevin Wells, Patrick Chardon, Gregory J. Tobin and John E. Butler J Immunol published online 5 March 2010 Downloaded from http://www.jimmunol.org/content/early/2010/03/05/jimmun ol.0903616 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2010/03/05/jimmunol.090361 Material 6.DC1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/190/3/1383.full.pdf

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published March 5, 2010, doi:10.4049/jimmunol.0903616 The Journal of Immunology

Antibody Repertoire Development in Fetal and Neonatal Piglets. XI. The Relationship of Variable Heavy Chain Gene Usage and the Genomic Organization of the Variable Heavy Chain Locus

Tomoko Eguchi-Ogawa,* Nancy Wertz,† Xiu-Zhu Sun,† Francois Puimi,‡ Hirohide Uenishi,* Kevin Wells,x Patrick Chardon,‡ Gregory J. Tobin,{ and John E. Butler†

In this study, we have mapped the 39 H chain V region (VH) genes and those in the H chain diversity, H chain joining, and 59 portion of

the H chain constant locus. We show that swine possess only two functional H chain diversity segments and only one functional H chain Downloaded from joining segment. These data help to explain more than a decade of observations on the preimmune repertoire of this species and reveal the vulnerability of swine to natural or designed mutational events. The results are consistent with earlier studies on the region containing Enh, Cm, and Cd while revealing that the ancestral IgG3 is the most 59 Cg gene. We also observed a recent duplication

(∼1.6 million years ago) in the VH locus that contains six of the seven VH genes that comprise 75% of the preimmune repertoire. Because there are no known transfers of immune regulators or Ags that cross the placenta as in mice and humans, fetal VH usage must be intrinsically regulated. Therefore, we quantiﬁed VH usage in fetal piglets and demonstrated that usage is independent of the http://www.jimmunol.org/ position of VH genes in the genome; the most 39 functional VH gene (IGHV2) is rarely used, whereas certain upstream genes (IGHV14 and IGHV15) are predominately used early in fetal liver but seldom thereafter. Similar to previous studies, three VH genes account for 40% of the repertoire and six for ∼70%. This limited combinatorial diversity of the porcine VH repertoire further emphasizes the dependence on CDR3 diversity for generating the preimmune Ab repertoire of this species. The Journal of Immunology, 2010, 184: 000–000.

he H chain Ig variable locus is organized similarly in all functional, whereas 27 DH segments can be expressed, but only six of by guest on September 27, 2021 mammals that have been studied. As few as 12 to .1000 H the nine JH segments are functional (2, 4). The VH genes of verte- T chain V region (VH) genes are thought to be arrayed 59 of brates belong to different families that have been grouped into three multiple H chain diversity (DH) segments that in turn are found 59 of clans based on sequence homologies (5). There are large differences up to nine H chain joining (JH) segments (1, 2). VH genes charac- in the number of VH genes and VH gene families among species. In terized to date include many pseudogenes (3), such as those with swine, ,30 genes have been described, all belonging to the ancestral nonconsensus signal sequences, stop codons, frameshift mutations, VH3 family (6, 7) and have identical or nearly identical framework or the absence of functional leader sequences. In humans, for ex- regions but differ in their CDR1 and CDR2 regions (8, 9). However, ample, only 38–46 of the .100 VH genes (haplotype dependent) are CDR regions are often shared among different porcine VH genes, suggesting they could be a consequence of gene duplication com- bined with a type of genomic gene conversion (10, 11). † *National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, Japan; Department The distribution of V gene segment usage in fetal and newborn of Microbiology, University of Iowa, Iowa City, IA 52242; ‡National Institute for Agro- H nomic Research, Institute of Molecular Biology, Jouy-en-Josas, France; xDivision of mice, humans, rabbits, and swine is nonrandom, and usage patterns { Animal Sciences, University of Missouri, Columbia, MO 65211; and Biological Mim- vary during ontogeny. In the fetal liver of mice, members of the VH5 etics, Frederick, MD 21702 and VH2 families (especially 7183 and Q52, respectively) are Received for publication November 11, 2009. Accepted for publication February 1, preferentially used (12, 13), but after birth, splenic B cells use the 2010. VH1 family (J558) (14). The VH2 and VH5 family genes are the most This work was supported by National Science Foundation-Integrative Organismal Systems Grant 15203800 and Grant 58-1265-5-053 from the National Pork Board 39 in the locus, whereas the J558 family is midway (more 59) in the and subaward C080090-UI from Biological Mimetics. locus, suggesting that VH usage in the preimmune repertoire favors The sequences presented in this article have been submitted to GenBank under 39 VH genes but that usage shifts upstream, presumably due to ex- accession numbers AB513624 and AB513625. posure to environmental Ag because this shift does not occur in Address correspondence and reprint requests to Dr. John E. Butler, Interdisciplinary germ-free mice (14, 15). A preferential usage of the most JH prox- Immunology Program, Department of Microbiology, University of Iowa, 51 Newton imal V 3 family genes has also been reported in humans (16, 17). Road, Iowa City, IA 52242. E-mail address: [email protected] H Early V usage in rabbits favors the most 39 V gene (V 1) in 90% The online version of this article contains supplemental material. H H H of VDJ rearrangements, but this preferential usage declines during Abbreviations used in this paper: BAC, bacterial artiﬁcial chromosome; CH, H chain development and with exposure to environmental Ag (18). How- constant; DG, day of gestation; DH, H chain diversity; FR, framework region; IMGT, ImMunoGeneTics; IPP, ileal Peyer’s patches; JH, H chain joining; LINE, long in- ever, developmental repertoire changes in rabbits are compounded terspersed nucleotide element; RSS, recombination signal sequence; VH, H chain V by somatic gene conversion, a phenomenon rarely seen in mice (19). region. The pattern of preferential usage of 39 VH genes is not supported in Copyright Ó 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00 all studies. In humans, V3-23 and V3-30 are preferentially used in the

