View, See [62]), As Well

G Protein Coupling and Regulation of Metabotropic Glutamate Receptor 6

Liantian Tian

Kent State University

May 2010

Dissertation written by

Liantian Tian

B.S., West China University of Medical Sciences, 2000

Ph.D., Kent State University, 2009

Approved by

______Dr. Mary Cismowski, Advisor ______Dr. Paul Kammermeier, Co-Advisor ______Dr. Kathleen Doane Member, Doctoral Dissertation Committee ______Dr. Mark Simmons Member, Doctoral Dissertation Committee ______Dr. June Yun Member, Doctoral Dissertation Committee

Accepted by

Director, School of Biomedical Sciences Dr. Robert Dorman Dean, College of Arts and Sciences Dr. John Stalvey

Table of Contents

List of Figures...... vi

List of Tables ...... ix

List of Abbreviations ...... x

Chapter I ...... 1

A. Mammalian retina cellular organization...... 1

B. Classification of bipolar cells and their roles in visual signal transduction...... 2

C. Metabotropic glutamate receptors...... 4

D. Accessory proteins in GPCR signaling...... 11

E. Hypothesis and Thesis Work...... 12

Chapter II ...... 14

A. Introduction...... 14

B. Methods...... 15

2.1 Reconstitution protocol...... 15

2.2 SCG isolation and cDNA injection...... 17

2.3 Patch-clamp electrophysiology...... 18

2.4 Single cell RT-PCR...... 19

2.5 Rat retinal bipolar cell isolation and identification...... 21

C. Results...... 22

2.1 Calcium current inhibition in SCG neurons by heterologously expressed

mGluR6...... 22

iii

2.2 Reconstitution of mGluR6 coupling to Gαi/o proteins...... 25

2.3 Examination of endogenous expression of mGluR6 and Gα proteins in bipolar

cells using single-cell RT-PCR...... 27

Chapter III...... 36

A. Introduction...... 36

B. Methods ...... 38

3.1 Yeast two-hybrid screening procedure...... 38

3.2 Construction of two-hybrid screening library...... 39

3.3 Construction of bait plasmids...... 41

3.4 Yeast two-hybrid screening...... 42

3.5 Calculation of mating efficiency and number of clones screened...... 44

3.6 β-galactosidase activity assay (LacZ assay)...... 45

3.7 Verification of plasmids and subsequent sequencing analysis...... 45

3.8 Specificity of potential interacting proteins...... 46

3.9 Amplification of additional (non-CIP98) library targets...... 47

C. Results ...... 51

3.1 Quality of retinal cDNA library...... 51

3.2 Yeast two-hybrid screening results...... 53

3.3 Secondary tests on yeast two-hybrid clones with mGluR6...... 63

Chapter IV...... 71

A. Introduction: Rationale for focusing on CIP98 as a putative mGluR6 regulator..... 71

B. Methods...... 73

4.1 Plasmid construction...... 73

4.2. mRNA expression of targeted genes in ON bipolar cells...... 79

4.3. SCG isolation and cDNA injection...... 80

4.4. Functional characterization of mGluR6/CIP98 interaction in rat sympathetic

neurons...... 80

4.5. Cell culture and transfection...... 81

4.6. Cell lysis, Immunoprecipitation and Immunoblotting...... 81

4.7. RNA extraction and qPCR analysis...... 83

4.8. Immunofluorescence...... 85

C. Results...... 86

4.1 Examination of expression of CIP98 in bipolar cells and retina...... 86

4.2. Functional analysis of different CIP98 constructs in the SCG reconstitution

system...... 87

4.3. Are mGluR6 and CIP98 endogenously expressed in HEK293 cells?...... 89

4.4 Do mGluR6 and CIP98 co-immunoprecipitate? ...... 90

4.5. mGluR6 co-localizes with CIP98 in HEK293 cells...... 103

Chapter V...... 117

References...... 128

List of Figures

Fig.1.1. Schematic figure of retina cellular organization (obtained and modified from

Webvision, The organization of the Retina and Visual System,

http://webvision.med.utah.edu/, with kind permission from Dr. Helga Kolb)...... 3

Fig. 2.1. Calcium current in SCG neurons was inhibited via activated mGluR6...... 23

Fig. 2.2. mGluR6 couples to PTX-insensitive Goa and Gob in SCG reconstitution system.

...... 30

Fig. 2.3. mGluR6 couples moderately to Gαi1, weakly to Gαi2 and Gαi3, but not the

other Gα proteins in reconstitution system...... 32

Fig. 2.4. Retinal ON bipolar cells express Gαo, Gαi2, but not Gαi1 or Gαi3...... 33

Fig. 2.5. Gαi1-3 were detected in SCGs using single-cell RT-PCR...... 35

Fig. 3.1. Flow chart of the yeast two-hybrid screening procedure...... 38

Fig. 3.2. Samples of randomly selected rat retinal cDNA library components digested

with restriction enzyme HindIII and analyzed using 1% agarose gel...... 52

Fig. 3.3. Example of a β-galactosidase activity assay with clones isolated in yeast two-

hybrid screening using the second intracellular loop of mGluR6 as bait...... 55

Fig. 3.4. β-galactosidase activity assay with clones isolated in yeast two-hybrid screening

using the third intracellular loop of mGluR6 as bait...... 58

Fig. 3.5. β-galactosidase activity assay with clones isolated in yeast two-hybrid screening

using the extreme C-terminus of mGluR6 as bait. clones...... 61

Fig. 3.6. Representative yeast growth assays of secondary tests to illustrate judgment of

yeast growth...... 64

Fig. 4.1. Schematic figure of CIP98 and the three constructs isolated in yeast two hybrid

screen...... 72

Fig. 4.2. CIP98 expression in the rat retina...... 88

Fig. 4.3. Effect of CIP98 coexpression on mGluR6 signaling in isolated SCG neurons.

Effects are measured as the percentage inhibition of calcium current upon activation

of mGluR6 by L-glutamate...... 91

Fig. 4.4. Standard curves for CIP98 and mGluR6 using qPCR analysis...... 94

Fig. 4.5. Image of HEK293 cells transfected with pEGFP-N1...... 96

Fig. 4.6. Immunoblotting of HEK293 cells...... 97

Fig. 4.7. Co-immunoprecipitation of HA-mGluR6 with Xpress-CIP98 130-860 with 2 µg

anti-Xpress antibody following incubation with 500 µg of HEK 293 cell lysates

expressing HA-mGluR6 or/and Xpress-CIP98 130-860 (indicated as “-” and “+” in

the figure)...... 100

Fig. 4.8. Immunoblot showing the result of co-immunoprecipitation experiment of HA-

mGluR6 with CIP98 542-920 with 2 µg anti-HA antibody following incubation with

500 µg of HEK 293 cell lysates expressing HA-mGluR6 or/and CIP98 542-920

(indicated as “-” and “+” in the figure)...... 101

vii

Fig. 4.9. Immunoblot showing the result of co-immunoprecipitation experiment of HA-

mGluR6 with Xpress-CIP98 130-860 with 2 µg anti-Xpress antibody following PTX

treatment overnight...... 104

Fig. 4.10. Immunoblot showing the result of co-immunoprecipitation experiment of HA-

mGluR6 with Xpress-CIP98 130-860 with 2 µg anti-HA antibody following

incubation with 1 mg of HEK 293 cell lysates treated with GTPγS...... 105

Fig. 4.11. Effects of different fixation condition on HEK293 cells...... 106

Fig. 4.12. Optimized fixation and permeabilization conditions for HEK293 cells...... 109

Fig. 4.13. Analysis of signal bleed-through in immunofluorescence experiments...... 111

Fig. 4.14. Expression pattern of Xpress-CIP98 130-860 following co-transfection with

HA-mGluR6 or HA-mGluR2...... 115

viii

List of Tables

Table 2.1. RT-PCR primers and expected product sizes...... 20

Table 3.1. PCR primers for baits construction in yeast two-hybrid screening...... 43

Table 3.2. PCR primers for the construction of intracellular loops of mGluRs...... 48

Table 3.3. Identity of randomly selected rat retinal cDNA library components...... 51

Table 3.4. Sequence identification of 22 clones from mGluR6 second intracellular loop

screen. Accession number: NCBI accession number...... 56

Table 3.5. Sequence identification of 23 clones from mGluR6 third intracellular loop

screen. Accession number: NCBI accession number...... 59

Table 3.6. Sequence identification of 14 clones from mGluR6 C-terminus screen.

Accession number: NCBI accession number...... 62

Table 3.7. Secondary test results of clones identified from three screens. Clone IDs are

the same as in Tables 3.4-3.6. mGluR6 baits used (Screen) and growth scores are

listed...... 66

Table 3.8. Secondary test results of clones that do not show non-specific interaction with

negative controls...... 70

Table 4.1. qPCR primers...... 85

List of Abbreviations

ONL outer nuclear layer

INL inner nuclear layer

GCL ganglion cell layer

OPL outer plexifom layer

G protein guanosine nucleotide-binding protein

GPCR G protein coupled receptor mGluRs metabotropic glutamate receptors

PTX pertussis toxin

CNS central nervous system

SCG Superior Cervical Ganglion

Glu L-glutamate

L-AP4 L-2-amino-4-phosphonobutyrate

MMLV Moloney murine leukemia virus

QDO quadruple dropout

SD–LT Leu, Trp dropout

Kan Kanamycin

Amp ampicilin

E. coli Escherichia coli

CarkL Carbohydrate kinase-like

Clic1 chloride intracellular channel 1

CIP98 CASK-interacting protein

PSD95 post synaptic density protein PDZ

DlgA Drosophila disc large tumor suppressor zo-1 zonula occludens-1 protein

PDZ PSD95, DlgA and zo-1

VLGR Very Large G protein coupled Receptor

CNS central nervous system

HA Hemagglutinin epitope

PCR Polymerase chain reaction

RT-PCR reverse transcriptase PCR

HEK293 Human embryonic kidney 293

IP immunoprecipitation

SDS–PAGE SDS-polyacrylamide gel

Acknowledgements

First of all, I would like to express my most sincere appreciation to my advisors, Dr.

Mary Cismowski and Dr. Paul Kammermeier, for their continuous guidance and encouragement all through my graduate studies, for their patience, time, and advice. I consider myself extremely fortune to have had the opportunity of working with them and learning from their wealth of knowledge, experience, and wisdom.

I would also like to thank and acknowledge the members of my dissertation committee:

Dr. Kathleen Doane, Dr. Mark Simmons, and Dr. June Yun for their enthusiasm and support throughout my study. Their encouragement, valuable comments, scientific and moral support are invaluable and greatly appreciated.

I am grateful to Dr. Derek Damron for his precious time, for participation my defense and comments on my research. Also, I greatly appreciate the help and technical support from Xiaojin

Zhang, Elena Bocola-Mavar, Daria Krenitsky, Danold Beqollari, Huiyan Ma, and Aaron West.

I am thankful for the Department of Biomedical Sciences of Kent State University,

Pharmacology program of NEOUCOM, University of Rochester Medical center, and Nationwide

Children’s Hospital for support expressed through the teaching and research fellowships, valuable lab facilities, and assistance through my study. Especially, I would like to thank Dr. Pamela

Lucchesi for her valuable advices and support, Dr. Maqsood Chotani and Dr. Selvi Jeyaraj for their advices. My thanks also goes to Dr. Kamermans for his kind help with TRPM1 articles.

Last but not the least I wish to thank my family and friends for their constant support and

encouragement.

xii

DEDICATION

This dissertation is dedicated to:

My parents

for their unconditional love and support over the years

xiii Chapter I

Introduction

A. Mammalian retina cellular organization.

The retina is a complex neural tissue which lies in the back of the eye. It mediates

visual transmission and is characterized by its laminar arrangement of three nuclear and

two plexiform layers, as well as the interweaving of six major classes of retinal cells

(photoreceptors, Müller cells, horizontal cells, bipolar cells, amacrine cells, and ganglion

cells). As seen in Fig.1, the bodies of these cells are organized into three nuclear layers,

the outer nuclear layer (ONL), inner nuclear layer (INL) and ganglion cell layer (GCL),

respectively, from the distal to the proximal. The majority of the synapses formed among

those cells are within two plexiform layers, the distal outer plexifom layer (OPL) and the

proximal inner plexiform layer (IPL) [1, 2]. The cell bodies of photoreceptors (rods and cones) reside in the ONL, and the bipolar cells and amacrine cells are located in the distal and proximal half of the INL, respectively. Ganglion cell bodies are found in the GCL, and Müller cells expand the thickness of the retina with their nuclei always located in the middle section of the INL (Fig. 1.1). The majority of synapses seen at the OPL level are synapses formed by photoreceptors with bipolar cells and/or horizontal cells. Synaptic contacts at the IPL are more complex than at the OPL, involving bipolar cells, amacrine cells and also ganglion cells [1, 3]. 1

Light travels through the full thickness of retina from the proximal to the distal

part to activate photoreceptors (Fig.1.1). Meanwhile, the visual signal is transmitted in the reverse direction, from photoreceptors through the succeeding neurons to ganglion cells to the brain. Visual transmission starts with two distinct types of photoreceptors, the rods and cones. They are both hyperpolarized in the presence of light, decreasing release of their neurotransmitter glutamate. Cones promote daylight vision when there are abundant photons, and are responsible for color vision and perception of details temporally and spatially. Rods, on the other hand, mediate visual transmission under starlight or twilight when few photons are available [4].

B. Classification of bipolar cells and their roles in visual signal transduction.

Retinal bipolar cells, which play an important role in mediating light

transmission, can be classified in different ways. In terms of forming synapses with

photoreceptors (rods and cones), they are classified into two types – rod bipolar cells

which synapse with rod photoreceptors and cone bipolar cells which form synaptic

contacts with cone photoreceptors [1]. However, from the perspective of mediating light

transmission and different visual information pathways, they are classified as ON bipolar

cells (including all rod bipolar cells and ON cone bipolar cells) and OFF bipolar cells

(OFF cone bipolar cells).

In the mammalian retina, visual transmission is organized in two different

pathways, termed the ON and OFF pathways, which are segregated at the level of bipolar

cells. The ON pathway is evoked by an increase in illumination (light onset) and

mediated through ON bipolar cells. The OFF pathway is activated by a decrease in light

Light

Fig.1.1. Schematic figure of retina cellular organization (obtained and modified from

Webvision, The organization of the Retina and Visual System,

http://webvision.med.utah.edu/, with kind permission from Dr. Helga Kolb). ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer.

(light termination) and mediated by OFF bipolar cells [5-11]. In the cone system, light onset hyperpolarizes photoreceptors (cones), thus reducing glutamate release from these cells. This in turn depolarizes ON cone bipolar cells which leads to glutamate release from ON bipolar cells to activate ON center ganglion cells and the ON pathway. At the same time, this decrease in glutamate release from cones cause hyperpolarization of OFF cone bipolar cells which synapse with OFF center ganglion cells.

Visual signal transmission in the rod system is more complicated than that in the cone system [4, 16-19]. Mammalian rods are thought to form invaginating synapses with the dendrites of rod bipolar cells, which are all ON bipolar cells and in turn synapse with a subset of amacrine cells. It is at these synapses where released glutamate hyperpolarizes the postsynaptic membrane. The amacrine cells then depolarize ON cone bipolar cells, and activate ON center ganglion cells and the ON pathway. However, the amacrine cells also inhibit OFF cone bipolar cells and OFF center ganglion cells through inhibitory synapses. Therefore visual transmission is separated, as ON bipolar cells activate ON center ganglion cells and the ON pathway and OFF bipolar cells activate OFF center ganglion cells and the OFF pathway.

C. Metabotropic glutamate receptors.

L-glutamate is the major excitatory neurotransmitter in the mammalian central nervous system (CNS) [5-7]. The effect of glutamate is mediated by two classes of receptors: ionotropic and metabotropic receptors. ON bipolar cells express the metabotropic glutamate receptor subtype 6 (mGluR6) together with a subset of ionotropic

glutamate receptors while OFF bipolar cells contain a diversity of ionotropic glutamate receptors but no detectible mGluR6 [8-12].

The ionotropic glutamate receptors consist of N-methyl-D-aspartate (NMDA), α-

amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA), and kainite receptors [7].

Unlike ionotropic receptors, which are glutamate gated cation-specific ion channels and mediate fast excitatory response [7, 13], metabotropic receptors (mGluRs) are G protein

coupled receptors (GPCRs) that exert their effect via interacting with membrane bound

heterotrimeric guanosine nucleotide-binding protein (G protein) and function through a

variety of intracellular effectors [7, 14]. To date eight metabotropic glutamate receptors

(mGluR1 to mGluR8) have been cloned and characterized [15].

Metabotropic glutamate receptors are members of the Class C family of GPCRs, characterized by putative seven transmembrane domains preceded by a large extracellular

domain [15-17]. Investigations using a series of chimeric receptors constructed from

mGluR1 and mGluR2, which have distinct selectivity towards their own specific

agonists, have demonstrated that this large extracellular domain is important in

determining agonist selectivity [17]. mGluRs can be divided into three distinct subgroups according to their sequence homology, pharmacological properties and G protein

coupling profiles [15]. Group I mGluRs, comprising mGluR1 and mGluR5 are coupled to

Gq heterotrimers and activation increases intracellular Ca2+, activating the

phosphatidylinositol hydrolysis signal cascade [18-20]. Group II mGluRs, comprising

mGluR2 and mGluR3, are coupled to the inhibitory G protein (Gi), and activation is

linked to the inhibition of cyclic AMP signaling [21-24]. The remaining four mGluRs –

mGluR4, mGluR6, mGluR7, and mGluR8 – belong to Group III and are coupled with

inhibitory Gi/o signaling pathways [25, 26]. Other than differences in signaling, the

different groups of mGluRs have distinct selective agonists. Quiasqualate has strong

selectivity for Group I mGluRs, (2R,4R)-4-aminopyrrolidine-2,4-dicarboxylate potently

activates Group II mGluRs, while L-2-amino-4-phosphonobutyrate (L-AP4) is specific

for Group III mGluRs [18-20, 25, 26].

In the retina, glutamate is released by both photoreceptors and bipolar cells.

Glutamate is released by photoreceptors to bipolar cells and horizontal cells in the OPL,

and by bipolar cells to amacrine cells and ganglion cells in the IPL [3]. Early

investigations regarding the physiological effect of glutamate in retina focused on

ionotropic glutamate receptors, but later studies supported the hypothesis that

metabotropic glutamate receptors play a very important role in mediating retinal synaptic

neurotransmission. One of the glutamate receptors found in the retina was first thought to be an ionotropic glutamate receptor [6], but later identified as the metabotropic glutamate receptor mGluR6 [10, 11, 27]. This receptor binds 2-amino-4-phosphonobutyrate (APB) and hence was initially named the APB receptor [27-30]. It was shown that an APB- sensitive receptor is responsible for the neurotransmission from photoreceptors to both types of ON bipolar cells, i.e. rod bipolar cells and cone ON bipolar cells [30]. This APB receptor was later suggested to belong to the metabotropic glutamate receptor family, as an mGluR-specific agonist caused a very similar effect as APB and mimicked the effect of glutamate at the ON bipolar synapse [31].

Messenger RNA for several metabotropic glutamate receptors has been reported

in different retinal cells. mGluR5 mRNA has been detected in horizontal cells located in

the outer part of the inner nuclear layer, and mGluR8 mRNA has been detected in both

the INL and GCL of retina. In addition, a subset of amacrine cells expresse mGluR1,

mGluR2, mGluR4, and mGluR7 mRNA; mGluR1 and mGluR4 are both expressed in

ganglion cells, and mGlurR6 is strongly expressed in bipolar cells [10, 22, 27, 32-34].

These expression patterns strongly suggest that metabotropic glutamate receptors are

important in mediating synaptic neurotransmission in retina, and likely to have distinct

roles in different cell types of the retina.

mGluR6 was first identified in a rat retinal cDNA library based on its ability to

cross-hybridize with probe derived from mGluR1 [10]. The isolated mGluR6 coded for a

protein of 871 amino acid residues with a calculated molecular weight of 95,084 [10].

Like the other mGluRs, mGluR6 contains a putative seven transmembrane domain and a

large extracellular domain (579 amino acids) [10]. The mGluR6 protein shares the

strongest sequence homology to mGluR4, with a 70% sequence identity and 83% identity if conservative substitutions are included. Using RNA hybridization analysis, mGluR6 mRNA expression was found to be restricted to the retina. Further examination of its

localization in the rat eye by in situ hybridization showed that mGluR6 mRNA was found

exclusively in the INL, where ON bipolar cell are known to be located [10]; the staining

was especially dense in the outer part close to the OPL where bipolar cells make synapses

with photoreceptors. Within the INL, mGluR6 expression is restricted to the postsynaptic

site of both rod bipolar cells and the subset of the cone bipolar cells which form ribbon

synapses instead of flat contacts [11, 35], indicating that these cone bipolar cells

expressing mGluR6 are ON bipolar cells [36, 37]. These data suggest mGluR6 is

responsible for neurotransmission from photoreceptors to bipolar cells.

More evidence indicating the role of mGluR6 in the ON response was generated

using mGluR6 gene modified animals. In mice lacking mGluR6 expression, retinal cellular organization and the neuronal projection of the optic fibers to the brain were not

affected [38, 39]. However, these animals had impaired synaptic transmission in ON bipolar cells, represented by abnormalities in their electroretinogram (ERG), while the

OFF response was intact [39]. Interestingly, in behavioral analyses of visual function in

these knock-out mice in response to light stimulation, such as shuttle box avoidance

learning analysis in conjunction with light exposure, mGluR6 deficient animals did not

show any significant differences compared to wild type animals, indicating these mutant

animals are capable of perceiving visual input [39]. However, mGluR6 deficiency

markedly reduced the sensitivity of papillary responses to light stimulation and greatly

impaired the animals’ ability to detect visual contrast [40]. Take together, these studies

demonstrate that mGluR6 is essential in synaptic transmission from photoreceptors to ON

bipolar cells.

