Identification and Characterization of a Novel Structural Protein of Porcine

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2014 Identification and characterization of a novel structural protein of porcine reproductive and respiratory syndrome virus, the replicase nonstructural protein 2 Matthew Allan Kappes Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Animal Diseases Commons, Molecular Biology Commons, Veterinary Infectious Diseases Commons, Veterinary Microbiology and Immunobiology Commons, and the Virology Commons

Recommended Citation Kappes, Matthew Allan, "Identification and characterization of a novel structural protein of porcine reproductive and respiratory syndrome virus, the replicase nonstructural protein 2" (2014). Graduate Theses and Dissertations. 14184. https://lib.dr.iastate.edu/etd/14184

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected].

Identification and characterization of a novel structural protein of porcine reproductive and respiratory syndrome virus, the replicase nonstructural protein 2

Matthew A. Kappes

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Immunobiology

Program of Study Committee: Kay S. Faaberg, Co-Major Professor Cathy L. Miller, Co-Major Professor Amy Andreotti Douglas E. Jones Crystal L. Loving

Iowa State University

Ames, Iowa

2014

TABLE OF CONTENTS

Page LIST OF FIGURES ...... iv LIST OF TABLES ...... v ABSTRACT ...... vi CHAPTER 1. GENERAL INTRODUCTION ...... 1 INTRODUCTION...... 1 REFERENCES ...... 3 CHAPTER 2. LITERATURE REVIEW ...... 6

GENOME AND REPLICATION ...... 7 Genome Organization ...... 8 5’ and 3’ UTR ...... 11 REPLICATION ...... 14 Membrane Rearrangement ...... 15 RdRp ...... 16 sgRNA Synthesis ...... 19 Heteroclite RNAs ...... 24 VIRION STRUCTURE ...... 25 STRUCTURAL PROTEINS (STRUCTURE, FUNCTION, AND IMMUNOGENICITY) ...... 26 N ...... 26 GP5 and M ...... 27 E, GP2, GP3 and GP4 ...... 29 NONSTRUCTURAL PROTEINS ...... 31 ORF1a ...... 32 ORF1b ...... 34 The Multifunctional Nsp2 ...... 35 REFERENCES ...... 39 CHAPTER 3. HIGHLY DIVERGENT STRAINS OF PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS INCORPERATE MULTIPLE ISOFORMS OF NONSTRUCTURAL PROTEIN 2 INTO VIRIONS ...... 59 ABSTRACT ...... 59 INTRODUCTION...... 60 MATERIALS AND METHODS ...... 62 RESULTS ...... 67 DISCUSSION ...... 78 ACKNOWLEDGEMENTS ...... 84 REFERENCES ...... 84 CHAPTER 4. PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS NONSTRUCTURAL PROTEIN 2 (NSP2) TOPOLOGY AND SELECTIVE ISOFORM INTEGRATION IN ARTIFICIAL MEMBRANES ...... 90 ABSTRACT ...... 90 INTRODUCTION...... 91 RESULTS ...... 93 DISCUSSION AND CONCLUSION ...... 105 ACKNOWLEDGEMENTS ...... 118 REFERENCES ...... 118

iii

CHAPTER 5. GENERAL CONCLUSIONS ...... 125 REFERENCES ...... 127

LIST OF FIGURES

Page Figure 2.1. PRRSV genome, transcription, and translation ...... 9 Figure 2.2. Predicted RNA secondary structure of the NA PRRSV 5’UTR ...... 13 Figure 2.3. sgRNA synthesis ...... 20 Figure 2.4. The PRRSV 5’UTR Leader TRS ...... 21 Figure 2.5. The PRRSV virion...... 26 Figure 3.1. Peptide sequence alignment of nsp2...... 68 Figure 3.2. Immunofluorescence detection of nsp2 within virally infected cells...... 69 Figure 3.3. A. Nsp2 localizes to high concentration within cell-to-cell protrusions ...... 71 Figure 3.4. IEM detection of nsp2 on PRRSV virions...... 72 Figure 3.5. Western blot detection of nsp2 in cell lysates by custom antibodies ...... 73 Figure 3.6. Nsp2 packaging is maintained across genetically diverse strains of PRRSV ...... 74 Figure 3.7. Identification of dominant nsp2 products in purified virions...... 75 Figure 3.8. Detection of packaged myc-tagged nsp2 isoforms ...... 76 Figure 4.1. PRRSV ORF1a encodes putative multi-spanning transmembrane domains ...... 92 Figure 4.2. Cell-free translation of PRRSV nsp2 ...... 94 Figure 4.3. N-terminal and C-terminal nsp2 isoforms ...... 96 Figure 4.4. Nsp2 associates strongly with membranes ...... 98 Figure 4.5. Membrane enrichment of select nsp2 isoforms ...... 100 Figure 4.6. Membrane Enrichment of FLAG-tagged products ...... 101 Figure 4.7. Nsp2 fragment is protected from protease degradation by membrane insertion...... 102 Figure 4.8. The C-terminus of nsp2 is protected from protease degradation by membranes ...... 103 Figure 4.9. RFS alters the hydrophobicity profile of nsp2 ...... 104

LIST OF TABLES

Page Table 3.1. Description of study strains ...... 64 Table 3.2. Infectivity of viral strains before and after purification ...... 70 Table 3.3 Percent pairwise identity between strains ...... 79 Table 4.1. Prediction of nsp2 transmembrane helices ...... 106 Table 4.2. Sequence of oligonucleotides for insertion of exogenous FLAG epitope ...... 114

ABSTRACT

Porcine reproductive and respiratory syndrome virus (PRRSV) is a rapidly mutating pathogen eliciting respiratory and reproductive disease of high economic consequence. The

PRRSV non-structural protein 2 (nsp2) is a large multifunctional protein encoded by the most genetically diverse region of the genome – the selective pressure potentiating mutation within this region is unknown. Here we report the identification of a unique function of nsp2 as a structural component of the PRRSV virion; the first PRRSV structural protein identified which is not expressed from a sub-genomic RNA or regulated via the discontinuous transcription pathway. Through the use of a set of custom α-nsp2 antibodies nsp2 was identified on the surface of the PRRSV virion by immunoelectron microscopy. Further, a class of nsp2 isoforms was defined to be packaged within or upon the PRRSV virion. Nsp2 packaging was found to be conserved across a panel of highly divergent stains of PRRSV including the genotype 1 and genotype 2 prototype strains as well as contemporary and highly-pathogenic isolates.

Next the hydrophobic domain of nsp2 was characterized as a putative multi-pass transmembrane domain predicted to facilitate nsp2 packaging through association with the viral envelope. Within an in vitro cell-free translation system nsp2 was found to strongly associate with canine microsomal membranes. Through high-speed ultracentrifugation, protease protection assay, and immunoprecipitation nsp2 was defined as an integral membrane protein and additionally identified to display an unexpected N-terminal cytoplasmic / C-terminal luminal topological orientation. Finally, membrane isolation

vii demonstrated two sub-dominant nsp2 isoforms of approximately 117 and 106 kDa in size and of unknown composition or function were enriched within membranes.

Together, these results define previously unknown attributes of nsp2. Identification of nsp2 as a structural protein implicates it in previously unpredicted functions related to attachment, entry, or early replication events and further provides rationale for the high mutation rate and robust adaptive immune response targeting the nsp2 protein.

Characterization of the nsp2 transmembrane domain demonstrates its role as an integral membrane protein and additionally raises new questions related to the unexpected topological orientation or enrichment of select isoforms within the membrane fraction.

CHAPTER 1. GENERAL INTRODUCTION

INTRODUCTION

Positive strand RNA viruses make up the largest group of viral agents, possess high evolutionary potential, and infect a wide range of hosts including animals, plants, insects, and bacteria (1, 2). The replicating enzyme of RNA viruses, the RNA dependent RNA polymerase (RdRp), is highly error prone within positive-sense RNA viruses (10-6 to 10-3

[avg. mutation rate]/base pair) (3). Evolution within the context of high mutation frequencies has resulted in a robust phenotype to genetic change for many viruses and thus enables positive-sense RNA viruses to respond quickly to selective pressure(s) (4-9). Upon infection, the messenger RNA (mRNA) genome serves as template for the initial round of translation – allowing rapid viral gene expression without the immediate requirement for transcription.

The rapid growth kinetics and high mutation frequency of positive-sense RNA viruses complicates eradication efforts and limits efficacy of conventional control strategies.

Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped, single-stranded positive-sense RNA virus within the Arteriviridae family. PRRSV infection induces immunodysregulation in the infected host by preferentially targeting the macrophage and through a range of immunomodulatory mechanisms (10-13). PRRSV has maintained a worldwide epidemic since its emergence in the late 1980’s through a continual set of emerging and re-emerging strains of high genetic and antigenic heterogeneity (14-19). Due to an extraordinary evolution rate, efficient transmission, and high infectability of PRRSV, current control and eradication efforts including vaccination strategies seem unlikely to be

2 broadly efficacious. Investigation of basic PRRSV biology and immunology is needed to define molecular targets with therapeutic potential.

The PRRSV genome encodes at least 14 nonstructural proteins (nsp) and eight structural proteins through two distinct transcription/translation regulatory mechanisms (20,

21). The first three-fourths of the genome exclusively encode nsps (nsp1α/β, nsp2-6, nsp7α/β, nsp 8-12) from the positive-sense mRNA genome. The final one-fourth of the genome encodes all canonical structural proteins that together make up the virion (GP2a/b,

GP3-4, GP5 and 5a, M, N). These structural proteins are generated through a negative strand intermediate via a complex co-terminal discontinuous transcription strategy (21, 22). Of the

PRRSV proteome, little is known about nsp functionality outside of the four characterized viral proteases (papain-like cysteine protease 1α (PLP1α), PLP1β, PLP2, main serine protease (SP)), the replicase, and the helicase enzymatic functions (23-25). Since viral genomes utilize highly efficient coding strategies, and additionally, viruses like PRRSV are further constrained in genome size due to their RdRp error rate (26), large proteins of unknown function are of particular interest. The PRRSV nsp2 is both the largest and the most genetically diverse protein encoded within the PRRSV genome. Nsp2 contains an N-terminal papain-like cysteine protease (PLP2), which also possesses deubiquitinating functionality, a central bipartite hypervariable region (HV), a predicted multi-transmembrane spanning element (TM) and a generally well-conserved C-terminal region of unknown function. The ultimate size of nsp2 coupled with the significant elevation of mutation frequency within this coding region suggests nsp2 functions in additional unknown mechanisms critical for

PRRSV entry, replication, or immune evasion.

In the following chapters evidence is presented to detail unexpected functions for nsp2 as a novel structural component of the PRRSV virion, to biochemically determine the nature of the putative nsp2 transmembrane elements, and to investigate the mechanism(s) by which recently described nsp2 isoforms are generated.

REFERENCES

1. King AMQ, Lefkowitz E, Adams MJ, Carstens EB. 2011. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier.

2. Denison MR. 2008. Seeking membranes: positive-strand RNA virus replication complexes. PLoS biology 6:e270.

3. Drake JW. 1993. Rates of spontaneous mutation among RNA viruses. Proceedings of the National Academy of Sciences of the United States of America 90:4171-4175.

4. Eigen M. 1971. Selforganization of matter and the evolution of biological macromolecules. Die Naturwissenschaften 58:465-523.

5. Domingo E, Sheldon J, Perales C. 2012. Viral quasispecies evolution. Microbiology and molecular biology reviews : MMBR 76:159-216.

6. Draghi JA, Parsons TL, Wagner GP, Plotkin JB. 2010. Mutational robustness can facilitate adaptation. Nature 463:353-355.

7. Elena SF, Sanjuan R. 2005. Adaptive value of high mutation rates of RNA viruses: separating causes from consequences. Journal of virology 79:11555-11558.

8. Noirel J, Simonson T. 2008. Neutral evolution of proteins: The superfunnel in sequence space and its relation to mutational robustness. The Journal of chemical physics 129:185104.

9. Wagner A. 2008. Robustness and evolvability: a paradox resolved. Proceedings. Biological sciences / The Royal Society 275:91-100.

10. Beura LK, Sarkar SN, Kwon B, Subramaniam S, Jones C, Pattnaik AK, Osorio FA. 2010. Porcine reproductive and respiratory syndrome virus nonstructural protein 1beta modulates host innate immune response by antagonizing IRF3 activation. Journal of virology 84:1574-1584.

11. Calvert JG, Slade DE, Shields SL, Jolie R, Mannan RM, Ankenbauer RG, Welch SK. 2007. CD163 expression confers susceptibility to porcine reproductive and respiratory syndrome viruses. Journal of virology 81:7371-7379.

12. Han M, Kim CY, Rowland RR, Fang Y, Kim D, Yoo D. 2014. Biogenesis of nonstructural protein 1 (nsp1) and nsp1-mediated type I interferon modulation in arteriviruses. Virology 458-459C:136-150.

13. van Kasteren PB, Bailey-Elkin BA, James TW, Ninaber DK, Beugeling C, Khajehpour M, Snijder EJ, Mark BL, Kikkert M. 2013. Deubiquitinase function of arterivirus papain-like protease 2 suppresses the innate immune response in infected host cells. Proceedings of the National Academy of Sciences of the United States of America 110:E838-847.

14. Morin M, Elazhary Y, Girard C. 1991. Porcine reproductive and respiratory syndrome in Quebec. The Veterinary record 129:252.

15. Baron T, Albina E, Leforban Y, Madec F, Guilmoto H, Plana Duran J, Vannier P. 1992. Report on the first outbreaks of the porcine reproductive and respiratory syndrome (PRRS) in France. Diagnosis and viral isolation. Annales de recherches veterinaires. Annals of veterinary research 23:161-166.

16. Wensvoort G, Terpstra C, Pol JM, ter Laak EA, Bloemraad M, de Kluyver EP, Kragten C, van Buiten L, den Besten A, Wagenaar F, et al. 1991. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Vet Q 13:121-130.

17. Collins JE, Benfield DA, Christianson WT, Harris L, Hennings JC, Shaw DP, Goyal SM, McCullough S, Morrison RB, Joo HS, et al. 1992. Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs. Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 4:117-126.

18. Meng XJ. 2012. Emerging and Re-emerging Swine Viruses. Transboundary and emerging diseases.

19. Murtaugh MP, Stadejek T, Abrahante JE, Lam TT, Leung FC. 2010. The ever- expanding diversity of porcine reproductive and respiratory syndrome virus. Virus research 154:18-30.

20. Pasternak AO, Spaan WJ, Snijder EJ. 2006. Nidovirus transcription: how to make sense...? The Journal of general virology 87:1403-1421.

21. Snijder EJ, Kikkert M, Fang Y. 2013. Arterivirus molecular biology and pathogenesis. The Journal of general virology 94:2141-2163.

22. van Marle G, Dobbe JC, Gultyaev AP, Luytjes W, Spaan WJ, Snijder EJ. 1999. Arterivirus discontinuous mRNA transcription is guided by base pairing between sense and antisense transcription-regulating sequences. Proceedings of the National Academy of Sciences of the United States of America 96:12056-12061.

23. Baker SC, Baric, R. S., Balasuriya, U.B., Brinton, M.A., Bonami, J.R., Crowley, J.A., de Groot, R.J., Enjuanes, L., Faaberg, K.S., Flegel, T.W., Gorbalenya, A.E., Holmes, K.V., Leung, F.C-C., Lightner, D.V., Nauwynck, H., Perlman, S., Poon, L., Rottier, P.J.M., Snijder, E.J., Stadejk, T., Talbot, P.J., Walker, R. M., Woo, P.C.Y., Yang, H., Yoo, D., Ziebuhr, J. 2012. Nidovirales, p. 785-834, Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier.

24. Snijder EJ, Wassenaar AL, Spaan WJ. 1994. Proteolytic processing of the replicase ORF1a protein of equine arteritis virus. Journal of virology 68:5755-5764.

25. Snijder EJ, Wassenaar AL, Spaan WJ, Gorbalenya AE. 1995. The arterivirus Nsp2 protease. An unusual cysteine protease with primary structure similarities to both papain-like and chymotrypsin-like proteases. The Journal of biological chemistry 270:16671-16676.

26. Steinhauer DA, Holland JJ. 1987. Rapid evolution of RNA viruses. Annual review of microbiology 41:409-433.

CHAPTER 2. LITERATURE REVIEW

Porcine reproductive and respiratory syndrome virus (PRRSV) is the etiological agent of a world-wide epidemic termed porcine reproductive and respiratory syndrome (PRRS).

PRRSV is highly host and tissue restricted to swine cells of the monocyte lineage, preferentially infecting the porcine alveolar macrophage (AMΦ) (1). PRRSV first emerged in the late 1980s as a ‘mystery’ disease progressing through swine populations in both Europe and North America (2-6). Prevailing clinical symptoms were noted to be respiratory distress in young hosts and widespread reproductive failure in pregnant sows including mummified, stillborn and aborted fetuses (7). Initial characterization of circulating European (EU, Type 1) and North American (NA, Type 2) genotype isolates were found to be surprisingly genetically divergent. Although overall disease phenotype, gross clinical symptoms, genomic organization and temporal emergence were all similar, these strains differed by ~40% at the nucleotide level (3, 5, 8). The degree of genetic heterogeneity suggests a protracted period of independent evolution on the two continents (9); molecular clock analysis predicts the divergence of the two genotypes from a common ancestor between a decade to over a century prior to clinical recognition (10, 11), presumably from another host species (12). The origin of PRRSV remains unknown and no secondary animal, human, or arthropod vectors have been identified to date (13-17). In the ~25 years since the first emergence of PRRSV, a global epidemic has been sustained by a set of emerging and re-emerging strains supported by high frequency mutation and recombination (18-20). PRRSV remains the most economically devastating disease of swine and contributes to the deterioration of animal health through disease and the continual emergence of increasingly virulent strains (21-24).

GENOME AND REPLICATION

PRRSV is a member of the Arteriviridae family within the order Nidovirales. The

Nidovirus order constitutes a group of positive-sense RNA viruses which share a hallmark replication/transcription strategy, similar genomic organization, and a defining set of genetic elements (25). Despite the strong genetic similarities between the nidoviruses, they differ biologically in many ways including host species and range, disease phenotype, virion morphology, cellular tropism, genomic size and encoded content (26). The similar genomic organization, characteristic genetic elements and common functionality of orthologous proteins has however led to the acceptance of many putative functions for PRRSV proteins; often derived from studies of the arterivirus prototype species equine arteritis virus (EAV) and the more distantly related coronaviruses. Classically the nidoviral families could be categorized into large nidoviruses (Coronaviridae, Roniviridae; ~28-32Kbs) and ‘small’ nidoviruses (Arteriviridae; ~15Kbs) based on genome size; however the recently described

Mesoniviridae of intermediate length (mesos = medium; ~20Kbs) depicts the large genomic size range the Nidovirus order inhabits (26, 27). The Arteriviridae is composed of four viral species which share similar genetic and biological characteristics such as genomic organization and content, and a cellular tropism for the macrophage lineage (28). Viral species include PRRSV, simian hemorrhagic fever virus (SHFV), lactate-dehydrogenase elevating virus (LDV) and the equine arteritis virus (EAV; arterivirus prototype species) (25,

29).

Genome Organization

The PRRSV genome is approximately 15Kb in length and expresses a range of accessory and structural proteins through two distinct transcription mechanisms. The genomic organization and associated expression profiles are depicted in Figure 2.1. The

PRRSV genome encodes a 5’ proximal non-coding element (untranslated region; UTR) of approximately 217-222 nucleotides (nt) (EU) and 188-191nt (NA) in length (data not shown). The 5’UTR performs functions important for transcriptional priming, translation initiation, and the coalescing junctional site for all sub-genomic RNA products (sgRNA; discussed below) (30-35).

Directly downstream of the 5’UTR are the large overlapping replicase open reading frames (ORF). The ORF1a/b share a single translational start site but is augmented by two ribosomal frameshift (RFS) sites at genomic positions 3,889nt (RFS1; nsp2) and 7,695nt

(RFS2; nsp8/9) [VR-2332 (U87392) reference sequence] (36, 37). The RFS1 site within nsp2 has only recently been identified and the terminology associating the newly defined ORF and polyprotein is forthcoming. Two products are generated from the RFS1 site; a -1 RFS occurs approximately 7% of the time and results in an immediate termination of translation (nsp2N)

(38). Additionally, a -2 RFS event occurs at ~20% efficiency and yields a translational extinction in the -2 coding frame through the putative transmembrane domain of nsp2 to generate the product nsp2TF (36). In order to maintain a consistent nomenclature the RFS1 polyprotein products will be referred to herein as pp1a-nsp2N (-1 RFS) and pp1a-nsp2TF (-2

RFS), or collectively as pp1a-nsp2.

Unlike the canonical structural proteins, the large replicase polyproteins pp1a-nsp2, pp1a, and pp1ab are generated from the mRNA PRRSV genome. Using the North American

Figure 2.1. PRRSV genome, transcription, and translation. PRRSV replication proceeds by a range of genetic and protein regulatory mechanisms. Expression of the first three-fourths of the ~15Kb genome yields multiple polyproteins (ORF1a-nsp2, ORF1a, ORF1b) through two documented programmed RFS. Polyproteins are co-translationally and post-translationally processed into at least 14 distinct replicase (accessory) nonstructural proteins (nsps) by four virally encoded proteases PLP1α, PLP1β, PLP2, and SP. Canonical structural proteins are expressed exclusively through a set of sub-genomic RNAs (sgRNA’s; RNA2-7) via a co- terminal discontinuous transcription strategy via a negative-sense strand intermediate (see below).

(Type 2) prototype strain VR-2332 (U87392) for a reference, ORF1a/b is encoded by a 5’ proximal segment of approximately 12 Kb [7512nt ORF1a, 4374nt ORF1b] yielding four distinct polyproteins including pp1a-nsp2N (1,234 amino acids (aa); -1 RFS at RFS1), pp1a- nsp2TF (1,403aa; -2 RFS at RFS1), pp1a (2,503aa), and pp1ab (3,960aa; -1 RFS at RFS2)

(Figure 2.1).

The replicase polyproteins are co-translationally and post-translationally processed into at least 14 distinct nonstructural proteins (nsp) via four virally encoded proteinases including papain-like cysteine proteinase 1α (PLP1α; nsp1α), PLP1β (nsp1β), PLP2 (nsp2), and the main serine proteinase (SP; nsp4) (25). PLP1α and PLPβ function to cleave the

10 nsp1α↓nsp1β and the nsp1β↓nsp2 junction, respectively; PLP2 is responsible for the cleavage of the nsp2↓nsp3 junction and the main SP processes all remaining nsp products (nsp3-12)

(39). pp1a-nsp2 is the smallest of the polyprotein precursors, composed of nsp1α, nsp1β, and a truncated form of nsp2. ORF1a encodes the pp1a encompassing nsps 1-8, and the ORF1ab encodes the pp1ab composed of all known nsps (nsp1α/β, nsp2-6, nsp7α/β, nsp8-12) whereas nsp9 is a translational extension of nsp8 via a programed -1 RFS at position 7,695nt (RFS2)

(Figure 2.1) (37). In contrast, structural proteins are encoded and individually expressed by a set of sgRNA’s through a negative-strand intermediate (RNA2-7; Figure 2.1) (40). sgRNA’s are genetically polycistronic (except RNA7) but are functionally monocistronic/bicistronic, whereas only the 5’ terminal ORF(s) is expressed (Figure 2.1; colored boxes of RNA2-7 denote the proteins derived from each RNA species). Generation of sgRNA’s and the resulting expression of the PRRSV structural proteins are described in detail below. Briefly,

RNA 2 encodes ORF2a/b which is translated to yield glycoprotein 2 (GP2(a)) and a small non-glycosylated envelope protein (E)(GP2b); ORF3 is expressed from RNA3 to yield GP3;

RNA4 encodes ORF4 yielding GP4 – together GP2, GP3, and GP4 form a trimeric complex resulting in the ‘minor’ glycoprotein complex which functions in viral entry (41). RNA5 encodes ORF5 and 5a, ORF5 is translated into GP5 whereas ORF5a encodes a small protein only recently described (42, 43) and of unknown function. ORF6 is expressed from RNA6 resulting in the generation of the membrane protein (M), GP5 and M form a disulfide linked dimer and together constitute the ‘major’ glycoprotein complex on the PRRSV virion (44).

Finally, the nucleocapsid protein (N) is encoded by ORF7 and expressed from RNA7. N is the major structural element within the PRRSV virion, functions to package the viral

11 genomic RNA (gRNA), and is the only known structural protein which does not encode a transmembrane domain or to not have an ectodomain upon the PRRSV virion (45-51).

5’ and 3’ UTR

Flanking the core protein coding regions of the PRRSV genome are the 5’ and 3’

UTRs. Both the 5’ and 3’ UTR are implicated as essential components contributing to the viral strategies imparting replicative and translational functionality; however, the exact functions of the 5’ and 3’ UTRs, and the associated mechanisms of interaction, are poorly understood. The 5’UTR is encoded within the first ~220nt (EU) or ~189nt (NA) within the

PRRSV genome and is believed to possess a putative type I 5’ Cap structure (Figure 2.1;

(52)). The 3’ UTR is located directly downstream of ORF7 (Figure 2.1) and is encoded by approximately 150nt excluding the polyadenylation site. Polyadenylation of the 3’ termini is essential to viral viability (35). Both the 5’ UTR and the 3’ UTR encode conserved putative

RNA secondary structures important to replicative function. The maintenance of this higher order structure(s) may supersede requirements for conservation of a primary sequence within these regions (32-34, 53).

The 5’UTR is genetically variable between strains whereas EU and NA strains share approximately 55% genetic homology within the 5’ UTR (31, 54). While genetic heterogeneity is noted within the 5’UTR, mutations within this region are often deleterious

(35). Viable mutations appear to maintain a conserved RNA secondary structure defined by stem-loop structures (SL) extending from a central bulge (Figure 2.2) (54). The RNA secondary structure is considered critical to the function of the 5’UTR (31), particularly in regards to the generation of sgRNA’s (40). The 5’UTR is initiated by an AU-rich region with

12 a highly conserved AUG as the first three nucleotides. This AUG codon appears to be nonfunctional, as no protein product has been defined from this region, and is nonessential to

PRRSV replication (35). While a small fraction of the AU-rich region can be deleted without lethality to the virus (~5% of the UTR), passage 0 (P0) shows significantly diminished growth of these deletion mutants and all recovered progeny displayed 5’ ends repaired with

AU rich sequence from an unknown source (33); demonstrating a rapid restoration of this region to retain viability. Analysis of the RNA structure of the 5’UTR of three North

American reference strains, nine North American field strains, and two European strains noted that field isolates had an internal bulge within the stem-loop of a variable structural domain 4 (SL4) (Figure 2.2), while cell culture adapted strains all lacked this element (54).

Cell culture adaptation of a field isolate strain resulted in loss of the base-pair mismatch

‘bulge’ (54). The importance or functionality of the noted genetic heterogeneity within and around SL4 (Figure 2.2A), including the central bulge on SL4, is unknown. Cellular factors including the poly-C binding proteins (PCBP) 1 and 2 have been reported to interact with the

5’ UTR (55). siRNA knock-down of PCBP1 and PCBP2 resulted in attenuation of PRRSV

RNA genomic and anti-genomic replication, but not translation of the replicase proteins from the mRNA genome (55). Detailed studies of the distantly related coronavirus species have shown the 5’UTR of nidoviruses are regulators of genomic replication, transcription, and mRNA translation and are considered a necessary docking site for a variety of viral and host factors to complete these functions (56-58).

Figure 2.2. Predicted RNA secondary structure of the NA PRRSV 5’UTR. The PRRSV 5’UTR maintains a conserved RNA secondary structure which is critical to sgRNA synthesis, including cis-acting elements within the SL domains. A) (ΔG) free energy dot plot (VR-2332 5’UTR 1-189nt; MFold prediction algorithm (59)), upper triangle shows possible stable structures: red = lowest free energy (most stable), black = highest free energy (least stable); lower triangle (below slopped line): optimal energy structures. Each plot point is the predicted base-paring interaction between i base (x-axis) and j base (y-axis) so that plot point (2,45) is the base- pair interaction of the second nucleotide with the 45th base (1st base-pair interaction in SL1). B) Graphical representation of putative RNA secondary structure (RNAFold) of the VR-2332 5’UTR showing the conserved SL1-5 radiating from a central bulge structure. RNAfold prediction algorithm accessed from the Geneious parental program (v6.1.6).

Current data suggests the polyadenylated 3’UTR is the initiating factor for synthesis of negative-sense gRNA and sgRNA transcription through one or more cis-acting elements, possibly including long-range RNA-RNA interactions, and acts through both primary RNA sequence and conserved secondary structure motifs (35, 60, 61). Through genetic probing of the N gene two highly conserved SL structures, one within the ORF7 coding region and one within the 3’UTR, were identified. The kissing loop interaction between these two SL structures was found to be critical for viral replication (53). Mutation of the predicted loop-

14 loop interaction domain abolished replication whereas secondary mutation restoring potential complimentary base pairing also restored replication (53). While it has been shown that some regions of the 3’UTR are dispensable without loss of viral growth kinetics (62), even small changes (single-nucleotide mutation) within the 3’UTR can have a range of deleterious effects (60). For instance, mutational probing of the 3’UTR identified a critical primary sequence within the tetranucleotide sequence at the 3’ termini, directly upstream to the poly-

A region (5’-AAUUAAA…An-3’) (60). Interestingly, mutation of each nucleotide resulted in slightly different phenotypic outcomes. Replacement of the final uracil base at the 3’ termini was fatal with a purine (adenine or guanine) substitution, but cytosine substitution had no effect on viral viability. Alteration of the upstream uracil base significantly reduced the synthesis of sgRNA and viral growth for all substitutions. Replacement of the 3’ proximal adenine (AAUU) did not appear to effect sgRNA synthesis or N protein expression, but resulted in a nonviable phenotype for unknown reasons. Finally, an alteration of the 5’ proximal adenine showed reduced (-) gRNA synthesis when replaced with a guanine base.

These data show that the coding strategies for the 5’ UTR and the 3’ UTR are complex.

Whereas some regions are robust to mutation, many domains maintain a requirement for stable secondary structures or primary sequence critical for specific replicative function including gRNA synthesis, sgRNA transcription, or possibly non-transcription related functions.