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0903616 2 VH USAGE AND GENOME ORGANIZATION

preimmune repertoire, but these map to the middle of the locus (20). region of the H chain locus that includes 15 DH proximal VH genes Alternatives to the locus position concept include: 1) negative se- and the 59 portion of the H chain constant (CH) genome. Our map lection for B cells utilizing VH genes that recognize certain self-Ags; shows that swine possess only one functional JH gene segment, ap- 2) positive selection for B cells by stromal ligands based on features parently two functional DH segments, and that preferential VH usage of their BCR; and 3) the evolutionary conservation of BCRs bearing in primary B cell tissues of fetal animals cannot be explained as VH genes that encode binding sites that recognize bacteria that a stochastic process dependent on the location of VH genes in the threaten the newborn. The basis for 2) and 3) above could be the same. locus. In contrast, the dominant early expression of porcine IgG3 in For example, human V3-23, mouse VH283 (a VH2 family gene), and late-term fetuses in an organ believed to develop an Ag-independent shark VH genes share .80% sequence similarity at the protein level repertoire appears correlated with its position in the H chain C region (7, 21) and encode BCRs that are polyreactive and recognize bacterial of the locus. polysaccharides (22). In humans and mice, such Abs are often associated with IgG3 (23, 24) and class switch that occurs in the ab- Materials and Methods sence of environmental Ag (25, 26) and in CD40/CD40L-deficient Nomenclature mice (27). In swine, IgG3 expression accounts for .60% of the total The porcine VH genes were originally named according to their order of IgG expression in the ileal Peyer’s patches (IPP) of fetal piglets discovery and given vernacular names like VHA and VHB (Table I) (9). (28). The IPP of swine is the anatomical homolog of the IPP of sheep, The intention was that once their location in the genome was known, the nomenclature would be changed to the familiar VH1, VH2, etc., system or in which Ab repertoire development is considered to be Ag-in- the ImMunoGeneTics (IMGT) system (IGHV1, IGHV2). In this report, we dependent (29). In both the human and mouse genome, IgG3 is the have maintained the vernacular nomenclature in certain cases and used it in most Cd proximal functional Cg gene (reviewed in Refs. 30, 31). parenthesis in the text. Both the vernacular and IMGT system are used in Downloaded from In contrast to rabbits, mice, and humans, fetal piglets present Table II. Because the IMGT system contains an unfortunate redundancy (IGHD is used for both IgD and DH diversity segments), we have used the a different pattern offetal/neonatal development that could affect VH conventional Cm,Cd, and Cg for CH regions. gene usages. In swine, there is no known protein transfer from mother to fetus including Igs (32–34). Because maternal Igs can Screening of bacterial artificial chromosome clones and influence fetal immune responses (35, 36) and presumably B cell construction of bacterial artificial chromosome contigs

selection and development, usage of certain VDJ rearrangements is All bacterial artificial chromosome (BAC) clones were isolated from http://www.jimmunol.org/ independent of this influence in fetal piglets. Although it is known a genomic library constructed by using a Large White boar resulting from that certain porcine viruses can cross the placenta, the mechanism intrafamilial matings at Institute Nationale Recherche Agronomique (Jouy en Josas, France) (42). BAC clones containing the porcine IGHV, IGHD, remains unknown. In any case, our studies on VDJ usage in fetal and IGHJ regions and 59 IGHC genes (Cm,Cd,Cg3, and Cg5) were piglets were done in animals free of all detectable viral pathogens. identified by using a PCR-based screening system. Selected BAC clones Offspring of swine are precosial and routinely reared in isolators were cultured overnight in Luria-Bertani broth containing 12.5 mM separate from their mothers, allowing the experimenter to control chloramphenicol. BAC clones 850A09 and 747A01 that hybridized with polynucleotide probes specific for VH genes, JH, and Cm (Table I) were environmental factors that might influence the development of selected for further study. DNA from relevant clones was extracted with adaptive immunity (37). In swine, VH,DH, and JH usage is highly a Qiagen Plasmid Midi Kit (Qiagen, Hilden, Germany). restricted. In the expressed preimmune repertoire, four to seven V by guest on September 27, 2021 H Sequencing of BAC clones genes account for 75–95% of the repertoire (9, 38) (Table I). Al- BAC DNAs were extracted by using a Qiagen Large Construction Kit though the mechanism is unknown, swine use only a single JH and two D segments to generate their preimmune Ab repertoire (38– (Qiagen). The DNAwere cleaved into 2- to 4-kb fragments by sonication and H then subcloned into the plasmid vector pUC118 (Takara, Otsu, Japan) at the 40). We believed these observations might be better understood by HincII site to construct a shotgun library. The inserts obtained were se- mapping the VH,DH, and JH loci of swine. We were especially quenced by an ABI 3730xl sequencer with a Big Dye Terminator version 3 interested to know if the predominant use of a few VH genes in the cycle sequencing kit (Applied Biosystems, Foster City, CA) using universal preimmune repertoire was confined to those at the 39 end of the V primers annealing to vector sequences. Sequence data were processed with H Phred base caller and assembled with Phrap (CodonCode, Dedham, MA) (43, locus as reported in rabbit, mouse, and some human studies. 44). Compiled sequences of the two BAC clones have been uploaded in We describe in this study the characterization of a 229-kb segment GenBank (AB513624 and AB513625). Restriction enzyme digestion was of swine chromosome 7 containing the VH-DH-JH-Cm-Cd and 59 Cg performed to confirm the sequence assembly. BAC clones were digested

Table I. Probe sequences used to identify common porcine VH genes, JH, and Cm

Probe Sequence for CDR1 Probe Sequence for CDR2

VH Gene CDR1 CDR2 39 FR1 CDR1 59 F2 39 F2 CDR2

VHAAACAGT AGTACCTACATTAAC T TGGCA GCTATTAGTACTAGT VHBBB GACAACGCTTTCAGC TGG GCCATTGCTAGTAGTGAC VHGGETTCAGT AGTTATAGCATGGAGC GGTATTGATAGTGGTAGTTA VHEEETCAGT AGTTATGCAGTGAGC T GGTATTGATAGTGGTAGTTA VHFFFGT AGTTATGGCGTAGGC TGG TCTATTGGTAGTGGTA VHCCCGT AGTTATGAAATCAGC TG GGTATTTATAGTAGTGGTAG VHZECTCAGT AGTTATGCAGTGAGC T GGTATTTATAGTAGTGGTAG VHYCAGT AGTTATGAAATCAGC TG TGGCA GCTATTAGTACTAGT VHA* A A AGAGACAACTCCCAGAACACG FR3 Pan CGCCAGGCTCCAGGGAAG FR2 JH TGAGGACACGACGACTTCAA JH Cm GCACATGCCGCTCGTGTA CH4