Nomura, et al., examined the developmental expression of mGluR6 in the rat

retina [11]. They found both temporal and spatial changes in mGluR6 expression, with

increased mGluR6 localization to dendritic processes of bipolar cells as the animals

progressed from postnatal day 6 to day 28. In single rod bipolar cells isolated from 18-

day old rats, mGluR6 immunostaining was predominantly detected at the dentritic tips

while PKC staining, which is a marker for rod bipolar cells, is diffused throughout the

soma, dentrites, and axons [11]. In RCS rats with inherited retinal dystrophy, the retinal

pigment epithelium has impaired capacity for growing photoreceptor outer segments,

leading to the loss of photoreceptors within the first 3 months following an initial 3-week

postnatal normal development of the retinal cellular organization [41]. Photoreceptor

degeneration develops until both the outer nuclear layer (ONL) and OPL were not

observed in rats at 6 months. In the 21 day old RCS rat retina, most of the mGluR6

immunostaining was comparable to that seen in normal rat, with a punctate pattern and restricted distribution at the OPL [11]. By 6 months, mGluR6 remained in the retina, but the punctate staining of mGluR6 at the OPL became rare and mGluR6 immunoreactivity was more diffusely distributed at the soma of the bipolar cells [11]. These data suggest

that expression of mGluR6 in the retina is independent of the intactness of

photoreceptors, but its trafficking from the soma of the cells to the tips of the dentrites is

a functional process and is related to normal retinal function.

In order to characterize the signal transduction properties of mGluR6, the direct adenylyl cyclase activator forskolin was used. Forskolin-stimulated cAMP accumulation was examined in Chinese hamster ovary cells stably expressing mGluR6; in these studies

L-glutamate induced a dose-dependent inhibition of cAMP accumulation [10]. In another set of experiments testing different agonists, L-AP4 was the most efficient among all the agonists with an EC50 value of 0.9 μM [10]. Pertussis toxin (PTX) catalyzes ADP- ribosylation of Gi/o members of the heterotrimeric G protein superfamily, resulting in

uncoupling of these G proteins from their receptors [42, 43]. To investigate the G protein

coupling of mGluR6, the effects of PTX on mGluR6 mediated signaling was examined.

PTX pretreatment prior to the addition of forskolin and L-glutamate greatly increased the

L-glutamate mediated inhibition of forskolin-induced accumulation of cAMP in a dose-

dependent manner, indicating that the mGluR6 response to agonist is likely mediated by one or more PTX-sensitive G proteins [10].

The downstream signals following mGluR6 activation and subsequent G protein

activation include closure of a cation channel in ON bipolar cells and subsequent ON bipolar cell hyperpolarization [44]. Initially it was thought that mGluR6 might adopt the same signaling cascade as the phototransduction cascade which includes a glutamate receptor, a G protein (transducin), PDE, cGMP, and a cGMP gated channel. However, immunostaining for these elements in ON bipolar cells was negative while the antibodies reacted strongly in rods [45], indicating that these components might not be involved in the mGluR6 signaling cascade. More evidence showed that introduction of the PDE inhibitor 3-isobutyl-1-methyl-xanthine (IBMX) into ON bipolar cells through a patch pipette did not affect the response to L-glutamate, suggesting that PDE was not required

for mGluR6 signal transduction [44]. In addition, the subcellular localization of Gαo was defined by immunocytochemistry combined with electron microscopy in different species

[46]. The overall localization pattern is well conserved among mammalian species, with

the strongest distribution in dendrites of ON bipolar cells and moderate expression in

their soma [46]. In monkey and cat, Gαo is detected in the dendritic tips of rod bipolar

cells, and cone bipolar cells which form an invagination with the cone terminal, indicating these cone bipolar cells are ON bipolar cells, while those cone bipolar cells

without Gαo staining form flat contacts with the cones, indicative of OFF cone bipolar

cells [47]. The expression pattern of Gαo in bipolar cells corresponds closely to that of

mGluR6, with a more broad distribution, indicating Gαo might be a strong candidate for

coupling to mGluR6 signaling cascade [35, 46, 48, 49]. Recently, the cation channel was

identified as TRPM1 (transient receptor potential channel, subfamily M, member 1) [50-

53]. In human retina, TRPM1 is localized to the dendritic site of ON bipolar cells [50]

where mGluR6 locates [11], and TRPM1 knock out mice lack ON bipolar response in

ERGs [53]. Furthermore, mutations in TRPM1 have been detected in a subtype of

congenital stationary night blindness [50, 52] where mutations in GRM6 which encodes

mGluR6 are also found [54-56].

D. Accessory proteins in GPCR signaling.

GPCR signaling pathways are a major mechanism for transducing signals from

the extracellular to the intracellular environment. Upon agonist activation, the signals generated by GPCRs are rarely transduced through a linear pathway, and each step in the

GPCR signaling cascade has the potential to be regulated in order to fine-tune and properly direct the signals. The loss of this regulation, leading to inappropriate activation

or inactivation of GPCR signaling cascades, is strongly implicated in a variety of human diseases. Somatic mutations of genes coding for key signaling components, such as receptor or heterotrimeric Gα, have been implicated as causative factors for some diseases [57, 58]. For others, the mechanisms underlying aberrant G-protein mediated

signaling are not as clear [59-61].

The identification of cell-specific cross talk between GPCR and other signaling

pathways such as those involving receptor tyrosine kinases (for review, see [62]), as well

as evidence for GPCR pathway activation in the absence of agonist (reviewed in [63]and

[64]), strongly suggest the presence of cell-specific signal regulators. In addition, it is also becoming clear that GPCR trafficking to and from the cell surface is influenced by the presence or activity of multiple intracellular regulators (reviewed in [65] and [66]; also see Chapter III for a discussion of known mGluR-specific regulators). Known

examples of proteins that directly regulate GPCR trafficking and/or function include

cytosolic enzymes such as protein kinase A and protein kinase C, which phosphorylate

GPCRs and initiate downstream signaling cascades [67, 68], G-protein coupled receptor kinases (GRKs), which mediate phosphorylation and desensitization of agonist activated

β-adrenergic receptors [69, 70], β-arrestins, which bind to GRK-phosphorylated GPCRs

and thus uncouple the receptor from its cognate G proteins [70], and receptor activity

modifying proteins (RAMPs), which directly interact with the calcitonin receptor-like

receptor (CRLR) and assist in trafficking, proper folding and agonist regulation of this

receptor [71].

E. Hypothesis and Thesis Work.

The major hypothesis of my thesis work is that mGluR6 localization and function

is dependent upon its association with specific G protein heterotrimers and specific

intracellular accessory proteins. To address this hypothesis, I first used a neuronal

reconstitution system to identify specific G protein heterotrimers that are capable of

activating rat mGluR6 (Chapter II). I then used a yeast two-hybrid assay to identify

proteins from the rat retina that specifically interacted with the intracellular domains of rat mGluR6 (Chapter III). One of the proteins identified from this yeast two-hybrid screen (CIP98), was then characterized for its ability to interact with, and modulate,

mGluR6 function (Chapter IV).

Chapter II

This chapter is derived from my published paper [72], with minor changes to adapt to

the format of the dissertation.

G protein coupling profile of mGluR6

A. Introduction.

mGluRs belong to the class C G protein coupled receptor superfamily. Eight

mGluRs (mGluR1-8) have been classified into three groups based on their sequence

homology, pharmacological properties, and coupling to G proteins [15]. The most

specialized member of this family of receptors is mGluR6, a Group III mGluR, which in

mammals exhibits high expression levels only in retinal ON bipolar cells [10, 11]. There,

mGluR6 acts as the primary post-synaptic receptor for glutamate, which it receives via

direct input from retinal photoreceptor cells. In ON bipolar cells, activation of mGluR6

by glutamate initiates a signaling cascade that ultimately results in inhibition of a cation channel, inducing hyperpolarization of the cells [73]. Because retinal photoreceptor cells

release glutamate in the absence of light input, ON bipolar cells are depolarized in response to light.

In the past decade, several studies have examined the mechanism of action of

mGluR6 in ON bipolar cells. Group III mGluRs couple exclusively to the PTX- 14

sensitive family of G proteins (Gαi/o), but the signaling cascade resulting in cation

channel inhibition by mGluR6 in ON bipolar cells proceeds primarily through the G

protein Gαo [44, 74-76], with little involvement of GαTr (transducin) [44], though both

are members of the Gαi/o family. Indeed, because Gαoa is the dominant splice variant in

ON bipolar cells, this subtype appears to mediate the primary signaling cascade of

mGluR6 [75]. However, many details about the signaling mechanism of mGluR6 in

retinal ON bipolar cells remain unclear. To date, the identity of the cation channel

inhibited by mGluR6 in these cells is not known, and a comprehensive study examining

the coupling of mGluR6 to each member of the Gαi/o family has neither been published,

nor have the implications of coupling to other Gα proteins, such as Gαi1-3, been

thoroughly considered. Whereas Gαoa appears to mediate the primary function of

mGluR6 signaling (i.e., the rapid inhibition of cation channel permeation), activation of

other members of the Gαi/o family may alter regulatory pathways that could fine tune

this signal or alter other ON bipolar cell processes.

In this study, I used a reconstitution system in isolated Superior Cervical

Ganglion (SCG ) neurons to examine mGluR6 coupling efficiency to individual members

of the Gαi/o family.

B. Methods.

2.1 Reconstitution protocol.

SCG neurons were intranuclearly injected with cDNA with mGluR6 alone or with

Gβ1, Gγ2(this Gβγ combination was chosen for its ability to robustly modulate N-type

calcium currents when expressed in SCG neurons), and a single PTX-insensitive mutant

(or naturally PTX-insensitive wild-type) Gα. Cells were then treated overnight with PTX

to inactivate endogenous Gαi/o proteins. Calcium currents were elicited using a triple-

pulse voltage protocol in which cells held at -80 mV were depolarized to +10 mV (the

first test pulse, or “prepulse”), then to +80 mV for 50 ms followed by a brief return to -80

mV and a second test pulse to +10 mV (the “postpulse”). The calcium current facilitation

ratio (postpulse current/prepulse current) measured 10 ms from the beginning of each test

pulse) was calculated from the current elicited by this protocol and used to determine the

Gα/Gβγ stoichiometry, as described later.

The calcium current modulatory pathway utilized by mGluR6 here is Gβγ-

mediated and voltage-dependent [77, 78]. This was evident from the slowed activation

kinetics of the inhibited currents and from the “facilitation” observed following a strong

depolarizing prepulse [79, 80]. These features are hallmarks of the Gβγ mediated calcium current inhibitory pathway. Commonly, facilitation is defined as the current in the postpulse divided by the current in the prepulse, measured 10 ms after the start of each voltage step.

Thus, facilitation can be used to quantitatively measure levels of relative free Gβγ in the SCGs. This modulation is mimicked by overexpressed Gβγ and overexpression of

Gβγ alone also produces basal currents characterized by slow activation and strong basal facilitation (>>1) [78, 81-83]. Overexpressing Gα alone generates basal currents with small facilitation (<1), because of strong buffering caused by endogenous Gβγ. Under

17 these conditions, Gβγ-mediated calcium current modulation upon application of agnoists is occluded.

Heterologous expression of Gα and Gβγ together resulted in cells with currents that were placed into three functional categories. The first category included cells that exhibited strong basal facilitation, >1.3, chosen arbitrarily, because basal facilitation this high was rare in control cells [83], indicative of excess Gβγ. The second category included cells with basal facilitation <1, indicating excess Gα, caused by Gβγ buffering.

The third category included cells with basal facilitation between 1 and 1.3, indicating a good functional stoichiometric balance of Gα and Gβγ. Therefore, Gα/Gβγ-expressing cells with basal facilitation in this range were chosen for analysis in the reconstitution experiments [84]. In addition to determining stoichiometric balance, these criteria provide a control for expression levels of different Gα subunits.

2.2 SCG isolation and cDNA injection.

Briefly, adult Wistar rats were deeply anaesthetized by CO2 and both SCGs were removed immediately after decapitation. SCGs were then incubated in Earle’s balanced salt solution (Invitrogen, Carlsbad, CA) supplemented with 0.55mg/ml trypsin

(Worthington Biochemicals, Freehold, NJ) and 0.7mg/ml collagenase D (Roche

Diagnostics, Indianapolis, IN) at 35°C for 1 h. Cells were spun at 600 RPM for 6 min, washed once and transferred to minimum essential medium (Invitrogen) supplemented with 10% FCS; 1% glutamine, and 1% Pen-Strep; then plated on poly-L-lysine-coated

(Sigma-Aldrich, St. Louis, MO) 35-mm polystyrene tissue culture dishes, and incubated

18 at 37°C before DNA injection. After injection, cells were incubated at 37°C overnight and patch-clamp experiments were carried out on the following day.

Plasmids were stored at -20°C in Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, pH 8). Intranuclear injection of cDNA was performed using an Eppendorf 5247 microinjector and InjectMan NI2 micromanipulator (Madison, WI) three to five hours after SCG neurons isolation. Rat mGluR6 was injected at 90–100 ng/μL. In reconstitution experiments, all constructs of Gα were injected at 6–8 ng/μl, whereas Gβ1 and Gγ2 were each injected at ~10 ng/μl. To identify successfully injected neurons, cells were co- injected with enhanced green fluorescent protein (pEGFP, BD Clontech, Mountain View,

CA) at 0.02 ng/μl. Injection of each cell resulted in an estimated 1–2 pL of plasmid cDNA in TE buffer. The specific PTX-insensitive point mutations for each Gα protein used were: rat: GαoaC351G, GαobC351G, Gαi1C351G, Gαi2C352G, Gαi3C351G, Gαz wild-type (naturally PTX-insensitive); human: GαTr-RC347G (GNAT-2), and GαTr-C351G

(GNAT-1) (all plasmids were a gift from Dr. Steve Ikeda).

2.3 Patch-clamp electrophysiology.

Patch-clamp pipettes were pulled using 8250 glass (Garner Glass, Claremont,

CA), with a Sutter P-97 horizontal puller. Series resistances were 2–6 MΩ before electronic compensation of 70% to 80%. Whole-cell recordings were made with an Axon

Axopatch 200B patch-clamp amplifier (Molecular Devices, Sunnyvale, CA). Current traces were low-pass-filtered at 5 kHz using the 4-pole Bessel filter in the amplifier, digitized at 2 to 5 kHz and stored on the computer. Data was acquired using custom acquisition software (generously donated by Dr.Stephen R. Ikeda, NIAAA, Rockville,

MD) on a Macintosh G3 or G4 computer. Data analysis was performed using Igor Pro

software (Wavemetrics, Lake Oswego, OR).

The external recording solution (bath solution) contained (in mM): 140

methanesulfonic acid, 145 tetraethylammonium hydroxide, 10 HEPES, 10 CaCl2, 15 glucose, and 0.0003 tetrodotoxin, adjusted to pH 7.4 using tetraethylammonium hydroxide. The internal solution (pipette solution) contained (in mM): 120 N-methyl-D- glucamine, 20 tetraethylammonium hydroxide, 11 EGTA, 10 HEPES, 10 sucrose, 1

CaCl2, 4 MgATP, and 0.3 NaGTP, adjusted to pH 7.2 with methanesulfonic acid. L-

glutamate (100 mM) and L-(+)-2-Amino-4-Phosphonobutyric acid (L-AP4, 300 mM)

were used as the agonist of mGluR6. L-glutamate and control solution (external solution)

were applied to the cells using gravity-driven perfusion system, positioned 100 mm from

the cell, which allowed rapid solution exchange (~250 ms). The degree of mGluR6

mediated calcium current inhibition was calculated as the maximal inhibition of the

current in the presence of drug compared with the last current measurement before drug

application.

2.4 Single cell RT-PCR.

Single-cell RT-PCR was carried out using gene specific primers (Table 2.1) at a

final concentration of 0.6 uM with the OneStep RT-PCR kit (Qiagen, Valencia, CA).

Positive controls producing products with predicted sizes confirmed effectiveness of each

primer pair. The method of this single cell harvesting was similar to previous publications

[85, 86]. Briefly, single bipolar cells were harvested using a patch pipette filled with culture media. The pipette was positioned at the soma of an identified bipolar cell and

single bipolar cell was harvested by applying negative pressure. The pipette was removed and the tip broken (expelling the contents of the pipette) into a thin-walled PCR tube and

placed on ice.

Table 2.1. RT-PCR primers and expected product sizes.

Product name Primer sequence Expected size Gαo 5'-CGTGGAGTATGGTGACAAGGAGAG-3' 300bp

5'-AAGGTGAAGTGGGTTTCTACGATG-3' Gαi1 5'-TGACTATGACCTGGTTCTTGCTGAG-3’ 482bp

5'-ACACTACATTCTCTGTTGCTGGGAG-3' Gαi2 5'-CAAGATGTTTGATGTGGGTGGTC-3' 210 bp 5'-AGGATGATGGAGGTGTCTGTGAAC-3' Gαi3 5'-TGAGTAAAGAGCCCAGGATTGC-3' 453bp

5'-CAAAGCAGTTCTGACCACCAACC-3' mGluR6 5'-CTGTTCCGCTCTTCCTCACTTG-3' 228bp

5'-ATTCAGACCTTGGCTCACCGAC-3'

All RT-PCR experiments were run with positive and negative controls in parallel

and repeated using 4–10 additional cells for each experiment. The positive control used

total RNA extracted from whole rat retina (Versagene Total RNA Purification kit; Gentra

Systems, Inc., Minneapolis, MN), rather than a single cell as the RNA source. The two

negative controls used RNase-free H2O and bath solution from the culture dish collected

with a patch pipette, respectively, in lieu of RNA as a starting material.

Each sample was subjected to the following PCR thermocycler protocol: 50°C for

30 min, 95°C for 15 min, 35–37 extension cycles (94°C for 30 s, 60°C to 62°C for 30 s,

72°C for 30 s), and a final extension at 72°C for 10 min. Samples were analyzed by 2%

to 4% agarose gel electrophoresis.

2.5 Rat retinal bipolar cell isolation and identification.

Retinas were removed from adult Wistar rats following decapitation, and bipolar

cells were isolated according to methods described in previous papers [87, 88] with minor

modifications. In brief, both retinas were removed and placed in ice cold Hank balanced

salt solution (HBSS; Sigma-Aldrich, St. Louis, MO) containing (in mM): 137 NaCl, 1

NaHCO3, 0.34 Na2HPO4, 5.4 KCl, 0.44 KH2PO4, 1.26 CaCl2, 0.8 MgSO4, 0.5 MgCl2, 5

HEPES, Phenol red 0.011 g/l, 22.2 D-glucose, adjusted to pH 7.2 with 1 N NaOH. The retinas were incubated at 37°C for 40 min in 10 ml HBSS supplemented with 0.2 mg/ml

DL-cysteine (TCI America, Portland, OR), 0.2 mg/ml bovine serum albumin, and 1.6

U/ml papain (Worthington Biochemicals, Freehold, NJ), adjusted to pH 7.2 with 1 N

NaOH. Following three rinses in HBSS, the retinas were mechanically dissociated by gentle trituration into single cells using a sterile Pasteur pipette. The dispersed cells were then suspended in HBSS and plated onto poly-L-lysine-coated 35 mm polystyrene tissue culture dishes. Cells were stored at room temperature and used within 5 h after isolation.

Bipolar cells were identified according to their characteristic morphology [88-90].

C. Results.

2.1 Calcium current inhibition in SCG neurons by heterologously expressed

mGluR6.

mGluR6 was heterologously expressed in SCG neurons by intranuclear cDNA

injection, and modulation of the native voltage-dependent calcium currents following L-

glutamate administration was examined as a measure of mGluR6 activity. Rat SCG

neurons do not natively express mGluRs [91]. Activation of heterologously expressed

mGluR6 in SCGs shows strong inhibition of the whole-cell calcium current, using 100

uM L-glutamate (glu) or 300 µM L-AP4 which is a selective group III mGluR agonist.

The inhibition was rapid, reversible, and similar with both agonists (Fig. 2.1). The

average magnitude of mGluR6 mediated inhibition of calcium current was 46±2% (glu)

and 49±4% (L-AP4) (n= 6), respectively. Treatment with PTX at 500ng/ml overnight

abolished calcium current inhibition in response to Glu and L-AP4. Inhibition of calcium

current following PTX treatment was 2±1% (glu) and 4±2% (L-AP4) (n=6), respectively.

Sample current traces (Fig. 2.1A, inset) illustrate that Glu-mediated calcium

current inhibition by mGluR6 is voltage dependent. Using a triple-pulse voltage protocol

[79], much of the inhibition is reversed by a strong, 50 ms depolarizing (80 mV) step indicative of Gβγ-mediated calcium channel modulation often associated with activation of PTX sensitive G proteins [92]. Together, these data confirm that mGluR6-mediated calcium channel modulation in SCG neurons proceeds exclusively through the native

PTX-sensitive, Gαi/o subfamily of G proteins.

Fig. 2.1. Calcium current in SCG neurons was inhibited via activated mGluR6.

(A) Time course and sample current traces (inset) of mGluR6-mediated inhibition of the

native calcium currents in SCG neurons using 100 µM glutamate and 300 µM L-AP4 as

agonists. Prepulse (closed circles) and postpulse (open circles) calcium current was

measured using the triple pulse voltage protocol showed in the inset. Scale bars in inset

represent 1 nA and 10 ms. (B) Average inhibition by glutamate (open bars) and L-AP4

(solid bars) in SCG neurons expressing mGluR6. Number of cells is shown in parentheses and error bars represent SEM.