REPLICATION

Due to the unique attributes of Nidovirus transcription and replication including uncharacteristically large polycistronic RNA genomes and the transcription of a nested set of

5’, 3’ co-terminal sgRNA’s through a discontinuous transcription strategy, nidovirus RNA synthesis mechanisms have been suggested to be of unparalleled complexity among positive strand RNA viruses (26, 63). PRRSV replication closely ties three key features: rearrangement of host membranes to establish viral replication complexes (RC), synthesis and expression of gRNA, and transcription of sgRNA for the efficient expression of structural proteins. Genesis of gRNA (replication) and sgRNA are inherently tied through the shared negative strand synthesis mechanism. Modulation of negative-sense transcription through a non-stochastic mechanism yields either gRNA or one of six sgRNA’s (RNA2-7) through an abortive disjoining/rejoining discontinuous transcription strategy (40, 64, 65).

Membrane Rearrangement

Little is known about the establishment of PRRSV infection, from the point of entry to the development of RC’s, including the formation of characteristic perinuclear double- membrane vesicles (DMV) (66). DMVs are believed to be derived from the endoplasmic reticulum (ER) which are apparent sites of viral replication (67). It has been shown that the arterivirus replicase proteins (ORF1a/b) are sufficient to support viral replication (68).

Through the use of point mutations abolishing the start codon selectively, through deletion of internal coding sequence, or through introduction of novel framshifts within each EAV structural protein ORFs, it was shown that replication and transcription was maintained for each structural protein knock-out mutant, but infectivity was lost in all cases (68). Further, deletion of the complete coding sequence of ORF2-6 as well as the 5’ 40nt of ORF7 resulted in accumulation of genomic RNA to wild-type (wt) levels, indicating the replicase proteins are sufficient for genomic replication (68). Additional deletion of 227nt of ORF7 [EAV

12350-12557] nearly eliminated genome replication (68). The authors proposed that loss of gRNA replication via ORF7 deletion mutants were due to disruption of a cis-acting replication element; supported by the later definition of the PRRSV (53) and the EAV (61) 3’ kissing-loop interaction between ORF7 and the 3’ UTR.

Upon entry, the gRNA serves as the mRNA for immediate translation of the large replicase polyproteins. Within ORF1a, three proteins are recognized putative transmembrane proteins (nsp2, nsp3, and nsp5) (see chapter 4). The EAV nsp2 and nsp3 were shown to be sufficient to modulate host cellular membranes into structures similar to those observed during viral infection (69). It is believed that membrane integration and possibly protein- protein interactions of these transmembrane proteins function to torque the existing membrane structures to form the DMVs; tethering the genesis and processing of the polyprotein(s) at the site of replication. Additional viral or cellular interacting partners are not well defined. The mechanism of DMV formation is a working unknown but may include the modulation of autophagy and/or apoptosis pathways (70-80).

RdRp

The core replicative machinery of PRRSV, the RdRp (nsp9) and the RNA helicase

(nsp10), is encoded within ORF1b. The calculated RFS efficiency of the RFS1 (6-7% -1

RFS; 16-20% -2 RFS) (36) and the RFS2 (~20%) (81) demonstrates that ORF1b (nsp9-12) is generated approximately once out of out of every six translational events (15%), suggesting the stoichiometric requirements for the core replicative machinery is low compared to the 5’ encoded replicase proteins.

RdRps form a characteristic right hand configuration (thumb, palm, finger(s)) with the thumb and fingers in contact to create a pocket for substrates (82). Comparison of single- and double-stranded RNA virus RdRp show structural similarity even though there is low sequence homology between classes (82). All polymerases share a core set of conserved motifs, suggesting a common ancestor, whereas the most conserved motifs are denoted A, B,

C, and D (83). The structure of the RdRp possesses an additional conserved motif E (84).

The RdRp of Nidoviruses are phylogenetically clustered with the picorna-like virus superfamily (26, 85) but possess a SDD (Ser-Asp- Asp) signature within motif C, located within the active site on the palm side of the RdRp. The nidoviral SDD motif is a hallmark of the viral family that discriminates it from all other (+) sense RNA virus groups that contain a

GDD (Gly-Asp- Asp) motif (81). The SDD motif at this position was shown to be critical for

EAV replication (86); surprisingly a S→G mutation within the PRRSV RdRp was replication competent (gRNA) but displayed deficiencies in sgRNA synthesis (87).

Nsp10 encodes the PRRSV helicase protein (88). The PRRSV multi-domain helicase

(HEL) is composed of the core 1A and 2A canonical domains found in super-family 1 type helicases, a flexible accessory domain (1B), and a unique zinc-binding domain (ZBD) (89).

The PRRSV HEL functions to unwind dsRNA in a 5’ to 3’ polarity (88). Both the flexible accessory domain and the ZBD are critical to replicative function of EAV including generation of gRNA and sgRNA (90, 91). The helicase is predicted to function in concert with the RdRp to facilitate replication and transcription, however, it is not understood how the 5’ to 3’ directionality of the helicase and the 3’ to 5’ RdRp synthesis coordinates these activities (39).

It is unknown how the PRRSV RdRp initiates replication, either by a primer dependent mechanism or by de novo synthesis. To assess the activity of the EAV RdRp, a recombinant version of the polymerase was generated and assessed. EAV RdRp activity was found in the absence of a primer with poly(U) or poly(C) templates but not with poly(A) templates, indicating a de novo initiation method in a template specific manner (92).

Introduction of primers to either the poly(U) or poly(C) templates reduced RdRp activity

(92). Incubation with non-complementary bases (i.e. for Poly(U) template = GTP and UTP) did not result in radiolabeling, which shows the RdRp did not function as a terminal transferase, and radioactively labeled primers were not incorporated into the synthetic non- viral templates (92). De novo polymerase activity could not be detected on viral templates however. This finding suggests the arterivirus RdRp is catalytically active without other viral factors and capable of de novo synthesis but may require other viral or cellular co-factors to efficiently perform replication or transcription processes.

It is generally believed that (+) sense RNA viruses use conformational switches in their terminal non-codling regions in the form of higher order RNA secondary structure to regulate translation, transcription (of sgRNA’s) and genomic replication (61). To define the minimal cis-acting 3’ genomic element required for efficient PRRSV replication, progressive

3’ deletions were introduced into self-limiting PRRSV replicons encoding an internal ribosome entry site (IRES)-driven luciferase (LUC) reporter within the deleted region (35).

Only the smallest deletion, encoding the full M and N proteins replicated to similar levels as the positive control. The next smallest deletion, removing the M protein coding region but maintaining the complete N ORF resulted in significant loss of genome replication (35).

Taken together with the data of the 5’UTR, 3’UTR and ORF7, these data show that key

19 genetic elements or protein interacting partners required for efficient PRRSV replication are interspersed within multiple coding regions of the genome.

sgRNA Synthesis

Viruses require the ability to selectively regulate transcription and translation processes both temporally and quantitatively in a highly ordered and balanced process (93).

The expression mechanisms between the nonstructural replicase proteins and the structural proteins are fundamentally separated within the PRRSV genome facilitating rapid expression of nsps from the gRNA and subsequent amplification of sgRNA transcripts through a differential transcription cascade (94). sgRNA’s are synthesized by the viral RdRp through a highly ordered process encoded within the PRRSV genome. The set of nested (Nido Latin: nested) sgRNA’s encode noncontiguous gRNA sequence including both the 5’UTR and the polyadenylated 3’UTR as well as one or more ORFs from the 3’ region of the genome

(ORF2-7) but lack the entire large ~12 Kb replicase coding region (ORF1a/b) (Figure 2.1)

(26, 95, 96). It was originally hypothesized that nidoviral sgRNA’s could be generated through a free 5’UTR priming stage (97, 98) but was ultimately shown that nidoviruses utilize a discontinuous sgRNA transcription strategy (40, 99). Discontinuous replication proceeds through a replicative fusion of the viral genome 5’UTR to one of many downstream

3’ sites through base pairing interactions between sense and antisense SL structures via long- range RNA-RNA interactions (40) (Figure 2.3). Fusion is facilitated by a conserved sequence, the transcription-regulating sequence (TRS), located near the 3’ terminus of the

5’UTR (Figure 2.4). An anti-sense TRS at or near the 5’ end of each structural protein coding region (ORF2-7) can each individually form a kissing-loop interaction with the leader-TRS

20 to prime transcriptional jumping. sgRNA’s synthesis and gRNA replication utilize a similar initial synthesis mechanism, whereby negative strand transcriptional extension from the 3’ termini is completed until a TRS signal sequence within the body of the genome is encountered (94, 100). The body TRS is ordered into a SL structure encoding a conserved heptanucleotide primary sequence (body TRS signal) (100) within the loop structure. This signal halts transcription of the negative strand and a ‘decision’ is made between transcriptional read-through and continuation of synthesis, or a disjoining of the transcriptional machinery and rejoining to the common leader TRS (antisense to body-TRS) by complimentary base-paring with a second SL structure within 5’ UTR (40, 101) (Figure

2.3). The leader TRS is located within the 5’UTR directly upstream of the AUG start codon

Figure 2.3. sgRNA synthesis. PRRSV structural proteins are translated from sgRNA’s. All structural protein coding regions are flanked upstream by transcription regulatory sequence (TRS) which are anti-sense complimentary to the leader TRS encoded within the 5’ UTR (102). sgRNA synthesis initiates as (-) strand replication (red) from the full length (+) sense (black) genome. RdRp interaction with a TRS either results with a read-through and a continuation of (-) strand replication or, in the case of sgRNA synthesis, disassociation of the replicating strain (body) and re-joining at the 5’ leader TRS (leader-body junction) through sequence complementarity annealing (red arrow) followed by completion of (-) strand sgRNA synthesis. All sgRNA’s possess identical 3’ and 5’ termini (see Figure 1-1). (-) sense sgRNA’s serve as template for generation of (+) sense sgRNA synthesis, required for structural protein translation.

21 of nsp1α and is part of a highly ordered and well conserved RNA secondary structure motif between the 5’UTR and the 5’ nsp1α coding region (Figure 2.4). Transcriptional read- through of all body TRS sites will result in gRNA synthesis. Decoupling from the genomic strand at the body TRS and rejoining at the leader TRS results in noncontiguous transcription that lacks a large central region of the genome, yielding one of six sgRNA products

(dependent on which body TRS is utilized) (65).

Figure 2.4. The PRRSV 5’UTR Leader TRS. PRRSV replication proceeds by the transcriptional priming of the 5’UTR for full-length genomic replication and as a site of convergence (5’UTR leader TRS) for all discontinuous replication strategies (RNA 2-7). Predictions of RNA folding for the 5’UTR and the leader TRS were completed using the RNAfold prediction algorithm within the Geneious parental program (v6.1.6). Nucleotide bases are colored per predicted stability of base-pair interaction: red (high stability), green (mid stability), and blue (low stability). 5’UTR VR-2332 (U87392) 1-189nt; MN184C (EF488739) 1-190nt; SRV-07 (JX512910) 1-189nt; JXwn06 (EF641008) 1-189nt; Lelystad (EU Prototype; M96262.2) 1-221nt). TRS secondary structure was demonstrated by predictive folding of the genomic region 124-249nt (VR-2332); 125- 250nt (MN184C); 124-249nt (SRV-07); 124-249nt (JXwn06); and 126-294nt (Lelystad).

While the mechanism of sgRNA generation is conserved, the discontinuous transcription process has been shown to be able to utilize both canonical and non-canonical body TRS sites and can have strain specific derivations (9, 64, 100). Alternative canonical and non-canonical body TRS sites often precede the coding region of PRSSV structural proteins, which function to drive sgRNA synthesis to various degrees of efficiency, yielding major and minor sgRNA species encoding the same structural protein. For instance, the NA

PRRSV prototype strain (VR-2332) utilizes at least two different leader-body junction sites

(AUAAC and UAAACC) for the generation of sgRNA7 sub-species (103). The mechanism(s) regulating sgRNA synthesis appear to be complex as shown by studies defining mutations within the EAV ORF7 body TRS (nucleocapsid) abolishing the generation of sgRNA7, the most abundantly produced sgRNA (40). Elimination of sgRNA7 synthesis resulted in obvious increase in sgRNA6, 5, 4, and 2 but production of sgRNA3 remained unchanged. Additionally, it was noted that a mutation within the leader TRS, altering the fifth nucleotide of the conserved sequence (5’-UCAAG-3’) eliminated synthesis of all sgRNA’s except sgRNA3 (40). This effect is due to a unique non-canonical TRS semi- independent generation of sgRNA3.1, noted to be produced by both EAV and PRRSV (40,

64). sgRNA3.1 uses a non-TRS body sequence of 5’-UCAAUACCC-3’ which lacks the 3’ terminal C residue of the canonical TRS sequence but possesses an additional five nucleotides (UACCC) that match the adjoining sequence downstream of the leader TRS, allowing for sense/antisense base pairing. (40).

PRRSV EU prototype strain Lelystad virus (LV) sgRNA’s possess a conserved six nucleotide junction sequence of UCAACC (or similar sequence), but show heterogeneity at the junction site, suggesting the joining mechanism may be ‘imprecise’ (102). Studies on

23 whole RNA RT-PCR (cDNA) of virally infected cells with NA PRRSV strains further identified a similar common leader-body junction sequence U(G)UA(G/C)ACC (31, 64).

Genetic heterogeneity was also noted at these junction sites, differing by a single base to a couple of nucleotides, showing there is slight flexibility within the disjoining and reattachment of the viral RdRp during this step (64). Data from single and double knock-out mutagenesis studies of alternative (non-canonical) TRS body sequences for EAV showed that the expression of solely the minor sgRNA species from alterative joining sites of the

GP3, GP4, and GP5 structural proteins were sufficient for production of infectious progeny virus (93). It is not clear if the alternative TRS body sites serve as a secondary mechanism to rescue deleterious mutations from the error-prone RdRp, or if they serve a dedicated purpose within the viral life cycle. Knock-out of the canonical TRS body sequence of ORF3, 4, or 5 resulted in infection rates at perceived wild-type levels (defined by IFA cell-to-cell spread; 1-

3 log PFU/ml reduction in titer) by utilizing secondary TRS sequences within these coding regions (93). Double knock-out mutants of both the canonical and accessory body TRS sequences surprisingly still resulted in generation of progeny virus, but at reduced levels

(ORF3 = 2 log reduction, ORF4 = 3 log reduction, ORF5 = 5 log reduction; PFU/ml). It is presumed that even if the use of alternative TRS sequences results in inefficient sgRNA synthesis, the two amplification cycles (genomic RNA → (-) sense sgRNA synthesis → (+) sense sgRNA) may result in sufficient sgRNA copy numbers to allow a productive infection cycle to proceed. The authors noted that the reduction in PFU titers of the single or double

TRS mutants corresponded “very well” to the reduction in molar ratios of each respective

RNA subspecies (93).

Heteroclite RNAs

Defective interfering (DI) RNAs are a normally observed by-product of (+) sense RNA virus replication, particularly under high multiplicity of infection (m.o.i.) culturing conditions

(104-107). DI RNA’s are generated through non-homologous recombination between viral genomes resulting in random internal deletions but still encode the replication elements essential for generation of defective progeny virus including the genes encoding for the polymerase, essential replicase proteins, and capsid protein(s) (108). Unlike DI’s, a group of

“heteroclite” sgRNA’s (heteroclite = deviating from common forms or rules) were identified within PRRSV replicative products of unusual structure but containing large internal deletions (108). Heteroclite sgRNA’s species were identified within infected cells, purified virions, porcine alveolar macrophages infected with field isolates under natural infection conditions, and within plaque-purified viral infections (108). The essential replicative products such as the viral RdRp were found to be absent within the heteroclite RNAs (108), discriminating them from prototypical DI genomes. Sequencing analysis showed a short site of three to seven conserved nucleotides between the 5’ and 3’ joining regions. The 5’ region of the heteroclites encoded terminal ORF1a proteins including one or more of the papain-like proteases and joined within the ORF6 coding region either in-frame or within alternative reading frames (108). These RNA species persist in a range of experimental culturing conditions including low m.o.i. passage and plaque purification (108) and were found to be packaged within the PRRSV virion (42, 109). Additional DI RNA that possess many similar genetic features have been identified but each contain a smaller deletion (nsp2-9) and encode all structural proteins (105). Currently there is no known function of heteroclite sgRNA’s but they have been proposed as a packaging vector to study the effect of viral factors, or the

25 effect of exogenous elements on viral replication, translation, progeny phenotype, or immune response/modulation (108).

VIRION STRUCTURE

The PRRSV virion is a nondescript spherical particle roughly 60nm in diameter

(Figure 2.5). The core of the particle is composed of the nucleocapsid protein (N), genomic viral RNA, and possibly cellular factors (45, 110). N protein assembles into a homodimer as the basic capsid unit and binds genomic vRNA via a set of positively charged residues within the N-terminal domain (47, 111). While it was originally believed the capsid formed icosahedral symmetry, structural studies have shown the vRNA is packaged into helical conformation (45). The fully package capsid-gRNA ultimately assembles to form a double- layered hollow core superstructure of approximately 39nm in diameter (45). Surrounding the core is the viral envelope which maintains a 2-3nm gap between the core particle and the viral envelope on all sides (45). The viral envelope is composed of a spherical lipid bilayer sequestered from intracellular membrane structures of the porcine AMΦ, most likely derived from the ER or Golgi compartments (44). Embedded within the viral envelope are a number of viral protein complexes including the minor glycoprotein complex (GP2-GP3-GP4) and the major glycoprotein complex GP5-M heterodimer (44, 112). Both the major and minor complexes only extend a short distance from the exterior surface of the viral envelope (45), which gives the PRRSV virion a smooth appearance lacking any discernable outward projections (Figure 2.5). The small E protein (GP2b), dispensable for virion assembly but essential for infectivity, most likely forms ion channels within the viral envelope (putative viroporin), presumed to be critical to the pH dependent entry process of the PRRSV virus

(113, 114). An alternative reading frame within ORF5 also encodes a short 55aa protein

(GP5a) packaged within the virion of PRRSV and of unknown function (42).

Figure 2.5. The PRRSV virion. Highly pathogenic PRRSV strain SRV-07 imaged by transmission electron microscopy using an FEI Tecnai G2 transmission electron microscope operated at 80 kV (120,000x magnification). Difference in size and appearance of the PRRSV virion is noted between the use of common negative stains A) phosphotungstic acid and B) uranyl acetate.

STRUCTURAL PROTEINS (STRUCTURE, FUNCTION, AND

IMMUNOGENICITY)

Structural proteins formulate the viral encoded protein content of the virion and function in egress, attachment, entry, and/or early replication steps (115). PRRSV structural proteins are expressed by a highly ordered transcription/translation mechanism through the generation and amplification of sgRNA’s (see above). ORFs 2-7 encode the structural proteins of PRRSV within the final one-fourth of the viral genome and include GP2(a), E,

GP3, GP4, GP5, GP5a, M, and N (Figure 2.1) (25, 112, 116).

The major structural elements comprising the virion are encoded with ORF5, 6, and 7

(GP5, M, and N respectively) (117). The 15 kDa N phosphoprotein functions as a

27 homodimer via covalent disulfide linkage through the conserved cysteine residue at position

23 (strain PA8) and by non-covalent interactions (47). The structure of the N dimer has been proposed to comprise a new class of viral capsid-forming domains and include antiparallel β- strands that form a continuous, flat floor (possible internal surface of the capsid shell) with two long α-helices located above the β-strand floor flanked by N-terminal and C-terminal helices (48). N protein packages viral gRNA though interaction with positively charged residues within the N-terminal domain and accounts for as much as 40% of the protein content of the packaged virion (48, 118). N is highly antigenic and is a major immunological determinant of the humoral immune response to PRRSV infection (119-121). The humoral immune response to N is non-neutralizing and not protective against infection and may contribute to antibody-dependent enhancement of infection (119, 122). Intracellularly, N localizes to the nucleolus of infected cells at early time points post infection but migrates to a diffuse cytoplasmic pattern as the infection progresses (123). N is targeted to the nucleus by a nucleolar localization signal (NoLS). The function(s) of N within the nucleus is unknown but disruption of this targeting signal was shown to attenuate PRRSV replication (123, 124). N protein was found to interact with host nucleolin, importin-α and importin-β shuttle proteins presumably facilitating nuclear localization, and Fibrillarin and poly(A) binding protein

(PABP) (125, 126); definitive functions of these interacting partners are yet to be determined.

GP5 and M

The unglycosylated M protein and GP5 formulate the major constituents of the viral envelope (44). Residues 1-31 of GP5 (200aa; 25 kDa apparent MW) encode a membrane targeting signal cleavage sequence (49, 127); it has been recently shown that GP signal

28 sequence is cleaved in two locations, yielding a combination of differentially cleaved GP5 within virions (127). GP5 encodes up to three additional membrane spanning helices between

60-128aa which anchors the mature protein to the viral envelope. GP5 is heterogeneously glycosylated with complex N-linked glycans upon transfer to the medial Golgi compartment, a potential site of virion packaging (44, 128). A variable number of glycosylation sites within

GP5 are located within the short ~30aa ectodomain of GP5 (31-60aa) which is a site of significant genetic heterogeneity between strains (49, 129). Genetic heterogeneity and differential glycosylation are believed to be major factors contributing to the lack of cross- protection between PRRSV isolates (18, 127, 128). The final 70aa of GP5 (~130-200aa) is maintained within the internal compartment of the PRRSV virion.

The 174aa M protein also encodes three putative membrane spanning helices which are located between residues 16 to 94. Packaged M protein is predicted to display a short

~16aa N-terminal ectodomain along with a large ~80aa C-terminal endodomain (130) and likely plays a key role in virion assembly (131). The M and GP5 heterodimeric complex is covalently linked by a disulfide bond presumably between conserved cysteine residues within the N-terminal ectodomains of each protein (44). The M-GP5 major glycoprotein complex functions in critical low-affinity binding interactions with the porcine AMΦ surface receptors heparin sulfate and sialoadhesin to initiate viral entry (132, 133). Neutralization epitopes are identified within the ectodomain of GP5 and are correlated with glycosylation sites (134-137), although a low quality humoral immune response including minimal serum neutralization titers are typical with PRRSV infection (138, 139). The M-GP5 dimer has been also shown to be critical for virion formation (46) and mutation of some N-glycosylation

29 sites of the GP5 ectodomain results in viral attenuation (128, 140) suggesting a role for these glycosylation sites in virion maturation or entry.

E, GP2, GP3 and GP4

GP2, GP3 and GP4 comprise the ‘minor’ heterotrimeric glycoprotein complex covalently attached by disulfide linkages (141). GP2 is a 30kDa integral membrane protein encoded by 256aa (NA) and 249aa (EU) (112, 131). GP2 possesses an N-terminal signal peptide (~40aa), a central 168aa ectodomain, a single transmembrane anchor domain and an approximately 20aa endodomain (112, 142). GP2 encodes two highly conserved putative N- linked glycosylation sites within the ectodomain (N173 and N178; EU LV strain) which are non-essential for virion formation or infectivity (142). In one study defining B-cell epitopes of PRRSV, two epitopes of GP2 comprised of regions 41-55aa and 121-135aa of an NA strain (NVSL 97-7895) were recognized by 60% (9/15) of sera from PRRSV infected hosts

(143) demonstrating GP2 is commonly recognized by the humoral immune response to infection. The ultimate antigenicity of a broader class of PRRSV strains, or the significance of immune responses targeting GP2 is however currently unknown (143). The small E protein, encoded within an embedded ORF (2b) inside the GP2a gene, was defined above.

Additionally, the myristoylated E protein (70-73aa) may also be a critical component of the minor glycoprotein complex (144). At least one study reported that E interaction with the

GP2-GP3-GP4 complex was essential for packaging of the minor glycoprotein complex

(145).

GP3 is a 254aa (NA) or 265 (EU) protein with an apparent molecular weight of

45kDa (112, 146). The topology of GP3 is currently unknown but may encode two

30 transmembrane domains, one predicted to be located on the N-terminus (1-27aa; possibly cleaved) and the other near the C-terminal domain (~182-201aa) (147). GP3 was originally thought to be a secreted nsp of PRRSV since GP3 was expressed to similar levels at GP5, M, and N in the infected cell, was originally not detected in the PRRSV virion, and a soluble form (sGP3) was identified (146, 148). Further analysis demonstrated GP3 as a structural micro-component of the virion (149). GP3 is predicted to be heavily glycosylated, encoding as many as seven putative N glycosylation sites (146). The disparity between the calculated molecular mass of GP3 (~27kDa) and the apparent molecular weight as defined by SDS-

PAGE analysis (43-45kDa) (112, 146) suggests that all seven glycosylation sites are used.

GP3 is noted as a major site of genetic heterogeneity between strains and is the second most genetically variable structural protein of PRRSV (49).

The 178aa (NA) or 183aa (EU) GP4 protein is predicted to encode four N glycosylation sites within the ectodomain (22-156aa) (41). Like GP2 and GP3, GP4 is predicted to encode N-terminal (~1-22aa) and C-terminal (156-178aa) transmembrane spanning domains (41) whereas the N-terminal transmembrane domain is a putative signal cleavage peptide (150). Along with GP5, humoral immune responses targeting the GP4 protein have neutralizing potential (150). The linear neutralization epitope (59-70aa; N-

SAAQEKISF-C) of GP4 is located within the hypervariable region of this protein (150). Due to the high mutation frequency of this region, neutralizing antibodies targeting GP4 appear to protect against homologous challenge but not heterologous isolates (150, 151). In vitro passage with suboptimal doses of neutralizing antibody showed that GP4 is susceptible to rapid immunoselection within the neutralization domain (152) and has been suggested to be a major determinant to PRRSV evolution (153). While immune responses generated against

GP4 are protective, one report using a panel of monoclonal antibodies showed that genetic subpopulations (quasispecies (20)) of single PRRSV isolates induce differential neutralizing capacity (154) which illustrates the complex nature of PRRSV host-pathogen interactions.

Together, the PRRSV minor glycoprotein complex functions to facilitate viral entry into the porcine AMΦ. Both GP4 and GP2 function to bind CD163 (41, 155), the PRRSV entry receptor (156). CD163 expression is restricted to cells of the monocyte lineage (157,

158) functioning physiologically as a haptoglobin scavenger receptor (159). Interaction of the minor glycoprotein complex with CD163 is most likely the defining characteristic conferring the highly restricted tissue tropism of PRRSV for cells of the monocyte lineage. Generation of chimeric viruses expressing the EAV minor glycoprotein genes (GP2, GP3, GP4), which has a broad tropism, within a PRRSV genetic backbone resulted in an equally broad in vitro tissue tropism (160) demonstrating the role of the minor glycoprotein complex in defining tissue tropism of PRRSV. Functionally, engagement of GP4/GP2 with CD163 initiates a clathrin-dependent receptor-mediated endocytosis of the PRRSV virion (156, 161), functioning as the primary entry mechanism for PRRSV infection (156, 162).

NONSTRUCTURAL PROTEINS

The PRRSV replicase nsp performs a variety of functions relating to the modulation of the host cellular environment, immunoregulation/immunoinhibition, and viral replication

(39). Polyprotein precursors are translated from gRNA and co-translationally and post- translationally processed by viral encoded proteases into at least 14 distinct nsp products including nsp1α, nsp1β, nsp2-6, nsp7α/β, and nsp8-12 (25). The mature PRRSV replicase proteins encompass a large size range from 16aa (nsp6; 1.7kDa) to 1196aa (nsp2; 129kDa).

ORF1a

Nsp1α and nsp1β each encode papain-like cysteine proteases (PLP) (163). PLPs are characterized by a catalytic dyad composed of a nucleophilic cysteine residue and a downstream histidine residue (164, 165). The putative catalytic dyad of nsp1α is located at cysteine 76 (C76) and histidine 146 (H146), although H115 or H157 could also participate

(166). PLP1α and PLP1β perform the essential functions of cleaving the nsp1α180↓nsp1β

(167) and nsp1β383↓nsp2 junctions (166). Nsp1α forms dimers both in solution and in crystals and structural analysis suggests that PLP1α most likely performs cis cleavage of the nsp1α180↓nsp1β (167). Mutation of either H115 or H157 of nsp1α resulted in a reduction but not elimination of nsp1α//nsp1β processing whereas amino acid substitution of either C76 or

H146 completely abolished proteolytic activity in vitro (166). Mutations that eliminated

PLP1α proteolytic activity also eliminated sgRNA synthesis (166). Nsp1α also encodes a putative zinc finger motif through four cysteine residues (C8, C10, C25, C28; EU genotype) that is a common feature of transcription factors (168), potentially important for regulation of sgRNA synthesis (168). Mutation of PCP1β catalytic dyad C276 and H345 completely inactivated protease activity, gRNA synthesis and sgRNA transcription (166) defining the requirement of both nsp1α and nsp1β processing for PRRSV replication. In addition, nsp1α and nsp1β have been shown to interfere with the innate antiviral immune response through multiple mechanisms including inhibiting interferon (IFN) regulatory factor (IRF3) and nuclear factor kappa-light-chain enhancer of activated B cells (NF-κB) signaling (169, 170), through interfering with IRF3/cAMP response element-binding protein (CREB) binding protein (CPB) interaction and increasing proteasome-depended degradation of CPB (171),

33 and inhibition of STAT nuclear translocation (172). Nuclear localization (172, 173), functionality of the nsp1α zinc finger motif (174) and PLP1α protease (175), and maintenance of a highly conserved sequence (GKYLQRRLQ) in nsp1β (176) were all reported to be important for the knock-down of pathogen recognition receptor (PRR) signaling and inhibition of type I IFN production.

Nsp2 performs a variety of functions related to virion replication, polyprotein processing, and immunosubversion and will be discussed in greater detail below. Nsp2, nsp3, and nsp5 each encode hydrophobic domains that integrate within the ER membrane at the site of replication (67). Nsp3 and nsp5 are almost entirely comprised of hydrophobic domains

(putative multi-pass transmembrane helices) and thus the functionality of these proteins are most-likely tightly associated with membrane associated functions (177). While the functionality of nsp5 is largely unexplored, nsp3 was found to be critical to the formation of

DMV RC’s (69). Mutation of a core set of four conserved cysteine residues located within the ‘luminal loop’ of the ER dramatically affected DMV formation and resulted in a nonviable phenotype (178).