Columns labeled CDR1 and CDR2 list the vernacular designation used in the laboratory for the porcine VH genes (see also Table II). The upstream VHA (IGHV10) is designated as VHAp and requires a special probe that binds in the FR3 region for identification. Detection of VHN requires a combination of the probes described in Table I. This method of recognition was confirmed by sequence analysis. The Journal of Immunology 3 with HindIII, PvuI, or FspI, and the fragment sizes were compared with respectively, as previously described (9, 39, 40). The VDJs recovered by ` those predicted by a Genetyx sequence editor (Genetyx, Tokyo, Japan). PCR were cloned into pCRO4-TOPO (Invitrogen), and 632 clones from The numberof IGHV genes contained in the BAC cloneswas confirmed by fetal liver and 432 from bone marrow transcripts were then sequentially PCRmethodsusingeachBACcloneDNAasatemplate.EachIGHVgenewas hybridized with polynucleotide probes specific for the CDR1 and CDR2 amplified using a primer set annealing to sequences in 59 framework region regions of the most common porcine VH genes (9, 39) (Table I). These (FR) 1 (59-GAGGAGAAGCTGGTGGAGT-39) and 39 FR3 (59-GCCGTG- clones were also hybridized with a pan-specific FR2 probe to identify all TCTTCGGTTCTCA-39) that are common to all known porcine VH genes clones with a plasmid containing a VDJ insert (Table I). except VHB. To amplify the VHB, 59 FR1 (59-GAGGAGAAGCTGGTGG- AGT-39) and FR3R IGHVB (59-GCCGTGTCTTCGGTTCTGA-39) were Statistical analysis used. The products were cloned into the TOPO 2.1 vector (Invitrogen, V usage was complied in Excel spreadsheets (Microsoft, Redmond, WA) Carlsbad, CA). More than 80 clones were selected at random from each PCR H and displayed as proportional usage (mean and SD) in GraphPad Prism product for sequence analysis. (GraphPad, San Diego, CA). Mean differences were compared by Student t Analysis of mapping data test routines embedded in the Prism program (GraphPad). Sequence similarity was examined using the BLAST2 program (45) (www. Results ncbi.nlm.nih.gov/BLAST/bl2seq/wblast2.cgi), and interspersed repetitive sequences in the pig genome were detected by using RepeatMasker (A. Smit Genomic structure of the region containing porcine IGHD, and P. Green, unpublished observations; www.repeatmasker.org/) with IGHJ, and the 39 IGHV genes Repbase (46) (www.girinst.org/repbase/index.html). Homologous regions between genomic sequences were identified by using the PipMaker program WescreenedseveralBACclonescontainingIGHDandIGHJsegments (47). Sequence alignment and phylogenetic analysis were performed by the byPCRtoidentifyclonesthatencompassthefulllocus.Clone851A09 CLUSTALW (1.83) program (48). The detected IGHV genes were analyzed contained 118,088 bp with sequences from the IGHD3 segment to Downloaded from by the BLAST program with public nucleotide databases (DNA Data Bank IGHV15. Clone747A01 overlapped 851A09 by ∼29.6 kbp and en- . of Japan, EMBL, and GenBank). Only sequences that showed 98% compassed IGHG2 through IGHV1P (Fig. 1). Together the two identity to previously identified porcine IGHV sequences were adopted. clones represent 229,148 bp of genomic sequence. The two BAC Quantitation of VH gene usage in fetal liver and late-gestation clones were subjected to shotgun sequencing as described in Mate- bone marrow rials and Methods. The sequence overlap between 747A01 and 851A09 was 100% homologous, indicating that they were derived

DNA from fetal liver at 30 d of gestation (DG30) from four piglets each http://www.jimmunol.org/ from four unrelated gilts and RNA from the bone marrow of ﬁve fetuses at from the same allele. By analyzing open reading frames and using DG95 were used to recover VDJ rearrangement from DNA and cDNA, BLASTagainst GenBank sequences, we identiﬁed15 IGHV,4 IGHD, by guest on September 27, 2021

FIGURE 1. Genomic structure of the porcine Ig H chain region encompassing Cg5 to IGHV15. SP6 and T7 denote primer sites located in the vector that flank the cloning site and assist in determining the orientation of the BAC clones. The putative coding sequence (CDS) and the switch region of IgM (Sm) are indicated by black boxes and a gray oval, respectively. Genes in which exon 1 was collapsed or contained stop codon(s) in the V segment are regarded as pseudogenes and are indicated by P. The enhancer region is indicated by a white circle, the position of which was estimated in a previous study (49). Restriction sites of HindIII, PvuI, and FspI are shown in the lower part of the figure. Numbers indicate the sizes of the BAC clone fragments generated by digestion with each enzyme. Bars below the gene map indicate the region of gene duplication. Both the IMGT and vernacular nomenclatures for VH genes are given. The familiar names of isotypes have been used because the IMGT does not distinguish between IGHD (IgD) and IGHD (diversity segment). 4 VH USAGE AND GENOME ORGANIZATION and 5 IGHJ gene segments as well as the constant regions of IgM (Cm) amplify the pig IGHV segments. The fragments obtained from ge- and IgD (Cd) and the two most 59 IgG genes (Cg3andCg5) (Fig. 1, nomic DNA were identical to VH genes previously reported for this Tables II–IV). The sequence of the switch region and C region of IgM species (9, 40). This, along with our restriction analysis (Fig. 1), in- had been reported previously (49); this sequence had a high level of dicates that the assembly process had been performed correctly. identity to the sequence determined in this study, showing that these Among the VH segments detected, exon 1 and a part of exon 2 were sequences were derived from the same region in the locus. collapsed in 4 of the 15 IGHV genes (IGHV3, IGHV7, IGHV9, and Previous studies showed that functionally rearranged VDJs used IGHV13), suggesting they are pseudogenes. The IGHV gene located only two IGHD segments and a single IGHJ segment (38, 40). on the 39-most side (IGHV1) had a stop codon in exon 2, indicating Although only transcripts carrying IGHD1, IGHD2, and IGHJ5 are that it was also a pseudogene, confirming a previous observation (40). in the public databases, we identified four IGHD segments and five IGHJ segments. The porcine genomic locus carrying the IGHD and VHA and VHB were highly expressed in newborn piglets and IGHJ genes was much shorter than its human counterpart (9 IGHJ were duplicated in the porcine genome sequence and 27 IGHD are detected in the corresponding region of the human We found a large degree of duplication in the porcine genomic se- genome: NT_026437.11, 86930000 to 87630000). In the case of JH, quencecarryingIGHV9PtoIGHV14withthatcontainingIGHV3Pto only reading frame III of IGHJ5 translates to the sequence of the IGHV8 (Supplemental Fig. 1). Repetitive sequences interspersed only expressed JH region of swine (38); IGHJ1, IGHJ2, and IGHJ4 around IGHV4 to IGHV6 were also highly conserved with those have noncanonical heptamer sequences (Table IV). A sequence around IGHV10 to IGHV12 (Fig. 2). We analyzed the duplication encoded by IGHJ3 has yet to be found in a rearranged or expressed event in the IGHV region by using repetitive sequences. As shown in VDJ, although its recombination signal sequence (RSS) seems Fig. 2B, the repetitive units include long interspersed nucleotide el- Downloaded from functional, and no stop codons are present. ement (LINE) sequences such as L1_Art and L1_BT. We used the Analysis of the DH shows that IGHD1 (DHA) and IGHD2 (DHB) excised sequences of the respective LINEs (commonly conserved have canonical RSSs, whereas both the heptamer and nonamer of among the sequences) to demonstrate that L1_Art and L1_BT are IGHD3 are noncanonical (Table III). The RSS of IGHD4 should highly conserved between the two repetitive IGHV units in com- be functional, but if expressed, the tiny segment it encodes (3 aas) parison with the others (Fig. 2C). The excised L1_BT sequences could be easily overlooked in a region where TdT-dependent derived from the two repetitive units [L1_BT (a) and L1_BT (c)] http://www.jimmunol.org/ nucleotide additions are common and exonucleases are active. (135 bp) were completely identical, which implied that the two re- The 15 IGHV genes found in the sequence had very homologous petitive units were established recently. We estimated the divergence sequences. Because of this, reads could be misassembled following time of the repetitive units by using L1_Art because the length of shotgun sequencing. Thus, we cloned the PCR fragments generated conserved regions was much longer (.800 bp) than that of L1_BT. It from clones 851A09 and 747A01 using the primer commonly used to revealed that L1_Art (b) and L1_Art (d) in Fig. 2B were diverged

