REGULATION OF OVARIAN FOLLICULAR DEVELOPMENT WITH ESTRADIOL
IN CATTLE
DISSERTATION
Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy
in the Graduate School of The Ohio State University
By
Christopher R. Burke, M.S.
*****
The Ohio State University
2003
Dissertation Committee: Approved by Professor Michael Day, Adviser
Professor James Kinder Adviser Associate Professor Mark Morrison Animal Science Graduate Program
Professor Joy Pate
Professor William Pope
Associate Professor Normand St-Pierre
ABSTRACT
Fundamental aspects of the use of estradiol benzoate (EB) to regulate ovarian follicular development were investigated in cattle. Three experiments examined the impact of stage of follicular maturity on the ability of EB to induce estrus, ovulation and normal luteal function in prepubertal heifers, estrous cycling heifers and anestrous cows.
The negative consequences of attempting to synchronize estrus/ovulation without regulating follicular development were clearly demonstrated in anestrous cows. The presence of an immature follicle at the time of applying an ovulatory stimulus, resulted in estrus without ovulation, or decreased function of the subsequently formed corpus luteum if ovulation did occur. This sensitivity was not apparent in heifers.
Another three experiments examined histological and functional changes associated with EB-induced atresia in the dominant follicle (DF). A rapid and sustained loss in the capacity of the DF to produce estradiol was promoted by treatment with EB.
These effects were associated with decreased circulating concentrations of LH or FSH. A primary target for this atretogenic action was aromatase. The DF of EB treated heifers had fewer granulosa cells, although no differences were observed in the rate of apoptosis or expression of apoptotic triggers (Fas/FasL). This approach could serve as a useful model to further investigate the process of ovarian follicular atresia.
ii The final experiment examined the DF-independent action of EB in regulating the timing of new follicular development by aspirating the DF on the ovaries of cows and then administering various doses of EB. Timing of follicular emergence and the rise in
FSH that precedes emergence were delayed in a dose dependent manner. Clearance of estradiol from circulation to allow for a rise in FSH was a key factor in determining the timing of new follicular development.
These studies demonstrate that follicular development needs to be regulated to successfully synchronize estrus/ovulation. Induction of atresia in the DF is rapidly achieved at the cellular and molecular levels; therefore, the variation in timing of new follicular development is dependent on clearance of estradiol from circulation. Further studies should aim at developing an approach where this pre-emergence rise in FSH is more tightly regulated.
iii
To Fran
iv
ACKNOWLEDGMENTS
My PhD program would not have been possible if it were not for the many people
who assisted me so generously along the way here at The Ohio State University, home of the 2003 National Champion 'Buckeyes'.
To my advisor, Mike Day, thank you for your support and guidance through all aspects of my education. The kindness, latitude and respect you afforded me made me feel more like a colleague, than a student, and this worked well for me. I hope to have an ongoing and prosperous relationship in science with you in the future. My appreciation is extended to the other members of the Day family (Toni, Travis and Leslie) who I consider my 'American family'. I will forever remember with fondness the occasions spent at the Lazy-D.
To Marty Mussard, I hope some day to repay my debt to you for your skilled support in all my animal experiments. Thanks also for your humor and comradeship. It would have been a much lonelier and more difficult task without you around. My thanks to Dave Grum for your help around the laboratory, RIAs and teaching in these matters that were initially so foreign to me. Thanks also to Horacio Cárdenas for teaching me RT-
PCR procedure. I both appreciated and gained immensely from your knowledge, and I actually came to enjoy the dialectical dimension you brought to any discussion. The work office (PH327: Did I say work?) was always fun when Eric Behlke and Chad Gasser
v were around. Thanks for the entertainment Eric, and thanks both for your support in a number of experiments. I extend an appreciation to John Huston and Valerie Bogacz who helped me settle into life as a graduate student. Best wishes to all you guys for the future.
I thank the members of my advisory committee, Jim Kinder, Mark Morrison, Joy
Pate, Bill Pope and Normand St-Pierre. Each contributed importantly in their different ways, so in all, I'll say thank you for teaching me scientific principles and rigor. Thanks also to key members at Dexcel Research in Hamilton, New Zealand, who backed me all the way in this endeavor. A special thanks is extended to Gwyn Verkerk in this regard.
Thanks also to Stuart Morgan who helped out immensely with our most intensive experiment. Various intern students and barn staff members assisted in the collection of these data. I especially thank Justin Lahmers, Allan Robison, Dave Sherman, Glenn
Hansen, Greg Fogle and Pam Ferrel. My appreciation is also extended to Jeanne Osborne,
Joan Jerauld and Debbie Gallagher for their expert administrative support.
I thank my family in New Zealand for their understanding and love. Most importantly, I thank my intelligent and loving wife, Fran. I may not have got this far without your support and you're the best thing that's happened to me.
Everybody has an open invitation to visit us in New Zealand, where we would be delighted for the opportunity to take good care of you.
vi
VITA
February 17, 1965 ...... Born - Hastings, New Zealand
1987...... B.S., Lincoln University, New Zealand
1987-1990 ...... Research Technician, Ministry of Agriculture and Fisheries,
New Zealand
1990-1999 ...... Technical Officer, Dairying Research Corporation,
New Zealand
1995...... M.S., Waikato University, New Zealand
1999 - 2003 ...... Graduate Research Associate, The Ohio State University
PUBLICATIONS
Peer Reviewed Publications
1. Burke, C. R., M. L. Mussard, C. L. Gasser, D. E. Grum, and M. L. Day. 2003. Estradiol benzoate delays new follicular wave emergence in a dose dependent manner after ablation of the dominant ovarian follicle in cattle. Theriogenology doi:10.1016/S0093-691X(03)00078-5.
2. Rathbone, M. J., C. R. Bunt, C. R. Ogle, S. Burggraaf, K. L. Macmillan, C. R. Burke, and K. L. Pickering. 2002. Reengineering of a commercially available bovine intravaginal insert (CIDR insert) containing progesterone. J. Control. Release 13;105-115.
vii 3. Rhodes, F. M., C. R. Burke, B. A. Clark, M. L. Day, and K. L. Macmillan. 2001. Effect of treatment with progesterone and oestradiol benzoate on ovarian follicular turnover in postpartum anoestrus cows and cows which have resumed oestrous cycles. Anim. Reprod. Sci. 69:139-150.
4. Burke, C. R., M. L. Mussard, D. E. Grum, and M. L. Day. 2001. Effects of maturity of the potential ovulatory follicle on induction of oestrus and ovulation in cattle with oestradiol benzoate. Anim. Reprod. Sci. 66:161-174.
5. Xu, Z. Z., G. A. Verkerk, J. Mee, S. Morgan, B. A. Clark, C. R. Burke, and L. J. Burton. 2000. Progesterone and follicular changes in postpartum noncyclic dairy cows after treatment with progesterone and oestradiol or with progesterone, GnRH, PGF2α, and oestradiol. Theriogenology 54:272-282.
6. Nation, D. P., C. R. Burke, G. Parton, R. Stevenson, and K. L. Macmillan. 2000. Hormonal and ovarian responses to a 5-day progesterone treatment in anoestrous dairy cows in the third week post-partum. Anim. Reprod. Sci. 63:13- 25.
7. Day, M. L., C. R. Burke, V. K. Taufa, A. M. Day, and K. L. Macmillan. 2000. The strategic use of estradiol to enhance fertility and submission rates of progestin-based estrus synchronisation programs in seasonal dairy Herds. J. Anim. Sci. 78:523-529.
8. Burke, C. R., M. L. Day, C. R. Bunt, and K. L. Macmillan. 2000. Use of a low dose of estradiol benzoate during diestrus to synchronize development of the ovulatory follicle in cattle. J. Anim. Sci. 78:145-151.
9. Nation, D. P., C. R. Burke, F. M. Rhodes, and K. L. Macmillan. 1999. The inter- ovarian distribution of dominant follicles is influenced by the location of the corpus luteum of pregnancy. Anim. Reprod. Sci. 56:169-176.
10. Burke, C. R., M. P. Boland, and K. L. Macmillan. 1999. Ovarian responses to progesterone and oestradiol benzoate administered intravaginally during dioestrus in cattle. Anim. Reprod. Sci. 55:23-33.
viii 11. Macmillan K. L., and C. R. Burke. 1996. Effects of oestrous cycle control on reproductive efficiency. Anim. Reprod. Sci. 42:307-320.
12. Burke, C. R., K. L. Macmillan, and M. P. Boland. 1996. Oestradiol potentiates a prolonged progesterone-induced suppression of LH release in ovariectomised cows. Anim. Reprod. Sci. 45:13-28.
13. McDougall, S., C. R. Burke, K. L. Macmillan, and N. B. Williamson. 1995. Follicle patterns during extended periods of postpartum anovulation in pasture- fed dairy cows. Res. Vet. Sci. 58:212-216.
14. Burke, C. R., M. Mihm, K. L. Macmillan, and J. F. Roche. 1994. Some effects of prematurely elevated concentrations of progesterone on luteal and follicular characteristics during the oestrous cycle in heifers. Anim. Reprod. Sci. 35:27- 39.
Book Chapters
1. Day, M. L., and C. R. Burke. 2002. Management of follicular growth with progesterone and estradiol within progestin-based estrous synchrony systems. Pages 101 to 118 in Factors Affecting Calf Crop: Biotechnology of Reproduction. M. Fields, R. Sand and J. Yelich, eds. CRC Press LLC, Boca Raton, FL.
2. Paine, M. S., C. R. Burke, G. A. Verkerk, and P. J. Jolly. 2001. Learning together about dairy cattle fertility technologies in relation to farming systems in New Zealand. Pages 163 to 174 in Cow Up a Tree. M. Cerf, D.Gibbon, B. Hubert, R. Ison, J. Jiggins, M. Paine, J. Proost, and N. Röling, eds. INRA Editions, France.
3. Rathbone, M. J., C. R. Burke, C. Ogle, C. R. Bunt, S. Burggraaf and K. L. Macmillan. 2000. Design and development of controlled release intravaginal veterinary drug delivery systems. Pages 173 to 200 in Controlled Release Veterinary Drug Delivery: Biological and Pharmaceutical Considerations. M.J. Rathbone and R. Gurney, eds. Elsevier Science B.V., Netherlands.
ix Recent (since 1999) Abstracts
1. Mussard, M. L., C. R. Burke, C. L. Gasser, and M. L. Day. 2002. Synchronizing ovarian follicular development with melengestrol acetate (MGA) and a CIDR in beef cattle. J. Anim. Sci. 80 (Suppl. 1): 535.
2. Gasser, C. L., C. R. Burke, M. L. Mussard, E. J. Behlke, D. E. Grum, and M. L. Day. 2002. Follicular development and reproductive maturation are precociously activated in heifers by early weaning and feeding a high concentrate diet. J. Anim. Sci. 80 (Suppl. 1): 536.
3. Mussard, M. L., C. R. Burke, E. J. Behlke, C. L. Gasser, A. R. Robison, J. E. Kinder, and M. L. Day. 2002. Influence of premature induction of an LH surge with GnRH on ovulation, luteal function, and fertility in cattle. Biol. Reprod. 66 (Suppl. 1): 415.
4. Burke, C. R., M. L. Mussard, and M. L. Day. 2002. Estradiol benzoate (EB) delays new follicular wave emergence in a dose dependent manner after ablation of the dominant follicle in the ovaries of cattle. J. Anim. Sci. 80 (Suppl. 1): Abstr. 798.
5. Burke, C. R., M. L. Mussard, C. L., Gasser, E. J., Behlke, D. E. Grum, and M. L. Day. 2002. Steroidogenic changes in dominant ovarian follicles undergoing atresia induced by estradiol benzoate (EB) in heifers. Biol. Reprod. 66 (Suppl. 1): Abstr. 83.
6. Burke, C. R., M. L. Mussard, and M. L. Day. 2001. Effects of maturity of the potential ovulatory follicle on the ability of estradiol benzoate (EB) to stimulate estrus, ovulation and luteal development in anestrous beef cows. J. Anim. Sci. (2): 253.
7. Burke, C. R., S. Morgan, M. L. Mussard, D. E. Grum, and M. L. Day. 2001. Estradiol benzoate (EB) inhibits secretion of LH and induces atresia of dominant follicles within 36 hours in cyclic heifers. J. Anim. Sci. 79 (Suppl. 1): 137.
x 8. Mussard, M. L., C. R. Burke, D. E. Grum, and M. L. Day. 2001. Effects of a progestin on ovulation, accessory CL formation and follicular development during GnRH and PGF2α treatment in beef cattle. J. Anim. Sci. 79 (Suppl. 1): 1034.
9. Burke, C. R., M. L. Mussard, and M. L. Day. 2000. Effects of estradiol benzoate (EB) on ovulation of newly emerged or mature dominant ovarian follicles in prepubertal heifers. J. Anim. Sci. 78 (Suppl. 1): 921.
10. Day, M. L., and C. R. Burke. 2000. Management of follicular growth with progesterone and estradiol with progestin-based estrous synchrony systems. Proc. 49th Annual Cattle Short Course, Gainsville FL. pp. 7-18.
11. Burke, C. R., M. S. Paine, G. A. Verkerk, and P. J. Jolly. 1999. Factors affecting the uptake of controlled breeding technologies. Proc. Massey Dairy Farmers Conf.: Dairyfarming Annual, May 18-20, Whangarei, New Zealand. 51:93-101.
12. Burke, C.R. 1999. Managing your herd to meet reproductive targets. Proc. Ruakura Farmers Conf. 51:22-32.
13. Bunt, C. R., M. J. Rathbone, S. Burggraaf, C. R. Ogle, and C. R. Burke. 1999. Elevation of plasma progesterone levels in cattle using a poly (ε-caprolactone) and cyclodextrin intravaginal insert containing progesterone. Proc. Control. Release Soc., Boston, USA.
14. Bunt, C. R., V. G. Woodward, M. J. Rathbone, S. Burggraaf, C. R. Ogle, C. R. Burke, and K. Pickering. 1999. A poly (ε-caprolactone) bovine intravaginal insert for the delivery of progesterone. Proc. Control. Release Soc., Boston, USA.
FIELDS OF STUDY
Major Field: Animal Sciences
xi
TABLE OF CONTENTS
Page
Abstract...... ii
Dedication...... iv
Acknowledgments...... v
Vita...... vii
List of Tables ...... xiv
List of Figures...... xvi
Chapters:
1. Introduction...... 1
2. Literature Review...... 3
2.1 Introduction...... 3
2.2 Reproductive Challenges and Opportunities in Cattle Systems ...... 3
2.3 Ovarian Follicular Development in Cattle...... 7
2.3.1 An Overview of the Hypothalamic-Pituitary-Ovarian Axis ...... 7 2.3.2 Morphological Dynamics of Ovarian Follicular Development ...... 11 2.3.3 Development of Ovarian Primordial Follicles...... 12 2.3.4 Recruitment of Ovarian Follicles into the Large Antral Growth Phase...... 14 2.3.5 Selection of the Dominant Ovarian Follicle (DF)...... 15 2.3.6 Ovarian Follicular Dominance...... 20 2.3.7 Ovarian Follicular Atresia...... 23 2.3.8 Ovulation...... 28 2.3.9 Behavioral Estrus...... 32
xii 2.4 Use of Exogenous Estradiol to Manipulate Reproduction...... 37
2.4.1 Historical Developments in Estrous Synchronization ...... 37 2.4.2 Current Strategies in Estrous Synchronization ...... 40 2.4.3 Use of Estradiol to Synchronize Ovarian Follicular Development ...... 41 2.4.4 Use of Estradiol to Induce Estrus and Ovulation...... 48
2.5 Statement of the Problem...... 54
3. Effects of Maturity of the Potential Ovulatory Follicle on Induction of Estrus and Ovulation in Cattle with Estradiol Benzoate...... 66
Abstract...... 66 Introduction...... 68 Materials and Methods...... 69 Results...... 74 Discussion...... 76
4. Changes in Gonadotropins and Function of the Dominant Ovarian Follicle During Estradiol-Induced Atresia in Cattle ...... 90
Abstract...... 90 Introduction...... 91 Materials and Methods...... 93 Results...... 104 Discussion...... 109
5. Estradiol Benzoate Delays New Follicular Wave Emergence in a Dose Dependent Manner after Ablation of the Dominant Ovarian Follicle in Cattle ...... 125
Abstract...... 125 Introduction...... 126 Materials and Methods...... 128 Results...... 133 Discussion...... 135
6. General Discussion ...... 145
Bibliography ...... 150
xiii
LIST OF TABLES
Table Page
2.1 Temporal relationships between behavioral estrus, the ovulatory LH surge and ovulation in cattle having spontaneous estrous cycles...... 57
2.2 Intervals from treatment with exogenous estradiol to onset and duration of estrus and to peak LH and duration of the LH surge in ovariectomized cattle...... 58
3.1 Age1 and diameter of newly emerged dominant follicles (DF) at the time of progesterone removal2 for each treatment group in all three experiments. Treatment groups were: progesterone source (IPI or CL) removed 1 to 2 d (YDF) or 4 to 5 d (MDF) after emergence of a new DF followed with (EB2) or without (NoEB2) an injection of 0.75 mg EB i.m./500 kg BW 24 h later...... 82
3.2 Incidence of detected estrus, ovulation, and age1 and diameter of dominant follicles (DF) at ovulation for each treatment group in all three experiments. Treatment groups were: progesterone source2 removed 1 to 2 d (YDF) or 4 to 5 d (MDF) after emergence of a new DF followed with (EB2) or without (NoEB2) an injection of 0.75 mg EB i.m./500 kg BW 24 h later ...... 83
4.1 GenBank accession numbers and sequences of primers used to amplify first strand cDNA for P450 aromatase (aromatase), P450 17α-hydroxylase (17α-OH), Fas antigen/CD95/APO-1 (Fas), Fas ligand (FasL), LH receptor (LHR), FSH receptor (FSHR) and β-actin...... 115
4.2 Experiment 1: Concentrations of steroid hormones in follicular fluid and histological characteristics of the granulosa cell membrane in dominant follicles collected at H 12, H 36 or after emergence of a new follicular wave (NW) in heifers treated with 1 mg EB i.m./500 kg body weight (EB) on Day 5.6 ± 0.1 of the estrous cycle (designated as Hour [H] 0), as compared to contemporary untreated controls (C) ...... 116
xiv 4.3 Experiment 3: Steroid hormone concentrations in follicular fluid (FF) of the first dominant follicle at Day 6.4 ± 0.1 of the estrous cycle (designated as Hour [H] 0; 0HC), at H 24 (24HC) or at H 24 with administration of 1 mg EB i.m./500 kg body weight at H 0 (24HEB)...... 117
5.1 Intervals from treatment initiation to emergence of a new wave of ovarian follicular development in cattle administered estrogen at various stages of follicular wave development and during periods of elevated progesterone/progestin in circulation from exogenous and/or endogenous sources...... 140
5.2 Intervals from treatment initiation to time of maximal concentration of FSH (FSH peak) and emergence of a new follicular wave in cows receiving 0 (0EB), 1 (1EB), 2 (2EB) or 4 (4EB) mg estradiol benzoate (EB) i.m. per 500 kg BW immediately after ablation of all ovarian follicles >4 mm in diameter 6.4 ± .2 d after ovulation ...... 141
xv
LIST OF FIGURES
Figure Page
2.1 Endocrine feedback signals between the ovaries (CL; corpus luteum: DF; dominant follicle) and the hypothalamic-pituitary axis when peripheral concentrations of (a) progesterone are elevated (e.g. during luteal phase) or when progesterone concentrations are (b) basal (e.g. after luteolysis)...... 59
2.2 Schematic representation of follicular dynamics during the estrous cycle in a cow having two waves of ovarian follicular development. Corresponding profiles of ovarian steroid hormones and gonadotropins in peripheral circulation are depicted in upper panels. Shaded vertical bars depict estrus ...... 60
2.3 Schematic adapated from Carr (1998) depicting the principal pathways of steroidogenesis in ovarian follicles. Bolded arrows designate the preferred route in conversion of cholesterol to estradiol (Fortune and Quirk, 1988). Enzymes are italicized ...... 61
2.4 Schematic depiction adapted from Fortune and Quirk (1988) of the "two- cell, two-gonadotropin" hypothesis underlying steroidogenic function in ovarian follicles...... 62
2.5 Schematic diagram of morphological changes during apoptosis (redrawn from Wilson and Potten, 1999)...... 63
2.6 Mean diameters of the second dominant follicle (DF2) relative to the time of emergence of the third dominant follicle (DF3) during the estrous cycle in cattle treated with 1 mg EB (T-3W) compared to untreated animals (C- 3W) undergoing spontaneous follicle wave turnover (data from Burke et al., 2000a)...... 64
2.7 Hypothetical representation of spontaneous follicular patterns (Panel a) in three cows (A, B and C) in contrast to when these follicular wave patterns are regulated (Panel b) by induction of atresia (Objective 2), allowing new follicular growth (Objective 3) and induction of estrus with ovulation (Objective 1) of a mature healthy follicle (DF) (* designates ovulation)...... 65
xvi 3.1 Outline of treatments applied relative to emergence of a new wave of follicular development in prepubertal heifers in Exp. 1. EB1: initial injection of estradiol benzoate (EB; 1 mg/500 kg BW); IPI; intravaginal progesterone insert; EB2: second injection of EB (0.75 mg EB/500 kg BW); YDF: “young” dominant follicle; MDF: “mature” dominant follicle...... 84
3.2 Distribution of intervals from treatment initiation to detected emergence of a new follicular wave in prepubertal heifers (Exp. 1) or anestrous cows (Exp. 3) treated with an intravaginal progesterone insert (IPI) and 1 mg EB/500 kg BW (EB1), or in heifers having estrous cycles that were administered EB1 on Day 6 of the estrous cycle (Exp. 2)...... 85
3.3 Mean intervals to estrus (follicle maturity x EB treatment, P < 0.05) and ovulation (EB2 treatment, P < 0.05) in postpubertal heifers (Exp. 2) following an injection of PGF 1 to 2 d (YDF) or 4 d (MDF) after emergence of a new DF followed with (EB2) or without (NoEB2) an injection of 0.75 mg EB/500 kg BW 24 h later ...... 86
3.4 Diameter of follicles on the ovaries of an individual cow (Exp. 3) showing ovulation on the right ovary of a large follicle from the previous follicular wave despite the induction of a new follicular wave on the left ovary four days prior ...... 87
3.5 Average daily concentrations of progesterone in plasma of anestrous cows nursing calves (Exp. 3) following removal of an intravaginal progesterone insert (IPI) 1 to 2 d (YDF) or 4 d (MDF) after emergence of a new DF followed with an injection of 0.75 mg EB/500 kg BW 24 h later. Treatment means that differed within Day of estrous cycle (treatment x Day, P < 0.05) are denoted with (*) ...... 88
3.6 Average cross-sectional area of corpora lutea in anestrous cows nursing calves (Exp. 3) following removal of an intravaginal progesterone insert (IPI) 1 to 2 d (YDF) or 4 d (MDF) after emergence of a new DF followed with an injection of 0.75 mg EB/500 kg BW 24 h later. There was a main effect of treatment (P < 0.01) but no treatment x Day of estrous cycle interaction (P > 0.1) ...... 89
4.1 Experiment 1: Plasma concentrations of estradiol (a), diameter of the first dominant follicle (DF1; b), plasma concentrations of progesterone (c) and FSH (d) in heifers that received 1 mg EB i.m./500 kg BW (EBNW) on Day 5.6 ± 0.1 of the estrous cycle (Hour [H] 0) as compared to untreated contemporaries (CNW)...... 118
4.2 Experiment 1: Frequency of LH pulses/12 h (a), amplitude of LH pulses (b) and mean concentrations of LH (c) during periods of 12 h beginning at
xvii H -12, 0, 24 and 48 in heifers that received 1 mg EB i.m./500 kg BW (EBNW; n = 7) on Day 5.6 ± 0.1 of the estrous cycle (Hour [H] 0) as compared to untreated controls (CNW; n = 7) ...... 119
4.3 Experiment 1: Example photographs of follicular wall for representative animals of the EB-treated groups; 12EB (a to d), 36EB (e to h) and EBNW (i to l) visualized at 400 X. Hematoxylin and eosin (e and i). DAPI (a and j). Positive control (DNase treated) TUNEL (b and f). TUNEL sample (c, g and k). Negative control (TdT omitted) TUNEL (d, h and l). RBCs; Red blood cells. GCs; Granulosa cells. APC; Apoptic granulosa cell...... 120
4.4 Experiment 2: Concentrations (LSMs) of FSH during the 48 h period after administration of 1 mg EB i.m./500 kg BW (EB) on Day 13.7 ± 0.2 of the estrous cycle (designated as Hour [H] 0) as compared to contemporary untreated controls (C). Concentrations of FSH for individuals at H 0 were used as a covariate in the model. Differences (P < 0.05) between treatments within time are designated with an asterisk ...... 121
4.5 Experiment 2: Follicular fluid concentrations of estradiol (a), progesterone (b), testosterone (c), and androstenedione (d) in dominant follicles aspirated at H 12, 24, 36 or 48 in heifers treated with 1 mg EB i.m./500 kg BW (EB) on Day 13.7 ± 0.2 of the estrous cycle (designated as Hour [H] 0), as compared to contemporary untreated controls (C)...... 122
4.6 Experiment 3: Concentrations (LSMs) of FSH during the 24 h period after administration of 1 mg EB i.m./500 kg BW (24HEB; n = 8) on Day 6.4 ± 0.1 of the estrous cycle (designated as Hour [H] 0) as compared to contemporary untreated controls (24HC; n = 7). Treatment x time; P = 0.06...... 123
4.7 Experiment 3: Abundance of mRNA for aromatase (a), 17α-hydroxylase (b), FSHR (c), LHR (d), Fas (e) and FasL (f) relative to β-actin in follicular wall of the first dominant follicle at Day 6.4 ± 0.1 of the estrous cycle (0HC; n = 6; designated as Hour [H] 0), at H 24 in untreated controls (24HC; n = 7) or at H 24 in animals administered 1 mg EB i.m./500 kg body weight at H 0 (24HEB; n = 8). Unique letter labels denote differences (P < 0.05)...... 124
5.1 Mean concentrations of estradiol (E2) in circulation of cows receiving 0 (0EB, ○ ), 1 (1EB, □ ), 2 (2EB, ● ) or 4 (4EB, ■ ) mg estradiol benzoate (EB)/500 kg BW i.m. immediately after ablation of all ovarian follicles >4 mm in diameter 6.4 ± 0.2 d after ovulation. Blood samples were collected until emergence of a new follicular wave was confirmed ...... 142
xviii 5.2 Mean concentrations of FSH in circulation of cows receiving 0 (0EB, ○; SEM = 0.20), 1 (1EB, □; SEM = 0.18), 2 (2EB, ●; SEM = 0.17) or 4 (4EB, ■; SEM = 0.16) mg estradiol benzoate (EB)/500 kg BW i.m. immediately after ablation of all ovarian follicles >4 mm in diameter 6.4 ± 0.2 d after ovulation. Blood samples were collected until emergence of a new follicular wave was confirmed ...... 143
5.3 Mean concentrations of estradiol in circulation relative to the timing of new follicular wave emergence of cows receiving 0 (0EB, ○ ), 1 (1EB, □ ), 2 (2EB, ● ) or 4 (4EB, ■ ) mg estradiol benzoate (EB) per 500 kg BW i.m. immediately after ablation of all ovarian follicles >4 mm in diameter 6.4 ± 0.2 d after ovulation ...... 144
xix
CHAPTER 1
INTRODUCTION
The ability to effectively synchronize and induce estrus in female cattle is essential for the expansion of the use of artificial insemination (AI) in beef systems and to achieve acceptable levels of reproductive competence in various cattle production systems. Many tools have been developed to control the estrous cycle in cattle that have the potential to increase reproductive efficiency, while also facilitating the use of superior genetics. A detectable display of estrous behavior in cattle is one essential requirement in breeding systems that apply AI on the basis of detection of estrus. Estrous detection efficiency varies widely between production systems and is a major limitation to reproductive competence in many classes of female cattle. Exogenous estradiol can be used to induce a predictably-timed behavioral estrus. However, in order for conception to occur to an insemination, estrus must be accompanied by a constantly-timed ovulation of a healthy follicle containing a fertile oocyte. The probability of successfully accomplishing this endpoint with an estrous control system is dependent upon providing the appropriate ovulatory signal at the suitable stage of follicular maturity. A successful
1 alignment also requires that the wave-like pattern of ovarian follicular development be synchronized to ensure the presence of a healthy mature follicle at the time that the ovulatory signal is provided.
Although there is much current “applied” activity targeted to test various estrous control regimens, the problem remains that there is a substantial lack of understanding of how these reproductive technologies alter the normal function of the processes that control follicular growth, estrus and ovulation. Several experiments were conducted to address three objectives to further our understanding of these processes.
Objective 1: To determine the impact of stage of ovarian follicular development on the capacity of exogenous estradiol to induce estrus, ovulation and a normal luteal function in beef cattle.
Objective 2: To elucidate the biochemical and molecular responses in dominant ovarian follicles induced to become atretic by treatment with estradiol.
Objective 3: To assess whether treatment with estradiol directly affects timing of the new wave of follicular development, independently to its effects on dominant follicles
(DFs).
These objectives are addressed respectively in the three experimental chapters (3 to 5) of this dissertation.
2
CHAPTER 2
LITERATURE REVIEW
2.1 Introduction
The scope of this review ranges from the applied to the fundamental aspects of cattle reproduction. The challenges and opportunities for improving cattle productivity through reproductive management technologies are initially addressed, followed by some basic reproductive physiology with an emphasis on ovarian follicular development. The historical development of estrous synchronization technologies is then discussed, leading to our current state of knowledge regarding the use and application of estradiol for this purpose. The review concludes with a problem statement from which the objectives of this dissertation are based.
2.2 Reproductive Challenges and Opportunities in Cattle Systems
Reproductive performance is a major contributor to the efficiency of all cattle production systems. Pregnancy rate (PR) is an important indicator of reproductive performance, and can be defined as the number of cows pregnant divided by the number
3 cows to be bred. For breeding systems that rely on artificial insemination (AI), the product of conception rate (CR; number of cows conceiving to AI divided by the number of cows inseminated) and submission rate (SR; number of cows inseminated divided by the number cows to be bred to AI) defines the PR (i.e., PR = CR x SR). In herds where animals are submitted for AI on the basis of a detected estrus, SR will be a dependent on estrous detection efficiency (EDE) as well as the prevalence of animals having estrous cycles, and therefore the proportion eligible to be detected in estrus. The EDE is a function of a combination of the skills employed for estrous detection, the proportion of cows that show signs of behavioral estrus in conjunction with ovulation and the intensity of the behavioral estrus. Animals in which estrus is not detected or in which estrus is not exhibited in conjunction with a fertile ovulation represent a major reproductive loss since an opportunity for conception is delayed by approximately 21 days. A subtle, but perhaps an as important loss occurs when the timing or occurrence of estrus is incorrectly diagnosed, leading to insemination at an inappropriate interval in relation to ovulation.
Therefore, deficiencies in estrous detection can adversely influence PR through both direct effects to reduce EDE, and indirectly through a reduction in CR.
The efficiency of estrous detection varies widely among production systems, management styles and reproductive classifications of cattle. For example, in seasonal production systems with beef and dairy cattle, EDE can exceed 90% during the first portion of the breeding season in cows that were having estrous cycles before the onset of the breeding season (Anderson and Day, 1998; McDowell et al., 1998; Xu et al., 1998).
However, in these same production systems, the proportion of females that may be anestrus at the start of the breeding season can range from 10 to 60% (Anderson and Day,
4 1998; McDowell et al., 1998; Xu et al., 1998). A significant prevalence of anestrum has a major negative impact on the SR of the entire herd during the early portion of the breeding season, and represents the largest source of reproductive failure in the New
Zealand seasonal-based dairy system (Rhodes et al., 2003). In traditional high-producing dairy systems in the USA, seasonal production is not emphasized and cows are allowed a voluntary waiting period of about 60 d after calving before they become eligible for AI.
Even though the majority of them have resumed having estrous cycles by this time (about
80%; W. W. Thatcher, personal communication; Stevenson et al., 2001), EDE in these cyclic cows is only 40 to 50% (Senger, 1994; M. C. Wiltbank, personal communication).
This component in reproductive failure was estimated to cost the USA dairy industry more than $300 million annually (Senger, 1994), and is additional to losses of about $140 for each individual cow of the 6 to 19% of cows that develop ovarian cysts (Bartlett et al.,
1986; Silvia et al., 2002).
Various hormonal technologies have, or are, being developed to overcome infertility problems associated with anestrus and inabilities to detect estrus; for the purpose of adequately timing insemination with ovulation (Day et al., 1998a; 1998b).
While the end point of increased pregnancies is consistent for all of these estrous control systems, the approach taken to achieve this goal varies between technologies. One approach that was originally developed to substitute for the reduced estrous behavior of high-producing dairy cows incorporates the use of gonadotropin-releasing hormone
(GnRH) to induce ovulation in the absence of estrous behavior (Pursley et al., 1997). All animals are inseminated irrespective of estrus so that SR equals 100%, and thus PR = CR.
5 However, the reliability of AI programs of this nature, that circumvent detection of
estrus, varies with production system, animal age and reproductive status (Day et al.,
1998a; Thatcher et al., 1999).
Alternative regimens involving progesterone and prostaglandin F2α (PGF2α) control estrous cycles by synchronizing the proestrous phase and providing a degree of stimulus to the reproductive system of anestrous females, but require the events of estrus and ovulation to be spontaneously generated by the endogenous reproductive axis of the female. Using this approach in post-pubertal heifers, Stevenson et al., (1996) found that detection of estrus by visual observation was only 73% effective. In anestrous cattle, this approach resulted in a synchronously induced ovulation in approximately 70% of females; however, estrus was not detected in up to 30% of the cows that ovulated
(Macmillan et al., 1995; Fike et al., 1997; Anderson and Day, 1998). The addition of estradiol at 24 to 48 h after the end of progesterone treatment facilitates a stronger and more synchronized expression of estrus (Hanlon et al., 1996; Lammoglia et al., 1998).
With this approach, estrous detection rates exceeding 90% in cows that have initiated estrous cycles (Day et al., 2000), and elimination of ovulations in the absence of behavioral signs of estrus in anestrous cows were achieved (Macmillan et al., 1995; Fike et al., 1997). Furthermore, the proportion of anestrous cows that were induced to ovulate and show estrus was increased to 80 to 90% (Macmillan et. al., 1995; Fike et al., 1997).
Therefore, the use of estradiol to induce and ensure detection of an estrus that is accompanied by ovulation has the potential to greatly increase EDE (and SR) and thereby enhance PR.
6 Some cattle industries are consciously aiming at achieving adequate reproductive performance while minimizing a reliance on the use of hormones. An example is the New
Zealand dairy industry where a prolonged period of anovulatory anestrus postpartum is the major source of reproductive failure. The motivation for reduced use of hormones appears to be to increase and/or maintain global market access for their dairy products, and long-term sustainability of animals in their production system. While these are legitimate goals, they should not distract from fundamental studies that investigate biological mechanisms using hormones purposefully as a tool. In fact, a reduced reliance on exogenous hormones will place an even greater importance on understanding the biological processes responsible for establishing pregnancy in cattle. Such knowledge will contribute to identification and exploitation of physiological processes to enhance
PR, even for farming systems that emphasize a minimal usuage of exogenous hormones to managing reproduction in the herd.
2.3 Ovarian Follicular Development in Cattle
2.3.1 An Overview of the Hypothalamic-Pituitary-Ovarian Axis
Regulation of ovarian function in mammals occurs primarily through the stimulatory actions of follicle-stimulating hormone (FSH) and luteinizing hormone (LH;
Figure 2.1) that are synthesized in gonadotropes within the anterior pituitary gland. Galen
(129-201 AD) proposed that the function of the pituitary is to drain mucus from the brain
(Asa et al., 1995). Thus the name 'pituitary' is derived from Greek ptuo (to spit) and Latin pituita (mucus; Thorner et al., 1998). The actual function of the pituitary gland came to
7 light during the 20th century, and this gland is now known to produce at least six hormones that have pivotal roles in all aspects of body function (Thorner et al., 1998).
The pituitary hormones responsible for coordinating reproductive function (i.e., LH and
FSH) are heterodimeric glycoproteins sharing a common α-subunit of about 96 amino acids with two asparagine-linked carbohydrate chains (Bhasin and Swerdloff, 1995). The glycosylated β-subunits of about 115 amino acids are unique between LH and FSH, and confer their biological specificity to respective receptors; LHR and FSHR located on ovarian structures.
The synthesis and release of LH and FSH from the anterior pituitary is stimulated by a hypothalamic decapeptide called gonadotropin-releasing hormone (GnRH; Asa et al., 1995; Figure 2.1), which was the second of the various hypothalamic hormones to be identified (Schally et al., 1971). The hypothalamus is a poorly defined anatomic region at the base of the brain. Cell surface G-protein-coupled, 7-transmembrane domain receptors for GnRH are located on the gonadotropes in the anterior pituitary (Sealfon et al., 1997).