The nsp4 3C-like main serine protease (SP) is defined by a His39-Asp64-Ser118 catalytic triad common to serine proteases, but shares substrate binding similarities with the picornavirus 3C-like cysteine proteases (179). The nsp4 SP is folded into three domains: an

N-terminal β-barrel, a central β-barrel, and a C-terminal α/β domain (179). The catalytic active site is located in the cleft between domains I and II (179) and domain III forms a putative hinge region possibly allowing regulatory function of the SP (180). SP functions to cleave all nsps downstream of the nsp2↓nsp3 junction (86) and has been shown to have cis- and trans- cleavage activities (179). Processing of the pp1a/b by SP can occur by differential

34 processing cascades, depended on nsp2 function as a molecular switch (181). The functions relating to nsp5-8 are currently unknown (28). The largest of the four proteins, nsp7 (256aa), is cleaved into two components nsp7α and nsp7β (180, 182). Structural studies of nsp7 identified a ‘unique fold’ which did not share any similarity to other characterized tertiary structures (183). While no functional motifs have been identified, mutational analysis showed that nsp7 was essential to PRRSV replication (184).

ORF1b

The functions relating to ORF1b proteins have been discussed previously and include the critical replicative machinery supporting PRRSV replication including the RdRp (nsp9) and helicase (nsp10). Nsp11 encodes the poorly characterized nidoviral uridylate-specific endoribonuclease (NendoU). The NendoU endoribonuclease cleaves internal segments of dsRNA in a sequence specific manner by targeting uridylates at GU(U) positions to yield 2’-

3’ cyclic phosphate ends (185). The viral NendoU is the most similar to the cellular homolog

XendoU endoribonuclease family that participates in ribosomal preRNA processing pathways (186). The active site of the arterivirus NendoU is composed of a catalytic triad

(His-126, His-141, and Lys-170; EAV) and closely resembles the active site of RNase A

(187). Unlike the coronavirus NendoU, the arterivirus homolog does not require a divalent cation (MN2+) for catalytic activity (185, 187). The function of the NendoU cleavage activity is currently unknown but mutation of the active site abolishing endoribonuclease activity is lethal for nidoviruses including PRRSV (187).

The Multifunctional Nsp2

The nsp2 protein is unique among the PRRSV genome due to its large size, significant genetic heterogeneity, accessory functions of the PLP2 protease, novel RFS, the generation of a large class of isoforms, and its biophysical characteristics among virally encoded putative transmembrane proteins (36, 38, 39, 188-191). Nsp2 is comprised of three domains including an N-terminal protease domain (PLP2), a large central hypervariable domain (HV) of unknown function, and a relatively well conserved C-terminal domain including a C-proximal hydrophobic region (putative transmembrane domain). The 1196aa nsp2 (NA VR-2332) is the largest protein encoded within the PRRSV genome; for reference, the second largest protein [the RdRp] is 685aa in length and 90% of the remaining proteins encoded within the PRRSV genome are 255aa or under (data not shown). Nsp2 is also the most genetically divergent coding region of the PRRSV genome, sharing as little as 32% aa sequence identity between strains (192). The majority of the mutation frequency noted within nsp2 occurs inside the large central HV region and includes a range of insertions, deletions, and nucleotide substitutions (188, 193-195). The driving selective pressure of nsp2 is unknown. It has been shown that large sections of the HV region of nsp2 are dispensable for replication in vitro (196) and in vivo (197). Due to the plasticity of the genome within this region it has been postulated that nsp2 may be an ideal location for the insertion of foreign epitope tags for the tracking and identification of PRRSV strains including vaccines (198-

201).

The PLP2 core protease domain (47-180aa; NA) possesses the canonical catalytic dyad C55 and H124 typical of papain-like proteases but differs in that a non-bulky glycine

(G) residue is located at position 56 whereas a tryptophan is typical at this position (202,

203). The PLP2 protease functions to cleave the nsp2↓nsp3 junction and possesses both cis- and trans-cleavage activities (202, 203). The PLP2 protease domain additionally displays deubiquitinating (DUB) accessory functionality (189). The arterivirus DUB activity functions to counteract ubiquitin (Ub) specific antiviral immune responses (191, 204). The arterivirus

DUB has been shown to be able to remove both Ub and Ub-like substrates (ISG15) (205) however the PRRSV DUB activity appears to be limited to Ub substrates in vitro (206).

Further, analysis of low and high pathogenicity PRRSV isolates showed different cleavage rates of both di-Ub and poly-Ub K-63 substrates (206). The arterivirus DUB enzyme was shown to knock-down type I IFN signaling nearly 10-fold, demonstrating the immunosuppressive activity of the PLP2 DUB (191).

The noted hydrophobic region of nsp2 is predicted to encode a multi-pass transmembrane domain. Nsp2, along with nsp3 and nsp5, comprise the putative replicase transmembrane proteins. Unlike nsp3 and nsp5, nsp2 possesses a large hydrophilic N- terminal domain (PLP2 and HV) that is known to participate in non-membrane viral replication functions including polyprotein processing and immunosubversive activities (191,

203). Recombinant expression of nsp2 and nsp3 of EAV were shown to be sufficient to modify host ER membranes into RC DMV-like structures (69). Additionally, nsp2 was shown to participate in polyprotein processing by the main SP, functioning as a molecular switch dictating between ‘major’ and ‘minor’ differential processing cascades of nsp5-8

(181). The functionally of the putative transmembrane domain of nsp2 remains unexplored; however, nsp2 is predicted to function in connection with nsp3 and nsp5 to tether the co- translational and post-translational processing of the large replicase polyproteins at the site of replication (DMVs) (69, 181).

In addition to alterative processing of the pp1a, nsp2 is also differentially expressed and modified at the translational and post-translational level (36, 190). As noted previously, encoded within the nsp2 gene is a unique -2 RFS site (36) that is expressed through an equally unusual protein transactivation mechanism (nsp1β; (38)). -2 RFS (16-20% efficiency) and -1 RFS (~7% efficiency) result in the expression of either nsp2-TF (36) or nsp2-N (38), respectively. The -1 RFS results in an immediate translation termination while the -2 RFS yields a translational extension within the -2 frame of 513nt (170aa). The function of these truncated nsp2 translational isoforms is currently unknown. The generation of post- translational (cleavage) isoforms has also been described for nsp2 (190). The mechanism of generation of these cleavage isoforms has not been defined and may include proteolytic cleavage by either cellular or viral proteases. The PLP2 protease preferentially cleaves GG dipeptides (202). GG residues are encoded within multiple regions within nsp2, three of these sites display ≥97% conservation (% pairwise identity) between 283 non-identical PRRSV genomes including NA and EU isolates (data not shown). At least six cleavage isoforms

(nsp2a-f) were originally identified, however, the genetic composition of these isoforms remains unknown (190).

A robust humoral immune response is generated against nsp2, similar to the magnitude of the response generated against the immunodominant N protein (207). Multiple

B-cell epitopes have been identified within the nsp2 coding region (208, 209). Deletion of these epitopes was not lethal for the virus but some of these deletion mutants displayed reduced growth kinetics and lower cytotoxicity profiles (210). Putative T-cell epitopes have also been defined within the nsp2 (188). A strong humoral immune response against nsp2 is somewhat surprising since it has no known extracellular function or localization, and the

38 response appears early in infection (211). Understanding the mechanism(s) contributing to recognition of nsp2, and further the impact of these immune responses on viral infection, may both help explain the high mutation rate of this region of the genome and additionally define molecular targets important to design of antiviral therapeutics.

REFERENCES

1. Duan X, Nauwynck HJ, Pensaert MB. 1997. Effects of origin and state of differentiation and activation of monocytes/macrophages on their susceptibility to porcine reproductive and respiratory syndrome virus (PRRSV). Archives of virology 142:2483-2497.

2. Morin M, Elazhary Y, Girard C. 1991. Porcine reproductive and respiratory syndrome in Quebec. The Veterinary record 129:252.

3. Wensvoort G, Terpstra C, Pol JM, ter Laak EA, Bloemraad M, de Kluyver EP, Kragten C, van Buiten L, den Besten A, Wagenaar F, et al. 1991. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Vet Q 13:121-130.

4. Baron T, Albina E, Leforban Y, Madec F, Guilmoto H, Plana Duran J, Vannier P. 1992. Report on the first outbreaks of the porcine reproductive and respiratory syndrome (PRRS) in France. Diagnosis and viral isolation. Annales de recherches veterinaires. Annals of veterinary research 23:161-166.

5. Collins JE, Benfield DA, Christianson WT, Harris L, Hennings JC, Shaw DP, Goyal SM, McCullough S, Morrison RB, Joo HS, et al. 1992. Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs. Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 4:117-126.

6. Hopper SA, White ME, Twiddy N. 1992. An outbreak of blue-eared pig disease (porcine reproductive and respiratory syndrome) in four pig herds in Great Britain. The Veterinary record 131:140-144.

7. Goyal SM. 1993. Porcine reproductive and respiratory syndrome. Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 5:656-664.

8. Benfield DA, Nelson E, Collins JE, Harris L, Goyal SM, Robison D, Christianson WT, Morrison RB, Gorcyca D, Chladek D. 1992. Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate ATCC VR-2332). Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 4:127-133.

9. Nelsen CJ, Murtaugh MP, Faaberg KS. 1999. Porcine reproductive and respiratory syndrome virus comparison: divergent evolution on two continents. Journal of virology 73:270-280.

10. Yoon SH, Kim H, Kim J, Lee HK, Park B, Kim H. 2013. Complete genome sequences of porcine reproductive and respiratory syndrome viruses: perspectives on their temporal and spatial dynamics. Molecular biology reports.

11. Forsberg R, Oleksiewicz MB, Petersen AM, Hein J, Botner A, Storgaard T. 2001. A molecular clock dates the common ancestor of European-type porcine reproductive and respiratory syndrome virus at more than 10 years before the emergence of disease. Virology 289:174-179.

12. Hanada K, Suzuki Y, Nakane T, Hirose O, Gojobori T. 2005. The origin and evolution of porcine reproductive and respiratory syndrome viruses. Mol Biol Evol 22:1024-1031.

13. Otake S, Dee SA, Moon RD, Rossow KD, Trincado C, Farnham M, Pijoan C. 2003. Survival of porcine reproductive and respiratory syndrome virus in houseflies. Can J Vet Res 67:198-203.

14. Otake S, Dee SA, Moon RD, Rossow KD, Trincado C, Pijoan C. 2003. Evaluation of mosquitoes, Aedes vexans, as biological vectors of porcine reproductive and respiratory syndrome virus. Can J Vet Res 67:265-270.

15. Schurrer JA, Dee SA, Moon RD, Murtaugh MP, Finnegan CP, Deen J, Kleiboeker SB, Pijoan CB. 2005. Retention of ingested porcine reproductive and respiratory syndrome virus in houseflies. Am J Vet Res 66:1517-1525.

16. Schurrer JA, Dee SA, Moon RD, Rossow KD, Mahlum C, Mondaca E, Otake S, Fano E, Collins JE, Pijoan C. 2004. Spatial dispersal of porcine reproductive and respiratory syndrome virus-contaminated flies after contact with experimentally infected pigs. Am J Vet Res 65:1284-1292.

17. Zimmerman JJ, Yoon KJ, Pirtle EC, Wills RW, Sanderson TJ, McGinley MJ. 1997. Studies of porcine reproductive and respiratory syndrome (PRRS) virus infection in avian species. Veterinary microbiology 55:329-336.

18. Murtaugh MP, Stadejek T, Abrahante JE, Lam TT, Leung FC. 2010. The ever- expanding diversity of porcine reproductive and respiratory syndrome virus. Virus research 154:18-30.

19. Meng XJ. 2012. Emerging and Re-emerging Swine Viruses. Transboundary and emerging diseases.

20. Goldberg TL, Lowe JF, Milburn SM, Firkins LD. 2003. Quasispecies variation of porcine reproductive and respiratory syndrome virus during natural infection. Virology 317:197-207.

21. Gauger PC, Faaberg KS, Guo B, Kappes MA, Opriessnig T. 2012. Genetic and phenotypic characterization of a 2006 United States porcine reproductive and respiratory virus isolate associated with high morbidity and mortality in the field. Virus research 163:98-107.

22. Han J, Wang Y, Faaberg KS. 2006. Complete genome analysis of RFLP 184 isolates of porcine reproductive and respiratory syndrome virus. Virus research 122:175-182.

23. Tian K, Yu X, Zhao T, Feng Y, Cao Z, Wang C, Hu Y, Chen X, Hu D, Tian X, Liu D, Zhang S, Deng X, Ding Y, Yang L, Zhang Y, Xiao H, Qiao M, Wang B, Hou L, Wang X, Yang X, Kang L, Sun M, Jin P, Wang S, Kitamura Y, Yan J, Gao GF. 2007. Emergence of fatal PRRSV variants: unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PloS one 2:e526.

24. Holtkamp D. 2011. Assessment of the Economic Impact of Porcine Reproductive and Respiratory Syndrome Virus on U.S. Pork Producers. Natonal Pork Board

25. Baker SC, Baric, R. S., Balasuriya, U.B., Brinton, M.A., Bonami, J.R., Crowley, J.A., de Groot, R.J., Enjuanes, L., Faaberg, K.S., Flegel, T.W., Gorbalenya, A.E., Holmes, K.V., Leung, F.C-C., Lightner, D.V., Nauwynck, H., Perlman, S., Poon, L., Rottier, P.J.M., Snijder, E.J., Stadejk, T., Talbot, P.J., Walker, R. M., Woo, P.C.Y., Yang, H., Yoo, D., Ziebuhr, J. 2012. Nidovirales, p. 785-834, Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier.

26. Gorbalenya AE, Enjuanes L, Ziebuhr J, Snijder EJ. 2006. Nidovirales: evolving the largest RNA virus genome. Virus research 117:17-37.

27. Lauber C, Ziebuhr J, Junglen S, Drosten C, Zirkel F, Nga PT, Morita K, Snijder EJ, Gorbalenya AE. 2012. Mesoniviridae: a proposed new family in the order Nidovirales formed by a single species of mosquito-borne viruses. Archives of virology.

28. Snijder EJ, Kikkert M, Fang Y. 2013. Arterivirus molecular biology and pathogenesis. The Journal of general virology 94:2141-2163.

29. Plagemann PG, Moennig V. 1992. Lactate dehydrogenase-elevating virus, equine arteritis virus, and simian hemorrhagic fever virus: a new group of positive-strand RNA viruses. Advances in virus research 41:99-192.

30. Lin YC, Chang RY, Chueh LL. 2002. Leader-body junction sequence of the viral subgenomic mRNAs of porcine reproductive and respiratory syndrome virus isolated in Taiwan. The Journal of veterinary medical science / the Japanese Society of Veterinary Science 64:961-965.

31. Oleksiewicz MB, Botner A, Nielsen J, Storgaard T. 1999. Determination of 5'- leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs. Archives of virology 144:981-987.

32. Gao F, Yao H, Lu J, Wei Z, Zheng H, Zhuang J, Tong G, Yuan S. 2013. Replacement of the heterologous 5' untranslated region allows preservation of the fully functional activities of type 2 porcine reproductive and respiratory syndrome virus. Virology 439:1-12.

33. Gao F, Lu J, Yao H, Wei Z, Yang Q, Yuan S. 2012. Cis-acting structural element in 5' UTR is essential for infectivity of porcine reproductive and respiratory syndrome virus. Virus research 163:108-119.

34. Lu J, Gao F, Wei Z, Liu P, Liu C, Zheng H, Li Y, Lin T, Yuan S. 2011. A 5'- proximal stem-loop structure of 5' untranslated region of porcine reproductive and respiratory syndrome virus genome is key for virus replication. Virology journal 8:172.

35. Choi YJ, Yun SI, Kang SY, Lee YM. 2006. Identification of 5' and 3' cis-acting elements of the porcine reproductive and respiratory syndrome virus: acquisition of novel 5' AU-rich sequences restored replication of a 5'-proximal 7-nucleotide deletion mutant. Journal of virology 80:723-736.

36. Fang Y, Treffers EE, Li Y, Tas A, Sun Z, van der Meer Y, de Ru AH, van Veelen PA, Atkins JF, Snijder EJ, Firth AE. 2012. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein. Proceedings of the National Academy of Sciences of the United States of America 109:E2920-2928.

37. Meulenberg JJ, Hulst MM, de Meijer EJ, Moonen PL, den Besten A, de Kluyver EP, Wensvoort G, Moormann RJ. 1993. Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 192:62-72.

38. Li Y, Treffers EE, Napthine S, Tas A, Zhu L, Sun Z, Bell S, Mark BL, van Veelen PA, van Hemert MJ, Firth AE, Brierley I, Snijder EJ, Fang Y. 2014. Transactivation of programmed ribosomal frameshifting by a viral protein. Proceedings of the National Academy of Sciences of the United States of America.

39. Fang Y, Snijder EJ. 2010. The PRRSV replicase: exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus research 154:61-76.

40. van Marle G, Dobbe JC, Gultyaev AP, Luytjes W, Spaan WJ, Snijder EJ. 1999. Arterivirus discontinuous mRNA transcription is guided by base pairing between sense and antisense transcription-regulating sequences. Proceedings of the National Academy of Sciences of the United States of America 96:12056-12061.

41. Das PB, Dinh PX, Ansari IH, de Lima M, Osorio FA, Pattnaik AK. 2010. The minor envelope glycoproteins GP2a and GP4 of porcine reproductive and respiratory syndrome virus interact with the receptor CD163. Journal of virology 84:1731-1740.

42. Johnson CR, Griggs TF, Gnanandarajah J, Murtaugh MP. 2011. Novel structural protein in porcine reproductive and respiratory syndrome virus encoded by an alternative ORF5 present in all arteriviruses. The Journal of general virology 92:1107-1116.

43. Robinson SR, Abrahante JE, Johnson CR, Murtaugh MP. 2013. Purifying selection in porcine reproductive and respiratory syndrome virus ORF5a protein influences variation in envelope glycoprotein 5 glycosylation. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases 20:362-368.

44. Mardassi H, Massie B, Dea S. 1996. Intracellular synthesis, processing, and transport of proteins encoded by ORFs 5 to 7 of porcine reproductive and respiratory syndrome virus. Virology 221:98-112.

45. Spilman MS, Welbon C, Nelson E, Dokland T. 2009. Cryo-electron tomography of porcine reproductive and respiratory syndrome virus: organization of the nucleocapsid. The Journal of general virology 90:527-535.

46. Wissink EH, Kroese MV, van Wijk HA, Rijsewijk FA, Meulenberg JJ, Rottier PJ. 2005. Envelope protein requirements for the assembly of infectious virions of porcine reproductive and respiratory syndrome virus. Journal of virology 79:12495- 12506.

47. Wootton SK, Yoo D. 2003. Homo-oligomerization of the porcine reproductive and respiratory syndrome virus nucleocapsid protein and the role of disulfide linkages. Journal of virology 77:4546-4557.

48. Doan DN, Dokland T. 2003. Structure of the nucleocapsid protein of porcine reproductive and respiratory syndrome virus. Structure 11:1445-1451.

49. Dea S, Gagnon CA, Mardassi H, Pirzadeh B, Rogan D. 2000. Current knowledge on the structural proteins of porcine reproductive and respiratory syndrome (PRRS) virus: comparison of the North American and European isolates. Archives of virology 145:659-688.

50. Loemba HD, Mounir S, Mardassi H, Archambault D, Dea S. 1996. Kinetics of humoral immune response to the major structural proteins of the porcine reproductive and respiratory syndrome virus. Archives of virology 141:751-761.

51. Bautista EM, Meulenberg JJ, Choi CS, Molitor TW. 1996. Structural polypeptides of the American (VR-2332) strain of porcine reproductive and respiratory syndrome virus. Archives of virology 141:1357-1365.

52. Sagripanti JL, Zandomeni RO, Weinmann R. 1986. The cap structure of simian hemorrhagic fever virion RNA. Virology 151:146-150.

53. Verheije MH, Olsthoorn RC, Kroese MV, Rottier PJ, Meulenberg JJ. 2002. Kissing interaction between 3' noncoding and coding sequences is essential for porcine arterivirus RNA replication. Journal of virology 76:1521-1526.

54. Tan C, Chang L, Shen S, Liu DX, Kwang J. 2001. Comparison of the 5' leader sequences of North American isolates of reference and field strains of porcine reproductive and respiratory syndrome virus (PRRSV). Virus genes 22:209-217.

55. Beura LK, Dinh PX, Osorio FA, Pattnaik AK. 2011. Cellular poly(c) binding proteins 1 and 2 interact with porcine reproductive and respiratory syndrome virus nonstructural protein 1beta and support viral replication. Journal of virology 85:12939-12949.

56. Liao CL, Lai MM. 1994. Requirement of the 5'-end genomic sequence as an upstream cis-acting element for coronavirus subgenomic mRNA transcription. Journal of virology 68:4727-4737.

57. Tahara SM, Dietlin TA, Bergmann CC, Nelson GW, Kyuwa S, Anthony RP, Stohlman SA. 1994. Coronavirus translational regulation: leader affects mRNA efficiency. Virology 202:621-630.

58. Zhang X, Liao CL, Lai MM. 1994. Coronavirus leader RNA regulates and initiates subgenomic mRNA transcription both in trans and in cis. Journal of virology 68:4738-4746.

59. Zuker M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic acids research 31:3406-3415.

60. Yin Y, Liu C, Liu P, Yao H, Wei Z, Lu J, Tong G, Gao F, Yuan S. 2013. Conserved nucleotides in the terminus of the 3' UTR region are important for the replication and infectivity of porcine reproductive and respiratory syndrome virus. Archives of virology 158:1719-1732.

61. Beerens N, Snijder EJ. 2007. An RNA pseudoknot in the 3' end of the arterivirus genome has a critical role in regulating viral RNA synthesis. Journal of virology 81:9426-9436.

62. Sun Z, Liu C, Tan F, Gao F, Liu P, Qin A, Yuan S. 2010. Identification of dispensable nucleotide sequence in 3' untranslated region of porcine reproductive and respiratory syndrome virus. Virus research 154:38-47.

63. van Hemert MJ, de Wilde AH, Gorbalenya AE, Snijder EJ. 2008. The in vitro RNA synthesizing activity of the isolated arterivirus replication/transcription complex is dependent on a host factor. The Journal of biological chemistry 283:16525-16536.

64. Meng XJ, Paul PS, Morozov I, Halbur PG. 1996. A nested set of six or seven subgenomic mRNAs is formed in cells infected with different isolates of porcine reproductive and respiratory syndrome virus. The Journal of general virology 77 ( Pt 6):1265-1270.

65. Pasternak AO, van den Born E, Spaan WJ, Snijder EJ. 2001. Sequence requirements for RNA strand transfer during nidovirus discontinuous subgenomic RNA synthesis. The EMBO journal 20:7220-7228.

66. Knoops K, Barcena M, Limpens RW, Koster AJ, Mommaas AM, Snijder EJ. 2012. Ultrastructural characterization of arterivirus replication structures: reshaping the endoplasmic reticulum to accommodate viral RNA synthesis. Journal of virology 86:2474-2487.

67. Pedersen KW, van der Meer Y, Roos N, Snijder EJ. 1999. Open reading frame 1a- encoded subunits of the arterivirus replicase induce endoplasmic reticulum-derived double-membrane vesicles which carry the viral replication complex. Journal of virology 73:2016-2026.

68. Molenkamp R, van Tol H, Rozier BC, van der Meer Y, Spaan WJ, Snijder EJ. 2000. The arterivirus replicase is the only viral protein required for genome replication and subgenomic mRNA transcription. The Journal of general virology 81:2491-2496.

69. Snijder EJ, van Tol H, Roos N, Pedersen KW. 2001. Non-structural proteins 2 and 3 interact to modify host cell membranes during the formation of the arterivirus replication complex. The Journal of general virology 82:985-994.

70. Cottam EM, Whelband MC, Wileman T. 2014. Coronavirus NSP6 restricts autophagosome expansion. Autophagy 10.

71. Sun MX, Huang L, Wang R, Yu YL, Li C, Li PP, Hu XC, Hao HP, Ishag HA, Mao X. 2012. Porcine reproductive and respiratory syndrome virus induces autophagy to promote virus replication. Autophagy 8:1434-1447.

72. Chen Q, Fang L, Wang D, Wang S, Li P, Li M, Luo R, Chen H, Xiao S. 2012. Induction of autophagy enhances porcine reproductive and respiratory syndrome virus replication. Virus research 163:650-655.

73. Razi M, Chan EY, Tooze SA. 2009. Early endosomes and endosomal coatomer are required for autophagy. The Journal of cell biology 185:305-321.

74. Wang L, Zhou L, Zhang H, Li Y, Ge X, Guo X, Yu K, Yang H. 2014. Interactome profile of the host cellular proteins and the nonstructural protein 2 of porcine reproductive and respiratory syndrome virus. PloS one 9:e99176.

75. Huo Y, Fan L, Yin S, Dong Y, Guo X, Yang H, Hu H. 2013. Involvement of unfolded protein response, p53 and Akt in modulation of porcine reproductive and respiratory syndrome virus-mediated JNK activation. Virology 444:233-240.

76. Yin S, Huo Y, Dong Y, Fan L, Yang H, Wang L, Ning Y, Hu H. 2012. Activation of c-Jun NH(2)-terminal kinase is required for porcine reproductive and respiratory syndrome virus-induced apoptosis but not for virus replication. Virus research 166:103-108.

77. Costers S, Lefebvre DJ, Delputte PL, Nauwynck HJ. 2008. Porcine reproductive and respiratory syndrome virus modulates apoptosis during replication in alveolar macrophages. Archives of virology 153:1453-1465.

78. Labarque G, Van Gucht S, Nauwynck H, Van Reeth K, Pensaert M. 2003. Apoptosis in the lungs of pigs infected with porcine reproductive and respiratory syndrome virus and associations with the production of apoptogenic cytokines. Veterinary research 34:249-260.

79. Breckenridge DG, Germain M, Mathai JP, Nguyen M, Shore GC. 2003. Regulation of apoptosis by endoplasmic reticulum pathways. Oncogene 22:8608- 8618.

80. Yu Z, Luo H, Fu W, Mattson MP. 1999. The endoplasmic reticulum stress- responsive protein GRP78 protects neurons against excitotoxicity and apoptosis: suppression of oxidative stress and stabilization of calcium homeostasis. Exp Neurol 155:302-314.

81. den Boon JA, Snijder EJ, Chirnside ED, de Vries AA, Horzinek MC, Spaan WJ. 1991. Equine arteritis virus is not a togavirus but belongs to the coronaviruslike superfamily. Journal of virology 65:2910-2920.

82. Ferrer-Orta C, Arias A, Escarmis C, Verdaguer N. 2006. A comparison of viral RNA-dependent RNA polymerases. Current opinion in structural biology 16:27-34.

83. Sabanadzovic S, Ghanem-Sabanadzovic NA, Gorbalenya AE. 2009. Permutation of the active site of putative RNA-dependent RNA polymerase in a newly identified species of plant alpha-like virus. Virology 394:1-7.

84. O'Reilly EK, Kao CC. 1998. Analysis of RNA-dependent RNA polymerase structure and function as guided by known polymerase structures and computer predictions of secondary structure. Virology 252:287-303.

85. Koonin EV. 1991. The phylogeny of RNA-dependent RNA polymerases of positive- strand RNA viruses. The Journal of general virology 72 ( Pt 9):2197-2206.

86. van Dinten LC, Rensen S, Gorbalenya AE, Snijder EJ. 1999. Proteolytic processing of the open reading frame 1b-encoded part of arterivirus replicase is

mediated by nsp4 serine protease and Is essential for virus replication. Journal of virology 73:2027-2037.

87. Zhou Y, Zheng H, Gao F, Tian D, Yuan S. 2011. Mutational analysis of the SDD sequence motif of a PRRSV RNA-dependent RNA polymerase. Science China. Life sciences 54:870-879.

88. Bautista EM, Faaberg KS, Mickelson D, McGruder ED. 2002. Functional properties of the predicted helicase of porcine reproductive and respiratory syndrome virus. Virology 298:258-270.

89. Deng Z, Lehmann KC, Li X, Feng C, Wang G, Zhang Q, Qi X, Yu L, Zhang X, Feng W, Wu W, Gong P, Tao Y, Posthuma CC, Snijder EJ, Gorbalenya AE, Chen Z. 2014. Structural basis for the regulatory function of a complex zinc-binding domain in a replicative arterivirus helicase resembling a nonsense-mediated mRNA decay helicase. Nucleic acids research 42:3464-3477.

90. van Dinten LC, van Tol H, Gorbalenya AE, Snijder EJ. 2000. The predicted metal-binding region of the arterivirus helicase protein is involved in subgenomic mRNA synthesis, genome replication, and virion biogenesis. Journal of virology 74:5213-5223.

91. van Marle G, van Dinten LC, Spaan WJ, Luytjes W, Snijder EJ. 1999. Characterization of an equine arteritis virus replicase mutant defective in subgenomic mRNA synthesis. Journal of virology 73:5274-5281.

92. Beerens N, Selisko B, Ricagno S, Imbert I, van der Zanden L, Snijder EJ, Canard B. 2007. De novo initiation of RNA synthesis by the arterivirus RNA- dependent RNA polymerase. Journal of virology 81:8384-8395.

93. Pasternak AO, Gultyaev AP, Spaan WJ, Snijder EJ. 2000. Genetic manipulation of arterivirus alternative mRNA leader-body junction sites reveals tight regulation of structural protein expression. Journal of virology 74:11642-11653.

94. Pasternak AO, Spaan WJ, Snijder EJ. 2004. Regulation of relative abundance of arterivirus subgenomic mRNAs. Journal of virology 78:8102-8113.

95. van Berlo MF, Horzinek MC, van der Zeijst BA. 1982. Equine arteritis virus- infected cells contain six polyadenylated virus-specific RNAs. Virology 118:345-352.

96. Pasternak AO, Spaan WJ, Snijder EJ. 2006. Nidovirus transcription: how to make sense...? The Journal of general virology 87:1403-1421.

97. Baker SC, Lai MM. 1990. An in vitro system for the leader-primed transcription of coronavirus mRNAs. The EMBO journal 9:4173-4179.