Table II. IgH genes identiﬁed from the genome sequence determined in this study by guest on September 27, 2021

IMGT Vernaculara No. of Exons Start End CDS Length (bp) Comment

IGHV15 VHN 2 3032 3473 353 IGHV14 VHY 2 9306 9747 353 IGHV13P 1 12,154 12,366 213 Exon 1 and part of exon 2 were collapsed IGHV12 VHB* 2 15,678 16,126 359 IGHV11 VHF 2 27,618 28,065 359 IGHV10 VHA* 2 34,235 34,676 353 IGHV9P 1 37,094 37,306 213 Exon 1 and part of exon 2 were collapsed IGHV8 VHE 2 42,141 42,589 359 IGHV7P 1 45,002 45,214 213 Exon 1 and part of exon 2 were collapsed IGHV6 VHB 2 48,526 48,974 359 IGHV5 VHT 2 60,198 60,645 359 IGHV4 VHA 2 66,808 67,249 353 IGHV3P 1 69,661 69,873 213 Exon 1 and part of exon 2 were collapsed IGHV2 VHG 2 76,020 76,470 359 IGHV1P Psg 2 2 90,845 91,288 352 Stop codon in exon 2 IGHD1 DHA 1 108,609 108,646 38 IGHD2 DHB 1 109,219 109,246 28 IGHD3 1 113,937 113,973 37 IGHD4 1 131,317 131,327 11 IGHJ1 1 132,104 132,157 54 IGHJ2 1 132,277 132,329 53 IGHJ3 1 132,587 132,634 48 IGHJ4 1 132,979 133,029 51 IGHJ5 JH5 1 133,523 133,576 54 Smb 135,726 139,170 3445 IGHM IgM (Cm) 4 139,705 141,406 1216 IGHD IgD (Cd) 5 147,270 152,588 1060 IGHG1 IgG3c (Cg3) 4 188,628 190,144 1001 IGHG2 IgG5bd (Cg5) 4 209,664 211,155 974

a VH gene names were classiﬁed according to CDR1 and CDR2 sequence speciﬁcities (9). The vernacular terminology is based on order of discovery, whereas the IMGT system is based on the position in the genome as shown in Fig. 1. bSwitch region for IgM cIgG nomenclature based on recent studies of Butler et al. (41). dIgG5b is an allele of IgG5 (41). Psg, pseudogenes discovered in genomic DNA prior to mapping studies (see Ref. 9). The Journal of Immunology 5

from each other ∼1.6 million y ago. This calculation is based on the estimated mutation rate in pseudogenes: 4.6 3 1029 (50). Evidence for recent duplication of the IGHV region is further supported by the observation of conserved HindIII and PvuI re- 9-mer striction fragments in Fig. 1. This duplication unit contained the ACAAAAACC GCAAAAACC duplicated VHA and VHB genes, which, along with VHC and VHE, comprise .75% of the preimmune repertoire in piglets (39). The exon-intron structures of the detected VHA and VHB genes were also conserved, perhaps a clue that these genes are important in generating the Ab repertoire. 12-mer VH gene usage in primary lymphoid tissues at DG30 and DG95

Fig. 3 summarizes VH usage in VDJ rearrangement in 632 clones from DG30 fetal liver and 432 cloned transcripts from DG95 bone marrow. VH genes are ordered on the x-axis according to their position in the locus, 39 to 59 (Fig. 1, Table II). The results conﬁrm 7-mer earlier ﬁndings that IGHV4, IGHV6, IGHV10, and IGHV12 CACAGCA TCACAGCGCCCT CACAGTG ACAGACCCGGTG CACAGTG ACTGACCAAACT CCCGGCCAG CACAGCA GGGCCTTGGAAC TGCAGAAAC dominate the early repertoire (∼30%) but also show that IGHV14

(VHY) and IGHV15 (VHN) play an equally dominant role at Downloaded from DG30. Noteworthy is that the ﬁrst functional VH gene IGHV2 (VHG) (Fig. 1) is seldom used. Thus, early usage in a primary lymphoid tissue cannot be ascribed to the position of the VH genes in the locus. In older fetuses (i.e., DG95), usage of IGHV14 and IGHV15 nearly disappears, whereas VHC and both IGHV4 (VHA)

and IGHV10 (VHA*) are signiﬁcantly increased. VH usage at http://www.jimmunol.org/ DG95 DNA rearrangements or transcripts from bone marrow, IPP, and spleen does not signiﬁcantly differ (J. E. Butler, X. Z. Sun, N. Wertz, K. M. Lager, and G. Tobin, unpublished observations). These data reject the notion that VH usage during development follows a continuous progression of V usage from 39 to 59.In

LL ** H * GPSWL both DG30 liver and DG95 bone marrow, usage of unidentiﬁed V RL H * * genes (UNK) does not change. Previous studies (9) indicate that

LWC many VDJ clones identiﬁed as UNK in conventionally reared Sequence and Deduced Amino Acid Sequence by guest on September 27, 2021 * RLL young pigs use the same common genes that account for 70% of AHSPEAPAGW *