All hypothalamic hormones regulating the release of anterior pituitary hormones are released from the median eminence into a portal plexus capillary system that supplies the underlying anterior pituitary (Asa et al., 1995). Thus, hypothalamic hormones are not required to enter general circulation to regulate pituitary hormone release.
Both FSH and LH are released from the pituitary in a pulsatile manner in cattle
(Rahe et al., 1980; Schallenberger et al., 1985), and the frequency and amplitude of these pulse episodes varies with stage of the estrous cycle. A pulse of LH occurs approximately every hour during the early (metestrous) and late (proestrous) stages, but at a reduced rate
(3 pulses/ 12 h) during the luteal phase of the estrous cycle (Rahe et al., 1980; 8 Schallenberger et al., 1985). However, the amplitude of LH pulses is greater during the luteal phase, compared with other times (as depicted in Figure 2.2). Pulses of FSH are greater during the proestrous phase (1 per h) compared to other stages of the estrous cycle
(1 per 2 h; Schallenberger et al., 1985). In a more recent study, the temporal relationship between pulses of LH and GnRH were monitored in cerebrospinal fluid at different stages of the estrous cycle in heifers (Yoshioka et al., 2001). During the proestrous and early luteal phases, pulses of GnRH occurred at a rate of 1.1 to 1.2 per h and 82 to 85% of these pulses induced a corresponding pulse release of LH (Yoshioka et al., 2001).
During the mid-luteal phase, pulse frequency of GnRH declined to 0.8 per h and only
60% were accompanied with a corresponding pulse of LH. On no occasion was an LH pulse detected without a corresponding GnRH pulse.
In ewes, the mode of LH release from the pituitary is also singularly pulsatile, whereas release of FSH was found to be both basal and episodic in nature (Padmanabhan et al., 1997). In this previous study, each pulse episode of GnRH induced a pulse of LH and FSH. However, additional pulses of FSH not corresponding to a pulse of GnRH were observed, suggesting that there also exists a component to FSH secretion that is independent of GnRH. A later study provided direct evidence of this in ewes by blocking the GnRH receptor with an antagonist and observing a complete attenuation of LH pulses, but a continuation of some FSH release episodes (Padmanabhan et al., 2003). The mechanistic nature of the GnRH-independent release component of FSH is not known, although involvement of GnRH isoforms (e.g., GnRH-II) acting via the GnRH-II receptor was a suggested possibility (Padmanabhan et al., 2003).
9 Gonadotropins stimulate growth and development of ovarian structures to produce steroids and protein factors that feed back on the hypothalamic-pituitary axis to modulate release of LH and FSH (Figure 2.1). The ovarian feed back on release of these tropic hormones is predominantly negative in nature, with the exception of the estradiol- induced LH surge that induces ovulation (Figure 2.1b). The decline in LH pulse frequency during the luteal phase is attributed to an increase in negative feed back by luteal progesterone on the hypothalamic-pituitary axis (Figure 2.1a). This is supported experimentally in studies where administration of progesterone to cattle reduced LH pulse frequency (Ireland and Roche, 1982b; Price and Webb, 1988), and in studies where pulse frequency increased after luteolysis was induced (Ireland et al., 1984). The effect of exogenous progesterone in reducing the frequency of LH pulses in cattle is rapid (within
6 h) and dose-dependent (Bergfeld et al., 1996).
In sheep, progesterone acts at the hypothalamus to reduce the frequency of GnRH pulses (Karsch et al., 1987). The findings of Yoshioka et al. (2001) suggest that progesterone has the same action in cattle, but these researchers also observed that a pulse of GnRH was less likely to induce a pulse of LH during the luteal phase. This could be a consequence of progesterone having a direct negative effect at the pituitary, although studies in sheep by Nett et al. (2002) suggest differently. Through an elaborate series of studies performed in vitro, they demonstrated that GnRH released from the hypothalamus has a positive feed back on its own receptor in the cell membrane of gonadotropes in the pituitary, and that progesterone acts indirectly to dislocate this positive feed back mechanism through suppression of GnRH release at the hypothalamus.
10 The effects of estradiol on circulating concentrations of LH are modulated by progesterone (Stumpf et al., 1993; Price and Webb, 1988). Several studies in ovariectomized cattle have demonstrated that small doses of exogenous estradiol increase concentrations of LH in circulation by enhancing the amplitude of LH pulses (Day et al.,
1986; Stumpf et al., 1988 and 1989; Kinder et al., 1991). These responses may be due to enhanced production of LH in the pituitary because studies performed in cultured ovine pituitary cells have found that estradiol stimulates synthesis of LH (Nett et al., 2002).
Other studies in which greater concentrations of estradiol in circulation were achieved and where gonadotropin responses were examined within a shorter time frame, found that concentrations of LH and amplitude of the LH pulses were reduced (Wolfe et al., 1992;
Price and Webb, 1988). These same studies demonstrated that estradiol also reduces concentrations of FSH in circulation. Estradiol inhibits synthesis of FSH in cultured ovine pituitary cells (Nett et al., 2002), but the more potent inhibitor of FSH secretion is follicular inhibin (Turzillo and Fortune, 1993; Kaneko et al. 2002).
2.3.2 Morphological Dynamics of Ovarian Follicular Development
Wavelike patterns of follicular development are observed in the ovaries of cattle during prepuberty (Hopper et al., 1993), the estrous cycle (Savio et al., 1988; Sirois and
Fortune, 1988), and during the first trimester of pregnancy (Ginther et al., 1989a).
Beyond the first trimester (>90 d), the wave-like follicular development continues but the diameter of the dominant follicle (DF) gets progressively smaller. In the final month of pregnancy, there is an absence of follicles >5 mm in diameter (Ginther et al., 1996a).
Follicular development resumes within days after calving, with each successive wave
11 containing a larger DF until ovulatory cycles are initiated (Murphy et al., 1990;
McDougall et al., 1995). During the estrous cycle of cattle, there are two or three distinct waves of follicular development (Savio et al., 1988; Sirois and Fortune, 1988; Ginther et al., 1989b). These events are schematically portrayed in Figure 2.2 using an example of a cow having two waves of follicular development during the estrous cycle.
2.3.3 Development of Ovarian Primordial Follicles
Primordial follicles are dervived from oocytes (female germ cells) and pre- granulosa (somatic cells surrounding the oocytes). The mechanisms involved in this process called gonadogenesis are not well understood. Studies performed in laboratory animals (see Richards, 2001) demonstrate the involvement of cell-to-cell communications via gap junctions (connexin 43) and stimulatory actions from members of the transforming growth factor-β (TGF-β) family, specifically bone morphogenetic proteins
(BMPs). In mammals, the greatest rate of gonadogenesis occurs during fetal life (see
Webb, 1999; Richards, 2001). Tanaka et al. (2001) evaluated follicle numbers and developmental stages in the ovaries of bovine fetuses at various stages of gestation. In this informative study, the estimated number of germ cells declined from about 3 million to 40,000 between 91 and 160 d of gestation, and further declined to about 16,000 at 285 d of gestation. The prevalence of primordial follicles increased between 74 and 120 d of gestation, and then remained static (about 8,000) to 285 d of gestation.
Development of primordial follicles through the primary (single layer of granulosa cells) and secondary stages (greater than a single layer of granulosa cells) of preantral development takes several weeks or months and is referred to as "initial"
12 recruitment (McGee and Hsueh, 2000). Initial recruitment is not to be confused with
"cyclic" recruitment, which refers to development of a cohort of antral follicles to form a wave of ovarian follicular development (see Section 2.3.4). In the study of Tanaka et al.
(2001), primary follicles first appeared in fetal ovaries at 91 d of gestation and increased in numbers through 150 d before remaining static at about 3,000 to 285 d of gestation.
Secondary follicles were first observed at 120 d and numbers remained static at about 500 between 150 to 285 d of gestation. Interestingly, early antral follicles were observed at
150 d and increased in numbers through 285 d of gestation, with the largest being 1.2 mm in diameter. The progression of follicular development was associated with increased concentrations of FSH in fetal circulation between 120 and 150 d of gestation.
Why some primordial follicles undergo initial recruitment, while others remain quiescent is not known. However, a basic framework of what is known about this process has been reported (Richards, 2001). During initial recruitment, the oocyte of the primordial follicle contributes in the initiation of follicular growth by expressing growth initiation factors, including a transcription factor called "factor in the germline-α" (Fig-
α). Synthesis of structural proteins required for formation of the zona pellucida, a protective envelope around the oocyte, is stimulated by Fig-α. This transcription factor is also involved in other processes as somatic cells in close proximity to the oocyte are organized into granulosa cells. The basal lamina is subsequently formed, providing an outer boundary for the granulosa membrane that is not penetrated by capillaries. Theca cells are then organized upon the outer side of the basal lamina. Growth and differentiation factor-9 (GDF-9), an oocyte derived TGF-β molecule is important in formation of the theca cells. Several other factors (e.g., TGFα, Kit ligand, Cyclin D2, and 13 vascular endothelial growth factor [VEGF]) have been identified to be involved as communicative microenvironments are established between the oocyte and cumulus cells, and between the granulosa and thecal cells (McGee and Hsueh, 2000; Richards, 2001;
Glister et al., 2003; Danforth et al., 2003). Receptors for FSH (FSHR), Insulin-Like
Growth Factor-1 (IGF-1R) and estradiol (ERα and ERβ) begin to appear on granulosa cells of secondary follicles, leading to subsequent proliferation of this cell type and thus the development of the granulosa membrane. Induction of FSH receptors is locally promoted by dimeric activin glycoproteins (Hasegawa et al., 1988). Follicles at this stage of development have transformed from being gonadotropin-independent to FSH- dependent, with the next phase of growth further requiring FSH support. The importance of ovarian follicles to acquire FSH receptors has been demonstrated in the FSHR gene- knockout mouse model, where follicular development was arrested at the preantral stage in mice with a mutated FSHR gene (Abel et al., 2000).
2.3.4 Recruitment of Ovarian Follicles into the Large Antral Growth Phase
As assessed by transrectal ovarian ultrasonography (Ginther et al., 2001), 'cyclic' recruitment of ovarian follicles is characterized with the emergence of several follicles about 4 mm in diameter that continue growing at 1 to 2 mm per day during a 'parallel' growing phase for 2 to 3 days (Figure 2.2). An average of seven follicles develop beyond
5 mm in diameter during a wave of follicular development (Ginther et al., 2001). A transient increase in FSH that peaks about one day before or at emergence of the wave of follicular development is responsible for follicular recruitment (Adams et al., 1992;
Ginther et al., 1996a). The increase in FSH that promotes new follicular development
14 occurs as a consequence of the previous DF becoming atretic or ovulating, and no longer suppressing circulating FSH through production of estradiol and inhibin (Kaneko et al.,
1997; Tohei et al., 2001). Follicles recruited in the growing phase have FSH receptors on granulosa cells and LH receptors on theca cells (Richards, 1994). At this stage of development, they have not yet attained LH receptors on the granulosa cells (Ireland and
Roche, 1982a, 1983a and 1983b; Xu et al., 1995a).
During cyclic recruitment of ovarian follicles, messenger RNAs (mRNAs) encoding cytochrome P450 side-chain cleavage enzyme (P450scc) and cytochrome p450 aromatase are increased in the granulosa cells (Xu et al., 1995b; Bao et al., 1998). These enzymes, among others, catalyze key steps in steroidogenesis, where cholesterol is ultimately converted to estrogens (Figure 2.3). The steroidogenic processes occurring in thecal cells are stimulated by LH, whereas aromatase activity in granulosa cells is stimulated by FSH. Signal transduction for either gonadotropin occurs via a G-protein coupled 7-transmembrane domain receptor (LHR an FSHR, respectively) with adenosine-
3',5'-cyclic monophosphate (cAMP) and protein kinase A (PKA) executing the gonadotopin signal (Erickson and Magoffin, 1983). These phenomena constitute the basis of the 'two-cell, two-gonadotropin' hypothesis depicted in Figure 2.4.
2.3.5 Selection of the Dominant Ovarian Follicle (DF)
Cattle are a monovular species, typically giving birth to a single calf. The underlying reason is that a single ovarian follicle among all those recruited is selected to attain full maturity and the opportunity to ovulate, while others regress (Figure 2.2). The underlying biological mechanism for selection of a follicle from which ovulation occurs
15 remains unclear, despite a large research effort to understand this phenomenon (see
Ginther et al., 2001; Fortune et al., 2001; Mihm and Austin, 2002). Concentrations of
FSH in circulation decline during the selection phase of ovarian follicular development
(Figure 2.2) in response to the negative feed back actions of estradiol and inhibin that are produced by the cohort of growing follicles (Figure 2.1: Ginther et al., 2000; Gibbons et al., 1997). A generally accepted hypothesis is that the follicle to be selected for dominance has an inherent advantage over others in the cohort, and is able to continue development during the decline in circulating FSH that occurs after recruitment while other follicles cease growing and regress. The most compelling evidence for this is that administration of FSH during the selection phase prevents the selection process from occurring, and results in the presence of multiple mature ovarian follicles (Adams et al.,
1993; Mihm et al., 1997).
Ginther et al. (2000) described the process of selection as a "close functional two- way coupling system" between declining FSH concentrations and follicular selection.
The basis of this hypothesis is that FSH stimulates all recruited ovarian follicles to grow, and in doing so, each contributes to suppressing FSH secretion through production of estradiol and inhibin. All but the subsequently formed DF are unable to continue developing as concentrations of FSH decline to basal. Subordinate follicles are atretic at five days after emergence of the developing follicular wave (Adams et al., 1993; Ko et al., 1991) and the DF alone continues to inhibit FSH secretion and prevent new waves of follicular development. The final phase in selection is marked by a 2 to 3 mm deviation in the diameters of the largest versus second largest follicle of the follicular wave. On average, deviation occurs about three days after follicular emergence when the largest
16 growing follicle is about 8.5 mm in diameter (Ginther et al., 1996b). In some cases where two large follicles continue growing beyond 10 mm ("co-dominance"), the nature of deviation is the same except that it occurs between the first and third largest follicle of the follicular wave (Kulick et al., 2001). The morphological dynamics associated with deviation is consistent among all waves of follicular development during the estrous cycle (Kulick et al., 2001).
A revolutionary technique was developed where a small sample (approx. 20 µL) of follicular fluid could be collected from follicles without compromising their continued development through the selection process (Ginther et al., 1997a; Mihm et al., 2000).
This allowed researchers to retrospectively compare key factors in follicular fluid of subsequently formed DFs to those that became subordinate, prior to deviation. The original study using this technique (Ginther et al., 1997a) suggested that the subsequently formed DF could not be determined on the basis of diameter or estradiol content prior to the time of deviation. However, other reports from the same laboratory did demonstrate that the subsequently formed DF is more likely to emerge sooner than its subordinates and maintain a 0.5 mm size advantage equivalent to an eight hour growth interval throughout the parallel growth phase, prior to deviation (Ginther et al., 1997b; Kulick et al., 1999).
Other studies (Mihm et al., 2000; Austin et al., 2001; Rhodes et al., 2001) have demonstrated that the subsequently formed DF has greater aromatase activity, is more estrogenic and has increased bioavailability of IGF that stimulates growth and steroidogenesis. The relative increase in bioavailable IGF in the selected follicle was associated with reduced amounts of IGF binding protein-4 (IGFBP-4; Mihm et al., 2002).
17 Increased degradation of IGFBP-4 and IGFBP-2 in preovulatory follicles of several domestic species is attributed to an IGFBP protease identified as pregnancy-associated plasma protein-A (PAPP-A: Conover et al., 1999). In addition, abundance of mRNA for some of the IGFBPs is reduced in healthy follicles, as compared with atretic follicles (see
Monget et al., 2003). These combined effects result in the increased bioavailability of
IGF that is characteristic of healthy developing ovarian follicles (Mazerbourg et al., 2001;
Monget et al., 2003).
The role of LH in the follicular selection process has been evaluated (Ginther et al., 2001) with the view that the selected follicle is the one that opportunistically switches from being predominantly FSH-dependent to being supported by LH. The results of this previous study suggested that the follicle selected for dominance does not become LH- responsive until after deviation. Expression of mRNA for LHR occurs in thecal cells of all sizes but not in granulosa cells until follicles surpass 9 mm in diameter (Xu et al.,
1995a; Bao et al., 1998), although a more recent study reported that mRNA for LHR in granulosa cells increased in the largest follicle eight hours before the time of deviation
(Beg et al., 2001). Crowe et al. (2001) used GnRH-immunized heifers as an animal model to evaluate the independent and combined roles of FSH and LH on ovarian follicular development. Heifers treated with LH alone had no ovarian follicles ≥ 5 mm in diameter.
Treatment with FSH alone stimulated growth of follicles up to the 10 mm, but not beyond this stage of development. When both FSH and LH were provided, mature estrogenic follicles ≥ 10 mm in diameter were able to develop. This previous study supported other evidence that indicated growth of small to medium sized follicles (5 to 9 mm) is FSH- dependent, while later stages of growth and maturity are LH dependent (Findlay et al., 18 1996; Gong et al., 1996). Because the process of follicle selection is ongoing throughout the parallel growing phase between recruitment and deviation, it appears doubtful that
LH has a decisive role in selection of the DF.
The possibility that ovarian follicles interact directly with one another in the selection process has been postulated (Fortune, 1994). Studies have been reported indicating inhibition of follicular development without reducing concentrations of FSH in heifers treated with bovine follicular fluid that was free of inhibin (Law et al., 1992), or in which heifers were immunized against inhibin (Wood et al., 1993). While these previous studies suggest the potential existence of an auxiliary mechanism of dominance, they do not provide the necessary evidence of a direct effect of the DF on subordinate follicles. If such a direct inhibitory factor existed, then it would also need to be endocrine in nature because dominance by the DF residing on a single ovary is exerted over all other follicles on both ovaries with the only feasible connection being via systemic blood circulation.
While functional differences between the DF and its' subordinates have been well characterized, an unequivocal mechanism explaining the origin of how a single follicle of a cohort of recruited follicles becomes dominant does not (yet) exist. Renowned researchers engaged in this area (Fortune, 1994; Ginther et al., 2001) are left to conclude that the subsequently formed DF is a recruited follicle "in the right place at the right time" to take an immediate growth advantage that is not relinquished through the selection phase of ovarian follicular development.
19 2.3.6 Ovarian Follicular Dominance
The dominance phase of ovarian follicular development is characterized morphologically by the presence of a single large follicle approximately 12 to 17 mm in diameter, while subordinate follicles regress and there is an absence of new follicular wave development (Figure 2.2). Dominant follicles exist in this 'plateau' growth phase for typically 5 to 7 days (Sirois and Fortune, 1988; Savio et al., 1988). Concentrations of estradiol in ovarian venous blood and in follicular fluid of the DF during the first wave of ovarian follicular development of the bovine estrous cycle is maximal during the growth phase of the DF, and declines throughout the plateau phase (Badinga et al., 1992; Price et al., 1995; Rhodes et al., 1995). The DF is responsible for preventing development of other gonadotropin dependent follicles. This has been demonstrated in studies where the
DF was aspirated using a needle, with this manipulation allowing either a resurgence in growth of the largest subordinate follicle, or a completely new wave of follicular development to emerge (Ko et al., 1991). Cessation in growth appears to be due to the DF obtaining a developmental status where current LH support is sufficient for maintenance, but not further growth. This has been demonstrated by studies where concentrations of
LH were artificially increased by providing low concentrations of progesterone that result in increased concentrations of LH (Sirois and Fortune, 1990), or by direct administration of LH (Taft et al., 1996). In both studies, the DF was observed to increase in diameter and persist beyond its' normal lifespan.
As discussed in the previous section, the possibility that the DF produces a factor(s) that directly inhibits development of other follicles has not been discounted, although compelling evidence of this does not exist. In contrast, exertion of dominance
20 systemically with the negative feed back actions of follicular estradiol and inhibin on gonadotropin secretion, FSH in particular, has been well documented (Figure 2.1: Price and Webb, 1988; Turzillo and Fortune, 1993). Kaneko et al. (2002) found a close inverse relationship between circulating FSH and inhibin A during the follicular growth phase in cattle during various reproductive states, but no relationship between plasma FSH and estradiol in postpartum anovulatory cows or during the mid-luteal phase of the estrous cycle. Their data indicated that inhibin A is the more potent negative regulator of FSH as compared with estradiol. Inhibins are disulphide-linked heterodimeric glycoproteins and members of the TGF-β superfamily (Knight and Glister, 2001). Various isoforms exist, but the mature bioactive forms are inhibin A and inhibin B. Each comprises a common α subunit, but differs with the β subunit being activin A or activin B. The development of assays to specifically quantify bioactive dimeric inhibin (Bleach et al., 2001; Kaneko et al., 2002) was crucial to understanding the physiology associated with inhibin.
Intrafollicular inhibin B declines throughout the selection process, while inhibin A increases after selection and is the predominant form in DFs (Beg et al., 2002).
Synthesis of estradiol is a core function of the DF since this steroid has multiple intraovarian actions (Rosenfeld et al., 2001; Schams and Berisha, 2003) and systemically, has a crucial coordinating role in the ovulatory/fertilization events (see Sections 2.3.8 and
2.3.9). Estradiol-17β (estradiol) is a C18-steroid with an aromatic 'A' ring, a phenolic hydroxyl group at C-3 and a hydroxyl group at C-17 (Figure 2.3). The other naturally occurring estrogen in follicles is estrone, which differs only from estradiol by having a ketone group at C-17 (Figure 2.3: Carr, 1998). Estradiol is the principal form that is secreted by follicles. The steroidogenic pathways that covert cholesterol to estradiol are 21 depicted in Figure 2.3. Most cholesterol enters theca cells in the form of low-density lipoproteins (LDL; Gwynne et al., 1982), and is initially converted to pregnenolone by the cytochrome P450 side chain cleavage (SCC) enzyme. Steroidogenic acute regulatory protein (StAR) transports cholesterol from the outer to inner membrane of mitochrondria, which is where conversion to pregnenolone takes place and is considered to be a rate- limiting step in steroidogenesis (Clark et al., 1995). The primary route of estradiol synthesis is the ∆5 pathway that transforms pregnenolone to androstenedione via 17α- hydroxypregnenolone and dihydroepiandrosterone (Figure 2.3), because pregnenolone is a much more effective precursor of androstenedione as compared with progesterone
(Fortune, 1986). The first two reactions are catalyzed by a single enzyme complex, cytocrome P450 17α-hydoxylase/17,20-lyase (17α-OH), and the final step in the ∆5 pathway is catalyzed by 3β-hydroxysteroid dehydrogenase/∆5-∆4 isomerase (3β-HSD:
Conley and Bird, 1997).
Thecal cells are responsible for the supply of androgen substrates to granulosa cells because the latter cell type does not contain the 17α-OH enzyme (Fortune and
Quirk, 1988; Xu et al., 1995b). Pregnenolone produced by granulosa cells moves into theca cells for conversion to androstenedione (Figure 2.4). Conversely, aromatization of androgens to estrogens occurs exclusively in granulosa cells, because aromatase is present in granulosa cells but not thecal cells. There is evidence of a local feed back mechanism whereby estradiol stimulates androgen production in theca cells, which in turn, results in greater substrate availability for estradiol synthesis in granulosa cells
(Fortune, 1986; Roberts and Skinner, 1990). Because the granulosa membrane is avascular, gap junctions composed of conexin proteins have an important role in 22 intracellular signaling among granulosa cells, and between other cells in the follicle
(Anderson and Albertini, 1976). Estrogens enhance the formation of these gap junctions in rats (Burghardt and Anderson, 1981).
Thus, estradiol has a major role as a local regulator of ovarian follicular development and can influence cellular function through multiple signaling pathways.
Estradiol is known to elicit rapid (non-genomic) effects on cellular function by binding to a membrane bound estrogen receptor (ER; Levin, 1999). However, the classical actions of estradiol are mediated after diffusing through the plasma membrane, and binding to
ERs in the nucleus that then form an activated dimer complex (see Tsai et al., 1998).
Once activated, these ER complexes can function as signal inducers or as transcription factors (Couse and Korach, 1999). Two major forms of ER are presently known; ERα and ERβ (see Klinge, 2000). Both forms are present in bovine granulosa and theca cells, although ERα predominates in theca and is upregulated as follicles become more estrogen active (Schams and Berisha, 2002).
The absence or presence of an ovulatory LH surge determines the eventual fate of the DF. As a consequence, the DF becomes atretic (Section 2.3.7) or it generally ovulates
(Section 2.3.8).
2.3.7 Ovarian Follicular Atresia
The establishment of pregnancy in cattle is most commonly achieved following fertilization of a single oocyte expelled from a single follicle during the ovulatory process. However, many more follicles in the ovary are recruited into a growing phase than will be required for the provision of an oocyte for fertilization. As will be discussed 23 in the following section (Section 2.3.8), ovulation can only occur during a defined period of the estrous cycle in cattle that have attained puberty and are neither pregnant nor anestrus. These periods represent only very limited "windows of opportunity" for ovulation over the lifetime of females. However, the wavelike pattern of ovarian follicular development is essentially an uninterrupted process throughout the lifetime of cattle beginning within the first four weeks after birth. Given the limited opportunity for follicles to ovulate, the vast majority of ovarian follicles (>99%) are destined for death and regression, a physiological process referred to as atresia. In the early stages of atresia in nonovulatory DFs, a reduction in aromatase activity and estradiol synthesis is observed
(Price et al., 1995) without substantial changes to gonadotropin receptor numbers on granulosa cell s (Bodensteiner et al., 1996). Loss of estrogenic capacity may (Badinga et al., 1992; Lucy et al, 1992) or may not (Xu et al., 1995b; McNatty et al., 1984) be associated with a reduction in the content of androgen precursors. In atretic DFs, the granulosa membrane is eroded, and cells with pyknotic nuclei are prevalent. Estradiol content in follicular fluid is basal, while concentrations of progesterone are increased
(Price et al., 1995).
Atresia in ovarian follicles is facilitated by a "programmed-cell death" process called apoptosis. The term, apoptosis, was coined by Kerr et al. (1972) after observing a unique form of death in adrenal cells following withdrawal of adrenocorticotrophic hormone stimulation. Apoptosis was initially shown to occur in the ovaries of rats
(Hughes and Gorospe, 1991), chickens and pigs (Tilly et al., 1991), and subsequently considered to be an evolutionarily conserved process for ovarian follicular atresia in all animals (Kaipia and Hsueh, 1997). Cellular demise by apoptosis is distinguished from the
24 other two forms of death, necrosis and terminal differentiation, in that it involves a pre- programmed and orderly dismemberment of the cell. During apoptosis, the nuclear DNA is cleaved by Ca2+/Mg2+ dependent endonuclease enzyme into fragments varying in size by multiples of 185 to 200 base pairs (Wyllie, 1980). Cells in which nucleic DNA is fragmented can be detected using the 'terminal deoxynucleotidyl transferase (TdT)- mediated dUTP nick-end-labeling (TUNEL) procedure (Gavrieli et al., 1992). The TdT enzyme incorporates a labeled dUTP to the free 3'-hydoxyl ends of the fragmented DNA that can subsequently be detected. During apoptosis, the entire cellular contents are disassembled in an orderly fashion while the cell membrane remains intact (Figure 2.5).
The morphological hallmarks of apoptotic cells include cell shrinkage, membrane blebbing and chromatin condensation (van Engeland et al., 1999). Inversion and externalization of phosphotidyl serine from the inner to the outer leaflet of the plasma membrane is an early characteristic in apoptosis and can be detected using a high affinity binding protein called Annexin V (Martin et al., 1995). The remnant pieces (apoptotic bodies) of the dead cell are phagocytosized by neighboring cells (Figure 2.5). Dynamic organs and tissues, such as the ovary, rely heavily on the apoptotic process for efficient remodeling.
The signals regulating the onset of apoptosis are cell-specific, but the morphological and biochemical events that occur during apoptosis are conserved among the animal kingdom. The actual mechanism of apoptosis in a small nematode
(Caenorhabditis elegans) is essentially the same as that in the mammalian ovary (Hsu and Hsueh, 2000). The process can be sequentially categorized into stages of: i) upstream signaling by 'survival' factors; ii) decision-making and signaling; and iii) execution of
25 apoptosis by caspase enzymes referred to as the 'caspase cascade' (Hsu and Hsueh, 2000).
The disappearance of survival factors and/or the appearance of cytotoxic factors, signal the decision-making machinery to initiate apoptosis. The decision-making cellular machinery for apoptosis is comprised of the Bcl-2 protein family. Some of these proteins act to prevent apoptosis (e.g., Bcl-2) while others are pro-apoptotic in nature (e.g., Bax).
The decision to initiate apoptosis or not, is believed to lie in the balance of these anti- and pro-apoptotic factors.
The signals that activate the caspase cascade to initiate apoptosis are complex.
They may be extrinsic (e.g., absence of external survival factors or presence of cytotoxic factors) or intrinsic (e.g., intracellular stress). There now appears to be two distinct locations from which the signal for apoptosis can be propagated (Adrain and Martin,
2001). The first discovered signal mechanism for apoptosis was activation of membrane bound receptors of the TNF receptor family, such as Fas antigen (Fas) being activated by
Fas ligand (FasL), that were dubbed as 'death receptors'. Recently it has been discovered that the apoptotic signal can also originate from the release of cytochrome c from the mitochrondria in response to cellular stresses (Green and Reed, 1998). Cytochrome c promotes assembly of a caspase-activating complex called an apoptosome that in turn activates the caspase cascade leading to apoptosis. Either of the signals leads to a ubiquitous execution of regulated apoptosis by proteolytic enzymes of the caspase family
(Hsu and Hseuh, 2000). This process is known as the caspase cascade and is regulated at multiple sites of the apoptotic cascade of cellular events to safe guard the life/death switch within the cell (Zheng and Flavell, 2000).
26 Cell survival is an active process and requires the maintained support of ‘survival factors’ to prevent apoptosis. Removal of these survival factors and the shift in balance to favor apoptosis through the Bcl-2/bax decision making step will activate the caspase cascade and result in cell death. Survival factors for mammalian ovarian follicles may originate from the follicles themselves and/or from the pituitary (Hsu and Hsueh, 2000).
Estradiol produced by granulosa cells stimulates cell proliferation and is a major antiapoptotic factor within the follicle (Billig et al., 1993; Mihm et al., 2000; Schams and
Berisha, 2002). Potential mechanisms for these effects have been investigated in ewes
(Lund et al., 1999). In this previous study, aromatase activity in preovulatory follicles was acutely suppressed by administration of Arimidex, and concentrations of circulating estradiol declined to basal 12 h after treatment. An accumulation of testosterone, lipid peroxidation and a decline in granulosa cell numbers occurred in the follicle 24 h after treatment. Additional studies showed that a mitogenic marker, proliferating cell nuclear antigen, was upregulated in granulosa cells by estradiol, and that estradiol protected granulosa cells from oxidative stress-induced apoptosis (Lund et al., 1999). Thus, estradiol has a major role in growth and maintenance of healthy follicles. Intrafollicular estradiol, and other putative survival agents (e.g., IGFs) are stimulated by gonadotropins
(LH/FSH). There is a significant amount of evidence that FSH is important (Yang and
Rajamahendran, 2000), and it is well established that the normal lifespan of the DF in cattle is greatly extended by increased frequency of LH pulse episodes (Sirois and
Fortune, 1990; Taft et al., 1996).
With few exceptions, the information in the literature describing morphological and biochemical events in follicles during atresia is based on retrospective classification
27 of follicles from ovaries collected at the abbatoir. No reports could be found that
evaluated sequential changes over time following induction of atresia. However, there are
two notable reports in the literature that investigate intrafollicular responses following
administration of a steroidal agent to induce atresia in the DF. The first of these was
performed in cattle (Manikkam and Rajamahendran, 1997) to determine the effect of
exogenous progesterone on development and function of DFs that were moderately
persistent. Contents of estradiol, IGF-I and II in follicular fluid, and aromatase activity in
granulosa cells were all markedly reduced in treated animals, whereas content of IGFBPs
were increased. The other study used the Rhesus monkey as an animal model to study the
effect of exogenous estradiol on induction of atresia of the DF (Hutz et al., 1986). The
morphological state of granulosa cells from the DF collected four days after estradiol
treatment was described in this previous study. Compared with untreated controls,
numbers of granulosa cells were not different, but substantial cell death had occurred in
the DF of treated animals. This agreed with other research in non-human primates
showing that granulosa cell numbers don’t diminish greatly until the late stages of atresia
(McNatty et al., 1979), but viability can be reduced within 48 h of treatment (Silavin and
Greenwald, 1984).
2.3.8 Ovulation
Ovulation is an alternative outcome to atresia, although ovulation occurs in < 1% of ovarian follicles. An LH surge from the anterior pituitary is responsible for inducing ovulation. The LH surge is triggered by a coincident surge of GnRH after activation of the "surge center" in the hypothalamus (Karsch et al., 1997). The duration of the GnRH
28 surge in sheep (Moenter et al., 1991) and cattle (Yoshioka et al., 2001) is considerably longer as compared with the LH surge. Down-regulation of GnRH receptors and depletion of LH in the pituitary probably accounts for the attenuated LH surge (Nett et al., 2002). An elevation in circulating concentrations of estradiol, in the absence of significant peripheral progesterone, is a required condition for activation of the hypothalamic surge center, leading to the ovulatory LH surge (Evans et al., 1997; Figure
2.1b). The increase in estradiol is simultaneously responsible for induction of behavioral estrus in cattle (Kesner et al., 1982). The behavioral estrus aspect is addressed in the next section of this review (Section 2.3.9).
Kaneko et al. (1991) observed in cattle that the initiation of the elevation in concentrations of estradiol coincided with the onset of luteolysis, which occurred three to four days before the ovulatory surge of LH in this previous study. Concentrations of estradiol increased from 2 pg/mL to 12 pg/mL during this 84 h period. The calculated constant rate of increase (0.7 pg/mL per six hours) agreed with previously published work in cattle (Coe and Allrich, 1989). Ireland et al. (1984) measured effluent concentrations of estradiol in the utero-ovarian veins (bilaterally) during the diestrous phase of the estrous cycle in cattle, and found an increase within three hours after administration of PGF2α. The increase was observed primarily from a single ovary, presumably the ovary bearing the preovulatory follicle. Pulses of estradiol measured in blood from the caudal vena cava correspond with pulses of LH in cattle (Walters and
Schallenberger, 1984; Rhodes et al., 1995). Thus, the preovulatory follicle is immediately responsive to the changing hormone environment associated with luteolysis. Prior to the
LH surge, the preovulatory follicle becomes increasingly sensitive to LH, because the
29 binding capacity of LH to receptors in theca and granulosa cells of the bovine preovulatory follicle increases throughout the proestrous phase, while binding of FSH in granulosa cells diminish (Ireland and Roche, 1983b). Circulating concentrations of LH and estradiol increase progressively throughout the proestrous phase of the estrous cycle of cattle (Walters and Schallenberger, 1984; Imakawa et al., 1986).
The exact mechanism of how estradiol triggers the LH surge is unclear. The region of control would appear to be in the hypothalamus because the LH surge is triggered by a GnRH surge (Yoshioka et al., 2001). However, it is also evident that estradiol sensitizes the pituitary to release more LH in response to GnRH (Kinder et al.,
1991). A synchronous surge of LH and FSH are observed, followed about 4 to 24 h later by a second FSH increase of lesser magnitude (Figure 2.2: Dobson, 1978; Walters and
Schallenberger, 1984; Kaneko et al., 1991). Emergence of the first wave of ovarian follicular development during the estrous cycle in cattle is dependent on the secondary increase in FSH (Turzillo and Fortune, 1990). A decline in peripheral concentrations of estradiol coincides with the peak of the LH surge. The magnitude of this decline (10 pg/mL in 30 h; Kaneko et al., 1991) is described as precipitous (Schams et al., 1977).
Three major processes (Hafez, 1987) occur during ovulation: 1) nuclear and cytoplasmic maturation of the oocyte; 2) cumulus cell dissociation from granulosa cells, and; 3) thinning and rupture of the apical follicle wall and expulsion of the oocyte.
Nuclear maturation is characterized by chromosome condensation, germinal vesicle
(nuclear envelope) breakdown and resumption in meiosis from the prophase-I to the metaphase-II stage (Bevers et al., 1997). Cytoplasmic maturation involves various molecular and structural changes required for successful fertilization and embryonic
30 development (Bevers and Izadyar, 2002). The granulosa-type cells that surround the oocyte (called cumulus cells) undergo expansion and dissociate from the 'mural' granulosa cells, thus freeing the cumulus oocyte complex (COC) so it can be expelled after rupture of the follicle (Eppig, 2001).
The apical region of the ovulatory follicle wall must be broken down in order for the COC to be expelled at ovulation. Several factors are involved in this process, as well as in the transition of follicular tissue to luteal tissue that occurs in ovulated follicles. A study using a microdialysis system implanted within the follicle wall was conducted to determine in vivo changes in vasoactive peptides, prostaglandins and steroids during ovulation in cattle (Acosta et al., 2000). Local synthesis of progesterone, androstenedione and estradiol increased in a transient manner concomitant with the ovulatory LH surge.