98. Baric RS, Stohlman SA, Lai MM. 1983. Characterization of replicative intermediate RNA of mouse hepatitis virus: presence of leader RNA sequences on nascent chains. Journal of virology 48:633-640.

99. Sawicki SG, Sawicki DL. 1995. Coronaviruses use discontinuous extension for synthesis of subgenome-length negative strands. Advances in experimental medicine and biology 380:499-506.

100. den Boon JA, Kleijnen MF, Spaan WJ, Snijder EJ. 1996. Equine arteritis virus subgenomic mRNA synthesis: analysis of leader-body junctions and replicative-form RNAs. Journal of virology 70:4291-4298.

101. Pasternak AO, van den Born E, Spaan WJ, Snijder EJ. 2003. The stability of the duplex between sense and antisense transcription-regulating sequences is a crucial factor in arterivirus subgenomic mRNA synthesis. Journal of virology 77:1175-1183.

102. Meulenberg JJ, de Meijer EJ, Moormann RJ. 1993. Subgenomic RNAs of Lelystad virus contain a conserved leader-body junction sequence. The Journal of general virology 74 ( Pt 8):1697-1701.

103. Faaberg KS, Elam MR, Nelsen CJ, Murtaugh MP. 1998. Subgenomic RNA7 is transcribed with different leader-body junction sites in PRRSV (strain VR2332) infection of CL2621 cells. Advances in experimental medicine and biology 440:275- 279.

104. Molenkamp R, Rozier BC, Greve S, Spaan WJ, Snijder EJ. 2000. Isolation and characterization of an arterivirus defective interfering RNA genome. Journal of virology 74:3156-3165.

105. Xiao CT, Liu ZH, Yu XL, Ge M, Li RC, Xiao BR, Zhou HR. 2011. Identification of new defective interfering RNA species associated with porcine reproductive and respiratory syndrome virus infection. Virus research 158:33-36.

106. Pattnaik AK, Ball LA, LeGrone AW, Wertz GW. 1992. Infectious defective interfering particles of VSV from transcripts of a cDNA clone. Cell 69:1011-1020.

107. Masters PS. 2006. The molecular biology of coronaviruses. Advances in virus research 66:193-292.

108. Yuan S, Murtaugh MP, Faaberg KS. 2000. Heteroclite subgenomic RNAs are produced in porcine reproductive and respiratory syndrome virus infection. Virology 275:158-169.

109. Yuan S, Murtaugh MP, Schumann FA, Mickelson D, Faaberg KS. 2004. Characterization of heteroclite subgenomic RNAs associated with PRRSV infection. Virus research 105:75-87.

110. Zhang C, Xue C, Li Y, Kong Q, Ren X, Li X, Shu D, Bi Y, Cao Y. 2010. Profiling of cellular proteins in porcine reproductive and respiratory syndrome virus virions by proteomics analysis. Virology journal 7:242.

111. Jourdan SS, Osorio FA, Hiscox JA. 2012. Biophysical characterisation of the nucleocapsid protein from a highly pathogenic porcine reproductive and respiratory syndrome virus strain. Biochemical and biophysical research communications 419:137-141.

112. Meulenberg JJ, Petersen-den Besten A, De Kluyver EP, Moormann RJ, Schaaper WM, Wensvoort G. 1995. Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology 206:155-163.

113. Lee C, Yoo D. 2006. The small envelope protein of porcine reproductive and respiratory syndrome virus possesses ion channel protein-like properties. Virology 355:30-43.

114. Kreutz LC, Ackermann MR. 1996. Porcine reproductive and respiratory syndrome virus enters cells through a low pH-dependent endocytic pathway. Virus research 42:137-147.

115. Flint SJ, Enquist LW, Racaniello VR, Skalka AM. 2004. Principles of virology : molecular biology, pathogenesis, and control of animal viruses, 2nd ed. ASM Press, Washington, D.C.

116. Conzelmann KK, Visser N, Van Woensel P, Thiel HJ. 1993. Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the arterivirus group. Virology 193:329-339.

117. Wu WH, Fang Y, Farwell R, Steffen-Bien M, Rowland RR, Christopher- Hennings J, Nelson EA. 2001. A 10-kDa structural protein of porcine reproductive and respiratory syndrome virus encoded by ORF2b. Virology 287:183-191.

118. Daginakatte GC, Kapil S. 2001. Mapping of the RNA-binding domain of the porcine reproductive and respiratory syndrome virus nucleocapsid protein. Advances in experimental medicine and biology 494:547-552.

119. Murtaugh MP, Xiao Z, Zuckermann F. 2002. Immunological responses of swine to porcine reproductive and respiratory syndrome virus infection. Viral immunology 15:533-547.

120. Dea S, Wilson L, Therrien D, Cornaglia E. 2000. Competitive ELISA for detection of antibodies to porcine reproductive and respiratory syndrome virus using recombinant E. coli-expressed nucleocapsid protein as antigen. Journal of virological methods 87:109-122.

121. Nelson EA, Christopher-Hennings J, Benfield DA. 1994. Serum immune responses to the proteins of porcine reproductive and respiratory syndrome (PRRS) virus.

Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 6:410-415.

122. Yoon KJ, Wu LL, Zimmerman JJ, Hill HT, Platt KB. 1996. Antibody-dependent enhancement (ADE) of porcine reproductive and respiratory syndrome virus (PRRSV) infection in pigs. Viral immunology 9:51-63.

123. Rowland RR, Kervin R, Kuckleburg C, Sperlich A, Benfield DA. 1999. The localization of porcine reproductive and respiratory syndrome virus nucleocapsid protein to the nucleolus of infected cells and identification of a potential nucleolar localization signal sequence. Virus research 64:1-12.

124. Lee C, Hodgins D, Calvert JG, Welch SK, Jolie R, Yoo D. 2006. Mutations within the nuclear localization signal of the porcine reproductive and respiratory syndrome virus nucleocapsid protein attenuate virus replication. Virology 346:238-250.

125. Yoo D, Wootton SK, Li G, Song C, Rowland RR. 2003. Colocalization and interaction of the porcine arterivirus nucleocapsid protein with the small nucleolar RNA-associated protein fibrillarin. Journal of virology 77:12173-12183.

126. Wang X, Bai J, Zhang L, Wang X, Li Y, Jiang P. 2012. Poly(A)-binding protein interacts with the nucleocapsid protein of porcine reproductive and respiratory syndrome virus and participates in viral replication. Antiviral research 96:315-323.

127. Thaa B, Sinhadri BC, Tielesch C, Krause E, Veit M. 2013. Signal peptide cleavage from GP5 of PRRSV: a minor fraction of molecules retains the decoy epitope, a presumed molecular cause for viral persistence. PloS one 8:e65548.

128. Ansari IH, Kwon B, Osorio FA, Pattnaik AK. 2006. Influence of N-linked glycosylation of porcine reproductive and respiratory syndrome virus GP5 on virus infectivity, antigenicity, and ability to induce neutralizing antibodies. Journal of virology 80:3994-4004.

129. Mateu E, Martin M, Vidal D. 2003. Genetic diversity and phylogenetic analysis of glycoprotein 5 of European-type porcine reproductive and respiratory virus strains in Spain. The Journal of general virology 84:529-534.

130. Faaberg KS, Plagemann PG. 1995. The envelope proteins of lactate dehydrogenase- elevating virus and their membrane topography. Virology 212:512-525.

131. Music N, Gagnon CA. 2010. The role of porcine reproductive and respiratory syndrome (PRRS) virus structural and non-structural proteins in virus pathogenesis. Animal health research reviews / Conference of Research Workers in Animal Diseases 11:135-163.

132. Delputte PL, Vanderheijden N, Nauwynck HJ, Pensaert MB. 2002. Involvement of the matrix protein in attachment of porcine reproductive and respiratory syndrome

virus to a heparinlike receptor on porcine alveolar macrophages. Journal of virology 76:4312-4320.

133. Delputte PL, Costers S, Nauwynck HJ. 2005. Analysis of porcine reproductive and respiratory syndrome virus attachment and internalization: distinctive roles for heparan sulphate and sialoadhesin. The Journal of general virology 86:1441-1445.

134. Pirzadeh B, Dea S. 1997. Monoclonal antibodies to the ORF5 product of porcine reproductive and respiratory syndrome virus define linear neutralizing determinants. The Journal of general virology 78 ( Pt 8):1867-1873.

135. Pirzadeh B, Dea S. 1998. Immune response in pigs vaccinated with plasmid DNA encoding ORF5 of porcine reproductive and respiratory syndrome virus. The Journal of general virology 79 ( Pt 5):989-999.

136. Wissink EH, van Wijk HA, Kroese MV, Weiland E, Meulenberg JJ, Rottier PJ, van Rijn PA. 2003. The major envelope protein, GP5, of a European porcine reproductive and respiratory syndrome virus contains a neutralization epitope in its N-terminal ectodomain. The Journal of general virology 84:1535-1543.

137. Faaberg KS, Hocker JD, Erdman MM, Harris DL, Nelson EA, Torremorell M, Plagemann PG. 2006. Neutralizing antibody responses of pigs infected with natural GP5 N-glycan mutants of porcine reproductive and respiratory syndrome virus. Viral immunology 19:294-304.

138. Li J, Murtaugh MP. 2012. Dissociation of porcine reproductive and respiratory syndrome virus neutralization from antibodies specific to major envelope protein surface epitopes. Virology 433:367-376.

139. Plagemann PG. 2006. Neutralizing antibody formation in swine infected with seven strains of porcine reproductive and respiratory syndrome virus as measured by indirect ELISA with peptides containing the GP5 neutralization epitope. Viral immunology 19:285-293.

140. Wei Z, Lin T, Sun L, Li Y, Wang X, Gao F, Liu R, Chen C, Tong G, Yuan S. 2012. N-linked glycosylation of GP5 of porcine reproductive and respiratory syndrome virus is critically important for virus replication in vivo. Journal of virology 86:9941-9951.

141. Wieringa R, De Vries AA, Post SM, Rottier PJ. 2003. Intra- and intermolecular disulfide bonds of the GP2b glycoprotein of equine arteritis virus: relevance for virus assembly and infectivity. Journal of virology 77:12996-13004.

142. Wissink EH, Kroese MV, Maneschijn-Bonsing JG, Meulenberg JJ, van Rijn PA, Rijsewijk FA, Rottier PJ. 2004. Significance of the oligosaccharides of the porcine reproductive and respiratory syndrome virus glycoproteins GP2a and GP5 for infectious virus production. The Journal of general virology 85:3715-3723.

143. de Lima M, Pattnaik AK, Flores EF, Osorio FA. 2006. Serologic marker candidates identified among B-cell linear epitopes of Nsp2 and structural proteins of a North American strain of porcine reproductive and respiratory syndrome virus. Virology 353:410-421.

144. Snijder EJ, van Tol H, Pedersen KW, Raamsman MJ, de Vries AA. 1999. Identification of a novel structural protein of arteriviruses. Journal of virology 73:6335-6345.

145. Wieringa R, de Vries AA, van der Meulen J, Godeke GJ, Onderwater JJ, van Tol H, Koerten HK, Mommaas AM, Snijder EJ, Rottier PJ. 2004. Structural protein requirements in equine arteritis virus assembly. Journal of virology 78:13019- 13027.

146. Gonin P, Mardassi H, Gagnon CA, Massie B, Dea S. 1998. A nonstructural and antigenic glycoprotein is encoded by ORF3 of the IAF-Klop strain of porcine reproductive and respiratory syndrome virus. Archives of virology 143:1927-1940.

147. Hedges JF, Balasuriya UB, MacLachlan NJ. 1999. The open reading frame 3 of equine arteritis virus encodes an immunogenic glycosylated, integral membrane protein. Virology 264:92-98.

148. Mardassi H, Gonin P, Gagnon CA, Massie B, Dea S. 1998. A subset of porcine reproductive and respiratory syndrome virus GP3 glycoprotein is released into the culture medium of cells as a non-virion-associated and membrane-free (soluble) form. Journal of virology 72:6298-6306.

149. de Lima M, Ansari IH, Das PB, Ku BJ, Martinez-Lobo FJ, Pattnaik AK, Osorio FA. 2009. GP3 is a structural component of the PRRSV type II (US) virion. Virology 390:31-36.

150. Meulenberg JJ, van Nieuwstadt AP, van Essen-Zandbergen A, Langeveld JP. 1997. Posttranslational processing and identification of a neutralization domain of the GP4 protein encoded by ORF4 of Lelystad virus. Journal of virology 71:6061-6067.

151. Vanhee M, Costers S, Van Breedam W, Geldhof MF, Van Doorsselaere J, Nauwynck HJ. 2010. A variable region in GP4 of European-type porcine reproductive and respiratory syndrome virus induces neutralizing antibodies against homologous but not heterologous virus strains. Viral immunology 23:403-413.

152. Costers S, Lefebvre DJ, Van Doorsselaere J, Vanhee M, Delputte PL, Nauwynck HJ. 2010. GP4 of porcine reproductive and respiratory syndrome virus contains a neutralizing epitope that is susceptible to immunoselection in vitro. Archives of virology 155:371-378.

153. Costers S, Vanhee M, Van Breedam W, Van Doorsselaere J, Geldhof M, Nauwynck HJ. 2010. GP4-specific neutralizing antibodies might be a driving force in PRRSV evolution. Virus research 154:104-113.

154. Weiland E, Wieczorek-Krohmer M, Kohl D, Conzelmann KK, Weiland F. 1999. Monoclonal antibodies to the GP5 of porcine reproductive and respiratory syndrome virus are more effective in virus neutralization than monoclonal antibodies to the GP4. Veterinary microbiology 66:171-186.

155. Du Y, Pattnaik AK, Song C, Yoo D, Li G. 2012. Glycosyl-phosphatidylinositol (GPI)-anchored membrane association of the porcine reproductive and respiratory syndrome virus GP4 glycoprotein and its co-localization with CD163 in lipid rafts. Virology 424:18-32.

156. Calvert JG, Slade DE, Shields SL, Jolie R, Mannan RM, Ankenbauer RG, Welch SK. 2007. CD163 expression confers susceptibility to porcine reproductive and respiratory syndrome viruses. Journal of virology 81:7371-7379.

157. Fabriek BO, Dijkstra CD, van den Berg TK. 2005. The macrophage scavenger receptor CD163. Immunobiology 210:153-160.

158. Buechler C, Ritter M, Orso E, Langmann T, Klucken J, Schmitz G. 2000. Regulation of scavenger receptor CD163 expression in human monocytes and macrophages by pro- and antiinflammatory stimuli. J Leukoc Biol 67:97-103.

159. Graversen JH, Madsen M, Moestrup SK. 2002. CD163: a signal receptor scavenging haptoglobin-hemoglobin complexes from plasma. Int J Biochem Cell Biol 34:309-314.

160. Tian D, Wei Z, Zevenhoven-Dobbe JC, Liu R, Tong G, Snijder EJ, Yuan S. 2012. Arterivirus minor envelope proteins are a major determinant of viral tropism in cell culture. Journal of virology 86:3701-3712.

161. Nauwynck HJ, Duan X, Favoreel HW, Van Oostveldt P, Pensaert MB. 1999. Entry of porcine reproductive and respiratory syndrome virus into porcine alveolar macrophages via receptor-mediated endocytosis. The Journal of general virology 80 ( Pt 2):297-305.

162. Wang L, Zhang H, Suo X, Zheng S, Feng WH. 2011. Increase of CD163 but not sialoadhesin on cultured peripheral blood monocytes is coordinated with enhanced susceptibility to porcine reproductive and respiratory syndrome virus infection. Veterinary immunology and immunopathology 141:209-220.

163. den Boon JA, Faaberg KS, Meulenberg JJ, Wassenaar AL, Plagemann PG, Gorbalenya AE, Snijder EJ. 1995. Processing and evolution of the N-terminal region of the arterivirus replicase ORF1a protein: identification of two papainlike cysteine proteases. Journal of virology 69:4500-4505.

164. Sfondrini G, Schiavi A, Lalli A, Ravelli A, Martini A. 1991. [TMJ in subjects with juvenile rheumatoid arthritis: functional and cephalometric analysis]. Mondo ortodontico 16:287-297.

165. Drenth J, Jansonius JN, Koekoek R, Swen HM, Wolthers BG. 1968. Structure of papain. Nature 218:929-932.

166. Kroese MV, Zevenhoven-Dobbe JC, Bos-de Ruijter JN, Peeters BP, Meulenberg JJ, Cornelissen LA, Snijder EJ. 2008. The nsp1alpha and nsp1 papain-like autoproteinases are essential for porcine reproductive and respiratory syndrome virus RNA synthesis. The Journal of general virology 89:494-499.

167. Sun Y, Xue F, Guo Y, Ma M, Hao N, Zhang XC, Lou Z, Li X, Rao Z. 2009. Crystal structure of porcine reproductive and respiratory syndrome virus leader protease Nsp1alpha. Journal of virology 83:10931-10940.

168. Tijms MA, van Dinten LC, Gorbalenya AE, Snijder EJ. 2001. A zinc finger- containing papain-like protease couples subgenomic mRNA synthesis to genome translation in a positive-stranded RNA virus. Proceedings of the National Academy of Sciences of the United States of America 98:1889-1894.

169. Beura LK, Sarkar SN, Kwon B, Subramaniam S, Jones C, Pattnaik AK, Osorio FA. 2010. Porcine reproductive and respiratory syndrome virus nonstructural protein 1beta modulates host innate immune response by antagonizing IRF3 activation. Journal of virology 84:1574-1584.

170. Song C, Krell P, Yoo D. 2010. Nonstructural protein 1alpha subunit-based inhibition of NF-kappaB activation and suppression of interferon-beta production by porcine reproductive and respiratory syndrome virus. Virology 407:268-280.

171. Kim O, Sun Y, Lai FW, Song C, Yoo D. 2010. Modulation of type I interferon induction by porcine reproductive and respiratory syndrome virus and degradation of CREB-binding protein by non-structural protein 1 in MARC-145 and HeLa cells. Virology 402:315-326.

172. Chen Z, Lawson S, Sun Z, Zhou X, Guan X, Christopher-Hennings J, Nelson EA, Fang Y. 2010. Identification of two auto-cleavage products of nonstructural protein 1 (nsp1) in porcine reproductive and respiratory syndrome virus infected cells: nsp1 function as interferon antagonist. Virology 398:87-97.

173. Han M, Kim CY, Rowland RR, Fang Y, Kim D, Yoo D. 2014. Biogenesis of nonstructural protein 1 (nsp1) and nsp1-mediated type I interferon modulation in arteriviruses. Virology 458-459C:136-150.

174. Shi X, Zhang X, Wang F, Wang L, Qiao S, Guo J, Luo C, Wan B, Deng R, Zhang G. 2013. The zinc-finger domain was essential for porcine reproductive and respiratory syndrome virus nonstructural protein-1alpha to inhibit the production of interferon-beta. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research 33:328-334.

175. Shi X, Zhang G, Wang L, Li X, Zhi Y, Wang F, Fan J, Deng R. 2011. The nonstructural protein 1 papain-like cysteine protease was necessary for porcine

reproductive and respiratory syndrome virus nonstructural protein 1 to inhibit interferon-beta induction. DNA Cell Biol 30:355-362.

176. Li Y, Zhu L, Lawson SR, Fang Y. 2013. Targeted mutations in a highly conserved motif of the nsp1beta protein impair the interferon antagonizing activity of porcine reproductive and respiratory syndrome virus. The Journal of general virology 94:1972-1983.

177. van der Meer Y, van Tol H, Locker JK, Snijder EJ. 1998. ORF1a-encoded replicase subunits are involved in the membrane association of the arterivirus replication complex. Journal of virology 72:6689-6698.

178. Posthuma CC, Pedersen KW, Lu Z, Joosten RG, Roos N, Zevenhoven-Dobbe JC, Snijder EJ. 2008. Formation of the arterivirus replication/transcription complex: a key role for nonstructural protein 3 in the remodeling of intracellular membranes. Journal of virology 82:4480-4491.

179. Tian X, Lu G, Gao F, Peng H, Feng Y, Ma G, Bartlam M, Tian K, Yan J, Hilgenfeld R, Gao GF. 2009. Structure and cleavage specificity of the chymotrypsin- like serine protease (3CLSP/nsp4) of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). Journal of molecular biology 392:977-993.

180. van Aken D, Snijder EJ, Gorbalenya AE. 2006. Mutagenesis analysis of the nsp4 main proteinase reveals determinants of arterivirus replicase polyprotein autoprocessing. Journal of virology 80:3428-3437.

181. Wassenaar AL, Spaan WJ, Gorbalenya AE, Snijder EJ. 1997. Alternative proteolytic processing of the arterivirus replicase ORF1a polyprotein: evidence that NSP2 acts as a cofactor for the NSP4 serine protease. Journal of virology 71:9313- 9322.

182. Li Y, Tas A, Snijder EJ, Fang Y. 2012. Identification of porcine reproductive and respiratory syndrome virus ORF1a-encoded non-structural proteins in virus-infected cells. The Journal of general virology 93:829-839.

183. Manolaridis I, Gaudin C, Posthuma CC, Zevenhoven-Dobbe JC, Imbert I, Canard B, Kelly G, Tucker PA, Conte MR, Snijder EJ. 2011. Structure and genetic analysis of the arterivirus nonstructural protein 7alpha. Journal of virology 85:7449-7453.

184. Zhang M, Cao Z, Xie J, Zhu W, Zhou P, Gu H, Sun L, Su S, Zhang G. 2013. Mutagenesis analysis of porcine reproductive and respiratory syndrome virus nonstructural protein 7. Virus genes 47:467-477.

185. Ivanov KA, Hertzig T, Rozanov M, Bayer S, Thiel V, Gorbalenya AE, Ziebuhr J. 2004. Major genetic marker of nidoviruses encodes a replicative endoribonuclease. Proceedings of the National Academy of Sciences of the United States of America 101:12694-12699.

186. Laneve P, Altieri F, Fiori ME, Scaloni A, Bozzoni I, Caffarelli E. 2003. Purification, cloning, and characterization of XendoU, a novel endoribonuclease involved in processing of intron-encoded small nucleolar RNAs in Xenopus laevis. The Journal of biological chemistry 278:13026-13032.

187. Nedialkova DD, Ulferts R, van den Born E, Lauber C, Gorbalenya AE, Ziebuhr J, Snijder EJ. 2009. Biochemical characterization of arterivirus nonstructural protein 11 reveals the nidovirus-wide conservation of a replicative endoribonuclease. Journal of virology 83:5671-5682.

188. Fang Y, Kim DY, Ropp S, Steen P, Christopher-Hennings J, Nelson EA, Rowland RR. 2004. Heterogeneity in Nsp2 of European-like porcine reproductive and respiratory syndrome viruses isolated in the United States. Virus research 100:229-235.

189. Frias-Staheli N, Giannakopoulos NV, Kikkert M, Taylor SL, Bridgen A, Paragas J, Richt JA, Rowland RR, Schmaljohn CS, Lenschow DJ, Snijder EJ, Garcia- Sastre A, Virgin HWt. 2007. Ovarian tumor domain-containing viral proteases evade ubiquitin- and ISG15-dependent innate immune responses. Cell host & microbe 2:404-416.

190. Han J, Rutherford MS, Faaberg KS. 2010. Proteolytic products of the porcine reproductive and respiratory syndrome virus nsp2 replicase protein. Journal of virology 84:10102-10112.

191. van Kasteren PB, Bailey-Elkin BA, James TW, Ninaber DK, Beugeling C, Khajehpour M, Snijder EJ, Mark BL, Kikkert M. 2013. Deubiquitinase function of arterivirus papain-like protease 2 suppresses the innate immune response in infected host cells. Proceedings of the National Academy of Sciences of the United States of America 110:E838-847.

192. Allende R, Lewis TL, Lu Z, Rock DL, Kutish GF, Ali A, Doster AR, Osorio FA. 1999. North American and European porcine reproductive and respiratory syndrome viruses differ in non-structural protein coding regions. The Journal of general virology 80 ( Pt 2):307-315.

193. Yoshii M, Okinaga T, Miyazaki A, Kato K, Ikeda H, Tsunemitsu H. 2008. Genetic polymorphism of the nsp2 gene in North American type--porcine reproductive and respiratory syndrome virus. Archives of virology 153:1323-1334.

194. Meng XJ. 2000. Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Veterinary microbiology 74:309-329.

195. Shen S, Kwang J, Liu W, Liu DX. 2000. Determination of the complete nucleotide sequence of a vaccine strain of porcine reproductive and respiratory syndrome virus and identification of the Nsp2 gene with a unique insertion. Archives of virology 145:871-883.

196. Han J, Liu G, Wang Y, Faaberg KS. 2007. Identification of nonessential regions of the nsp2 replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for replication in cell culture. Journal of virology 81:9878-9890.

197. Faaberg KS, Kehrli ME, Jr., Lager KM, Guo B, Han J. 2010. In vivo growth of porcine reproductive and respiratory syndrome virus engineered nsp2 deletion mutants. Virus research 154:77-85.

198. Fang Y, Christopher-Hennings J, Brown E, Liu H, Chen Z, Lawson SR, Breen R, Clement T, Gao X, Bao J, Knudsen D, Daly R, Nelson E. 2008. Development of genetic markers in the non-structural protein 2 region of a US type 1 porcine reproductive and respiratory syndrome virus: implications for future recombinant marker vaccine development. The Journal of general virology 89:3086-3096.

199. Kim DY, Calvert JG, Chang KO, Horlen K, Kerrigan M, Rowland RR. 2007. Expression and stability of foreign tags inserted into nsp2 of porcine reproductive and respiratory syndrome virus (PRRSV). Virus research 128:106-114.

200. Kim DY, Kaiser TJ, Horlen K, Keith ML, Taylor LP, Jolie R, Calvert JG, Rowland RR. 2009. Insertion and deletion in a non-essential region of the nonstructural protein 2 (nsp2) of porcine reproductive and respiratory syndrome (PRRS) virus: effects on virulence and immunogenicity. Virus genes 38:118-128.

201. Xu YZ, Zhou YJ, Zhang SR, Jiang YF, Tong W, Yu H, Tong GZ. 2012. Stable expression of foreign gene in nonessential region of nonstructural protein 2 (nsp2) of porcine reproductive and respiratory syndrome virus: applications for marker vaccine design. Veterinary microbiology 159:1-10.

202. Han J, Rutherford MS, Faaberg KS. 2009. Porcine Reproductive and Respiratory Syndrome Virus Nsp2 Cysteine Protease Domain Possesses Both Trans- and Cis- cleavage Activities. Journal of virology.

203. Snijder EJ, Wassenaar AL, Spaan WJ, Gorbalenya AE. 1995. The arterivirus Nsp2 protease. An unusual cysteine protease with primary structure similarities to both papain-like and chymotrypsin-like proteases. The Journal of biological chemistry 270:16671-16676.

204. van Kasteren PB, Beugeling C, Ninaber DK, Frias-Staheli N, van Boheemen S, Garcia-Sastre A, Snijder EJ, Kikkert M. 2012. Arterivirus and nairovirus ovarian tumor domain-containing Deubiquitinases target activated RIG-I to control innate immune signaling. Journal of virology 86:773-785.

205. James TW, Frias-Staheli N, Bacik JP, Levingston Macleod JM, Khajehpour M, Garcia-Sastre A, Mark BL. 2011. Structural basis for the removal of ubiquitin and interferon-stimulated gene 15 by a viral ovarian tumor domain-containing protease. Proceedings of the National Academy of Sciences of the United States of America 108:2222-2227.

206. Deaton MK, Spear A, Faaberg KS, Pegan SD. 2014. The vOTU domain of highly- pathogenic porcine reproductive and respiratory syndrome virus displays a differential substrate preference. Virology 454-455:247-253.

207. Brown E, Lawson S, Welbon C, Gnanandarajah J, Li J, Murtaugh MP, Nelson EA, Molina RM, Zimmerman JJ, Rowland RR, Fang Y. 2009. Antibody response to porcine reproductive and respiratory syndrome virus (PRRSV) nonstructural proteins and implications for diagnostic detection and differentiation of PRRSV types I and II. Clinical and vaccine immunology : CVI 16:628-635.

208. Oleksiewicz MB, Botner A, Toft P, Normann P, Storgaard T. 2001. Epitope mapping porcine reproductive and respiratory syndrome virus by phage display: the nsp2 fragment of the replicase polyprotein contains a cluster of B-cell epitopes. Journal of virology 75:3277-3290.

209. Yan Y, Guo X, Ge X, Chen Y, Cha Z, Yang H. 2007. Monoclonal antibody and porcine antisera recognized B-cell epitopes of Nsp2 protein of a Chinese strain of porcine reproductive and respiratory syndrome virus. Virus research 126:207-215.

210. Chen Z, Zhou X, Lunney JK, Lawson S, Sun Z, Brown E, Christopher-Hennings J, Knudsen D, Nelson E, Fang Y. 2010. Immunodominant epitopes in nsp2 of porcine reproductive and respiratory syndrome virus are dispensable for replication, but play an important role in modulation of the host immune response. The Journal of general virology 91:1047-1057.

211. Wang FX, Song N, Chen LZ, Cheng SP, Wu H, Wen YJ. 2013. Non-structural protein 2 of the porcine reproductive and respiratory syndrome (PRRS) virus: A crucial protein in viral pathogenesis, immunity and diagnosis. Research in veterinary science.