* the preimmune repertoire (Fig. 3) but have mutated CDRs so they L * TGACTATAGCGGTTGCTATAGCGGTTAC GAATTGCTATAGCTATGGTGCTAGTTGCTATGATGACC CGGCTGAGCGCACAGCCCTGAGGCCCCAGCTGGCTGG CACAGTG ACAGACCCGGTG GCAAAAACC CTCACCGGGAC CTCACCGGGAC no longer hybridize with gene-specific probes (Table I). This low frequency of somatic hypermutation occurs in utero in the com- plete absence of environmental Ag stimulation, although there is no accumulation of mutations in CDR regions as is the case in Ag- ILTG IELL I IRLSAQP ILTG II S P G II NCYSYGASCYDD II G II D Y S G C Y S G Y II S P G III H R D III IAIAMVLVAMMT III A E R T A L R P Q L A III T I A V A I A V III H R D stimulated piglets (S. Bratsch, N. Wertz, T. Kunz, and J.E. Butler, unpublished observations). As indicated above, Enh, Cm, and Cd map to the same region as previously described (40, 51). Among the six Cg subclasses and eleven allotypes (41), Cg3 and Cg5 are the most Cd proximal C region genes. 7-mer Reading Frame CACTGTG CACTGTG CACAGTG Discussion We present the first partial map of the porcine H chain locus that covers the 59 portion of the CH region, JH region, DH region, and the first 15 of the most 39 VH genes. These results confirm previous data on Cm and Cd (51) and Sm and Cm (49). Data presented in this study 12-mer also explain .15 y of observations that swine express only two DH segments, IGHD1, formally called DHA, and IGHD2, formally called DHB (40). Our mapping data also explain why swine only express a single JH sequence (38). Evidence that only IGHJ5 (JH5) is functional has recently been confirmed in studies in which this segment was mutated, resulting in B cell knockout piglets (M.

9-mer Mendicino, J. Ramsoondar, C. Phelps, T. Vaught, S. Ball, T. LeR- genes detected in this study GGTTTGAGA ACGGGCCTGTGG GCTTTTTGC CAAGGCCTTTCC CGGCCGACC TGAAGCCTCCGT GCCTGTG GCTTGGGC CGAGCCAGGAAC oith, J. Moonahan, S. Chen, A. Dandro, J. Boone, P. Jobst, A. Vance, N. Wertz, Z. Bergman, X-Z Sun, I. Polejaeva, J. Butler, Y. Dai, D. Ayares, and K. Wells, personal communication). Collectively, the map and sequence data we provide for DH,JH,Sm,Cm, and Cd are Gene Stop codon. IGHD1 IGHD3 IGHD2 IGHD4

Canonical heptamers and nonamers* are underlined. consistent with earlier partial mapping studies (49, 51) and explain

Table III. IGHD why swine express only two DH segments and a single JH (38, 40). 6 VH USAGE AND GENOME ORGANIZATION

The partial map of the VH locus identified the same major VH genes that our previous studies had identified (9, 39, 40) (Table II). When the location of particular genes in the locus (e.g., IGHV4, IGHV15, and IGHV2) is compared with their proportional usage, there is no positive correlation between position and usage (Fig. 3). This sharply differs from the situation in rabbits, in which the most 39 VH gene is used in ∼90% of early rearrangements (18), or in mice, in which 7183 and Q52 dominate early VH usage (12, 13), and IGHV5 and IGHV6 are dominant in humans (17). In fact, IGHV2 is seldom used in swine at any time in development (Fig. 3) (J. E. Butler, X. Z. Sun, N. Wertz, L. M. Lager, and G. Tobin, unpublished observations). Our findings are more consistent with the studies by the Milner group that selective usage is seen at all stages of development (20). The much higher level of control of factors that might influence Ab repertoire development during fetal life in piglets argues that the pattern of VH usage that we observed is intrinsic and therefore

Sequence and Deduced Amino Acid Sequence may differ from earlier studies in mouse and human fetuses. The

mapping studies provided in this paper eliminate gene position as Downloaded from an explanation for VH,DH, and JH expression. Although it is a mistake to extrapolate data from one mammal to another, our ﬁndings and the controversy in the literature make us skeptical of ACAACGGGCTCGAAAGCTGGGGCCAGGGGACCCTAGTCTACGACGCCTCGG GCCATGGCTACTTAGATTCGTGGGGCCAGGGCATCCTGGTCACCGTCTCCTCAG ACCATCTTCACAGCTGGGGCCGAGGAGTCGAGGTCACCGTCTCCTCAG ATTACTATGCTATGGATCTCTGGGGCCCAGGCGTTGAAGTCGTCGTGTCCTCAG CCCCTGGAAACTTGACCACTGGGGCAGGGGCGTCCTGGTCACCGTCTCCTCAG YYAMDLWGPGVEVVVSS any arguments that VH usage in early development is exclusively positionally dependent. The studies of Pospisil et al. (33) using

the Alicia rabbit would support our skepticism. http://www.jimmunol.org/ Our study does offer several insights that may be related. First is the evidence for recent duplication within the porcine V locus. I TTGSKAGARGP*STTPR I AMAT*IRGARASWSPSPQ I TIFTAGAEESRSPSPQ I ITMLWISGAQALKSSCPQ I PLET*PLGQGRPGHRLL H II QRARKLGPGDPSLRRL II PWLLRFVGPGHPGHRLL II PSSQLGPRSRGHRLL II LLCYGSLGPRR*SRRVL II PWKLDHWGRGVLVTVSS III NGLESWGQGTLVYDAS III HGYLDSWGQGILVTVSS III HLHSWGRGVEVTVSS III III PGNLTTGAGASWSPSPQ IGHV4 (VHA) and IGHV10 (VHA*) share identical CDR1 and CDR2 regions (Table I) and differ only in one nucleotide in FR3. The latter difference allowed us to prepare a probe that could distinguish the expression of these two genes by probe hybridization (Fig. 3, Table I). Likewise, IGHV6 (VHB) and IGHV12 (VHBp) differ by only one nucleotide in CDR1. For this reason, 51 54 48 54 53 by guest on September 27, 2021 gene-specific probes for VHB do not distinguish between IGHV6 IGHJ (bp) Reading Frame and IGHV12 so that usage of both is included in VHB usage (Fig. 3). Other similarities suggest that IGHV9P to IGHV14 and IGHV3P to IGHV8 (Fig. 1) may be recent duplicons. Similar du- a a plicons have been reported in the human VH genome (52). Thus, whatever factors control VH usage would be likely to affect all of 7-mer the genes in each of these duplicon cassettes. Although overall VH usage is not positional, proportional usage for VH genes within each cassette may be the case (e.g., IGHV3P to IGHV8 in the first cassette and IGHV9P to IGHV14 in the second cassette). Swine genetics, especially the fine genetics of lymphocyte receptors, are still in infancy compared with mouse genetics. Most of the nearly 30 VH genes described for swine were mostly recovered from outbred farm pigs so that the number very likely contains numerous alleles (9). The BAC library used in this study 23-mer was made from the Large White breed that was interbred at In- stitute Nationale Recherche Agronomique, whereas the data presented in Fig. 3 were derived from United States animals, largely