Marked increases in PGF2α and angiotensin-II within the follicular wall were observed at the expected time of ovulation, about 30 h after the onset of the LH surge. An earlier study in cattle clearly identified the involvement of PGF2α and PGE2 in the ovulatory process after using indomethacin to inhibit prostaglandin synthesis and completely blocking ovulation (Algire et al., 1992). The role of the prostaglandins is to induce vasodilation, increase vascular permeability and stimulate collagen breakdown in order for the follicle to rupture (Murdoch et al., 1986). Thus, ovulation has been likened to an inflammatory reaction (Espey, 1980). Angiotensin-II, in association with other vasoactive peptides (e.g., endothelin-1 and atrial natriuretic peptide) stimulate angiogenesis, and the newly formed corpus luteum becomes immensely vascular.
After the LH surge has occurred, binding of LH to theca cells, and LH or FSH to granulosa cells is greatly reduced (Ireland and Roche, 1983b). This loss in gonadotropin 31 responsiveness after the LH surge is associated with a cessation in estradiol synthesis
(Staigmiller et al., 1982). Oxytocin is probably involved in this process because oxytocin production by granulosa cells increases substantially during the period between the LH surge and ovulation (Voss and Fortune, 1991 and 1992). Oxytocin inhibits production of androgens and estradiol but stimulates progesterone synthesis in preovulatory follicles (Jo and Fortune, 2002). Both granulosa and theca cells of preovulatory follicles have receptors for oxytocin (Jo and Fortune, 2003). Thus, the increase in oxytocin production by granulosa cells following the LH surge is believed to be a key factor in the transformation of follicular cells to luteal cells. Additionally, the bi-directional type of communication that occurs between the oocyte and follicular cells is removed at ovulation (see Eppig, 2001). Oocytes will undergo the final maturation process spontaneously if removed from antral follicles; similarly, granulosa cells spontaneously luteinize in the absence of the oocyte. Thus, the physical separation of the oocyte from granulosa cells at ovulation is one important event that allows the default pathways of final oocyte maturation and follicular cell luteinization to occur.
2.3.9 Behavioral Estrus
Around a dozen behavioral characteristics of estrus in cattle have been described
(Katz et al., 1980; Cook et al., 1986), including inter-animal conflict activity, flehmen, vulva sniffing, chin resting, bellowing, attempted mounting activity and congregating into sexually active groups. However, the definitive absolution of a heifer/cow in estrus is when this animal stands immobile while being mounted from the rear by other cattle.
Those that are not in estrus will rapidly terminate contact if another attempts to mount.
32 Females that mount, or attempt to mount another animal, are more likely themselves to be in estrus or in the proestrous phase of the estrous cycle than in the anestrous, luteal and pregnant states of reproduction (Helmer and Britt, 1985; Vailes et al., 1992). A number of variables can be used to quantify the estrous event in cattle. These include incidence of estrus, duration of estrus, number of mounts, duration of mounts, intervals between mounts and intervals from administration of specific treatments to onset of estrus (Xu et al., 1998; Cavalleri et al., 2003).
The event of estrus is substantially impacted by demands of production and nutritional status. There is a plethora of evidence demonstrating that cows with the greatest milk production are less likely to have a fully expressed estrus (see Senger,
1994). Energetic demand for production aside, Burke et al. (1996b) investigated the effect of body weight loss on estrous cycle characteristics in non-lactating dairy cows.
Feed allowance was progressively restricted such that these animals lost 20% of their body weight (BW) over a period of six months. They were then offered a generous feeding allowance to regain the lost weight during the subsequent six months. Only one of these cows became anovulatory after the 20% body weight loss, but the estrous detection rate at the nadir in body weight was reduced to 40%, compared with > 80% preceding this nadir and 100% once the cows were on an increasing plane of nutrition.
These results demonstrated that expression/detection of behavioral estrus is negatively affected by lreduced body weight associated with restricted feeding, and is more sensitive to this negative impact as compared with the process of ovulation.
A number of other factors besides nutrition influence the characteristics of behavioral estrus. A recent study conducted in a subtropical environment found that
33 breed, temperature-humidity index, type of estrus (synchronized versus spontaneous) and social dominance status were all factors that influenced expression/detection aspects of behavioral estrus (Landaeta-Hernández et al., 2002). Concrete flooring and lameness are detrimental to estrous expression (Britt et al., 1986). A common factor for many of the variables that reduce expression of estrus is stress, and this is supported by findings that administration of stress response hormones (i.e., adrenocorticotropin and cortisol) inhibits estrous behavior as well as the LH surge (Stoebel and Moberg, 1982). The animals’ sense of ‘well-being’ is perhaps an underestimated quantity regarding factors that might regulate estrous activity. A review of the 'higher' nervous activity of cattle (Baryshnikov and Kokorina, 1964) indicated that cattle have acute sensory capabilities. They can distinguish the colors of the spectrum, have an accurate sense of light intensity, acute hearing, and a keen sense of smell and taste. Cattle would be acutely aware of any environmental stimuli and these might influence the nature of estrous behavior. There are various efferent signals coming from these exteroceptive, as well interoceptive, sensory centers of the brain to the hypothalamus (Asa et al., 1995), and likely other regions of the brain influencing behavior.
The onset of estrus occurs at about the same time as the LH surge (Tables 2.1 and
2.2). As previously mentioned, the initiation of the proestrous increase in estradiol begins with the onset of luteolysis in cattle having estorus cycles and continues to increase for at least three days before the onset of estrus and the ovulatory LH surge occurs (Kaneko et al., 1991). In ovariectomized cattle treated with estradiol, an elevation in circulating concentrations of estradiol to levels above the threshold required to induce estrus is achieved in less than four hours (Lammoglia, 1998). In this situation, the interval to onset
34 of estrus is about 18 h, while the timing of the LH surge remains coincident with this onset of estrus (Table 2.2). Greater doses of estradiol administered do not greatly alter this timing (Lammoglia et al, 1998). The mechanistic events relating to the induction of estrus that occur during this period of about 18 h remains unknown, and there is little information in the literature that addresses this topic. A traditional belief is that the actions of estradiol on the brain are mediated via intracellular binding to ERs (Blaustein and Olster, 1989; Pfaff and Schwartz-Giblin, 1988). In sheep, there are numerous locations in the brain that are identified as being estrogen responsive (Lehman et al.,
1993). However, greatest ER densities are found in regions (e.g., medial preoptic area and medial hypothalamus) that are implicated in facilitating aspects of reproductive behavior (Pfaff and Schwartz-Giblin, 1988; Sachs and Meisel, 1988).
With regard to the neuroendocrine mechanism that underlies the estrous event, it is very notable that the onset of behavioral estrus and the ovulatory LH surge are coincident, even when comparing cattle in which the preceding conditions leading to estrus are quite different (e.g., spontaneous versus estradiol-induced estrus and LH surge). As previously discussed, estradiol activates the "surge center" in the hypothalamus which results in a surge release of GnRH to induce the LH surge from the pituitary (Figure 2.1b). The coincidence in timing of events raises the possibility that the estrous event is mediated by some factor closely associated with the GnRH surge, and not by estradiol directly. This possibility has been raised previously following the observation that the onset of estrus and onset of the surges in GnRH and LH all occurred at about 67 h in heifers after treatment with PGF2α (Yoshioka et al., 2001). These researchers further demonstrated that the surge in GnRH lasted several hours longer than
35 the LH surge, and considerably overlapped the 14 h period of behavioral estrus in these heifers. They suggested that GnRH might have a role in sexual behavior in cattle, but
Cook et al. (1986) found no effect of injecting 500 µg GnRH 10 h after estradiol treatment on the characteristics of estradiol-induced estrus in ovariectomized cattle.
Most vertebrate animals have two or more forms of GnRH that occur in distinct neuronal populations within the hypothalamus (see Temple et al., 2003). In mammals, the best characterized is GnRH-1 (mammalian-GnRH), and is generally and simply referred to as 'GnRH'. Another common, and more evolutionary primitive isoform occurring widely among mammals is GnRH-II (Millar et al., 1999), also referred to as 'chicken-
GnRH', which binds to specific type II GnRH receptors (Sun et al., 2001). Both these isoforms of GnRH are decapeptides, but GnRH-II differs from GnRH-I at amino acids 5,
7 and 8, as follows:
GnRH-I pGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-Gly-NH2 (see Asa et al., 1995)
GnRH-II pGlu-His-Trp-Ser-His-Gly-Trp-Tyr-Pro-Gly-NH2 (Sherwood et al., 1993)
The interesting thing about GnRH-II is that it has recently been found to activate mating behavior in the feed deprived musk shrew within minutes of administration
(Temple et al., 2003). Further, these actions were associated with GnRH-II specifically binding to GnRH type II receptors located in regions of the brain associated with mating behavior. Clegg et al. (1958) demonstrated in ewes that electrolytic lesions to the ventral hypothalamus just above the median eminence consistently abolished the capability of the animals to have behavioral estrus, despite seven of nine animals continuing to have
36 estrous cycles. In sheep, most GnRH-1 neuron bodies are located in the preoptic area
(POA) and project to the median eminence where GnRH is released (see Robinson,
1995). These GnRH neurons do not contain ERs so estradiol must regulate GnRH release through some intermediary factor. Gama amino-butyric acid (GABA) neurons are also present in the POA and are considered a good candidate as an intermediary, because these possess ERs (Herbison, 1995) and also form synapses with GnRH neurons (Karsch, et al., 1989). Given the above evidence, it is possible that estradiol activates an intermediary signaling factor in the hypothalamus that results in the simultaneous surge release of GnRH-I that triggers the LH surge at the pituitary to induce ovulation from the ovary, while simultaneously causing the release of GnRH-II that targets specific regions in the brain to initiate behavioral estrus.
The proposed involvement of GnRH-II in behavioral estrus is based on speculation, but it does have merit with regard to building a hypothesis toward examining the underlying signals responsible for this behavior. Such a mechanism would explain the temporal coincidence between the LH surge and onset of behavioral estrus, because this coordination remains rigidly intact across variant scenarios leading to these events.
2.4 Use of Exogenous Estradiol to Manipulate Reproduction
2.4.1 Historical Developments in Estrous Synchronization
Original attempts to synchronize estrus in cattle were based on the knowledge that progesterone prevents the occurrence of estrus and ovulation (Christian and Casida,
1948). Various forms and methods of administration of progestins were subsequently 37 tested, and generally shown to be effective at synchronizing estrus (Trimberger and
Hansel, 1955; Hansel et al., 1961; Roche, 1974). Relatively long durations of progestin treatment (14 to 18 d) were necessary to allow for the spontaneous occurrence of luteolysis before treatment withdrawal (Roche, 1979). These treatment regimens produced a highly synchronized, but ‘infertile’ estrus (Trimberger and Hansel, 1955;
Wishart, 1977).
Attempts were made to shorten the duration of progestin treatment by using pharmacological doses of estradiol to induce luteal regression rather than relying on the spontaneous occurrence of luteolysis (Wiltbank and Kasson, 1968; Mauleon, 1974).
Synchrony and fertility tended to be variable because responses to estradiol were different between the various stages of the estrous cycle (Lemon, 1975; Miksch et al.,
1978; Pratt et al., 1991). The identification of PGF2α as the natural luteolysin
(McCracken et al., 1972) led to the development of synthetic forms of PGF2α that were substantially more effective than estradiol at inducing luteolysis during diestrus
(Lauderdale, 1975). However, estrous synchrony and fertility responses continued to remain variable with progestins and PGF2α (Wishart, 1974; Thimonier et al., 1975).
The precision of synchrony of estrus remained vulnerable to stage of the estrous cycle at which luteal regression was induced (King et al., 1982; Stevenson et al., 1984).
Furthermore, it was noted that conception rates to the synchronized estrus were reduced when short-term progestin treatments, combined with PGF2α were initiated in the last third of the estrous cycle (Beal et al., 1988; Brink and Kiracofe, 1988).
38 To this point, the capacity to prevent estrus until a desired time with progestins, and to predictably induce regression of the corpus luteum with PGF2α had been achieved, however, the efficacy of estrous synchrony programs using this approach was limiting. Although it had been known for some time that ovarian follicular development was not a random event in cattle (Rajakoski, 1960), the relevance of this for synchrony of estrus was not realized and the means to control follicular development was not a deliberate component of estrous synchrony systems. It was not until the technique of ovarian ultrasonography was applied to monitor daily changes throughout the estrous cycle that the wave-like pattern of follicle growth was characterized in detail (Savio et al., 1988; Sirois and Fortune, 1988; Ginther et al., 1989b).
The problems associated with the use of progestins to synchronize estrus became apparent shortly following the characterization of the normal pattern of follicular growth that occurs during the estrous cycle. The wave-like pattern of follicular development was interrupted by administration of progestins in the absence of a corpus luteum, resulting in prolonged lifespan of the DF present at the time of luteal regression
(Sirois and Fortune, 1990). It has since been demonstrated that lesser than midluteal phase concentrations of progesterone, or administration of progestins at doses typically used to synchronize estrus in cattle, results in a greater frequency of LH pulses than when a corpus luteum is present (see Kinder et al., 1996). The greater LH secretion is associated with elevated concentrations of estradiol (Roberson et al., 1989), extended lifespan of the DF and development of abnormally large, "persistent" DF (Savio et al.,
1993). Termination of progestin treatment permits occurrence of the LH surge (Kesner
39 et al., 1982) and ovulation of persistent follicles (Stock and Fortune, 1993). While the
timing of estrus is typically very precise following removal of a progestin in cattle with
persistent follicles, fertility at the resultant estrus is reduced (Sanchez et al., 1993). It
has been demonstrated that if the lifespan of a DF is prolonged four days beyond
normal, fertility is reduced (Mihm et al., 1994). Fertilization rate of oocytes released
from persistent follicles does not appear to be affected, however, the resulting embryo
dies before the 16-cell stage of development (Ahmad et al., 1995). As a result of this
inherent characteristic associated with the use of progestins, the ‘compromising’
situation existed that acceptable conception rates (i.e., >60%) could not be achieved
even though the use of progestins could produce a highly precise estrus (i.e., >85% in
24 h).
2.4.2 Current Strategies in Estrous Synchronization
This primary disadvantage to the use of progestins for estrous synchrony in cattle is balanced against the many benefits that progestins provide for estrous control.
Advantages to the use of progestins include: induction of onset of estrous cycles in prepubertal heifers and anestrous, postpartum cows; reduction of the incidence of short- lived corpora lutea associated with the first ovulation in anestrous cattle; increased number of cattle responding with luteal regression in response to a single injection of
PGF2α; and suppression of estrus in cattle administered exogenous estradiol or subjected to superovulation for the purposes of embryo transfer (see Day, 1998b). As a result of the numerous positive aspects of the use of progestins, considerable research has been
40 performed to develop technologies that garner the advantages provided by progestins, while avoiding the negative aspects of altered follicular growth associated with their use. The underlying objective of most of these investigations has been to develop methods to regulate ovarian follicle growth and synchronize estrus to avoid ovulation of persistent follicles.
2.4.3 Use of Estradiol to Synchronize Ovarian Follicular Development
An approach to overcome the problem of development of persistent follicles when progestins are used to synchronize estrus is to manage the "normal" population of follicles that exist in the ovary. This approach is designed to wholly prevent development of persistent follicles and coordinate synchronous follicle wave turnover.
An excellent tool for this purpose is the use of estradiol to reset follicular development through the induction of atresia of ovarian follicles (Bo et al., 1995a and 1995b) before development of persistent follicles can occur with progestin-based treatments. However, the application of estradiol to estrous control systems extends beyond the capacity to regulate the process of follicular turnover. Estradiol can also be used to synchronize the events of estrus and ovulation after progestin withdrawal (see Section 2.4.4). For either indication, the effects of estradiol are mediated through the gonadotropic axis, with the presence or absence of progesterone determining the type of response elicited by estradiol (Figure 2.1).
One of the earliest reports suggesting that estradiol may induce atresia of large ovarian follicles came from a study using injections of 10 mg estradiol valerate while
41 investigating ovarian follicular cysts in dairy cows (Engelhardt et al., 1989). The subsequent development of transrectal ultrasonography in cattle allowed researchers to conveniently monitor in vivo ovarian responses to estradiol. Initial studies focused on the early phase of the estrous cycle, during the development of the first DF (Bo et al.,
1995a). It was demonstrated that injected estradiol(-17β) induced atresia of the DF and emergence of a new follicle wave 4.3 ± 0.2 d later. The interval to new wave emergence was consistent regardless of the stage of the growth of the first DF at the time of estradiol treatment.
The development and commercialization of progesterone-based treatments (i.e., progesterone releasing intravaginal device [PRID] and controlled internal drug releasing
[CIDR] insert) routinely included a gelatin capsule containing 10 mg estradiol benzoate
(EB) affixed to the insert to promote luteolysis. It was later found that with the inclusion of estradiol, developers were unwittingly perturbing follicle wave development on the ovaries. This was clearly demonstrated in a field trial involving more than 1000 dairy cows (Macmillan and Burke, 1996). These animals were treated with a CIDR insert for 7 or 12 d, with or without a gelatin capsule containing 10 mg
EB. Relative to stage of the estrous cycle, the timing of insertion was such that the inserts were removed on each of the days between Day 20 and Day 24 after the preceding estrus (estrus = Day 0). Cows were subsequently inseminated on detection of estrus. Inclusion of EB with insertion of a CIDR for seven days decreased the proportion of females inseminated 48 h after removal of the CIDR insert, but increased the proportion inseminated at 48 h in females treated with a CIDR for 12 d. Fertility
42 tended to decline as the interval from CIDR insert removal and the preceding estrus
increased (i.e., 20 to 24 d), while inclusion of EB increased fertility irrespective of this
interval. The effect of including EB with initiation of a progesterone treatment was
most pronounced when treatment was initiated on Day 13 of the estrous cycle.
This field study prompted a series of experiments aimed at characterizing
ovarian responses to treatments involving progesterone and estradiol (Burke et al.,
1997, 1998, 1999, 2000; Bogacz et al. 1999). A common feature to these studies was
that treatments were initiated 13 d after a synchronized estrus, with the critical endpoint
being whether or not a new wave of follicular development occurred prior to ovulation.
Thus this approach has been coined the “Day 13 follicle wave turnover” model (Day
and Burke, 2002). Prior to these studies, ovarian responses to treatments initiated in the
mid- to late-stages of the estrous cycle had not been reported, despite this stage being
perhaps the most difficult and critical time to achieve control of follicle wave dynamics.
The first of these studies (Burke et al., 1999) included four treatments in a 2 x 2
factorial design. Treatments were initiated on Day 13 of the estrous cycle and involved
insertion of a CIDR insert for five days with or without a capsule containing 10 mg EB,
the capsule alone and an untreated control group. Follicle wave turnover occurred in all
animals treated with EB and was characterized by the emergence of a new wave of
follicles 4.0 ± 0.3 d after treatment initiation. Thus all cows receiving an estradiol
capsule had estrous cycles containing three waves of follicular development. In
contrast, the ratio of two and three waves of follicular development during the estrous
cycle was 1:1 when estradiol was not included in the treatment regimen. This previous
43 study showed that 10 mg EB administered intravaginally was effective in promoting follicle wave turnover of a healthy growing DF during a time of peak concentrations of plasma progesterone in non-lactating cows.
However, in a field study with multiple herds of lactating dairy cows that had initiated estous cyclicity (Xu et al., 1996), cows treated with a 10 mg EB capsule per vaginum in conjunction with a CIDR insert had reduced conception rates as compared with cows inseminated at spontaneous estrus. It was inferred from these results that the use of the estradiol capsule was not always preventing development of persistent ovarian follicles in lactating cows. Macmillan et al. (1997) demonstrated that an intramuscular (i.m.) injection of 1 mg EB on Day 12, 13 or 14 of the estrous cycle in lactating dairy cows partially synchronized estrus to an interval of 9 to 10 d after this treatment. Further, it appeared that improved fertility could be gained by administering estradiol as an injection rather than via the intravaginal route (Ryan et al., 1996). A subsequent report (O’Rourke et al., 2000) confirmed that maximal blood concentrations of estradiol following treatment with a capsule containing 10 mg EB were equivalent to that following an i.m. injection of 0.5 mg EB. Lactating dairy cows having initiated estrous cycles and injected i.m. with 2 mg of EB at the initiation of a 7 d-CIDR treatment had conception rates that were equivalent to those for cows inseminated at a spontaneous estrus (Day et al., 2000). Furthermore, conception rates for cows receiving an injection containing 1 mg EB tended to be reduced compared with those receiving 2 mg EB in the same study. Collectively, these results suggested that the 10
44 mg EB capsule provided an inadequate signal for follicle turnover in lactating dairy
cows but that this method might be sufficient in non-lactating animals.
The follicular responses to 1 mg EB i.m. were subsequently investigated using
the “Day 13 follicle turnover model” and was found to be effective in promoting a new
wave of follicular development four to five days later in non-lactating dairy cows
(Burke et al., 2000). In a more recent experiment, this model was used to compare the
efficacy of EB at doses of 0.5, 1 or 2 mg/500 kg BW to induce follicle wave turnover
in non-lactating beef cows (Bogacz et al., 1999). In this previous study, both 1 and 2
mg of EB were highly effective in inducing follicle wave turnover using the “Day 13”
model. Timing of emergence of the new wave of follicles was later with 2 versus 1 mg
of EB. Follicle wave turnover also occurred following injection of 1 mg of EB in
conjunction with insertion of a CIDR in heifers in the early, mid and late stages of the
estrous cycle (Bogacz et al., 2000).
The ability of estradiol to induce follicle wave turnover is dependent on elevated
concentrations of progesterone in circulation. This was clearly demonstrated in cows
that received an injection of 1 mg EB on Day 13 of the estrous cycle and then received
no further treatment, or a luteolytic dose of PGF2α either 0, 24 or 48 h after the injection of EB (Burke et al., 1997). Treatment with PGF2α was effective in inducing a precipitous decline in concentrations of progesterone within 24 h of administration.
Follicle wave turnover, as indicated by the incidence of animals having three waves of follicular development (three-wave), was induced in all animals that did not receive
PGF2α, and in all but one of those receiving PGF2α at 48 h after EB. In contrast, those
45 receiving PGF2α at either 0 or 24 h after EB had estrous cycles with two, three and four
waves of follicular development occurring and some prevalence in development of
cystic follicles that failed to ovulate. This previous study showed that concentrations of
circulating progesterone needed to remain elevated for at least 48 h following estradiol
treatment in order for follicle wave turnover to be induced. These observations raised
the possibility that the chance occurrence of spontaneous luteolysis around the time that progesterone/estradiol synchrony treatments are initiated could prevent the ability of estradiol to induce follicle wave turnover.
Accordingly, a subsequent study investigated whether the addition of an exogenous progesterone source with an injection of 1 mg EB during induced luteolysis in the “Day 13 follicle wave model” would be sufficient to facilitate estradiol-induced
follicle wave turnover (Burke et al., 1998). In this study, cows received a luteolytic
dose of PGF2α on Day 13 of the estrous cycle and then immediately received 1 mg EB
only, a CIDR insert for six days only, or a CIDR insert plus an injection of either 1 or
2 mg EB. All cows not receiving the combination of EB and a CIDR insert had estrous
cycles with two waves of follicular development. In contrast, all cows receiving the
combination of either 1 or 2 mg EB by injection and a CIDR insert had estrous cycles
with three waves of follicular development. This study demonstrated that, in the
absence endogenous progesterone, concentrations of progesterone in circulation were
sufficiently elevated by CIDR treatment to facilitate an estradiol-induced turnover of
follicle waves. A subsequent study found that an i.m. injection of 200 mg progesterone,
rather than insertion of the CIDR in the design described above, was not sufficient to
46 facilitate estradiol-induced follicle turnover (C. R. Burke, unpublished). It was concluded that progesterone in circulation was cleared too quickly to allow for at least a
48 h sustained elevation that the previous study (Burke et al., 1997) showed was necessary for estradiol to promote follicular wave turnover.
All evidence to date suggests that the mechanism by which estradiol induces follicle wave turnover is mediated through systemic mechanisms involving the gonadotropic axis. In ovariectomized cows, treatment with progesterone provided an effective, but transient inhibition of LH secretion (i.e., 36 h) and had no measurable effect on FSH secretion (Burke et al., 1996a). The progesterone-induced suppression of
LH was extended several days by addition of EB at the initiation of the CIDR treatment, and FSH secretion was also depressed. Follicular development is initially supported by FSH while a greater dependency on LH is acquired as DFs mature
(Findlay et al., 1996; Gong et al., 1996). Because progesterone suppresses LH secretion, but not FSH secretion directly, newly developed FSH-dependent follicles may be less affected by progesterone in the absence of estradiol. In contrast, effective suppression of both FSH and LH secretion, by administration of progesterone and estradiol in combination, probably accounts for induction of atresia regardless of age or diameter of the DF. It seems unlikely that estradiol would have a direct atretogenic effect on ovarian follicles because follicular concentrations of estradiol in non-atretic follicles are typically many times greater than in peripheral circulation (Ginther et al.,
1997a). Further, direct placement of estradiol(-17β) into the ovarian stroma adjacent to the DF failed to induce follicle wave turnover (Bo et al., 2000).
47 It is clearly established that EB halts development of growing DFs, and that synchronization of a new wave of follicular development follows this cessation in growth of the DF. The assumption is that a new follicular wave emerges after EB treatment has caused the DF to become atretic and lose its dominance over other follicles. A recent analysis of a data set previously published (Burke et al., 2000) compared the diameter of
DFs among EB-treated and untreated animals relative with the timing of new follicular wave emergence (Figure 2.6). From this, it was evident that the diameter of DFs in treated animals regressed at a faster rate than those untreated and undergoing spontaneous atresia, but that the beginning of this decline in diameter in either group was at least a day after emergence of a new follicular wave. This and other published data (Hutz et al.,
1986), demonstrates that anatomical measures are not sufficiently accurate to study the process of atresia during the period when functional dominance is lost.
2.4.4 Use of Estradiol to Induce Estrus and Ovulation
A detectable display of estrous behavior in cattle is requisite in breeding programs that use AI on the basis of detected estrus. Estrous detection efficiency varies widely between production systems and is a major limitation to reproductive competence in many classes of female cattle (Senger, 1994; Stevenson et al., 1996;
Anderson and Day, 1998; Xu et al., 1998). Several factors may contribute to these variations, including, the reproductive and metabolic status of the animal, the competency of those responsible and the system for detecting estrus, the environment in
48 which the animal is managed, and the responsiveness or opportunity of other animals to interact with an animal in estrus (Helmer and Britt, 1985).
As discussed previously (Sections 2.3.8 and 2.3.9), elevated concentrations of estradiol in the absence of luteal-like concentrations of circulating progesterone are the required hormonal conditions for behavioral estrus and the preovulatory LH surge in cattle. Initial efforts to study this phenomenon were performed using ovariectomized cattle in order to more accurately and conveniently regulate circulating concentrations of ovarian steroids. Asdell et al. (1945) demonstrated that administration of 0.1 mg EB i.m. daily for three days induced estrus in ovariectomized cattle. Ray (1965) tested single administrations ranging from 0.2 to 0.6 mg EB i.m. in ovariectomized beef heifers and found 0.3 mg EB to be a marginal dose (50% response) in inducing behavioral estrus.
Doses of 0.4 mg EB i.m. or greater induced estrus in all animals, while 0.2 mg EB i.m. failed to induce estrus in any heifer. Cook et al. (1986) reported that the interval from administration of EB to estrus (15.5 h) and the duration of estrus (12 h) were independent of dose over the range of 0.125 to 2.4 mg EB i.m. A pharmacological dose of 4.8 mg EB i.m. extended the duration of estrus to 20 h, but did not reduce the interval to onset of estrus. In agreement with previous studies (Ray, 1965; Carrick and Shelton, 1969), Cook et al. (1986) concluded that the minimum dosage required for induction of estrus in >80% of ovariectomized cattle was 0.5 to 0.6 mg EB i.m. This threshold was independent of age and maturity of the animal, as cows and heifers responded similarly in the dose- titration regimen. Taken together, these studies reveal that induction of estrus in ovariectomized cattle using exogenous estradiol is readily achieved. The incidence of an estrous response is dose dependent, but the region of marginal doses is very narrow, to
49 the point that induction of estrus with estradiol has been described as an “all or none”
phenomenon (Allrich, 1994). However, the characteristics of the estrus in animals that
respond are influenced by dose. For example, Nessan and King (1981) consistently
induced estrus in ovariectomized Holstein-Friesian cows by administering three i.m.
injections of 0.25 mg EB 12 h apart, while increasing the dose of this three-injection
regimen to 0.5 mg EB enhanced the intensity and duration of estrous expression.
A biphasic pattern of change in circulating concentrations of LH following
administration of estradiol is evident in ovariectomized cattle (Beck and Convey, 1977)
and ovariectomized sheep (Coppings and Malven, 1976). Concentrations of LH in
circulation are initially reduced between two and six hours after administration of
estradiol, followed by a surge-like increase beginning at 14 h, and lasting 8 to 10 h with a
peak at 18.5 h (Beck and Convey, 1977). Ovarian-intact cattle with basal concentrations
of progesterone in circulation respond similarly to administration of estradiol
(Lammoglia et al., 1998). As in ovarian-intact animals (Table 2.1), the onset of the LH
surge coincides with the onset of estrus (Short et al., 1973). Kesner et al. (1981) used a
'GnRH-challenge' approach (1 µg GnRH/20 min for eight hours) after estradiol treatment in ovariectomized cattle to demonstrate firstly, that estradiol sensitizes the pituitary to
GnRH stimulation, and secondly that an LH surge can be induced by GnRH as early as four hours after estradiol treatment. Thus, the delay of 14 h from administration of estradiol to onset of the LH surge is not a consequence of an unresponsive pituitary, and must designate the temporal requirement of a poorly understood process whereby estradiol is preparing the hypothalamus to secrete the GnRH surge. The biphasic pattern in LH secretion following exogenous estradiol is not observed during the spontaneous
50 proestrous event in cattle (Imakawa et al., 1986), where circulating concentrations of
estradiol increase gradually (Kaneko et al., 1991). Whether this transient suppression of
LH occurs in ovarian-intact animals, and what effect it might have on development of the
preovulatory follicle is not known.
Lammoglia et al. (1998) derived ‘optimal’ doses of EB for use in anestrous
postpartum cows (1 mg EB i.m.), and peripubertal heifers (0.4 mg EB i.m.) to facilitate
the events of estrus and ovulation following a progestin/ PGF2α treatment. At these doses, the intervals from EB injection to maximum blood concentrations of estradiol (cows: 11 h; heifers; 17 h) and the peak of the LH-surge were reported (22 h for cows and heifers).
Although the dose titration showed that the pituitary release of LH was very sensitive to
EB, in no case was there any significant elevation in concentrations of LH until after at least eight hours of elevated concentrations of estradiol. With respect to the interval from injection of EB to peak LH concentrations, ovariectomized cows responded in the same way (Short et al., 1973), suggesting that the ovaries are neither essential nor interfering with exogenous stimulation of the LH surge with estradiol. Short et al. (1973) used 10 mg estradiol(-17β) i.m. to investigate potential interactions between estradiol and progesterone or cortisol on LH secretion in ovariectomized cattle. This dose elevated circulating concentrations of estradiol for 16 h compared with untreated animals. The LH surge occurred on average at 20 h after EB treatment in ovariectomized cattle, ranging from 16 to 24 h (Short et al, 1973). Previous treatment with progesterone did not influence the characteristics of the LH surge.
It remains undetermined whether the dose effect is a function of peak concentrations of estradiol, the period of time that concentrations of estradiol are greater 51 than a threshold concentration, or some relationship involving an interaction between these variables. Two experiments involving ovariectomized ewes were reported by
Fabre-Nys et al. (1993) that had the overall objective of delineating the effects of dose and duration of exogenous estradiol treatment effects. Estrous responses to 25 and 50 µg estradiol(-17β) i.m were initially evaluated to test the effect of dose. Secondly, they compared effects of treating ovariectomized ewes with subcutaneous implants containing two different doses of estradiol(-17β) for between 12 to 48 h. All ewes treated in these experiments become ‘strongly’ receptive to a ram and had an LH surge, showing that the doses and durations chosen for these experiments were above marginal thresholds.
However, they did observe effects of dose and duration on the interval from treatment to estrus and the duration of estrus. There are no reported studies to our knowledge with the specific aim of testing the effect of duration of elevated concentrations of estradiol on induction of estrus and the ovulatory LH surge in cattle.
Estradiol is routinely used in New Zealand dairy herds for treatment of anestrous dairy cows to facilitate the expression of estrus (McDougall et al., 1992).
Estrous response following several days of progesterone treatment by insertion of a
CIDR insert was increased from 70% to over 90% by the addition of an i.m. injection of 1 mg EB 24 h after progesterone withdrawal. Much of the improvement was attributed to the elimination of ‘silent ovulations’ (i.e., ovulation unaccompanied with a detected estrus), because conception rates were not altered even though more animals were inseminated. Thus, the overall improvement by the addition of estradiol was considered largely due to an increase in animals being detected in estrus and submitted
52 for AI (Macmillan et al., 1995; Day et al., 2000). Similar improvements in estrous behavior have resulted from the application of estradiol to anestrous beef cows (Fike et al., 1997) and beef heifers (Rasby et al., 1998) previously treated with a CIDR insert.
The rationale for the use of EB after progesterone withdrawal described above for treatment of anestrous cows has been extended to produce a more precisely synchronized estrus in cows that have initiated estrous cycles before treatment (Day et al., 2000). In especially high-producing dairy cows, the use of estradiol after progesterone treatment is beneficial in alleviating the problem of poor estrous expression that is characteristic of animals under greater metabolic demand (K.L.
Macmillan, personal communication). An issue associated with the use of estradiol for facilitating an expressive estrus after progesterone treatment has been the possibility that this estrus is not subsequently followed by development of a normal corpus luteum.
An assumption is that estrus was not accompanied with ovulation. A recent study involving anestrous dairy cows in New Zealand reported the incidence of “false heats” to be 21.4%, and highly variable among herds (5 to 46%; Rhodes et al., 2003). The negative consequences of an anestrous animal induced to have estrus but not ovulating or resuming having estrous cycles are two-fold. Firstly, the cow has no chance to get pregnant due to ovulation failure. Secondly, if the animal remains anestrus, the farm manager would assume the animal got pregnant for lack of a return estrus. While there are several potential reasons for lack of ovulation, a distinct possibility is the presence of an immature and unresponsive DF at the time that estradiol is administered.
53 2.5 Statement of the Problem
Because follicular development is a dynamic process within an individual animal, all stages of development will be represented at any single time among a group of cattle
(Figure 2.7a). Within a herd, some of these animals will be anovulatory (i.e., Cow B), while others will be having ovulatory cycles (i.e., Cows A and C). To apply an estrous synchronization program, the process of follicular development needs to be regulated within an animal and this regulation must be coordinated across individuals. These programs must contend with this inherent variation in order to be successful. Based upon the nature of follicular development described earlier, three key processes to be controlled are follicular atresia, follicular emergence and ovulation (Figure 2.7b). Some estrous control systems are already developed to at least partially accomplish control of these events, although the underlying mechanisms of control are not always clear.
An on-going problem with all current technologies is the variability in responses when attempting to regulate follicular events through synchronous induction of a new wave of follicular development. With respect to the use of estradiol, some of the sources of variation are known at the animal level. These include factors such as breed, production-type, reproductive status, and stage of estrous cycle. However, little or nothing is known about the underlying causes for this variation at the follicular or endocrine level. This lack of knowledge is hampering improvements in the design of estrous synchronization protocols as well as the application of existing ones.
The overall goal was to investigate fundamental aspects of follicular function when estradiol is used to strategically regulate ovarian follicular development. An
54 increased understanding of these processes is critical for on-going improvements to programs designed to regulate follicular events. The three objectives of the present research that contribute to this are depicted in Figure 2.7b.
Objective 1: Induction of estrus and ovulation with estradiol
This objective was to specifically investigate the impact of maturity of the DF on ovulation when estradiol is used to induce estrus and ovulation. The outcomes of this study would highlight the consequences of not regulating follicular development, and also assess the impact of animal type in this regard. The working hypothesis was that a mature DF must be present in order for estradiol-induced estrus to be accompanied with ovulation.
Objective 2: Induction of follicular atresia with estradiol
In this objective, it was premised that induction of atresia of the DF is of critical importance when estradiol is used to synchronously induce new follicular development.
An initial aim was to understand how this process impacts on the degree to which new follicular development is synchronized using estradiol in a group of animals. Three experiments were conducted as this objective was further expanded to investigate mechanisms of estradiol-induced atresia at the cellular, biochemical and molecular levels.
Objective 3: Induction of new follicular emergence with estradiol
Results of the initial experiment for Objective 2 indicated that the effect of estradiol to induce a new wave of follicular development is not mediated solely through
55 inducing the DF to become atretic. Thus, Objective 3 aimed to investigate the DF- independent effect of estradiol on the timing of new follicular development. The hypothesis was that exogenous estradiol delays the timing of new follicular development by delaying the timing of the increase in FSH that stimulates new follicular development.