CHAPTER 3. HIGHLY DIVERGENT STRAINS OF PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS INCORPERATE MULTIPLE ISOFORMS OF NONSTRUCTURAL PROTEIN 2 INTO VIRIONS

Published within the Journal of Virology

Matthew A. Kappes1,2, Cathy L. Miller2, Kay S. Faaberg1

1Virus and Prion Research Unit, USDA-ARS-National Animal Disease Center, Ames, Iowa, USA; 2Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, Ames, Iowa, USA

ABSTRACT

Viral structural proteins form the critical intermediary between viral infection cycles within and between hosts, function to initiate entry, participate in immediate early viral replication steps, and are major targets for the host adaptive immune response. We report the identification of nonstructural protein 2 (nsp2) as a novel structural component of the porcine reproductive and respiratory syndrome virus (PRRSV) particle. A set of custom α-nsp2 antibodies targeting conserved epitopes within four distinct regions of nsp2 (the PLP2 protease domain [OTU], the hypervariable domain [HV], the putative transmembrane domain [TM], and the C-terminal region [C]) were obtained commercially and validated in PRRSV- infected cells. Highly purified cell-free virions of several PRRSV strains were isolated through multiple rounds of differential density gradient centrifugation and analyzed by immunoelectron microscopy (IEM) and western blot assays using the α-nsp2 antibodies. Purified viral preparations were found to contain pleomorphic, predominantly spherical virions of uniform size (57.9 nm ± 8.1 nm diameter; n =50), consistent with the expected size of PRRSV particles. Analysis by IEM indicated the presence of nsp2 associated with the viral particle of diverse strains of PRRSV. Western blot analysis confirmed the presence of nsp2 in purified viral samples and revealed that multiple nsp2 isoforms were associated with the virion. Finally, a recombinant PRRSV genome containing a myc-tagged nsp2 was used to generate purified virus, and these particles were also shown to harbor myc-tagged nsp2

60 isoforms. Together, these data identify nsp2 as a virion-associated structural PRRSV protein and reveal that nsp2 exists in or on viral particles as multiple isoforms.

INTRODUCTION

Porcine reproductive and respiratory syndrome virus (PRRSV) is the cause of a complex systemic disease of swine, most notably affecting the respiratory and reproductive systems of infected hosts. PRRS is characterized by an acute viral infection of the porcine macrophage that leads to an immunologically altered state. In extreme cases, respiratory distress, metabolic dysregulation, and neuronal involvement result in significant mortality within days to weeks of experimental inoculation with highly pathogenic isolates (1, 2).

Endemic disease from emerging and reemerging PRRSV results in estimated annual economic losses totaling greater than 560 million dollars, or $1.5 million per day, to the US economy alone (3, 4).

A key hurdle to PRRSV investigation has been the difficulty in ascribing conserved functional characteristics to virally encoded nonstructural proteins. This hurdle is largely rooted in the significant genetic heterogeneity noted among strains, genotypes, and viral species of the family Arteriviridae and, more broadly, the order Nidovirales that also encompasses Coronaviridae and Roniviridae. Through the combined effects of a highly error prone viral RNA dependent RNA polymerase (RdRp) and a significant rate of genetic recombination, the evolution rate of PRRSV (4.71-9.8 X 10-2 synonymous substitution rate/site/year) is estimated to be nearly 10-fold higher than those of human immunodeficiency virus (HIV) or influenza virus (5-9). The narrative of the last two decades

61 of PRRSV investigation has demonstrated the robust nature of PRRSV to undergo extraordinary genetic change while maintaining pathogenicity.

A significant fraction of attenuating and naturally occurring mutations have been observed within the region of the replicase nonstructural protein 2 (nsp2) (10-12). Nsp2 is encoded by 21-23% of the genome and consists of a papain-like protease domain (PLP2) near the amino terminus that has been shown to be a member of the ovarian tumor domain protease (OTU) family (13-16). The nsp2 PLP2/OTU region is followed by an extended central hypervariable (HV) region with strain-specific insertions or deletions, a putative transmembrane region (TM) that is predicted to encode up to five membrane-spanning regions, and a relatively conserved carboxyl (C-terminal) domain. Previous reports suggest a multifunctional role of nsp2 in critical replication and immune evasion functions (14-20).

Nsp2 is both the largest and most genetically diverse protein encoded within the PRRSV genome. The elevated frequency of mutation and recombination within the nsp2 coding region suggests there is significant selective pressure(s) placed against nsp2 genetic or protein content (17, 21, 22). Interestingly, whereas current data only support an intracellular role for nsp2 (19, 23-26), a strong antibody response is generated against nsp2 during the course of natural infection (27). Nsp2 is recognized as an immunodominant target of the adaptive immune response resulting in significant anti (α)-nsp2 titers comparable to the response generated against the highly abundant/highly immunogenic nucleocapsid protein

(N) (27, 28). Moreover, various B-cell and T-cell epitopes have been bioinformatically or experimentally defined within the nsp2 coding region (21, 29, 30). These attributes suggest nsp2 might also maintain an extracellular localization or function during the viral replication cycle. Similarly, recent findings have described the incorporation of a PRRSV nsp2

62 orthologue, nsp3, into to the virion of the related Coronaviridae including severe acute respiratory syndrome virus (SARS) and transmissible gastroenteritis coronavirus (TGEV)

(31, 32). In this report, we investigated the association of PRRSV nsp2 with the virion and provided evidence that nsp2 is a novel structural protein of the PRRSV particle. This finding was conserved across a range of five genetically diverse PRRSV strains including the

European (Type 1) and North American (Type 2) prototype strains Lelystad (33) and VR-

2332 (34, 35), respectively, a disparate Type 2 strain MN184 (12), as well as the Asian highly pathogenic PRRSV (HP-PRRSV) strains rJXwn06 (2) and rSRV07 (36) (Table 3.1).

The presence of nsp2 in/on virions indicates a plausible immediate-early function of this protein within the viral life cycle and importantly, virion-associated extracellular localization may also contribute to the high selective pressure driving nsp2 genetic diversity.

MATERIALS AND METHODS

Antibodies. Custom affinity purified polyclonal antibodies (rabbit) to PRRSV nsp2 included

α-nsp2-OTU (OTU domain; epitope SKFETTLPERVRPP), α-nsp2-HV (hypervariable region; epitope TRPKYSAQAIIDSG), α-nsp2-TM (transmembrane region; epitope

SDPVGTACEFDSPE), and α-nsp2-C (C-terminal region; epitope NGLKIRQISKPSGG)

(GenScript, Piscataway, NJ). Prior to western blot probing, α-nsp2 antibodies were cross- absorbed with uninfected MARC-145 cell lysate for ≥1 hour at 37°C to eliminate potential cross-reactivity with cellular products. Epitope sites were chosen based on predicted antigenicity [proprietary algorithm, Genscript, Piscataway, NJ], sequence conservation in the five study strains, and epitope location within the nsp2 coding region.

Immunofluorescence analysis. MARC-145 cells were seeded at a density of ~5 X 104 cells/cm2 and allowed to incubate for 2-3 days prior to infection in 1X minimum essential medium (MEM; SAFC Biosciences, Lenexa, KS) supplemented with 2.2% w/v sodium bicarbonate, 11% w/v sodium pyruvate (Life Technologies, Carlsbad, CA) and 10% fetal bovine serum [bovine viral diarrhea virus-free] (FBS; PAA Laboratories, GE Healthcare Bio-

Sciences Corp, Piscataway, NJ). Monolayers were inoculated with passage 5 of VR-2332 at an M.O.I. of 0.1 and the infections were allowed to progress for 48 hours. At 48 hours post infection (h.p.i.), supernatants were removed and the monolayers were washed in phosphate buffered saline (10 mM Na2HPO4/KH2PO4, 137 mM NaCl, pH 7.4; PBS) prior to fixation with a 4% solution of paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) in

PBS, followed by permeabilization with a 0.2% solution of Triton-X 100 (Sigma-Aldrich, St.

Louis, MO) in PBS. Fixed and permeabilized monolayers were analyzed by indirect immunofluorescence using the primary antibodies α-nsp2-OTU (1:100), α-nsp2-HV (1:100),

α-nsp2-TM (1:50), and α-nsp2-C (1:50), or α-N SDOW-17-A (mouse) 1:50 (Rural

Technologies Incorporated, Brookings, SD) followed by detection with the secondary Alexa

Fluor® 546 goat α-rabbit IgG (H+L) (Invitrogen, Carlsbad, CA) [at a final concentration of

80µg/ml (1:25 dilution in PBS)] and FITC conjugated α-mouse IgG (Sigma-Aldrich, St.

Louis, MO) (1:12.5 dilution in PBS). Images were acquired with the Leica DM IRBE microscope in connection with the Leica DFC500 digital camera and the Leica Application

Suite (v3.7.0) at magnifications between 200X and 400X.

Virus purification. For the generation of purified viral stocks used in this study, low passage

(≤15 passages) MARC-145 cells were seeded at a density of ~5.0 X 104 cell/cm2 and allowed to incubate for three days in 1X MEM prior to inoculation. Low passage viral stocks (passage

5 or below) of field isolates VR-2332 (U87392), recombinant (r) rJXwn06 (EF641008), rSRV07 (JX512910), MN184C (EF488739), Lelystad virus (M96262), and a rVR-2332 strain (rV7) encoding a myc-tag in the hypervariable region of nsp2 (rV7-myc) (FJ524377)

Table 3.1. Description of study strains

Strain Description Lelystad European (Type 1) prototype strain (1991) VR-2332 North American (Type 2) prototype strain (1989) rV7-myc Recombinant VR-2332 expressing a 3X c-myc epitope tag within nsp2 MN184C Regional North American isolate (2001) rJXwn06 Chinese Highly Pathogenic PRRSV isolate (2006) rSRV07 Vietnamese Highly Pathogenic PRRSV isolate (2007)

(37) were used to infect confluent MARC-145 monolayers (2500 cm2 per isolate) at a multiplicity of infection (M.O.I.) of 0.1 and maintained at 37°C and 5% CO2 until 60-80% cytopathic effect (CPE) was reached (roughly two days). Please refer to previous publication for analysis of the growth kinetics for each study strain (36, 38, 39). Cell supernatants were collected and clarified at 5,000 x g, 4°C, for 1 hour to remove non-adherent cells and large cellular debris prior to downstream purification of cell-free virions. The resulting clarified viral supernatants were pelleted through a sterile 0.5 M sucrose in TNE buffer (10mM Tris-

HCL (pH7.0), 0.1M NaCl, 1mM EDTA) cushion at 104,000 x g for 3-4 hours at 4°C to selectively exclude the pelleting of viral and cellular components < 1g/ml density. Viral pellets were gently reconstituted in low volumes of TNE buffer prior to overlaying on top of

1.29g/ml density cesium chloride (CsCl) (optical grade; Life Technologies, Carlsbad, CA) in

TNE buffer and subjected to banding at 151,000 x g for 12-24hr at 4°C. Viral bands were collected by side tapping with a sterile needle followed by a second round purification

65 through CsCl gradient banding (2X CsCl). 2X CsCl purified virus was diluted 10-fold in

TNE buffer and pelleted at 151,000 x g for 2hr at 4°C. Final purified viral pellets were eluted in low volumes TNE buffer in 10% protease inhibitor cocktail (P8340, Sigma-Aldrich, St.

Louis, MO) and subjected to downstream analysis by immunoelectron microscopy and western blotting. Alternatively, after the initial pelleting step through the 0.5M sucrose cushion, viral and mock isolates were purified by semi-discontinuous sucrose gradients generated as previously described (40). Since a viral band was not visible by sucrose purification, final samples were collected by side-tapping the sucrose gradients and collecting density ranges between the 20% and 30% sucrose + TNE, estimated to contain the density range of the PRRSV virion (1.18-1.19g/mL, (35)).

Immunoelectron microscopy. To prepare purified samples for immunoelectron microscopy, a small volume of each purified PRRSV preparation (5-10µL) was chemically cross-linked using electron microscopy grade paraformaldehyde (PFA) at a final concentration of 4% for

5 min at room temperature (Electron Microscopy Sciences, Hatfield, PA) to maintain the integrity of the virion during processing. Fixed samples were loaded onto Nickel Formvar support grids (Electron Microscopy Sciences, Hatfield, PA), and remaining reactive aldehydes were inactivated by treatment of the grids with 0.5M glycine in PBS followed by blocking overnight with 1% bovine serum albumin (BSA; CAS 9048-46-8, Sigma-Aldrich,

St. Louis, MO) in PBS at 4°C. Immunodetection of virions was accomplished by probing with primary α-nsp2 antibody, diluted in 1% BSA in PBS at a final dilution of 1:100 (2 hours at 4°C), and the secondary antibody goat α-rabbit conjugated to 1-6nm colloidal gold (CG), used at 1:10 dilution (Electron Microscopy Sciences, Hatfield, PA) (4°C for 30 minutes).

After each antibody incubation step, grids were washed a minimum of 4 times for 5 minutes

66 with 1% BSA in PBS at room temperature. Probed samples (grids) that were labeled with

1nm CG were further processed with the Aurion R-gent SE-EM high efficiency silver enhancement system per manufacturer’s instructions (Electron Microscopy Sciences,

Hatfield, PA) to increase visibility, resulting in large, slightly pleomorphic punctate label of varying size greater than the original 1nm diameter (at times larger than 20nm). Samples labeled with 6nm CG were not silver-enhanced. Images were acquired using the FEI

Tecnai™ G2 transmission electron microscope operated at 80Kv with a Hamamatsu

Photonics ORCA-HR digital CCD camera in conjunction with the FEI Tecnai™ G2 software platform.

Western blot analysis. Purified virus samples were resolved under reducing and denaturing conditions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using

4-12% Bis-Tris Novex NuPage® gels in conjunction with the XCell Surelock® mini-cell electrophoretic module with 2-(N-morpholino)ethanesulfonic acid (MES) running buffer per manufacturer’s instructions (Life Technologies, Carlsbad, CA). Resolved proteins were transferred to nitrocellulose membranes for western blot detection by the iBlot dry transfer system (Life Technologies; Carlsbad, CA) and blocked at room temperature for ≥1hr in 5% dehydrated milk (w/v) in PBS/0.05% Tween 20 (PBST) with shaking. Nsp2 detection proceeded by probing with the primary α-nsp2 antibodies (OTU) and (HV) (rabbit), or the α- myc monoclonal antibody 9E10 (mouse) (Developmental Studies Hybridoma Bank,

University of Iowa, IA), diluted in filtered 5% milk in PBST at a ratio of 1:1000 (α-nsp2 antibodies) or 1:1500 (9E10) overnight at 4°C while rocking, followed by the secondary goat

α-rabbit conjugated horseradish peroxidase (HRP; IgG H+L chain, SouthernBiotech,

Birmingham, AL) or the goat α-mouse conjugated horseradish peroxidase (Santa Cruz

Biotechnology, Dallas, TX) antibody diluted in filtered 5% milk in PBST at a ratio of 1:2500 incubated overnight at 4°C while rocking. To detect nsp2 isoforms, Western blots were treated with the chemilumininescent/chemifluorescent ECL Plus substrate (Pierce, Rockford,

IL) and imaged by chemilumininescent film (Kodak, Rochester, New York) or by digital capture (G:BOX Chemi XT4, Syngene, Frederick, MD).

RESULTS

Characterization of intracellular nsp2 during PRRSV infection. Polyclonal affinity-purified anti-peptide antibodies were produced in rabbits against four different regions of the nsp2 protein, denoted as -nsp2-OTU (VR-2332 aa 69-82), -nsp2-HV (VR-2332 aa 633-646), - nsp2-TM (VR-2332 aa 630-643) and -nsp2-C (VR-2332 aa 1183-1196) (Fig. 3.1). The selected epitopes represented conserved regions of the PRRSV strains examined, except for

Type 1 strain Lelystad in some cases. Three antibodies, -nsp2-OTU, -nsp2-HV and - nsp2-C, were found to specifically stain PRRSV-infected MARC-145 cells (200X) in primarily perinuclear regions and did not cross-react with any uninfected cell component

(Fig. 3.2A). However, in a subset of infected cells, a diffuse punctate pattern, characteristic of ER/Golgi compartments, was evident throughout much of the cell by -nsp2-OTU staining at higher magnification (400X) (Fig. 3. 2B). A similar staining pattern was noted with the α-nsp2-HV antibody, although to a lesser extent, and the bulk of staining was localized to the perinuclear region (Fig. 3.2A and B). Nsp2 was not detected by the α-nsp2-

TM antibody by IFA (Fig. 3.2A and B); perhaps because this region is predicted to be embedded in the membrane, rendering the epitope inaccessible under the experimental conditions used, or the antibody itself was ineffective. Finally, -nsp2-C detection localized

68 primarily to regions directly surrounding the cell nuclei (Fig. 3.2A and B). Surprisingly, in some cases, nsp2 densely localized to long cellular extensions as detected by each of the three antibodies (Fig. 3.3A). These extensions extend the length of two or more cells and are

Figure 3.1. Peptide sequence alignment of nsp2. The nsp2 peptide sequence from genetically diverse study strains of PRRSV including the European Type 1 prototype Lelystad virus and the North American Type 2 prototype strain VR-2332, the regional North American strain MN184, and the Asian highly pathogenic PRRSV isolates rJXwn06 (China) and rSRV07 (Vietnam) were aligned using the ClustalW algorithm (41) in the parent program Geneious 6.1.5 (Biomatters Limited) and transferred to Jalview 2.8 (42) for percentage identity coloring. Intensity of shading depicts the level of sequence similarity between strains; the darkest shaded areas represent a fully conserved residue or region, no shading represents a low level of sequence conservation at that position. Alignment regions are shown for each epitope sequence targeted by custom α-nsp2 antibodies. Linear epitope sequence range denoted above alignment in reference to the VR-2332 nsp2 protein sequence (AA = amino acid). Diagram of nsp2 in reference to VR-2332 nsp2, PLP2 (Papain like Protease 2/OTU enzymatic domain); HV (large central hypervariable region); TM1-4 (hydrophobic region, predicted transmembrane regions 1-4).

found to possess moderate to high intensity nsp2 detection along the length of the filament.

PRRSV nucleoprotein (N) co-localized with nsp2 at the greatest intensity at the perinuclear regions of virally infected cells. N was additionally identified to localize to a lesser extent near the distal and proximal regions of the nsp2 cellular projections (Fig. 3.3B).

Procedural validation of PRRSV particle purification. Viral supernatants were generated from low M.O.I. infections and were harvested prior to any overt destruction of the cellular monolayer or cellular necrosis (60-80% CPE, 0-5% monolayer detachment [by surface area]), thereby limiting release of any cellular nsp2 into the supernatant. Cell-free virions were pelleted through a 0.5M sucrose exclusion cushion to limit collection of cellular and

69 viral components < 1g/ml density. Sucrose cushion pellets were resuspended and subsequently purified by two sequential continuous CsCl self-forming gradients, where banded viral particles were harvested at each step by side-tapping with a syringe.

Figure 3.2. Immunofluorescence detection of nsp2 within virally infected cells. A. MARC-145 cell monolayers inoculated with VR-2332 at an M.O.I. = 0.1 (48 h.p.i.) were fixed and permeabilized prior to detection with the primary antibodies α-nsp2-OTU (1:50), α-nsp2-HV (1:50), α-nsp2-C (1:100), and α-nsp2-C (1:50) followed by indirect fluorescence detection with secondary Goat α-Rabbit Alexa Fluor 488 antibody (1:25) [Invitrogen, Carlsbad, CA], imaged at 200X-400X magnification. Images were collected using a consistent exposure and saturation setting for all images. For each antibody an uninfected cell control (negative) is shown, labeled with identical primary and secondary antibody concentrations. B. Selected high magnification images of virally infected monolayers. A representative image of α-nsp2-OTU, α-nsp2-HV, α-nsp2-TM, α- nsp2-C is shown.

Alternatively, virions were initially also purified by semi-discontinuous (10-60%) sucrose gradients (Fig. 3.6). As a negative control, uninfected cell cultures of equal surface area and media volume were processed by the same methods as viral samples, using the viral bands of

PRRSV positive isolates as a reference for proper density collection. Collection volumes were kept consistent across all samples. The purified viral samples of each PRRSV strain

70 were demonstrated to be infectious, and produced typical CPE on MARC-145 cells, with recovery rates of final CsCl purified virus from supernatant at 12-30% by TCID50

(Spearman-Kärber method) (43, 44) (Table 3.2).

Table 3.2. Infectivity of viral strains before and after purification

Viral Strain Total Virus - Supernatant Total Virus - Purified % Recovery Lelystad 4.27 x 108 1.26 X 108 30 VR-2332 9.13 X 107 2.25 X 107 25 MN184 1.95 X 108 2.25 X 107 12 rJXwn06 9.13 X 107 2.25 X 107 25 rSRV07 1.95 X 108 4.00 X 107 20

50% tissue culture infectious dose (TCID50) assay. Low passage MARC-145 cells were either mock infected, or inoculated with one of the five strains of PRRSV (VR-2332, rJXwn06, rSRV07, MN184, Lelystad virus) and the infection allowed to progress to 60-80% CPE (virally infected) or 2-3d.p.i. (uninfected cell control). At time of collection, supernatants were clarified at 5,000 X g (4°C, 1hr) and an aliquot taken for titration prior to downstream purification. The initial clarified supernatant as well as the final purified isolates were titered by tissue culture infectious dose 50% assay (TCID50) for each strain purified. Initial and final quantities of total virus were calculated [TCID50/mL * Volume (mL)] from the supernatant and purified isolates respectively. Recovery was defined as the percentage (%) of total virus remaining after purification in relation to the starting initial amount (i.e. [Total Virus (Purified) / Total Virus (Supernatant)] * 100].

Nsp2 associates with highly-purified PRRSV particles by immunoelectron microscopy. To determine if nsp2 was associated with the PRRSV particle, purified virus and uninfected control samples were assessed by immunoelectron microscopy using antibodies against nsp2.

Electron micrographs of the purified uninfected cell control were generally free of observable contaminants and no vesicles or subcellular structures were noted; however, occasional protein aggregates were observed (Fig. 3.4A). Purified viral isolates were found to contain pleomorphic, predominantly spherical, virions of regular size (57.9nm ± 8.1nm diameter, n=50) consistent with published results (45) (Fig. 3.4B-E). Immunoelectron microscopy

(IEM) analysis using both α-nsp2-OTU and α-nsp2-HV detected nsp2 associated with particles from all purified viral isolates tested, as shown for purified rSRV07 (Fig. 3.4B and

C) and VR-2332 (Fig. 3.4E). Immunoelectron microscopy was initially conducted with the

Lelystad strain; however, the conditions between the α-nsp2 antibodies and ultimately the low virion load on the sample grid resulted in a high degree of background which was not overcome. Detection of the OTU epitope (Fig. 3.4B and E) was greater than that of the HV

Figure 3.3. A. Nsp2 localizes to high concentration within cell-to-cell protrusions. Nsp2 was confirmed to localize to these projections by a variety of α-nsp2 antibodies including α-nsp2-OTU (I and II), α-nsp2-HV (III and IV), and α-nsp2-C (V). These projections are observed to span the distance of two or more cell lengths, ultimately terminating at either cells which also possess perinuclear nsp2 staining, or in rare cases, within cells which appear completely devoid of nsp2 (uninfected) except at the apparent point of cell-to-cell contact (III and IV, lower left/center). B. Nucleocapsid co-localizes with nsp2 at the proximal and distal regions of the cell-to- cell projections. VR-2332 infected MARC-145 cell monolayers dual stained for nsp2 (α-nsp2-OTU) and N (α- Nucleocapsid, SDow17-A) revealed punctate foci of N along the axis of some nsp2(+) cell-to-cell projections (Merge, right cellular projection). However, strongest co-localization occurred at the perinuclear region and, to a lesser extent, at the proximal and distal regions of nsp2(+) cell-to-cell projections (Merge).

epitope (Fig. 3.4C), and the transmembrane (TM) and C-terminal (C) epitopes were not detectable in the IEM protocol. Detection of virion-associated nsp2 by IEM was not consistent across all viral particles (Fig. 3.4B and C), which may be at least partly explained by the highly stringent nature of the assay conditions.

To further address the possibility that residual unbound nsp2 was being co-purified through a nonspecific interaction with the virion surface, viral particles were subjected to an elongated purification method where banding times within the cesium chloride purification gradients were increased to greater than 48 hours, with the intent to strip residual protein

Figure 3.4. IEM detection of nsp2 on PRRSV virions. Purified virions of PRRSV isolates rSRV07 (HP- PRRSV), VR-2332 (NA prototype), or the purified product of the uninfected cell control [referred to as purified Cell (-)] were labeled by α-nsp2 and imaged by electron microscopy between 32,000X and 150,000X magnification. A. Purified Cell (-) labeled with the α-nsp2-OTU (1:100) + secondary Goat α-Rabbit conjugated to 1nm CG (1:10) + silver enhancement. B-C.) Purified virions of the HP-PRRSV strain rSRV07 labeled with either the α-nsp2-OTU primary (1:100) + Goat α-Rabbit-1nm CG (1:10) + silver enhancement (B) or the α- nsp2-HV primary (1:100) + Goat α-Rabbit-6nm CG (1:10) (no enhancement) (C). D. Unlabeled VR-2332 purified virions isolated under the ‘standard’ purification technique. E. Immunodetection of nsp2 (α-nsp2-OTU) on VR-2332 purified virions isolated under an elongated purification protocol.

material closely associated to the virions (noted in Fig. 3.4B and C as a dark halo around the outside of the virions). Upon centrifugation for this elongated period, a significant fraction of the sample was lost due to additional osmotic and mechanical stresses placed on the virion during this protracted purification. The resulting virions displayed increased virion diameter

73 and pleomorphism, but had lost the dark halo surrounding the outside of the virion (Fig. 3.4D and E). Specific nsp2 staining remained detectable on these extensively purified viral particles, indicating that nsp2 is strongly associated with, or most likely incorporated in or on, the PRRSV virion (Fig. 3.4E).

Figure 3.5. Western blot detection of nsp2 in cell lysates by custom antibodies. MARC-145 cell lysates of VR-2332, rJXwn06, or uninfected negative controls harvested at 48h.p.i. were titrated at 10µg, 20µg, 30µg, and 40µg (per well) by SDS-PAGE western blot analysis. Full-length nsp2 as well as lower molecular weight isoforms were identified with the primary antibodies α-nsp2-OTU (1:2500) (A), α-nsp2-HV (1:2500) (B), and α-nsp2-C (1:2500)

Multiple isoforms of nsp2 were present within purified PRRSV particles. To characterize the anti-peptide antibodies to nsp2 in western blot assays, increasing amounts (10-40 μg) of

VR-2332- and rJXwn06-infected, as well as uninfected MARC-145 cell lysates, were separated by SDS-PAGE and transferred to nitrocellulose followed by probing with each α- nsp2 antibody. Consistent with previous observations (38, 46), multiple bands were seen in

VR-2332- and rJXwn06-infected cell lysates as detected by -nsp2-OTU, -nsp2-HV and - nsp2-C (Fig. 3.5). The uppermost band (~130 kDa) migrated similarly using all three antibodies when compared with the Super Signal ladder (Thermo Scientific) (Fig. 3.5A-C), whereas the two bands directly below the uppermost band had a similar migration rate when probed with -nsp2-OTU and -nsp2-HV (Fig. 3.5A and B). Lower molecular weight

74 protein bands were also seen, some of similar migration. As noted in the IFA data, no

PRRSV specific proteins were recognized by -nsp2-TM (data not shown). Detection of rJXwn06 nsp2 proteins exceeded that of VR-2332, most likely due to the fact that rJXwn06 replicates to 10-100 fold higher titers than VR-2332 in MARC-145 cells (2).

Figure 3.6. Nsp2 packaging is maintained across genetically diverse strains of PRRSV. MARC-145 derived viral supernatants of PRRSV isolates of broad genetic heterogeneity including the Lelystad virus (EU prototype), VR-2332 (NA prototype), rSRV07 and rJXwn06 (HP-PRRSV), and NA regional MN184 isolate as well, as the uninfected control, were individually collected and subjected to virus purification through semi- discontinuous sucrose gradients as outlined in the materials and methods. Samples were separated by SDS- PAGE under denaturing/reducing conditions prior to transfer to nitrocellulose and subjected to western blot using the α-nsp2-OTU primary antibody followed by detection with the goat α-rabbit HRP secondary. Blots were exposed using the chemiluminescence / chemifluorescence ECL+ substrate and imaged by digital capture via the Syngene G:Box.

To further investigate nsp2 virion association, western blot analysis was performed under denaturing, reducing conditions on purified viruses rJXwn06, VR-2332, rSRV07,

MN184, and Lelystad, representing diverse genotypes, and gradient purified uninfected cell controls (Fig.3.6). Multiple bands of different molecular weights were detected (nsp2 isoforms) within PRRSV positive samples but not the purified uninfected and gradient

75 banded cell control. Full-length nsp2 proteins of 126 kDa (rSRV07) or 129.6 kDa (VR-2332) were expected, as well as additional protein bands that had been observed previously (38,

46).

Figure 3.7. Identification of dominant nsp2 products in purified virions. Highly concentrated purified viral samples were generated to identify dominant nsp2 protein products associated with the virion. Two-fold dilutions (1:1 - 1:64) of the purified viral isolates rSRV07 and VR-2332, or the purified Cell (-) (only the highest concentration of 1:1 is shown) of identical surface area, media volume, purification strategy and collection volume, were denatured and reduced prior to electrophoretic separation by SDS-PAGE to differentiate minor bands of closely migrating high intensity bands. Black arrows: A consistent core set of nsp2 products are noted between strains. Black Star: noted repetitive similarly migrating band of differing intensity between strains (A and B). Similar banding pattern is noted for the core set of nsp2 isoforms between VR-2332 as detected by the α-nsp2-OTU (B) and α-nsp2-HV (C) although the ultimate intensities of these bands are noted to differ.