2.2 Reconstitution of mGluR6 coupling to Gαi/o proteins.

To examine the G protein coupling profile of mGluR6, PTX insensitive Gαi/o proteins [93] were expressed in SCG neurons with Gβ1γ2 to reconstitute coupling of individual Gα proteins in the Gi/o family (see Methods for a description of each PTX- insensitive mutant Gα). PTX treatment was then used to inactivate native G proteins. The mutant G proteins contained a cysteine to glycine mutation in the extreme C-terminus that eliminates ADP ribosylation of the C-terminal cysteine by PTX. However, because excess expression of either Gα or Gβγ proteins would obfuscate receptor mediated signaling (either by buffering the Gβγ that mediates the calcium current inhibition, or by mimicking this modulation in the absence of receptor activity), cells with adequate stoichiometric balance of expressed Gα and Gβγ had to be selected for analysis using basal facilitation (the ratio of postpulse to prepulse current magnitude from the triple pulse voltage protocol in the absence of agonist, Fig. 2.1B) as a guide (see [83] and the

Materials and methods section for a more complete description of this protocol). Cells with a basal facilitation less than one (indicative of excess expressed Gα) and greater than

1.3 (excess Gβγ) were excluded.

Reconstitution of coupling to mGluR6 was strong with the PTX-insensitive Gαoa mutant, GαoaCG (Gαoa containing a cys to gly mutation at the C351, 4 amino acids from the C-terminus, preventing ADP ribosylation by PTX), strongly suggesting that mGluR6 couples efficiently with Gαoa, as expected from previous studies (Dhingra et al., 2002,

2004). Calcium currents in PTX treated cells expressing GαoaCG (and Gβ1γ2) were inhibited 37±7% (n=5; Fig. 2.2). In paired positive (PTX untreated) and negative (PTX-

treated) control cells which only express mGluR6 and thus utilize native SCG G proteins,

the inhibition was 33±7% (n=5) and 2±1% (n=3), respectively. Gαob also appeared to couple to mGluR6, although to a slightly lesser extent than Gαoa. SCG neurons reconstituted with GαobCG (and Gβ1γ2) exhibited calcium current inhibition of 23±3%

(n= 6; Fig. 2.2C). Taken together, these data indicate that mGluR6 couples strongly to

Gαoa, and moderately to Gαob.

Coupling of mGluR6 to several other members of the Gαi/o family was also

examined (Fig. 2.3). Paired positive and negative controls exhibited calcium current

inhibition of 34±2% (mGluR6 alone, untreated; n=33) and 2±1% (mGluR6 alone, PTX-

treated; n =23), respectively. Neurons reconstituted with Gαi1CG exhibited significant, though moderate coupling to mGluR6, inhibiting the calcium current by 22±5% (n= 9).

This level of inhibition was statistically greater than the negative control group (mGluR6 expression only, PTX-treated). SCG neurons reconstituted with Gαi2CG and Gαi3CG showed only weak signaling through mGluR6, generating inhibitions of only 10±4% (n=

16) and 14±6% (n=10), respectively (Fig. 2.3), which were significantly different from the positive control group.

Further, calcium current modulation was undetectable in SCG neurons

reconstituted with PTX-insensitive mutants of either of the retinal-specific Gα proteins,

rod- or cone-transducin (GαTr-RCG, or GαTr-CCG). Average calcium current inhibition in

these cells was 2±1% (n=7) and 0±4% (n=4), respectively. Finally, coupling to Gαz, a

naturally PTX-insensitive member of the Gαi/o family, was also absent. Inhibition of

calcium currents in these cells averaged 2±1% (n= 9). Whereas a clear signal was absent,

the Gα proteins used for reconstitution in these experiments did appear to express,

because stoichiometric balance with expressed Gβ1γ2 was achieved in each case. In the

absence of Gα expression, postpulse: prepulse facilitation ratios would be expected to

exceed 1.5 in virtually every cell, as is observed when Gβ1γ2 is expressed alone [83].

This observation indicates that the Gα constructs are not only expressed, but retain their ability to bind Gβγ while in the GDP-bound state. These data demonstrate that mGluR6 is unable to couple to GαTr-R, GαTr-C or Gαz.

2.3 Examination of endogenous expression of mGluR6 and Gα proteins in bipolar

cells using single-cell RT-PCR.

To explore the potential physiological roles of mGluR6 coupling to members of

the Gαi/o family, single-cell RT-PCR was performed in adult rat bipolar cells to detect

mRNAs of each Gα protein shown to be capable of coupling to mGluR6 (above). Primer

sequences and expected PCR product sizes for each target are shown in Table 2.1.

Following isolation, bipolar cells were identified based on their characteristic

polarized morphology (Fig. 2.4A). Bipolar cells have an eccentrically positioned round or

oval soma with a short cluster of dendrites that arise from one end of the soma and a long

axon at the opposite end [88-90].

Fig. 2.4 shows the single-cell RT-PCR results probing for message of several G

proteins. In each case, a positive control is shown using total RNA extracted from whole

rat retinas (“Total RNA”), as are two negative controls in which only bath solution from

the culture dish is used in lieu of a cell (denoted as N1) and in which RNAase-free water

was used (denoted as N2). Further, for each sample (single bipolar cell), two primer pairs

28 were included in the tube: one for the targeted Gα message, the other to detect mGluR6 message. Cells positive for mGluR6 were identified as ON bipolar cells, because ON and

OFF bipolar cells could not be distinguished based on of morphology alone. We identified a total of 36 single bipolar cells used for RT-PCR experiments, seven of which were mGluR6 negative (most are not shown). Because our method of isolation favors rod bipolar cells [87], which are exclusively ON bipolar cells, this ratio of apparent ON to

OFF bipolar cells was not surprising.

Gαo (the RT-PCR primers used do not distinguish Gαoa from Gαob), which coupled most strongly to mGluR6 (Fig. 2.2) and, which has been shown previously to couple endogenously to mGluR6 [44, 74-76] was clearly expressed in every ON bipolar cell examined (Fig. 2.4B). In addition, Gαi2 message was present in several bipolar cells in which mGluR6 was also present (Fig. 2.4D), but Gαi2 did not show significant coupling to mGluR6 in reconstituted SCG neurons (Fig. 2.3). Surprisingly, the only other

Gα protein able to couple significantly with mGluR6, Gαi1, was undetectable in the ON bipolar cells examined (Fig. 2.4C, E), as was Gαi3, which coupled weakly but not significantly to mGluR6 in SCG neurons.

To demonstrate that each of the Gαi primer sets were capable of detecting message under single-cell RT-PCR conditions, individual SCG neurons were used as the

RNA source, paired with the Gαo primer set to positively verify that an intact cell was included in the sample (Fig. 2.5). The data illustrate that Gαi1 (Fig. 2.5A), Gαi2 (Fig.

2.5B), and Gαi3 (Fig. 2.5C) message were detectable from single SCG neurons in a

29 majority of the neurons examined. Together these data demonstrate that rat retinal ON bipolar cells express message for Gαo and Gαi2 but neither Gαi1 nor Gαi3.

In summary, reconstitution experiments using PTX-insensitive Gα mutants heterologously expressed in SCG neurons suggest that mGluR6 is capable of coupling to members of the Gαi/o protein family in which it couples the most strongly to Gαoa; moderately to Gαob and Gαi1; and weakly to Gαi3 and Gαi2. Of the Gα proteins capable of coupling moderately or better with mGluR6, only Gαo message was detectable in rat retinal ON bipolar cells using single-cell RT-PCR, strongly suggesting that the majority of physiological signaling through mGluR6 in ON bipolar cells of the retina occurs via

Gαo.

Fig. 2.2. mGluR6 couples to PTX-insensitive Goa and Gob in SCG reconstitution system.

(A) Time course of calcium current inhibition in a PTX-treated SCG neuron reconstituted with GαoaCG, Gβ1, and Gγ2. Prepulse (closed circles) and postpulse (open circles) calcium current was measured using the triple pulse voltage protocol shown in Fig. 2.1A.

(B) Sample current traces from the cell shown in A (upper) and a representative cell reconstituted with GαobCG (lower). Scale bars represent 1 nA and 10 ms. The voltage protocol and symbols are as in Fig. 2.1A. (C)Average calcium current inhibition in SCG neurons expressing mGluR6 alone or in combination with PTX-insensitive Gαoa or Gαob

(and Gβ1 and Gγ2). ±PTX-treatment is indicated below. Number of cells is shown in parentheses with error bars represent SEM. # and * indicate statistically significant difference between the group (P<0.05) (One-way Anova).

Fig. 2.3. mGluR6 couples moderately to Gαi1, weakly to Gαi2 and Gαi3, but not the other Gα proteins in reconstitution system. Average calcium current inhibition in SCG

neurons expressing mGluR6 alone or in combination with indicated PTX-insensitive Gα

protein (plus Gβ1 and Gγ2). GαTr-rCG and GαTr-cCG represent PTX-insensitive rod

transducin and cone transducin, respectively. ±PTX-treatment is indicated below.

Number of cells is shown in parentheses. Error bars represent SEM. # and * represent

statistically significant difference among the groups with P< 0.05 (One-way Anova).

Fig. 2.4. Retinal ON bipolar cells express Gαo, Gαi2, but not Gαi1 or Gαi3. (A)Phase contrast images of retinal bipolar cells (indicated by arrows) identified by characteristic morphology. (B) RT-PCR results showing positive control “Total RNA,” and negative controls (N1: bath solution from the culture dish was used instead of a cell, N2: RNAase- free water was used), and results from six selected ON bipolar cells. Each reaction tube contained two sets of primers for detection of mGluR6 and for Gαo (see Table 2.1). A positive band for mGluR6 indicated ON bipolar cell identity. (C, D, E) RT-PCR was performed as in (B), but using Gαi1, Gαi2 and Gαi3 primer pairs, respectively.

Fig. 2.5. Gαi1-3 were detected in SCGs using single-cell RT-PCR. Similar to RT-PCR results in Fig. 2.4, but with single SCG neurons as the RNA source, and using Gαo primers paired with primers for Gαi1 (A), Gαi2 (B), or Gαi3 (C). Two negative controls were included (N1: bath solution from the culture dish was used instead of cells, N2:

RNAase-free water was used).

Chapter III

Identification of Proteins Potentially Regulating mGluR6 Function and/or

Localization

A. Introduction.

Most GPCRs require accessory proteins in order to function properly. These

interacting proteins impact function of GPCRs through a variety of mechanisms, such as

contributing to celluar localization or regulating downstream signal transduction

pathways. A number of accessory proteins for mGluRs have been identified. As with

many GPCRs, second messenger dependent kinases, β-arrestin, and GRKs mediate

Group I mGluR phosphorylation, desensitization and internalization [94]. In addition to

these regular accessory proteins, specific proteins that regulate mGluRs have been

identified. For example, Homer proteins, a family of proteins composed of several

isoforms, act as adaptor proteins for Group I mGluRs to regulate function by modifying

coupling of downstream effectors; or facilitating their cell surface localization [95-98] .

Another example of regulatory proteins for Group I mGluRs is huntingtin binding protein

optineurin, which can interact with mGluR1/5 and inhibit their PLC and InsP3 signaling

pathways [94, 99]. Group II mGluRs appear to be differentially desensitized and

internalized by GRKs and β-arrestins [100]. Ran-BPM (Ran-binding protein M) was

identified in a yeast two-hybrid assay using intracellular loops of mGluR8 as baits against 36

a rat brain cDNA library. It associates with both Group II and Group III mGluRs, but not

with mGluR6 [101]. Protein interacting with protein kinase C (PICK) 1 was identified as

interacting protein of mGluR7 type b through its C-terminus region [102]. Finally, in

vitro evidence suggests Group III receptors, including mGluR6, are candidates for

sumoylation [103].

In looking specifically at the mGluR6 receptor, a retinal-specific regulator of G

protein signaling protein (Ret-RGS1) was identified via yeast two-hybrid screen as a regulator of the mGluR6 receptor signaling pathway [104]. Ret-RGS1, a splice variant of

RGS20, accelerates the termination of mGluR6 signaling in a heterologous system[104].

However, Ret-RGS regulates the mGluR6 signaling cascade at the G protein level instead

of the receptor level. Little is known about regulation of mGluR6 receptor function,

especially at the level of regulation of receptor localization both prior to and after

activation. Because mGluR6 is localized specifically to the postsynaptic sites of ON

bipolar cells in the retina, a search for specific mGluR6 associated proteins may aid in

understanding the localization and regulation of mGluR6 function. As it is reasonable to

assume that accessory proteins regulating localization may directly interact with the

mGluR6 receptor, I utilized a yeast two-hybrid screening system to search for these

proteins. Yeast two-hybrid screening is a well defined method to identify novel protein- protein interactions and to confirm known protein-protein interactions. Using a rat retinal library, this approach identified a small number of proteins with affinity for the intracellular components of the mGluR6 receptor, which are thus candidates for functional regulators of mGluR6.

B. Methods

3.1 Yeast two-hybrid screening procedure.

A general schematic chart of the yeast two-hybrid screening procedure used in

this study is presented in Figure 3.1. Details regarding this screening procedure follow.

Fig. 3.1. Flow chart of the yeast two-hybrid screening procedure. LB-Amp: Luria Broth

(LB) containing the antibiotic ampicillin. SD–LT plates: (6.7 g/L Difco yeast nitrogen base, 2% glucose, 2% agar, 1 x Leu, Trp dropout mix [BD Clontech]). SD-LTHA

(quadruple dropout, QDO) plates: (6.7 g/L yeast nitrogen base, 2% glucose, 2% agar, 1 x

QDO dropout mix lacking leucine, tryptophan, histidine and adenine [BD Clontech]).

3.2 Construction of two-hybrid screening library.

A rat retinal cDNA library was recombined into the pGADT7-Rec vector

according to the user manual (BD Matchmaker™ Library Construction &Screening Kit).

Briefly, 1µg of rat retinal poly A+ RNA (Invitrogen, CA) was used as starting material to

synthesize first-strand cDNA using a primer (5'-ATTCTAGAGGCCGAGGCGGCCGA

CATG-d(T)30VN-3') containing an oligo (dT) sequence upstream of a unique

recombination sequence (termed CDSIII) and the Moloney murine leukemia virus

(MMLV) reverse transcriptase. MMLV contains a terminal transferase activity that adds several deoxycytidines to the 3’ end of the nascent transcript. Addition of a second primer (5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG-3') containing an oligo (dG) sequence downstream of another recombination sequence

(termed SMARTIII) led to template switching by MMLV and incorporation of this second primer sequence into the transcript. Double strand cDNA was then generated from single strand cDNA by LD-PCR (long distance polymerase chain reaction) with primers complementary to the SMART III and CDSIII sequences, and cDNAs were purified with BD CHROMA SPIN™ TE-400 Columns to select for cDNA molecules larger than 200 bp in size. A GAL4 Activation Domain (AD) fusion library was then constructed by co-transforming yeast strain AH109 (MATa, trp1-901, leu2-3, 112, ura3-

52, his3-200, gal4Δ, gal80Δ, LYS2::GAL1UAS-GAL1TATA-HIS3, GAL2UAS-GAL2TATA-

ADE2, URA3::MEL1UAS-MEL1TATA-lacZ) with the SmaI-linearized pGADT7-Rec vector

and the PCR generated library. Co-transformation of yeast cultures was performed as

described by the user manual. Briefly, 20 μl ds cDNA, 6 μl pGADT7-Rec (0.5 μg/μl) and

20 μl heat denatured Herring Testes Carrier DNA were mixed in a sterile prechilled 15 ml reaction tube. Following addition of 600 μl competent cells and 2.5 ml freshly prepared polyethylene 40% glycol/Li Acetate, 0.1 M Li Acetate, 10 mM Tris-HCl, 1 mM EDTA solution, reaction was incubated at 30°C for 45 min. After addition of DMSO to 10% final concentration, the cells were heated at 42°C for 20 min, centrifuged at 700 x g for 5 min and the cell pellet resuspend in 3 ml of YPD Plus Liquid Medium (BD Clontech) for plating. Recombination occurs within the yeast to created fusions with the GAL4 activator domain, and successfully recombined plasmids were selected by growing the yeast on 2% agar SD–L media (6.7 g/L Difco yeast nitrogen base, 2% glucose, 1 x Leu dropout mix [BD Clontech]). The cDNA library was collected by pooling all of the growing yeast colonies in SD–L media containing 25% glycerol and stored at -80ºC in 1 mL aliquots.

The quality of the cDNA library was confirmed by randomly selecting single yeast colonies, isolating plasmids, and subsequent DNA sequencing and restriction analysis. Plasmids were isolated from confluent yeast cultures (2 ml) grown in SD–L media using a modification of the Qiagen Qiaprep Spin Miniprep protocol to accommodate yeast cell lysis. Briefly, cultures were centrifuged at 10,000 x g, 5 min,

25°C, washed once with sterile water, and resuspended in 250 μl Buffer P1.

Approximately 100 μl glass beads (0.5 micron, Biospec) were added to each culture, followed by vortexing at maximum speed for 5 min, 25°C. Samples were centrifuged at

10,000 x g, 5 min, 25°C and supernatants removed to fresh 1.5 ml culture tubes for the remainder of the manufacturer’s plasmid isolation protocol. Isolated plasmids were

transformed into chemically competent E. coli (Top 10, Invitrogen) and selected on LB-

Amp plates at 37°C. Single E. coli colonies were grown 18-24 hrs at 37°C in liquid LB-

Amp, followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit and

protocol). Inserts were sequenced by dye-terminator chemistry using the Beckman

CEQ8000 system and protocols and the T7 forward primer. Restriction analysis was

performed by digesting isolated plasmids with Hind III, followed by resolution on a 1%

agarose gel.

3.3 Construction of bait plasmids.

DNA fragments encoding the second intracellular loop (amino acids 661-694), the

third intracellular loop (amino acids 759-788), and the extreme C-terminus (amino acids

831-871) of the rat mGluR6 receptor were amplified by PCR using 20 ng of pcDNA3.1(-

)/mGluR6 plasmid as template [6] and specific primers (each at 1 uM) carrying EcoRI and Bam HI restriction sites (Table 3.1).

PCR reactions were carried out with the following thermocycler protocol: 94°C,

10 min; 30 extension cycles (94°C, 30 sec, 53°C, 30 sec, 72°C, 20 sec); final extension at

72°C, 2 min; held at 4°C. Successful PCR was verified using 2% agarose gel

electrophoresis. PCR products (approximately 200 ng) were digested with the restriction

enzymes EcoRI and BamHI (Fermentas Life Sciences), gel purified using the Qiagen

Qiaquick Gel Extraction kit and protocol, and ligated to approximately 20 ng

EcoRI/BamHI digested, gel purified pGBKT7 vector using the Epicentre Fast-Link DNA

ligation kit and protocol. Ligated product was used to transform chemically competent E.

coli, and transformation reactions were plated on LB-Kan plates. Single colonies were

picked for growth in LB-Kan liquid media (18-24 hrs), followed by miniprep purification

of plasmid (Fermentas GeneJet Miniprep kit and protocol). Correct plasmid constructions

forming fusions of these mGluR6 intracellular domains with the DNA binding domain of

GAL4 were verified by dye-terminator sequencing using the Beckman CEQ8000 system

and protocols and plasmid specific primers (T7 forward primer and 3’DNA-BD

sequencing primer).

3.4 Yeast two-hybrid screening.

Each bait strain was made by transforming chemically competent yeast strain

Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, met-, gal4Δ, gal80Δ,

URA3::GAL1UAS-GAL1TATA-lacZ, MEL1) with bait plasmid generated in Section 3.3

according to the user manual, followed by selection on 2% agar SD–T media (6.7 g/L

Difco yeast nitrogen base, 2% glucose, 1 x Trp dropout mix [BD Clontech]). Yeast two-

hybrid screening was carried out by mating the library in strain AH109 from Section 3.2

with each bait in strain Y187. Briefly, single colonies from bait strains were inoculated

into 50 mL selective media (SD–T supplemented with 50 μg/mL kanamycin) and grown

overnight at 30°C, 200 rpm. The yeast cultures were then centrifuged at 600 x g, 5 min,

25°C, and resuspended in 50 mL enriched media (2 x YPDA [40 g/L Difco peptone, 20

g/L yeast extract, 0.006% adenine hemisulfate] supplemented with 50 μg/mL kanamycin). These fresh yeast cultures were mixed with 1 mL aliquots of the cDNA library in AH109 in a 1 L flask with , and co-cultures were incubated at 30°C, 30-50 rpm

for 20-24 hrs to allow mating to occur. Mating mixtures were transferred into 50 mL

Table 3.1. PCR primers for baits construction in yeast two-hybrid screening.

Primer name Primer sequences Amino acid sequences of products 5’EcoRImGluR6il2 GATC GAATTCGCCC mGluR6il2 TGCTCACCAAGACC 661 3’BamHImGluR6il2 CTAG GGATCCTCAGATG ALLTKTNRIYRIFEQGK ACTAGTTGCGAAGTGGGG RSVTPPPFISPTSQLVI 694 5’ EcoRImGluR6il3 GATC GAATTCTGTACAG mGluR6il3 TGTATGCCATCAAGG 759 3’BamHImGluR6il3 GATC GGATCCTCAATACA CTVYAIKARGVPETFNE GGTGGTGTACATGGTGAA AKPIGFTMYTTCI 788 G 5’EcoRImGluR6tail CATG GAATTCGTGCC mGluR6C-tail CAAAACCTACGTCATC 831 3’BamHImGluR6tail GATC GGATCCCTAC VPKTYVILFHPEQNVQK TTGGCGTCCTCTGCG RKRSLKKTSTMAAPPQ NENAEDAK 871

conical tubes and centrifuged at 1000 x g for 10 min, 25°C. The flasks used for mating

were rinsed twice with 25 mL 0.5 x YPDA media supplemented with 50 μg/mL kanamycin, and the two rinses combined to resuspend the yeast pellets. The resuspended yeast cultures were centrifuged again at 1000 x g for 10 min, 25°C, and the pellets resuspended in 10 mL 0.5 x YPDA supplemented with 50 μg/mL kanamycin. The resuspension volumes were recorded for subsequent calculation of the number of clones screened (see below). Aliquots of approximately 150 µl mating mixture were then spread on quadruple dropout (QDO) plates for high stringency selection to reduce the number of false positives. In addition, 100 µl of serially diluted mating mixture was spread on 3 different media, with 1:100, 1:1000 dilutions spread on SD–LT plates and a 1:10,000 dilution spread on SD–LT, SD–T and SD–L 2% agar plates. These serial dilutions were

44 used to calculate mating efficiency and numbers of clones screened for each yeast two- hybrid screen (see below). Plates were incubated at 30°C for 5-7 days.