The ability to regulate the processes of atresia, emergence and ovulation will allow for tight control of follicular development within and among animals, with the target of consistently achieving the pattern depicted in Figure 7b.
56 Onset of Onset of Duration LH peak Duration estrus to estrus to of estrus to of LH LH peak ovulation (h) ovulation surge Authors (h) (h) (h) (h)
Chenault et al., 1975 2.8 ± 1.3 - 10.0 ± 1.5 22.3 ± 3.5 - Swanson & Hafs, 1971 - 29 ± 6 - 32 ± 6 ≈ 8 Christenson et al., 1975 2.8 ± .8 31.3 ± 0.6 - 28.7 ± .7 - Schams et al., 1977 6.4 ± .3 - 16.9 ± 4.9 25.7 ± 6.9 7.4 ± 2.6 Coe & Allrich, 1989 - - 14.9 ± .7 - - White et al., 2002 - 31.1 ± 0.6 13.9 ± 0.9a - - Yoshioka et al., 2001b ≈ 5 - 14.0 ± 1.4 - 10.5 ± 0.8
a Value is for study performed in the spring season. Values for summer and winter
seasons were 17.6 ± 0.8 and 15.5 ± 0.8, respectively.
b Estrus synchronized by treatment with PGF2α
Table 2.1. Temporal relationships between behavioral estrus, the ovulatory LH surge and ovulation in cattle having spontaneous estrous cycles.
57 Treatment Treatment to Duration Duration of to onset LH peak (h) of estrus LH surge of estrus (h) (h) Authors (h)
Short et al., 1973 ≈21 19.5 (16-24) - - Beck & Convey, 1977 18.5 8 Cook et al., 1986 15.5 - 12 - Allrich et al., 1989 ≈ 19 - ≈ 11 - Lefebvre & Block, 1992 ≈ 22 - ≈ 16 - Stewart et al., 1993 ≈ 14 - ≈ 8 -
Table 2.2. Intervals from treatment with exogenous estradiol to onset and duration of estrus and to peak LH and duration of the LH surge in ovariectomized cattle.
58
(a) (b)
Hypothalamus Hypothalamus
GnRH GnRH
(+) (+)
Ant. Pit. Ant. Pit.
Progesterone Estradiol FSH LH Inhibin FSH LH Estradiol (-) (+) (-) (+) (+)
CL DF DF
Ovary Ovary
Figure 2.1. Endocrine feed back signals between the ovaries (CL; corpus luteum: DF; dominant follicle) and the hypothalamic-pituitary axis when peripheral concentrations of (a) progesterone are elevated (e.g., during luteal phase) or when progesterone concentrations are (b) basal (e.g., after luteolysis).
59
Progesterone (ng/mL) Estradiol (pg/mL)
LH (ng/mL)
FSH (ng/mL)
Ovulation Dominance
DF1 DF2
Selection Atresia
Recruitment
01510 520
Day of estrous cycle
Figure 2.2. Schematic representation of follicular dynamics during the estrous cycle in a cow having two waves of ovarian follicular development. Corresponding profiles of ovarian steroid hormones and gonadotropins in peripheral circulation are depicted in upper panels. Shaded vertical bars depict estrus.
60
Cholesterol 17
HO 5 4
scc CH3
17α -hydroxylase C O
3β -HSD HO Progesterone 17α-Hydroxypregnenolone Pregnenolone
17,20-lyase 17α -hydroxylase 17 Hydroxyprogesterone Dehydroepiandrosterone 17,20-lyase OH O
3β -HSD
17-HSD O O Androstenedione Testosterone
Aromatase Aromatase OH O
17β -HSD HO HO Estrone Estradiol
Figure 2.3. Schematic adapated from Carr (1998) depicting the principal pathways of steroidogenesis in ovarian follicles. Bolded arrows designate the primary route in conversion of cholesterol to estradiol (Fortune and Quirk, 1988). Enzymes are italicized.
61
Blood
LH Cholesterol
FSH LHR Pregnenolone + Theca H 4 -O ∆ Interna α 7 ∆5 Progesterone 1 Androgens
Basement Membrane Cholesterol e s FSHR
+ ata Pregnenolone
om Granulosa r
A Progesterone
Estradiol
Figure 2.4. Schematic depiction adapted from Fortune and Quirk (1988) of the "two-cell, two-gonadotropin" hypothesis underlying steroidogenic function in ovarian follicles.
62
Normal Cell Cell shrinkage away Plasma membrane from neighbors blebbing Cytoplasmic & nuclear condensation
Margination of condensed chromatin
“Apoptotic bodies” Nuclear & cellular fragmentation
Phagocytosis by neighbors
Figure 2.5. Schematic diagram of morphological changes during apoptosis (redrawn from Wilson and Potten, 1999).
63
14 Trt x Time: *p< 0.05
) 12 m
m *
2 ( 10 F *
D * f 8 o C-3W * er * et 6 T-3W am i * D 4 2
0 -4 -2 0 2 4 6 8 10
Days relative to emergence of DF3
Figure 2.6. Mean diameters of the second dominant follicle (DF2) relative to the time of emergence of the third dominant follicle (DF3) during the estrous cycle in cattle treated with 1 mg EB (T-3W) compared with untreated animals (C-3W) undergoing spontaneous follicle wave turnover (data from Burke et al., 2000a).
64
20 a) 'Spontaneous' follicular pattern
1st DF 2nd DF * 15 * mm) (
r
e t
e m a i 10
D le llic
o F 5
Cow A Cow B Cow C 0 0 5 10 15 20
Time (days)
b) 'Regulated' follicular pattern 20
Obj.2) Induced atresia Cow A
15 * Cow B mm) (
* r * Cow C e t
e m
a Obj.1) Induced i 10
d estrus/ovulation le llic
o
F 5 1st DF
2nd DF Obj.3) New wave emergence 0 0 5 10 15 20
Time (days)
Figure 2.7. Hypothetical representation of spontaneous follicular patterns (Panel a) in three cows (A, B and C) in contrast to when these follicular wave patterns are regulated (Panel b) by induction of atresia (Objective 2), allowing new follicular growth (Objective 3) and induction of estrus with ovulation (Objective 1) of a mature healthy dominant follicle (DF) (* designates ovulation). 65
CHAPTER 3
EFFECTS OF MATURITY OF THE POTENTIAL OVULATORY FOLLICLE
ON INDUCTION OF ESTRUS AND OVULATION IN CATTLE WITH
ESTRADIOL BENZOATE
ABSTRACT
The effect of maturity of the dominant follicle (DF) on the capacity of estradiol benzoate (EB) to induce estrus and ovulation was examined in cattle. In Exp. 1, 31 prepubertal heifers each received an intravaginal progesterone insert (IPI) and 1 mg EB i.m./500 kg body weight (BW; EB1). Daily ovarian ultrasonography detected emergence of a new follicular wave 3.1 ± 0.1 d after EB1. The IPI was removed when newly emerged DF were “young” (1.3 ± 0.1 d after emergence; YDF; n = 15) or “mature” (4.2 ±
0.1 d; MDF; n = 16), and 24 h later, heifers received 0.75 mg EB i.m./500 kg BW (EB2; n = 16) or no further treatment (NoEB2; n = 15). Most of the heifers receiving EB2 were observed in estrus (15/16) and ovulated (12/16), as compared with 0/15 and 1/15 in the
NoEB2 Group, respectively (P < 0.01).
In Exp. 2, 32 heifers received EB1 on Day 6 of the estrous cycle (estrus = Day 0), and new follicular wave emergence was detected 3.2 ± 0.1 d later. Heifers received an 66 injection of prostaglandin-F2α (PGF2α) when the DF was young (1.1 ± 0.1 d after
emergence; YDF; n=16) or mature (4 d; MDF; n=16), and then EB2 24 h later or no
further treatment (NoEB2). The interval from PGF2α to estrus was greater (P < 0.01) in the YDF-NoEB2 (70 ± 3.9 h) as compared to MDF-NoEB2 Group (57 ± 1.8 h).
Inclusion of EB2 reduced (P < 0.01) this interval to 47.0 ± 0.7 h without regard to the maturity of the DF (Maturity x EB2, P < 0.05) and also reduced (P < 0.05) the interval to ovulation.
In Exp. 3, 21 suckling anestrous cows received an IPI and EB1 at 29.3 ± 1.7 d postpartum. The IPI were removed either 1 d (YDF; n = 9) or 3.9 ± 0.1 d (MDF; n = 9)
after emergence of a new follicular wave and every cow received EB2. Estrus was
subsequently detected in all but one animal. Ovulation of the newly emerged DF was
detected within 48 h of EB2 in 9 of 9 cows of the MDF Group, and in 4 of 9 of the YDF
Group (P < 0.05). During the subsequent ovulatory cycle, luteal size and plasma
concentrations of progesterone were greater (P < 0.01) in the MDF Group compared with
the YDF Group.
We conclude that behavioral estrus is readily induced by 0.75 mg EB i.m./500 kg
BW. Maturity of the DF appeared to have little influence on the ability of the DF to
ovulate in heifers. In contrast, young DF in lactating anestrous cows were less likely to
respond to the ovulatory cue provided, and luteal development was compromised in those
that did ovulate.
67 INTRODUCTION
A detectable display of estrous behavior is requisite in cattle breeding programs that rely on overt estrus for correct timing of artificial insemination (AI). The efficiency of estrous detection varies between production systems and is a major limitation to reproductive competence in many classes of female cattle (Senger, 1994; Stevenson et al., 1996; Anderson and Day, 1998; Xu et al., 1998). Progestin-based treatments have been applied in an attempt to overcome these limitations and improve the overall success of a breeding program (Day et al., 2000). The addition of estradiol benzoate (EB) after termination of a progestin treatment is particularly effective in the treatment of anestrous cattle (McDougall et al., 1992), with a greater proportion of animals induced to resume having estrous cycles in dairy (Macmillan et al., 1995) or beef cattle systems (Fike et al.,
1997; Rasby et al., 1998).
Lammoglia et al. (1998) demonstrated that EB increased plasma concentrations of estradiol and the percentage of animals having an acute preovulatory LH release, in a dose dependent manner. However, the ability of estradiol to induce behavioral estrus in cattle is independent of ovarian follicular events (Ray, 1965), such that induced estrus may not always be subsequently accompanied with ovulation and development of a corpus luteum (CL). A cascade of physiological events and signals involving the hypothalamic-pituitary axis, behavioral centers of the brain and the ovary (Hansel and
Convey, 1983) are required for EB to successfully induce estrus, ovulation and subsequent development of a ‘healthy’ CL. In published reports, the prevalence of anestrous cattle showing estrus but failing to ovulate after a progesterone-estradiol
68 treatment is about 10% (Fike et al., 1997; Rhodes et al., 1999). The severity of this condition may vary between seasons and management systems. In a recent field study involving over 1000 anestrous dairy cows treated with progesterone and EB, the incidence of “false heats” was 21.4%, ranging from 5.4 to 46.2% among individual herds
(Rhodes et al., 2003).
One possible reason for the failure of ovulation following induction of estrus is that a dominant follicle (DF) capable of ovulating to the preovulatory signals provided by exogenous estradiol is not present at the appropriate time. Therefore, we hypothesized that; i) behavioral estrus is readily induced by administration of estradiol after peripheral concentrations of progesterone have declined, but that; ii) the presence of a mature DF is required for ovulation and normal luteal development, while; iii) immature DF are incapable of responding to the ovulatory cue provided by estradiol.
MATERIALS AND METHODS
Animal procedures were approved by The Ohio State University Agricultural Animal
Care and Use Committee (Protocols 00-AG004, 00-AG007).
Experiment 1
Prepubertal beef heifers (n = 31) weighing 323 kg (SD; 28 kg) and 306 d (SD; 33 d) of age each received an intravaginal progesterone insert (IPI; CIDR-B, InterAg,
Hamilton, New Zealand) and an injection (i.m.) of 1 mg EB/500 kg BW (EB1; Figure
3.1). The diameter and location of all ovarian follicles ≥ 3 mm were monitored and
69 mapped daily by transrectal ultrasonography using a 7.5 MHz transducer probe (Aloka
500V, Wallingford CT) beginning the day of IPI insertion and continuing up to 5 d after
IPI withdrawal. The time of new follicular wave emergence was defined as the day on which the new DF was 4 to 5 mm in diameter. Animals were randomly allocated to treatments in a 2 x 2 factorial design balanced for timing of new follicular wave emergence subsequent to insertion of the IPI. Heifers were initially designated to have the
IPI removed either 1 to 2 d (“Young” DF: YDF; n = 15) or 4 to 5 d (“Mature” DF: MDF; n = 16) after emergence of the new follicular wave. Within each follicle age group, heifers were further assigned to either receive a second injection of EB (EB2; 0.75 mg
EB i.m./500 kg BW) 24 h after IPI withdrawal, or no further treatment (NoEB2).
Expression of behavioral estrus was monitored by twice daily observations with the aid of tail-paint (Macmillan et al., 1988) for five days after IPI withdrawal. Additional ultrasonographic examinations were performed at intervals of seven days during the four weeks following IPI withdrawal to determine if normal luteal phases (defined as presence of a corpus luteum of healthy appearance for at least 14 d) were induced.
Experiment 2
The estrous cycles of 32 heifers weighing 396 kg (SD; 24 kg) were synchronized to a common estrous date (Day 0) following a single i.m. injection of prostaglandin F2α
(PGF2α: 25 mg Dinoprost; Lutalyse, Pharmacia and Upjohn, Kalamazoo, MI) to a group of 55 heifers. On Day 6 of the synchronized estrous cycle, all heifers were injected with 1 mg EB i.m. /500 kg BW (EB1) in order to induce atresia of the first DF and emergence of a new follicular wave. Based upon detection of a new follicular wave as described in 70 Exp. 1, animals were assigned to treatments in a 2 x 2 factorial design balanced for
timing of new follicular wave emergence subsequent to EB1. Heifers were initially
assigned to receive a PGF2α injection at either 1 d (YDF) or 4 d (MDF) after the new
follicular wave emergence. Within each follicle age group, heifers were further assigned
to receive either a second injection of EB (EB2; 0.75 mg EB/500 kg BW) 24 h after
PGF2α, or no further treatment (NoEB2). A 10 mL blood sample was collected from a jugular vein of every heifer 48 h after administration of PGF2α and analyzed for
concentrations of progesterone to confirm luteal regression in response to PGF2α. All
animals were observed twice daily for signs of behavioral estrus for at least five days
after the final PGF2α injection as previously described. The diameter and location of all
corpora lutea and follicles ≥ 3 mm in diameter on the ovaries of every animal were
monitored daily using transrectal ultrasonography from Day 5 to subsequent ovulation, or
until five days after the final PGF2α injection. An additional blood sample was collected
and analyzed for concentrations of progesterone, and diameter of corpora lutea measured,
on a single day during the subsequent mid-luteal stage to confirm development of the
corpus luteum subsequent to the observed ovulation.
Experiment 3
The ovaries of 34 mixed age suckling beef cows that had calved 16 to 36 d
previously were examined for the absence or presence of corpora lutea by transrectal
ultrasonography. Twenty-one were confirmed as anestrus, while the remaining 13 cows
had corpora lutea that appeared healthy and were rejected from the experiment. Those
used were predominantly Simmental/Angus crossbreeds at 29.3 d postpartum (SD; 7.8 d) 71 and weighed 564 kg (SD; 83 kg). The next day, each cow received an IPI (CIDR insert)
and an injection of 1 mg EB i.m./500 kg BW (EB1). The diameter and location of
follicles ≥ 3 mm in diameter on the ovaries of every animal were monitored daily using
transrectal ultrasonography from the day before IPI insertion to subsequent ovulation or
eight days after withdrawal of the IPI. Cross-sectional area of corpora lutea on the ovaries
of cows that ovulated after treatment were measured using the elliptical caliper function
in the ultrasonographic machine. Animals were assigned randomly to 1 of 2 treatment
groups balanced for timing of new follicular wave emergence subsequent to insertion of
the IPI. The IPI was removed either 1 d (YDF; n = 9) or 4 d (MDF; n = 9) after
emergence of the new follicular wave and every animal received an injection of EB
(EB2: 0.75 mg EB i.m./500 kg BW) 24 h after IPI withdrawal. Expression of behavioral
estrus was monitored as described previously.
Additional ultrasonographic examinations were performed at intervals of three
days throughout the subsequent estrous cycle in those animals in which ovulation was
detected. A 10 mL blood sample was collected daily from a jugular vein of every animal
that ovulated throughout the subsequent estrous cycle and for at least the first 12 d after
EB2 in those that did not ovulate.
Blood collection and radioimmunoassay (RIA)
Blood was collected into glass tubes containing anticoagulant (EDTA) and
immediately placed on ice for up to one hour before centrifugation at 1500 x g for 15
min. Plasma samples were stored at –20°C. Plasma concentrations of progesterone were determined in all samples using a double-antibody RIA as previously validated in our 72 laboratory by Anderson et al. (1996). The average intra-assay coefficient of variation
(CV) was 2.8%, and inter-assay CVs (five assays) for pooled plasma samples containing
1.5 and 7.5 ng/mL were 19.2% and 14.3%, respectively. The average sensitivity of the assays was 0.2 ng/mL.
Statistical procedures
Data analyses were performed using GLM procedures (SAS, 1996). Animals in which a new follicular wave was not induced following treatment initiation were excluded from the analyses. Treatment differences in Exp. 1 and 2 were determined using
ANOVA for a 2 x 2 factorial treatment design. The main factors (Maturity of DF and injection of EB2) and their interaction were tested for effects on characteristics of follicular growth, incidence and timing of ovulation and estrus. In Exp. 3, one-way
ANOVA was used to compare discrete variables, while treatment differences in plasma concentrations of progesterone and cross-sectional area of the corpora lutea were tested by split-plot ANOVA to account for repeated measures (Steel and Torrie, 1980). Specific mean comparisons were performed using Fisher’s protected LSD (Steel and Torrie,
1980). All data are expressed as the mean ± SEM unless stated otherwise. Error bars on all figures represent the SEM.
73 RESULTS
Experiment 1
Emergence of a new follicular wave was observed in 31 of 34 prepubertal heifers
3.1 ± 0.1 d after treatment initiation (Figure 3.2; Exp. 1). New emergence was not detected in three heifers during the first five days of treatment. Data for these animals were excluded from the analyses. Age and diameter of DF at the time of IPI withdrawal were greater (P < 0.01) in heifers of the MDF Groups (Table 3.1; Exp. 1). Most heifers in both the YDF and MDF groups that received EB2 were detected in estrus (15/16) and ovulated (12/16; Table 3.2). Among animals that did not receive EB2, only 1 of 15 heifers ovulated and none were detected in estrus within five days of IPI withdrawal. Age and diameter of the DF at ovulation were greater (P < 0.05) in heifers of the MDF-EB2 group compared with those in the YDF-EB2 Group (Table 3.2). The estrous cycles subsequent to treatment were of normal length in all but two (one each from the YDF and
MDF groups) animals that ovulated in response to EB2, and the corpus luteum of the second estrous cycle was detected approximately 28 d after induced ovulation in all but one animal.
Experiment 2
Emergence of a new wave of ovarian follicular development was observed in all
32 cyclic heifers at an average of 3.2 ± 0.1 d after treatment initiation (Figure 3.2; Exp.
2). The ages and diameters of the newly emerged DF at the time of PGF2α administration were greater (P < 0.01) in heifers assigned to the MDF than YDF Group (Table 3.1). 74 These differences (P < 0.01) were maintained through to ovulation (Table 3.2). Follicle age and size at ovulation also were affected by administration of EB2 (P < 0.01). There were no interactions (P > 0.1) between main effects of follicle maturity and EB2 treatment for the follicular variables measured.
Concentrations of progesterone in plasma were less than 1 ng/mL in every animal at 48 h after PGF2α treatment, confirming the completion of functional luteolysis by this time. The interval from PGF2α injection to estrus (as measured at intervals of eight hours) was greater (P < 0.01) in the YDF-NoEB2 (70 ± 3.9 h) as compared with the MDF-
NoEB2 (57 ± 1.8 h) treatment. Administration of EB2 reduced (P < 0.01) this interval to
47.0 ± 0.7 h without regard (P > 0.1) to maturity of the DF (Figure 3.3; follicle maturity x
EB2 treatment, P < 0.05). The EB2 treatment also reduced (P < 0.05) the interval from
PGF2α to ovulation across follicle maturity groups (EB2, 2.5 ± 0.2 d; NoEB2, 3.1 ± 0.1 d) based upon daily measurements (Figure 3.3).
Experiment 3
Emergence of a new wave of ovarian follicular development within five days after treatment initiation was observed in 18 of the 21 cows initially treated. The other three animals were excluded from subsequent analyses. In two of these cows, it appeared that treatments had been initiated at about the same time as new follicular wave emergence based upon a retrospective interpretation of ultrasonography results. Mean interval to emergence of a new follicular wave was 2.2 ± 0.2 d (Figure 3.2; Exp. 3).
Age and diameter of DF at the time of IPI removal (Table 3.1) and at ovulation
(Table 3.2) were greater (P < 0.05) in the MDF than YDF Group. All but a single animal 75 was detected in estrus (Day 0) within 48 h after EB2, and all of those in the MDF Group ovulated within 48 h of EB2. In contrast (P < 0.05), four of nine cows of the YDF Group failed to ovulate and develop a CL. Another ovulated the DF from the previous follicular wave rather than that induced two days after initiation of treatment (Figure 3.4).
Among animals that ovulated the newly emerged DF, concentrations of progesterone in plasma were greater (P < 0.01) in cows of the MDF Group from Day 12 to 18 of the estrous cycle (Figure 3.5; follicle maturity x Day of the estrous cycle, P <
0.05). The Day of the estrous cycle on which concentrations of progesterone declined below 1 ng/mL tended (P = 0.07) to be later in the MDF (Day 19.3 ± 0.4) than YDF
Group (Day 17.8 ± 0.6). Average cross-sectional area of the corpus luteum was greater in the MDF as compared with the YDF Group throughout the estrous cycle (P < 0.01;
Figure 3.6).
DISCUSSION
The data from the present study indicate that EB is effective in inducing estrus and ovulation in prepubertal heifers previously treated with progesterone and EB, or in postpubertal heifers following induced luteolysis. While the maturity of the DF present at the time of PGF2α treatment influenced the intervals to estrus and ovulation in postpubertal heifers, it had no affect on the incidence of estrus and ovulation in either prepubertal or postbubertal heifers. This was not the case with anestrous beef cows
76 nursing calves where a newly emerged DF was less likely to ovulate, and the subsequently formed corpus luteum was smaller and less functional in those cows that did ovulate.
The treatment regimen for every animal in these experiments was initiated with an injection of 1 mg EB/500 kg BW in order to synchronize a new wave of follicular development (Burke et al., 2000; Bogacz et al., 2000). In all cases, EB was administered during elevated peripheral concentrations of progesterone, from either an exogenous or endogenous source. Emergence of a new follicular wave was detected in 81 of 87 cows and heifers during the subsequent five days. The interval from the EB injection to emergence of a new wave of follicular development was less than previously reported
(Bo et al., 1994; Burke et al., 1999 and 2000), particularly among the anestrous beef cows. The variations in timing to emergence of a new wave of follicular development among the experiments of the present study and to those in the literature are associated with differences in breed type, age and lactation status. Although efficacy and synchrony of follicular wave turnover are more important than the interval to emergence of a new wave of follicular development, the latter variable has important consequences on the maturity of the DF at the pre-planned time of progestin withdrawal within an estrous synchrony program. The timing of progestin withdrawal can be altered to increase the likelihood of having a large healthy DF present at the time of induced ovulation. Further work is necessary to determine if 1 mg EB/500 kg BW is the optimal dose across cattle of different functional states and production systems.
Puberty was induced in 12 of the 16 prepubertal heifers that received the second injection of EB 24 h after progesterone withdrawal. This event was characterized with
77 behavioral estrus, ovulation and the subsequent luteal phases of normal duration in 10 of the 12 animals that ovulated. Somewhat surprising were the observations that; i) maturity of the DF at the time of EB2 administration did not affect these responses; and ii) only a single heifer responded when the second EB injection was not administered. It has been reported that DFs less than 10 mm in diameter in lactating dairy cows do not have the capacity to ovulate to a direct LH signal, but become increasingly responsive as diameter exceeds 10 mm (Sartori et al., 1998). Our working hypothesis was that estrus is readily induced by EB, but that this event would not be accompanied with timely ovulation if a young ‘immature’ DF was present. Based on the results of Exp. 1 and 2, it is suggested that the capacity of a DF to ovulate in heifers is attained sooner and at a smaller diameter than that of older cattle.
Results of the present study agree with those of Rasby et al. (1998), that a progesterone treatment followed by an injection of EB is a successful regimen for inducing puberty in cattle. However, Rasby et al. (1998) also observed that progesterone treatment alone for seven days promoted an estrous event with ovulation in about 40% of cases, which contrasts with the present findings. Anderson et al. (1996) also showed that progestin treatment hastens the onset of puberty by accelerating the peripubertal decrease of estradiol negative feed back on LH secretion. The present study included an injection of EB at the time that progesterone treatment was initiated. Although new follicular wave emergence was synchronized, this treatment may have in some way predisposed animals to being non-responsive after progesterone withdrawal, and requiring further stimulation with EB. Alternatively, the younger age of the heifers used in the present study (306 ± 6
78 d) compared with those of Rasby et al. (365 ± 38 d) or Anderson et al. (320 ± 1.3 d) may be responsible for differences in response to progesterone treatment.
Previous authors have demonstrated that the intervals from progestin withdrawal to estrus and ovulation are influenced by stimulation with estradiol (Lemaster et al.,
1999) and maturity of the DF (Austin et al., 1999). An objective of the present study was to examine the interaction between maturity of the potential ovulatory DF, and estradiol stimulation of estrus and ovulation, on these intervals. We were unable to address this objective from Exp. 1 because the majority of prepubertal heifers that did not receive the second injection of EB failed to display estrus or ovulate. Experiment 2 was conducted later using the same pool of heifers, but used those that had attained puberty to ensure that the periestrous event would occur spontaneously in the absence of estradiol stimulation. Without the injection of EB2, heifers with mature DF were observed in estrus sooner after the injection of PGF2α as compared with those with newly emerged
DF, although a similar timing in ovulation between the NoEB2 Groups was observed.
The addition of EB2 reduced the intervals to estrus and ovulation without regard to maturity of the DF. The results of Exp. 1 and 2 collectively demonstrate that the ability of
EB 24 h after progesterone withdrawal to induce estrus and ovulation in heifers is relatively insensitive to maturity of the DF present at the time of administration.
In contrast to the results obtained in prepubertal and postpubertal heifers, maturity of the DF at the time of progestin withdrawal in the anestrous cows nursing calves was an important determinant of ovulation and subsequent luteal development. A limited availability of anestrous cows (i.e., 22) prevented us from implementing a 2 x 2 factorial design but still enabled us to examine ovarian responses to EB administered when 'young' 79 or mature DFs were present. In agreement with previous reports (Taponen et al., 1999;
Vasconcelos et al., 1998) newly emerged DFs were less likely to ovulate in response to
an ovulatory signal (i.e., EB). When newly emerged DF did ovulate, the subsequently
formed luteal structures were smaller and females had lesser circulating progesterone
concentrations during mid to late diestrus. This finding is a potential underlying cause for
‘false’ heats and sub-luteal function in anestrous cattle stimulated to exhibit behavioral
estrus following a progestin/EB treatment regimen (Fike et al., 1997; Rhodes et al.,
1999). Further, this experiment demonstrated that at least in one case, the DF of a
previous follicular wave has the potential to ovulate despite having been succeeded by a
new DF. This possibility raises interesting questions regarding functional atresia of DFs
and challenges a fundamental premise that new follicular wave emergence is indicative
that the previous DF has become non-ovulatory. Together, these observations strengthen
the importance of establishing control of follicular development in postpartum anestrous
cattle during progestin treatment.
In conclusion, animal status and maturity of the DF are factors influencing the
ability of EB to induce ovulation in animals previously treated with progesterone. In
contrast, induction of estrus was achieved readily with EB, independent of animal status and maturity of the DF. In heifers, it appears that maturity of the DF does not influence the ability of EB to induce ovulation. However, in anestrous cows, some young DFs were not capable of ovulating in response to EB. In those that did ovulate a young DF, subsequently formed corpora lutea were smaller and less functional compared to when mature DFs were induced to ovulate. These results imply that inclusion of an agent that synchronizes emergence of new follicular development, followed by an adequate interval
80 for follicular growth and maturation, is required to ensure the presence of a preovulatory
DF that will respond to the ovulatory cue provided by exogenous estradiol.
81
Treatment groups YDF MDF NoEB2 EB2 NoEB2 EB2 Exp. 1: Prepubertal heifers n 7 8 8 8 Age (d)a 1.4 ± 0.2 1.3 ± 0.2 4.2 ± 0.2 4.2 ± 0.2 Diameter (mm)a 6.4 ± 0.2 7.0 ± 0.2 9.1 ± 0.8 9.1 ± 0.3 Exp. 2: Postpubertal heifers n 8 8 8 8 Age (d)a 1.1 ± 0.1 1.0 4.0 4.0 Diameter (mm)a 6.0 ± 0.2 6.3 ± 0.2 10.1 ± 0.4 9.9 ± 0.7 Exp. 3: Anestrous cows n na 9 na 9 Age (d)a - 1.0 - 3.9 ± 0.1 Diameter (mm)a - 6.4 ± 0.2 - 11.0 ± 0.6 aMain effect of follicle maturity (P < 0.05).
1Age is the interval from emergence of the DF to the time at which progesterone source was removed.
2Progesterone removal is the time at which IPI were removed (Exp. 1 and 3) or heifers in Exp.2 were administered PGF2α.
Table 3.1. Age1 and diameter of newly emerged dominant follicles (DF) at the time of progesterone removal2 for each treatment group in all three experiments. Treatment groups were: progesterone source (IPI or CL) removed 1 to 2 d (YDF) or 4 to 5 d (MDF) after emergence of a new DF followed with (EB2) or without (NoEB2) an injection of 0.75 mg EB i.m./500 kg BW 24 h later.
82
Treatment groups YDF MDF NoEB2 EB2 NoEB2 EB2 Exp. 1: Prepubertal heifers Proportion detected in estrusb 0/7 8/8 0/8 7/8 Proportion ovulatingb 1/7 7/8 0/8 5/8 Age (d)a 5 3.7 ± 0.2 - 6.4 ± 0.2 Diameter (mm)a 13 8.7 ± 0.3 - 11.2 ± 0.7 Exp. 2: Postpubertal heifers Proportion detected in estrus 8/8 8/8 8/8 8/8 Proportion ovulating 8/8 8/8 8/8 8/8 Age (d)ab 4.3 ± 0.2 3.5 ± 0.3 7.0 6.5 ±0.2 Diameter (mm)ab 11.5 ± 0.4 9.9 ± 0.4 13.0 ± 0.3 11.9 ± 0.5 Exp. 3: Anestrous cows Proportion detected in estrus na 9/9 na 8/9 Proportion ovulatinga - 4/9 - 9/9 Age (d)a - 3.8 ± 0.3 - 6.3 ± 0.2 Diameter (mm)a - 9.0 ± 0.6 - 13.8 ± 0.4 aMain effect of follicle maturity (P < 0.05).
bMain effect of the second EB injection (P < 0.05).
1Age is the interval from emergence of the DF to the time of last detection (ovulation).
2Progesterone sources were an IPI (Exp. 1 and 3) or a corpus luteum (Exp. 2).
Table 3.2. Incidence of detected estrus, ovulation, and age1 and diameter of dominant follicles (DF) at ovulation for each treatment group in all three experiments. Treatment groups were: progesterone source2 removed 1 to 2 d (YDF) or 4 to 5 d (MDF) after emergence of a new DF followed with (EB2) or without (NoEB2) an injection of 0.75 mg EB i.m./500 kg BW 24 h later.
83
EB1
± IPI EB2
± IPI EB2 MDF
YDF
-3-2-1012345
Days from new follicular emergence
Figure 3.1. Outline of treatments applied relative to emergence of a new wave of follicular development in prepubertal heifers in Exp. 1. EB1: initial injection of estradiol benzoate (EB; 1 mg/500 kg BW); IPI; intravaginal progesterone insert; EB2: second injection of EB (0.75 mg EB/500 kg BW); YDF: “young” dominant follicle; MDF: “mature” dominant follicle.
84
0.6
Exp. 1: Prepubertal heifers (n = 34) 0.5
t Exp. 2: Postpubertal heifers (n = 32) n
e m i r 0.4 Exp. 3: Anestrous cows (n = 21)
pe x
e n i h t
i 0.3
w on i
t 0.2 opor
r P 0.1
0.0 12345>5
Interval from treatment initiation to new follicular wave emergence (d)
Figure 3.2. Distribution of intervals from treatment initiation to detected emergence of a new follicular wave in prepubertal heifers (Exp. 1) or anestrous cows (Exp. 3) treated with an intravaginal progesterone insert (IPI) and 1 mg EB/500 kg BW (EB1), or in heifers having estrous cycles that were administered EB1 on Day 6 of the estrous cycle (Exp. 2).
85
88
estrus ovulation 80
72 ) h
F ( 64 PG
m o
r 56
f l a
v r
e 48
t n I 40
32
24
YDF-NoEB2 YDF-EB2 MDF-NoEB2 MDF-EB2
Figure 3.3. Mean intervals to estrus (follicle maturity x EB2 treatment, P < 0.05) and ovulation (EB2 treatment, P < 0.05) in postpubertal heifers (Exp. 2) following an injection of PGF2α 1 to 2 d (YDF) or 4 d (MDF) after emergence of a new DF followed with (EB2) or without (NoEB2) an injection of 0.75 mg EB/500 kg BW 24 h later.
86
Right ovary Ovulation 20 Left ovary 18 16
) 14 m
m 12 (
er 10 t e 8 am i
D 6 EB1
4 EB2 2 IPI
0 -3 -2 -1 0 1 2 3 4 5 6
Days from new follicle emergence
Figure 3.4. Diameter of follicles in the ovaries of an individual cow (Exp. 3) showing ovulation on the right ovary of a large follicle from the previous follicular wave despite the induction of a new follicular wave on the left ovary four days prior.
87
6 MDF-EB2 (n = 9)
YDF-EB2 (n = 4) 5
) * P < 0.05 L
m 4 / *
g *
n * *
ne ( 3 o r e t s e 2 og * r
P
1 *
0
0 2 4 6 8 10121416182022 Day of estrous cycle
Figure 3.5. Average daily concentrations of progesterone in plasma of anestrous cows nursing calves (Exp. 3) after removal of an intravaginal progesterone insert (IPI) 1 to 2 d (YDF) or 4 d (MDF) after emergence of a new DF followed with an injection of 0.75 mg EB/500 kg BW 24 h later. Treatment means that differed within Day of estrous cycle (treatment x Day, P < 0.05) are denoted with (*).
88
5 MDF-EB2 (n = 9)
) YDF-EB2 (n = 4) 2 4 m
c (
ea
ar
l 3 a n o i ct
e s
- 2 s os
r c l a e t 1 u
L
0 0 2 4 6 8 10121416182022 Day of estrous cycle
Figure 3.6. Average cross-sectional area of corpora lutea in anestrous cows nursing calves (Exp. 3) after removal of an intravaginal progesterone insert (IPI) 1 to 2 d (YDF) or 4 d (MDF) after emergence of a new DF followed with an injection of 0.75 mg EB/500 kg BW 24 h later. There was a main effect of treatment (P < 0.01) but no treatment x Day of estrous cycle interaction (P > 0.1).
89
CHAPTER 4
CHANGES IN GONADOTROPINS AND FUNCTION OF THE DOMINANT
OVARIAN FOLLICLE DURING ESTRADIOL-INDUCED ATRESIA IN
CATTLE
ABSTRACT
Histological and functional changes associated with atresia in dominant ovarian follicles (DF) following systemic administration of estradiol benzoate (EB) were investigated in three experiments with cattle. Administration of EB to heifers 5.6 ± 0.1 d after the onset of estrus attenuated growth of the DF, reduced follicular fluid (FF) content of androgens and estradiol, and thickness of the granulosa, without altering the proportion of apoptotic granulosa cells. These effects were accompanied by suppressed peripheral concentrations of LH but not FSH. Administration of EB on the fourth day after emergence of the second follicular wave in mature cows nursing calves also rapidly suppressed estrogenic function of the DF. In contrast to the first study, circulating FSH concentrations were transiently reduced and androgen content in FF was increased. A similar transient reduction in circulating FSH was observed when mature non-lactating cows were administered EB during the late growth phase of the first DF. Semi-
90 quantitative RT-PCR on follicular tissue revealed that the loss in estrogenicity at 24 h after EB treatment was associated with reduced abundance of messenger RNA (mRNA) for aromatase and 17α-hydroxylase, but with no change in mRNA for gonadotropin receptors, Fas antigen and Fas Ligand. The early stages of estradiol-induced atresia of DF in cattle are characterized by reduced gonadotropic support and a rapid loss of estrogenic function, leading to an unfavorable internal environment for continued survival.