Initially, multiple isoforms of nsp2 were detected between 181 and 48 kDa for all

PRRSV strains examined at low concentrations of virus, consisting of a central set of similarly migrating products detected by α-nsp2-OTU, as measured in reference to the

Benchmark prestained molecular weight marker (Invitrogen, Carlsbad, CA), different from the Super Signal Ladder used previously. This initial purification strategy employing a semi- discontinuous sucrose gradient yielded positive identification of nsp2 within the viral fraction

(Fig. 3.6). However, the dual rate-zonal and isopycnic centrifugation properties of sucrose gradients resulted in diffuse density collection ranges and with it an increased probability of

76 co-collection of non-virion protein contaminants. In order to better assess the relationship of nsp2 with the virion, a stringent purification procedure was established by pelleting through a sucrose cushion followed by multiple rounds of banding within a continuous cesium chloride

(CsCl) gradient at high centrifugal forces (Fig. 3.7 and 3.8). Western blot detection of two- fold

Figure 3.8. Detection of packaged myc-tagged nsp2 isoforms. rV7-Myc expressing a modified c-myc-tagged nsp2 was amplified in MARC-145 cells and purified as described in Materials and Methods. Purified virions of the nsp2-tagged rV7-Myc, untagged parental VR-2332 virus, or the purified uninfected cell control was assessed by western blot using the α-myc mAb 9E10 detection antibody followed by labeling with the secondary goat α- mouse HRP conjugate and assessed in relation to the Kaleidoscope protein molecular weight marker.

dilutions of CsCl purified rSRV07, VR-2332, and the uninfected cellular control were completed to facilitate observation of all bands at optimal intensities and to distinguish dominant products for each strain of PRRSV. This more detailed analysis at higher concentrations of these two viruses revealed the same central set of nsp2 bands, indicated by

77 the arrows, however different intensities were noted between strains for some of the similarly migrating nsp2 isoforms, as shown by the star symbol (Fig. 3.7A and B). Detection of virion associated nsp2 products by α-nsp2-HV resulted in a similar banding pattern as noted for by

α-nsp2-OTU (Fig. 3.7B (OTU), Fig. 3.7C (HV)), however, different intensities of many bands were apparent (i.e. 87kDa, 76kDa and 30kDa). It is of note that the total number of bands detected were more than previously reported (38). These differences could be partially due to the different experimental conditions (direct detection of purified virions versus immunoprecipitation of cell lysates) and sensitivity of detection as defined by assay and antibodies used. Strain specific bands were also observed; additional products migrating at

181, 174, 30, 24, and 18 kDa were seen in purified VR-2332 particles that were not present in rSRV07 particles (Fig. 3.7). The noted high molecular weight products larger than the predicted full-length nsp2 may be the result of post-translational modifications, or incomplete replicase polypeptide processing.

Epitope-tagged nsp2 is incorporated into purified PRRSV particles. To further confirm nsp2 packaging in PRRSV virions, a recombinant strain of the parental VR-2332 virus expressing an exogenous c-myc epitope within the hypervariable region of nsp2 (rV7-Myc), was purified by multiple CsCl gradient purification and assessed by western blot in relation to the similarly purified products of the uninfected control and the untagged parental VR-

2332. Myc-tagged nsp2 was detected using the primary α-myc 9E10 monoclonal antibody

(mAb). Multiple myc-tagged nsp2 isoforms were identified to be present within the rV7-Myc purified virions but not within the purified uninfected control or the purified virions of the untagged parental VR-2332 (Fig. 3.8). The 3X c-myc epitope tag replaced amino acids 323 to

431 in relation to the parental VR-2332 virus strain. The net molecular weight change of the rV7-Myc nsp2 is therefore expected to be a reduction of approximately 10kDa as compared to the wild-type VR-2332 nsp2. A total of eight nsp2-myc isoforms were detected at 119kDa

(full length nsp2), 82, 71, 66, 55, 53, 51 and 19kDa as measured in reference to the

Kaleidoscope molecular weight marker (Fig. 3.8). These results further verify, using a different antibody, that several isomers of nsp2 were packaged as part of the PRRSV virion.

DISCUSSION

The rapid evolution of PRRSV has yielded a highly diverse antigenic population of

PRRSV isolates. A substantial fraction of these mutation and recombination events are noted to occur within the coding region of nsp2, the largest and most genetically diverse protein encoded by PRRSV. While the nsp2 is encoded by 21-23% of the PRRSV genome, it accounts for 23-48 % of the pairwise nucleotide differences between the five wild-type study strains presented in this report (Table 3.3, data not shown). Previous research has demonstrated that multiple isoforms of nsp2 are generated through viral replication within the permissive cell line MARC-145 (38, 46); we have additionally noted the presence of nsp2 isoforms within virally infected porcine alveolar macrophages (data not shown). Transfection of a VR-2332 nsp2-3 construct alone was also shown to be sufficient to yield multiple nsp2 products (18), a subset of which were of lower molecular mass than the recently reported translational isoforms (46). The presence of lower molecular weight nsp2 protein products suggests cleavage isoforms may be generated, either by the viral PLP2 protease, cellular proteases, or both (18, 38). The role of these isoforms in the viral replication cycle are yet to

Table 3.3 Percent pairwise identity between strains

% pairwise identity with strain:

Alignment and strain Whole Genome

(nucleotide) VR-2332 MN184C rJXwn06 rSRV07 Lelystad VR-2332 100% 85% 89% 89% 62% MN184C 100% 83% 83% 62%

rJXwn06 100% 99% 61%

rSRV07 100% 61%

Lelystad 100%

Nsp2 (nucleotide)

VR-2332 MN184C rJXwn06 rSRV07 Lelystad VR-2332 100% 73% 83% 82% 52% MN184C 100% 71% 71% 56%

rJXwn06 100% 99% 56%

rSRV07 100% 55%

Lelystad 100%

Nsp2 (protein)

VR-2332 MN184C rJXwn06 rSRV07 Lelystad VR-2332 100% 70% 79% 78% 38% MN184C 100% 67% 67% 38%

rJXwn06 100% 99% 37%

rSRV07 100% 37%

Lelystad 100%

Nucleotide (whole genome, nsp2 only) and protein (nsp2) sequence pairwise alignments were generated using the Geneious alignment algorithm within the Geneious R6 (v6.1.6, Biomatters Limited) software package for each combination of study strains [VR-2332 (U87392), rJXwn06 (EF641008), rSRV07 (JX512910), MN184C (EF488739), Lelystad virus (M96262)]. Figures are presented as % homology between whole genomes (top panel), nsp2 nucleotide sequence (middle panel), and nsp2 peptide sequence (bottom panel).

be determined, but may facilitate differential localization of nsp2 functional domains within the virally infected cell or allow for preferential packaging of selected isoforms.

Nsp2 was positively identified upon the outside viral envelope of the virion by IEM using antibodies to the viral OTU domain and the HV region, but not by antibodies to the predicted TM region or the C-terminal epitope. Failure to detect nsp2 at or downstream of the hydrophobic region by IEM might suggest nsp2 was packaged as an integral membrane protein, that the native structure precluded detection, or that these antibodies were not well suited for the experimental conditions under which IEM was completed. Previous work has shown nsp2 and nsp3 proteins of EAV were necessary and sufficient to induce cellular membrane rearrangements similar in appearance typically observed during viral infection

(23). PRRSV nsp2 possesses a hydrophobic domain downstream of the HV region that is predicted to function in cellular membrane rearrangement similar to EAV nsp2. It is therefore predicted that PRRSV nsp2 protein associates with the virion during packaging through integration with the membrane of the viral envelope, however further studies are needed to define the relationship of nsp2 with the virion.

Purified virions possessed multiple isoforms of nsp2, whereas packaged isoforms were similar in size to a subset of the isoforms detected within virally infected cell lysates.

Highly concentrated purified isolates were additionally found to possess a core set of nsp2 isoforms, as well as strain specific isoforms. While it was unlikely that the α-nsp2 custom antibody set was cross-reacting with an enriched cellular product co-purifying with the virion density fraction (and not identified in the uninfected cellular control), to eliminate this possibility we verified nsp2 packaging using a recombinant VR-2332 strain expressing a c- myc tagged nsp2 (rV7-Myc), which further confirmed our initial results (Fig. 3.8). Reduced growth kinetics for rV7-Myc hindered generation of purified viral stocks to as high of a concentration as wild-type viruses, particularly VR-2332 and the HP-PRRSV isolates

81 rJXwn06 and rSRV07. Due to the lower initial viral titers, it is possible minor nsp2 isoforms were not identified with this virus.

The function(s) and exact boundaries of nsp2 isoforms are yet to be determined, however, it was generally noted that IFA detection of nsp2 by three (OTU, HV, C) of the four target epitopes did maintain subtle differences in cellular localization (Fig. 3.2). Nsp2 predominantly localized to the perinuclear region of infected cells (VR-2332, 48 h.p.i) similar to what has been previously described for PRRSV (47) and EAV (48) when assessed by IFA (Fig. 3.2A-B). The noted differences in nsp2 localization as detected by targeting the

N-terminal protease domain, the central HV region, or the C-terminal domain was generally subtle, but was consistent across a range of replicates and antibody dilutions (Fig. 3.2B). It is postulated that some isoforms, such as those possessing the recognized hydrophobic region, may maintain a constrained localization in and around internal membrane structures while isoforms lacking this domain may adopt a more diffuse localization pattern. It is currently unknown if nsp2 isoforms localize preferentially to different regions of the cell but would allow spatial separation of nsp2 functional domains as a mechanism of targeted activity.

Interestingly, nsp2 was observed to also localize to cellular projections that appeared to connect two or more cells over distances of multiple cell lengths, consistent between the three target epitopes (OTU, HV, C-terminal) (Fig. 3.3). Cellular projections were noted to occur in equal frequency in infected and uninfected cells and therefore not believed to be virally derived or nsp2 derived, however, nsp2 densely localized to these protrusions. In some occurrences the cell-to-cell process, extending from an infected cell to uninfected cell, resulted in a high intensity point of nsp2 staining at the apparent point of contact with membrane/cytosol of the uninfected cell (Fig. 3.2A, panel IV lower center). Previous work

82 by Cafruny et al. indicated a cell-to-cell transmission route occurs for PRRSV within

MARC-145 cells during mid-phase viral growth cycle (>24 hours post infection) (49), as measured by α-N IFA detection of M.O.I. independent viral foci development. Similarly, in this study, N protein was found to weakly co-localize with nsp2 at distal and proximal regions of nsp2 (+) cellular projections (Fig. 3.3B, Merge) and with a punctate pattern along the axis of some projections (Fig. 3.3B, right projection).

Investigations into the role of nsp2 in viral replication and immune evasion have yielded an increasingly complex understanding of nsp2 mechanisms. This has been further compounded by the recent descriptions of translational (46) and cleavage (38) nsp2 isoforms of yet unknown function. Nsp2 is a region of substantial diversity at both the genetic and protein levels whereas emerging strains often possess novel mutations, insertions and deletions within this coding region (12, 30, 50). Nsp2 is the most genetically diverse protein of PRRSV; however, the mechanism potentiating the higher mutation rate within the nsp2 coding region has not been defined. Curiously, nsp2 elicits a strong humoral immune response in animals experimentally infected with PRRSV, and the magnitude of that antibody responses is similar to those generated against the highly immunogenic and highly abundant N protein by 14 days post infection (27). N protein is a dominant component of the

PRRSV virion (20-40% of the total virion protein mass) (28, 51), so it was therefore surprising that the nsp2 replicase protein with no known extracellular localization or function could elicit an antibody response commensurate to that generated against the N protein.

Likewise, it has been shown that hosts infected or vaccinated with the arterivirus prototype virus EAV established a serological response to nsp2 (52), suggesting that the mechanism by which the anti-nsp2 humoral immune response is elicited may be conserved across the

Arteriviridae. Genetic alignment of the nsp2 coding region of PRRSV demonstrates a large central bipartite region of high genetic variability (Fig. 3.1, unpublished results), which includes a number of single nucleotide polymorphisms (SNPs), insertions, and deletions between strains (12, 53, 54). Much of this central hypervariable region was found to be nonessential for the North American Type 2 prototype strain VR-2332 to replicate within the

MARC-145 cell line (37). Replication of a viral mutant possessing a large deletion within the hypervariable region of nsp2 (Δ324-726aa) was also found to be replication competent in vivo, yet with reduced kinetics relative to wild type virus or other mutants with smaller nsp2 hypervariable deletions (Δ727-813aa, Δ543-726aa and Δ324-523aa) (55) . The major factor(s) potentiating the high evolutionary rate of nsp2 is currently unknown, however multiple experiments have delineated T-cell and B-cell epitopes within the nsp2 coding region either bioinformatically or experimentally (17, 21, 29, 30, 56). Inclusion of nsp2 within the PRRSV virion suggests it may function in previously unknown roles related to extracellular function, entry, or immediate-early viral replication events. The known robust humoral immune response generated against nsp2, coupled with the observed high genetic diversity within this coding region, points towards a driving selective pressure against the nsp2 protein acting to alter or hinder one or more requisite functions. Nsp2 packaging was conserved across a genetically diverse set of study strains ranging from original outbreak isolates to contemporary highly pathogenic strains, suggesting this is a wholly conserved feature of PRRSV. These packaged nsp2 isoforms shared a consistent 'core' set between viral strains, however, additional strain specific products were also identified. These findings suggest the ultimate antigenic composition of the virion may be more complex than originally predicted. Identification of PRRSV nsp2 packaging establishes a foundation for

84 new considerations relevant to future vaccine design, and has important implications on yet unexplored functions of nsp2 as a structural protein.

ACKNOWLEDGEMENTS

The authors sincerely thank Judith Stasko for her kind and patient teaching, her efforts, and her invaluable expertise in immunoelectron microscopy. We would also like to thank Dr. Allyn Spear for his willingness to discuss experimental approaches, and for his assistance with editing of the manuscript.

This work was partially supported by Boehringer Ingelheim Vetmedica, Incorporated.

USDA is an equal opportunity provider and employer.

REFERENCES

1. Tian K, Yu X, Zhao T, Feng Y, Cao Z, Wang C, Hu Y, Chen X, Hu D, Tian X, Liu D, Zhang S, Deng X, Ding Y, Yang L, Zhang Y, Xiao H, Qiao M, Wang B, Hou L, Wang X, Yang X, Kang L, Sun M, Jin P, Wang S, Kitamura Y, Yan J, Gao GF. 2007. Emergence of fatal PRRSV variants: unparalleled outbreaks of atypical PRRS in China and molecular dissection of the unique hallmark. PloS one 2:e526.

2. Guo B, Lager KM, Henningson JN, Miller LC, Schlink SN, Kappes MA, Kehrli ME, Jr., Brockmeier SL, Nicholson TL, Yang HC, Faaberg KS. 2013. Experimental infection of United States swine with a Chinese highly pathogenic strain of porcine reproductive and respiratory syndrome virus. Virology 435:372-384.

3. Neumann EJ, Kliebenstein JB, Johnson CD, Mabry JW, Bush EJ, Seitzinger AH, Green AL, Zimmerman JJ. 2005. Assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the United States. J Am Vet Med Assoc 227:385-392.

4. Holtkamp D. 2011. Assessment of the Economic Impact of Porcine Reproductive and Respiratory Syndrome Virus on U.S. Pork Producers. Natonal Pork Board

5. van Vugt JJ, Storgaard T, Oleksiewicz MB, Botner A. 2001. High frequency RNA recombination in porcine reproductive and respiratory syndrome virus occurs preferentially between parental sequences with high similarity. The Journal of general virology 82:2615-2620.

6. Yuan S, Nelsen CJ, Murtaugh MP, Schmitt BJ, Faaberg KS. 1999. Recombination between North American strains of porcine reproductive and respiratory syndrome virus. Virus research 61:87-98.

7. Hanada K, Suzuki Y, Nakane T, Hirose O, Gojobori T. 2005. The origin and evolution of porcine reproductive and respiratory syndrome viruses. Mol Biol Evol 22:1024-1031.

8. Lemey P, Kosakovsky Pond SL, Drummond AJ, Pybus OG, Shapiro B, Barroso H, Taveira N, Rambaut A. 2007. Synonymous substitution rates predict HIV disease progression as a result of underlying replication dynamics. PLoS computational biology 3:e29.

9. Shi M, Lam TT, Hon CC, Hui RK, Faaberg KS, Wennblom T, Murtaugh MP, Stadejek T, Leung FC. 2010. Molecular epidemiology of PRRSV: A phylogenetic perspective. Virus research 154:7-17.

10. Ellingson JS, Wang Y, Layton S, Ciacci-Zanella J, Roof MB, Faaberg KS. 2010. Vaccine efficacy of porcine reproductive and respiratory syndrome virus chimeras. Vaccine 28:2679-2686.

11. Yoshii M, Okinaga T, Miyazaki A, Kato K, Ikeda H, Tsunemitsu H. 2008. Genetic polymorphism of the nsp2 gene in North American type--porcine reproductive and respiratory syndrome virus. Archives of virology 153:1323-1334.

12. Han J, Wang Y, Faaberg KS. 2006. Complete genome analysis of RFLP 184 isolates of porcine reproductive and respiratory syndrome virus. Virus research 122:175-182.

13. Barretto N, Jukneliene D, Ratia K, Chen Z, Mesecar AD, Baker SC. 2005. The papain-like protease of severe acute respiratory syndrome coronavirus has deubiquitinating activity. Journal of virology 79:15189-15198.

14. Frias-Staheli N, Giannakopoulos NV, Kikkert M, Taylor SL, Bridgen A, Paragas J, Richt JA, Rowland RR, Schmaljohn CS, Lenschow DJ, Snijder EJ, Garcia- Sastre A, Virgin HWt. 2007. Ovarian tumor domain-containing viral proteases evade ubiquitin- and ISG15-dependent innate immune responses. Cell host & microbe 2:404-416.

15. Sun Z, Chen Z, Lawson SR, Fang Y. 2010. The cysteine protease domain of porcine reproductive and respiratory syndrome virus nonstructural protein 2 possesses deubiquitinating and interferon antagonism functions. Journal of virology 84:7832- 7846.

16. van Kasteren PB, Beugeling C, Ninaber DK, Frias-Staheli N, van Boheemen S, Garcia-Sastre A, Snijder EJ, Kikkert M. 2012. Arterivirus and nairovirus ovarian tumor domain-containing Deubiquitinases target activated RIG-I to control innate immune signaling. Journal of virology 86:773-785.

17. Chen Z, Zhou X, Lunney JK, Lawson S, Sun Z, Brown E, Christopher-Hennings J, Knudsen D, Nelson E, Fang Y. 2010. Immunodominant epitopes in nsp2 of porcine reproductive and respiratory syndrome virus are dispensable for replication, but play an important role in modulation of the host immune response. The Journal of general virology 91:1047-1057.

18. Han J, Rutherford MS, Faaberg KS. 2009. Porcine Reproductive and Respiratory Syndrome Virus Nsp2 Cysteine Protease Domain Possesses Both Trans- and Cis- cleavage Activities. Journal of virology.

19. Snijder EJ, Wassenaar AL, Spaan WJ, Gorbalenya AE. 1995. The arterivirus Nsp2 protease. An unusual cysteine protease with primary structure similarities to both papain-like and chymotrypsin-like proteases. The Journal of biological chemistry 270:16671-16676.

20. Sun Y, Han M, Kim C, Calvert JG, Yoo D. 2012. Interplay between Interferon- Mediated Innate Immunity and Porcine Reproductive and Respiratory Syndrome Virus. Viruses 4:424-446.

21. Oleksiewicz MB, Botner A, Toft P, Normann P, Storgaard T. 2001. Epitope mapping porcine reproductive and respiratory syndrome virus by phage display: the nsp2 fragment of the replicase polyprotein contains a cluster of B-cell epitopes. Journal of virology 75:3277-3290.

22. Mahajan VS, Drake A, Chen J. 2009. Virus-specific host miRNAs: antiviral defenses or promoters of persistent infection? Trends in immunology 30:1-7.

23. Snijder EJ, van Tol H, Roos N, Pedersen KW. 2001. Non-structural proteins 2 and 3 interact to modify host cell membranes during the formation of the arterivirus replication complex. The Journal of general virology 82:985-994.

24. Ziebuhr J, Snijder EJ, Gorbalenya AE. 2000. Virus-encoded proteinases and proteolytic processing in the Nidovirales. The Journal of general virology 81:853- 879.

25. Wassenaar AL, Spaan WJ, Gorbalenya AE, Snijder EJ. 1997. Alternative proteolytic processing of the arterivirus replicase ORF1a polyprotein: evidence that NSP2 acts as a cofactor for the NSP4 serine protease. Journal of virology 71:9313- 9322.

26. van Hemert MJ, Snijder EJ. 2008. The Arterivirus Replicase, p. 83-101. In Stanley Perlman TGaES (ed.), The Nidoviruses. ASM Press, Washington, DC.

27. Brown E, Lawson S, Welbon C, Gnanandarajah J, Li J, Murtaugh MP, Nelson EA, Molina RM, Zimmerman JJ, Rowland RR, Fang Y. 2009. Antibody response to porcine reproductive and respiratory syndrome virus (PRRSV) nonstructural proteins and implications for diagnostic detection and differentiation of PRRSV types I and II. Clinical and vaccine immunology : CVI 16:628-635.

28. Dea S, Wilson L, Therrien D, Cornaglia E. 2000. Competitive ELISA for detection of antibodies to porcine reproductive and respiratory syndrome virus using recombinant E. coli-expressed nucleocapsid protein as antigen. Journal of virological methods 87:109-122.

29. de Lima M, Pattnaik AK, Flores EF, Osorio FA. 2006. Serologic marker candidates identified among B-cell linear epitopes of Nsp2 and structural proteins of a North American strain of porcine reproductive and respiratory syndrome virus. Virology 353:410-421.

30. Fang Y, Kim DY, Ropp S, Steen P, Christopher-Hennings J, Nelson EA, Rowland RR. 2004. Heterogeneity in Nsp2 of European-like porcine reproductive and respiratory syndrome viruses isolated in the United States. Virus research 100:229-235.

31. Neuman BW, Joseph JS, Saikatendu KS, Serrano P, Chatterjee A, Johnson MA, Liao L, Klaus JP, Yates JR, 3rd, Wuthrich K, Stevens RC, Buchmeier MJ, Kuhn P. 2008. Proteomics analysis unravels the functional repertoire of coronavirus nonstructural protein 3. Journal of virology 82:5279-5294.

32. Nogales A, Marquez-Jurado S, Galan C, Enjuanes L, Almazan F. 2012. Transmissible gastroenteritis coronavirus RNA-dependent RNA polymerase and nonstructural proteins 2, 3, and 8 are incorporated into viral particles. Journal of virology 86:1261-1266.

33. Wensvoort G, Terpstra C, Pol JM, ter Laak EA, Bloemraad M, de Kluyver EP, Kragten C, van Buiten L, den Besten A, Wagenaar F, et al. 1991. Mystery swine disease in The Netherlands: the isolation of Lelystad virus. Vet Q 13:121-130.

34. Collins JE, Benfield DA, Christianson WT, Harris L, Hennings JC, Shaw DP, Goyal SM, McCullough S, Morrison RB, Joo HS, et al. 1992. Isolation of swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North America and experimental reproduction of the disease in gnotobiotic pigs. Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 4:117-126.

35. Benfield DA, Nelson E, Collins JE, Harris L, Goyal SM, Robison D, Christianson WT, Morrison RB, Gorcyca D, Chladek D. 1992. Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate ATCC VR-2332). Journal of veterinary diagnostic investigation : official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc 4:127-133.

36. Guo B, Lager KM, Schlink SN, Kehrli ME, Jr., Brockmeier SL, Miller LC, Swenson SL, Faaberg KS. 2013. Chinese and Vietnamese Strains of HP-PRRSV Cause Different Pathogenic Outcomes in United States High Health Swine. Virology 446:238-250.

37. Han J, Liu G, Wang Y, Faaberg KS. 2007. Identification of nonessential regions of the nsp2 replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for replication in cell culture. Journal of virology 81:9878-9890.

38. Han J, Rutherford MS, Faaberg KS. 2010. Proteolytic products of the porcine reproductive and respiratory syndrome virus nsp2 replicase protein. Journal of virology 84:10102-10112.

39. Meulenberg JJ, Bos-de Ruijter JN, van de Graaf R, Wensvoort G, Moormann RJ. 1998. Infectious transcripts from cloned genome-length cDNA of porcine reproductive and respiratory syndrome virus. Journal of virology 72:380-387.

40. Yuan S, Murtaugh MP, Schumann FA, Mickelson D, Faaberg KS. 2004. Characterization of heteroclite subgenomic RNAs associated with PRRSV infection. Virus research 105:75-87.

41. Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids research 22:4673-4680.

42. Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. 2009. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics 25:1189-1191.

43. Hermann JR, Munoz-Zanzi CA, Roof MB, Burkhart K, Zimmerman JJ. 2005. Probability of porcine reproductive and respiratory syndrome (PRRS) virus infection as a function of exposure route and dose. Veterinary microbiology 110:7-16.

44. Kärber G. 1931. Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Naunyn-Schmiedebergs Archiv für experimentelle Pathologie und Pharmakologie 162:480-483.

46. Fang Y, Treffers EE, Li Y, Tas A, Sun Z, van der Meer Y, de Ru AH, van Veelen PA, Atkins JF, Snijder EJ, Firth AE. 2012. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein. Proceedings of the National Academy of Sciences of the United States of America 109:E2920-2928.

47. Li Y, Tas A, Snijder EJ, Fang Y. 2012. Identification of porcine reproductive and respiratory syndrome virus ORF1a-encoded non-structural proteins in virus-infected cells. The Journal of general virology 93:829-839.

48. van der Meer Y, van Tol H, Locker JK, Snijder EJ. 1998. ORF1a-encoded replicase subunits are involved in the membrane association of the arterivirus replication complex. Journal of virology 72:6689-6698.

49. Cafruny WA, Duman RG, Wong GH, Said S, Ward-Demo P, Rowland RR, Nelson EA. 2006. Porcine reproductive and respiratory syndrome virus (PRRSV) infection spreads by cell-to-cell transfer in cultured MARC-145 cells, is dependent on an intact cytoskeleton, and is suppressed by drug-targeting of cell permissiveness to virus infection. Virology journal 3:90.

50. Fang Y, Snijder EJ. 2010. The PRRSV replicase: exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus research 154:61-76.

51. Mardassi H, Mounir S, Dea S. 1995. Molecular analysis of the ORFs 3 to 7 of porcine reproductive and respiratory syndrome virus, Quebec reference strain. Archives of virology 140:1405-1418.

52. Go YY, Snijder EJ, Timoney PJ, Balasuriya UB. 2011. Characterization of equine humoral antibody response to the nonstructural proteins of equine arteritis virus. Clinical and vaccine immunology : CVI 18:268-279.

53. Fang Y, Schneider P, Zhang WP, Faaberg KS, Nelson EA, Rowland RR. 2007. Diversity and evolution of a newly emerged North American Type 1 porcine arterivirus: analysis of isolates collected between 1999 and 2004. Archives of virology 152:1009-1017.

54. Brockmeier SL, Loving CL, Vorwald AC, Kehrli ME, Jr., Baker RB, Nicholson TL, Lager KM, Miller LC, Faaberg KS. 2012. Genomic sequence and virulence comparison of four Type 2 porcine reproductive and respiratory syndrome virus strains. Virus research 169:212-221.

55. Faaberg KS, Kehrli ME, Jr., Lager KM, Guo B, Han J. 2010. In vivo growth of porcine reproductive and respiratory syndrome virus engineered nsp2 deletion mutants. Virus research 154:77-85.

56. Yan Y, Guo X, Ge X, Chen Y, Cha Z, Yang H. 2007. Monoclonal antibody and porcine antisera recognized B-cell epitopes of Nsp2 protein of a Chinese strain of porcine reproductive and respiratory syndrome virus. Virus research 126:207-215.

CHAPTER 4. PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS NONSTRUCTURAL PROTEIN 2 (NSP2) TOPOLOGY AND SELECTIVE ISOFORM INTEGRATION IN ARTIFICIAL MEMBRANES

Formatted for publication within the journal Virology

Matthew A. Kappes1,2, Cathy L. Miller2, Kay S. Faaberg1

ABSTRACT

Membrane modification of host subcellular compartments is critical to the replication of many RNA viruses. Enveloped viruses additionally require the ability to requisition cellular membranes during egress for the development of infectious progeny. Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped virus encoded by a positive-sense single-stranded RNA genome. PRRSV nsp2 is a predicted transmembrane protein with a recognized C-terminal hydrophobic region; however, the functionality of the putative nsp2 transmembrane domain has not been defined. In this report, the insertion and topology of nsp2 was assessed using cell free translation in the presence or absence of membranes. Full-length nsp2 was found to strongly associate with membranes and, surprisingly, two additional large nsp2 isoforms of approximately 117 and 106 kDa were enriched within the membrane fraction. Membrane integration was further defined for full- length nsp2 through high-speed density fractionation, protection from protease digestion, and immunoprecipitation. The results demonstrated that nsp2 integrated into the membranes with an unexpected topology, where the N-terminal (cytoplasmic) and C-terminal (luminal) domains were orientated on opposite sides of the membrane surface.

INTRODUCTION

Viruses are obligate intracellular pathogens that modulate the host cellular environment to establish locations conducive to the biogenesis of infectious progeny. To date, all positive- sense RNA viruses that have been studied modify host cellular membranes of intracellular compartments, including mitochondria (1, 2), chloroplasts (3), endoplasmic reticulum

(ER)/Golgi (3-6), and endosomes/lysosomes (7) to establish structured sites of replication

(replication complexes (RCs)). Enveloped viruses further require the ability to capture cellular membranes as a component of progeny virions during egress. Porcine reproductive and respiratory syndrome virus (PRRSV) is an enveloped single-stranded positive-sense

RNA virus within the Arteriviridae family (8). The first approximately three-fourths of the genome encode at least 14 nonstructural proteins (nsp) from a large polyprotein precursor

(pp1a/b) which is co-translationally and post-translationally processed by four viral proteases including the papain-like cysteine proteinase 1α (PLP1α; nsp1α), PLP1β (nsp1β), PLP2

(nsp2), and the main serine proteinase (SP; nsp4) (Fig. 4.1) (9). The final one-fourth of the genome encodes nine additional ORFs, including all canonical structural proteins (10). Of the replicase proteins, nsp2 is unique due to its large size (~1196 amino acids (aa)), genetic heterogeneity, its participation in diverse roles supporting the viral replication cycle, and its packaging within the PRRSV virion (11-16). Nsp2 is the largest protein encoded within the

PRRSV genome and is also the location of the greatest level of genetic heterogeneity identified between strains (17). The N-terminal PLP2 protease domain of nsp2 is recognized for its dual functionality between viral pp1a/b processing (9, 18) and its immunomodulatory deubiquitinating activity (19-21). However, outside of the context of the PLP2 protease domain, very little is known about the potential functional roles for the large central and C-

Figure 4.1. PRRSV ORF1a encodes putative multi-spanning transmembrane domains. Predicted hydrophobicity of the entire ORF1a coding region is depicted using the TMHMM prediction algorithm within the Geneious software platform. A) Top: graphical representation of pp1a noting the location of viral protease domains PLP1α, PLP1β, PLP2, and SP. Middle: model of membrane integration sites and topologies of pp1a based upon predicted transmembrane spanning helices. Regions where the putative transmembrane spanning domains are unclear are denoted in white. Bottom: plot of hydrophobicity strength scores (TOPCONS) and amino acid charge by position. B) Possible topologies of nsp2 dependent on even (1 and 2) or odd (3 and 4) number of transmembrane spanning elements and cytoplasmic versus luminal orientation.

terminal domains of nsp2. The PRRSV nsp2 is a predicted transmembrane protein due to the recognized hydrophobic C-terminal domain (Fig. 4.1). The arterivirus prototype equine arteritis virus (EAV) nsp2 has been shown to function in membrane rearrangement in support of the formation of double-membrane vesicles (DMVs) RCs (22, 23) and ORF1a polyprotein processing (18, 24, 25), believed to be intrinsically associated with ER membrane integration

(26). Recently the PRRSV nsp2 was also shown to be packaged within or upon the PRRSV virion, presumably through interaction with the viral envelope (16). While PRRSV nsp2 has been historically recognized as a putative multi-spanning transmembrane protein, the membrane insertion, topology and functionality of the nsp2 hydrophobic domain has never been conclusively determined. In this report, membrane association of the full-length nsp2

93 and sub-dominant isoforms are identified and further nsp2 is demonstrated to be an integral membrane protein with an unexpected topological orientation within the cell-free in vitro translation system.