3.5 Calculation of mating efficiency and number of clones screened.

Calculations were performed according to manufacturer’s instructions (BD

Clontech Matchmaker™ Library Construction & Screening Kit). For each screen, the number of colonies (cfu) growing on the SD–LT, SD–T and SD–L plates from serial dilutions of mating mixtures were counted. Second, the viability in cfu/mL on each type of media was calculated using the following formula:

﴿ viable cells (cfu/mL) = cfu / ﴾volume plated (mL) × dilution factor #

The number of viable colonies on the SD–LT plates corresponds to the number of viable diploids screened. The number of viable colonies on the SD–L plates corresponds to the number of independent library components in the mating, and the number of viable colonies on the SD–T plates corresponds to the number of bait cells in the mating. The limiting partner in the mating was determined by comparing the viable cfu/mL calculated from the SD–T and SD–L plates. In this study, the library strain was made limiting to ensure the maximum efficiency of library cells to find a mating partner. The mating efficiency was then calculated using the following formula:

Mating efficiency = ﴾cfu/mL of diploids / cfu/mL of limiting partner ﴿× 100

The number of clones screened was estimated using this formula:

# clones screened = cfu/mL of diploids × resuspension volume (mL)

3.6 β-galactosidase activity assay (LacZ assay).

β-galactosidase activity assays were performed essentially as described [105].

Briefly, yeast colonies selected by growth on QDO plates were patched onto SD–LT plates and incubated at 30°C until patches were confluent. Approximately equal amounts of yeast were inoculated from each patch into 1 ml SD–LT liquid culture and incubated at

30°C 18 hrs (200 rpm). The cultures were diluted 1:10 with fresh liquid SD–LT and incubated with shaking at 30°C for another 5 hr (200 rpm). Assays were performed in duplicate for each culture in 96-well microplates. 100 μL/well of each culture was mixed with 25 µl lacZ assay buffer (0.36 M Na2HPO4, 0.36 M NaH2PO4, 60 mM KCl, 6 mM

MgCl2, 1.6% 2-mercaptoethanol (v/v), 2.5% Triton X-100 (v/v), and 6 mg/ml chlorophenolred-β-D-galactopyranoside [CPRG] as substrate). Microplates were then

incubated with shaking (400 rpm) at 25°C and color development (yellow to deep red)

monitored. Reactions were terminated by increasing pH through the addition of 2 M Tris

base, and plates were read at 570 nm. A negative control, consisting of a randomly

selected diploid from a non-screening plate (SD–LT) was included in each 96 well-plate.

3.7 Verification of plasmids and subsequent sequencing analysis.

Plasmids were extracted from yeast clones selected from screens and LacZ assay,

transformed and amplified in E. coli and purified from bacterial cultures as described

above. Plasmids were first subject to restriction enzyme digestion using HindIII and

analyzed on 1% agarose gels to verify the presence of an insert. Clones with inserts were

then analyzed by DNA sequencing as described above using standard T7 forward and 3’

AD sequencing primers (BD Clontech).

3.8 Specificity of potential interacting proteins.

Secondary tests were carried out by either co-transformation or small scale mating using available protocols (BD Clontech Yeast Protocols Handbook). These two procedures are qualitatively similar, though mating generally has a higher level of efficiency than co-transformation. Two non-specific baits (pGBKT7-53 [BD Clontech] and pGBKT7-RhoA [Cismowski, unpublished]), encoding GAL4 DNA binding domain fusions with p53 and human RhoA, respectively, were included to examine the specificity of interacting targets. In addition, a negative control using empty vector pGBKT7 as bait was included to assess self-activation by library proteins. Equal amounts of co- transformants or mating mixtures were spread on selective media (SD–LT, SD–LTH,

SD– LTHA) to examine growth under different stringencies.

Additional specificity tests were carried out using fragments (second intracellular

loops, the third intracellular loops, and the extreme C-termini) of different rat mGluRs as

baits, with mGluR1 as representative of Group I mGluRs, mGluR2 as representative of

Group II mGluRs, and mGluR4, 6 and 7 as representative of Group III mGluRs. (mGluRs

1, 2 and 7 (mGluR1 and 7 are in pcDNA3.1(+), mGluR2 is in pCI) were a gift from Dr.

Steve Ikeda. mGluR4 in pcDNA3.1(+) was a gift from Dr. David Hampson at the

University of Toronto.).

All DNA fragments were amplified via PCR, ligated to pGBKT7, sequenced, and transformed into Y187 yeast essentially as described above. Table 3.2 lists the primers used for amplification of each construct.

These constructs transformed into Y187 yeast were subjected to small scale mating with specific yeast library isolates, and the mating mixtures plated on selective drop out media (SD–LT, SD–LTH, SD–LTHA) to examine growth under different stringencies.

3.9 Amplification of additional (non-CIP98) library targets.

The amplification of the library target CIP98 for subsequent analysis will be described in Chapter IV. Two other library target sequences were amplified as follows.

pcDNA3.1(+)-CarkL: A DNA fragment encoding full length CarkL was amplified by PCR using 20 ng of isolated library plasmid (Table 3.4) with 1 uM of the following primers (Forward: GATCGAATTCCACCATGACTTCGCGACCCGTC,

Reverse: CTAGGCGGCCGCCTAGCTGATGTCTCTCCGGAGC). PCR reactions were carried out with the following thermocycler protocol: 94°C, 10 min; 35 extension cycles

(94°C, 30 sec, 55°C, 30 sec, 72°C, 4 min); final extension at 72°C, 10 min; held at 4°C.

Successful PCR was verified using 1% agarose gel electrophoresis. PCR product

(approximately 20 ng) was then ligated into PCR4-TOPO-Blunt cloning vector

(Invitrogen) following the user manual. Ligated product was used to transform chemically competent E. coli, and transformation reactions were plated on LB-

Kanamycin plates. Single colonies were picked for growth in LB-Kan liquid media (18-

Table 3.2. PCR primers for the construction of intracellular loops of mGluRs.

Primer name Primer sequences Amino acid sequences of products 5’EcoRImGluR1il2 GATCGAATTCGCTTTAGTG mGluR1il2 ACCAAAACCAATCG 674ALVTKTNRIARILA GSKKKICTRKPRFMS 3’BamHImGluR1il2 CTAGGGATCCTCATATGAT AWAQVII 709 CACTTGGGCCCAAGC 5’EcoRImGluR1il3 GATCGAATTCTGTACCTAC mGluR1il3 TATGCCTTCAAGACC 767CTYYAFKTRNVPA NFNEAKYIAFTMYTT 3’BamHImGluR1il3 CTAGGGATCCTCAGATGC CI 796 AGGTAGTGTACATGGTGA AG 5’ EcoRImGluR1tail GATCGAATTCACTCCGAA mGluR1tail GATGTACATCATCATTGC 832 TPKMYIIIAKPER…… 3’BamHImGluR1tail CTAGGGATCCCTACAGGG ………..LRDYKQSSST TGGAAGAGCTTTGC L 1199

5’EcoRImGluR2il2 GATCGAATTCGCCCTCCTC mGluR2il2 ACCAAGACC 649ALLTKTNRIARIFG GAREGAQRPRFISPAS 3’BamHImGluR2 il2 CTAGGGATCCTCAGATGG QVAI 682 CCACCTGTGAGGC 5’EcoRI mGluR2 il3 GATCGAATTCTGCACGCTC mGluR2il3 TATGCCTTCAAG 742CTLYAFKTRKCPE NFNEAKFIGFTMYTTC 3’BamHImGluR2 il3 CTAGGGATCCTCAGATGC I 771 AGGTGGTGTACATGGTG 5’EcoRImGluR2 tail GATCGAATTCGCACCCAA mGluR2tail GTTGCACATCATC 811APKLHIILFQPQKN VV……………..VVDST 3’BamHImGluR2tail CTAGGGATCCCTAAAGCG TSSL 872 ACGACGTTGTTGAGTC

Table 3.2.(continued) PCR primers for the construction of intracellular loops of mGluRs.

Primer name Primer sequences Amino acid sequences of products 5’EcoRI mGluR4 il2 GATCGAATTCGCCCTGCTGA mGluR4il2 CCAAGACC 669ALLTKTNRIYRIF 3’BamHImGluR4 il2 CTAGGGATCCTCAGATGGCC EQGKRSVSAPRFISP AGCTGCGAGG ASQLAI 702 5’EcoRI mGluR4 il3 GATCGAATTCTGTACTGTGT mGluR4il3 ACGCCATCAAGAC 767CTVYAIKTRGVP 3’BamHImGluR4 il3 CTAGGGATCCTCAAATGCAG ETFNEAKPIGFTMYT GTGGTGTACATGGTG TCI 796 5’EcoRImGluR4 tail GATCGAATTCATGCCCAAAG mGluR4tail TCTACATCATCCTC 839MPKVYIILFHPEQ 3’BamHImGluR4 tail CTAGGGATCCCTAGATGGCA NVP………TPALATK TGGTTGGTGTAGG QTYVTYTNHAI 912

5’EcoRI mGluR7 il2 GATCGAATTCGCCCTTTTAAC mGluR7il2 AAAGACCAATCGG 672ALLTKTNRIYRIF 3’ BamHImGluR7 il2 CTAGGGATCCTCAGATCGCC EQGKKSVTAPRLISP AGTTGTGACGTTGG TSQLAI 705 5’EcoRI mGluR7 il3 GATCGAATTCTGTACTGTGT mGluR7il3 ATGCCATCAAGACTC 770CTVYAIKTRGVP 3’BamHImGluR7 il3 CTAGGGATCCTCAGATACAC ENFNEAKPIGFTMY GTCGTGTACATAGTGAACC TTCI 799

5’EcoRImGluR7 tail GATCGAATTCATGCCGAAAG mGluR7tail TGTACATCATCATTTTC 842MPKVYIIIFHPEL 3’BamHImGluR7 tail CTAGGGATCCCTAGATAACC NVQ…..…..SPAAKK AGGTTATTATAACTGACATA KYVSYNNLVI 915 C

24 hrs), followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit

and protocol). Approximately 4 µg of plasmid was digested with the restriction enzymes

EcoRI and NotI (Fermentas Life Sciences), gel purified using the Qiagen Qiaquick Gel

Extraction kit and protocol, and approximately 400 ng gel purified product was ligated to

approximately 20 ng EcoRI/NotI digested, gel purified pcDNA3.1(+) vector using the

Epicentre Fast-Link DNA ligation kit and protocol. Ligated product was used to

transform chemically competent E. coli, and transformation reactions were plated on LB-

Amp plates. Single colonies were picked for growth in LB-Amp liquid media (18-24 hrs),

followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit and

protocol).

pcDNA3.1(+)-Clic1: A DNA fragment encoding full length Clic1 was amplified by PCR

using 20 ng of the clone identified in yeast two-hybrid screening (Table 3.4) as template,

with 1 uM of the following primers (Forward: GATCGGATCCACCATGGCTGAAGA

ACAACCTCAGGTC, Reverse: CTAGCTCGAGTCATTTGAGAGCCCTGGCCAC

TTG). PCR reactions were carried out with the following thermocycler protocol: 94°C,

10 min; 35 extension cycles (94°C, 30 sec, 53°C, 30 sec, 72°C, 4 min); final extension at

72°C, 10 min; held at 4°C. Successful PCR was verified using 1% agarose gel

electrophoresis. PCR products (approximately 20 ng) was then ligated into PCR4-TOPO-

Blunt cloning vector (Invitrogen) following the user manual. Ligated product was used to

transform chemically competent E. coli, and transformation reactions were plated on LB-

Kan plates. Single colonies were picked for growth in LB-Kan liquid media (18-24 hrs),

followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit and

protocol). Approximately 4 µg of plasmid was digested with the restriction enzymes

BamHI and XhoI (Fermentas Life Sciences), gel purified using the Qiagen Qiaquick Gel

Extraction kit and protocol, and approximately 400 ng gel purified product was ligated to

approximately 20 ng BamHI and XhoI digested, gel purified pcDNA3.1(+) vector using the Epicentre Fast-Link DNA ligation kit and protocol. Ligated product was used to

transform chemically competent E. coli, and transformation reactions were plated on LB-

Amp plates. Single colonies were picked for growth in LB-Amp liquid media (18-24 hrs), followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit and protocol).

C. Results

3.1 Quality of retinal cDNA library.

A rat retinal cDNA library was constructed using rat retinal mRNA as starting

material as described in the methods. The quality of the cDNA library was confirmed by restriction analysis and DNA sequencing of plasmids isolated from 16 randomly selected single yeast colonies (Fig. 3.2, Table 3.3).

Table 3.3. Identity of randomly selected rat retinal cDNA library components.

Clone number Identity of insert NCBI Accession number 1 Rat LR8 protein NM_134390 2 Rat CD24 antigen NM_012752 3 Rat ric-8b NM_175598 4 Rat splicing factor 3b XM_343570 5 Rat Delta1 NM_032063 6 No match 7 Rat hypothetical protein XM_580062 8 Rat ortholog of SNAP-associated protein NM_133854 9 No match 10 Rat matrix Gla protein BC086394 11 Rat SEC13-like-1 BC084705 12 Rat adafin, predicted XM_344820 13 Rat Api1, predicted XM_342470 14 Rat ASB2 XM_576093 15 Rat ATPase, H+ transporting, V0 subunit XM_574227 D 16 Similar to mouse DNA sequence from AL807771 clone RP23-141C15

1 2 3 4 5 6 7 8 M

3000 bp

1000 bp

500 bp

9 10 11 12 13 14 15 16 M

3000 bp

1000 bp 500 bp

Fig. 3.2. Samples of randomly selected rat retinal cDNA library components digested with restriction enzyme HindIII and analyzed using 1% agarose gel. All16 samples contained inserts. The inserts had sizes varying from around 500bp to around 4000bp, and encode for distinct proteins(see Table 3.3). M= Fermentas GeneRuler™ 1 kb DNA

Ladder.

3.2 Yeast two-hybrid screening results.

Having established that mGluR6 couples exclusively to Gαo in ON bipolar cells, and since little is known about potential interacting proteins or accessory proteins that regulate mGluR6 signaling, we developed a conventional yeast two-hybrid screening strategy, using the second intracellular loop (amino acids 661-694), the third intracellular loop (amino acids 758-788), and the C- tail domain (amino acids 830-871) of mGluR6 as baits. The loop bait constructs were designed to include several hydrophobic amino acid residues from adjacent transmembrane regions to facilitate possible loop formation in the expressed fusion proteins (see Table 3.1).

3.2.1 Yeast two-hybrid Screening results using the second intracellular loop as bait.

For screening with the second intracellular loop, the final resuspension volume following mating was 25mL. The number of viable cfu/mL were calculated using formulae described in methods section (see Methods, Calculation of mating efficiency and number of clones screened). The viable cfu/mL on SD-L (AH109, library strain, limiting partner) was 2.35×107, the viable cfu/mL on SD-T (Y187, bait strain) was

6.8×107, viable cfu/mL on SD-LT (viability of diploids) was 3.44×105. The total number of yeast transformants screened was 8.6×106. Following growth assay on drop out medium under high stringency (QDO plates), 190 clones were isolated and subjected to semi-quantitative LacZ assays to measure β-galactosidase gene activity [105]. A negative control (designated as N) selected randomly from non-screening plate (SD-LT) was included in each set of experiments. An arbitrary cut off was made to select clones with

β-galactosidase activity with a minimum of 2 fold over negative controls. Fig. 3.3

54 illustrates an example of a β-galactosidase activity assay and how the arbitrary cut off was made. 29 clones were selected by this method and were analyzed by restriction enzyme digestion using HindIII, and agarose gel analysis to examine for the presence of inserts. A total number of 22 clones with confirmed presence of an insert were then subjected to DNA sequencing analysis for the identity, proper orientation, and reading frame of inserts (Table 3.4).

Fig. 3.3. Example of a β-galactosidase activity assay with clones isolated in yeast two- hybrid screening using the second intracellular loop of mGluR6 as bait. The assay was performed in a 96-well microplate. A negative control (designated as N) was included in each 96-well plate. Numbers on the X-axis indicate clone IDs assigned to individual clones. Y-axis indicates β-galactosidase activity readout at the wavelength of 570nm.

Dotted lines indicated where the arbitrary cut offs were made and clones with β- galactosidase activity higher than the dotted lines were selected for later analysis. Clones marked (*) in each figure were the ones selected for further analysis.

Table 3.4. Sequence identification of 22 clones from mGluR6 second intracellular loop screen. Accession number: NCBI accession number.

Clone ID LacZ Value ± SD Accession number Protein ID 1-2 0.33±0.01 XM_343396 COMM domain containing 4 1-3 0.42±0.02 AK044429 homolog of mouse unknown protein 1-11 0.98±0.04 BAA08790 prion protein 1-47 0.30±0.01 AK145767 homolog of mouse unknown protein 1-51 0.92±0.04 BAA08790 prion protein 2-56 0.46±0.03 BC101914 Carbohydrate kinase-like (Carkl) 2-58 0.52±0.04 CR622014 homolog of human cDNA clone CS0DI067YM07 of Placenta Cot 25-normalized 3-4 0.79±0.01 AY539901 LRRGT00150 3-8 0.64±0.02 X14876 unknown protein 3-21 0.46±0.02 NM_133854 homolog of mouse SNAP- associated protein 3-23 0.58±0.01 XM_575592 similar to rat Poly(rC)-binding protein 1 (Alpha- CP1)(hnRNP-E1) 3-26 0.44±0.01 AK088615 homolog of mouse unknown protein 3-43 0.37±0.02 AK077840 homolog of mouse unknown protein 3-48 0.83±0.05 NM_001002807 chloride intracellular channel 1(Clic1) 3-52 0.61±0.01 AK077840 homolog of mouse unknown protein 4-6 0.80±0.01 AK044429 homolog of mouse unknown protein 4-20 0.57±0.01 AK088615 homolog of mouse unknown protein 4-46 0.83±0.11 NM_022886 homolog of mouse sciellin 4-47 0.96±0.07 BC098736 COP9 (constitutive photomorphogenic) homolog 4-50 1.14±0.09 BAA08790 prion protein 5-9 0.52±0.01 BC087588 Protease product 5-14 0.50±0.01 AK048007 homolog of mouse unknown protein

3.2.2 Yeast two-hybrid Screening results using the third intracellular loop as bait.

In screening using the third intracellular loop of mGluR6 as bait against rat retinal

cDNA library, numbers of viable cfu/mL were 2.42×107 on SD-L (AH109, library strain,

limiting partner), 2.95×107on SD-T (Y187, bait strain), and 7.4×104 on SD-LT (viability of diploids), (see Methods, Calculation of mating efficiency and number of clones screened). The total number of yeast transformants screened was 1.8×106. A total number

of 416 clones were isolated by growth assay under high stringency (QDO plates) and

subjected to semi-quantitative LacZ assay [105] (Fig. 3.4). After selection from LacZ

assay and confirmation of the presence of insert by restriction digest with HindIII, 23

clones were subjected to sequencing analysis (Table 3.5).

Fig. 3.4. β-galactosidase activity assay with clones isolated in yeast two-hybrid screening using the third intracellular loop of mGluR6 as bait. The assay was performed in a 96- well microplate. A negative control (designated as N) selected randomly from non- screening plate (SD-LT) was included in each set of experiments. Numbers on the X-axis indicate clone ID assigned to individual clone. Y-axis indicates β-galactosidase activity readout at the wavelength of 570nm. An arbitrary cut off was made to select clones with

β-galactosidase activity with minimum 2 fold over negative controls. Dotted lines indicated where the arbitrary cut offs were made and clones with β-galactosidase activity higher than the dotted lines were selected for later analysis. Clones marked (*) in each figure were the ones selected for further analysis.

Table 3.5. Sequence identification of 23 clones from mGluR6 third intracellular loop screen. Accession number: NCBI accession number.