INTRODUCTION
Strategic regulation of ovarian follicular development is an important component in the application of cattle reproductive technologies such as estrous synchronization and embyro transfer (Bo et al., 2002). One approach to synchronizing stage of ovarian follicular development is to synchronously induce atresia in the dominant follicle (DF).
Removal of the functional DF allows for an increase in FSH that stimulates recruitment of a new cohort of follicles into a growing phase (Adams et al. 1992; Bergfelt et al.,
1994). Estradiol-17β (Bo et al., 1995a) or conjugated forms of estradiol (Thundathil et al., 1998; Day and Burke, 2002) have been used effectively for this purpose. The current challenges for further improving the outcomes to this approach include minimizing the variability in responses associated with stage of follicular development when estradiol is administered, and also improving the precision in timing of new follicular wave development (Diskin et al., 2002; Burke et al., 2003). A greater understanding of the fundamental nature of estradiol-induced atresia in DFs would contribute to addressing these challenges. 91 Much of the biochemistry of non-ovulatory DFs as they progress through the various developmental phases has been well characterized (reviewed in Fortune, 1994;
Bao and Gaverick, 1998). The primary steroidogenic route in ovarian follicles is the ∆5- pathway that results in the formation of androstenedione from pregnenolone (Fortune and
Quirk, 1988). This conversion occurs exclusively in theca cells with cytochrome P450
17α-hydoxylase/17,20-lyase (17α-OH) playing a key catalytic role (Fortune and Quirk,
1988; Xu et al., 1995b). Androgens diffuse into granulosa cells where they are aromatized to estradiol, a reaction occurring exclusively in granulosa cells with the key regulatory enzyme being cytochrome P450 aromatase (aromatase). The expression of genes encoding for these various steroidogenic enzymes during development of the DF of the first wave of follicular development during the estrous cycle is greatest on about the fourth day after emergence (Xu et al., 1995b), and coincides with peak concentrations of estradiol in follicular fluid (FF). In the early stages of atresia in non-ovulatory DFs, a reduction in aromatase activity and estradiol synthesis was observed (Price et al., 1995) without substantial changes to gonadotropin receptor numbers on granulosa cells
(Bodensteiner et al., 1996). Loss of estrogenicity may (Badinga et al., 1992; Lucy et al,
1992) or may not (Xu et al., 1995b; McNatty et al., 1984) be associated with a reduction in androgen precursors. In atretic DFs, the granulosa membrane is eroded, with a greater incidence of pyknotic nuclei. Estrogen content is less, while concentrations of progesterone are increased (Price et al., 1995).
Mammalian ovarian follicles become atretic through a process of programmed- cell death referred to as apoptosis (Hughes and Goropse, 1991; Tilly et al., 1991). Cells undergoing apoptosis are dismembered in an orderly fashion and phagocytized by 92 neighboring cells. A group of cysteine proteases called caspases have a central role in apoptosis. Activation of the caspase-cascade potentially involves multiple signaling pathways, which may include the removal of survival factors and/or the introduction of cytotoxic factors (Kaipia and Hsueh, 1997; Hsu & Hsueh, 2000; Markstrom et al., 2002).
In cattle ovaries, activation of membrane-bound apoptotic receptors (Fas antigen/APO-
1/CD95) by binding of its ligand (FasL) is observed in vitro to be a signaling pathway for apoptosis in both follicles (Hu et al., 2001; Porter et al., 2001) and corpora lutea
(Taniguchi et al., 2002).
The ability of exogenous estradiol to synchronize a new wave of follicular development in cattle is well documented. This model permits an evaluation of the temporal changes occurring within the DF as dominance is relinquished to allow new follicular growth. The underlying basis for this loss of dominance following administration of estradiol in cattle has not been previously described. The objectives of the present study were to characterize key biochemical, cellular and molecular changes within the DF during loss of dominance after administration of estradiol benzoate (EB).
The associated changes in systemic hormone concentrations during loss of dominance were also evaluated.
MATERIALS AND METHODS
All animal procedures used in these experiments were approved by The Ohio
State University Agricultural Animal Care and Use Committee (Protocols 99-AG010, 00-
AG001, 01-AG003 and 02-AG009).
93
Experiment 1
Experiment 1 involved 30 reproductively mature Simmental x Angus heifers weighing 462 kg (SD; 38 kg). Estrus was synchronized following one or two i.m. injections of prostaglandin F2α (PGF2α; 25 mg Dinoprost, Lutalyse, Pharmacia Animal
Health, Kalamazoo, MI). Behavioral estrus was monitored using an electronic surveillance system (HeatWatch, DDx, Denver, CO). Animals were allocated at Day 5.6
± 0.1 relative to onset of estrus (Day 0) to receive 1 mg EB/500 kg body weight (BW) by i.m. injection (EB; CIDIROL, InterAg, Hamilton, New Zealand; n = 15) or to serve as untreated controls (C; n = 15). The timing of the EB injection was designated as Day (D)
0 and Hour (H) 0. Eight animals from each treatment were bilaterally ovariectomized at either 12 h (12H) or 36 h (36H; n = 4 per time point). The remaining seven heifers per treatment remained intact until emergence of a new wave of follicular development was detected (new wave: NW). Four heifers per treatment in the NW group were ovariectomized at this time, while the remaining three NW animals per treatment remained intact. Diameter and location of corpora lutea and ovarian follicles ≥3 mm in diameter were monitored daily by transrectal ultrasonography using a 7.5 MHz transducer probe (Aloka 500 V, Wallingford, CT) beginning within 24 h after estrus was detected. The frequency of these examinations increased to every 12 h from H 60 in heifers of the NW group until ovariectomy, or until emergence of a new follicular wave for the six heifers not ovariectomized.
94 Blood sampling
Blood samples were collected daily from a jugular vein of all animals after detection of estrus and then at intervals of 6 h between H -12 and ovariectomy, or until emergence of a new wave of follicular development was confirmed. Blood was collected into glass tubes containing an anticoagulant (EDTA) and centrifuged at 1500 x g for 12 min. Plasma were harvested and stored at -20°C until determination of FSH, progesterone and estradiol content. Serial blood collections from a jugular vein via indwelling catheters were performed in all heifers assigned to the NW Groups for determination of
LH. A 4-mL blood sample was taken at intervals of 20 min for periods of 12 h beginning at H -12, 0, 24 and 48. Serial blood sampling was facilitated by placement of an indwelling 14-gauge catheter (Angiocath, Becton-Dickinson Infusion Therapy Systems,
Inc., Sandy, UT) into a jugular vein. A 210 mm length of plastic tubing (Tygon, Norton
Performance Plastics Co., Akron, OH) with an internal diameter of 1.2 mm and an overall capacity of 3 mL was attached to the jugular catheter using a modified 16-gauge needle inserted through an injection adaptor (Medex, Hilliard, OH). Between the removals of each blood sample, the catheter line was flushed with 6 mL sterile 3.5% sodium citrate–
0.9% saline solution containing an antibiotic (2 mg/mL oxytetracycline; OXY-TET 100,
Anchor Division Boehringer Inhelheim Animal Health, Inc., St. Joseph, MO). The initial
7 mL of fluid withdrawn from the catheter was discarded while the following 4 mL was retained as the blood sample. Blood was collected into plastic tubes without additives and allowed to stand at 4°C for about 42 h before centrifugation at 4750 x g for 30 min. Sera were harvested and stored at -20°C.
95 Histology of the DF
Following ovariectomy, the ovary bearing the DF was immediately placed into ice-cold sterile PBS for 3 min. A sample of FF (approx. 150 µL) was collected and stored at -20°C. Within 10 min of the ovary having been removed, the DF was dissected out of the ovary and fixed in freshly prepared 4% paraformaldehyde-PBS (pH 7.2) for about 24 h. The tissue samples were then washed with 50% ethanol and allowed to incubate for 20 min before transfer to 70% ethanol with fresh changes after 30 and 60 min. Samples remained in 70% ethanol for up to 14 d before further dehydration steps. These involved stepwise incubations in 95% ethanol for 1 h with changes every 20 min, 100% ethanol for
4.5 h with changes every 90 min, and xylenes for 4.5 h with changes every 90 min.
Tissues were then placed overnight in a mixture of xylenes and paraffin wax embedding medium (Paraplast; Oxford Labware, St Louis, MO) with a sufficient amount of xylenes added to keep this solution fluid at room temperature. Tissues were then transferred to an equal volume of xylenes and molten paraffin wax (at 60°C). This mixture was allowed to solidify at room temperature for 5 h, melted at 60°C, then the samples were transferred to fresh molten paraffin for 3 h with fresh changes every 60 min. The tissue specimens were transfered into labeled moulds filled with molten paraffin wax, incubated for a further 1 h at 60°C to allow bubbles to escape, and then allowed to set at room temperature.
Embedded follicles were sliced into 8 µm sections and mounted in groups of three to five consecutive sections on slides coated with aminoalkylsilane (Silane-Prep Slides,
Sigma Diagnostics, St. Louis, MO). The proportion of apoptotic cells in the granulosa membrane was determined by terminal deoxynucleotidyl transferase (TdT)-mediated 96 dUTP nick-end-labeling (TUNEL) procedure using the ApoAlert DNA Fragmentation kit
(Clontech Laboratories, Inc., Palo Alto, CA) in accordance with the manufacturers instructions. An anti-photo bleaching and nuclear counter-stain agent (DAPI,
Vectashield, Vector Laboratories, Inc., Burlingame, CA) was added as a final step to visualize all nucleated granulosa cells. Each slide included a positive control section
(DNase I treated), the TUNEL section and a negative control (TUNEL reaction buffer lacking TdT). A fluorescent microscope was used to assess five fields within each follicle under a 40 X magnification objective. In each field, the number of FITC (510 nm emission wavelength) labeled granulosa cells (apoptotic) was counted and divided by the total number of nucleated granulosa cells (DAPI stained; 430 nm emission wavelength).
An average percent apoptotic cells was calculated for each follicle. Most cells (>90%) were FITC labeled in positive controls and no labeling was observed in negative controls.
The number of layers of granulosa cells was estimated visually in all fields by detection of DAPI stained nuclei.
Experiment 2
Experiment 2 involved 28 Simmental x Angus heifers weighing 435 kg (SD; 42 kg). Estrus was initially synchronized following two injections of PGF2α 14 d apart. A second estrus was also synchronized by treatment with an intravaginal progesterone insert (CIDR, Pharmacia Animal Health, Kalamazoo, MI) for six days beginning on Day
17 of the initially synchronized estrous cycle, with administration of PGF2α at the time of
CIDR removal. Heifers in which estrus was detected at the appropriate time, and in which ovarian characteristics were normal were used in this experiment. A total of 39 data 97 observations were collected over the two synchronized estrous cycles. Daily monitoring of ovarian follicular development beginning on Day 7 of the estrous cycle was performed by transrectal ultrasonography to detect emergence of the second follicular wave. When the DF of this follicular wave had been present for four days (Day 13.7 ± 0.2 of the estrous cycle), heifers were administered 1 mg EB i.m./500 kg BW (EB; n = 20) or served as untreated controls (C; n = 19). The timing of the EB injection was designated as
H 0. For each treatment, FF was collected from the DF at H 12, 24, 36 or 48 (n = four to six heifers per time point) with a 17-gauge needle per vaginum by the ultrasonography- guided approach using a 7.5 MHz convex array transducer (Bergfelt et al., 1994). Blood sera samples were collected from a coccygeal vessel of the tail every 12 h from H 0 to follicle aspiration.
Experiment 3
Experiment 3 involved 22 Simmental x Angus non-lactating cows aged 4.2 yr
(SD; 1.9 yr) and weighing 605 kg (SD; 75 kg). Estrus was synchronized by treatment with a CIDR for eight days and an injection of PGF2α at CIDR removal. Development of the DF was monitored daily by ultrasonography beginning two to three days after estrus.
At Day 6.4 ± 0.1 of the synchronized estrous cycle (designated [Hour] H 0), animals were allocated to one of three treatments. At H 0, cows received no further treatment (Control;
C; n = 14) or 1 mg EB i.m./500 kg BW (EB; n = 8). The ovary containing the DF1 was removed from cows in the C treatment at H 0 (OHC; n = 7) or H 24 (24HC; n = 7).
98 Unilateral ovariectomy was performed in the eight cows assigned to the EB treatment at
H 24 (24HEB). Blood sera samples were collected every six hours from H 0 to ovariectomy.
Measurement of messenger RNAs (mRNAs) in the wall of the DF
Following ovariectomy, a sample of FF (≈300 µl) was collected from the DF. The region of the DF protruding beyond the surface of the ovary was immediately (within 5 min of ovariectomy) excised with a scalpel and frozen on liquid nitrogen. Tissues were stored at -70°C until extraction of total cellular RNA.
Relative abundances of mRNA for cytochrome P450 aromatase (aromatase), cytochrome P450 17α-hydroxylase/C-17, 20-lyase (17α-OH), LH receptor (LHR), FSH receptor (FSHR), Fas antigen (Fas) and Fas ligand (FasL) were determined in follicular tissue using semi-quantitative reverse transcription polymerase chain reactions (RT-
PCR). The reference gene used was β-actin. Total RNA was extracted from follicular tissue using Trizol reagent (Invitrogen, Life Technologies, Rockville, MD) according to manufacturer's instructions. Concentrations of RNA were determined by measuring the absorbance at 260 nm. Integrity of the RNA was verified by visually estimating the ratio of 28s to 18s rRNA after electrophoresis on a denaturing formaldehyde-agarose gel. The
GeneAmp kit (Applied Biosystems, Roche Molecular Systems, Inc., Branchburg, NJ) was used to perform the RT-PCR reactions using the 'two-step' approach. Reactions for first-strand cDNA synthesis included 5 mM MgCl2, 1 X PCR buffer II, 1 mM dNTPs, 1
U/µL RNase inhibitor, 2.5 U/µL murine leukemia virus reverse transcriptase (RTase), 2.5
µM random hexamers, 1 U RNase-free DNase I (Promega, Madison, WI) and 1 µg RNA 99 per 20 µL total reaction. Before addition of RTase, tubes were incubated with DNase I
(37 °C for 30 min, 75 °C for 5 min, then chilled to 5 °C) to reduce genomic DNA contamination (Huang et al., 1996). RTase was then added and tubes were incubated at room temperature for 10 min, 42 °C for 30 min, 99 °C for 5 min, then chilled to 5 °C and stored at -20 °C. A common master-mix was used to prepare both positive (included
RTase) and negative (RTase substituted with RNase-free water) reverse transcription
(RT) reactions for all samples.
Primers spanning at least one intron on respective genes were constructed from known bovine mRNA sequences in GenBank (National Center for Biotechnology
Information [NCBI], www.ncbi.nlm.nih.gov; Table 4.1). Polymerase chain reactions
(PCR) were performed in 25 µL mixtures containing 5 µL RT reaction, 2 mM MgCl2, 1
X PCR buffer II, 0.15 mM primers and 0.625 U AmpliTaq DNA polymerase. Thermal cycling conditions were: denaturation at 95 °C for 1 min, annealing at 55 °C for 45 s and extension at 72 °C for 2 min. The last cycle included an additional extension phase at 72
°C for 7 min before chilling to 5 °C. Duplex PCR was performed for aromatase/β-actin
(23 cycles), 17α-OH/β-actin (23 cycles) and Fas/FasL (30 cycles), whereas simplex PCR was performed for LHR (29 cycles) and FSHR (30 cycles). Simplex PCR for β-actin (23 cycles) were also performed using aliquots of the same RT products when not included in the duplex with the target gene. Number of cycles chosen for the assays was determined from the midpoint of the linear growth phase in PCR product from cycle titrations performed for each gene. Number of PCR cycles for each gene was determined All samples (n = 21) were always included in the same assay, and a PCR was performed on
100 negative RT (water in place of RTase) for every sample and target gene. Products were analyzed by electrophoresis on 1.5% (w/v) agarose gels, visualized under UV illumination after ethidium bromide staining with the image being digitally recorded.
Densitometric analyses of the cDNA bands were performed using ImageJ (National
Institute of Health; http://rsb.info.nih.gov/ij). Relative abundance of mRNA for target genes was defined as the ratio of densitometric values relative to β-actin, within individual animals. No products were found when PCR was performed using negative RT reaction mixtures. PCR products of all genes were sequenced in both directions and were at least 97% homologous to those in GenBank (Table 4.1).
Hormone RIAs
Concentrations of FSH were determined using a double-antibody RIA (Wolfe et al., 1992; Burke et al., 2003). Intra- and inter-assay CV (four assays) were 2.4% and
11.9%, respectively. Average sensitivity was 0.2 ng/mL. Concentrations of LH were determined in duplicate using a double-antibody RIA (Dyer et al., 1990). Intra- and inter- assay CV (five assays) were 2.9% and 7.7%, respectively. Average sensitivity was 0.13 ng/mL.
For Exp. 1, concentrations of progesterone in sera or plasma were determined in duplicate using a double-antibody RIA (Anderson et al., 1996). Intra- and inter-assay CV
(three assays) were 3.4% and 14.9%, respectively. Average sensitivity was 0.24 ng/mL.
For all other samples, progesterone was determined using a kit (Progesterone Coat-a-
Count, DPC, Los Angeles, CA) as previously described (Burke et al., 2003). Validation for use in FF was performed. Parallelism was confirmed by comparing the slopes from
101 serially diluted FF (-0.72) with the standard curve (-0.76) after natural log-logit transformation. Average recovery of progesterone across concentrations ranging from 2.2 to 7 ng/mL was 102%. Follicular fluid was diluted 1:10 or 1:100 in Progesterone Zero
Calibrator (DPC, Los Angeles, CA) before addition to the reaction tube. Intra- and inter- assay CV (five assays) were 2.4% and 4.0%, respectively, with a sensitivity of 0.05 ng/mL. Concentrations of estradiol in plasma or sera were determined in duplicate using a double-extraction single-antibody RIA (Anderson et al., 1996). The same assay without ether extraction was used to determine estradiol content in FF where samples were diluted 102, 103,104 and 105 in assay buffer before addition to the reaction tube. Intra- and inter-assay CV (11 assays) were 2.7% and 12.2%, respectively. Average sensitivity of the assays was 1.0 pg/mL.
Concentrations of testosterone in FF were determined in duplicate using a kit
(Total Testosterone Coat-a-Count, DPC, Los Angeles, CA). Parallelism was confirmed by comparing the slopes from serially diluted FF (-0.79) with the standard curve (-0.71) after natural log-logit transformation. Average recovery of testosterone across concentrations ranging from 0.4 to 6.8 ng/mL was 105%. Follicular fluid samples were diluted 1:4 in Testosterone Zero Calibrator (DPC, Los Angeles, CA). Intra- and inter- assay CV (six assays) were 2.5% and 11.1%, respectively. Average sensitivity was 0.03 ng/mL. Concentrations of androstendione in FF were determined in duplicate using a kit
(Direct Androstenedione Coat-a-Count, DPC, Los Angeles, CA). The slope of serially diluted FF (-0.89) was parallel with the standard curve (-0.82), and average recovery of androstendione across concentrations ranging from 1 to 3 ng/mL was 98%. Samples of
102 FF were diluted 1:4 in Androstenedione Zero Calibrator (DPC, Los Angeles, CA). The intra-assay CV (single assay) was 3.9% with a sensitivity of 0.1 ng/mL.
Statistical analyses
In Exp. 1, three of four DF in the 12HC treatment were accidentally ruptured during ovariectomy. Thus, initial analyses of follicular parameters was confined to the
H36 and NW treatments in a 2 x 2 arrangement, and secondly to the 12HEB, 36HEB and
NWEB to test if the 12HEB differed from either 36HEB or NWEB treatments. Data for
Exp. 2 and 3 were analyzed as 2 x 4 and single factor arrangements respectively, as per design.
The effects of treatment, time and the treatment by time interactions on variables involving repeated type measurements were analyzed by ANOVA using the MIXED procedure in SAS V8.2 (SAS, Cary, NC). The repeated measures model was Yijk = µ + Ti
th th + cj:i + Hk + (TH)ik + eijk; where Yijk is the observation of the j animal in the i treatment
th th at the k time, µ is the overall mean, Ti is the fixed effect of the i treatment, cj:i is the
th th 2 random effect of the j animal in the i treatment (cj:i ~ N[0, σ c]), Hk is the fixed effect
th of the k time, (TH)ik is the treatment by time interaction term and eijk is the random residual error effect (eijk ~ N[0, Σ]), with Σ representing the variance-covariance structure of the residual errors for repeated measurements within animals. Bayesian Information
Criteria (BIC; 'smaller is better') was used to determine the best variance-covariance structure for the models. The first order autoregressive structure ([AR(1)]) was typically the best option and was used throughout unless specified otherwise in the results. The effect of experimental replication in Exp. 1 and 2 was tested for all dependent variables 103 and replication was included in the model if it was a significant (P < 0.05) source of variation. For analyses of FSH data, the pretreatment concentration of FSH (value at H 0) within animal was included as a covariate in the model for all experiments to compensate for variable initial concentrations among animals. The LSM values of FSH are reported in the results. Homogeneity of the variances across treatments or times was tested using the Likelihood Ratio test (Littell et al., 1996). Square root transformations were performed prior to ANOVA in many instances involving steroid concentrations in FF in which treatment variances were heterogeneous or proportional to mean values. Data are expressed as the actual mean ± SEM unless stated otherwise.
RESULTS
Experiment 1
Treatments were initiated on Day 5.6 ± 0.1 of the estrous cycle when the DF was
10.8 ± 0.3 mm in diameter (at H 12), having emerged 4.1 ± 0.2 d previously.
Concentrations of estradiol in plasma (Figure 4.1a) were elevated in the EBNW treatment at H 12, and although declining, remained greater (P < 0.01) than the CNW treatment to
H 96. The increase in plasma estradiol in the EBNW treatment was associated with an immediate cessation in growth of the DF (Figure 4.1b) and a smaller (P < 0.01) diameter during the plateau phase as compared with the DF in the CNW treatment. Time of emergence of a new wave of follicular development after treatment initiation for the
EBNW (D 4.8 ± 0.3) and CNW (D 4.4 ± 0.1) was not different. Overall concentrations of progesterone in plasma were 1.2 ± 0.1 ng/mL at the time treatments were initiated. The 104 subsequent increase in circulating progesterone with luteal development during the next five days was evident in both treatments, but reduced (P < 0.01) in the EBNW compared with the CNW treatment (Figure 4.1c).
Gonadotropin responses
Concentrations of FSH (Figure 4.1d) were not affected by treatment, but were greater (P < 0.05) between H 66 and 102 than at the time that treatment was initiated (H -
12 to18). Average maximum values were observed at H 90 and 96, and the first decline
(P < 0.05) from this peak was observed at H 108. Time of peak concentration of FSH was also assessed within individual animals. Average time of the FSH peak within individuals of the EBNW (H 79.0 ± 8.4) and CNW (H 89.1 ± 3.6) treatments was not different.
However, the interval from the FSH peak to emergence of a new wave of follicular development was increased (P < 0.01) in the EBNW (35.0 ± 2.9 h) compared with the
CNW treatment (17.1 ± 2.4 h).
Characteristics of LH secretion were compared among four 12 h periods that began at H -12, 0, 24 and 48 (Figure 4.2). The frequency of LH pulses (Figure 4.2a) declined (P < 0.01) over time in a similar (P > 0.1) manner for both treatments. In the
CNW treatment, the amplitude of the LH pulses was greater (P < 0.05) during the H 24 to
36 and H 48 to 60 periods than in earlier periods (Figure 4.2b), whereas pulse amplitude remained constant (P < 0.1) over all periods in the EBNW treatment. Thus, mean concentrations of LH (Figure 4.2c) remained constant at about 0.8 ng/mL throughout the serial blood collection periods in the CNW treatment. Mean values in the EBNW
105 treatment were similar (P > 0.1) to the CNW treatment from H -12 to H 12, but declined
(P < 0.05) to less than 0.6 ng/mL between H 24 to H 60.
Steroids in follicular fluid (FF)
At H 36, concentrations of estradiol in FF of the DF of the EB treatment were five-fold reduced (P < 0.01) compared with the C treatment at this time, and equivalent to the C treatment after a new follicular wave had emerged (Table 4.2). A substantial decline (P < 0.01) in concentrations of estradiol occurred between H12 and H36 in the
EB treated group. This reduction was associated with reduced (P < 0.05) concentrations of testosterone and androstendione at H 36 in the EB treated as compared with control groups (Table 4.2). Androgen concentrations were positively correlated across all animals
(r2 = 0.85; P < 0.01). A four-fold increase (P < 0.01) in concentrations of progesterone in
FF was observed in the EB-treated group after a new follicular wave had emerged, compared with similar (P > 0.1) values among other treament groups (Table 4.2).
Number of granulosa cell layers and incidence of apoptosis
Number of granulosa cell layers was reduced (treatment; P < 0.05) in the DF of heifers that were treated with EB (5.2 ± 1.2) as compared with untreated controls (8.34 ±
1.6). Across treatments, the number of granulosa cell layers declined from 9.7 ± 1.0 at H
36 to 3.2 ± 0.6 after emergence of a new wave of follicular development (time; P < 0.01).
A treatment by time interaction was not detected. Number of granulosa cell layers in the
EBH12 treatment (Table 4.2) was greater (P < 0.05) as compared with EBNW treatment, and tended (P = 0.08) to be greater than EBH36 treatment. The proportion of apoptotic 106 granulosa cells increased (time; P < 0.01) from 2.9 ± 1.7% at H 36 to 25.4 ± 4.2% after emergence of a new wave of follicular development, similarly (P > 0.1) for EB and C treated groups (Table 4.2). The erosion of the granulosa membrane over time, and the increase in the proportion of apoptotic granulosa cells after emergence of a new wave of follicular development, are portrayed for representative animals of the EB-treated groups in Figure 4.3.
Experiment 2
Treatments were initiated on Day 13.7 ± 0.2 of the estrous cycle when the DF2 was 10.3 ± 0.2 mm in diameter, having emerged 4 days previously. Circulating concentrations of estradiol were elevated (P < 0.05) from 2.0 pg/mL at H 0 to 26.9 ± 0.9 pg/mL at H 12 in the EB-treated group, as compared with no change in the C-treated group. Circulating concentrations of progesterone (2.9 ± 0.2 ng/mL) were not affected by treatment or time. Concentrations of FSH were reduced (P < 0.05) at H 12 and H 24 in the EB-treated group (Figure 4.4).
Steroid concentrations in follicular fluid (FF)
Concentrations of estradiol in FF decreased (P < 0.01) over time across treatments and were less (P < 0.01) in the EB-treated (35.1 ± 11.1 ng/mL) as compared with the C group (104.6 ± 18 ng/mL). Although a treatment by time interaction was not detected, the effect of EB in reducing FF estradiol was nominally apparent at H 12 and H 24, with no changes observed after H 24 (Figure 4.5a). Concentrations of progesterone (Figure 4.5b) were reduced (P < 0.05) at H 12 in the EB-treated group as compared with the C group at 107 this time, and tended (P = 0.07) to be less overall in the EB-treated as compared with the
C group. Concentrations of testosterone (Figure 4.5c) were greater (P < 0.05) at H 36 in the EB-treated group as compared with the C group at H 36, and to earlier time points in the EB-treated group. Although concentrations of androgens were highly correlated (r2 =
0.88; P < 0.01), there were no effects of treatment, time or an interaction on concentrations of androstendione (Figure 4.5d).
Experiment 3
Stage of estrous cycle at H 0 (Day 6.4 ± 0.1) and diameter of the DF1 at the time of ovariectomy (12.9 ± 0.3 mm) were similar (P > 0.1) among treatments. Concentrations of estradiol in FF were reduced (P < 0.05) in the 24HEB treatment compared with either time point within the C treatment (Table 4.3). Likewise, concentrations of progesterone tended (P = 0.08) to be less in 24HEB compared with the control treatments. A treatment by time interaction (P = 0.06) was detected when comparing concentrations of FSH
(Figure 4.6) between the 24HC and 24HEB treatments. The interaction reflected a tendency (P = 0.11) for a reduction at H 18 in the 24HEB treatment compared with the
24HC treatment, and a subsequent increase (P < 0.05) from H 18 to H 24 in the 24HEB treatment.
Relative abundance of mRNAs
Relative abundance of aromatase mRNA (Figure 4.7a) was reduced (P < 0.05) in the 24HEB treatment compared with similar values in the 0HC and 24HC treatments.
Abundance of 17α-OH mRNA (Figure 4.7b) was reduced (P < 0.05) in the 24EB 108 treatment compared with the 0HC treatment, with the 24HC being intermediate (P > 0.1).
Abundance of mRNAs for LHR, FSHR, Fas and FasL (Figure 4.7c, d, e and f, respectively) were not different among treatments.
DISCUSSION
The present experiments have examined changes in systemic hormone concentrations and key intrafollicular factors during atresia in DFs of the first and second follicular waves of the estrous cycle in cattle treated systemically with EB.
Administration of EB to heifers on Day 5.6 ± 0.1 of the estrous cycle (Exp. 1) reduced mean concentrations of LH by preventing the increase in amplitude of LH pulses observed in untreated animals. Suppressed concentrations of LH were observed between
24 and 60 h after EB, and were associated with a cessation in growth of the DF, fewer numbers of cell layers in the granulosa membrane, and reduced steroidogenic function, but not with any measurable changes in the proportion of apoptotic granulosa cells remaining in the granulosa membrane.
Administration of EB on the fourth day after emergence of the second follicular wave of the estrous cycle in cows (Exp. 2) produced a similar result in that estradiol content in the DF was rapidly suppressed (i.e., within 12 h). In contrast to when EB was administered during the first follicular wave, androgen content in the DF was increased at
36 h. These effects were associated with a transient decline in circulating FSH, whereas
EB did not alter FSH concentrations when administered to heifers on Day 5 to 6 of the estrous cycle. A similar transient reduction in circulating FSH was observed when cows
109 were administered EB on Day 6.4 ± 0.1 of the estrous cycle. Again, concentrations of estradiol in the first DF were markedly reduced at 24 h. Semi-quantitative RT-PCR revealed that the loss in steroidogenic capacity to produce estradiol at 24 h in EB-treated cattle was associated with reduced abundance of mRNA for aromatase, and for 17α- hydoxylase to a lesser extent, but not with any changes in expression of several other genes considered to be key regulators of follicular function. Collectively, these data characterize the early responses in function of the DF to administration of an agent (EB) known to be effective in promoting atresia of ovarian follicles.
In all experiments, gonadotropic support (either LH or FSH) was diminished.
Both LH and FSH are the major survival signals for mature antral follicles (Markstrom et al., 2002). Reductions in circulating concentrations of LH (Burke et al., 1996) and FSH
(O'Rourke et al., 2000) are believed to be the mode of action through which exogenous estradiol perturbs follicular development. Likewise, steroidogenic function was rapidly impacted following EB treatment, leading to a substantial loss in estrogenicity. This effect is considered unfavorable for continued survival of the follicle, as estradiol promotes growth of the follicle in multiple ways (Rosenfeld et al., 2001; Schams and
Berisha, 2002) and is considered an anti-apoptotic factor (Knecht et al., 1984; Billig et al., 1993; Kaipia and Hsueh, 1997; Lund et al., 1999).
An outcome of Exp. 1 that was initially puzzling was that timing of the pre- emergence increase in FSH, and consequently timing of new follicular wave development, was not different between the EB-treated heifers and the control group.
This suggested that in EB-treated animals, either the DF was capable of exerting dominance despite its loss in estrogenic function, or that this treatment was having a 110 direct influence on timing of emergence of the next wave of follicular development independent of the DF. In a subsequent experiment, this was tested by aspirating the DF, and then administering varying doses of EB (Burke et al., 2003). The results of this second study clearly showed that EB delays the increase in FSH and timing of the new follicular wave emergence in a dose dependent manner, in the absence of the DF. Thus, timing of new follicular wave emergence after treatment with EB is a deceptive indicator of DF function. In the present study, EB may have postponed emergence by inhibiting the pre-emergence increase in FSH, even though the DF had entered the atretic state.
Interestingly, the direction of change in concentrations of androgens at 36 h in response to EB differed when administered to heifers during the first wave of follicular development compared with the second wave of follicular development in mature cows.
In the first instance, testosterone, androstendione and estradiol were all markedly reduced at 36 h. Thus, in agreement with other studies in cattle (Lucy et al. 1992; Badinga et al.,
1992), a reduction in follicular estradiol could be explained by reduced availability of androgen substrate for aromatization in this case. However, in other experiments, concentrations of estradiol in FF also declined rapidly but androgen concentrations were either markedly elevated at 36 h (Exp. 2) or remained unchanged at 24 h (Exp. 3). In agreement with studies in sheep (Tsonis et al., 1984), these data indicated that the blockage in estradiol production was primarily related to reduced aromatase activity, with the possibility of an accumulation in androgens caused by this downstream blockage.
Experiment 3 confirmed that mRNA abundance for aromatase was reduced 24 h after administration of EB. Concentrations of estradiol, aromatase activity and mRNA for aromatase are well correlated (Tsonis et al., 1984; Silva and Price, 2000). The role of
111 EB to negatively impact mRNA for 17α-OH is interpreted with caution, since abundance was not significantly different to the contemporary controls (24HC). Transcripts for 17α-
OH, located exclusively in theca interna, do decline spontaneously in the first DF between days 4 to 8 in its development (Xu et al, 1995b). It is speculated that the decline in mRNA for 17α-OH was accelerated by administration of EB.
No effect of treatment was observed on mRNAs for LHR and FSHR in the present study. This is consistent with previous reports observing that changes in the expression of these receptors (Xu et al., 1995a) and receptor numbers on granulosa cells
(Bodensteiner et al., 1996), were not diminished in early atretic follicles. In agreement with Xu et al. (1995a), we speculate that a loss in gonadotropin responsiveness that is observed in the more advanced stages of atresia is more likely a consequence of atresia, rather than a mechanism underlying the initiation of atresia.
Concentrations of progesterone in FF of EB-treated heifers were markedly greater compared to the DF in control heifers after a new wave of follicular development had been initiated, suggesting a more advanced stage of atresia (Exp. 1). The later finding is consistent with several reports showing that progesterone increases as follicles become atretic (Uilenbroek et al., 1980; Bodensteiner et al., 1996) and the underlying reason is probably not isolated to a single mechanism. Firstly, theca cells remain viable and continue to produce progesterone even during apoptotic destruction of the granulosa membrane where aromatization of androgens to estradiol is exclusively located (Fortune and Quirk, 1988; Xu et al., 1995b). Thus, the increase in progesterone may simply reflect an accumulation of substrate that is not converted to downstream steroids (Hubbard and
Greenwald, 1981). Additionally, a recent study has suggested that an increase in 112 progesterone is an important aspect of cell death and is achieved in granulosa cells through an FSH-stimulated increase in progesterone synthesis following potassium efflux from cells during the early phase of apoptosis (Gross et al., 2001). The greater concentrations of progesterone in atretic DF after emergence of a new follicular wave in the EB-treated animals suggests a more advanced state of atresia compared with that in untreated controls.
Indications of an advancement of atresia in follicles of EB-treated animals were further supported with reduced numbers of granulosa cell layers in the granulosa membrane. It is estimated that maximum number of granulosa cells is attained in bovine follicles at about 9 mm in diameter (Lussier et al., 1987; Fortune, 1994), which is a smaller diameter as compared with what the DF were in the present study at treatment initiation. Thus, the observed reduction in number of granulosa cell layers in the DF of
EB-treated animals is interpreted to indicate increased degradation of the granulosa membrane. This was not supported with any observed increase in the rates of apoptosis using the TUNEL assay procedure. It is possible that the rate of apoptosis was greater in the DF of the EB treatment at time points not measured in the present study. However, an apparent limitation to this technique is that it fails to account for granulosa cells that are completely degraded, or are sloughed from the granulosa membrane into the antrum of the follicle. Neither of these potential outcomes of cellular death was assessed in the present study.
Binding of FasL to its membrane-bound receptor, Fas antigen, is a signaling pathway for the initiation of apoptosis in bovine ovarian follicles (Hu et al., 2001), and an increase in expression of mRNA for Fas and FasL during atresia is coordinated with
113 greater amounts of Fas and FasL protein (Porter et al., 2001). Abundance of mRNA for
Fas and FasL remained unchanged 24 h after administration of EB (Exp. 3), indicating that the signaling process for apoptosis was not upregulated 24 h after treatment with EB.
This interpretation is cautionary because mRNAs of the present study were measured within the entire follicle wall. Thus changes occurring specifically in granulosa cells could be masked by a lack of corresponding changes in theca tissues. For example, FasL mRNA content is greater in granulosa cells of atretic DF, but not in the theca cells of atretic DF compared with a healthy DF (Porter et al., 2001).