RESULTS

Nsp2 expression. Nsp2 was assessed in the absence of all other viral components by use of a cell-free translation system. Translation of the non-template control (NTC) or pcDNA vector

(vector control) were free of any detectable translation products (Fig. 4.2A-D), however, general 35S-cysteine cross-labeling of microsomal membrane components was noted (Fig.

4.2B and D). Isotopically labeled nsp2 translation products were shown to be predominantly full-length nsp2 of an approximate molecular mass of 130kDa (Fig. 4.2A), consistent with the expected product size of 129.4kDa. Additional secondary translation products of lower molecular weight were also faintly visible under normal exposure conditions (Fig. 4.2A, black arrows) and could be easily visualized when overexposed (Fig. 4.2C). The expression of either untagged (pNsp2), N-FLAG (pNsp2 N-FLAG), or C-FLAG-tagged (pNsp2 C-

FLAG) nsp2 constructs resulted in the generation of full-length nsp2 protein products of comparable molecular weight (Fig. 4.2A), however, there were noted differences in the banding pattern of some of the lower molecular weight translation products of pNsp2 N-

FLAG as assessed in relation to the C-FLAG-Tagged expression construct (Fig. 4.2C, lanes 4 and 5). Multiple products between 50-75 kDa of the N-FLAG construct displayed a minor upward band-shift as compared to the C-FLAG or the untagged nsp2 expression construct

(Fig. 4.2A and C; black arrows). The lower molecular weight products of the C-FLAG and untagged nsp2 expression constructs appeared to have similar migration patterns. Temporal

Figure 4.2. Cell-free translation of PRRSV nsp2. VR-2332 nsp2 coding region was isotopically labeled by transcription/translation coupled reaction in rabbit reticulocyte lysate with [35] S-cysteine either without (A and C) or with (B and D) microsomal membranes. [35]S-labeled translation products were loaded at 100,000 counts/lane and PAGE separated under denaturing, reducing conditions in MES running buffer. C) Overexposed image of (A) to highlight the low molecular weight products; D) overexposed image of (B) to highlight microsomal cross-labeling and low molecular weight products. 1 = Non-template control (NTC), 2 = pcDNA vector control, 3 = pVR-nsp2, 4 = pVR-nsp2 5’FLAG, 5 = pVR-nsp2 3’FLAG.

studies showed that the lower molecular weight products emerged early during the translation reaction, as early as 15 minutes and at times preceding the detectable generation of full- length product (data not shown). There was also the appearance of a minor secondary product that migrated at a larger molecular mass (~149kDa) than the complete nsp2 product.

This large 150kDa protein was an observed product for all nsp2 expression constructs from

95 both closed (circular) (Fig. 4.2-6) and linearized templates (data not shown). A 150kDa band with a similar migration pattern was also a noted nsp2 product within purified virions via detection by multiple anti-nsp2 antibodies (in contrast to 35S-cysteine labeling) (16). This high molecular weight product was more apparent when nsp2 was expressed with canine microsomal membranes (microsomes) (Fig. 4.2B). Addition of microsomes to translation reactions confounded the visualization of the lower molecular weight products, partly due to

35S cross-labeling of microsomal components (Fig. 4.2B and D, lanes 1 and 2).

Nsp2 isoforms differ in PAGE gel banding pattern. Nsp2 translation products were assessed by α-FLAG immunoprecipitation (IP) to define the generation of N-terminal and C- terminal nsp2 isoforms in relation to the full-length product (Fig. 4.3). As expected untagged nsp2 expression products were not immunoprecipitated (Fig. 4.3 A and B; lane 3). IP of

FLAG-tagged nsp2 constructs clearly demonstrated differences in generation of N-terminal and C-terminal isoform generation in the absence of microsomes (Fig. 4.3A). Numerous N- terminal FLAG-tagged nsp2 products efficiently precipitated at a range between 150kDa and

5kDa (Fig. 4.3 lane 4). In contrast, only two low molecular weight C-terminal nsp2 isoforms were efficiently precipitated by α-FLAG IP in the absence of membranes (Fig. 4.3A lane 5).

In addition to the full-length nsp2 and the 150 kDa nsp2 protein product, C-terminal isoforms of approximately 73 and 68kDa were observed (Fig. 4.3A lane 5). These noted differences between N- and C-FLAG constructs were diminished when translated in the presence of microsomes (Fig. 4.3B, lanes 4 and 5). Translations in the presence of microsomes resulted in full-length nsp2 as the dominant product. The appearance of secondary products was

Figure 4.3. N-terminal and C-terminal nsp2 isoforms. Translation products generated from reticulocyte lysate expression of nsp2 constructs were immunoprecipitated targeting the FLAG epitope. IP products were PAGE separated under reducing/denaturing conditions. Expression was completed either without (A) or with (B) microsomal membranes. 1 = Non-template control (NTC), 2 = pcDNA vector control, 3 = pNsp2, 4 = pNsp2 5’FLAG, 5 = pNsp2 3’FLAG.

significantly reduced when nsp2 constructs were expressed in the presence of microsomal membranes (Fig. 4.3B). A number of faint low molecular products were still observed within the N-FLAG+microsomes IP (Fig. 4.3B, Lane 4) but were of lower intensity. C-terminal isoforms (C-FLAG+microsomes) comprised only a small fraction of translation reaction products and were only visualized under extreme overexposure conditions, but were able to be visualized (data not shown). IP reactions of nsp2 translation products demonstrate differential banding patterns of N-terminal and C-terminal low-molecular weight isoforms

(Fig.3A). Further, the addition of membrane to the reactions was shown to apparently stabilize the translation reaction yielding predominantly full-length nsp2.

Nsp2 and select isoforms strongly associate with membranes. The membrane association of nps2 was assessed by isolating the membrane fraction of translation reactions through high-speed centrifugation. Equal counts of the initial translation reactions of both nsp2 (- microsomes) and nsp2 (+ microsomes) were assessed by PAGE (Fig. 4.4A). As noted previously, multiple subdominant low molecular weight products were noted when nsp2 was expressed in the absence of membranes (Fig. 4.4A, - microsomes). While equal counts of both translation reactions (with and without microsomes) were added, the noted 35S-cysteine cross-labeling of microsomal components resulted in a weaker intensity of full-length nsp2

(per 100,000 counts; Fig. 4.4A, + microsomes). To assess the relative pelleting efficiencies of

35S-cysteine labeled nsp2 either without microsomes (Fig. 4.4B; - microsomes) or with microsomes (Fig. 4.4B; + microsomes); equal counts of each translation reaction was pelleted by high-speed ultracentrifugation in isotonic buffer as outline in the materials and methods. As expected, in the absence of membranes 35S-cysteine labeled nsp2 failed to pellet under the experimental conditions outline, demonstrating free nsp2 is not pelleted as part of the isolated membrane fraction (Fig. 4.4B; - microsomes). Extending the centrifugation time four-fold from 30min to 120min did not result in isolation of free nsp2 in the membrane fraction (Fig. 4.4B; - microsomes). In contrast, 35S-cysteine labeled full-length nsp2 was efficiently isolated within the membrane fraction of translation products which were expressed in the presence of microsomal membranes (Fig. 4.4B; + microsomes). Increasing

Figure 4.4. Nsp2 associates strongly with membranes. [35]S-labeled pNsp2 translation products were expressed either with (+) or without (-) the addition of microsomal membranes. A) Translation products at 100,000 counts per lane. B) Translation products equal to 100,000 counts/reaction were pelleted to enrich for the microsomal fraction. Eluted pellets were assessed by PAGE separation under reducing, denaturing conditions.

the spin times by four-fold did not result in any significant increase in isolated product (Fig.

4.4B; + microsomes). The results show full-length nsp2 is strongly membrane associated.

Surprisingly, a second lower molecular weight product in addition to full-length nsp2 was observed to strongly associate with membranes (Fig. 4.4; + microsomes). While low molecular weight isoforms were only faintly visible within the original translation reaction under the exposer conditions depicted (Fig. 4.4A, + microsomes); the secondary lower molecular weight band was of equal intensity to the full-length product in the membrane fraction (Fig. 4.4B, + microsomes) demonstrating an enrichment of this product within the microsomal fraction. A repeat of this experiment allowed a more detailed resolution of the nsp2 expression products (-/+ microsomes) and subsequent isolation of the membrane fraction was repeated (Fig. 4.5). Generation of full-length nsp2 and secondary lower molecular weight products were similar in banding pattern between expression without

99 microsomes (Fig. 4.5A lane 1) and with microsomes (Fig. 4.5A lane 2). Significant cross- labeling of microsomal components were noted between 15-5kDa (Fig. 4.5A lane 2).

Isolation of the membrane fraction again showed the efficient isolation of membrane associated nsp2 but not free nsp2 (Fig. 4.5B). Additionally, lower molecular weight nsp2 isoforms of approximately 117 and 106kDa (Fig. 4.5A, black arrows) co-purified in the membrane fraction (Fig. 4.5B, black arrows). All other nsp2 isoforms were not found to be associated with the membrane fraction; demonstrating selective purification of only a fraction of the nsp2 isoforms (Fig. 4.5B, black arrows). Further, the 117 and 106kDa isoforms were noted to be enriched within the membrane fraction as co-dominant products

(Fig. 4.5B). These membrane isolation studies show the selective enrichment of nsp2 including the full-length nsp2 and two additional nsp2 isoforms.

Nsp2 is an integral membrane protein. To assess whether the introduction of the FLAG- tag epitope to either the N- or C-terminus of nsp2 altered the ability of nsp2 to associate with membranes, the membrane fraction of N-FLAG and C-FLAG nsp2 expression products were assessed in relation to the untagged nsp2 (pNsp2) (Fig. 4.6). As noted previously, the expression of the pcDNA vector only, or the NTC, did not result in the generation of any detectable protein product and subsequently no 35S-cysteine labeled product was observed in the microsomal fraction either without or with microsomal membranes (Fig. 4.6 lanes 1 & 2; left and right panels respectively). As expected, when microsomes were not added to the translation reaction N-FLAG and C-FLAG products did not precipitate with the membrane fraction (Fig. 4.6; - microsomes lanes 4-5). Expression of N-FLAG and C-FLAG nsp2 constructs in the presence of microsomal membranes resulted in the efficient isolation of

100

Figure 4.5. Membrane enrichment of select nsp2 isoforms. pVR-nsp2 [35] S-labeled translation products were expressed either with or without canine microsomal membranes. Lane 1 = (-) microsomes, Lane 2 = (+) microsomes. A) Translation reactions PAGE separated under reducing, denaturing conditions. B) Translation products equal to 100,000 counts/reaction were pelleted at 150,000 x g for 1hr to enrich for the microsomal fraction. Eluted pellets were assessed by PAGE separation under reducing, denaturing conditions. Black arrows indicate the approximate molecular weight of enriched nsp2 sub-dominant products.

nsp2 within the microsomal fraction, similar to that of the untagged nsp2 (Fig. 4.6; + microsomes). These results show that the insertion of the FLAG epitope to the N-terminal or

C-terminal coding regions of nsp2 does not affect membrane association of nsp2.

Protein domains that have either embedded within the membrane or that have traversed the bilayer and are enclosed within the luminal surface of the microsomes are protected from protease digestion (27). To test whether nsp2 functions as an integral membrane protein, the isolated membrane fraction of each translation product was subjected to proteinase K digestion [protease protection assays (PPA)]. Proteinase K PPA products were assessed by PAGE to define any 35S-cysteine labeled product protected from digestion

101

Figure 4.6. Membrane Enrichment of FLAG-tagged products. [35]S-labeled translation products were expressed either with or without canine microsomal membranes. Products were pelleted at 150,000 x g (4C) 1hr. Eluted pellets were subjected to PAGE separation under reducing, denaturing conditions. 1 = Non-template control (NTC), 2 = pcDNA vector control, 3 = pVR-nsp2, 4 = pVR-nsp2 5’FLAG, 5 = pVR-nsp2 3’FLAG.

(Fig. 4.7). A single 13-15kDa protein product from the PPAs was observed to be protected from digestion (Fig. 4.7) whereas N-FLAG, C-FLAG, and untagged nsp2 membrane associated products were equally protected (Fig. 4.7, lanes 3-5). The observed 15kDa protected product is similar in size to both the predicted multi-pass transmembrane domain

(TM1-5; 17kDa) and the C-terminal domain downstream of the TM region (20kDa). These

102

Figure 4.7. Nsp2 fragment is protected from protease degradation by membrane insertion. [35]S-labeled translation products were expressed either with or without canine microsomal membranes. Products were pelleted at 150,000 x g (4C) 1hr. Membrane associated nsp2 was subjected to protease protection assay (proteinase K digestion) as outlines in the materials and methods and assessed by PAGE separation under reducing, denaturing conditions. 1 = Non-template control (NTC), 2 = pcDNA vector control, 3 = pVR-nsp2, 4 = pVR-nsp2 5’FLAG, 5 = pVR-nsp2 3’FLAG.

results demonstrate nsp2 integrates within microsomal membranes and that an approximately

15kDa product is protected from digestion either through integration within the membrane bilayer (transmembrane helices) or through orientation within the luminal surface of the microsomal compartment.

103

Figure 4.8. The C-terminus of nsp2 is protected from protease degradation by membranes. A) Translation products were expressed in the presence of microsomes. [35]S-labeled translation products were stabilized in TBSS and an enriched microsomal fraction was generated through pelleting at 150,000xg 1hr. The pelleted fraction was digested with proteinase K (protease protection assay) and further processed by immunoprecipitation, targeting the exogenous FLAG epitope (α-FLAG). 1 = Non-template control (NTC), 2 = pcDNA vector control, 3 = pVR-nsp2, 4 = pVR-nsp2 5’FLAG, 5 = pVR-nsp2 3’FLAG. B) Graphical representation of the predicted membrane associated functions of the weakly hydrophobic putative transmembrane domains TM1 and TM3.

Nsp2 membrane integration yields an unexpected topology. PPA experiments demonstrated a ~15kDa protein product was protected from proteinase K digestion, defining nsp2 insertion into microsomal membranes. To further define the topology of nsp2, and to identify the protected domain of nsp2, PPA products were subjected to IP analysis (Fig.

4.8A). IP analysis of PPA protected fragments clearly demonstrated the 15kDa fragment to originate from the C-terminal domain (Fig. 4.8A). The protected fragment from the PPA of both the untagged nsp2 and N-FLAG nsp2 constructs did not precipitate by IP pull-down

(Fig. 4.8A; lanes 3 and 4). While a single ~15kDa band was observed from the PPA reaction

104

Figure 4.9. RFS alters the hydrophobicity profile of nsp2. Predicted hydrophobicity profiles using the TMHMM algorithm depicted for both the full-length nsp2 (VR-2332) and nsp2-TF (-2 RFS). Red arrows denote the putative transmembrane helices as defined by the TOPCONS prediction algorithm. Green lines define the predicted probability of an encoded transmembrane domain (TMHMM) from 0% (bottom) to 100% (top). Images were generated using the Geneious software platform.

(Fig. 4.7), two C-terminal FLAG tagged nsp2 product of approximately 15kDa and 5kDa were identified in the IP pull-down of PPA reactions. It is unknown if the 5kDa protein was enriched within the IP reaction or if it is a partially digested product. Partially digested products could result from low amounts of incompletely inactivated proteinase K incubated for long time points (≥18hr) during the IP reaction. These results clearly demonstrate the C- terminal domain of nsp2 adopts a luminal topology. Further, the large hydrophilic N-terminal domain (PLP2 & HV; ~90kDa) was not observed to be protected from digestion, indicating a cytoplasmic orientation. These results define an unexpected topology of nsp2 where the large

N-terminal domain is maintained on the cytoplasmic surface and the C-proximal hydrophobic region integrates within the membrane orientating the C-terminal domain within the luminal surface.

105

DISCUSSION AND CONCLUSION

Within ORF1a, three proteins possess recognized hydrophobic domains: nsp2, nsp3 and nsp5 (Fig. 4.1). Of the three, nsp2 is unique in that the hydrophobic domain comprises only a small fraction of the protein coding sequence. The arterivirus nsp2 is a large multifunctional protein that has been reported to interact with a diverse set of viral and cellular proteins, and cellular membranes (21, 22, 24, 28, 29). RNA viruses modify host cellular membranes of intracellular compartments to establish structured sites of replication including mitochondria (1, 2), chloroplasts (3), ER/Golgi (3-6), and endosomes/lysosomes (7); creating factories for the biogenesis of genomic and protein constituents of progeny virions (30, 31).

The arterivirus nsp2 is believed to participate in cellular membrane reorganization of the endoplasmic reticulum (ER) leading to the formation of characteristic double-membrane vesicle (DMV) RCs (22), and to be packaged within the PRRSV virion presumably by association within the viral envelope (16). The biological aspects of PRRSV nsp2 membrane integration have not been defined and it is unknown what functional role the recently identified translational (13) and cleavage (32) isoforms play in support of virion replication cycle. To address these questions we sought to define nsp2 transmembrane insertion. Since strong viral protein-protein interactions can complicate assessment of native transmembrane insertion (29), and additionally PRRSV nsp2 interacts with a wide range of cellular proteins

(28), we chose to complete these initial studies on nsp2 transmembrane functionality within a reductionist cell-free translation system in the absence of all other viral proteins.

Fig. 4.1A proposes a simple diagram of PRRSV replicase integral membrane proteins as outlined by the predicted hydrophobicity strength scores (TMHMM) of the entire ORF1a

106

Table 4.1. Prediction of nsp2 transmembrane helices

Nsp2 (VR-2332 (DQ217415)) transmembrane domains were assessed by bioinformatic predictive algorithms Phobius (33); HMMTOP 2.0 (34); SCAMPI (35); TOPCONS (36); OCTOPUS (37); PRO/PRODIV-TMHMM (38); and MemBrain [TMH prediction; (39)] using default settings unless otherwise noted in the materials and methods. On average, most prediction algorithms define four transmembrane spanning domains (TM1-4); however, the aggregated output from the nine predictive programs defines a total of five transmembrane spanning helices (Region 1-5).

polyprotein. The transmembrane prediction of the ORF1a hydrophobic domains (Fig. 4.1A; green line) depicts multiple regions where the number TM helices are inconclusive. Of the three putative ORF1a transmembrane proteins, nsp2 transmembrane prediction is the most unclear. Further, discrepancies were noted when assessing the putative nsp2 transmembrane domain by nine separate bioinformatic predictive algorithms (Table 4.1). The ultimate number of functional transmembrane domains encoded and the resulting topological orientation (in/out) (Fig. 4.1B, 1-4) has important implications on the mechanism of

ORF1a/b polyprotein processing, orientation of downstream ORF1a putative transmembrane proteins, and on potential function(s) of nsp2 within the viral reticulovasicular network

(RVN) (26). Because of these unknowns we sought to define the functionality of the putative transmembrane domain and further define the topological orientation of nsp2.

107

In this report we demonstrated the membrane association of both nsp2 and select isoforms, and further defined a surprising topological orientation for nsp2. Expression of nsp2 within reticulocyte lysate resulted in multiple sub-dominant protein products in addition to the full-length nsp2, similar to the banding pattern previously described (16) including a faint triplicate between 80kDa - 60kDa and a tight duplet/triplicate at or near the 50kDa range (Fig. 4.2). IP pull-down of FLAG-tagged nsp2 constructs further identified the lower molecular weight products as isoforms of nsp2 (Fig. 4.3). Clear differences in banding patterns between N-terminal (N- FLAG) and C-terminal (C-FLAG) isoforms emerged from

IP reactions (Fig. 4.3), predicted to be at least in part due to differential products derived from nsp2 cleavage (32). An alternative hypothesis that the lower molecular weight bands are abortive translation products is also possible in some instances. Translation within the cell- free system (reticulocyte) of such a large protein is near the upper range for this assay and could help explain some of the minor secondary N-terminal isoforms (N- FLAG). Abortive translation products however would not explain the clearly defined low molecular weight C- terminal nsp2 isoforms possessing the C-FLAG epitope observed within α-FLAG IP reactions. It is probable that the defined bands between 50kDa – 75kDa (Fig. 4.3) were generated through cleavage of the nsp2 protein by an as yet undefined mechanism. Initial attempts were made to express nsp2 within the reticulocyte system in the presence of multiple protease inhibitors, all of which completely aborted translation (data not shown).

Addition of microsomes to the translation reaction clearly stabilized nsp2 expression, potentiating generation of predominantly full-length nsp2 product (Fig. 4.3B). Isolation of the membrane (microsomal) fraction demonstrated the strong association of not only the full- length nsp2 protein (Fig. 4.4) but additionally the enrichment of two nsp2 isoforms migrating

108 at approximately 117kDa and 106kDa (Fig. 4.5). These results remained consistent with the isolation of membrane bound FLAG-tagged nsp2 constructs (Fig. 4.6). The isolation of two tightly membrane associated nsp2 isoforms was surprising since enrichment in banding intensity (from sub-dominant translation products to dominant products within the membrane fraction) suggest a tighter interaction with the membrane compared to the full-length product.

Further, these isoforms are consistent in size to the previously reported translational isoforms nsp2TF and nsp2N generated through -2 RFS and -1 RFS, respectively (13). While the critical requirement of nsp1β for efficient RFS within transmembrane region 1 (TM1) of nsp2 was recently demonstrated (15), strongly suggesting these are not translational isoforms, it is important to note that the -2 RFS dramatically changes the predicted hydrophobicity of the multi-spanning transmembrane region strongly favoring membrane insertion (strong hydrophobicity profiles; Fig. 4.9).

Nsp2 membrane integration was conclusively determined and the topology defined through investigations utilizing protease protection assays (PPA) against proteinase K digestion (Fig. 4.7). Results demonstrated a small fragment was protected from digestion, defining membrane insertion, and IP further confirmed the protected fragment (15 kDa) was derived from the C-terminus (Fig. 4.8A). The integration of nsp2 with a topological orientation yielding N- and C-termini on opposing sides of the membrane is counterintuitive since the established polyprotein processing cascade requires the PLP2 (OTU) protease domain and the nsp2-3 junction site is contiguous and not impeded by physical barriers.

However, the historical rules of membrane integration and ‘positive-inside’ topology (40) has been muddled by recent unexpected findings from the growing number of solved high- resolution structures of integral membrane proteins and correlative biological data (41).

109

Observed topological variations include dual-topology proteins (“flip-flopping” or

“indecisive” integration) (42), mixed or diverse topological profiles of monotopic (43) and polytopic membrane proteins (44, 45) (topological heterogeneity), and temporally dynamic topologies which either re-orient post- translationally (46) or, as in the case of the hepatitis B large envelope glycoprotein (L), a fraction (~50%) re-orients in a protracted Hsc70/Bip chaperone-mediated process (47) (dynamic topologies). Topological variation has, at least in part, been attributed to inefficiencies in integration of weakly hydrophobic domains (48, 49).

As noted in Fig. 4.1, nsp2 encodes three regions of strong hydrophobicity (VR-2332 nsp2

874-902aa, 960-980aa, and 986-1007aa) and two weaker hydrophobic domains (nsp2 845-

864aa and 906-927aa) (Fig. 4.1). Further assessment of the nsp2 hydrophobic region by the use of multiple bioinformatic predictive programs showed that while most algorithms define a succinct set of four potential transmembrane domains (Table 4.1; TM1-4), the aggregated output of the nine separate bioinformatic transmembrane/hydrophobicity predictive algorithms describe a total of five distinct putative transmembrane helices within PRRSV nsp2 (Table 4.1; Region 1-5). Originally we postulated that one of the two weak hydrophobic domains would not be functional (Fig. 4.1B, 1 and 2) in order to maintain an even number of transmembrane domains, allowing for the cis-cleavage of the nsp2-3 junction following co-translational integration within the membrane. However, alternative pathways allowing for membrane integration and proteolytic processing are possible based on existing data. The physical separation of the large cytoplasmic PLP2 protease domain and the luminal

C-termini by the membrane interface would require that polyprotein processing of the nsp2↓nsp3 junction to be cleaved either in trans following membrane insertion, or that cleavage of nsp2-3 precedes membrane insertion. Similarly, previous data both shows that

110 the PLP2 possess both cis- and trans- cleavage activities (18) and that nsp2 has been additionally shown to interact with cellular chaperones known to participate in post- translational membrane integration (28). Most simply, any nsp2 isoform resulting from a cleavage event between the PLP2 protease domain and the TM region would allow for physical separation of these domains and thus differential localization. While this would allow for unbound nsp2 isoforms to migrate to the nsp2-3 junction and process this site in trans, detailed studies defining the genesis of these cleavage isoforms are needed.

Additionally, an N-terminal ER targeting sequence has not been identified, making it unlikely these unbound isoforms (most between 50-120 kDa; Fig. 4.3) would be able to traverse the to the luminal side of the ER to access the nsp2-3 junction at early time points during infection (prior to DMV/RVN formation). At later time points after DMV formation, nsp2 localizes diffusely within the perinuclear region (16, 50) and thus it is possible that trans-cleavage specificity could play some role at this stage.

Alternatively, post-translational insertion into the ER membrane has been shown to occur via multiple pathways including signal recognition particle (SRP)-dependent (51), heat-shock protein (HSP70)-dependent (52), and ‘unassisted’ (53, 54) mechanisms. As a nascent apolar peptide emerges from the ribosomal tunnel, it requires immediate shielding from the aqueous cytosolic environment to protect against inappropriate folding or aggregation, either through direct membrane insertion (co-translational insertion) (55) or chaperone mediated nascent protein shielding (post-translational integration pathways) (52,

56). The PRRSV nsp2 has been found to interact with multiple cellular proteins associated with translational regulation and membrane insertion, particularly the chaperone protein human leukocyte antigen (HLA)-B–associated transcript 3 (Bat3/Bag6/Scythe) (28). Bat3 is

111 a multi-functional chaperone protein that plays a central role in regulation of post- translational ER membrane targeting (56-58), ubiquitin-dependent ER-associated protein degradation (ERAD) proteome targeting (59), and removal and degradation of mislocalized proteins (60). Bat3 functions by binding to nascent hydrophobic polypeptides as they emerge from the ribosomal tunnel, specifically binding long stretches of hydrophobic residues (57,

61), maintaining hydrophobic proteins in a soluble state until membrane insertion (56). In addition, nsp2 has been found to also interact with other ER chaperone proteins implicated in post-translational membrane integration, HSP70 (28, 52) and binding immunoglobulin protein (Bip/GRP78/HSPA5) (32, 62). Bat3 appears to play a fundamental role in association with both of these proteins whereas Bat3 promotes the stability of HSP70 and Bip (63, 64).

Bat3 and related holdase machinery (TRC35/UBL4) are present within reticulocyte lysates

(57).

Whether a transmembrane protein is processed co-translationally or post- translationally, and which mechanism/pathway is utilized, most often relies on attributes of protein coding sequence adjacent to or within the hydrophobic area (43, 51, 65-69), however, the ‘rules’ dictating how protein sequence imparts these regulatory signals is currently not well understood (70). It is important to mention that all chaperone proteins that interact with nsp2 also participate in a diverse set of functions, and that interaction with nsp2 does not necessitate it is exclusively for post-translational roles associated with membrane integration.

However, a core function of Bat3 is to bind hydrophobic regions of proteins in order to maintain solubility while a triage (protein quality control) decision is made regarding ER targeting or ubiquitin-dependent destruction (61). While it is postulated that Bat3 would function to directly target nsp2 for membrane insertion, the PLP2 protease possesses

112 deubiquitinating functionality (19, 20) that, if targeted for destruction, may rescue nsp2 from

ULB4 ubiquitin-dependent degradation and further potentiate ER targeting.

In this report we demonstrate nsp2 is an integral membrane protein and possesses an cytoplasmic/luminal topological orientation within the context of the cell-free in vitro translation assay. Research has shown that retention of proteins in membranes does not exist as a static state and the environment of the polar/apolar surface is dynamic and is managed by a range of physical forces and biological intermediaries (40, 49, 69-71). Future research is needed to define the membrane integration steps of nsp2, whether co-translationally or post- translationally, and what the cellular and viral interacting partners may be. Stepping up studies into cellular in vitro and ex vivo systems using vectored nsp2, ORF1a, or competent infection studies should show if interaction with additional cellular or viral components induce altered integration or varied topologies. As noted earlier, nsp2 encodes two weak hydrophobic elements of unknown functionality (Fig. 4.8B). Initial attempts to map the transmembrane coding helices through mutational analysis failed to conclusively define which elements associate or embed within the membrane and require further investigation

(data not shown). Studies showed a strong association of the full-length nsp2 and two large nsp2 isoforms with membranes (Fig. 4.5); and further demonstrated the C-termini of nsp2 is translocated through to the lumen surface of canine pancreatic membranes (Fig. 4.7-8). These results define nsp2 as an integral membrane protein of PRRSV. The demonstrated membrane integration of nsp2 within this report supports previous predicted functions of nsp2 associated with membrane rearrangement and association with the PRRSV virion.

Identification of a small class of membrane associated nsp2 isoforms of unknown function further highlight the complex composition of nsp2.