Clone ID LacZ value ±SD Accession number Protein ID 1-1 0.70±0.04 NM_181088 CASK-interacting protein (CIP98) 1-2 1.02±0.07 AY539901 LRRGT00150 protein 1-45 2.38±0.19 XM_919599 hypothetical protein XP_919599 1-50 0.82±0.01 NM_017033 phosphoglucomutase 1 2-14 0.83±0.02 BC087588 Protease product 2-37 1.40±0.02 NM_181088 CASK-interacting protein (CIP98) 2-44 0.77±0.05 NM_175838 eukaryotic translation elongation factor 1 alpha 1 2-47 1.14±0.12 NM_175838 eukaryotic translation elongation factor 1 alpha 1 3-8 0.78±0.06 NM_175838 eukaryotic translation elongation factor 1 alpha 1 3-24 1.44±0.07 XM_575871 similar to channel-interacting PDZ domain protein isoform 1 3-34 0.81±0.02 CT030724 Similar to mouse DNA sequence from clone RP24- 63K13 on chromosome 9 4-24 0.90±0.03 NM_017314 ubiquitin C 4-25 1.00±0.01 NM_019271 stress 70 protein chaperone, microsome-associated 4-49 0.98±0.03 NM_173324 epidermal Langerhans cell protein LCP1 5-34 0.94±0.02 BC087588 protease product 5-52 0.82±0.01 NM_017033 phosphoglucomutase 1 6-23 0.91±0.03 NM_017033 phosphoglucomutase 1 7-13 1.80±0.11 AC136091 18 BAC CH230-329A5 7-21 0.89±0.04 NM_001025667 ring finger protein 2 7-51 1.12±0.08 NM_175838 eukaryotic translation elongation factor 1 alpha 1 8-9 0.97±0.04 NM_029564 homolog of mouse Tax1 (human T-cell leukemia virus type I) binding protein 3 8-16 0.83±0.05 BC087588 protease product 8-24 1.16±0.04 NM_175838 eukaryotic translation elongation factor 1 alpha 1

3.2.3 Yeast two-hybrid Screening results using the extreme C-terminus as bait.

The extreme C-terminus of mGluR6 was the last bait used to screen the rat retinal cDNA library. The number of viable cfu/mL were calculated using formulae described in methods section (see Methods, Calculation of mating efficiency and number of clones screened). The viable cfu/mL on SD-L (AH109, library strain, limiting partner) was

1.97×107, the viable cfu/mL on SD-T (Y187, bait strain) was 1.54×107, viable cfu/mL on

SD-LT (viability of diploids) was 2.35×104. This screening resulted in approximately

0.5×106 of yeast transformants; 28 clones were isolated by growth on drop out medium

under high stringency (QDO plates) and subjected to semi-quantitative LacZ assays to

measure β-galactosidase gene activity [105] (Fig. 3.5). Similar to what was done in the

other two screenings, a negative control selected randomly from non-screening plate (SD-

LT) was included in each set of lacZ assay experiments. An arbitrary cut off was made to

select clones with β-galactosidase activity with a minimum 2 fold over negative controls.

14 clones were selected from lacZ assay and digested using restriction enzyme to

examine for the presence of inserts and were subjected to sequencing analysis (Table

3.6).

Fig. 3.5. β-galactosidase activity assay with clones isolated in yeast two-hybrid screening

using the extreme C-terminus of mGluR6 as bait. The assay was performed in a 96-well

microplate. A negative control (designated as N) selected randomly from non-screening plate (SD-LT) was included in each set of experiments. Numbers on the X-axis indicate clone IDs assigned to individual clones. Y-axis indicates β-galactosidase activity readout at the wavelength of 570nm. An arbitrary cut off was made to select clones with β- galactosidase activity with minimum 2 fold over negative control. Dotted lines indicated where the arbitrary cut offs were made and clones with β-galactosidase activity higher than the dotted lines were selected for later analysis. Clones marked (*) in each figure were the ones selected for further analysis.

Table 3.6. Sequence identification of 14 clones from mGluR6 C-terminus screen.

Accession number: NCBI accession number.

Clone ID LacZ Value ± SD Accession number Protein ID 1-4 1.08±0.07 NM_181088 CASK-interacting protein CIP98 1-7 0.61±0.08 NM_181088 CASK-interacting protein CIP98 1-8 0.76±0.07 XM_575592 similar to Poly(rC)-binding protein 1 (Alpha-CP1) (hnRNP-E1) 1-9 1.01±0.22 XM_575592 similar to Poly(rC)-binding protein 1 (Alpha-CP1) (hnRNP-E1) 1-11 1.36±0.16 NM_025567 homolog of mouse cytochrome c-1 2-1 0.78±0.06 XM_575592 similar to Poly(rC)-binding protein 1 (Alpha-CP1) (hnRNP-E1) 2-4 1.43±0.01 NM_001025667 ring finger protein 2 2-6 0.81±0.01 XM_216944 similar to cytochrome c-1(rat) 2-9 0.83±0.03 XM_216944 similar to cytochrome c-1(rat) 2-10 1.68±0.01 NM_001025667 ring finger protein 2 2-25 1.00±0.05 NM_001008217 proteasome (prosome, macropain) subunit, alpha type 7 2-27 1.44±0.07 NM_001008217 proteasome (prosome, macropain) subunit, alpha type 7 2-31 1.03±0.01 XM_216944 similar to cytochrome c-1(rat) 2-32 0.83±0.01 XM_216944 similar to cytochrome c-1(rat)

3.3 Secondary tests on yeast two-hybrid clones with mGluR6.

A total number of ~1.1x107 diploids were screened; 634 clones were selected from growth assays and subjected to LacZ assays, 59 clones were selected from LacZ assays and subjected to sequencing analysis; 28 independent sequences were identified in the three yeast two-hybrid screens. To examine the specificity of these clones’ interaction with mGluR6, two independent secondary tests were performed using a yeast growth assay on QDO plates. Initial specificity tests were carried out by co-transforming isolated bait and library plasmids into strain Y187. Subsequent tests used mating as mating is more efficient (see Methods). The secondary tests provide basic information about the specificity of mGluR6 interaction with the potential interacting protein. Two non-specific baits, pGBKT7-53 (p53) and pGBKT7-RhoA (RhoA), and an empty vector (pGBKT7) were each transformed into Y187 cells; these served as negative controls to exclude library clones capable of self-activating transcription (pGBKT7) and library clones that non-specifically interact with all proteins (p53 and RhoA). Growth assays were used in these secondary tests rather than LacZ assays, allowing results to be assessed by simply observing visible growth of yeast on QDO plates after 3-4 days. Fig. 3.6 shows representative growth assays. Growth was scored as positive (+), intermediate (±) or negative (-) as defined in the figure legend (Fig. 3.6). Table 3.7 shows scores of all the clones examined in all three screens.

Fig. 3.6. Representative yeast growth assays of secondary tests to illustrate judgment of yeast growth.

Cotransformations were plated in 4 individual quadrants of the same plate. Left

panels are schematic figures showing how each quadrant was assigned, where il2 represents the second intracellular loop and il3 represents the third intracellular loop of

mGluR6. The other three baits are two non-specific baits (pGBKT7-53 (p53) and

pGBKT7-RhoA (RhoA)) and an empty vector (pGBKT7); these served as negative

controls to exclude library clones capable of self-activating transcription (pGBKT7) and

library clones that non-specifically interact with all proteins (p53 and RhoA). Numbers

(i.e. 2-47) represent library clone examined. SD-LT plates showed total growth of all

diploids under non-selective condition. QDO plate showed growth under stringent

conditions.

Results were evaluated by comparing the overall growth on QDO plates to growth

on SD-LT plates. No visible growth in QDO plates were scored as negative “-” (A). In

cases where only a fraction of the colonies seen on SD-LT plates grew on QDO plates

(B), this was also scored as negative “-”, as it likely represents yeast mutations. Where equivalent numbers of yeast colonies grew on QDO plates with both specific and non- specific baits (C), this was also scored as negative “-“. Robust specific growth of ≥ 50%

of total plated diploids was scored as “±” (D), and robust specific growth of > 50% of total plated diploids was scored as “+” (E).

SD-LT QDO score A

B -

D ±

E +

Table 3.7. Secondary test results of clones identified from three screens. Clone IDs are the same as in Tables 3.4-3.6. mGluR6 baits used (Screen) and growth scores are listed.

Clone ID Protein ID Screen Score 1-2 COMM domain containing 4, amino acids 131- il2 - end (199 aa) 1-3 homolog of unknown mouse protein il2 - 1-47 homolog of unknown mouse protein, 240-end il2 - (336 aa) 2-56 Carbohydrate kinase-like (Carkl), complete il2 + coding sequence (472aa) 3-8 unknown protein, amino acid 22-end (147aa) il2 - 3-21 homolog of mouse SNAP-associated protein, il2 - amino acid 1-44 (136aa) 3-23 similar to Poly(rC)-binding protein 1 (Alpha- il2 - CP1)(hnRNP-E1), (356aa) 3-26 homolog of mouse unknown protein, amino acid il2 - 162-end (248 aa) 3-43 homolog of mouse unknown protein, amino acid il2 - 1-53 (136aa) 3-48 chloride intracellular channel 1(Clic1), complete il2 + coding sequence(241 aa) 3-52 homolog of unknown mouse protein, complete il2 - sequnce (136 aa) 4-46 homolog of mouse sciellin, 593-end (652 aa) il2 - 4-47 COP9 (constitutive photomorphogenic) homolog, il2 - subunit 5, amino acid 16-141(334aa) 5-14 homolog of unknown mouse protein, amino acid il2 - 1-26(136 aa)

Table 3.7 (continued). Secondary test results of clones identified from three screens.

Clone ID Protein ID Screen Score 1-1 CASK-interacting protein CIP98, amino acid il3 ± 130-end (920 aa) 1-2 LRRGT00150 protein, amino acid 142-end?(1366 il3 - aa) 1-45 hypothetical protein XP_919599 il3 -

2-47 eukaryotic translation elongation factor 1 alpha 1, il3 - amino acid 287-end (462 aa) 3-8 eukaryotic translation elongation factor 1 alpha 1, il3 - amino acid 238-437 (462 aa) 3-24 similar to channel-interacting PDZ domain il3 ± protein isoform 1( rat), amino acid 357-530 (662aa) 4-24 ubiquitin C, amino acid 704-end (810aa) il3 -

4-25 stress 70 protein chaperone, microsome- il3 - associated, 60kD human homolog, amino acid 310-end (471 aa) 4-49 epidermal Langerhans cell protein LCP1, amino il3 - acid 104-263 (619aa) 5-52 phosphoglucomutase 1, amino acid 433-end (562 il3 - aa) 8-9 homolog of mouse Tax1 (human T-cell leukemia il3 - virus type I) binding protein 3, complete coding sequence (124 aa)

Table 3.7. (continued) Secondary test results of clones identified from all three screens.

Clone ID Protein ID Screen Score 1-4 CASK-interacting protein CIP98, aa 642-860 c-tail ± (920 aa) 1-7 CASK-interacting protein CIP98, aa 542-860 c-tail ± (920 aa) 1-8 similar to Poly(rC)-binding protein 1 (Alpha- c-tail - CP1) (hnRNP-E1) amino acid 33-210 (356 aa) 1-9 similar to Poly(rC)-binding protein 1 (Alpha- c-tail - CP1) (hnRNP-E1) amino acid 36-226 (356 aa) 1-11 homolog of mouse cytochrome c-1, amino acid 1- c-tail - 162 (325 aa) 2-1 similar to Poly(rC)-binding protein 1 (Alpha- c-tail - CP1) (hnRNP-E1) amino acid 34-215 (356 aa) 2-9 similar to cytochrome c-1, amino acid 1-174 (326 c-tail - aa) 2-10 ring finger protein 2,complete coding sequence c-tail - (308aa) 2-27 proteasome (prosome, macropain) subunit, alpha c-tail - type 7, amino acid 162-end (248 aa) 2-31 similar to cytochrome c-1, amino acid 1-154 (326 c-tail - aa) 2-32 similar to cytochrome c-1, amino acid 1-170 (326 c-tail - aa)

Following these secondary tests, 6 clones were identified as being potential

interaction partners of mGluR6, as they did not interact with non-specific baits (Table

3.6). Full length CarkL and Clic1 were isolated from screens using the second

intracellular loop of mGluR6 as bait, CIP98, amino acids 130-860 was isolated twice from screens using the third intracellular loop of mGluR6 as bait, as was a clone

predicted to encode a channel-interacting PDZ domain protein isoform 1. The C-terminal mGluR6 screen isolated 2 additional CIP98 clones, encoding CIP98, amino acids 642-

860 and amino acids 542-860. To identify whether these clones specifically interact with

mGluR6, various AD fusion constructs were generated using the second intracellular loop, the third intracellular loop and the C-terminal domain of mGluRs from different groups, with mGluR1 representing group I mGluRs, mGluR2 representing group II mGluRs, mGluR4, mGluR6, and mGluR7 representing group III mGluRs. Tests were then performed by growth assay on selected medium with high stringency (QDO plates) using these constructs as baits. The results suggested that none of these clones interacted with mGluR6 alone. Interestingly, none of these clones interacted with the intracellular loops of mGluR1, representing Group I mGluRs. CarkL and CIP98 showed the most specificity towards Group III mGluRs, while Clic1 interacted strongly with the intracellular loops of mGluR2 and mGluR4, but not with mGluR6 and mGluR7 (Table

3.8). These data indicated that CarkL and CIP98 may have some specificity and selectivity for Group III mGluRs.

Table 3.8. Secondary test results of clones that do not show non-specific interaction with negative controls.

Score

Protein screened mGR1-il2 mGR2-il2 mGR4-il2 mGR6-il2 mGR7-il2

CarkL - - + + +

Clic1 - + + ± ±

mGR1-il3 mGR2-il3 mGR4-il3 mGR6-il3 mGR7-il3 channel-interacting + + + + + PDZ domain protein isoform 1

CIP98 130-860 - - + + +

mGR1-tail mGR2-tail mGR4-tail mGR6-tail mGR7-tail

CIP98 542-860 - + + - -

CIP98 642-860 + + + + +

Chapter IV

Characterization of CIP98 as a potential regulator of mGluR6 function

A. Introduction: Rationale for focusing on CIP98 as a putative mGluR6 regulator.

CIP98 (Cask-interacting protein 98) was identified multiple times in our yeast

two-hybrid screening. Further, secondary tests suggested CIP98 interacts with Group III

mGluRs. To date, a clear function for CIP98 has not been elucidated. CIP98 expression

in retinal bipolar cells has not been reported. However, CIP98 has some very interesting

features that make it a strong candidate for regulating the function or/and localization of mGluR6.

CIP98 is a 920 amino acid protein with a molecular weight of 98kD that contains

a proline rich domain and three PDZ (post synaptic density protein (PSD95), Drosophila

disc large tumor suppressor (DlgA), and zonula occludens-1 protein (zo-1)) domains, a

domain which is known to interact with GPCRs (Fig. 4.1) [106, 107].

CIP98 has been shown to interact with calmodulin-dependent serine kinase

(CASK) via its C-terminal PDZ domain of CIP98. CASK is a member of the membrane

associated guanylyl kinase family of scaffolding proteins [108], which includes CASK,

PSD-95, and PSD-93, this family has been shown to play an important role in trafficking

and localization of proteins to synaptic sites [108]. 71

Furthermore, CASK has been shown to facilitate NMDA receptor localization

[109]. CIP98 and CASK co-localize to the dendritic processes of some neurons [107]. In

addition, mutation of the gene DFNB31, encoding CIP98 (also called whirlin) causes one

type of Usher syndrome characterized by hearing loss and visual impairment, suggesting

an important role for CIP98 in retinal normal function [110].

Fig. 4.1. Schematic figure of CIP98 and the three constructs isolated in yeast two hybrid screen. 3 PDZ domains are indicated, and P represents a proline-rich domain.

Furthermore, studies have shown that CIP98 plays an important role in synaptic

networks by its association and interaction with the orphan GPCR VLGR1b (Very Large

G protein coupled Receptor), and USH2A, proteins which co-localize with CIP98 in the

synaptic region of photoreceptors [111-113]. In adult rat retina, CIP98 shows specific

expression in the photoreceptor inner segments, in the outer limiting membrane and

connecting cilia, and in the outer plexiform layer where photoreceptors and bipolar cells

form synapses [111]. During rat embryonic development, CIP98 exhibits spatial and

temporal expression patterns in the retina [111]. At E12.5, transcription of CIP98 is

detected in the innermost layer of neural retina of developing eye, and also is seen

strongly detected in regions of the developing CNS such as the optic recess. Expression of CIP98 in these regions becomes more prominent and stronger as the embryo develops.

The developing photoreceptors start to express CIP98 from postnatal day 7 [111].

Because CIP98 was isolated multiple times from our yeast two-hybrid screens and

because of its potential function in retinal signaling and receptor localization, I decided to

confine my characterization of yeast two-hybrid interacting proteins to CIP98.

Association and colocalization of CIP98 and mGluR6, and effects of CIP98 on mGluR6 function was explored by a combination of co-immunoprecipitation, immunofluoresence and functional reconstitution in SCG neurons.

B. Methods.

4.1 Plasmid construction.

All plasmid constructs were amplified in E. coli and verified by sequencing.

HA-mGluR6: Hemagglutinin epitope (HA; amino acid sequence Y P Y D V P D Y A)

tagged mGluR6 was amplified from pcDNA3.1(-)/mGluR6 using overlapping PCR, with

a single HA tag being inserted between the 22nd and 23rd amino acid of mGluR6. In brief,

two pairs of primers were designed with an HA tag (underlined) included at the 3’ end of the reverse primer of one pair and at the 5’ end of the forward primer of the other pair: primer pair 1(mGluR6EcoRIForward primer, mGluR6HAtagReverse) and primer pair 2

(mGluR6HAtagForward primer, mGluR6BamHIReverse primer). Two PCR reactions

were carried out using 20 ng pcDNA3.1(-)/mGluR6 as template for each, using the

following thermocycler protocol: 94°C 10 min; 30 extension cycles (94°C, 30 sec, 54°C,

30 sec, 72°C, 1 min 30 sec); final extension at 72°C, 10 min; held at 4°C. Successful

PCR was verified using 1% agarose gel electrophoresis. Approximately 5 ng of each PCR product was then used in an overlapping PCR reaction to generate an mGluR6 DNA sequence containing an internal HA tag. An initial reaction was carried out using the following program: 94°C 10 min; 5 extension cycles (94°C, 30 sec, 60°C, 30 sec, 72°C, 2

min 30 sec); held at 25°C 30 sec. Primers (mGluR6EcoRIForward primer and

mGluR6BamHIReverse primer) were then added (each at 1µM) and PCR was continued

with the following program: 25 cycles (94°C, 30 sec, 54°C, 30 sec, 72°C, 2min 30 sec);

final extension at 72°C, 10 min; held at 4°C. Successful PCR products were visualized

using 1% agarose gel and approximately 300 ng PCR product was digested with the

restriction enzymes EcoRI and BamHI (Fermentas Life Sciences), gel purified using the

Qiagen Qiaquick Gel Extraction kit and protocol, and ligated to approximately 20 ng

EcoRI/BamHI digested, gel purified mGluR6/pcDNA3(-) plasmid using the Epicentre

Fast-Link DNA ligation kit and protocol.

HA-mGluR2: HA tagged mGluR2 (HA tag inserted between the 21st and 22nd amino

acid residue) was constructed using the same conditions as HA-mGluR6 and the following primers: primer pair 1: mG2-pCI HindIIIforward AAGCTTTATTGCGGTA

GTTTATCACAGTTAAATTGC, mG2-HA tag reverse AGCGTAGTCTGGGACGTC

GTATGGGTACGGGCCCTCGGCCAC; primer pair 2: mG2-HA tag forward TACCC

ATACGACGTCCCAGACTACGCTGCCAAGAAGGTG CTGACCCTG, mG2-pCI

XhoIreverse CTCGAGCTCGAAAGCCTCAATGCC. Following overlapping PCR,

approximately 300 ng PCR product were digested with the restriction enzymes HindIII and XhoI, gel purified and ligated to approximately 20 ng HindIII/XhoI digested, gel purified mGluR2/pCI plasmid as described above.

CIP98 constructs:

A. CIP98 130-860, CIP98 542-860, CIP98 642-860, CIP98 542-920 and full length

CIP98 in pcDNA3.1(+):

DNA fragments encoding truncated forms of CIP98 (CIP98 642-860, 542-860,

130-860) were amplified by PCR using 20 ng library clones identified in yeast two- hybrid screening as template and specific primers (each at 1 µM) carrying XhoI and

BamHI restriction sites.

PCR reactions were carried out with the following thermocycler protocol: 94°C,

10 min; 35 extension cycles (94°C, 30 sec, 53°C, 30 sec, 72°C, 4 min); final extension at

72°C, 10 min; held at 4°C. Successful PCR was verified using 1% agarose gel

electrophoresis. PCR products (approximately 20 ng) were then ligated into PCRII-

TOPO-Blunt cloning vector (Invitrogen) following the user manual. Ligated product was

used to transform chemically competent E. coli, and transformation reactions were plated

on LB-Kan plates. Single colonies were picked for growth in LB-Kan liquid media (18-

24 hrs), followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit

and protocol). Approximately 4 µg of plasmid was digested with the restriction enzymes

BamHI and XhoI (Fermentas Life Sciences), gel purified using the Qiagen Qiaquick Gel

Extraction kit and protocol, and approximately 400 ng gel purified product was ligated to

approximately 20 ng BamHI and XhoI digested, gel purified pcDNA3.1(+) vector using

the Epicentre Fast-Link DNA ligation kit and protocol. Ligated product was used to

transform chemically competent E. coli, and transformation reactions were plated on LB-

Amp plates. Single colonies were picked for growth in LB-Amp liquid media (18-24 hrs), followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit and protocol).

CIP98 542-920: Reverse transcription was performed using 2 µg rat retinal total RNA as

template to generate cDNA following user manual of Omniscript RT kit (Qiagen).

DNA fragments encoding CIP98 542-920 were amplified by PCR using cDNA

equivalent to 1/10 of materials in the reverse transcription as template and specific

primers (each at 1 uM) carrying BamHI and XhoI restriction sites (forward primer:

GATCGGATCCACCATG CCGGGCATTGCACCCAC, reverse primer: CTAGCTC

GAGTCAGAGCATCACGTTGAACTCAGTGACC).