In conclusion, administration of an atretogenic dose of EB suppressed concentrations of gonadotropins in circulation and promoted a rapid and sustained loss in the capacity of healthy DFs in cattle to produce estradiol. A primary target for this atretogeic action was aromatase, while other sites in the steroidogenic pathway were variably affected depending on animal type and/or stage of estrous cycle. Erosion of the granulosa membrane was enhanced in the DF of EB-treated animals, although no differences were observed in the rate of apoptosis in granulosa cells at 36 h, or in a potential trigger signal (Fas/FasL) for apoptosis at 24 h. However, it is clear that the initial one to two days following an atretogenic signal by administration of EB involves a severe disruption to steroidogenic function and growth of the follicle in association with a suppression of gonadotropins, conditions that initiate atresia. Although the extent to which EB induced-atresia approximates the process occurring in ovarian follicles during spontaneous atresia requires further clarification, this approach could serve as a useful model to better understand the mechanisms that initiate atresia and the progressive nature of this process.
114
PCR Product Gene Accession Primer1 Sequence (5' to 3') size (bp) Aromatase Z32741 F AGCATAGATTTCGCCACTGAG 592 R TGCATCTTCTCAACGCACCG 17α-OH M12547 F GACACATGCTCGCTACTATAG 441 R GCTCCAAAGGGCAAGTAGCT Fas U34794 F TCCGGGATCTGGGTTCACTT 470 R CTCGTTGGTGTGCATTTCTCA FasL AB035802 F AGTCCACCAGCCAAAGGCAT 249 R CCCCGGAAGTACACTTTGGA LHR2 AF491303 F CCACAAGCTTCCAGATGTTAC 465 R CTGCTCGTTTGTTGGCAAGTT FSHR L22319 F GACCCTGATGCCTTCCAGAA 405 R GGCCCGCAGCTTCTTAAGAT β-actin AY141970 F AGGGCGTAATGGTGGGCATG 348 R TCACCGGAGTCCATCACGAT Primer1: Forward (F) and reverse (R).
LHR2: High homology (>97%) for LHR isoforms 1 (Accn. U41413) and 2 (Accn. U41414) in bovine.
Table 4.1. GenBank accession numbers and sequences of primers used to amplify first strand cDNA for P450 aromatase (aromatase), P450 17α-hydroxylase (17α-OH), Fas antigen/CD95/APO-1 (Fas), Fas ligand (FasL), LH receptor (LHR), FSH receptor (FSHR) and β-actin.
115
C EB Variablea H12 H36 NW H12 H36 NW
Observations (n) 1 3 3 4 4 4
Concentrations (ng/ml) in follicular fluid Estradiol 366 258 ± 27b 28 ± 18c 545 ± 182 49 ± 4c 1.3 ± 1d Progesterone 38 35 ± 2b 28 ± 5b 30 ± 6 23 ± 4b 118 ± 31c Testosterone 5.2 2.7 ± 1.3b 1.3 ± 0.6b,c 15.2 ± 4.2 0.2 ± 0.1c 1.5 ± 0.4b Androstenedione 2.9 1.2 ± 0.6b,d 2.0 ± 0.6d,e 18.8 ± 8.7 0.2 ± 0.1b 3.5 ± 1.2e
Histological characteristics No. granulosa cell 8.8 11.1 ± 1.9 4.7 ± 0.4 11.0 ± 1.7 8.3 ± 0.6 2.1 ± 0.6 layersf % granulosa cells 4.6 3.8 ± 3.2 25.0 ± 6.2 0.3 ± 0.3 1.9 ± 1.8 25.7 ± 6.4 apopticg a Mean comparisons confined to treatment differences among the H36 and NW groups. b,c,d,e Means within rows with no common superscripts are different (P < 0.05). fTreatment (P < 0.05) and time (P < 0.01). gTime (P < 0.01).
Table 4.2. Experiment 1: Concentrations of steroid hormones in follicular fluid and histological characteristics of the granulosa cell membrane in dominant follicles collected at H 12, H 36 or after emergence of a new follicular wave (NW) in heifers treated with 1 mg EB i.m./500 kg BW (EB) on Day 5.6 ± 0.1 of the estrous cycle (designated as Hour [H] 0), as compared with contemporary untreated controls (C).
116
Steroid hormone 0HC 24HC 24HEB
No. observations (n) 7 7 8 Estradiol (ng/mL) 259.2 ± 93.0a 164.4 ± 39.1a 46.2 ± 8.1b Progesterone (ng/mL) 41.0 ± 5.3a 43.4 ± 3.7 a 31.0 ± 2.7 b* Testosterone (ng/mL) 3.5 ± 1.7 1.8 ± 0.6 1.3 ± 0.4 a,bDifferent superscript letters within rows designate different (P < 0.05) mean values.
*Tendency (P = 0.08) for a difference among 0HC and 24HEB treatments.
Table 4.3. Experiment 3: Steroid hormone concentrations in follicular fluid (FF) of the first dominant follicle at Day 6.4 ± 0.1 of the estrous cycle (designated as Hour [H] 0; 0HC), at H 24 (24HC) or at H 24 with administration of 1 mg EB i.m./500 kg BW at H 0 (24HEB).
117 b) 20 a) 14
EBNW (n = 7) 12 )
15 CNW (n = 7) m ) m (
L 10 1
m F g/ p
D 8
f (
10 o ol
er
adi 6 et r t
s am E i 4 5 D 2
0 0 -120 -96 -72 -48 -24 0 24 48 72 96 120 -120 -96 -72 -48 -24 0 24 48 72 96 120 Time relative to treatment (h) Time relative to treatment (h)
c) 5 d)
4
) 2 ) mL) L g
3 m g/
n (
one (ng/ H
S 2 F 1 g( M ogester LS
Pr 1
0 0 -120 -96 -72 -48 -24 0 24 48 72 96 120 -120 -96 -72 -48 -24 0 24 48 72 96 120 Time relative to treatment (h) Time relative to treatment (h)
Figure 4.1. Experiment 1: Plasma concentrations of estradiol (a), diameter of the first dominant follicle (DF1; b), plasma concentrations of progesterone (c) and FSH (d) in heifers that received 1 mg EB i.m./500 kg BW (EBNW) on Day 5.6 ± 0.1 of the estrous cycle (Hour [H] 0) as compared with untreated contemporaries (CNW).
118
a) b) 8 CNW 1.4
7 EBNW 1.2 ) l
6 m
g/ 1 n ( e 2 h 5 1 / ud 0.8 t s i
l e s p
l 4
m a
pu 0.6
e H 3 s l L u
p 0.4
2 H L 0.2 1
0 0 -12-0 0-12 24-36 48-60 -12- 0 0-12 24-36 48-60 Period (h) Period (h)
1.2 c)
1
0.8
) l m
/ g n 0.6 (
LH 0.4
0.2
0 -12-0 0-12 24-36 48-60
Period (h)
Figure 4.2. Experiment 1: Frequency of LH pulses/12 h (a), amplitude of LH pulses (b) and mean concentrations of LH (c) during periods of 12 h beginning at H -12, 0, 24 and 48 in heifers that received 1 mg EB i.m./500 kg BW (EBNW; n = 7) on Day 5.6 ± 0.1 of the estrous cycle (Hour [H] 0) as compared with untreated controls (CNW; n = 7).
119
a) b) c) d) Antrum
GCs
RBCs
e) f) g) h)
GCs
i) j) k) l)
GCs
AGC
Figure 4.3. Experiment 1: Example photographs of follicular wall for representative animals of the EB-treated groups; 12EB (a to d), 36EB (e to h) and EBNW (i to l) visualized at 400 X. Hematoxylin and eosin (e and i). DAPI (a and j). Positive control (DNase treated) TUNEL (b and f). TUNEL sample (c, g and k). Negative control (TdT omitted) TUNEL (d, h and l). RBCs; Red blood cells. GCs; Granulosa cells. AGC; Apoptic granulosa cell. 120
C EB
) 2
ml /
g *
(n H
S 1.5 *
M F S
L
1 0 12243648 Time after treatment (h)
Figure 4.4. Experiment 2: Concentrations (LSMs) of FSH during the 48 h period after administration of 1 mg EB i.m./500 kg BW (EB) on Day 13.7 ± 0.2 of the estrous cycle (designated as Hour [H] 0) as compared with contemporary untreated controls (C). Concentrations of FSH for individuals at H 0 were used as a covariate in the model. Differences (P < 0.05) between treatments within time are designated with an asterisk.
121
250 a) C 100 b)
EB ) 200 L 80 m ) L g/ m n / ( g 150 60 n one l ( r e io t d 100 s 40 a
r t s oge
r E 50 P 20
0 0 12 24 36 48 12 24 36 48
Time after treatment (h) Time after treatment (h)
15 c) 30 d)
) L
) L m m
10 ng/ 20 ( ng/
(
one one di r
e t ne
e t os 5 10 t s
os e
T ndr
A 0 0
12 24 36 48 12 24 36 48 Time after treatment (h) Time after treatment (h)
Figure 4.5. Experiment 2: Follicular fluid concentrations of estradiol (a), progesterone (b), testosterone (c), and androstenedione (d) in dominant follicles aspirated at H 12, 24, 36 or 48 in heifers treated with 1 mg EB i.m./500 kg BW (EB) on Day 13.7 ± 0.2 of the estrous cycle (designated as Hour [H] 0), as compared with contemporary untreated controls (C).
122
2.1 24HC
24HEB ) 2 l
m
ng/ 1.9
( H
S 1.8 F
M
LS 1.7
1.6 0 6 12 18 24
Time after treatment (h)
Figure 4.6. Experiment 3: Concentrations (LSMs) of FSH during the 24 h period after administration of 1 mg EB i.m./500 kg BW (24HEB; n = 8) on Day 6.4 ± 0.1 of the estrous cycle (designated as Hour [H] 0) as compared with contemporary untreated controls (24HC; n = 7). Treatment x time; P = 0.06.
123
a b c
0.8 1 1.2
0.9 a 0.7 a 1 a 0.8 0.6 A ab N 0.7 R 0.8 m 0.5 b
e 0.6 NA R as l m 0.4 y 0.5 0.6 ox R atase mRNA b H dr 0.4 L m 0.3 hy 0.4 Aro 0.3
0.2 17a- 0.2 0.2 0.1 0.1
0 0 0 0HC 24HC 24HEB 0HC 24HC 24HEB 0HC 24HC 24HEB
d e f 0.9 0.9 0.8 0.8 0.8 0.7
0.7 0.7 0.6 0.6 0.6
0.5 A A N N
0.5 0.5 R R m m 0.4
L 0.4 s 0.4 s HR mRNA Fa Fa
S 0.3 F 0.3 0.3 0.2 0.2 0.2
0.1 0.1 0.1 0 0 0 0HC 24HC 24HEB 0HC 24HC 24HEB 0HC 24HC 24HEB
Figure 4.7. Experiment 3: Abundance of mRNA for aromatase (a), 17α-hydroxylase (b), LHR (c), FSHR (d), Fas (e) and FasL (f) relative to β-actin in follicular wall of the first dominant follicle at Day 6.4 ± 0.1 of the estrous cycle (0HC; n = 6; designated as Hour [H] 0), at H 24 in untreated controls (24HC; n = 7) or at H 24 in animals administered 1 mg EB i.m./500 kg BW at H 0 (24HEB; n = 8). Unique letter labels denote differences (P < 0.05).
124
CHAPTER 5
ESTRADIOL BENZOATE DELAYS NEW FOLLICULAR WAVE EMERGENCE
IN A DOSE DEPENDENT MANNER AFTER ABLATION OF THE DOMINANT
OVARIAN FOLLICLE IN CATTLE
ABSTRACT
Administration of estradiol benzoate (EB) induces atresia of the dominant follicle
(DF) in the ovaries of cattle within 36 h but emergence of a new wave of follicular development is delayed three to five days. The present study investigated the role of EB in determining timing of emergence of a new wave of follicular development after removing the influence of the DF. At Day 6.4 ± 0.2 after ovulation in Angus and
Angus/Simmental cattle (n = 26), all ovarian follicles ≥ 5 mm in diameter were aspirated with a 17-gauge needle using an ultrasound-guided transvaginal approach (Day [D] 0 and
Hour [H] 0) and animals immediately received 0 (0EB), 1(1EB), 2 (2EB) or 4 (4EB) mg
EB i.m. /500 kg body weight (BW; n = six or seven per treatment). Ovarian structures were monitored by ultrasonography on a daily basis until emergence of a new wave of follicular development occurred. Concentrations of estradiol were different among all treatment groups between H 24 and 72, increasing (P < 0.01) with greater doses of EB 125 administered. Time of peak FSH was H 29.3 ± 4.0, 53.3 ± 4.5, 81.1 ± 15.5 and 91.4 ± 8.2 for the 0EB, 1EB, 2EB and 4EB treatments, respectively, and emergence of a new wave of follicular development occurred on D 1.5 ± 0.2, 3.3 ± 0.3, 4.0 ± 0.6 and 4.4 ± 0.4, respectively. Timing of peak FSH and emergence of a new wave of follicular development was earliest (P < 0.05) in the 0EB treatment, similar (P > 0.1) among the
1EB and 2EB treatments, and most delayed (P < 0.05) in the 4EB treatment when compared to the 0EB or 1EB treatments. The overall mean interval from peak FSH to emergence of a new wave of follicular development was 15.7 ± 3.3 h and was not affected by treatment. Concentrations of estradiol at 24 h before emergence of a new wave of follicular development were not different among EB-treated animals (20.2 ± 5.5 pg/mL), but lower (P < 0.01) in the 0EB treatment (1.6 ± 0.2 pg/mL). In a dose dependent manner, EB delayed the pre-emergence increase in FSH that stimulates emergence of a new wave of follicular development after the DF has ceased to be functional. The importance of using an 'optimal' dose of EB in hormonal regimens using this agent to strategically regulate follicular development is emphasized by the outcomes of this study.
INTRODUCTION
The outcomes of hormonal treatments aimed at controlling the estrous cycle in cattle are to a large extent dependent on the pattern of follicular wave dynamics that occurs inherently in the ovaries. Strategic manipulation of follicular development is a common component in contemporary estrous synchronization programs with the aim of 126 optimizing synchrony of ovulation and fertility (Macmillan and Burke, 1996; Roche et al.
1999; Bo et al., 2002). The desired endpoint of such programs is the presence of a healthy mature dominant follicle (DF), or multiple healthy DFs in the case of a superovulatory regimen, capable of ovulating and releasing a fertile ovum.
Transient increases in circulating concentrations of FSH precede and are responsible for the recruitment of a cohort of small follicles into the growing phase of development (Adams et al., 1992). The approach of strategically regulating follicular development is first to remove the dominating follicle and then to promote, or allow, a synchronous surge in FSH that leads to the synchronous timing of a new wave of follicular development. This can be achieved by physical ablation of the DF (Bergfelt et al., 1994) or through the use of exogenous hormones including GnRH (Twagiramungu et al., 1995), human chorionic gonadotropin (Rajamahendran and Calder, 1993), progesterone (Anderson and Day, 1994), and estradiol(-17β) or ester conjugates of estradiol (Table 5.1).
When concentrations of progesterone are elevated in circulation, estradiol provides a highly efficacious means of synchronizing a new wave of follicular development compared with other exogenous hormones (Roche et al., 1999; Martinez et al., 2000). Previous data (Bogacz et al., 1999) indicated that the efficacy of estradiol benzoate (EB) to induce atresia is dose-dependent until a threshold dosage is attained
(i.e., 1 mg i.m. /500 kg body weight [BW]) while doses of EB greater than that required to consistently promote atresia of the DF (i.e., 2 mg i.m. /500 kg BW), result in increased intervals from treatment to emergence of a new follicular wave. The previous experiments described in Chapter 4 demonstrated that a loss of estrogenic function in the
127 DF after treatment with EB is initiated within 12 h and mostly complete at 36 h, but that the effect of EB to promote atresia in the DF is not necessarily associated with advanced timing of new follicular wave emergence. Thus, the hypothesis was tested that, in the absence of a functional DF, EB delays the timing of new follicular wave emergence in a dose-dependent manner by delaying the increase in FSH that precedes emergence of a new wave of follicular development.
MATERIALS AND METHODS
Animal procedures were approved by The Ohio State University Agricultural Animal
Care and Use Committee (Protocol 01-AG003).
Animals and treatments
This experiment was performed using Angus and Angus/Simmental cattle (n =
26), 4.9 yr (SD; 3.1 yr) of age and weighing 634 kg (SD; 102 kg). All but three cows were nursing calves at 97 d (SD; 26 d) postpartum and all cows were having estrous cycles. Estrous cycles were synchronized following six days feeding of melengestrol acetate (MGA, 0.5 mg/animal/d) with GnRH (Cystorelin, 100 µg i.m.) one day before initiation of MGA feeding, and prostaglandin F2α (Lutalyse, 25 mg i.m. Dinoprost) the day after the end of feeding MGA. At 6.4 ± 0.2 d after ovulation, all ovarian follicles ≥ 5 mm in diameter were aspirated with a 17-gauge needle by the ultrasonography-guided transvaginal approach using a 7.5 MHz convex array transducer (Aloka 500 V,
Wallingford, CT). The procedure used was similar to that described by Bergfelt et al. 128 (1994). Immediately after follicular aspiration (designated as Day [D] 0 and Hour [H] 0), animals received 0 (0EB), 1 (1EB), 2 (2EB) or 4 (4EB) mg EB (CIDIROL, InterAg,
Hamilton, New Zealand)/500 kg BW i.m. (n = six or seven animals per treatment).
Allocation to treatment was balanced for stage of estrous cycle, days since calving and
BW. The diameters of ovarian structures were monitored by transrectal ultrasonography
(7.5 MHz linear array transducer) on a daily basis from D -1 until the emergence of a new wave of follicular development was confirmed retrospectively. The day of new follicular wave emergence was defined as the day on which the largest follicle of a growing cohort was 4 to 5 mm in diameter. Blood samples were collected at D -1 and then every 8 h from
D 0 until emergence of a new follicular wave was confirmed. Blood was collected from a coccygeal vessel into evacuated tubes containing no anticoagulant (Vaccutainer,
Becton-Dickinson, Franklin Lakes, NJ) and kept at 4 °C for 24 to 40 h before centrifugation at 1500 x g for 15 min. Sera were stored at -20 °C until determination of concentrations of FSH, progesterone and estradiol.
Hormone RIAs
Concentrations of FSH were determined in all samples by a double-antibody RIA
(Wolfe et al., 1992) using an antiserum raised against ovine FSH (JAD-RaOFSH #679,
Dr J.A. Dias, New York State Department of Health, Albany, NY) and highly purified ovine FSH (LER 1976-A2, Dr L.E. Reichert, Tucker Endocrine Research Institute, LLC.,
Tucker, GA) as labeled hormone and standards. Because this assay was being used for the first time in our laboratory, parallelism and recovery were validated in sera and plasma samples collected from female cattle. Sera were collected from whole blood 129 allowed to coagulate at 4 °C for 36 h before centrifugation at 1500 x g for 20 min. Plasma samples were prepared by the addition of an anticoagulant (EDTA) and centrifuged within two hours of collection. Parallelism was confirmed by comparing the slopes from serially diluted samples (-1.11 in sera; -1.07 in plasma) with the standard curve (-1.08) after natural log-logit transformation. Average recovery of FSH from standard plasma or sera spiked with purified FSH standards among combined concentrations ranging from
1.7 to 6.6 ng/mL was 107 ± 2.3%. Regression analysis of concentrations of FSH in serially diluted serum and plasma collected from the same animal demonstrated that this assay does not distinguish between these sample types (plasma FSH = 1.00 x serum FSH
– 0.03; r2 = 0.999). Concentrations of FSH in samples of the present study were quantified in two assays having inter-assay CVs of 5.4% and 4.3% for standard concentrations of 2.2 and 3.3 ng/mL, respectively. Average intra-assay CV among duplicate samples was 3.3%. Average sensitivity was 0.3 ng/mL and calculated using the intra-assay CV to determine two standard deviations (95% confidence) from maximum binding.
Concentrations of progesterone were determined using a modified commercially available RIA kit (Coat-a-Count, Diagnostic Products Corporation, Los Angeles, CA).
The modification involved adding 50 µL standard or sample instead of 100 µL as instructed by the manufacturer, while adding 50 µL of Progesterone Zero Calibrator
(Diagnostic Products Corporation, Los Angeles, CA) for a total volume of 100 µL.
Because this assay was being conducted for the first time in our laboratory, the conditions of parallelism and recovery were validated. Parallelism was confirmed by comparing the slopes from serially diluted samples (-0.75) with the standard curve (-0.77) after natural 130 log-logit transformation. Average recovery of progesterone across concentrations ranging from 0.7 to 7.8 ng/mL was 112 ± 2.4%. A single assay was used to measure concentrations in samples collected daily (D -1 to 3) in the present study. Average intra- assay CV among six standards was 4.3%. Average sensitivity was 0.16 ng/mL and calculated using the intra-assay CV to determine two standard deviations (95% confidence) from maximum binding.
Concentrations of estradiol were determined in serum samples collected daily using a double-extraction single-antibody RIA as reported by Kojima et al. (1992) and previously validated in this laboratory (Anderson et al., 1996). The antibody used (Dr.
N.R. Mason, Lilly Research Laboratories, Indianapolis, IN) has 71% cross-reactivity with
EB (Kesler et al., 1977). Samples containing concentrations above the greatest standard of 25 pg/mL were diluted 1:4 or 1:8 in charcoal stripped steer serum. Inter-assay CVs
(three assays) were 10.4 and 6.8% for standard concentrations of 5.4 and 8.9 pg/mL, respectively. Average intra-assay CV among duplicate samples was 3.2%. Average sensitivity was 0.7 pg/mL and calculated using the average intra-assay CV to determine two standard deviations (95% confidence) from maximum binding.
Statistical analyses
Time to peak FSH was assessed in individual animals and defined as the interval from follicular aspiration to the time that concentrations were maximal. The effects of treatment, time and the treatment by time interaction on concentrations of estradiol, progesterone and FSH were analyzed by ANOVA using the MIXED procedure in SAS
V8.1 (SAS Inst. Inc., Cary, NC) with repeated measures analysis included in the model.
131 Log-transformation was used for concentrations of estradiol before analyses to stabilize variances, although actual means are presented in the results. The repeated measures
th model was Yijk = µ + Ti + cj:i + Hk + (TH)ik + eijk, where Yijk is the observation of the j
th th th cow in the i treatment at the k hour, µ is the overall mean, Ti is the i treatment, cj:i is
th th 2 th the random effect of the j cow within the i treatment (cj:i ~ N[0, σ c] ), Hk is the k hour, (TH)ik is the treatment by hour interaction term, and eijk is the random residual effect (eijk ~ N [0, ∑]), where ∑ is the variance-covariance structure of the residual errors with a first order autoregressive structure for repeated measurements within cows . The same repeated measures model was used to compare concentrations of estradiol among treatment groups on the day before, day of and day after emergence of a new wave of follicular development was detected. The effects of treatment on the intervals from treatment initiation to the time of peak FSH and new follicular wave emergence, the interval between the time of peak FSH and new follicular wave emergence, and concentrations of FSH at the time of peak FSH were analyzed using the MIXED procedure in SAS V 8.1 (Yij = µ + Ti + eij, with notations as defined previously).
Likelihood Ratio tests using the ratios of the -2 log restricted maximum likelihoods
(REML) statistic of full and reduced models were performed to test the homogeneity of the variances across treatments (Littell et al., 1996). The full model allowing variances to differ among treatments was used if heterogeneity was indicated. Data are expressed as the mean ± SEM unless stated otherwise.
132 RESULTS
Concentrations of estradiol in circulation
Treatment by time interactions were detected (P < 0.05) when concentrations of estradiol were compared across time from H 0 to 72 in all treatments or to H 120 among the 1EB, 2EB and 4EB treatments (Figure 5.1). Concentrations increased as greater doses of EB were administered, and all treatments differed (P < 0.05) from each other at H 24,
48 and 72. Maximal values were observed at H 24 for the 1EB (29.1 ± 2.9 pg/mL), 2EB
(63.7 ± 9.01) and 4EB (112.1 ± 12.7 pg/mL) treatments. At H 96, concentrations of estradiol for the 2EB (6.8 ± 2.6 pg/mL) and 4EB (10.2 ± 2.1 pg/mL) treatments were similar (P > 0.1), and both were greater (P = 0.06 and P < 0.01, respectively) than the mean for the 1EB treatment (3.2 ± 0.7 pg/mL). There were no differences among these treatments at H 120, nor were there any differences at H 0 among any of the four treatments. Concentrations of estradiol did not differ over time for the 0EB treatment with the overall mean being 1.9 ± 0.2 pg/mL. Relative to the respective mean value within treatments at H 0, concentrations in both the 2EB and 4EB treatments remained greater (P < 0.05) through H 120, but were not different from H 96 onward for the 1EB treatment.
133 Concentrations of progesterone in circulation
Concentrations of progesterone increased (P < 0.01) from D –1 (1.5 ± 0.2 ng/mL) through D 0 (2.0 ± 0.2 ng/mL) and D 1 (2.7 ± .2 ng/mL), before reaching a plateau between D 1 to 3 (2.8 ± 0.2 ng/mL). Concentrations of progesterone were not affected (P
> 0.1) by treatment.
Relationships between follicular development and concentrations of estradiol and FSH
Concentrations of FSH did not differ among treatments at H 0. Aspiration of the
DF without concurrent administration of EB (i.e., 0EB treatment) produced a rapid elevation in concentrations of FSH that peaked at H 29.3 ± 4.0. The well-defined increase in FSH observed in the 0EB treatment was not evident in other treatments (Figure 5.2).
Emergence of a new wave of follicular development was observed either one or two days after aspiration of the DF in all animals of the 0EB treatment and contrasted (P < 0.01) with delayed emergence of a new wave of follicular development among other treatments
(Table 5.2). The effect of EB in delaying the time to emergence of a new wave of follicular development was dose-dependent and followed a similar effect (P < 0.01) of
EB dose on the timing of the FSH peak (Table 5.2). Both of these variables were subject to heterogeneous treatment variance (P < 0.05) as responses were more variable with greater doses of EB administered. Greater variability was particularly evident in the 2EB treatment where in one animal, peak FSH occurred at H 16 followed by new follicular emergence on D 2, while in another, peak FSH occurred at H 152 with new emergence on
D 7. In the remaining five animals of the 2EB treatment, peak FSH ranged from H 72 to
104 and new emergence occurred at either D 3 (one animal) or D 4 (four animals). Mean 134 concentrations of FSH at the time of peak FSH (2.4 ± 0.1 ng/mL) and the interval between peak FSH and new follicular wave emergence (15.7 ± 3.3 h) were not affected
(P > 0.1) by treatment.
A treatment by time interaction was detected (P < 0.01) when concentrations of estradiol were standardized to the time of emergence of a new follicular wave and compared over the interval from 24 h before, to 24 h after emergence of a new follicluar wave (Figure 5.3). Concentrations of estradiol for the 0EB treatment were less (P < 0.05) at all times compared with 2EB and 4EB treatments, but only less (P < 0.05) than the
1EB treatment 24 h prior to new wave emergence. However, no differences were observed among the 1EB, 2EB and 4EB treatments within these time points, with the pooled means being 20.2 ± 5.5, 9.1 ± 2.7 and 5.4 ± 1.6 pg/mL for -24 h, 0 h and 24 h, respectively.
DISCUSSION
An animal model was used whereby the DF was ablated by follicular aspiration to evaluate the effects of EB on FSH secretion and timing in emergence of a new wave of ovarian follicular development independent of influences that may be exerted by the DF while it is simultaneously undergoing atresia in response to EB. In agreement with previous reports (Bergfelt et al., 1994; Amiridis et al., 1999; Tohei et al., 2001), aspiration of the DF without further treatment initiated a rapid and well defined increase in FSH with concentrations peaking at about 29 h and emergence of a new wave of follicular development at 36 h. Time of emergence of a new wave of follicular 135 development and the increase in FSH was delayed by EB that was given at the time of aspiration. Furthermore, this interval was lengthened as dose of EB was increased.
Results of the present study clearly demonstrate that EB delays the post-ablation increase of FSH in a dose dependent manner, and consequently the timing of emergence of a new wave of follicular development.
Consideration of results of the present study, in conjunction with previous investigations, permits the suggestion that a DF undergoing atresia after treatment with estradiol has minimal impact on subsequent follicular development. The 3.3 d interval to emergence of a new wave of follicular development following treatment with 1 mg
EB/500 kg BW in the present study, is virtually identical to previously reported intervals using this same dose in beef heifers (Chapter 3) and in non-lactating beef cows having estrous cycles (Bogacz et al., 1999; Day and Burke, 2002) where follicular aspirations were not performed as in the present study. Further, recent studies from our laboratory have shown that administration of EB initiates a sustained reduction in estrogenic capacity of the DF within 12 h after treatment (Chapter 4) and by 36 h, follicular concentrations of estradiol in the DF of treated animals are similar to those in the DF of untreated animals that have spontaneously become atretic (Chapter 4). The collective evidence argues that any potential influence of the DF undergoing atresia following treatment with EB is masked by the impact of elevated concentrations of estradiol, and has disappeared before estradiol concentrations have declined sufficiently to allow the increase in FSH that stimulates emergence of a new wave of follicular development.
The lower threshold concentration of estradiol that allowed the pre-emergence increase in FSH to proceed in animals receiving EB is estimated at about 20 pg/mL,
136 which was the concentration observed 24 h prior to detection of emergence of a new wave of follicular development and several hours prior to peak concentrations in FSH.
Although concentrations of estradiol had halved (to 9 pg/mL) at the time of emergence of a new wave of follicular development, these values are still several-fold greater than baseline values measured at the time of aspiration during a period of follicular dominance when FSH suppression is expected to be great. A likely explanation for this apparent disparity relates to the action of follicular inhibin in suppressing FSH secretion (Kaneko et al., 1997). Aspiration of the DF transiently reduces concentrations of inhibin in circulation (Tohei et al., 2001). Although not quantified in the present study, we presume that follicular aspiration on D 0 reduced the magnitude of inhibin negative feed back on
FSH secretion and that FSH suppression was predominantly sustained by elevated estradiol. Thus, a reduction in circulating inhibin as a result of follicular aspiration may explain why concentrations of estradiol were considerably greater than normal while allowing the pre-emergence increase in FSH to occur.
Treatment with EB prevented the rapid postablation increase in FSH, but it did not reduce concentrations of FSH below pretreatment values. Other studies conducted in ovariectomized cattle having supra-physiological secretion of gonadotropins have demonstrated that estradiol suppresses secretion of FSH (Burke et al., 1996) in a dose dependent manner (Roche et al., 1999). In the present study, administration of EB coincided with a period of maximum dominance of the DF (Day 6.4 of the estrous cycle), and presumably therefore, minimum concentrations of FSH. The present data suggest that exogenous estradiol does not reduce FSH below concentrations already under maximal suppression by a fully functional DF. Responses in FSH secretion to EB may differ at
137 other stages of the estrous cycle when follicular dominance is not so strong, or not so synchronously established as it is on Day 6 or 7 of the estrous cycle. A previous study
(Exp. 2 of Chapter 4) investigating the effects of EB on function of the second DF that emerges during the midluteal phase of the cycle, did observe a transient reduction in FSH concentrations, and small doses of estradiol have been successfully used as a tool to reduce FSH during the selection phase of follicular dominance (Ginther et al., 2000).
Although the inclusion of an estrogen at the initiation of progestin-based treatments, or during the luteal phase of the estrous cycle generally promotes a synchronous timing of emergence of a new wave of follicular development, the interval to emergence is variable (Table 5.1). This variability could be due to a number of factors with the most obvious being formulation (Bo et al., 2000; Vynckier et al., 1990; present study), route of delivery, and dose of estradiol (Table 5.1). The influence of the type of animal being treated and its metabolic and physiological state has not been directly investigated to our knowledge, but when considering a number of studies using EB administered intramuscularly (Table 5.1), responses appear to be affected by animal breed-type (dairy versus beef), and maternal or lactation status. These factors are associated with differences in metabolic status and hence differences in metabolic clearance rates. Thus, in addition to the pharmacological properties of the estrogen administered, differences in metabolic clearance rates of estradiol from circulation are likely to influence the point at which concentrations of estradiol in circulation fail to maintain suppression of the pre-emergence increase in FSH, and thus the timing of new follicular wave emergence. However, the variability in response observed with
138 administration of greater doses of EB in the present study, particularly the 2EB treatment, suggests other sources of variation not identified in the preceding discussion.
These results clearly demonstrate a dose-dependent effect of EB on delaying the pre-emergence increase in FSH that stimulates emergence of a new wave of follicular development. It is concluded that when atretogenic doses of EB are administered, timing of new follicular wave emergence is dependent on clearance of estradiol from circulation and the attainment of a lower threshold concentration of estradiol that allows the pre- emergence increase in FSH to occur. The importance of using an 'optimal' dose of EB in hormonal regimens using this agent to strategically regulate follicular development is emphasized by the outcome of the present study.
139
Interval to new Estrogena Stage of follicular wave emergence Animalb Reference (dose/route) wave development (d) Bo et al., 1995a E-17β (5 mg i.m.) 4.3 ± 0.2 Beef cows/heifers Growing/dominance and b Martinez et al., E-17β (5 mg i.m.) 3.4 ± 0.1 Beef heifers Random 2000 Anestrous suckling EB (1 mg i.m.) 3.0 Various Salfen et al., 2001 beef cows EB (10 mg i.vag.) 4.0 ± 0.3 Dairy cows Growing/dominance Burke et al., 1999 EB (1 mg i.m.) 4.5 ± 0.2 Dairy cows Growing/dominance Burke et al., 2000 Lactating dairy EB (1 mg i.m.) 2.8 ± 0.8 Growing/dominance Burke et al., 1998 heifers Lactating dairy EB (2 mg i.m.) 3.2 ± 0.4 Growing/dominance Burke et al., 1998 heifers EB (1 mg i.m./500 Prepubertal beef 3.1 ± 0.1 Random Burke et al., 2001 kg BW) heifers EB (1 mg i.m./500 Burke et al., 2001 3.2 ± 0.1 Beef heifers Dominance kg BW) EB (1 mg i.m./500 Anestrous suckling Burke et al., 2001 2.2 ± 0.2 Random kg BW) beef cows EB (1 mg i.m./500 Bogacz et al., 3.3 ± 0.5 Beef cows Dominance kg BW) 1999 EB (2 mg i.m./500 Bogacz et al., 5.0 ± 0.3 Beef cows Dominance kg BW) 1999 Lactating dairy Thundathil et al. ECP (0.5 mg i.m.) 6.5 ± 0.6 Growing cows 1998 Lactating dairy Thundathil et al. ECP (1 mg i.m.) 5.8 ± 0.5 Growing cows 1998 aEstrogen (dose/route): E-17β (estradiol-17β); EB (estradiol benzoate); ECP (estradiol cypionate); Route: i.m. (intramuscular); i.vag. (intravaginal); BW (body weight). bAnimal: Non-lactating and cyclic unless otherwise noted.
Table 5.1. Intervals from treatment initiation to emergence of a new wave of ovarian follicular development in cattle administered estrogen at various stages of follicular wave development and during periods of elevated progesterone/progestin in circulation from exogenous and/or endogenous sources.
140
Treatment 0EB 1EB 2EB 4EB Animals (n) 6 6 7 7 Time to FSH peak (h) 29.3 ± 4.0a 53.3 ± 4.5b 81.1 ± 15.5bc 91.4 ± 8.2c Range (h) 24-48 48-72 16-152 56-120 Time to new emergence (d) 1.5 ± 0.2a 3.3 ± 0.3b 4.0 ± 0.6bc 4.4 ± 0.4c Range (d) 1-2 2-4 2-7 3-6 abcValues with different superscript letters within rows are different (P < 0.05).
Table 5.2. Intervals from treatment initiation to time of maximal concentration of FSH (FSH peak) and emergence of a new wave of follicular development in cows receiving 0 (0EB), 1 (1EB), 2 (2EB) or 4 (4EB) mg estradiol benzoate (EB) i.m. per 500 kg BW immediately after ablation of all ovarian follicles >4 mm in diameter 6.4 ± 0.2 d after ovulation.
141
120
100 ) L
m 80 / g p
l ( 60 io d a tr
s 40 E
20
0 0 24487296120 Time after treatment (h)
Figure 5.1. Mean concentrations of estradiol in circulation of cows receiving 0 (0EB, ○ ), 1 (1EB, □ ), 2 (2EB, ● ) or 4 (4EB, ■ ) mg estradiol benzoate (EB)/500 kg BW i.m. immediately after ablation of all ovarian follicles > 4 mm in diameter 6.4 ± 0.2 d after ovulation. Blood samples were collected until emergence of a new follicular wave was confirmed.
142
2.5
2.0 ) L m
/ 1.5 g n (
FSH 1.0
0.0 0 24487296120 Time after treatment (h)
Figure 5.2. Mean concentrations of FSH in circulation of cows receiving 0 (0EB, ○; SEM = 0.20), 1 (1EB, □; SEM = 0.18), 2 (2EB, ●; SEM = 0.17) or 4 (4EB, ■; SEM = 0.16) mg estradiol benzoate (EB)/500 kg BW i.m. immediately after ablation of all ovarian follicles >4 mm in diameter 6.4 ± 0.2 d after ovulation. Blood samples were collected until emergence of a new follicular wave was confirmed.