113

MATERIALS AND METHODS

Construction of expression plasmids. pVR-2332 (DQ217415) template was amplified

(Platinum Taq, Invitrogen) using custom DNA primers VR-nsp2-F: 5’-GCT GGA AAG AGA

GCA AGA AAA GCA CG-3’ and VR-nsp2-R: 5’-TCC CCC TGA AGG CTT GGA AAT TTG

C-3’ targeting the complete nsp2 coding region (VR-2332 1339nt-4926nt). Amplified products were gel purified using the QIAquick gel extraction kit [Qiagen] and underwent a second round of amplification (Phusion® High-Fidelity DNA polymerase, NEB) and gel purification. Purified PCR products were incubated with 12mM dATP [New England Biolabs

(NEB)], GoTaq Flexi DNA polymerase (1.25U), and GoTaq reaction buffer (1X; 1.5mM

MgCl2) [Promega] at 72°C for 20 minutes to introduce 3’ A-tail overhangs. A-tailed products were purified to remove reaction components [Zymogen Clean and Concentrator-5] and A-T cloned into the pGEM®-T EASY vector system per manufacturer’s instructions (Promega).

Resulting ligations were transformed into either JM-109 (Promega) or Mach1 (Invitrogen) chemically competent cells per manufacturer’s instructions. Positive ligation clones grown under ampicillin resistance (100ug/ml; Sigma) were amplified and screened by restriction digest and sequenced for positive forward insertion. Correct clones were sequenced to cover the entire nsp2 coding region and flanking vector sequence. Two point mutations that altered the amino acid coding sequence were identified and restored to parental sequence with the

QuikChange II XL site-directed mutagenesis kit (Agilent) and custom DNA mutagenesis primers. Additional restriction digestion and site-directed mutagenesis was completed directly upstream of the nsp2 5’ coding sequence to remove inefficient upstream start codons and an upstream NotI restriction site, and to introduce a novel PacI restriction site and a

114

Table 4.2. Sequence of oligonucleotides for insertion of exogenous FLAG epitope

Name Primer Sequence 5'FLAG SDM Forward '5- TTAATTAAGCCGCCGCCATG(CCTGCA↓GG)GCTGGAAAGAGAGCAAGAAA -3' 5'FLAG SDM Reverse '5- TTTCTTGCTCTCTTTCCAGC(CC↑TGCAGG)CATGGCGGCGGCTTAATTAA -3'

3'FLAG SDM Forward '5- TTTCCAAGCCTTCAGGGGGA(CCTGCA↓GG)ATCACTAGTGAATTCGCGGC -3' 3'FLAG SDM Reverse '5- GCCGCGAATTCACTAGTGAT(CC↑TGCAGG)TCCCCCTGAAGGCTTGGAAA -3'

FLAG Forward '5- ATTATT(CCTGCA↓GG)CGACTACAAAGACGATGACGACAAGA(CCTGCA↓GG)CGCAGCA -3' FLAG Reverse '5- TGCTGCG(CC↑TGCAGG)TCTTGTCGTCATCGTCTTTGTAGTCG(CC↑TGCAGG)AATAAT -3'

strong Kozak sequence flanked by the start codon (5’-GCCGCCGCCAUG-3’). The pcDNA

3.0 cloning vector was also altered by site-directed mutagenesis to introduce a novel PacI restriction site directly upstream of the NotI restriction site (to facilitate directional cloning) by changing the sequence 5’-CATCACAC-3’ (vector sequence 954-961nt) to TTAAT↓TAA. pGEM-Nsp2 clones were digested with PacI and NotI restriction enzymes and the nsp2 insert was selected and gel purified [QIAquick gel extraction kit, Qiagen]. Purified inserts were directionally cloned into the pcDNA 3.0 expression vector downstream of the T7 transcription initiation factor using the PacI/NotI restriction sites and the Blunt/TA ligase master mix [NEB]. The resulting expression construct was denoted as pNsp2 (1-1196aa).

To facilitate immunoprecipitation assays, expression constructs were engineered to encode an exogenous FLAG epitope (DYKDDDDK) either at the 5’ termini (pNsp2 N-

FLAG) or directly downstream of the nsp2 coding region (pNsp2 C-FLAG). Intermediate pNsp2 clones were engineered to possess a SbfI restriction site (CCTGCA↓GG) by site- directed mutagenesis (pNsp2 5’SbfI: [AUG (CCTGCA↓GG) GCT GGA AAG… -3’]; pNsp2

3’SbfI: [5’- …TCA GGG GGA (CCTGCA↓GG)…- 3’], bold = nsp2 sequence) flanking the

5’ or 3’ termini of nsp2 (Table 4.2). A pair of synthetic oligonucleotides encoding the FLAG epitope (FLAG Forward and FLAG Reverse) was designed to encode flanking SbfI

115 restriction sites (Table 4.2). The FLAG oligonucleotides were annealed by first heating to

95°C and then reducing the temperature 1°C/min in a thermocycler [Eppendorf] until 20°C is reached. The annealed FLAG oligonucleotides were digested by SbfI and ligated into pNsp2

5’SbfI or pNsp2 3’SbfI at a 1:1 molar ratio to generate in-frame FLAG-tagged expression constructs pNsp2 N-FLAG and pNsp2 C-FLAG, respectively.

Bioinformatic predictions. pVR-2332 (DQ217415) nsp2 protein coding sequence was analyzed by the transmembrane prediction algorithms Phobius [‘Normal prediction’ method;

(33)]; HMMTOP 2.0 (34); SCAMPI (35); TOPCONS (36); OCTOPUS (37); PRO/PRODIV-

TMHMM (38); and MemBrain [TMH prediction; (39)] using default settings unless otherwise noted.

Cell-free translation of nsp2. Nsp2 expression constructs were translated using the TNT®

T7 coupled transcription/translation reticulocyte lysate system (Promega) with some modifications to the manufacturer’s instructions. The rabbit reticulocyte lysate was thawed quickly at 37°C prior to being placed on ice, all other components including H20 and DNA template were chilled to 4°C before assembling translation reactions. Reactions were assembled on ice using 1ug DNA template per 25μl translation reaction either with or without the addition of canine pancreatic microsomal membranes (microsomes; Promega; see below). RNasin® Plus RNase inhibitor (Promega) was added to each reaction (1.6U/μl per rxn) to inhibit RNA degradation during the translation reaction. It was found to be important to increase the amino acid mixture [minus cysteine] (Promega) 3-fold to a 0.06mM final concentration to enable efficient translation of the large 129kDa nsp2 protein. All other reaction components were added per manufacturer’s specifications. [35]-S cysteine (Cysteine

L-[35]; 10μCi/μl; PerkinElmer) thawed on ice was added to the translation reaction after all

116 other components (0.4mCi/mL final concentration). When used, microsomes were added to the translation reaction as a final step at a dilution of 1μl microsomes per 25μl translation reaction volume. The reaction was then mixed gently followed by incubation at 25°C for 1 hour. Lowering the incubation temperature to 25°C was found to aid expression of full- length nsp2 product. All reactions were then quickly chilled to 4°C. Translation products were quantified by measuring the amount of incorporated product (scintillation counts;

Promega #TB126) prior to use in downstream assays.

Polyacrylamide gel electrophoresis. Reactions to be assessed by polyacrylamide gel electrophoresis (PAGE) were diluted to 15μl in phosphate-buffered saline (PBS; 10mM

Na2HPO4/KH2PO4, 137mM NaCl, pH 7.4) as needed. Samples were reduced with 4X

NuPAGE® LDS sample buffer (Life Technologies) supplemented with 10% v/v DTT

(500mM; Life Technologies) and 30% w/v urea (Mallinckrodt). Reducing buffer was added to a 1X final concentration followed by heat denaturation at 100°C for 5 minutes. Reduced and denatured samples were loaded onto NuPAGE® Novex® 4-12% Bis-Tris polyacrylamide gels (Life Technologies) and electrophoresed at constant voltage in 1X

Novex® 2-(N-morpholino)ethanesulfonic acid running buffer (MES; 145V) (Life

Technologies) or 1X Novex® 3-(N-morpholino) propanesulfonic acid running buffer

(MOPS; 125V) (Life Technologies) supplemented with NuPAGE® antioxidant (Life

Technologies) per manufacturer’s instructions. PAGE separated gels were incubated in gel drying buffer [50% methanol (HPLC grade; Honeywell), 7.5% glacial acetic acid (Fisher

Chemical), and 10% glycerol (ACS grade; Macron)] for 30 minutes at room temperature

(RT), further dehydrated in 200 proof ethanol (ETOH, Decon Laboratories) for 15 minutes at

RT (72), and then submerged in Amersham™ Amplify™ fluorographic reagent (GE

117

Healthcare) for 30min at RT to infuse the gel with the fluorographic reagent. PAGE products were dried completely under vacuum at 80°C for 2 hours. PAGE separated [35]-S-cysteine labeled products were imaged using BIOMAX MR High-Resolution Film (Carestream).

Immunoprecipitation. Immunoprecipitation (IP) pull-down assays were completed with the use of the magnetic DYKDDDDK (FLAG) immunoprecipitation kit (ClonTech) per manufacturer’s instructions, with one exception. Anti-DYKDDDDK magnetic beads were pre-absorbed by suspending 20μl beads into 1ml ClonTech IP lysis buffer supplemented with

0.1% BSA and allowed to tumble at 4°C overnight prior to the addition of translation products. Approximately 100,000 counts per translation product were then added to the pre- absorbed anti-DYKDDDDK beads suspended in 0.1%BSA/ IP lysis buffer and tumbled for an additional night at 4°C. Beads were then washed 3 times with ClonTech IP wash buffer per manufacturer’s instructions. Washed IP reactions were eluted with the ClonTech IP elution buffer at RT for 5 minutes. IP beads were removed from eluted products prior to analysis by PAGE under reducing and denaturing conditions.

Isolation of the microsomal fraction. Approximately 250,000 counts per translation reaction were diluted with chilled (4°C) PBS or tris-buffered sucrose (TS buffer; 25mM Tris-

HCl pH7.5, 250mM sucrose) (27). Reactions were diluted to a final volume of 10 mL and mixed thoroughly by gently pipetting. Diluted translation products were stabilized at 4°C for

≥1 hour, followed by pelleting at 150,000xg, 4°C, for 1 hour. Supernatants from high-speed pelleting were discarded and the resulting pellets were eluted in low volumes (15-25ul) of chilled PBS or TS buffer while keeping all components on ice.

Protease protection assay. Expression constructs and controls were translated as described above, either with or without the addition of canine pancreatic microsomal membranes.

118

Translated products were processed to isolate the microsomal fraction (as described above) using TS buffer. Pelleted products were eluted in TS buffer and were stabilized at 4°C for ≥1 hour. Stabilized products (4°C) were then treated with proteinase K (Ambion) (0.6mg/ml) for

2 hours followed by proteinase K inactivation with fresh phenylmethylsulfonyl fluoride

(PMSF) (10mM final concentration) and incubated at 4°C overnight. Protease protection assay (PPA) reactions were assessed by IP and PAGE analysis as described above.

ACKNOWLEDGEMENTS

This work was partially supported by the National Pork Board (#13-196). USDA is an equal opportunity provider and employer.

REFERENCES

1. Miller DJ, Schwartz MD, Ahlquist P. 2001. Flock house virus RNA replicates on outer mitochondrial membranes in Drosophila cells. Journal of virology 75:11664- 11676.

2. Gant VU, Jr., Moreno S, Varela-Ramirez A, Johnson KL. 2014. Two membrane- associated regions within the Nodamura virus RNA-dependent RNA polymerase are critical for both mitochondrial localization and RNA replication. Journal of virology 88:5912-5926.

3. Wei T, Huang TS, McNeil J, Laliberte JF, Hong J, Nelson RS, Wang A. 2010. Sequential recruitment of the endoplasmic reticulum and chloroplasts for plant potyvirus replication. Journal of virology 84:799-809.

4. Hsu NY, Ilnytska O, Belov G, Santiana M, Chen YH, Takvorian PM, Pau C, van der Schaar H, Kaushik-Basu N, Balla T, Cameron CE, Ehrenfeld E, van Kuppeveld FJ, Altan-Bonnet N. 2010. Viral reorganization of the secretory pathway generates distinct organelles for RNA replication. Cell 141:799-811.

5. Gillespie LK, Hoenen A, Morgan G, Mackenzie JM. 2010. The endoplasmic reticulum provides the membrane platform for biogenesis of the flavivirus replication complex. Journal of virology 84:10438-10447.

119

6. Delgui LR, Rodriguez JF, Colombo MI. 2013. The endosomal pathway and the Golgi complex are involved in the infectious bursal disease virus life cycle. Journal of virology 87:8993-9007.

7. Magliano D, Marshall JA, Bowden DS, Vardaxis N, Meanger J, Lee JY. 1998. Rubella virus replication complexes are virus-modified lysosomes. Virology 240:57- 63.

8. Baker SC, Baric, R. S., Balasuriya, U.B., Brinton, M.A., Bonami, J.R., Crowley, J.A., de Groot, R.J., Enjuanes, L., Faaberg, K.S., Flegel, T.W., Gorbalenya, A.E., Holmes, K.V., Leung, F.C-C., Lightner, D.V., Nauwynck, H., Perlman, S., Poon, L., Rottier, P.J.M., Snijder, E.J., Stadejk, T., Talbot, P.J., Walker, R. M., Woo, P.C.Y., Yang, H., Yoo, D., Ziebuhr, J. 2012. Nidovirales, p. 785-834, Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Elsevier.

9. Fang Y, Snijder EJ. 2010. The PRRSV replicase: exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus research 154:61-76.

10. Snijder EJ, Kikkert M, Fang Y. 2013. Arterivirus molecular biology and pathogenesis. The Journal of general virology 94:2141-2163.

11. van Kasteren PB, Bailey-Elkin BA, James TW, Ninaber DK, Beugeling C, Khajehpour M, Snijder EJ, Mark BL, Kikkert M. 2013. Deubiquitinase function of arterivirus papain-like protease 2 suppresses the innate immune response in infected host cells. Proceedings of the National Academy of Sciences of the United States of America 110:E838-847.

12. Sun Z, Li Y, Ransburgh R, Snijder EJ, Fang Y. 2012. Nonstructural protein 2 of porcine reproductive and respiratory syndrome virus inhibits the antiviral function of interferon-stimulated gene 15. Journal of virology 86:3839-3850.

13. Fang Y, Treffers EE, Li Y, Tas A, Sun Z, van der Meer Y, de Ru AH, van Veelen PA, Atkins JF, Snijder EJ, Firth AE. 2012. Efficient -2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein. Proceedings of the National Academy of Sciences of the United States of America 109:E2920-2928.

14. Fang Y, Fang L, Wang Y, Lei Y, Luo R, Wang D, Chen H, Xiao S. 2012. Porcine reproductive and respiratory syndrome virus nonstructural protein 2 contributes to NF-kappaB activation. Virology journal 9:83.

15. Li Y, Treffers EE, Napthine S, Tas A, Zhu L, Sun Z, Bell S, Mark BL, van Veelen PA, van Hemert MJ, Firth AE, Brierley I, Snijder EJ, Fang Y. 2014. Transactivation of programmed ribosomal frameshifting by a viral protein. Proceedings of the National Academy of Sciences of the United States of America.

120

16. Kappes MA, Miller CL, Faaberg KS. 2013. Highly divergent strains of porcine reproductive and respiratory syndrome virus incorporate multiple isoforms of nonstructural protein 2 into virions. Journal of virology 87:13456-13465.

17. Wang FX, Song N, Chen LZ, Cheng SP, Wu H, Wen YJ. 2013. Non-structural protein 2 of the porcine reproductive and respiratory syndrome (PRRS) virus: A crucial protein in viral pathogenesis, immunity and diagnosis. Research in veterinary science.

18. Han J, Rutherford MS, Faaberg KS. 2009. Porcine Reproductive and Respiratory Syndrome Virus Nsp2 Cysteine Protease Domain Possesses Both Trans- and Cis- cleavage Activities. Journal of virology.

19. Deaton MK, Spear A, Faaberg KS, Pegan SD. 2014. The vOTU domain of highly- pathogenic porcine reproductive and respiratory syndrome virus displays a differential substrate preference. Virology 454-455:247-253.

20. Frias-Staheli N, Giannakopoulos NV, Kikkert M, Taylor SL, Bridgen A, Paragas J, Richt JA, Rowland RR, Schmaljohn CS, Lenschow DJ, Snijder EJ, Garcia- Sastre A, Virgin HWt. 2007. Ovarian tumor domain-containing viral proteases evade ubiquitin- and ISG15-dependent innate immune responses. Cell host & microbe 2:404-416.

21. van Kasteren PB, Beugeling C, Ninaber DK, Frias-Staheli N, van Boheemen S, Garcia-Sastre A, Snijder EJ, Kikkert M. 2012. Arterivirus and nairovirus ovarian tumor domain-containing Deubiquitinases target activated RIG-I to control innate immune signaling. Journal of virology 86:773-785.

22. Snijder EJ, van Tol H, Roos N, Pedersen KW. 2001. Non-structural proteins 2 and 3 interact to modify host cell membranes during the formation of the arterivirus replication complex. The Journal of general virology 82:985-994.

23. Pedersen KW, van der Meer Y, Roos N, Snijder EJ. 1999. Open reading frame 1a- encoded subunits of the arterivirus replicase induce endoplasmic reticulum-derived double-membrane vesicles which carry the viral replication complex. Journal of virology 73:2016-2026.

24. Wassenaar AL, Spaan WJ, Gorbalenya AE, Snijder EJ. 1997. Alternative proteolytic processing of the arterivirus replicase ORF1a polyprotein: evidence that NSP2 acts as a cofactor for the NSP4 serine protease. Journal of virology 71:9313- 9322.

25. Ziebuhr J, Snijder EJ, Gorbalenya AE. 2000. Virus-encoded proteinases and proteolytic processing in the Nidovirales. The Journal of general virology 81:853- 879.

26. Knoops K, Barcena M, Limpens RW, Koster AJ, Mommaas AM, Snijder EJ. 2012. Ultrastructural characterization of arterivirus replication structures: reshaping

121

the endoplasmic reticulum to accommodate viral RNA synthesis. Journal of virology 86:2474-2487.

27. Faaberg KS, Plagemann PG. 1995. The envelope proteins of lactate dehydrogenase- elevating virus and their membrane topography. Virology 212:512-525.

28. Wang L, Zhou L, Zhang H, Li Y, Ge X, Guo X, Yu K, Yang H. 2014. Interactome profile of the host cellular proteins and the nonstructural protein 2 of porcine reproductive and respiratory syndrome virus. PloS one 9:e99176.

29. van der Meer Y, van Tol H, Locker JK, Snijder EJ. 1998. ORF1a-encoded replicase subunits are involved in the membrane association of the arterivirus replication complex. Journal of virology 72:6689-6698.

30. den Boon JA, Diaz A, Ahlquist P. 2010. Cytoplasmic viral replication complexes. Cell host & microbe 8:77-85.

31. Miller S, Krijnse-Locker J. 2008. Modification of intracellular membrane structures for virus replication. Nature reviews. Microbiology 6:363-374.

32. Han J, Rutherford MS, Faaberg KS. 2010. Proteolytic products of the porcine reproductive and respiratory syndrome virus nsp2 replicase protein. Journal of virology 84:10102-10112.

33. Kall L, Krogh A, Sonnhammer EL. 2004. A combined transmembrane topology and signal peptide prediction method. Journal of molecular biology 338:1027-1036.

34. Tusnady GE, Simon I. 2001. The HMMTOP transmembrane topology prediction server. Bioinformatics 17:849-850.

35. Bernsel A, Viklund H, Falk J, Lindahl E, von Heijne G, Elofsson A. 2008. Prediction of membrane-protein topology from first principles. Proceedings of the National Academy of Sciences of the United States of America 105:7177-7181.

36. Bernsel A, Viklund H, Hennerdal A, Elofsson A. 2009. TOPCONS: consensus prediction of membrane protein topology. Nucleic acids research 37:W465-468.

37. Viklund H, Elofsson A. 2008. OCTOPUS: improving topology prediction by two- track ANN-based preference scores and an extended topological grammar. Bioinformatics 24:1662-1668.

38. Viklund H, Elofsson A. 2004. Best alpha-helical transmembrane protein topology predictions are achieved using hidden Markov models and evolutionary information. Protein science : a publication of the Protein Society 13:1908-1917.

39. Shen H, Chou JJ. 2008. MemBrain: improving the accuracy of predicting transmembrane helices. PloS one 3:e2399.

122

40. von Heijne G, Gavel Y. 1988. Topogenic signals in integral membrane proteins. European journal of biochemistry / FEBS 174:671-678.

41. von Heijne G. 2011. Membrane proteins: from bench to bits. Biochemical Society transactions 39:747-750.

42. Rapp M, Granseth E, Seppala S, von Heijne G. 2006. Identification and evolution of dual-topology membrane proteins. Nature structural & molecular biology 13:112- 116.

43. Ott CM, Lingappa VR. 2004. Signal sequences influence membrane integration of the prion protein. Biochemistry 43:11973-11982.

44. Skach WR, Calayag MC, Lingappa VR. 1993. Evidence for an alternate model of human P-glycoprotein structure and biogenesis. The Journal of biological chemistry 268:6903-6908.

45. Zhang JT, Ling V. 1991. Study of membrane orientation and glycosylated extracellular loops of mouse P-glycoprotein by in vitro translation. The Journal of biological chemistry 266:18224-18232.

46. Lu Y, Turnbull IR, Bragin A, Carveth K, Verkman AS, Skach WR. 2000. Reorientation of aquaporin-1 topology during maturation in the endoplasmic reticulum. Molecular biology of the cell 11:2973-2985.

47. Lambert C, Prange R. 2003. Chaperone action in the posttranslational topological reorientation of the hepatitis B virus large envelope protein: Implications for translocational regulation. Proceedings of the National Academy of Sciences of the United States of America 100:5199-5204.

48. von Heijne G. 2006. Membrane-protein topology. Nature reviews. Molecular cell biology 7:909-918.

49. Ota K, Sakaguchi M, von Heijne G, Hamasaki N, Mihara K. 1998. Forced transmembrane orientation of hydrophilic polypeptide segments in multispanning membrane proteins. Molecular cell 2:495-503.

50. Li Y, Tas A, Snijder EJ, Fang Y. 2012. Identification of porcine reproductive and respiratory syndrome virus ORF1a-encoded non-structural proteins in virus-infected cells. The Journal of general virology 93:829-839.

51. Abell BM, Pool MR, Schlenker O, Sinning I, High S. 2004. Signal recognition particle mediates post-translational targeting in eukaryotes. The EMBO journal 23:2755-2764.

52. Abell BM, Rabu C, Leznicki P, Young JC, High S. 2007. Post-translational integration of tail-anchored proteins is facilitated by defined molecular chaperones. Journal of cell science 120:1743-1751.

123

53. Brambillasca S, Yabal M, Makarow M, Borgese N. 2006. Unassisted translocation of large polypeptide domains across phospholipid bilayers. The Journal of cell biology 175:767-777.

54. Brambillasca S, Yabal M, Soffientini P, Stefanovic S, Makarow M, Hegde RS, Borgese N. 2005. Transmembrane topogenesis of a tail-anchored protein is modulated by membrane lipid composition. The EMBO journal 24:2533-2542.

55. Nagai K, Oubridge C, Kuglstatter A, Menichelli E, Isel C, Jovine L. 2003. Structure, function and evolution of the signal recognition particle. The EMBO journal 22:3479-3485.

56. Leznicki P, Clancy A, Schwappach B, High S. 2010. Bat3 promotes the membrane integration of tail-anchored proteins. Journal of cell science 123:2170-2178.

57. Mariappan M, Li X, Stefanovic S, Sharma A, Mateja A, Keenan RJ, Hegde RS. 2010. A ribosome-associating factor chaperones tail-anchored membrane proteins. Nature 466:1120-1124.

58. Leznicki P, Roebuck QP, Wunderley L, Clancy A, Krysztofinska EM, Isaacson RL, Warwicker J, Schwappach B, High S. 2013. The association of BAG6 with SGTA and tail-anchored proteins. PloS one 8:e59590.

59. Wang Q, Liu Y, Soetandyo N, Baek K, Hegde R, Ye Y. 2011. A ubiquitin ligase- associated chaperone holdase maintains polypeptides in soluble states for proteasome degradation. Molecular cell 42:758-770.

60. Hessa T, Sharma A, Mariappan M, Eshleman HD, Gutierrez E, Hegde RS. 2011. Protein targeting and degradation are coupled for elimination of mislocalized proteins. Nature 475:394-397.

61. Lee JG, Ye Y. 2013. Bag6/Bat3/Scythe: a novel chaperone activity with diverse regulatory functions in protein biogenesis and degradation. BioEssays : news and reviews in molecular, cellular and developmental biology 35:377-385.

62. Rapoport TA. 2007. Protein translocation across the eukaryotic endoplasmic reticulum and bacterial plasma membranes. Nature 450:663-669.

63. Sasaki T, Marcon E, McQuire T, Arai Y, Moens PB, Okada H. 2008. Bat3 deficiency accelerates the degradation of Hsp70-2/HspA2 during spermatogenesis. The Journal of cell biology 182:449-458.

64. Corduan A, Lecomte S, Martin C, Michel D, Desmots F. 2009. Sequential interplay between BAG6 and HSP70 upon heat shock. Cellular and molecular life sciences : CMLS 66:1998-2004.

124

65. Kang SW, Rane NS, Kim SJ, Garrison JL, Taunton J, Hegde RS. 2006. Substrate-specific translocational attenuation during ER stress defines a pre-emptive quality control pathway. Cell 127:999-1013.

66. Abell BM, Jung M, Oliver JD, Knight BC, Tyedmers J, Zimmermann R, High S. 2003. Tail-anchored and signal-anchored proteins utilize overlapping pathways during membrane insertion. The Journal of biological chemistry 278:5669-5678.

67. van Geest M, Lolkema JS. 2000. Membrane topology and insertion of membrane proteins: search for topogenic signals. Microbiology and molecular biology reviews : MMBR 64:13-33.

68. Walter P, Johnson AE. 1994. Signal sequence recognition and protein targeting to the endoplasmic reticulum membrane. Annual review of cell biology 10:87-119.

69. von Heijne G. 1985. Signal sequences. The limits of variation. Journal of molecular biology 184:99-105.

70. Seppala S, Slusky JS, Lloris-Garcera P, Rapp M, von Heijne G. 2010. Control of membrane protein topology by a single C-terminal residue. Science 328:1698-1700.

71. White SH, von Heijne G. 2008. How translocons select transmembrane helices. Annual review of biophysics 37:23-42.

72. Fadouloglou VE, Glykos NM, Kokkinidis M. 2000. A fast and inexpensive procedure for drying polyacrylamide gels. Analytical biochemistry 287:185-186.

125

CHAPTER 5. GENERAL CONCLUSIONS

The focus of this thesis was centered on investigations into the molecular biology of

PRRSV nsp2. The unique attributes of nsp2 including its large size, genetic heterogeneity, immunosuppressive functionality, and essential activities supporting viral replication made the nsp2 an intriguing target to study. At the core of the original hypothesis was the intent to identify a possible mechanism that could potentiate the high rate of mutation within the nsp2 hypervariable domain (HV). A set of custom antibodies targeting conserved regions of the four domains of nsp2 [PLP2 protease (OTU), HV, transmembrane (TM) domain, and the C- termini] were utilized with a highly stringent virus purification strategy to define the packaging of nsp2 and an abundant population of subdominant nsp2 isoforms. Comparison of western blot analysis of infected cell lysates versus highly purified virions showed the enrichment of many lower molecular weight nsp2 isoforms within the purified virion. Both

α-OTU and α-HV antibodies positively and selectively detected nsp2 on purified virions by immunoelectron microscopy (IEM); however, the TM and C-terminal domains were unable to be efficiently detected by IEM. These data suggested nsp2 maintained an N-terminal ectodomain on the virion surface and possibly associated with the viral envelope through the putative TM region. Immunofluorescence assay (IFA) detected the OTU, HV and C-terminal domains within infected cells, but the TM domain could not be labeled, further suggesting the TM domain was functional and that the target epitope was unavailable for detection by antibody labeling. Interestingly, IFA also showed differential localization patterns of nsp2 depended on which epitope was targeted. The N-terminal OTU domain displayed a diffuse cytoplasmic and perinuclear localization pattern whereas the C-terminal domain appeared

126 highly restricted to the perinuclear region. It is postulated that nsp2 isoforms lacking the TM domain are able to differentially localize throughout the cytoplasmic space to regulate non- membrane associated host processes such as the defined PLP2 OTU downregulation of RIG-I signaling (1).

We next sought to characterize the TM domain of nsp2 because, while the membrane association of nsp2 appears critical for the activities of nsp2 both intracellularly and for packaging, the functionality of the TM domain or the resulting topology had never been assessed. Nsp2 was found to strongly associate with the membrane fraction. Surprisingly, in addition to the full-length nsp2, two lower molecular weight isoforms (117 and 106 kDa) were enriched within the membrane fraction. Enrichment of these subdominant isoforms suggests a stronger association with the membrane. While the composition of these enriched isoforms are unknown, curiously, the recently described translational isoform (nsp2-TF) resulting from a -2 ribosomal frame shift within the putative TM1 helix yields a much stronger hydrophobic domain. Further analysis of the membrane associated fraction by protease protection assay (proteinase K) and immunoprecipitation (α-FLAG) conclusively defined nsp2 as an integral membrane protein and additionally demonstrated that nsp2 integrated in an unexpected topological orientation within the in vitro cell-free translation system. Nsp2 integrates within the microsomal membranes with the N- and C-terminus on opposite sides of the membrane whereas the C-termini was transported across the membrane surface into the luminal side of the microsomes. This out/in topology of nsp2 has important implications on the polyprotein processing cascade, specifically the mechanism of cleavage of the nsp2↓nsp3 junction (cis versus trans) as well as the topological orientation of downstream replicase proteins.

127

REFERENCES

1. van Kasteren PB, Beugeling C, Ninaber DK, Frias-Staheli N, van Boheemen S, Garcia-Sastre A, Snijder EJ, Kikkert M. 2012. Arterivirus and nairovirus ovarian tumor domain-containing Deubiquitinases target activated RIG-I to control innate immune signaling. Journal of virology 86:773-785.