PCR reactions were carried out with the following thermocycler protocol: 94°C,

10 min; 35 extension cycles (94°C, 30 sec, 53°C, 30 sec, 72°C, 4 min); final extension at

72°C, 10 min; held at 4°C. Successful PCR was verified using 1% agarose gel

electrophoresis. PCR products (approximately 20 ng) was then ligated into PCRII-TOPO-

Blunt cloning vector (Invitrogen) following the user manual. Ligated product was used to

transform chemically competent E. coli, and transformation reactions were plated on LB-

Kan plates. Single colonies were picked for growth in LB-Kan liquid media (18-24 hrs),

followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit and

protocol). Approximately 4 µg of plasmid was digested with the restriction enzymes

BamHI and XhoI (Fermentas Life Sciences), gel purified using the Qiagen Qiaquick Gel

Extraction kit and protocol, and approximately 400 ng gel purified product was ligated to

approximately 20 ng BamHI and XhoI digested, gel purified pcDNA3.1(+) vector using the Epicentre Fast-Link DNA ligation kit and protocol. Ligated product was used to transform chemically competent E. coli, and transformation reactions were plated on LB-

Amp plates. Single colonies were picked for growth in LB-Amp liquid media (18-24 hrs), followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit and protocol).

Full length CIP98: The DNA fragment encoding full length CIP98 was generated by

PCR reaction using cDNA equivalent to 1/10 material cDNA equivalent to 1/10 of

materials in the reverse transcription using the following primers at 1 uM (forward primer: GATCGGATCCACCATGAACGCACAGCTGGACGG, reverse primer:

CTAGCTCGAGTCAGAGCATCACGTTGAACTCAGTGACC). PCR reactions were

carried out with the following thermocycler protocol: 94°C, 10 min; 35 extension cycles

(94°C, 30 sec, 53°C, 30 sec, 72°C, 4 min); final extension at 72°C, 10 min; held at 4°C.

Successful PCR was verified using 1% agarose gel electrophoresis. PCR products

(approximately 400 ng) were then digested with the restriction enzymes BamHI and XhoI

(Fermentas Life Sciences), gel purified using the Qiagen Qiaquick Gel Extraction kit and

protocol, and ligated to approximately 20 ng BamHI and XhoI digested, gel purified pcDNA3.1(+) vector using the Epicentre Fast-Link DNA ligation kit and protocol.

Ligated product was used to transform chemically competent E. coli, and transformation reactions were plated on LB-Amp plates. Single colonies were picked for growth in LB-

Amp liquid media (18-24 hrs), followed by miniprep purification of plasmid (Fermentas

GeneJet Miniprep kit and protocol).

The amplified CIP98 generated from this approach was a modified form of CIP98 containing a 40 bp genomic sequence at its 3’ end that did not match anything in NCBI database. To correct this, I took advantage of a BglII site at 1738 bp in both CIP98 542-

920 and the full length CIP98 coding sequence. Using this site, I could swap the 3’ end

(BglII-XhoI) of CIP98 542-920 with the BglII- XhoI site of the incorrect full length

CIP98. However, as there is another BglII site in the pcDNA3.1(+) vector which would interfere with this approach, the vector was first modified to eliminate the BglII site. pcDNA3.1(+) vector was digested with BglII and filled in with Klenow to generate a linear vector with blunt ends. This linear vector was then ligated and transformed into E. coli. Following a miniprep, successfully modified vector was verified by demonstrating lack of BglII digestion. pcDNA3.1(+)/full length CIP98 (with genomic sequence) and pcDNA3.1(+)/CIP98 542-920 were then digested with BamHI and XhoI to release the inserts encoding full length CIP98 and CIP98 542-920, respectively; these inserts were each ligated into BamHI/XhoI digested, gel purified BglII-minus pcDNA3.1(+) vector.

The newly constructed plasmids were digested with BglII and XhoI. The ~1kb insert fragment generated from CIP98 542-920 construct was ligated to the vector carrying the

5’ end of full length CIP98 construct to replace the sequence containing the genomic sequence. Ligated product was used to transform chemically competent E. coli, and transformation reactions were plated on LB-Amp plates. Single colonies were picked for growth in LB-Amp liquid media (18-24 hrs), followed by miniprep purification of

plasmid (Fermentas GeneJet Miniprep kit and protocol). This generate a new construct

which contains full length CIP98.

B. CIP98 130-860 in pcDNA3.1/HisC:

CIP98 130-860 in pcDNA3.1/HisC was constructed using pcDNA3.1(+)-CIP98

130-860 as template. Approximately 4 µg of pcDNA3.1(+)-CIP98 130-860 plasmid was

digested with the restriction enzymes BamHI and XhoI (Fermentas Life Sciences), gel

purified using the Qiagen Qiaquick Gel Extraction kit and protocol, and approximately

400 ng gel purified product was ligated to approximately 20 ng BamHI and XhoI digested, gel purified pcDNA3.1/HisC vector (Invitrogen). Ligated product was used to transform chemically competent E. coli, and transformation reactions were plated on LB-

Amp plates. Single colonies were picked for growth in LB-Amp liquid media (18-24 hrs), followed by miniprep purification of plasmid (Fermentas GeneJet Miniprep kit and protocol).

4.2. mRNA expression of targeted genes in ON bipolar cells.

Single cell RT-PCR was used to detect the mRNA expression of CIP98 in rat

retina bipolar cells. Single-cell RT-PCR was carried out using gene specific primers

(forward primer AGTTCACTCACTGCCTCAACGC, reverse primer ACCCGTAA

CCCTTCCTTCTCTG) at a final concentration of 0.6 uM with OneStep RT-PCR kit

(Qiagen, Valencia, CA), as described in Chapter II, Methods. Detection of mGluR6 was

used as a positive indicator of ON bipolar cells. A positive control using total RNA

extracted from whole rat retina (RNeasy® Mini kit, Qiagen) was used to confirm

effectiveness of each primer pair. The two negative controls were RNase-free H2O and

bath solution from the culture dish collected with a patch pipette in the same way single

cells were harvested, respectively. In single cell RT-PCR where rat SCG neurons were

used, cells were harvested in the same way as bipolar cells, with the exception that 3-4

cells were included in each reaction to enhance the strength of signal.

Each reaction was subjected to the following PCR thermocycler protocol: 50°C for 30 min, 95°C for 15 min; 30-40 extension cycles (94°C for 30 sec, 60°C for 30 sec,

72°C for 30 sec); final extension at 72°C for 10 min; held at 4°C. Samples were analyzed by 2% agarose gel electrophoresis.

4.3. SCG isolation and cDNA injection.

Detailed methods for isolation SCG neurons and for cDNA injections are in

Chapter II. Rat mGluR6 and all constructs of CIP98 were injected at 100 ng/μl each. To identify successfully injected neurons, cells were co-injected with enhanced green fluorescent protein cDNA (pEGFPN1, BD Clontech) at 0.2 ng/μl. The CIP98 constructs

[all in pcDNA3.1(+)] used were: rat: full length CIP98, CIP98 130-860, CIP98 542-960,

CIP98 542-920, and CIP98 642-860.

4.4. Functional characterization of mGluR6/CIP98 interaction in rat sympathetic

neurons.

The effect of introduction of CIP98 constructs on mGluR6/Gαo coupling was

examined following co-expression in SCG using nuclear injection. The effect of different

constructs on glutamate-mediated activation of mGluR6 was monitored by measuring

calcium current modulation using whole cell patch-clamp electrophysiology (see Chapter

II, Methods).

4.5. Cell culture and transfection.

Human embryonic kidney 293 (HEK293) cells were cultured at 37°C with 5%

® CO2 atmosphere in Dulbecco’s Modified Eagle’s Medium (DMEM, Mediatech Cellgro )

supplemented with 10% fetal bovine serum (Thermo Scientific, HyClone®), 1%

Penicillin-streptomycin (Mediatech Cellgro®), 1% HEPES ( Mediatech Cellgro®), and

1% non-essential amino acid (Mediatech Cellgro®).

Cells were transfected according to the Polyfect (Qiagen)user manual. Briefly, cells were seeded at 2x106 cells per 100mm dish or 5×104 cells per OptiPlus positively

charged barrier slide (Biogenex, CA) 24 hours prior to the transfection. Transfections

contained 8 µg DNA (4 µg CIP98 plasmid and 4 µg of pcDNA3.1(+) plasmid; or 4 µg

mGluR2/6 and 4 µg of pcDNA3.1/HisC plasmid) per 100 mm dish (barrier slides were

set in 100 mm dishes and transfected in the same way as cells plated on 100 mm dishes).

Some reactions used 4 µg pEGFP to gauge transfection efficiency. After transfection,

cells were cultured for 48 hours in complete medium prior to analysis.

4.6. Cell lysis, Immunoprecipitation and Immunoblotting.

Rat retinal total protein was extracted using protein extraction kit (Bio-Rad).

Briefly, retinas were acutely isolated from several rats and sonicated briefly. After

incubation in lysis buffer for 30 min at 4°C, retinal total protein was collected by

centrifugation at 10,000 rpm for 10 min.

Transfected, HEK293 cells monolayers were harvested in 1xPBS and centrifuged

at 1000rpm for 10 minutes at 4°C. Then cell pellets were washed twice with 1xPBS and

lysed for 1 hour at 4°C in regular lysis buffer containing: 25mM HEPES (PH 7.0), 300

mM NaCl, 1.5 mM MgCl2, 2 mM EDTA, 0.5% Triton X-100, 1% Nonidet P-40, 1%

deoxycholine, protease inhibitor cocktail (Amresco). Whole cell lysates were collected by

centrifugation at 10,000 rpm for 10 minutes at 4°C and total protein concentration

measured using a BCA quantitation assay (Pierce) following the user manual. Indicated amounts of total protein extract were analyzed by SDS-polyacrylamide gel (SDS-PAGE) electrophoresis and immunoblotting to verify successful expression of each protein as

described below. For immunoprecipitation, 500 µg total protein (in some experiments

1000 µg total protein), was diluted in lysis buffer to a final volume of 200 µl or 500 µl,

immunoprecipitated with either 1 µg or 2 µg anti-HA [BD Clontech] or anti-Xpress

[Invitrogen, CA] antisera for 2-4 hours at 4°C. Antibody was captured with 50 µl of a

slurry of 50% protein A/G beads (Invitrogen) equilibrated in lysis buffer by mixing

overnight at 4°C, beads were washed three times with lysis buffer. Bound protein eluted

in 2x loading buffer and analyzed by SDS-PAGE electrophoresis and immunoblotting as

described below. In some experiments, HEK293 cells were treated with PTX (List

Biological Lab. Inc. Campbell, CA) at 500 ng/ml overnight at 37°C prior to lysis. In

GTPγS experiments, cells were lysed using lysis buffer lacking Nonidet P-40 and

deoxycholate and supplemented with 1uM GTPγS for 1 hour at 4°C prior to

immunoprecipitation. For immunoblotting, after the addition of 2×loading buffer

containing 20% glycerol, 0.14 M Tris pH 6.8, 40 mg/ml SDS, 50 µl/ml β-mecaptoethanol

and bromophenol blue for visualization, each sample was denatured at the temperatures

indicated in each figure legend for 10 minutes, separated by SDS-PAGE electrophoresis

with a 3% stacking gel and either a 6% or an 8% separating gel, and transferred to PVDF

membrane (Immobilon, Millipore) at 4°C degrees overnight at a constant voltage of 25V.

Following blocking with 5% nonfat dry milk in TBST (50 mM Tris-HCl, pH 8.0, 138

mM NaCl, 2mM KCl, 0.05% Tween-20), for 1 hour at room temperature, blots were

probed with specific antisera as described in each figure legend for 2-4 hours at room

temperature. Filters were washed 4 times 10 min with TBST, then incubated with

corresponding horseradish peroxidase-conjugated secondary antibody (1:20,000 for anti-

mouse antibody; 1:25,000 for anti-mouse antibody; Amersham) for 1 hour. Following 4 times 10 min TBST target proteins were visualized by enhanced chemiluminescence

(SuperSignal West Pico Chemiluminescent Substrate, Pierce) and Kodak X-ray film with exposure times indicated in each figure legend. The primary antisera used in immunoblottings were: anti-HA antibody (1:1,000 dilution in 2% nonfat dry milk in

TBST; [BD Clonthech]), anti-Xpress antibody (1:2,000 dilution in 2% nonfat dry milk in

TBST; [Invitrogen, CA]), and anti-DFNB31 (1:1,000 dilution in 2% nonfat dry milk in

TBST; [Novus Biologicals]).

4.7. RNA extraction and qPCR analysis.

Total RNA was extracted from untransfected and transfected HEK293 cells (80%

confluency) using the RNeasy® Plus Mini kit (Qiagen) according to the user manual.

Briefly, cells were washed once with 10 ml 1xDPBS(Mediatech, Inc, VA) and disrupted

with 600 µl buffer RLT plus supplemented with β-mercaptoethanol (10 µl/ml). Cell

lystes were homogenized using a Qiashredder™ spin column and genomic DNA was

eliminated using gDNA Eliminator spin column. RNA was captured on RNeasy mini

spin columns, washed and eluted in 50 µl nuclease free water. RNA concentrations were

measured using NanoDrop® ND-2000 (Thermo Scientific, DE).

Expression of mGluR6 and CIP98 genes was examined using two-step quantitative real-time PCR. 2 µg total RNA from HEK293 cells was reverse transcribed using the First Strand cDNA Synthesis Kit (Fermentas) according to the manufacturer’s protocol. 2 µg total RNA was mixed with random hexamer primer, heated to 70°C to denature the RNA, and reverse transcribed in the presence of RNase inhibitors. After inactivation of the reverse transcriptase, first strand product equivalent to 0.2 µg total

RNA was used to perform qPCR using a SYBR green PCR Master Mix (Fermentas) and primer pairs as listed in Table 4.1. PCR reactions were carried out with an Eppendorf

Realplex2 Mastercycler using the following program (95°C 10 min; 40 cycles of (95°C

15 sec, 55°C 15 sec, 68°C 20 sec); 95°C 15 sec, 60°C 15 sec, 95°C 15 sec).A negative control using samples processed without reverse transcriptase was included. Post amplification dissociation curves were performed to verify the presence of unique amplification products.

Standard curves of mGluR6 and CIP98 were generated using half-log serial dilutions of pcDNA3.1-mGluR6 and pcDNA3.1HisC-CIP98 130-860 plasmids. Table 4.1 lists primers used to generate standard curve. Data were analyzed using GraphPad Prism

4 (GraphPad Software, Inc. La Jolla, CA) and Excel.

Copy number was calculated with the following methods:

This calculation is based on the assumption that the average weight of a base pair

(bp) is 650 Daltons. The number of copies of template in the sample can be estimated by the following formula:

number of copies = (amount µg x 10-6 x 6.022x1023) / (length bp x 650 g/mole of bp)

Table 4.1. qPCR primers.

Primer name Primer sequence rCIP98forward (for standard curve) ACCTAGACCAGTACCGTGGTG rCIP98reverse (for standard curve) CCTCAGACAGGAGTGAGAACTTG r-mGluR6forward (for standard curve) AACGTCTTGCGCCTGTTT r-mGluR6reverse (for standard curve) AGGAGTCAGGAGGCACCAC h-mGluR6forward CCATGTACACCACCTGCATC h-mGluR6reverse CGGTTAGCGTGGTTGTCTG hCIP98forward GGCCTACTACCTGGATGAGTACC hCIP98reverse CACCTCAGAGAGGAGTGAGAACT

4.8. Immunofluorescence.

Immunofluorescence experiments were carried out using HEK293 cells grown

and transfected on OptiPlus positively charged barrier slides (Biogenex, CA). Slides were

placed in a 100 mm cell culture dishes with 10 ml complete medium (see above) added to

the dish to cover each slide. 48 hours after transfection, cells were washed twice with 10 ml cold PBS, then fixed using 2% paraformaldehyde (Sigma)/PBS for 10 minutes at room temperature. In some cases, cells were then permeablized using 0.01% Triton X-

100/PBS at room temperature for 5 minutes. After being blocked in 2% normal goat

serum for 2 hours at room temperature, cells were incubated with a mixture of 1:500 anti-

Xpress antisera and 1:250 anti-HA antisera in diluted in PBS overnight at 4°C. After washing 3 times 5 minutes with cold PBS, a combination of secondary antibodies (Alexa

Fluor®488 goat anti-mouse antibody and Alexa Fluor®568 goat anti-rabbit antibody, each

at 1:1000 dilution in PBS; Invitrogen, CA) was incubated with the slides for 1 hour at

room temperature. After washing with cold PBS 3 times 5 minutes, the slides were

mounted with Vectashield® mounting medium with DAPI (Vector, CA), covered

carefully with cover glass (24x60 mm, Corning Labware&Equipment) and sealed with

black nail polish. Cells were observed using an inverted fluorescence microscope

(Olympus XI51) and pictures taken with Olympus DP72 for fluorescence images.

Confocal images were obtained on a Zeiss LSM510 META Confocal Imaging System

with 63x water objective, and analyzed using LSM Image Browser (Carl Zeiss. Inc.).

C. Results.

4.1 Examination of expression of CIP98 in bipolar cells and retina.

mGluR6 has a unique expression pattern which is restricted to retinal ON bipolar

cells [2, 3, 35]. In order to identify a possible physiological function of CIP98 in

regulating mGluR6 function, we first examined whether CIP98 is also expressed in

retinal ON bipolar cells. Single cell RT-PCR (see methods) was adopted using rat retinal

bipolar cells to detect mRNA for CIP98. In each RT-PCR reaction, two pairs of primers were included, one to detect mGluR6 as an indicator of ON bipolar cells, and the other to

detect CIP98. Total retinal RNA was used as a positive control, and two negative controls

were included (designated as N1 and N2), using either H2O or bath solution as RNA

source, respectively. In all three bipolar cells harvested, both mGluR6 and CIP98

transcript were detected (figure 4.2A), suggesting CIP98 is expressed in rat retinal ON

bipolar cells. To further confirm the expression of native CIP98 in retina, immuno blot

analysis was performed on total protein extracts from rat retinas. Retinal total protein was used to examine the expression of CIP98, due to the limited amount of material available from isolated ON bipolar cells,. Using different amounts of total retinal protein and a

CIP98 specific antibody, a distinct band was detected with the molecular weight ~98kD

consistent with the expression of CIP98 in retina (Fig. 4.2B).

4.2. Functional analysis of different CIP98 constructs in the SCG reconstitution

system.

Having identified that truncated forms of CIP98 interact with mGluR6 in the yeast

system, we assessed whether these interactions might impact mGluR6 signaling cascade

in mammalian neurons. pcDNA3.1-based plasmids carrying different CIP98 constructs

(see Methods) were co-injected with mGluR6 in our established reconstitution system

using rat sympathetic neurons from the rat SCG [72]. In this reconstitution system where

we have shown activated mGluR6 modulation of N-type calcium channels, we found a

dose-dependent shift in the mGluR6 response to agonist (L-glutamate) when co- expressed with certain CIP98 truncation mutants (CIP98 130-860, CIP98 542-860, and

CIP98 542-920). As illustrated in Fig.4.3A, B, these truncated mutants caused a rightward shift in the glutamate dose-response curve. In contrast, this dose-dependent shift was not observed when mGluR6 was coexpressed with the shortest form of CIP98

Fig. 4.2. CIP98 expression in the rat retina. (A).Single cell RT-PCR results showing mGluR6 and CIP98 expression together in individual cells. Positive control (+), N1 and

N2 are as described in Fig. 2.4. (B).Immuno blot showing expression of CIP98 in protein isolates from whole rat retina. Blot was exposed to film for 20 sec. The ~98kD bands indicate presence of CIP98 in the retina. Amount of total protein loaded is indicated.

identified in yeast two-hybrid screening (CIP98 642-860) (Fig. 4.3C), which did not

show any selectivity in yeast assay (Table 3.8). Similarly, full length CIP98 was also

ineffective in modulating mGluR6 dose response (Fig. 4.3D).

The dose response data, combined with yeast assay data, suggest that the CIP98

constructs that interact with mGluR6 appear to produce a shift in the dose response.

mGluR2 was also tested as negative control, as CIP98 130-860 did not interact with

mGluR2 in yeast two hybrid tests (Table 3.8). Not surprisingly, co-expression of CIP98

130-860 with mGluR2 did not cause any significant shift in the mGluR2 dose response curve (Fig. 4.3E). These observations indicate that the interaction between mGluR6 and

CIP98 identified in yeast two hybrid screening may be physiologically relevant.

4.3. Are mGluR6 and CIP98 endogenously expressed in HEK293 cells?

Studies aimed at showing direct interaction between mGluR6 and CIP98 were

carried out in HEK293 cells. Before evaluating these interactions, it is important to assess

the endogenous CIP98 and mGluR6 expression levels in HEK293 cells. This was done by

qPCR analysis of CIP98 and mGluR6 in native HEK293 cells.

Standard curves were generated using serial dilutions of rat HA-mGluR6 and rat

Xpress-CIP98 130-860 plasmids (Fig. 4.4). Though these curves were used to assess

levels of human transcripts in HEK293 cells, primer pairs were designed to amplify

regions of mGluR6 and CIP98 that are highly homologous between rat and human. In

addition, corresponding rat and human primers had similar melting temperatures and GC

content. Thus, these standard curves should give an accurate assessment of mGluR6 and

CIP98 transcript levels in HEK293 cells.

In native HEK293 cells, mGluR6 did not amplify above baseline at 40 cycles, and

human CIP98 message was detected with an average Ct value of 28.2. Extrapolating from

the CIP98 standard curve, this is equivalent to 6x10-8 µg/µl template. The calculated copy

number was 3x104 in 0.2 µg total RNA ( See Methods for formula). The total RNA

isolated from HEK293 cells (~3x106 cells) was 58.3 µg. This resulted in ~3 copies of

native CIP98 per cell.

Following transfection of Xpress-CIP98 130-860, the average Ct for transfected

rat CIP98 was 12.1 with a delta Ct of 16.1. Thus, under the transfection conditions used

for all subsequent experiments, the endogenous human CIP98 was unlikely to interfere

with analysis as it represented only about 0.0015% of the total cellular CIP98.