143
40
30 ) L m / g p
l ( 20 io d a tr s
E 10
0 -24 0 24 Time relative to new wave emergence (h)
Figure 5.3. Mean concentrations of estradiol in circulation relative to the timing of new follicular wave emergence of cows receiving 0 (0EB, ○ ), 1 (1EB, □ ), 2 (2EB, ● ) or 4 (4EB, ■ ) mg estradiol benzoate (EB)/500 kg BW i.m. immediately after ablation of all ovarian follicles >4 mm in diameter 6.4 ± 0.2 d after ovulation.
144
CHAPTER 6
GENERAL DISCUSSION
The initial three experiments (Chapter 3) investigated responses to using estradiol benzoate (EB) to stimulate estrus and ovulation in cattle at various stages of reproductive competence. It was hypothesized that a mature dominant follicle (DF) must be present when this stimulus is provided in order for estrus to be accompanied with ovulation. In all animals, immature follicles had emerged two days previously and this was the earliest practical time to test the ability of estradiol to induce ovulation of immature follicles, without resorting to predicting timing of new follicular emergence. All cows that had an immature DF at the time that EB was administered were detected in estrus, but less than half of them ovulated. In the four cows that did ovulate from an immature DF, the subsequently formed corpus luteum was smaller and less functional compared with when a mature DF ovulated. The hypothesis was accepted for anovulatory cows, and an inadequate control of follicular development is proposed to be at least one of the underlying problems for the limited success in treating anestrous cattle with progesterone and estradiol. The same line of inquiry is applicable to estrous synchronization programs that are based on GnRH (e.g., Ovsynch), and accordingly has become the basis of another
Ph.D. program (Martin Mussard) in this laboratory.
145 Unlike anestrous cows, estrus and ovulatory responses in prepubertal or postpubertal heifers were not affected by maturity of the DF. The nature of the subsequent estrous cycle in heifers was characterized only to the extent that we were able to determine that the luteal phase was of a normal length. Studies have since been published that aimed to address very similar questions to those posed in the present study.
Evans et al. (2003) implemented a design that was virtually identical to that for the postpubertal heifers (Exp. 2 of Chapter 3) of the present study. They also found that the length of the subsequent estrous cycle was normal after administering EB when the preovulatory follicle was immature, and further, that the size of the corpus luteum was similar to that when a mature DF ovulated. Additionally, they demonstrated that the temporal relationships between estrus, the LH surge and ovulation were not affected by stage of maturity of the DF.
Why heifers respond differently to mature cattle is not clear, although one possibility is that follicles mature earlier and at a comparatively smaller size in heifers. If this is the case, then it may provide a clue to discovering the underlying cause for why heifers respond differently to some estrous synchronization treatments as compared with cows. For example, the Ovsynch program provides acceptable results in mature cattle but does not work well in heifers. Similarly, long-term progesterone treatments (e.g., 10 d) produce acceptable pregnancy results in heifers, but in mature cows, pregnancy rates are negatively impacted with progesterone treatment involving more than 8 d. This does not mean that a regulated pattern of follicular development in heifers is unnecessary. Another report published subsequent to the present study demonstrated that when estradiol was
146 used as a stimulus for estrus/ovulation during the presence of an immature DF in heifers, pregnancy rate in was decreased (57%) compared with when a mature DF was present
(84%; Lane et al., 2001).
The experiments described in Chapter 4 are important and novel. Our prior knowledge regarding the use of estradiol benzoate (EB) was that it caused the DF to relinquish dominance and consequently allowed a new wave of follicular development to evolve. This response was colloquially referred to as 'follicle wave turnover'. The underlying mechanism for loss of dominance by the DF was assumed to be that the DF became atretic, and that the timing of emergence of a new wave of follicular development was dependent on the DF becoming atretic. The delay and variability in timing of emergence of a new wave of follicular development (i.e., two to five days), as compared with other approaches in removing dominance, was considered to be a consequence of variable rates of atresia in the DF.
The results of the present study clearly demonstrate that EB promotes a rapid, sustained and consistent loss in the ability of the DF to produce estradiol. We have considered this to be indicative of atresia because follicles with a low content of estradiol are classically defined as atretic. By this definition, the DF present when EB was administered was atretic at 36 h, and a major reduction in mRNA for a key enzyme was obvious within 24 h. However, the timing of emergence of a new wave of follicular development occurred four to five days later. Thus, the assumption that the timing of new emergence is dependent on the timing of atresia in the DF was incorrect. Induction of atresia in the DF by treatment with EB is requisite for new follicular development, but it is not the only factor involved in this process.
147 The final experiment demonstrated that administration of EB regulates the timing of emergence of a new wave of follicular development in a dose-dependent manner irrespective of the DF. While there is no question that EB will induce atresia in the DF, the indications are that timing of new emergence is dependent on a more direct effect of estradiol. These results suggested that clearance of estradiol from circulation is a key factor in determining the timing of the pre-emergence increase in FSH and consequently, timing of new emergence. This is an important discovery because it unlocks the mystery surrounding the variability in responses (Table 5.1) observed among cattle when EB is used to promote emergence of a new wave of follicular development.
Unfortunately, it also signals that achieving a highly synchronous wave of new follicular development with estradiol alone may be more difficult than previously thought. This is because clearance of estradiol from circulation will be dependent on the metabolic rate of an individual animal. From Table 5.1, it is notable that the timing to emergence of a new wave of follicular development after 1 mg EB was 4.5 d in the non- lactating New Zealand type dairy cow weighing 500 kg (Burke et al., 2000), but only 2.8 d in a similar type of animal that was in peak lactation (Burke et al. 1998). Further, because steroid type compounds are readily taken out of circulation by body fat, variations in body fat mass will add another dimension to variability in clearance of estradiol from circulation. Again this is supported by data in Table 5.1. An interval about
3.3 d to emergence of a new wave of follicular development was observed in non- lactating American beef heifers treated with 1 mg EB/500 kg body weight (Bogacz et al.,
1999; Chapter 3), which was at least a day earlier than when the same dose per body weight was administered to non-lactating New Zealand dairy cows. Finally, in American
148 beef cows nursing calves, an unprecedented interval of just 2.2 d to emergence of a new wave of follicular development was observed (Chapter 3; Table 5.1).
The application of estrous synchronization programs that use estradiol to ensure that emergence of a new wave of follicular development occurs during the estrous synchrony treatment, should take account of this variation and tailor the program to suit the animal type being treated. Limiting the variation between individuals of the same population would require the development of a method(s) that synchronizes the timing of the pre-emergence increase in FSH.
149
BIBLIOGRAPHY
Abel, M. H, A. N. Wootton, V. Wilkins, I. Huhtaniemi, P. G. Knight, and H. M. Charlton. 2000. The effect of a null mutation in the follicle-stimulating hormone receptor gene on mouse reproduction. Endocrinol. 141:1795-1803.
Acosta, T. J., T. Ozawa, S. Kobayashi, K. Hayashi, M. Ohtani, W. D. Kraetzl, K. Sato, D. Schams, and A. Miyamoto. 2000. Periovulatory changes in the local release of vasoactive peptides, prostaglandin F2α, and steroid hormones from bovine mature follicles in vivo. Biol. Reprod. 63:1253-1261.
Adams, G. P., K. Kot, C. A. Smith, and O. J. Ginther. 1993. Selection of the dominant follicle and suppression of follicular growth in heifers. Anim. Reprod. Sci. 30:259- 271.
Adams, G. P., R. L. Matteri, J. P. Kastelic, J. C. H. Ko, and O. J. Ginther. 1992. Association between surges of follicle-stimulating hormone and the emergence of follicles waves in heifers. J. Reprod. Fertil. 94:177-188.
Adrain, C., and S. J. Martin. 2001. The mitochrondrial apoptosome: A killer unleashed by the cytochrome seas. TRENDS Biochem. Sci. 26:390-397.
Ahmad, N., F. N. Schrick, R. L. Butcher, and E. K. Inskeep. 1995. Effect of persistent follicles on early embryonic losses in beef cows. Biol. Reprod. 52:1129-1135.
Algire, J. E., A. Srikandakumar, L. A. Guilbault, and B. R. Downey. 1992. Preovulatory changes in follicular prostaglandins and their role in ovulation in cattle. Can. J. Vet. Res. 56:67-69.
150 Allrich, R. D. 1994. Endocrine and neural control of estrus in dairy cows. J. Dairy Sci. 77:2738-2744.
Amiridis, G. S., L. Robertson, S. Reid, J. S. Boyd, P. J. O'Shaughnessy, and I. A. Jeffcoate. 1999. Plasma estradiol, FSH and LH concentration after dominant follicle aspiration in the cow. Theriogenology 52:995-1003.
Anderson, E., and D. F. Albertini. 1976. Gap junctions between the oocyte and companion follicle cells in the mammalian ovary. J. Cell. Biol. 71:680-686.
Anderson, L.H., C. M. McDowell, and M. L. Day. 1996. Progestin-induced puberty and secretion of luteinizing hormone in heifers. Biol. Reprod. 54:1025-1031.
Anderson, L. H., and M. L. Day. 1994. Acute progesterone administration regresses persistent dominant follicles and improves fertility of cattle in which estrus was synchronized with melengestrol acetate. J. Anim. Sci. 72:2955-2961.
Anderson, L. H., and M. L. Day. 1998. Development of a progestin-based estrus synchronization program: I. Reproductive response of cows fed melengestrol acetate for 20 days with an injection of progesterone. J. Anim. Sci. 76:1267-1272.
Armstrong, D. G., and R. Webb. 1997. Ovarian follicular dominance: the role of intraovarian growth factors and novel proteins. Rev. Reprod. 2:139-146.
Asa, S. L., K. Kovacs, and S. Melmed. 1995. The hypothalamic-pituitary axis. Pages 3 to44 in The Pituitary. S. Melmed, ed. Blackwell Science, Cambridge, MS.
Asdell, S. A., J. de Alba, and J. S. Roberts. 1945. The levels of ovarian hormones required to induce heat and other reactions in the ovariectomized cow. J. Anim. Sci. 4:277.
Austin, E. J., M. Mihm, A. C. O. Evans, P. G. Knight, J. L. H. Ireland, J. J. Ireland, and J. F. Roche. 2001. Alterations in intrafollicular regulatory factors and apoptosis during selection of follicles in the first follicular wave of the bovine estrous cycle. Biol. Reprod. 64:839-848.
151
Austin, E. J., M. Mihm, M. P. Ryan, D. H. Williams, and J. F. Roche. 1999. Effect of dominance of the ovulatory follicle on onset of estrus and fertility in heifers. J. Anim. Sci. 77:2219-2226.
Badinga L., M. A. Driancourt, J. D. Savio, D. Wolfenson, M. Drost, R. L. de la Sota, and W. W. Thatcher. 1992. Endocrine and ovarian responses associated with the first- wave dominant follicle in cattle. Biol. Reprod. 47:871-883.
Bao B., and H. A. Garverick. 1998. Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: A review. J. Anim. Sci. 76:1903-1921.
Bartlett P. C., P. K. Ngategize, J. B. Kaneene, J. H. Kirk, S. M. Anderson, and E. C. Mather. 1986. Cystic follicular disease in Michigan Holstein-Friesian cattle: incidence, descriptive epidemiology and economic impact. Prev. Vet. Med. 4:15-34.
Baryshnikov I. A., and É. P. Kokorina. 1964. Higher nervous activity of cattle. Dairy Sci. Abstr. 26:97-115.
Beck, T. W., and E. M. Convey. 1977. Estradiol control of serum luteinizing hormone concentrations in the bovine. J. Anim. Sci. 45:1096-1101.
Beal, W. E., J. R. Chenault, M. L. Day, and L. R. Corah. 1988. Variation in conception rates following synchronization of estrus with melengestrol acetate and prostaglandin F2α. J. Anim. Sci. 66:599-602.
Beg, M. A., D. R. Bergfelt, K. Kot, and O. J. Ginther. 2002. Follicle selection in cattle: Dynamics of follicular fluid factors during development of follicle dominance. Biol. Reprod. 66:120-126.
Beg, M. A., D. R. Bergfelt, K. Kot, M. C. Wiltbank, and O. J. Ginther. 2001. Follicular fluid factors and granulosa-cell gene expression associated with follicle deviation in cattle. Biol. Reprod. 64:432-441.
152 Bergfeld, E. G., F. N. Kojima, A. S. Cupp, M. E. Wehrman, K. E. Peters, V. Mariscal, T. Sanchez, and J. E. Kinder. 1996. Changing dose of progesterone results in sudden changes in frequency of luteinizing hormone pulses and secretion of 17 beta-estradiol in bovine females. Biol. Reprod. 54:546-553.
Bergfelt, D. R., K. C. Lightfoot, and G. P. Adams. 1994. Ovarian synchronization following ultrasound-guided transvaginal follicle ablation in heifers. Theriogenology 42:895-907.
Bevers, M. M., S. J. Dieleman, R. van den Hurk, and F. Izadyar. 1997. Regulation and modulation of oocyte maturation in the bovine. Theriogenology 47:13-22.
Bevers, M. M., and F. Izadyar. 2002. Role of growth hormone and growth hormone receptor in oocyte maturation. Mol. Cell. Endocrinol. 197:173-178.
Bhasin, S., and Swerdloff, R. S. 1995. Follicle-stimulating hormone and luteinizing hormone. Pages 230-276 in The Pituitary. S. Melmed, ed. Blackwell Science, Cambridge, MS.
Billig, H., I. Furuta, and A. J. Hsueh. 1993. Estrogens inhibit and androgens enhance ovarian granulosa cell apoptosis. Endocrinology. 133:2204-2212.
Blaustein, J. D., and D. H. Olster. 1989. Gonadol steroid hormone receptors and social behaviors. Adv. Comp. Environ. Physiol. 3:31-104.
Bleach, E. C. L., R. G. Glencross, S. A. Feist, N. P. Groome, and P. G. Knight. 2001. Plasma inhibin in heifers, relationship with follicular dynamics, gonadotropins and steroids during the estrous cycle and after treatment with bovine follicular fluid. Biol. Reprod. 64:743-752.
Bo, G. A., G. P. Adams, M. Caccia, M. Martinez, R. A. Pierson, and R. J., Mapletoft. 1995a. Ovarian follicular wave emergence after treatment with progestogen and estradiol in cattle. Anim. Reprod. Sci. 39:193-204.
Bo, G. A., G. P. Adams, R. A. Pierson, and R. J. Mapletoft. 1995b. Exogenous control of follicular wave emergence in cattle. Theriogenology 43:31-40.
153
Bo, G. A., G. P. Adams, R. A. Pierson, H. E. Tribulo, M. Caccia, and R. J. Mapletoft. 1994. Follicular wave dynamics after estradiol-17β treatment of heifers with or without a progestogen implant. Theriogenology 41:1555-1569.
Bo, G. A., P. S. Baruselli, D. Moreno, L. Cutaia, M. Caccia, R. Tribulo, H. Tribulo, and R. J. Mapletoft. 2002. The control of follicular wave development for self-appointed embryo transfer programs in cattle. Theriogenology 57:53-72.
Bo, G. A., D. R. Bergfelt, G. M. Brogliatti, R. A. Pierson, G. P. Adams, and R. J. Mapletoft. 2000. Local versus systemic effects of exogenous estradiol-17β on ovarian follicular dynamics in heifers with progestogen implants. Anim. Reprod. Sci. 59:141- 157.
Bodensteiner K. J., M. C. Wiltbank, D. R. Bergfelt, and O. J. Ginther. 1996. Alterations in follicular estradiol and gonadotropin receptors during development of bovine antral follicles. Theriogenology 45:499-512.
Bogacz, V. L., J. E. Huston, D. E. Grum, and M. L. Day. 1999. Identification of the optimal dose of estradiol benzoate in combination with a progestin to program follicular turnover in cyclic cattle. J. Anim. Sci. (Suppl. 1) 77:124 (Abstr.).
Bogacz, V. L., J. E. Huston, D. E. Grum, and M. L. Day. 2000. Effect of estradiol benzoate in combination with progesterone to induce follicular turnover at various stages of the estrous cycle. J. Anim. Sci. (Suppl. 1) 83: 211 (Abstr.).
Brink, J. T., and G. H. Kiracofe. 1988. Effect of estrous cycle stage at Syncro-Mate B treatment on conception and time to estrus in cattle. Theriogenology 29:513-520.
Brit, J. H., R. G. Scott, J. D. Armstrong, and M. D. Whitacre. 1986. Determinants of estrous behavior in lactating Holstein cows. J. Dairy Sci. 69:2195-2202.
Burghardt, R. C., and E. Anderson. 1981. Hormonal modulation of gap junctions in rat ovarian cells. Cell Tissue Res. 214:181-193.
154 Burke, C. R., M. P. Boland and, K. L. Macmillan. 1999. Ovarian responses to progesterone and oestradiol benzoate administered intravaginally during dioestrus in cattle. Anim. Reprod. Sci. 55:23-33.
Burke, C. R., M. L. Day, C. R. Bunt, and K. L. Macmillan. 2000. Use of a low dose of estradiol benzoate during diestrus to synchronize development of the ovulatory follicle in cattle. J. Anim. Sci. 78:145-151.
Burke, C. R., M. L. Day, B. A. Clark, C. R. Bunt, M. J. Rathbone, and K. L. Macmillan, 1997. Effect of luteolysis on follicle wave control using oestradiol benzoate in cattle. Proc. New Zealand Soc. Endocrinol. 40:134 (Abstr.).
Burke, C. R., K. L. Macmillan, and M. P. Boland. 1996a. Oestradiol potentiates a prolonged progesterone-induced suppression of LH release in ovariectomised cows. Anim. Reprod. Sci. 45:13-28.
Burke, C. R., S. Morgan, B. A. Clark, and F. M. Rhodes. 1998. Effect of luteolysis on control of ovarian follicles using oestradiol benzoate and progesterone in cattle. Proc. New Zealand Soc. Anim. Prod. 58:89-91.
Burke, C. R., M. L. Mussard, C. L. Gasser, D. E. Grum, and M. L. Day. 2003. Estradiol benzoate delays new follicular wave emergence in a dose dependent manner after ablation of the dominant ovarian follicle in cattle. Theriogenology (In Press).
Burke, C. R., M. L. Mussard, D. E. Grum, and M. L. Day. 2001. Effects of maturity of the potential ovulatory follicle on induction of oestrus and ovulation in cattle with oestradiol benzoate. Anim. Reprod. Sci. 66:161-174.
Burke, C. R., G. A. Verkerk, and K. L. Macmillan. 1996b. An attempt to create an 'anoestrous cow' model by restricting feed allowances in non-lactating cyclic cows. Proc. New Zealand Soc. Anim. Prod. 56:233-235.
Carr, B. R. 1998. Disorders of the ovaries and female reproductive tract. Pages 751-818 in Williams Textbook of Endocrinology. 9th ed. J. Wilson, D. Foster, H. Kronenbug, and P. Larsen, eds. W. B. Saunders Co., Philadelphia, PA.
155 Carrick, M. J., and J. N. Sheldon. 1969. Oestrogen-progesterone relationships in the induction of oestrus in spayed heifers. J. Endocrinol. 45:99.
Cavalieri, J., L. R. Flinker, G. A. Anderson, and K. L. Macmillan. 2003. Characteristics of oestrus measured using visual observation and radiotelemtry. Anim. Reprod. Sci. 76:1-12.
Christian, R. E., and L. E. Casida. 1948. The effect of progesterone in altering the estrual cycle of the cow. J. Anim. Sci. 7:540 (Abstr.).
Clark, B. J., S. C. Soo, and K. M. Caron. 1995. Hormonal and developmental regulation of the steroidogenic acute regulatory protein. Mol. Cell. Endocrinol. 9:1346-1355.
Clegg, M. T., J. A. Santolucito, J. D. Smith, and W. F. Ganong. 1958. The effect of hypothalamic lesions on sexual behavior and estrous cycles in the ewe. Endocrinol. 62:790-797.
Coe, B. L., and R. D. Allrich. 1989. Relationship between endogenous estradiol-17β and estrous behavior in heifers. J. Anim. Sci. 67:1546-1551.
Conley, A. J., and I. M. Bird. 1997. The role of cytochrome P450 17α-hydroxylase and 3β-hydroxysteroid dehydrogenase in the integration of gonadal and adrenal steroidogenesis via the ∆5 and ∆4 pathways of steroidogenesis in mammals. Biol. Reprod. 56:789-799.
Conover, C. A., C. Oxvig, M. T. Overgaard, M. Christiansen, and L. C. Guidice. 1999. Evidence that insulin-like growth factor binding protein-4 protease in human ovarian follicular fluid is pregnancy associated plasma protein-A. J. Clin. Endocrinol. Metab. 81:4742-4745.
Cook, D. L., T. A. Winters, L. A. Horstman, and R. D. Allrich. 1986. Induction of estrus in ovariecyomized cows and heifers: Effects of estradiol benzoate and gonadotropin releasing hormone. J. Anim. Sci. 63:546-550.
Coppings, R. J., and P. V. Malven. 1976. Biphasic effect of estradiol on mechanisms regulating LH release in ovariectomized sheep. Neuroendocrinol. 21:146-156. 156
Couse, J. F., and K. S. Korach. 1999. Estrogen receptor null mice: What have we learned and where will they lead us? Endocrine Rev. 20:358-417.
Crowe, M. A., P. Kelly, M. A. Driancourt, M. P. Boland, and J. F. Roche. 2001. Effects of follicle-stimulating hormone with and without luteinizing hormone on serum hormone concentrations, follicle growth, and intrafollicular estradiol and aromatase activity in gonadotropin-releasing hormone-immunized heifers. Biol. Reprod. 64:368- 374.
Danforth, D. R., L. K. Arbogast, S. Glosh, A. Dickerman, R. Rofagha, and C. I. Friedman. 2003. Vascular endothelial growth factor stimulates preantral follicle growth in the rat ovary. Biol. Reprod. 68:1736-1741.
Day, M. L. 1998a. Practical manipulation of the estrous cycle in beef cattle. Pages 51-61 in Proc. of the 31st Annual Convention of the American Association of Bovine Practitioners, September 25, 1998, Spokane, WA.
Day, M. L. 1998b. Estrous control and management of follicular growth with progesterone - based synchrony systems. Pages 10-33 in Proc. of the 17th Annual Convention of the American Embryo Transfer Association, October 16, 1998, San Antonio, TX.
Day, M. L., C. R. Burke, V. K. Taufa, A. M. Day, and K. L. Macmillan. 2000. The strategic use of estradiol to enhance fertility and submission rates of progestin based estrus synchronization programs in seasonal dairy herds. J. Anim. Sci. 78:523-529.
Day, M. L., and C. R. Burke. 2002. Management of follicular growth with progesterone and estradiol within progestin-based estrous synchrony systems. Pages 101-117 in Factors Affecting Calf Crop: Biotechnology of Reproduction. M. Fields, R. Sand and J. Yelich, eds. CRC Press LLC, Boca Raton, FL.
Day, M. L., K. Imakawa, P. L. Pennel, D. D. Zalesky, A. C. Clutter, R. J. Kittok, and J. E. Kinder. 1986. Influence of season and estradiol on secretion of LH in ovariectomized cows. Biol. Reprod. 62:1641-1648.
157 Diskin M. G., E. J. Austin, and J. F. Roche. 2002. Exogenous hormonal manipulation of ovarian activity in cattle. Dom. Anim. Endocrinol. 23:211-228.
Dobson, H. 1978. Plasma gonadotrophins and oestadiol during oestrus in the cow. J. Reprod. Fertil. 52:51-53.
Dyer R. M., M. D. Bishop, and M. L. Day. 1990. Exogenous estradiol reduces inhibition of luteinizing hormone by estradiol in prepubertal heifers. Biol. Reprod. 42:755-761.
Engelhardt, H., J. S. Walton, R. B. Miller, and G. J. King. 1989. Estradiol-induced blockade of ovulation in the cow: Effects of luteinizing hormone release and follicular fluid steroids. Biol. Reprod. 40:1287-1297.
Erickson, G. F., and D. A. Magoffen. 1983. 3. Ovarian function: follicle. The endocrine control of follicle androgen synthesis. J. Steroid Biochem. 19:113-117.
Eppig, J. J. 2001. Oocyte control of ovarian follicular development and function in mammals. Reprod. 122:829-838.
Espey, L. L. 1980. Ovulation as an inflammatory reaction - a hypothesis. Biol. Reprod. 22:73-106.
Evans, N. P., G. E. Dahl, V. Padmanabhan, L. A. Thun, and F. J. Karsch. 1997. Estradiol requirements for induction and maintenance of the gonadotropin-releasing hormone surge: Implications for neuroendocrine processing of the estradiol signal. Endocrinol. 138:5408-5414.
Evans, A. C. O., P. O'Keeffe, M. Mihm, J. F. Roche, K. L. Macmillan, and M. P. Boland. 2003. Effect of oestradiol benzoate given after prostaglandin at two stages of follicle wave development on oestrus synchronization, the LH surge and ovulation in heifers. Anim. Reprod. Sci. 76:13-23.
Fabre-Nys, C., G. B. Martin, and G. Venier. Analysis of the hormonal control of female sexual behavior and the preovulatory LH surge in the ewe: Roles of quantity of estradiol and duration of its presence. Horm. Behav. 27:108-121.
158
Fike, K. E., M. L. Day, E. K. Inskeep, J. E. Kinder, P. E. Lewis, R. E. Short, and H. D. Hafs. 1997. Estrus and luteal function in suckled beef cows that were anestrous when treated with an intravaginal device containing progesterone with or without a subsequent injection of estradiol benzoate. J. Anim. Sci. 75:2009-2015
Findlay, J. K., A. E. Drummond, and R.C. Fry. 1996. Intragonadal regulation of follicular development and ovulation. Anim. Reprod. Sci. 42:321-331.
Fortune, J. E. 1986. Bovine theca and granulosa cells interact to promote androgen production. Biol. Reprod. 35:292-299.
Fortune, J. E. 1994. Ovarian growth and development in mammals. Biol. Reprod. 50:225- 232.
Fortune, J. E., G. M. Rivera, A. C. O. Evans, and A. M. Turzillo. 2001. Differentiation of dominant versus subordinate follicles in cattle. Biol. Reprod. 65:648-654.
Fortune J. E., and S. M. Quirk. 1988. Regulation of steroidogenesis in bovine preovulatory follicles. J. Anim. Sci. 66 (Suppl. 2):1-8.
Gavrieli, Y., Y. Sherman, and A. A. Bensasson. 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119:493-501.
Gibbons, J. R., M. C. Wiltbank, and O. J. Ginther. 1997. Functional interrelationships between follicles greater than 4 mm and the follicle stimulating surge in heifers. Biol. Reprod. 57:1066-1073.
Ginther, O. J., M. A. Beg, D. R. Bergfelt, F. X. Donadeu, and K. Kot. 2001. Follicle selection in monovular species. Biol. Reprod. 65:638-647.
Ginther, O. J., D. R. Bergfelt, L. J. Kulick, and K. Kot. 2000. Selection of the dominant follicle in cattle: Role of two-way functional coupling between follicle-stimulating hormone and the follicles. Biol. Reprod. 62:920-927.
159
Ginther, O. J., L. Knopf, and J. P. Kastelic. 1989a. Ovarian follicular dynamics in heifers during early pregnancy. Biol. Reprod. 41: 247-254.
Ginther, O. J., L. Knopf, and J. P. Kastelic. 1989b. Temporal associations among ovarian events in cattle during oestrous cycles with two and three follicular waves. J. Reprod. Fertil. 87:223-230.
Ginther, O. J., K. Kot, L. J. Kulick, S. Martin, and M. C. Wiltbank. 1996a. Relationships between FSH and ovarian follicular waves during the last six months of pregnancy in cattle. J. Reprod. Fertil. 108:271-279.
Ginther, O. J., K. Kot, L. J. Kulick, and M. C. Wiltbank. 1997a. Sampling follicular fluid without altering follicular status in cattle: Oestradiol concentrations early in the follicular wave. J. Reprod. Fertil. 109:181-186.
Ginther, O. J., K. Kot, L. J. Kulick, and M. C. Wiltbank. 1997b. Emergence and deviation of follicles during the development of follicular waves in cattle. Theriogenology 48:75-87.
Ginther, O. J., M. C. Wiltbank, P. M. Fricke, J. R. Gibbons, and K. Kot. 1996b. Selection of the dominant follicle in cattle. Biol. Reprod. 55:1187-1194.
Glister C., N. P. Groome, and P. G. Knight. 2003. Oocyte-mediated suppression of follicle-stimulating hormone- and insulin-like growth factor-induced secretion of steroids and inhibin-related proteins by bovine granulosa cells in vitro: Possible role of transforming growth factor α. Biol. Reprod. 68:758-765.
Gong, J. G., T. A. Campbell, T. A. Bramley, C. G. Gutierrez, A. R. Peters, and R. Webb. 1996. Suppression in the secretion of follicle-stimulating hormone and luteinizing hormone, and ovarian follicular development in heifers continuously infused with a gonadotropin-releasing hormone agonist. Biol. Reprod. 55:68-74.
Green, D. R., and J. C. Reed. 1998. Mitochrondria and apoptosis. Science 281:1309- 1312.
160 Gross S. A., J. M. Newton, and F. M. Hughes. 2001. Decreased intracellular potassium levels underlie increased progesterone synthesis during ovarian follicular atresia. Biol. Reprod. 64:1755-1760.
Guthrie, H. D., G. R. Welch, B. S. Cooper, A. D. Zakaria, and L. A. Johnson. 1994. Flow cytometric determination of degraded deoxyribonucleic acid in granulosa cells to identify atretic follicles during preovulatory maturation in the pig. Biol. Reprod. 50:1303-1311.
Gwynne, J. T., and J. F. Strauss. 1982. The role of lipoproteins in steroidogenesis and cholesterol metabolism in steroidogenic glands. Endocrine Rev. 3:299-329.
Hafez, E. S. E. 1987. Folliculogenesis, egg maturation and ovulation. Pages 130-167 in Reproduction in Farm Animals. E. Hafez, ed. Lea & Febiger, Philadelphia, PA.
Hanlon, D. W., N. B. Williamson, J. J. Wichtel, I. J. Steffert, A. L. Craigie and D.U. Pfeiffer. 1996. The effect of estradiol benzoate administration on estrous response and synchronized pregnancy rate in dairy heifers after treatment with exogenous progesterone. Theriogenology 45:775-785.
Hansel, W., and E. M. Convey. 1983. Physiology of the estrous cycle. J. Anim. Sci. 57 (Suppl. 2):404-424.
Hansel, W., P. V. Malven, and D. L. Black. 1961. Estrous cycle regulation in the bovine. J. Anim. Sci. 20:621-625.
Hasegawa, Y., K. Miyamoto, Y Abe, T. Nakamura, H. Sugino, Y. Eto, H Shibai, and M. Igarashi. 1988. Induction of follicle-stimulating hormone receptor by erythroid differentiation factor on rat granulosa cells. Biochem. Biophys. Res. Comm. 156:668- 674.
Helmer, S. D., and J. H. Britt. 1985. Mounting behavior as affected by stage of estrous cycle in Holstein heifers. J. Dairy Sci. 68:1290-1296.
Herbison, A. E. 1998. Multimodal influence of estrogen upon gonadotropin-releasing hormone neurons. Endocrine Rev. 19:302-330.
161
Hopper, H. W., R. W. Silcox, D. J. Byerley, and T. E. Kiser. 1993. Follicular development in prepubertal heifers. Anim. Reprod. Sci. 31:7-12.
Hsu, S. Y., and A. J. W. Hsueh. 1998. Intracellular mechanisms of ovarian cell apoptosis. Mol. Cell. Endocrinol. 145:21-25.
Hsu, S. Y., and A. J. W. Hsueh, 2000. Tissue-Specific Bcl-2 protein partners in apoptosis: An ovarian paradigm. Phys. Rev. 80:593-614.
Hu C-L., R. G. Cowan, R. M. Harman, D. A. Porter, and S. M. Quirk. 2001. Apoptosis of granulosa cells after serum withdrawal is mediated by Fas antigen (CD95) and Fas ligand. Biol. Reprod. 64:518-526.
Huang Z., M. J. Fasco, and L. S. Kaminsky. 1996. Optimization of DNase I removal of contaminating DNA from RNA for use in quantitative RNA-PCR. BioTechniques 20:1014-1019.
Hubbard C. J., and G. S. Greenwald. 1981. Changes in DNA, cyclic nucleotides and steroids during induced follicular atresia in the hamster. J. Reprod. Fert. 63:455-461.
Hughes, F. M., and W. C. Gorospe. 1991. Biochemical identification of apoptosis (programmed cell death) in granulosa cells: evidence for a potential mechanism underlying follicular atresia. Endocrinol. 129:2415-2422.
Hutz, R. J., D. J. Dierschke, and R. C. Wolf. 1986. Markers of atresia in ovarian folliclular components from Rhesus Monkeys treated with estradiol-17β. Biol. Reprod. 34:65-70.
Imakawa, K., M. L. Day, D. D. Zalesky, M. Garcia-Winder, R. J. Kittock, and J. E. Kinder. 1986. Regulation of pulsatile LH secretion by ovarian steroids in the heifer. J. Anim. Sci. 63:162-168.
162 Ireland J. J., R. L. Fogwell, W. D. Oxender, K. Ames, and J. L. Cowley. 1984. Production of estradiol by each ovary during the estrous cycle of cows. J. Anim. Sci. 59:764-771.
Ireland J. J., J. F. Roche. 1982a. Development of antral follicles in cattle after prostaglandin-induced luteolysis: Changes in serum hormones, steroids in follicular fluid, and gonadotropin receptors. Endocinol. 111:2077-2086.
Ireland J. J., J. F. Roche. 1982b. Effect of progesterone on basal LH and episodic LH and FSH secretion in heifers. J. Reprod. Fert. 64:295-302.
Ireland J. J., J. F. Roche. 1983a. Development of nonovulatory antral follicles in heifers: Changes in steroids in follicular fluid and receptors for gonadotropins. Endocinol. 112:150-156.
Ireland J. J., J. F. Roche. 1983b. Growth and differentiation of large antral follicles after spontaneous luteolysis in heifers: Changes in concentration of hormones in follicular fluid and specific binding of gonadotropins to follicles. J. Anim. Sci. 57:157-167.
Jo, M., and J. E. Fortune. 2002. Oxytocin inhibits LH-stimulated production of androstenedione by bovine theca cells. Mol. Cell. Endocrinol. 188:151-159.
Jo, M., and J. E. Fortune. 2003. Changes in oxytocin receptor in bovine preovulatory follicles between the gonadotropin surge and ovulation. Mol. Cell. Endocrinol. 200:31-43.
Kaipia A., and A. J. W. Hsueh. 1997. Regulation of ovarian follicle atresia. Annu. Rev. Physiol. 59:349-363.
Kaneko, H., J. Noguchi, K. Kikuchi, J. Todoroki, and Y. Hasegawa. 2002. Alterations in peripheral concentrations of inhibin A in cattle studied using a time-resolved immunofluorometric assay: Relationship with estradiol and follicle-stimulating hormone in various reproductive conditions. Biol. Reprod. 67:38-45.
163 Kaneko, H., K. Taya, G. Watanabe, J. Noguchi, K. Kikuchi, A. Shimada, and Y. Hasegawa. 1997. Inhibin is involved in the suppression of FSH secretion in the growth phase of the dominant follicle during the early luteal phase in cows. Dom. Anim. Endocrinol. 14:263-271.
Kaneko, H., T. Terada, K. Taya, G. Watanabe, S. Sasamoto, Y. Hasegawa, and M. Igarashi. 1991. Ovarian follicular dynamics and concentrations of oestradiol-17β, progesterone, luteinizing hormone and follicle stimulating hormone during the periovulatory phase of the oestrous cycle in the cow. Reprod. Fertil. Dev. 3:529-535.
Karsch, F. J., J. M. Bowen, A. Caraty, N. P. Evans, and S. M. Moenter. 1997. Gonadotropin-releasing hormone requirements for ovulation. Biol. Reprod. 56:303- 309.
Karsch, F. J., F. J. P. Ebling, and M. N. Lehman. 1989. Do catecholaminergic, neuropeptide Y, substance P and GABAergic terminals innervate GnRH neurons in the sheep? Soc. Neurosci. Abstr. 15:1083.
Katz, L. S., E. A. B. Oltenacu, and R. H. Foote. 1980. The behavioral responses in ovariectomized cattle to estradiol, testosterone, androstenedione, or dihydrotestosterone. Horm. Behav. 14:224-235.
Kerr, J. F., A. H. Wyllie, and A. R. Currie. 1972. Apoptosis: A basic biological phenomenon with wide-ranging implications in tissue kinetics. Br. J. Cancer 26:239- 257.
Kesler, D. J., H. A. Gaverick, R. S. Youngquist, R. G. Elmore, and C. J. Bierschwal. 1977. Effect of days postpartum and endogenous reproductive hormones on GnRH- induced LH release in dairy cows. J. Anim. Sci. 46:797-803.