ACACCCCCTAATGGGGGCCACAG CACTGTG CTGGGATCCGGGCTTAGTTGTCG CAATGTG TGGGGCGAGCCTGGAGATTGCAC CACTGTG Landrace, Yorkshires, and their crosses that are preferred over inbred animals for fecundity, health, and absence of viral disease, all of which are also important criteria for their use in fetal and

a a a neonatal isolator studies. We know from studies on Ig genetics that even randomly inbred swine can be homozygous in the IGHC locus (53). This background might therefore explain one of two troubling 9-mer observations made in this study. The ﬁrst concerns our failure to GGTTCTGTG TGCCAGGGCCTGGGTGGGCACAT TGGTGTG AGGTTTTTG GTGTATTTG TCAAGGAGGGGCAACAGGGTGCA GACTGTG CTTTCTTAA GGTTTTTGG localize VHC within the region of the VH locus that was mapped, despite its prominent expression (Fig. 3) (9, 39, 40). IGHV14 IGHJ genes detected in this study (VHY) (Fig. 1, Table II) shares CDR1 with VHC and CDR2 with IGHV4 (VHA) and IGHV10 (VHA*); all porcine VH genes have Gene Stop codon. Canonical heptamers and nonamers. IGHJ1 IGHJ5 IGHJ2 IGHJ4 IGHJ3 a p Boldface text indicates only expressed J region. essentially identical framework sequences. It is altogether possible

Table IV. that IGHV14 (VHY) and VHC are alleles and the BAC library came The Journal of Immunology 7

A Downloaded from http://www.jimmunol.org/ B by guest on September 27, 2021

FIGURE 2. A, Phylogenetic tree of porcine IGHV genes detected in this study. Human b2-microglobulin (huB2M: NM_004048.2) was used as an unrelated reference. Exon 2 sequences (or sequences corresponding to exon 2 of functional IGHV segments) were used for the alignment. Because all porcine VH genes belong to the VH3 family of clan III, we designated the various subgroups as VH3-1, -2, and -3, respectively. Bootstrap values for 1000 replicates are indicated beside the branches. B, Genomic structure in the vicinity of the region coding IGHV. Repetitive sequences such as LINE/L1 and PRE1 are indicated by black boxes. IGHV genes are indicated by white boxes. Areas surrounded by dashed lines are highly conserved regions. C, Phylogenetic tree estimating the divergence of the two major duplicons within the mapped locus. Line, long interspersed nucleotide element; Pre, porcine repeat element family belonging to short interspersed nucleotide elements. 8 VH USAGE AND GENOME ORGANIZATION

swine is a result of their recognition by certain stromal receptors that recognize epitopes expressed in FRs due to the conformation im- posed by the VH genes they use. Perhaps this also explains the data of Pospisil et al. (56) in rabbits with a mutated VH1 gens. Finally, our data reveal that porcine IgG3, regarded as the ancestral IgG of swine (41) and which comprise 60% of all IgG expression in the fetal IPP (25), is most 39 proximal to Cd. Because speciation preceded subclass diversiﬁcation, IgG3 in swine, human, and mouse are not homologous genes (1, 41). Coincidentally, the Cg gene called IgG3 in all three species is the most 59 Cg gene and appears to be involved in early natural Ab responses to bacteria such as those expressed by marginal zone B cells. In swine, the

FIGURE 3. Proportional usage of major porcine VH genes in VDJ re- dominant expression of IgG3 in the fetal IPP of piglets would be arrangement in fetal liver DNA at DG30 and in cDNA from bone marrow consistent with this concept because the IPP is considered the site of at DG95. The x-axis provides both the vernacular names of the VH genes Ag-independent repertoire development (29). and the position in the locus as defined in Fig. 1 (see Table II). Significant Our data argue that there is a practical reason to understand how differences between proportional usage at DG30 and DG95 are indicated the IgH locus is organized and how the Ab repertoire is developed, together with p values. Data are based on 632 cloned VDJs from fetal and, in this case, to expose the Achilles’ heel of a species that spleen DNA and 432 from DG95 bone marrow RNA. IGHV6 (VHB) and supplies 60% of the world’s meat supply. Although a mutation of Downloaded from IGHV12 (VHB*) cannot be distinguished by hybridization using the gene- specific probes shown in Table I. VH1 in the Alicia still allows rabbits a second chance, probably by gene conversion, a mutation of JH5 in pigs destroys the entire Ab system of this species, as has been experimentally demonstrated from a swine homozygous for IGHV14. The second observation (M. Mendicino et al., personal communication). Thus, JH5 of swine concerns IGHV5 (VHT) that is expressed in low frequency in out- represents a deleterious genetic target of spontaneous or designed