4.4 Do mGluR6 and CIP98 co-immunoprecipitate?

To perform a more careful examination of the interaction between mGluR6 and

CIP98, co-immunoprecipitation and immunoblotting were used to confirm the interaction

of mGluR6 and CIP98 constructs in HEK293 cells, since physical interaction in a more physiologically-relevant environment is a critical component in validating yeast two- hybrid data. HEK293 cells are quite commonly used in co-immunoprecipitation experiments since they are easy to culture and to transfect. Transfection efficiency in my experiments was around 70% percent, as assessed by transfection with pEGFP-N1 plasmid (Fig. 4.5).

In this HEK293 cell system, I utilized epitope tagged versions of both mGluR6 and CIP98 130-860 to facilitate visualization of proteins using commercially available

antibodies. The tagged receptor was tested in the SCG reconstitution system and it

Fig. 4.3.Effect of CIP98 coexpression on mGluR6 signaling in isolated SCG neurons.

Effects are measured as the percentage inhibition of calcium current upon activation of mGluR6 by L-glutamate. (A).Moderate truncation of CIP98 produces a rightward shift in the mGluR6 dose response which is statistically significant. EC50 (mGluR6 alone)

=8.8uM, EC50 (mGluR6 with CIP98 130-860) =23.5uM. *P=0.01 relative to mGluR6 alone. (B). CIP98 542-920 causes a rightward shift in mGluR6 dose-response curve while

CIP98 542-860 causes a moderate but non-significant shift. *P=0.02 relative to mGluR6 alone. (C, D). Neither CIP98 642-860 (P>0.27 at all data points) nor full length CIP98

(P>0.15 at all data points) alter mGluR6 signaling. (E). mGluR2 dose-response is not affected by CIP98 130-860 (P>0.21 at all data points).

Fig. 4.4. Standard curves for CIP98 and mGluR6 using qPCR analysis. The primers used

were designed to amplify regions where the sequence homology between rat and human is 85% for CIP98 and 94% for mGluR6. Half-log serial dilutions of pcDNA3.1-mGluR6

and pcDNA3.1HisC-CIP98 130-860 plasmids each ranging from 1:104 to 1:3x107 were used. Reactions were carried out in duplicates and error bars represent SEM.

expressed well and was functional (data not shown). Initial experiments were performed

to show that all target proteins including HA tagged mGluR6, HA tagged mGluR2,

Xpress tagged CIP98 130-860, and untagged CIP98 542-920 can be successfully overexpressed in HEK293 cells (Fig. 4.6A, B). If mGluR6 is directly associated with

CIP98, it may be possible to co-immunoprecipitate them from HEK293 cell lysates. The

two CIP98 constructs tested were CIP98 130-860 and CIP98 542-920 since they both

caused a rightward shift in the dose-response curve of mGluR6 (Fig. 4.3A, B). Xpress

epitope tagging was chosen for CIP98 130-860, as the commercially available antibody is

raised against the extreme C-terminus of CIP98 which does not recognize the product of

this construct.

Co-immunoprecipitation experiments were carried out in HEK293 lysates using

both standard and modified conditions (see Methods and below). Initial conditions as

described in Methods failed to show an interaction between mGluR6 and CIP98 130-860

(Fig. 4.7).

I tried several different conditions to optimize the system. The most important

condition is the lysis buffer. I modified the lysis buffer condition by using different

detergent combination and concentration (0.5% Triton X-100, 1% deoxycholine, 1%

Nonidet P-40; 0.5% Triton X-100, 1% deoxycholine, 1% Nonidet P-40, 0.1% SDS; 0.5%

Triton X-100, 1% deoxycholine, 1% Nonidet P-40, 0.5% lubrol; 1% Triton X-100; 0.1%

Triton X-100), hoping to find a balance point where the target proteins are solublizeds yet

well maintained their conformation. Further, I tried to vary the concentration of proteins

Fig. 4.5. Image of HEK293 cells transfected with pEGFP-N1. See Methods for detailed description of culturing and transfecting HEK 293 cells. Cells were visualized with an inverted fluorescent microscope using FITC filter. Shown is a representative field of 8 independent fields examined. Scale bar represents 20 um.

Fig. 4.6. Immunoblotting of HEK293 cells. A. HEK293 cells were transfected with

tagged mGluR and CIP98 constructs. From right to left lane: HA tagged mGluR2, HA

tagged mGluR6, Xpress tagged full length CIP98, Xpress tagged CIP98 130-860. Total

protein loaded: 50 µg per well. Blots were probed with anti-HA antibody(1:1000) to

detect HA-tagged mGluR2/6, and with anti-Xpress antibody (1:2000) to detect Xpressed-

tagged CIP98 constructs. Exposed for 1 min for mGluRs and 10 sec for CIP98 constructs.

B. Immunoblotting of untagged CIP98 542-920 overexpressed in HEK293 cells and probed with anti-DFNB31 antibody (1:1000) which is raised against the extreme C-

terminus of CIP98 (Novus Biologicals). Total protein loaded: 50 µg per well. Blot was

exposed for 10 sec.

260KD

140KD

100KD 70KD

50KD

CIP98 542-920 50KD

in the immunoprecipitation (3 different concentrations between 1 mg/ml to 5 mg/ml), as

an increased amount of material might yield stronger detectable signal. The protein

extraction methods were modified, such as sonication verses non-sonication. The rationale for employing physical dissociation methods to disrupt the plasma membrane is

that I might be able to lower the concentrations of detergents, thus provide a better

chance to see weak interactions. The amount of precipitating antibody used was varied from 1µg to 2 µg, as greater antibody concentrations may provide a better chance of precipitating the target protein. I also tried to perform the immunoprecipitation using

either antibody targeting the HA tagged mGluR6 construct or antibody targeting the

Xpress tagged CIP98 130-860 construct. Unfortunately, none of these conditions resulted

in co-immunoprecipitation between mGluR6 and CIP98 130-860, qualitatively different

from the results in Fig. 4.7 (data not shown).

Co-immunoprecipitation experiments were also performed using HA-mGluR6

and untagged CIP98 542-920, as CIP98 542-920 caused rightward shift in mGluR6 dose-

response curve (Fig. 4.3B). For this co-immunoprecipitation, a lysis buffer containing 25

mM HEPES, 300 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1% Triton X-100, and protease inhibitors was used. Again, no interaction between CIP98 542-920 and HA- mGluR6 was seen (Fig. 4.8). I did not perform the immunoprecipitation using commercially available antibody targeting untagged CIP98 542-920 construct, as multiple bands were detected in western blots of whole cell lysates (Fig.4.6).

100

Lysate IP Supernatant

IB: anti-HA

IB: anti-Xpress

HA-mGluR6 + - + + - + + - +

Xpress-CIP98 130-860 - + + - + + - + +

Fig. 4.7. Co-immunoprecipitation of HA-mGluR6 with Xpress-CIP98 130-860 with 2 µg anti-Xpress antibody following incubation with 500 µg of HEK 293 cell lysates expressing HA-mGluR6 or/and Xpress-CIP98 130-860 (indicated as “-” and “+” in the figure). A lysis buffer containing 25 mM HEPES, 300 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.1% Triton X-100, and protease inhibitors was used. Left panel shows expression of both constructs from 50 µg aliquots of HEK 293 cell lysates (1:10 of the

protein precipitated); the middle panel shows co-immunoprecipitated total material; the

right panel shows fraction of supernatant collected following co-immunoprecipitation

(equivalent to 1:10 of the material used in the precipitation). Immunoblotting was

performed using antibody indicated on the figure. The blot in the upper panel was

exposed for 5 min, and the blot in the lower panel was exposed for 10 sec.

101

Lysate IP Supernatant IB: anti-DFNB31

IB: anti-HA

HA-mGluR6 + - + + - + + - +

CIP98 542-920 - + + - + + - + +

Fig. 4.8. Immunoblot showing the result of co-immunoprecipitation experiment of HA-

mGluR6 with CIP98 542-920 with 2 µg anti-HA antibody following incubation with 500

µg of HEK 293 cell lysates expressing HA-mGluR6 or/and CIP98 542-920 (indicated as

“-” and “+” in the figure). Left panel shows expression of both constructs in

corresponding 50 µg aliquots of HEK 293 cell lysates; middle panel shows results of co-

immunoprecipitation; right panel shows supernatant collected from co-

immunoprecipitation. Immunoblotting was performed using antibody indicated on the figure. The upper panel was exposed for 5 sec, and the lower panel was exposed for 30 sec.

102

One possible explanation for the negative results from these co-

immunoprecipitation experiments is that mGluR6 remains associated with its G protein

heterotrimer, thus blocking a potential interaction interface between mGluR6 and CIP98.

One way to examine this hypothesis is to uncouple Gα from mGluR6 using PTX, since

mGluR6 couples to Gαo and PTX catalyses the ADP-ribosylation of the Gi/o family.

After overnight treatment with PTX, protein samples were collected and co-

immunoprecipitation performed using lysis buffer described in Fig. 4.7. Other conditions

are described in the figure legend (Fig. 4.9).

Under these conditions, when HA-mGluR6 and Xpress-CIP98 130-860 were co-

expressed, a very small portion of HA-mGluR6 was precipitated with Xpress-CIP98 130-

860 (Fig. 4.9, upper middle panel). However, comparing the strength of the band in the

lysate lanes to the immunoprecipitated signal, and taking into account that relative

amount of protein that each represents, I estimate that only ~ 5% of HA-mGluR6 was

precipitated. However, these appears to be some level of receptor degradation in this

sample, making interpretation difficult.

Another approach to release heterotrimer is to use GTPγS, a nonhydrolyzable analogue of GTP, to form a persistently bound state of Gα. Hopefully the interaction interface of mGluR6 will be released to associate with CIP98. After treatment with

GTPγS for 1 hour, protein samples were collected and co-immunoprecipitation performed using lysis buffer described in Fig. 4.7. Other conditions are described in the figure legend (Fig. 4.10).

103

Under these conditions, when HA-mGluR6 and Xpress-CIP98 130-860 were co-

expressed, and precipitated using anti-HA antibody targeting the receptor, no observable

Xpress-CIP98 130-860 was co-precipitated (Fig. 4.10, middle panel). The immunoblot was exposed at a serial of length and figure shown here represents 5 seconds exposure.

No visible band was observed in the middle panel with exposure times up to 15 minutes

(data not shown).

4.5. mGluR6 co-localizes with CIP98 in HEK293 cells.

Having encountered difficulty showing mGluR6 and CIP98 interaction using co-

immunoprecipitation, I decided to try a different approach. Immunocytochemistry is a

well established method to examine if two proteins co-localize in a more “intact”

environment than co-immunoprecipitation. Using this approach, the cells are not fully

lysed thus bypassing the problem of using detergents at concentrations that may disrupt

protein interactions. If mGluR6 and CIP98 do co-localize, it provides indirect evidence

that mGluR6 and CIP98 might interact. In perfoming immunofluoresence imaging, three

different filters were used for detection of nuclei and the tagged proteins (Texas Red, red signal--620 nm; FITC, green signal--520 nm; DAPI was used to detect nuclei--460 nm).

In initial experiments, 2% paraformaldehyde was used to fix the cells for 30

minutes at 4°C degrees. This condition appeared to be too harsh, as there was significant

CIP98 staining (staining seen in around 30% of the cells) without permeabilizing the

cells, which is presumably to be intracellular (Fig. 4.11A). After changing to 10 minutes

fixation at room temperature, CIP98 signal from unpermeabilized cells was greatly

reduced (Fig. 4.11B).

104

Lysate IP Supernatant IB: anti-HA

IB: anti-Xpress

HA-mGluR6 + - + + - + + - +

Xpress-CIP98 130-860 - + + - + + - + +

Fig. 4.9. Immunoblot showing the result of co-immunoprecipitation experiment of HA- mGluR6 with Xpress-CIP98 130-860 with 2 µg anti-Xpress antibody following PTX treatment overnight. 1 mg of HEK 293 cell lysates was used. Other conditions were the same as described in Fig. 4.7. Immunoblotting was performed using antibodies indicated on the figure. The upper panel was exposed for 15 min, and the lower panel was exposed for 5 sec.

105

Lysate IP Supernatant IB: anti-Xpress HA-mGluR6 + - + + - + + - +

Xpress-CIP98 130-860 - + + - + + - + +

Fig. 4.10. Immunoblot showing the result of co-immunoprecipitation experiment of HA-

mGluR6 with Xpress-CIP98 130-860 with 2 µg anti-HA antibody following incubation

with 1 mg of HEK 293 cell lysates treated with GTPγS. Other conditions are as described

in Fig. 4.9 except 50 µg aliquots of cell lysates were used in the left panel (1:20 of the

protein precipitated), and the right panel shows fraction of supernatant collected

following co-immunoprecipitation (equivalent to 1:20 of the material used in the precipitation). Immunoblotting was performed using anti-Xpress antibody (1:2000). The blot shown was exposed for 5 sec.

106

Fig. 4.11. Effects of different fixation condition on HEK293 cells. 48 hours after

transfection, HEK 293 cells were fixed using 2% paraformaldehyde for 30 minutes at

4°C degrees (A) or 10 minutes at room temperature (B) without permeablizing the cells.

(A). HEK293 cells were co-transfected with HA-tagged mGluR6 and Xpress-tagged

CIP98 130-860. Double immunocytochemistry was performed to detect HA–mGluR6

(Alexa Fluor®568 goat anti-rabbit antibody-Texas Red, red signal) and Xpress-CIP98

130-860 (Alexa Fluor®488 goat anti-mouse antibody-FITC, green signal), and DAPI was

used to detect nuclei. (B). HEK293 cells either co-transfected with HA-mGluR6 and

Xpress-CIP98 130-860 (upper panel) or singly transfected with Xpress-tagged CIP98

130-860 (lower panel). Double Immunocytochemistry performed as described in (A).

Images are taken at 20x magnification and are representative of 5 to 14 observations.

Scale bar indicates 20 µm.

107

A. DAPI CIP98 130-860 mGluR6

B. DAPI CIP98 130-860 mGluR6

108

Having optimized the fixation condition, I next sought to identify an optimal permeabilization condition. Initial attempts to permeabilize cells for 30 min at room

temperature in 1% Triton X-100 appeared to disrupt the cell structure and damage cell morphology (data not shown). Others looking at immunofluorescence of mGluR expression and/or immunofluorescence using HEK293 cells have used lower concentrations of Triton X-100 (0.1%-0.5%) [95, 114-124] and shorter incubation times

(5 min to 20 min) [119, 121, 123, 124]. However, when I lowered the Triton X-100

concentration to 0.1% and tried these shorter incubation times, I still saw poor cell

morphology (data not shown). By lowering the concentration of Triton X-100 to 0.01%

and incubation for 5 min, I was able to preserved cell morphology and structure and still

allow adequate permeabilization (staining seen in approximately 30% of the cells, Fig.

4.11). Therefore all subsequent experiments were carried out by fixing the cells with 2% paraformaldehyde for 10 minutes at room temperature and, where indicated, permeabilizing cells with 0.01% Triton X-100 for 5 minutes at room temperature.

Overlay images are used to examine for possible co-localization. Although both

the excitation and emission spectra for FITC and Texas Red are well-separated, any bleed

through of signal may interfere with the results. To rule this out, HEK293 cells were

singly transfected with HA-mGluR6, HA-mGluR2 or Xpress-CIP98 130-860 and images

were taken using the three filters stated above. No bleed through of signal was detected

with any of these transfectants (Fig. 4.12).

To assess if mGluR6 and CIP98 130-860 co-localize, HEK293 cells were singly

or co-transfected with HA-tagged mGluR6 and Xpress-tagged CIP98 130-860 in

109

Fig. 4.12. Optimized fixation and permeabilization conditions for HEK293 cells. 48

hours after transfection, HEK 293 cells were fixed using 2% paraformaldehyde for 10

minutes at room temperature, and permeabilized (upper panel, designated as +)with

0.01% Triton X-100 at room temperature for 5 min. Unpermeabilized cells (bottom

panels, designated as -) are shown as controls. (A). HEK293 cells were singly transfected

with HA-tagged mGluR6 and detected for mGluR6 as in Fig. 4.11. (B). HEK293 cells

were singly transfected with HA-tagged mGluR2 and detected as in Fig. 4.11. (C).

HEK293 cells were singly transfected with Xpress-tagged CIP98 130-860 and detected as

in Fig. 4.11. Overlays of DAPI and single channel images are shown on the right. Images are taken at 40x magnification for phase contrast and at 20x magnification for others.

Scale bar indicates 20 µm.

110

Phase contrast DAPI mGluR6 overlay A.

Phase contrast DAPI mGluR2 overlay B.

Phase contrast DAPI CIP98 130-860 overlay

C. +

111

Fig. 4.13. Analysis of signal bleed-through in immunofluorescence experiments. 48 hours after transfection, HEK 293 cells were fixed and permeabilized as described in the text.

(A). HEK293 cells were singly transfected with HA-tagged mGluR6 and detected as in

Fig. 4.11. (B). HEK293 cells were singly transfected with HA-tagged mGluR2 and detected as in Fig.4.11. (C). HEK293 cells were singly transfected with Xpress-tagged

CIP98 130-860 and detected as in Fig. 4.11. Images are representative of 3 to 18 observations of fields. Images were taken at 60x magnification. Scale bar indicates 10

µm.

112

DAPI FITC TexasRed Overlay A.

. DAPI FITC TexasRed Overlay B.

113

DAPI FITC TexasRed Overlay C.

114

HEK293 cells. In HEK293 cells transfected with only HA-tagged mGluR6, there was a

clear cell surface staining in all cells examined with or without permeabilization, consistent with GPCR localization. As expected, cells expressing only Xpress-CIP98

130-860 produced intracellular staining in all cells analyzed, as evidenced by robust immunoreactivity only after cell permeablization. When Xpress-CIP98 130-860 and HA- mGluR6 were co-expressed in HEK293 cells, the two proteins showed similar immunostaining to the singly transfected cells (Fig. 4.14A and Fig. 4.13). From examination of 6 fields using a confocal microscope, all cells co-expressing HA-mGluR6 and Xpress-CIP98 130-860 showed a partial punctate co-localization of the two proteins, as indicated by the yellow staining in the overlay image and the higher magnification image of the regions boxed (Fig. 4.14A).

Transfections with HA-tagged mGluR2 and Xpress-CIP98 130-860 were also

performed. Similar to HA-mGluR6, singly expressed HA-mGluR2 showed cell surface

staining in HEK293 cells, and singly expressed Xpress-CIP98 130-860 showed intracellular labeling (Fig. 4.14B). In co-expression experiments, HA-mGluR2 and

Xpress-CIP98 130-860 had similar immunostaining to the singly expressed proteins (Fig.

4.13, Fig. 4.14B). Interestingly, these proteins also appeared to co-localize, but to a lesser

extent than seen with HA-mGluR6/Xpress-CIP98 130-860 coexpression (Fig. 4.14B). In

addition, the intracellular immunofluorescence for Xpress-CIP98 130-860 appeared in

many cases to be more diffuse and less localized to the inner cell surface when co-

expressed with mGluR2, suggesting at least that there may be a somewhat different

association of CIP98 with mGluR2 than with mGluR6.

115

Fig. 4.14. Expression pattern of Xpress-CIP98 130-860 following co-transfection with

HA-mGluR6 or HA-mGluR2.

Images show localization (in red) of HA-mGluR6 (A) or HA-mGluR2 (B) and Xpress-

CIP98 130-860 (in green) in transfected HEK293 cells. Scale bar, 10 um. Overlay images

are shown to the right. Arrows in inset windows at higher magnification point to

colocalized HA-mGluR6 (or HA-mGluR2) and Xpress-CIP98 130-860. Images are

representative of 6 (A) or 4 (B) observations. Images are taken with Zeiss LSM510

META Confocal Imaging System using a 63x water objective.

116

A. HA-mGluR6 Xpress-CIP98 130-860 Overlay

B. HA-mGluR2 Xpress-CIP98 130-860 Overlay

Chapter V

Conclusions and Perspectives

I have shown through reconstitution experiments in SCG neurons that mGluR6

exhibits selective coupling to members of the Gαi/o protein family. It couples the most

strongly to Gαoa; moderately to Gαob and Gαi1; and weakly to Gαi3 and Gαi2. And

mGluR6 does not couple to GαTr-R, GαTr-C, and Gαz. Among the Gα proteins capable of

efficiently coupling to mGluR6 in SCG neurons, only Gαoa/b was detectable in rat retinal

ON bipolar cells using single-cell RT-PCR, strongly suggesting that physiological

signaling through mGluR6 in ON bipolar cells of the retina occurs via Gαoa/b. It is

intriguing, though, that Gi2 was also strongly expressed in ON bipolar cells (Fig. 2.4).

Though Gi2 did not exhibit efficient coupling to mGluR6 in SCG neurons (Fig. 2.3), the

possibility exists that it might couple efficiently to mGluR6 in ON bipolar cells. Though

technically challenging, the extension of our PTX-insensitive reconstitution system to

ON bipolar cells would clarify this possibility. If mGluR6 does couple to Gi2 in ON

bipolar cells, this would suggest the existence of one or more accessory proteins present

in ON bipolar cells and absent in SCG neurons that facilitate this coupling.