Kesner, J. S., E. M. Convey, and C. R. Anderson. 1981. Evidence that estradiol induces the preovulatory LH surge in cattle by increasing pituitary sensitivity to LHRH and then increasing LHRH release. Endocrinol. 108:1386-1391.
Kesner, J. S., V. Padmanabhan, and E. M. Convey. 1982. Estradiol induces and progesterone inhibits the preovulatory surges of luteinizing hormone and follicle- stimulating hormone in heifers. Biol. Reprod. 26:571-578.
164
Kinder, J. E., M. Garcia-Winder, K. Imakawa, M. L. Day, D. D. Zalesky, M. L. D'Occhio, T. T. Stumpf, R. J. Kittock, and B. D. Schanbacher. 1991. Circulating concentrations of 17-estradiol influence pattern of LH in circulation of cows. Dom. Anim. Endocrinol. 8:463-469.
Kinder, J. E., F. N. Kojima, E. G. M. Bergfeld, M. E. Wehrman, and K. E. Fike. 1996. Progestin and estrogen regulation of pulsatile LH release and development of persistent ovarian follicles in cattle. J. Anim. Sci. 74:1424-1440.
King, M. E., G. H. Kiracofe, J. S. Stevenson, and R. R. Schalles. 1982. Effect of stage of the estrous cycle on interval to estrus after PGF2 in beef cattle. Theriogenology 18:191.
Klinge, C. M. 2000. Estrogen receptor intercation with co-activators and co-repressors. Steroids 65:227-251.
Knecht, M., J. M. Darbon, J. M. Ranta, A. J. Baukal, and K. J. Catt. 1984. Estrogens enhance the adenosine 3',5'-monophosphate-mediated induction of follicle- stimulating hormone and luteinizing hormone receptors in rat granulosa cells. Endocrinol. 115:41-49.
Knight, P. G., and C. Glister. 2001. Potential local regulatory functions of inhibins, activins and follistatin in the ovary. Reprod. 121:503-512.
Ko, J. C. H., J. P. Kastelic, M. R. Del Campo, and O. J. Ginther. 1991. Effects of a dominant follicle on ovarian follicular dynamics during the oestrous cycle in heifers. J. Reprod. Fert. 91:511-519.
Kojima, N., T. T. Stumpf, A. S. Cupp, L. A. Werth, M. S. Roberson, M. W. Wolfe, R. J. Kittok, and J. E. Kinder. 1992. Exogenous progesterone and progestins as used in estrous synchrony regimens do not mimic the corpus luteum in regulation of luteinizing hormone and 17β-estradiol in circulation of cows. Biol. Reprod. 47:1009- 1017.
165 Kulick, L. J., D. R. Bergfelt, K. Kot, and O. J. Ginther. 2001. Follicle selection in cattle: Follicle deviation and codominance within sequential waves. Biol. Reprod. 65:839- 846.
Kulick, L. J., K. Kot, M. C. Wiltbank, and O. J. Ginther. 1999. Follicular and hormonal dynamics during the first follicular wave in heifers. Theriogenology 52:913-921.
Lammoglia, M. A., B. E. Short, S. E. Bellows, R. A. Bellows, M. D. MacNeil, and H. D. Hafs. 1998. Induced and synchronized estrus in cattle: Dose titration of estradiol benzoate in peripubertal heifers and postpartum cows after treatment with an intravaginal progesterone-releasing insert and prostaglandin F2α. J. Anim. Sci. 76:1662-1670.
Landaeta-Hernández, A. J., J. V. Yelich, J. W. Lemaster, M. J. Fields, T. Tran, C. C. Chase, D. O. Rae, and P. J. Chenoweth. 2002. Environmental, genetic and social factors affecting the expression of estrus in beef cows. Theriogenology 57:1357-1370.
Lane, E. A., E. J. Austin, J. F. Roche, and M. A. Crowe. 2001. The effect of oestradiol benzoate on synchrony of estrus and fertility after removal of a progesterone- releasing intravaginal device. Theriogenology 55:1807-1818.
Lauderdale, J. W. 1975. The use of prostaglandin in cattle. Ann. Biol. Anim. Bioch. Biophys. 15:419.
Law, A. S., G. Baxter, D. N. Logue, T. O'Shea, and R. Webb. 1992. Evidence for the action of bovine follicular fluid factor(s) other than inhibin in suppressing follicular development and delaying oestrus in heifers. J. Reprod. Fertil. 96:603-616.
Lehman, M. N., F. J. P. Ebling, S. M. Moenter, and F. J. Karsch. 1993. Distribution of estrogen receptor-immunoreactive cells in the sheep brain. Endocrinol. 133:876-886.
Lemaster, J. W., J. V. Yelich, J. R. Kempfer, and F. N. Schrick. 1999. Ovulation and estrus characteristics in crossbred Brahman heifers treated with an intravaginal progesterone-releasing insert in combination with prostaglandin F2α and estradiol benzoate. J. Anim. Sci. 77:1860-1868.
166 Lemon, M. 1975. The effect of oestrogens alone or in association with progestagens on the formation and regression of the corpus luteum of the cyclic cow. Ann. Biol. Anim. Bioch. Biophys. 15:243-253.
Levin, E. R. 1999. Cellular functions of the plasma membrane estrogen receptor. Trends Endocrinol. Metab. 10:374-377.
Littell, R. C., G. A. Milliken, W. W. Stroup, and R. D. Wolfinger. 1996. SAS System for Mixed Models, Cary, NC: SAS Institute Inc.
Lucy M. C., J. D. Savio, L. Badinga, R. L. De La Sota, and W. W. Thatcher. 1992. Factors that affect ovarian follicular dynamics in cattle. J. Anim. Sci. 70:3615-3626.
Lund, S. A., J. Murdoch, E. A. Van Kirk, and W. J. Murdoch. 1999. Mitogenic and antioxidant mechanisms of estradiol action in preovulatory ovine follicles: Relevance to luteal function. Biol. Reprod. 61:388-392.
Lussier, J. G., P. Matton, and J. J. Dufour. 1987. Growth rates of follicles in the ovary of the cow. J. Reprod. Fert. 81:301-307.
Macmillan, K. L., and C. R. Burke. 1996. Effects of oestrous cycle control on reproductive efficiency. Anim. Reprod. Sci. 42:307-320.
Macmillan, K. L., and V. K. Taufa. 1997. Oestradiol concentrates the synchrony pattern in heifers treated with progesterone and prostaglandin F2α. Proc. New Zealand Soc. Anim. Prod. 57:238.
Macmillan, K. L., V. K. Taufa, D. R. Barnes, A. M. Day, and R. Henry. 1988. Detecting oestrus in synchronised heifers using tailpaint and an aerosol raddle. Theriogenology 30:1099-114.
Macmillan, K. L., V. K. Taufa, A. M. Day, and S. McDougall, 1995. Some effects of using progesterone and oestradiol benzoate to stimulate oestrus and ovulation in dairy cows with anovulatory anoestrus. Proc. of the New Zealand Soc. of Anim. Prod. 55:239-241.
167
Manikkam, M., and R. Rajamahendran. 1997. Progesterone-induced atresia of the proestrus dominant follicle in the bovine ovary: Changes in diameter, insulin-like growth-factor system, aromatase activity, steroid hormones, and apoptotic index. Biol. Reprod. 57:580-587.
Markström E., E. C. Svensson, R. Shao, B. Svanberg, H. Billig. 2002. Survival factors regulating ovarian apoptosis - dependence on follicle differentiation. Reprod. 123:23- 30.
Martin, S. J., C. P. M. Reutelingsperger, A. J. McGahon, J. A. Rader, R. C. A. A. van Schie, D. M. LaFace, and D. R. Green. 1995. Early redistribution of plasma membrane phosphotidylserine is a general feature of apoptosis regardless of the initiating stimulus: Inhibition by overexpression of Bcl-2 and Abl. J. Exp. Med. 182:1545-1556.
Martinez, M. F., G. P. Adams, J. P. Kastalic, D. R. Bergfelt, and R. J. Mapletoft. 2000. Induction of follicular wave emergence for estrus synchronization and artificial insemination in heifers. Theriogenology 54:757-769.
Mauleon, P.1974. New trends in the control of reproduction in the bovine. Livestock Prod. Sci. 1:117-131.
Mazerbourg, S., M. T. Overgaard, C. Oxvig, M. Christiansen, C. A. Conover, I. Laurendeau, M. Vidaud, G. Tosser-Klopp, J. Zapf, and P. Monget. 2001. Pregnancy associated plasma protein-A (PAPP-A) in ovine, bovine, porcine and equine ovarian follicles: Involvent in IGFBP-4 proteolytic degradation and mRNA expression during follicular development. Endocrinol. 142:5243-5253.
McCracken, J. A., J. C. Carlson, M. E. Glew, J. R. Goding, D. T. Baird, K. Green, and B. Samuelsson. 1972. Prostaglandin F2α identified as a luteolytic hormone in sheep. Nature New Biol. 238:129-134.
McDougall, S., C. R. Burke, K. L. Macmillan, and N. B. Williamson. 1992. The effect of pretreatment with progesterone on the oestrous response to oestradiol-17β benzoate in the post-partum dairy cow. Proc. New Zealand Soc. Anim. Prod. 52:157-160.
168 McDougall, S., C. R. Burke, K. L. Macmillan, and N. B. Williamson. 1995. Follicle patterns during extended periods of postpartum anovulation in pasture-fed dairy cows. Res. Vet. Sci. 58:212-216.
McDowell, C. M., L. H. Anderson, R. P. Lemenager, D. A. Mangione, and M. L. Day. 1998. Development of a progestin-based estrus synchronization program: II. Reproductive response of cows fed melengestrol acetate for 14 days with injections of progesterone and prostaglandin F2α. J. Anim. Sci. 76:1273-1279.
McGee, E. A., and A. J. Hsueh. 2000. Initial and cyclic recruitment of ovarian follicles. Endocrine Rev. 21:200-214.
McNatty K. P., D. A. Heath, K. M. Henderson, S. Lun, P. R. Hurst, L. M. Ellis, G. W. Montgomery, L. Morrison, and D. C. Thurley. 1984. Some aspects of thecal and granulosa cell function during follicular development in the bovine ovary. J. Reprod. Fert. 72:39-53.
McNatty, K. P., D. H. Smith, A. Makris, R. Osathanondh, and K. J. Ryan. 1979. The microenvironment of the human antral follicle: Interrelationships among the steroid levels in antral fluid, the population of granulosa cells and the status of the oocyte in vivo and in vitro. J. Clin. Endocrinol. Metab. 49:851-860.
Mihm, M., and E. J. Austin. 2002. The final stages of dominant follicle selection in cattle. Dom. Anim. Endocrinol. 23:155-166.
Mihm, M., E. J. Austin, T. E. M. Good, J. L. H. Ireland, P. G. Knight, J. F. Roche, and J. J. Ireland. 2000. Identification of potential intrafollicular factors involved in selection of dominant follicles in heifers. Biol. Reprod. 63:811-819.
Mihm, M., A. Baguisi, M. P. Boland, and J. F. Roche. 1994. Association between the duration of dominance of the ovulatory follicle and pregnancy rate in beef heifers. J. Reprod. Fertil. 102:123-130.
Mihm, M., T. E. M. Good, J. L. H. Ireland, J. J. Ireland, P. G. Knight, and J. F. Roche. 1997. Decline in serum follicle-stimulating hormone concentrations alters key intrafollicular growth factors involved in selection of the dominant follicle in heifers. Biol. Reprod. 57:1328-1337.
169
Miksch, E. D., D. G. LeFever, G. Mukembo, J. C. Spitzer, and J. N. Wiltbank. 1978. Synchronization of estrus in beef cattle. II. Effect of an injection of norgestomet and an estrogen in conjunction with a norgestomet implant in heifers and cows. Theriogenology 10:201-221.
Millar, R., D. Conklin, C. Loften-Day, E. Hutchinson, B. Troskie, N. Illing, S. C. Sealfon, and J. Hapgood. 1999. A novel human GnRH receptor homolog gene: Abundant and wide tissue distribution of the antisense transcript. J. Endocrinol. 162:117-126.
Moenter, S. M., A. Caraty, A. Locatelli, and F. J. Karsch. 1991. Pattern of gonadotropin- releasing hormone (GnRH) secretion leading up to ovulation in the ewe: Existence of a preovulatory GnRH surge. Endocrinol. 129:1175-1182.
Monget, P., S. Mazerbourg, T. Delpuech, M-C. Maurel, S. Manière, J. Zapf, G. Lalmanach, C. Oxvig, and M. T. Overgaard. 2003. Pregnancy associated plasma protein-A is involved in insulin-like growth factor binding protein-2 (IGFBP-2) proteolytic degradation in bovine and porcine preovulatory follicles: Identification of cleavage site and characterization of IGFBP-2 degradation. Biol. Reprod. 68:77-86.
Murdoch, W. J., T. A. Peterson, E. A. Van Kirk, D. L. Vincint, and E. K. Inskeep. 1986. Interactive roles of progesterone, prostaglandins, and collagenase in the ovulatory mechanism of the ewe. Biol. Reprod. 35:1187-1194.
Murphy, M. G., M. P. Boland, and J. F. Roche. 1990. Pattern of follicular growth and resumption of ovarian activity in post-partum beef suckler cows. J. Reprod. Fertil. 90:523-533.
Naval, J., and A. Anel. 1999. Cell-mediated cytotoxicity and cell death receptors. Pages 81-103 in Apoptosis: A Practical Guide. G. Studzinski, ed. Oxford University Press, New York.
Nessan, G. K., and G. J. King. 1981. Sexual behaviour in ovariectomized cows treated with oestradiol benzoate and testosterone propionate. J. Reprod. Fert. 61:171-178.
170 Nett, T. M., A. M. Turzillo, M. Baratta, and L. A. Rispoli. 2002. Pituitary effects of steroid hormones on secretion of follicle-stimulating hormone and luteinizing hormone. Dom. Anim. Endocrinol. 23:33-42.
O’Rourke, M., M. G. Diskin, J. M. Shreenan, and J. F. Roche. 2000. The effect of dose and route of oestradiol benzoate administration on plasma concentrations of oestradiol and FSH in long-term ovariectomised beef heifers. Anim. Reprod. Sci. 59:1-12.
Padmanabhan, V., M. B. Brown, G. E. Dhal, N. P. Evans, F. J. Karsch, D. T. Mauger, J. D. Neill, and J. van Cleeff. 2003. Neuroendocrine control of follicle-stimulating hormone (FSH) secretion: III. Is there a gonadotropin-releasing hormone independent component of episodic FSH secretion in ovariectomized and luteal phase ewes? Endocrinol. 144:1380-1392.
Padmanabhan, V., K. McFadden, D. T. Mauger, F. J. Karsch, and Jr A. R. Midgley. 1997. Neuroendocrine control of FSH secretion: I. Direct evidence for separate episodic and basal components of FSH secretion. Endocrinol. 138:424-432.
Pfaff, D., and S. Schwartz-Giblin. 1988. Cellular mechanisms of female reproductive behaviors. Pages 1487-1568 in The Physiology of Reproduction. E. Knobil and J Neill, eds. Raven Press, New York.
Porter D. A., R. M. Harman, R. G. Cowan, and S. M. Quirk. 2001. Relationship of Fas ligand expression and atresia during bovine follicular development. Reprod. 121:561- 566.
Pratt, S. L., J. C. Spitzer, G. L. Burns, and B. B. Plyler. 1991. Luteal function, estrous response, and pregnancy rate after treatment with norgestomet and various dosages of estradiol valerate in suckled cows. J. Anim. Sci. 69:2721-2726.
Price C. A., P. D. Carrière, B. Bhatia, and N. P. Groome. 1995. A comparison of hormonal and histological changes during follicular growth, as measured by ultrasonography, in cattle. J. Reprod. Fert. 103:63-68.
Price C. A., and R. Webb. 1988. Steroid control of gonadotropin secretion and ovarian function in heifers. Endocrinol. 122:2222-2231.
171
Pursley, J. R., M. R. Kosorok, and M. C. Wiltbank. 1997. Reproductive management of lactating dairy cows using synchronization of ovulation. J. Dairy Sci. 80:301-306.
Rajakoski, E. 1960. The ovarian follicular system in sexually mature heifers with special reference to seasonal, cyclical, and left-right variations. Acta Endocrinologica, Suppl. 52: 4-68.
Rajamahendran, R., and M. D. Calder. 1993. Superovulatory responses in dairy cows following ovulation of the dominant follicle of the first wave. Theriogenology 40:99- 109.
Rahe, C. H., R. E. Owens, J. L. Fleeger, H. J. Newton, and P. G. Harms. 1980. Pattern of plasma luteinizing hormone in the cyclic cow: Dependence upon the period of the cycle. Endocrinol. 107:498-503.
Rasby, R. J., M. L. Day, S. K. Johnson, J. E. Kinder, J. M. Lynch, R. E. Short, R. P. Wettemann, and H. D. Hafs. 1998. Luteal function and estrus in peripubertal beef heifers given an intravaginal progesterone releasing insert with or without a subsequent injection of estradiol. Theriogenology 50:55-63.
Ray, D. E. 1965. Oestrous response of ovariectomized beef heifers to oestradiol benzoate and human chorionic gonadotrophin. J. Reprod. Fertil. 10:329-335.
Rhodes, F. M., L. A. Fitzpatrick, K. W. Entwistle and J. E. Kinder. 1995. Hormone concentrations in the caudal vena cava during the first ovarian follicular wave of the oestrus cycle in heifers. J. Reprod. Fert. 104:33-39.
Rhodes, F. M., B. A. Clark, S. McDougall, and K. L. Macmillan. 1999. Insemination at the second of two induced oestrus periods in anoestrous dairy cows increased conception rates to first service. New Zealand Vet. J. 47:39-43.
Rhodes, F. M., S. McDougall, C. R. Burke, G. A. Verkerk, and K. L. Macmillan. 2003. Review: Treatment of cows with an extended postpartum anestrous interval. J. Dairy Sci. (In Press)
172
Rhodes, F. M., A. J. Peterson, and P. D. Jolly. 2001. Gonadotrophin responsiveness, aromatase activity and insulin-like growth factor binding protein content of bovine ovarian follicles during the first follicular wave. Reprod. 122:561-569.
Richards, J. S. 1994. Hormonal control of gene expression on the ovary. Endocrine Rev. 15:725-751.
Richards, J. S. 2001. Perspective: The ovarian follicle - A perspective in 2001. Endocrinol. 142:2184-2193.
Roberson, M. S., M. W. Wolfe, T. T. Stumpf, R. J. Kittok, and J. E. Kinder. 1989. Luteinizing hormone secretion and corpus luteum function in cows receiving two levels of progesterone. Biol. Reprod. 41:997-1003.
Roberts, A. J., and M. K. Skinner. 1990. Estrogen regulation of thecal cell steroidogenesis and differentiation: Thecal cell-granulosa cell interactions. Endocrinol. 127:2918-2929
Robinson, J. E. 1995. Gamma amino-butyric acid and the control of GnRH secretion in sheep. J. Reprod. Fert. (Suppl. 49):221-230.
Roche, J. F. 1979. Control of oestrus in cattle. World Rev. Anim. Prod. 15:49-76.
Roche, J. F. 1974. Synchronization of oestrus in heifers with implants of progesterone. J. Reprod. Fert. 41:337-344.
Roche, J. F., E. J. Austin, M. Ryan, M. O'Rourke, M. Mihm, and M. G. Diskin. 1999. Regulation of follicle waves to maximize fertility in cattle. J. Reprod. Fertil. Suppl. 54:61-71.
Rosenfeld C. S., J. S. Wagner, R. M. Roberts, and D. B. Lubahn. 2001. Intraovarian actions of oestrogen. Reprod. 122:215-226.
173 Ryan, D. P., J. A. Galvin, and K. J. O’Farrell. 1996. Effect of various oestrous synchronization regimens applied to lactating dairy cows on oestrus synchrony and pregnancy rates. In: Proc. 13th Int. Congr. Anim. Reprod., Sydney, Australia. 3:P19- 10.
Sachs, B. D., and R. L. Meisel. 1988. The physiology of male sexual behavior. Pages 1393-1465 in The Physiology of Reproduction. E. Knobil and J. Neill, eds. Raven Press, New York.
Salfen, B. E., F. N. Kojima, J. F. Bader, M. F. Smith, and H. A. Garverick. 2001. Effect of short-term calf removal at three stages of a follicular wave on fate of a dominant follicle in postpartum beef cows. J. Anim. Sci. 79:2688-2697
Sanchez, T., M. E. Wehrman, E. G. Bergfeld, K. E. Peters, F. N. Kojima, A. S. Cupp, V. Mariscal, R. J. Kittok, R. J. Rasby, and J. E. Kinder. 1993. Pregnancy rate is greater when the corpus luteum is present during the period of progestin treatment to synchronize time of estrus in cows and heifers. Biol. Reprod. 49:1102-1107.
Sartori, R., P. M. Fricke, J. C. P. Ferreira, O. J. Ginther, and M. C. Wiltbank. 1998. Acquisition of ovulatory capacity by ovarian follicles during growth of follicular waves in lactating dairy cows. J.Anim. Sci. (Suppl. 1) 81:223.
SAS. 1996. SAS Users Guide: SAS Inst. Inc., Cary NC.
Savio, J. D., L. Keenan, and M. P. Boland. 1988. Pattern of growth of dominant follicles during the oestrous cycle of heifers. J. Reprod. Fertil. 83:663-671.
Savio, J. D., W. W. Thatcher, G. R. Morris, K. Entwistle, M. Drost, and M. R. Mattiacci. 1993. Effects of induction of low plasma progesterone concentrations with a progesterone-releasing device on follicular turnover and fertility in cattle. J. Reprod. Fert. 98:77-84.
Schallenberger, E., A. M. Schöndorfer, and D. L. Walters. 1985. Gonadotrophins and ovarian steroids in cattle. I. Pulsatile changes of concentrations in the jugular vein throughout the oestrous cycle. Acta Endocrinologica 108:312-321.
174 Schally, A. V., A. Arimura, Y. Baba, R. M. Nair, H. Matsuo, T. W. Redding, and L. Debeljuk. 1971. Isolation and properties of the FSH and LH releasing hormone. Biochem. Biophys. Res. Commun. 43:393-399.
Schams, D., and B. Berisha. 2002. Steroids as local regulators of ovarian activity in domestic animals. Dom. Anim. Endocrinol. 23:53-65.
Schams, D., E. Schallenberger, B. Hoffman, and H. Karg. 1977. The oestrus cycle of the cow: Hormonal parameters and time relationships concerning oestrus, ovulation, and electrical resistance of the vaginal mucus. Acta Endocrinologica 86:180-192.
Sealfon, S. C., H. Weinstein, and R. P. Millar. 1997. Molecular mechanisms of ligand interaction with the gonadotropin-releasing hormone receptor. Endocrine Rev. 18:180-205.
Senger, P. L. 1994. The estrus detection problem: new concepts, technologies, and possibilities. J. Dairy Sci. 77:2745.
Sherwood, N., D. Lovejoy, and I. Coe. 1993. Origin of mammalian gonadotropin- releasing hormones. Endocrine Rev. 14:241-254.
Short, R. E., B. E. Howland, R. D. Randel, D. S. Christensen, and R. A. Bellows. 1973. Induced LH release in spayed cows. J. Anim. Sci. 37:551-557.
Silva, J. M., and C. A. Price. 2000. Effect of follicle stimulating hormone on steroid secretion and messenger ribonucleic acids encoding cytochrome P450 aromatase and cholesterol side chain cleavage in bovine granulosa cells in vitro. Biol. Reprod. 62:186-191.
Silavin, S. L., and G. S. Greenwald. 1984. Steroid production by isolated theca and granulosa cells after initiation of atresia in the hamster. J. Reprod. Fertil. 71:387-392.
Silvia, W. J., T. B. Hatler, A. M. Nugent, and L. F. Laranja da Fonseca. 2002. Ovarian follicular cysts in dairy cows: An abnormality in folliculogenesis. Dom. Anim. Endocrinol. 23:167-177.
175
Sirois, J., and J. E. Fortune. 1988. Ovarian follicular dynamics during the estrous cycle in heifers monitored by real-time ultrasonography. Biol. Reprod. 39:308-317.
Sirois, J., and J. E. Fortune. 1990. Lengthening the bovine estrous cycle with low levels of exogenous progesterone: A model for studying ovarian follicular dominance. Endocrinol. 127:916-925.
Staigmiller, R. B., B. G. England, R. Webb, R. E. Short, and R. A. Bellows. 1982. Estrogen secretion and gonadotropin binding by individual bovine follicles during estrus. J. Anim. Sci. 55:1473-1482.
Steel, R. D. G., and J. H. Torrie. 1980. Principles and Procedures of Statistics: A Biometrical Approach. 2nd ed. McGraw-Hill Book Co., New York.
Stevenson, J. S., M. K. Schmidt, and E. P. Call. 1984. Stage of estrous cycle, time of insemination, and seasonal effects on estrus and fertility of Holstein heifers after prostaglandin F2α. J. Dairy Sci. 67:1798.
Stevenson, J. S., M. W. Smith, J. R. Jaeger, L. R. Corah, and D. G. LeFever. 1995. Detection of estrus by visual observation and radiotelemetry in peripubertal, estrus- synchronized beef heifers. J. Anim. Sci. 74:729-735.
Stevenson, J. S. 2001. Incidence of anestrus in suckled beef and milked dairy cattle. J. Anim. Sci. 79 (Suppl. 1):116 (Abstr. 481).
Stock, A. E., and J. E. Fortune. 1993. Ovarian follicular dominance in cattle: Relationship between prolonged growth of the ovulatory follicle and endocrine parameters. Endocrinol. 132:1108-1114.
Stoebel, D. P., and G. P. Moberg. 1982. Effect of adrenocorticotropin and cortisol on luteinizing hormone surge and estrous behavior of cows. J. Dairy Sci. 65:1016-1024.
Studzinski, G. P. 1999. Overview of apoptosis. Pages 1-17 in Apoptosis: A Practical Guide. G. Studzinski, ed. Oxford University Press, New York.
176
Stumpf, T. T., M. L. Day, P. L. Wolfe, M. W. Wolfe, A. C. Clutter, R. J. Kittock, and J. E. Kinder. 1988. Feedback of 17 beta-estradiol on secretion of luteinizing hormone during different seasons of the year. J. Anim. Sci. 66: 447-451.
Stumpf, T. T., M. L. Day, M. W. Wolfe, A. C. Clutter, J. A. Stotts, P. L. Wolfe, R. J. Kittock, and J. E. Kinder. 1989. Effect of estradiol on secretion of luteinizing hormone during the follicular phase of the bovine estrous cycle. Biol. Reprod. 40:91- 97.
Stumpf, T. T., M. S. Roberson, M. W. Wolfe, D. L. Hamernik, R. J. Kittock, and J. E. Kinder. 1993. Progesterone, 17β-estradiol, and opioid neuropeptides modulate pattern of luteinizing hormone in circulation of the cow. Biol. Reprod. 49:1096-1101.
Sun, Y. M., C. A. Flanagan, N. Illing, T. R. Ott, R. Stellar, B. J. Fromme, J. Hapgood, P. Sharp, S. C. Sealfon, and R. P. Millar. 2001. A chicken gonadotropin-releasing hormone receptor that confers agonist activity to mammalian antagonists. Identification of D-Lys(6) in the ligand and extracellular loop two of the receptor as determinants. J. Biol. Chem. 276:7754-7761.
Taft, R., N. Ahmad, and E. K. Inskeep. 1996. Exogenous pulses of luteinizing hormone cause persistence of the largest bovine ovarian follicle. J. Anim. Sci. 74:2985-2991.
Tanaka, Y., K. Nakada, M. Moriyoshi, and Y. Sawamukai. 2001. Appearance and number of follicles and change in the concentration of serum FSH in female bovine fetuses. Reprod. 121:777-782.
Taniguchi H., Y. Yokomizo, and K. Okuda. 2002. Fas-Fas ligand system mediates luteal cell death in bovine corpus luteum. Biol. Reprod. 66:754-759.
Taponen, J., T. Katila, and H. Rodriguez-Martinez. 1999. Induction of ovulation with gonadotropin-releasing hormone during proestrus in cattle: influence on subsequent follicular growth and luteal function. Anim. Reprod. Sci. 55:91-105.
Temple, J. L., R. P. Millar, and Rissman. 2003. An evolutionary conserved form of gonadotropin-releasing hormone coordinates energy and reproductive behavior. Endocrinol. 144:13-19.
177
Thatcher, W. W., C. A. Risco, and F. Moreira. 1999. Practical manipulation of the estrous cycle in dairy animals. Pages 34-50 in Proc. of the 31st Annual Convention of the American Association of Bovine Practitioners, September 25, 1998, Spokane, WA.
Thimonier, J., D. Chupin, and J. Pelot. 1975. Synchronization of oestrus in heifers and cyclic cows with progestagens and prostaglandin analogues alone or in combination. Ann. Bio. Anim.Biochem. Biophys. 15: 437-449.
Thorner, M. O., M. L. Vance, Jr. E. R. Laws, E. Horvath, and K. Kovacs. 1998. The anterior pituitary. Pages 249-340 in Williams Textbook of Endocrinology. 9th ed. J. Wilson, D. Foster, H. Kronenbug, and P. Larsen, eds. W. B. Saunders Co., Philadelphia, PA.
Thundathil, J., J. P. Kastelic, and R. J. Mapletoft. 1998. The effect of estradiol cypionate (ECP) on ovarian follicular development and ovulation in dairy cattle. Can. J. Vet. Res. 62:314-316.
Tilly, J. L., K. I. Kowalski, A. L. Johnson, and A. J. W. Hsueh. 1991. Involvement of apoptosis in ovarian follicular atresia and postovulatory regression. Endocrinol. 129:2799-2801.
Tohei, A., F. X. Shi, M. Ozawa, K. Imai, H. Takahashi, I. Shimohira, T. Kojima, G. Watanabe, and K. Taya. 2001. Dynamic changes in plasma concentrations of gonadotropins, inhibin, estradiol-17β and progesterone in cows with ultrasound- guided follicular aspiration. J. Vet. Med. Sci. 63:45-50.
Trimberger, G. W., and W. Hansel. 1955. Conception rate and ovarian function following estrus control by progesterone injections in dairy cattle. J. Anim. Sci. 14:224-232.
Tsai, M-J., J. H. Clark, W. T. Schrader, and B. W. O'Malley. 1998. Mechanisms of action of hormones that act as transcription-regulatory factors. Pages 55-94 in Williams Textbook of Endocrinology. 9th ed. J. Wilson, D. Foster, H. Kronenbug, and P. Larsen, eds. W. B. Saunders Co., Philadelphia, PA.
178 Tsonis C. G., R. S. Carson, and J. K. Findlay. 1984. Relationships between aromatase activity, follicular fluid oestradiol-17β and testosterone concentrations, and diameter and atresia of individual ovine follicles. J. Reprod. Fert. 72:153-163.
Twagiramungu, H., L. A. Guilbault, and J. J. Dufour. 1995. Synchronization of ovarian follicular waves with a gonadotropin-releasing hormone agonist to increase the precision of estrus in cattle: A review. J. Anim. Sci. 73:3141-3151.
Turzillo A. M., and J. E. Fortune. 1993. Effects of suppressing plasma FSH on ovarian follicular dominance in cattle. J. Reprod. Fert. 98:113-119.
Turzillo A. M., and J. E. Fortune. 1990. Suppression of the secondary FSH surge with bovine follicular fluid is associated with delayed ovarian follicular development in heifers. J. Reprod. Fert. 89:643-653.
Uilenbroek J. T. J., P. J. A. Woutersen, and P. van der Schoot. 1980. Atresia of preovulatory follicles: gonadotropin binding and steroidogenic activity. Biol. Reprod. 23:219-229.
Vailes, L. D., S. P. Washburn, and J. H. Britt. 1992. Effects of various steroid milieus or physiological states on sexual behavior of Holstein cows. J. Anim. Sci. 70:2094-2103.
van Engeland, M., B. Schutte, A. H. N. Hopman, F. C. S. Ramaekers and C. P. M. Reutelingsperger. 1999. Cytochemical detection of cytoskeletal and nucleoskeletal changes during apoptosis. Pages 125-140 in Apoptosis: A Practical Guide. G. Studzinski, ed. Oxford University Press, New York.
Vasconcelos, J. L. M., R. Sartori, H. N. Oliveira, J. N. Guenther, and M. C. Wiltbank. 1998. Reduction in size of the ovulatory follicle reduces subsequent luteal size and pregnancy rate. J. Anim. Sci. (Suppl. 1) 76:224.
Voss, A. K., and J. E. Fortune. 1991. Oxytocin secretion by bovine granulosa cells: Effects of stage of follicular development, gonadotropins, and coculture with theca interna. Endocrinol. 128:1991-1999.
179 Voss, A. K., and J. E. Fortune. 1992. Oxytocin/neurophysin-I messenger ribonucleic acid in bovine granulosa cells increases after the luteinizing hormone (LH) surge and is stimulated by LH in vitro. Endocrinol. 131:2755-2762.
Vynckier, L., M. Debackere, A. De Kruif, and M. Coryn. 1990. Plasma estradiol-17β concentrations in the cow during induced estrus and after injection of estradiol-17β benzoate and estradiol-17β cypionate - a preliminary study. J. Vet. Pharmacol. Therap. 13:36-42.
Walters, D. L. and E. Schallenberger. 1984. Pulsatile secretion of gonadotropins, ovarian steroids and ovarian oxytocin during the periovulatory phase of the oestrous cycle in the cow. J. Reprod. Fert. 71:503-512.
Webb, R., R. G. Gosden, E. E. Telfer, and R. M. Moor. 1999. Factors affecting folliculogenesis in ruminants. Anim. Sci. 68:257-284.
Wilson, J. W., and C. S. Potten. 1999. Morphological recognition of apoptotic cells. Pages 19-39 in Apoptosis: A Practical Guide. G. Studzinski, ed. Oxford University Press, New York.
Wiltbank, M. C., and C. W. Kasson. 1968. Synchronization of estrus in cattle with an oral progestational agent and an injection of an oestrogen. J. Anim. Sci. 27:113-116.
Wishart, D. F. 1974. Synchronization of oestrus in cattle using a progestogen (SC21009) and PGF2α. Theriogenology 1:87.
Wishart, D. F. 1977. Synchronization of oestrus in heifers using steriod (SC 5914, SC 9880 and SC 21009) treatment for 21 days: The effect of treatment on the ovum collection and fertilization rate and the development of the early embryo. Theriogenology 8:249-269.
Wolfe, M. W., M. S. Roberson, T. T. Stumpf, R. J. Kittock, and J. E. Kinder. 1992. Circulating concentrations and pattern of luteinizing hormone and follicle-stimulating hormone in circulation are changed by the circulating concentration of 17β-estradiol in the bovine male and female. J. Anim. Sci. 70:248-253.
180 Wood, S. C., R. G. Glencross, E. C. L. Bleach, R. Lovell, A. J. Beard, and P. G. Knight. 1993. The ability of steroid-free bovine follicular fluid to suppress FSH secretion and delay ovulation persists in heifers actively immunized against inhibin. J. Endocrinol. 136:137-148.
Wyllie, A. H. 1980. Glucocorticoid-induced thermocyte apoptosis is associated with endogenous endonuclease activation. Nature 339:625-626.
Xu, Z. Z., L. J. Burton, and K. L. Macmillan. 1996. Reproductive performance of lactating dairy cows following oestrus synchronization with progesterone, oestradiol and prostaglandin. New Zealand Vet. J. 44:99-104.
Xu Z. Z, H. A. Garverick, G. W. Smith, M. F. Smith, S. A. Hamilton, and R. S. Youngquist. 1995a. Expression of follicle-stimulating hormone and luteinizing hormone receptor messenger ribonucleic acids in bovine follicles during the first follicular wave. Biol. Reprod. 53:951-957.
Xu Z. Z, H. A. Garverick, G. W. Smith, M. F. Smith, S. A. Hamilton, and R. S. Youngquist. 1995b. Expression of messenger RNA encoding cytochrome P450 side chain cleavage, cytochrome P450 17α-hydroxylase and cytochrome P450 aromatase in bovine follicles during the first follicular wave. Endocrinol. 136:981-989.
Xu, Z. Z., D. J. McKnight, R. Vishwanath, C. J. Pitt, and L. J. Burton. 1998. Estrus detection using radiotelemetry or visual observation and tail painting for dairy cows on pasture. J. Dairy Sci. 81:2890-2896.
Yang, M. Y., and R. Rajamahendran. 2000. Morphological and biochemical identification of apoptosis in small, medium and large bovine follicles and the effects of follicle-stimulating hormone and insulin-like growth factor-1 on spontaneous apoptosis in cultured bovine granulosa cells. Biol. Reprod. 62:1209-1217.
Yoshioka, K., C. Suzuki, S. Arai, S. Iwamura, and H. Hirose. 2001. Gonadotropin- releasing hormone in the third ventricular cerebrospinal fluid of the heifer during the estrous cycle. Biol. Reprod. 64:563-570.
Zheng, T. T., and R. A. Favell. 2000. Death by numbers. Nature Biotech. 18:717-718.
181