bred North American swine (9). However, based on its position in mutation. http://www.jimmunol.org/ the first duplicon (Fig. 1), high expression might be expected. IGHV5 (VHT) shares CDR1 with IGHV8 (VHE) and CDR2 with Disclosures IGHV11 (VHF), respectively. Because all three (IGHV5, IGHV8, The authors have no financial conflicts of interest. and IGHV11) map to separate loci, IGHV5 cannot be an allele of either IGHV8 or IGHV11. Recent progress with the porcine genome project might resolve these issues. References Although the gene mapping studies we present can explain the 1. Butler, J. E. 2006. Preface: why I agreed to do this. Dev. Comp. Immunol. 30: 1–17. 2. Schroeder, H. W., Jr. 2006. Similarity and divergence in the development and expression of only two DH segments and one JH, they fail to ex- expression of the mouse and human antibody repertoires. Dev. Comp. Immunol. by guest on September 27, 2021 plain the basis of selection for VH gene usage and expression. 30: 119–135. 3. Das, S., M. Nozawa, J. Klein, and M. Nei. 2008. Evolutionary dynamics of the Clearly, it is not position in the locus. At DG30 in liver, there is immunoglobulin heavy chain variable region genes in vertebrates. Immunoge- very little transcription and no BCR expression as determined by netics 60: 47–55. flow cytometry and immunohistochemistry (54). Because this is 4. Lefranc, M.-P., and G. Lefranc. 2001. The Immunoglobulin Facts Book. Aca- demic Press, New York. not true at DG95, the changes in VH usage in fetal BCRs at DG95 5. Brodeur, P. H., and R. Riblet. 1984. The immunoglobulin heavy chain variable could be due to selection by intrinsic ligands for B cells that use region (Igh-V) locus in the mouse. I. One hundred Igh-V genes comprise seven certain V genes to form their BCRs. families of homologous genes. Eur. J. Immunol. 14: 922–930. H 6. Schroeder, H. W., Jr., J. L. Hillson, and R. M. Perlmutter. 1990. Structure and Theories to explain positive selection of B cells expressing evolution of mammalian VH families. Int. Immunol. 2: 41–50. certain surface receptors date to the pre-B selection hypothesis of 7. Marchalonis, J. J., M. K. Adelman, S. F. Schluter, and P. A. Ramsland. 2006. The Melchers (55) and the work of Pospisil et al. (56). The latter antibody repertoire in evolution: chance, selection, and continuity. Dev. Comp. Immunol. 30: 223–247. studies used Alicia rabbits that carry a deficient VH1. These rab- 8. Sun, J., I. Kacskovics, W. R. Brown, and J. E. Butler. 1994. Expressed swine VH bits show increased expression of a VH1-like gene that was gen- genes belong to a small VH gene family homologous to human VHIII. J. Im- munol. 153: 5618–5627. erated by gene conversion following gut colonization. As 9. Butler, J. E., P. Weber, and N. Wertz. 2006. Antibody repertoire development in indicated above, the authentic VH1 gene is normally used in fetal and neonatal piglets. XIII. Hybrid VH genes and the preimmune repertoire .90% of rearrangements in newborn rabbits (18). These ob- revisited. J. Immunol. 177: 5459–5470. 10. Meselson, M. S., and C. M. Radding. 1975. A general model for genetic re- servations by Melchers (55) and the Pospisil team (56) can be combination. Proc. Natl. Acad. Sci. USA 72: 358–361. interpreted to mean that B cells at certain stages of development 11. Szostak, J. W., T. L. Orr-Weaver, R. J. Rothstein, and F. W. Stahl. 1983. The display BCRs that are recognized by stromal receptors that pro- double-strand-break repair model for recombination. Cell 33: 25–35. 12. Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore, mote their survival and proliferation. and F. W. Alt. 1984. Preferential utilization of the most JH-proximal VH gene The dominant role of CDR3 in determining Ab specificity is well segments in pre-B-cell lines. Nature 311: 727–733. acceptedandwasexperimentallyshowninstudiesbyPadlan(57)and 13. Perlmutter, R. M., J. F. Kearney, S. P. Chang, and L. E. Hood. 1985. De- velopmentally controlled expression of immunoglobulin VH genes. Science 227: Xu and Davis (58). The latter group showed that mice with a single 1597–1601. VH gene could make Abs to nearly all of the same Ags as control 14. Malynn, B. A., G. D. Yancopoulos, J. E. Barth, C. A. Bona, and F. W. Alt. 1990. littermates with a full germline V repertoire as long as the D and Biased expression of JH-proximal VH genes occurs in the newly generated H H repertoire of neonatal and adult mice. J. Exp. Med. 171: 843–859. JH region was intact. Because of limited VH,DH, and JH usage in 15. Freitas, A. A., A.-C. Viale, A. Sundblad, C. Heusser, and A. A. Coutinho. 1991. swine, we estimated that .95% of the repertoire is determined by Normal serum immunoglobulins participate in the selection of peripheral B-cell repertoires. Proc. Natl. Acad. Sci. USA 88: 5640–5644. CDR3 (59). In the case of TCR, CDR1 and CDR2 are purported to be 16. Varade, W. S., E. Marin, A. M. Kittelberger, and R. A. Insel. 1993. Use of the mainly responsible for MHC recognition, whereas CDR3 is re- most JH-proximal human Ig H chain V region gene, VH6, in the expressed sponsible for peptide (Ag) recognition. Because TCR and BCR are immune repertoire. J. Immunol. 150: 4985–4995. 17. Cuisinier, A. M., V. Guigou, L. Boubli, M. Fougereau, and C. Tonnelle. 1989. structural and genetic homologs, what is true for the goose may also Preferential expression of VH5 and VH6 immunoglobulin genes in early human be true for the gander. Perhaps VH usage by surviving B cells in B-cell ontogeny. Scand. J. Immunol. 30: 493–497. The Journal of Immunology 9

18. Knight, K. L., and R. S. Becker. 1990. Molecular basis of the allelic inheritance 39. Sun, J., C. Hayward, R. Shinde, R. Christenson, S. P. Ford, and J. E. Butler. 1998. of rabbit immunoglobulin VH allotypes: implications for the generation of an- Antibody repertoire development in fetal and neonatal piglets. I. Four VH genes tibody diversity. Cell 60: 963–970. account for 80 percent of VH usage during 84 days of fetal life. J. Immunol. 161: 19. Becker, R. S., and K. L. Knight. 1990. Somatic diversification of immuno- 5070–5078. globulin heavy chain VDJ genes: evidence for somatic gene conversion in rab- 40. Sun, J., and J. E. Butler. 1996. Molecular characteristics of VDJ transcripts from bits. Cell 63: 987–997. a newborn piglet. Immunology 88: 331–339. 20. Kraj, P., S. P. Rao, A. M. Glas, R. R. Hardy, E. C. Milner, and L. E. Silberstein. 41. Butler, J. E., N. Wertz, N. Deschacht, and I. Kacskovics. 2009. Porcine IgG: 1997. The human heavy chain Ig V region gene repertoire is biased at all stages structure, genetics, and evolution. Immunogenetics 61: 209–230. of B cell ontogeny, including early pre-B cells. J. Immunol. 158: 5824–5832. 42. Rogel-Galliard, C., N. Bourgeaux, A. Billault, M. Vaiman, and P. Chardon. 1999. 21. Ollo, R., J.-L. Sikorav, and F. Rougeon. 1983. Structural relationships among Construction of a swine BAC library: application to the characterization and mouse and human immunoglobulin VH genes in the subgroup III. Nucleic Acids mapping of porcine type C endoviral elements. Cytogenet. Cell Genet. 85: 205– Res. 11: 7887–7897. 211. 22. Adderson, E. E., P. G. Shackelford, A. Quinn, and W. L. Carroll. 1991. Re- 43. Ewing, B., and P. Green. 1998. Base-calling of automated sequencer traces using stricted Ig H chain V gene usage in the human antibody response to Haemo- phred. II. Error probabilities. Genome Res. 8: 186–194. philus influenzae type b capsular polysaccharide. J. Immunol. 147: 1667–1674. 44. Ewing, B., L. Hillier, M. C. Wendl, and P. Green. 1998. Base-calling of auto- 23. Fulton, R. J., M. H. Nahm, and J. M. Davie. 1983. Monoclonal antibodies to mated sequencer traces using phred. I. Accuracy assessment. Genome Res. 8: streptococcal group A carbohydrate. II. The VK1GAC light chain is preferen- 175–185. tially associated with serum IgG3. J. Immunol. 131: 1326–1331. 45. Tatusova, T. A., and T. L. Madden. 1999. BLAST 2 Sequences, a new tool for 24. Oliver, A. M., F. Martin, G. L. Gartland, R. H. Carter, and J. F. Kearney. 1997. comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174: 247–250. Marginal zone B cells exhibit unique activation, proliferative and immuno- 46. Jurka, J. 2000. Repbase update: a database and an electronic journal of repetitive globulin secretory responses. Eur. J. Immunol. 27: 2366–2374. elements. Trends Genet. 16: 418–420. 25. Milili, M., M. Fougereau, P. Guglielmi, and C. Schiff. 1991. Early occurrence of 47. Schwartz, S., Z. Zhang, K. A. Frazer, A. Smit, C. Riemer, J. Bouck, R. Gibbs, immunoglobulin isotype switching in human fetal liver. Mol. Immunol. 28: 753– R. Hardison, and W. Miller. 2000. PipMaker—a web server for aligning two 761. genomic DNA sequences. Genome Res. 10: 577–586. 26. Fagarasan, S., and T. Honjo. 2000. T-independent immune responses: new as- 48. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. pects of B cell biology. Science 290: 89–92. The CLUSTAL_X windows interface: flexible strategies for multiple sequence Downloaded from 27. Manis, J. P., M. Tian, and F. W. Alt. 2002. Mechanism and control of class- alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876–4882. switch recombination. Trends Immunol. 23: 31–39. 49. Sun, J., and J. E. Butler. 1997. Sequence analysis of pig switch m,Cm, and C m 28. Butler, J. E., and N. Wertz. 2006. Antibody repertoire development in fetal and m. Immunogenetics 46: 452–460. neonatal piglets. XVII. IgG subclass transcription revisited with emphasis on 50. Li, W. H., T. Gojobori, and M. Nei. 1981. Pseudogenes as a paradigm of neutral new IgG3. J. Immunol. 177: 5480–5489. evolution. Nature 292: 237–239. 29. Reynaud, C. A., C. Garcia, W. R. Hein, and J. C. Weill. 1995. Hypermutation 51. Zhao, Y., Q. Pan-Hammarstro¨m, I. Kacskovics, and L. Hammarstro¨m. 2003. The generating the sheep immunoglobulin repertoire is an antigen-independent porcine Ig delta gene: unique chimeric splicing of the first constant region do-

process. Cell 80: 115–125. main in its heavy chain transcripts. J. Immunol. 171: 1312–1318. http://www.jimmunol.org/ 30. Zhang, J., F. W. Alt, and T. Honjo. 1995. Regulation of class switch re- 52. Sasso, E. H., K. Willems van Dijk, A. Bull, S. M. van der Maarel, and E. C. combination of the immunoglobulin heavy chain genes. In Immunoglobulin B. Milner. 1992. VH genes in tandem array comprise a repeated germline motif. Genes. T. Honjo, and F. W. Alt, eds. Academic Press, New York. p. 235–265. J. Immunol. 149: 1230–1236. 31. Honjo, T., and F. Matsuda. 1995. Immunoglobulin heavy chain locus of mouse 53. Navarro, P., R. K. Christenson, G. Ekhardt, B. Bosworth, J. K. Lunney, and humans. In Immunoglobulin Genes. T. Honjo, and F. W. Alt, eds. Academic M. Rothschild, J. Lemke, and J. E. Butler. 2000. Genetic differences in the Press, New York. p. 145–171. frequency of the hinge variants of porcine IgA is breed dependent. Vet. Immunol. 32. Brambell, F. W. R. 1970. The Transmission of Passive Immunity from Mother to Immunopathol. 73: 287–295. Young. North-Holland Publishers, Amsterdam. 54. Sinkora, M., and J. E. Butler. 2009. The ontogeny of the porcine immune system. 33. Butler, J. E. 1974. Immunoglobulins of the mammary secretions. In Lactation, A Dev. Comp. Immunol. 33: 273–283. Comprehensive Treatise, Vol. III. B. L. Larson, and V. Smith, eds. Academic 55. Melchers, F. 1995. The role of B cell and pre-B cell receptors in development Press, New York, p. 217–255. and growth control of the B-lymphocyte cell lineage. In Immunoglobulin Genes.

34. Butler, J. E. 1998. Immunoglobulins and immune cells in animal milks. In T. Honjo, and F. W. Alt, eds. Academic Press, New York, p. 33–56. by guest on September 27, 2021 Mucosal Immunology, P. L. Ogra, J. Mestecky, M. E. Lamm, W. Strober, J. R. 56. Pospisil, R., G. O. Young-Cooper, and R. G. Mage. 1995. Preferential expansion McGhee, and J. Bienenstock, eds. Academic Press, New York, p. 1531–1554. and survival of B lymphocytes based on VH framework 1 and framework 3 35. Yamaguchi, N., S. Shimizu, A. Hara, and T. Saito. 1983. The effect of maternal expression: “positive” selection in appendix of normal and VH-mutant rabbits. antigenic stimulation upon the active immune responsiveness of their offspring. Proc. Natl. Acad. Sci. USA 92: 6961–6965. Immunology 50: 229–238. 57. Padlan, E. A. 1994. Anatomy of the antibody molecule. Mol. Immunol. 31: 169– 36. Wikler, M., C. Demeur, G. Dewasme, and J. Urbain. 1980. Immunoregulatory 217. role of maternal idiotypes. Ontogeny of immune networks. J. Exp. Med. 152: 58. Xu, J. L., and M. M. Davis. 2000. Diversity in the CDR3 region of V(H) is 1024–1035. sufficient for most antibody specificities. Immunity 13: 37–45. 37. Butler, J. E., and M. Sinkora. 2007. The isolator piglet: a model for studying the 59. Butler, J. E., P. Weber, M. Sinkora, J. Sun, S. J. Ford, and R. Christenson. 2000. development of adaptive immunity. Immunol. Res. 39: 33–51. Antibody repertoire development in fetal and neonatal piglets. II. Character- 38. Butler, J. E., J. Sun, and P. Navarro. 1996. The swine Ig heavy chain locus has ization of heavy chain complimentarity-determining region 3 diversity in the a single JH and no identifiable IgD. Int. Immunol. 8: 1897–1904. developing fetus. J. Immunol. 165: 6999–7011. The Journal of Immunology

Corrections

Eguchi-Ogawa, T., N. Wertz, X.-Z. Sun, F. Puimi, H. Uenishi, K. Wells, P. Chardon, G. J. Tobin, and J. E. Butler. 2010. Antibody repertoire development in fetal and neonatal piglets. XI. The relationship of variable heavy chain gene usage and the genomic organization of the variable heavy chain locus. J. Immunol. 184: 3734–3742.

The fourth author’s name was published incorrectly. The correct spelling is Francois Piumi. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1290085