My yeast two hybrid experiments revealed an interaction between truncated forms of CIP98 and mGluR6 that appears specific for Group III mGluRs. CIP98 expression was

detected both in rat retinal ON bipolar cells using single cell RT-PCR and in whole

117

118 retinal extracts using immunoblotting. When co-expressed in our SCG reconstitution system, two of the truncated forms isolated via yeast two-hybrid (CIP98 130-860 and

CIP98 542-920) caused a rightward shift in the dose-response curve of mGluR6, indicating a negative effect on mGluR6 coupling to downstream effectors. Interestingly, neither full length CIP98, CIP98 542-860, nor CIP98 642-860 had an effect on mGluR6 signaling in this system. Though this seems contradictory to our yeast data, as CIP98

542-860 showed specificity towards Group III mGluRs, it is possible that different constructs are expressed to differing extents or show differential stability in the SCG system. Unfortunately, the actual level of expression of proteins following plasmid injection is difficult to monitor in these single cells. It may be possible to inject plasmid constructs with CIP98 coding sequences fused to the green fluorescent protein to monitor microscopically the expression of these individual constructs, though the expression or stability of these fusions may not accurately reflect that of the non-fusion constructs.

Another possibility is that the endogenously expressed CIP98 or some other endogenously expressed protein in SCG neurons affects the function of exogenously introduced CIP98 constructs. This would suggest that the region of CIP98 between amino acids 542 and 860 may be critical for function or may be involved in binding to an as-yet- unidentified protein. This region contains a partial PDZ domain near the C-terminus of

CIP98, suggesting this binding may be through this PDZ domain. An additional possibility for lack of function of CIP98 542-860 is that this truncated protein may not fold properly. In this scenario, amino acids 130-542 and 860-920 may be involved in critical intra- or inter-molecular interactions that place CIP98 in a conformation capable

119 of direct interaction with mGluR6. One would then have to argue that the extreme N- terminus prevents this, perhaps through additional interactions. This possibility is not too far-fetched, as multiple PDZ domain proteins often serve to “scaffold” larger protein complexes involved in receptor and other signaling complexes [125-129].

In my yeast two-hybrid screening, CIP98 130-860 was identified using the third intracellular loop of mGluR6 as bait. In subsequent tests, the third intracellular loop of mGluR2 did not show interaction with CIP98 130-860. This is why mGluR2 was chosen as the control in functional and interaction studies. In the electrophysiology assay examining potential function of CIP98, CIP98 130-860 did not affect mGluR2 function.

However, interestingly, it appears that mGluR2 and CIP98 130-860 do co-localize in immunofluorescence experiments. Though both receptor constructs are tagged, it is unlikely that the results are due to non-specific immunoreactivity, as controls with only vector showed no immunofluorescence. One possibility is that the use of a heterologus over-expression system in HEK293 cells leads to an artificial interaction between CIP98 and mGluR2, making it difficult to assess the specificity of the mGluR6 interaction in this system. Another possibility is that, because the immunofluorescence experiments can only assess the proximity of these two proteins, mGluR2 is not directly interacting with CIP98. Unfortunately, the confocal imaging did not clarify this possibility. Perhaps the use of other mGluRs, especially mGluR1 which also showed no interaction with

CIP98 in the yeast two hybrid experiments, would clarify the issue of specific association. Though mGluR2 showed co-localization with CIP98 130-860, there are differences between mGluR2 and mGluR6 (Fig. 4.14). Nevertheless, the lack of

120 functional effects of CIP98 on mGluR2 in the electrophysiology experiments suggests that CIP98 may indeed have some specific role in mGluR6 function.

The yeast two hybrid and immunocytochemistry data suggest that some fraction of mGluR6 and CIP98 130-860 co-localize and interact in HEK293 cells. Although I was unable to show significant direct interaction of these two proteins using co- immunoprecipitation, even after varying many parameters in the co-immunoprecipitation protocol, this interaction may still be valid. There are many possible reasons why this interaction was not detected by co-immunoprecipitation. First, co-immunoprecipitation is a very complicated technique. It is often difficult to find optimal conditions for transfection, cell lysis, antibody concentration, and wash conditions that maintain interactions. The most challenging step is to find an optimal lysis buffer condition in which the target proteins are solubilized yet still maintain their native conformation to allow interaction between the two proteins. This is a particular dilemma for multi-pass transmembrane proteins such as GPCRs, where conformation of intracellular domains is likely defined by the receptor’s orientation within the plasma membrane. In this case, weak interactions are likely to be lost. Second, both constructs used in co- immunoprecipitation experiments were modified by addition of tagging sequences in order to perform these experiments. Although they are both tagged at the N-terminus, and it appears from yeast two hybrid that downstream regions of both proteins interact, it is possible that the tags could still interfere with the either the conformation or the actual function of the two proteins. Attempts were made to clarify this question, using both tagged constructs to perform electrophysiology experiments. The shift observed in Fig.

121

4.3A with co-expression of mGluR6 and CIP98 130-860, was not reproduced with the tagged constructs (data not shown). However, the tagged receptor is expressed and is functional, though there is shift in the dose-response curve of HA-mGluR6, compared to the untagged receptor. This indicates that the tagging might be interfering. To further address this problem, one could construct new plasmids with different tags, or in different locations. Though clean commercial antibodies to each of these proteins are not currently available, one could try to raise antibodies specific to mGluR6 and CIP98 to allow co- immunoprecipitation reactions using native proteins.

Another issue with the co-immunoprecipitation experiments was that I was not able to fully resolve the HA-mGluR6 on the 6% or 8% acrylamide gels (Fig. 4.6), though several modifications, including varying the denaturation conditions, were attempted

(data not shown). It is not unusual for GPCRs, especially Class C GPCRs, to run aberrantly on acrylamide gels. As previously reported, heterologously expressed mGluR6 in HEK293 cells ran at a size smaller than predicted [130]. In my case, aberrant migration could be due to the formation of membrane aggregation or post-translational modification of mGluR6 in HEK293 cells. However, receptor aggregation could contribute to the unsuccessful co-immunoprecipitation. Finally, CIP98 is a large multi domain scaffolding protein which is known to interact with other proteins such as CASK and USH2A [107,

108, 110]. It is possible that one or more of these protein components is needed for

CIP98 to fold properly and this component is missing in HEK293 cells. Thus we may not be able to detect the interaction between CIP98 and mGluR6 following heterologous

122 expression in cells. This possibility is not that likely, though, as these interactions were detected via yeast two-hybrid, and we do see co-localization by immunofluorescence.

Though it is possible that the interaction between CIP98 and mGluR6 identified by yeast two-hybrid is not physiologically relevant, this possibility seems unlikely. CIP98 was identified multiple times in the yeast two-hybrid screens using different mGluR6 baits, and the series of secondary tests all support a specific interaction between CIP98 and Group III mGluRs, including mGluR6. Further, the functional tests in SCG neurons and immunocytochemistry data strongly suggest a role for CIP98 in regulating mGluR6 function. Added together with the known functional domains of CIP98 (i.e. PDZ domains), the visual signaling impairment of CIP98 mutation in Usher syndrome, and the potential function of CIP98 complexed with CASK in regulating receptor localization,

CIP98 remains an attractive candidate as mGluR6 regulator.

Though beyond the scope of this project, several other approaches can be taken to validate the function of CIP98 as a direct interactor and regulator of mGluR6 expression and/or localization. For example, one could construct glutathione-S-transferase (GST) fusion constructs of mGluR6, introduce them into HEK293 cells along with CIP98, and perform GST pull down assays. Another approach to show interaction is to use crosslinking reagents specific for functional groups on proteins to chemically join two or more proteins by a covalent bond. Proteins crosslinked in this manner can then be co- purified by affinity chromatography. Crosslinked complexes can then be dissociated and examined using SDS–PAGE gel or mass spectroscopy.

123

It would also be interesting to examine additional potential functions for CIP98 in

regulating or localizing of mGluR6. One could examine immunostaining of mGluR6 and

CIP98 in a heterologous expression system upon the activation by glutamate, to see if

CIP98 affects mGluR6 localization or vice versa. With antisera specific for native proteins, one could perform co-immunoprecipitation from retinal extracts to see if CIP98

will be precipitated by mGluR6, or vice versa. If they can be co-precipitated in this way,

this provides a possible explanation to my unsuccessful attempts at co-

immunoprecipitation using HEK293 cells, and also evidences that additional neuronal

components are required for protein interaction. One could also perform

immunohistochemitry using retinal tissue slices to observe the expression pattern of

CIP98 and mGluR6, and to observe potential changes in localization and expression

patterns during development. As several splice variants of CIP98 have been identified

[112], it would be interesting to examine expression of these splice variants in normal

and dysfunctional retina. Very importantly, one could test for a direct role of CIP98 on

mGluR6 signaling via electrophysiology using isolated ON bipolar cells.

In my immunofluroscence experiments, CIP98 showed a mesh-like pattern of

expression (Fig. 4.13C), and previous studies have shown that CIP98 co-localizes with

both myosin XVa [111] and F-actin in the ear [112]. It would interesting to examine the

potential co-localization of CIP98, myosin XVa and/or F-actin, and mGluR6 in both

heterologous system and in retinal slices. This may give clues about the possible

components of scaffolding protein complexes involving CIP98 in the retina.

124

In my electrophysiology experiments, CIP98 130-860 and CIP98 542-920 showed

regulation of mGluR6 signaling in SCG neurons. Endogenous CIP98 was also detected in

native SCG neurons by single cell RT-PCR (data not shown). It is therefore important to

assess whether endogenous CIP98 interferes with the electrophysiology. Attempts were

made to knock down native CIP98 message using siRNA. My initial experiment in

hippocampal neurons showed that siRNA significantly reduced native CIP98 expression

level after 24 hours, examined using western immunoblotting. However, in

electrophysiology experiments using reconstitution system in SCG neurons, co-injecting

plasmids of mGluR6 and siRNA constructs did not show significant effect in modulating

mGluR6 dose-response to L-glutamate (data not shown). More experiments could be done to further explore this question. One could do more experiments to carefully select

proper time point. Or one could examine the effect of heterologously expressed siRNA-

resistant CIP98 constructs on mGluR6. Eventually, one could test the effect of knocking

down native CIP98 using siRNA in retina bipolar cells.

Finally, it is important to note that other candidates for regulators of mGluR6

were isolated from the yeast two-hybrid screens. Of these candidates, two seem most

appealing. CarkL, which is thought to be as a carbohydrate kinase [131-133], was

isolated using the second intracellular loop of mGluR6 as bait. Carbohydrate kinases are

a class of enzymes involved in the phosphorylation of sugars [134]. CarkL transcript is

detected in a wide range of tissues, with strong expression in liver, kidney, and pancreas,

weaker in heart and placenta, and very weak in brain and lung [131]. Mutation of the

CTNS gene, including deletion of the adjacent gene CARKL, causes a disease called

125

cystinosis, characterized by a deficiency in a lysosomal membrane cystine carrier, with

the kidney being the most sensitive organ to the accumulation of cystine in lysosomes

and crystallization [131]. In these patients, levels of certain carbohydrates are increased in the urine which was indicated to be caused by the lack of CarkL [132, 133]. Though photophobia caused by corneal crystallization is observed in these patients at a later age

[131], it is not clear if this is directly caused by the deletion of CarkL. In my electrophysiology experiments, CarkL did not have effect in mGluR6 signaling (data not shown). This may be a case where the yeast two hybrid identified a non-physiologically significant interaction with mGluR6. Nevertheless it might be interesting to examine retinal expression of CarkL, especially in ON bipolar cells, to possibly determine a novel function for this protein.

Clic1 was isolated using the second intracellular loop of mGluR6 as bait. It is a

member of a large group of chloride intracellular channels [135]. The most intriguing

feature of this group is their ability to shuttle between two states: plasma membrane

bound and soluble state [135-137]. It would be very interesting to investigate how these

proteins form channels themselves, and how they traffic between these two states. Clic1

was reported to have wide expression pattern in tissues such as gastric intestine tract,

lung, kidney and skeletal muscle [138]. Though lack of functional effects of Clic1 on

mGluR6 in the electrophysiology experiments (data not shown), Clic1 message was

detected in ON bipolar cells (data not shown). And as reported, level of Clic1 was

upregulated in mouse retina induced by light damage [139]. It would be interesting to

126

explore this to search for possible role of Clic1 in the retina. A Clic1 inhibitor IAA94 has

been described [140-142] which may be a valuable tool to use in these studies.

Significance of this study:

Strong evidence indicates a role for CIP98 (or Whirlin) in regulating visual and

auditory systems. Both during embryonic development and in the adult animal, the

expression pattern and function of CIP98/Whirlin strongly implicate it as a regulator of

neuronal signaling complexes involved in synaptic organization and/or in synaptic vesicle transmission. In patients with DFNB31 and in whirler mice, profound deafness is detected. However, visual impairment has not been reported, either in human or in mouse. From the expression pattern of whirlin from the early development of the retina until the adulthood, one wound predict that some visual impairment or retinal dysfunction would be expected. More evidence includes very early loss of PSD-95 from the rod terminals is linked with loss of synapse between rod and rod bipolar cells involved in retinitis pigmentosa [143].

Further, given the expression pattern of CIP98 and mGluR6 in the retina, it is

reasonable to speculate CIP98 might have an important role in visual system. Thus it is

somewhat surprising that no one has ever investigated potential relationship between

CIP98 and mGluR6 prior to this study. Our identification of CIP98 as a potential

regulatory protein of mGluR6 via yeast two hybrid screening, as well as our functional

and co-localization data, provide evidence that CIP98 may indeed regulate mGluR6

function. Although the evidence we have gathered is not strong enough to make a

127 definitive conclusion that CIP98 regulates mGluR6 in mammalian retinal neurons, these initial studies pave the way for further investigation of CIP98 function.

References

1. Dowling, J.E., Organization of vertebrate retinas. Invest Ophthalmol, 1970. 9(9):

p. 655-80.

2. Stenkamp, D.L. and D.A. Cameron, Cellular pattern formation in the retina:

retinal regeneration as a model system. Mol Vis, 2002. 8: p. 280-93.

3. Tachibana, M. and T. Okada, Release of endogenous excitatory amino acids from

ON-type bipolar cells isolated from the goldfish retina. J Neurosci, 1991. 11(7): p.

2199-208.

4. Sharpe, L.T. and A. Stockman, Rod pathways: the importance of seeing nothing.

Trends Neurosci, 1999. 22(11): p. 497-504.

5. Hollmann, M. and S. Heinemann, Cloned glutamate receptors. Annu Rev

Neurosci, 1994. 17: p. 31-108.

6. Monaghan, D.T., R.J. Bridges, and C.W. Cotman, The excitatory amino acid

receptors: their classes, pharmacology, and distinct properties in the function of

the central nervous system. Annu Rev Pharmacol Toxicol, 1989. 29: p. 365-402.

7. Nakanishi, S., Molecular diversity of glutamate receptors and implications for

brain function. Science, 1992. 258(5082): p. 597-603.

8. Morigiwa, K. and N. Vardi, Differential expression of ionotropic glutamate

receptor subunits in the outer retina. J Comp Neurol, 1999. 405(2): p. 173-84.

9. Chalupa, L.M. and E. Gunhan, Development of On and Off retinal pathways and

retinogeniculate projections. Prog Retin Eye Res, 2004. 23(1): p. 31-51. 128

129

10. Nakajima, Y., et al., Molecular characterization of a novel retinal metabotropic

glutamate receptor mGluR6 with a high agonist selectivity for L-2-amino-4-

phosphonobutyrate. J Biol Chem, 1993. 268(16): p. 11868-73.

11. Nomura, A., et al., Developmentally regulated postsynaptic localization of a

metabotropic glutamate receptor in rat rod bipolar cells. Cell, 1994. 77(3): p.

361-9.

12. DeVries, S.H., Bipolar cells use kainate and AMPA receptors to filter visual

information into separate channels. Neuron, 2000. 28(3): p. 847-56.

13. Sommer, B. and P.H. Seeburg, Glutamate receptor channels: novel properties

and new clones. Trends Pharmacol Sci, 1992. 13(7): p. 291-6.

14. Conn, P.J. and J.P. Pin, Pharmacology and functions of metabotropic glutamate

receptors. Annu Rev Pharmacol Toxicol, 1997. 37: p. 205-37.

15. Pin, J.P. and R. Duvoisin, The metabotropic glutamate receptors: structure and

functions. Neuropharmacology, 1995. 34(1): p. 1-26.

16. Brauner-Osborne, H., P. Wellendorph, and A.A. Jensen, Structure, pharmacology

and therapeutic prospects of family C G-protein coupled receptors. Curr Drug

Targets, 2007. 8(1): p. 169-84.

17. Takahashi, K., et al., Role of the large extracellular domain of metabotropic

glutamate receptors in agonist selectivity determination. J Biol Chem, 1993.

268(26): p. 19341-5.

130

18. Abe, T., et al., Molecular characterization of a novel metabotropic glutamate

receptor mGluR5 coupled to inositol phosphate/Ca2+ signal transduction. J Biol

Chem, 1992. 267(19): p. 13361-8.

19. Aramori, I. and S. Nakanishi, Signal transduction and pharmacological

characteristics of a metabotropic glutamate receptor, mGluR1, in transfected

CHO cells. Neuron, 1992. 8(4): p. 757-65.

20. Houamed, K.M., et al., Cloning, expression, and gene structure of a G protein-

coupled glutamate receptor from rat brain. Science, 1991. 252(5010): p. 1318-21.

21. Moss, J. and M. Vaughan, ADP-ribosylation of guanyl nucleotide-binding

regulatory proteins by bacterial toxins. Adv Enzymol Relat Areas Mol Biol,

1988. 61: p. 303-79.

22. Tanabe, Y., et al., A family of metabotropic glutamate receptors. Neuron, 1992.

8(1): p. 169-79.

23. Tanabe, Y., et al., Signal transduction, pharmacological properties, and

expression patterns of two rat metabotropic glutamate receptors, mGluR3 and

mGluR4. J Neurosci, 1993. 13(4): p. 1372-8.

24. Gierschik, P., ADP-ribosylation of signal-transducing guanine nucleotide-binding

proteins by pertussis toxin. Curr Top Microbiol Immunol, 1992. 175: p. 69-96.

25. Saugstad, J.A., et al., Cloning and expression of a new member of the L-2-amino-

4-phosphonobutyric acid-sensitive class of metabotropic glutamate receptors.

Mol Pharmacol, 1994. 45(3): p. 367-72.

131

26. Okamoto, N., et al., Molecular characterization of a new metabotropic glutamate

receptor mGluR7 coupled to inhibitory cyclic AMP signal transduction. J Biol

Chem, 1994. 269(2): p. 1231-6.

27. Akazawa, C., et al., Expression of mRNAs of L-AP4-sensitive metabotropic

glutamate receptors (mGluR4, mGluR6, mGluR7) in the rat retina. Neurosci Lett,

1994. 171(1-2): p. 52-4.

28. Slaughter, M.M. and R.F. Miller, 2-amino-4-phosphonobutyric acid: a new

pharmacological tool for retina research. Science, 1981. 211(4478): p. 182-5.

29. Nawy, S. and C.E. Jahr, Suppression by glutamate of cGMP-activated

conductance in retinal bipolar cells. Nature, 1990. 346(6281): p. 269-71.

30. Yamashita, M. and H. Wassle, Responses of rod bipolar cells isolated from the

rat retina to the glutamate agonist 2-amino-4-phosphonobutyric acid (APB). J

Neurosci, 1991. 11(8): p. 2372-82.

31. Tian, N. and M.M. Slaughter, Pharmacological similarity between the retinal

APB receptor and the family of metabotropic glutamate receptors. J

Neurophysiol, 1994. 71(6): p. 2258-68.

32. Hartveit, E., et al., Expression of the mRNA of seven metabotropic glutamate

receptors (mGluR1 to 7) in the rat retina. An in situ hybridization study on tissue

sections and isolated cells. Eur J Neurosci, 1995. 7(7): p. 1472-83.

33. Ohishi, H., et al., Distribution of the messenger RNA for a metabotropic

glutamate receptor, mGluR2, in the central nervous system of the rat.

Neuroscience, 1993. 53(4): p. 1009-18.

132

34. Duvoisin, R.M., C. Zhang, and K. Ramonell, A novel metabotropic glutamate

receptor expressed in the retina and olfactory bulb. J Neurosci, 1995. 15(4): p.

3075-83.

35. Vardi, N. and K. Morigiwa, ON cone bipolar cells in rat express the metabotropic

receptor mGluR6. Vis Neurosci, 1997. 14(4): p. 789-94.

36. Raviola, E. and N.B. Gilula, Intramembrane organization of specialized contacts

in the outer plexiform layer of the retina. A freeze-fracture study in monkeys and

rabbits. J Cell Biol, 1975. 65(1): p. 192-222.

37. Stell, W.K., A.T. Ishida, and D.O. Lightfoot, Structural basis for on-and off-

center responses in retinal bipolar cells. Science, 1977. 198(4323): p. 1269-71.

38. Tagawa, Y., et al., Immunohistological studies of metabotropic glutamate

receptor subtype 6-deficient mice show no abnormality of retinal cell

organization and ganglion cell maturation. J Neurosci, 1999. 19(7): p. 2568-79.

39. Masu, M., et al., Specific deficit of the ON response in visual transmission by

targeted disruption of the mGluR6 gene. Cell, 1995. 80(5): p. 757-65.

40. Iwakabe, H., et al., Impairment of pupillary responses and optokinetic nystagmus

in the mGluR6-deficient mouse. Neuropharmacology, 1997. 36(2): p. 135-43.

41. Bok, D. and M.O. Hall, The role of the pigment epithelium in the etiology of

inherited retinal dystrophy in the rat. J Cell Biol, 1971. 49(3): p. 664-82.

42. Fields, T.A. and P.J. Casey, Signalling functions and biochemical properties of

pertussis toxin-resistant G-proteins. Biochem J, 1997. 321 ( Pt 3): p. 561-71.

133

43. Locht, C. and R. Antoine, A proposed mechanism of ADP-ribosylation catalyzed

by the pertussis toxin S1 subunit. Biochimie, 1995. 77(5): p. 333-40.

44. Nawy, S., The metabotropic receptor mGluR6 may signal through G(o), but not

phosphodiesterase, in retinal bipolar cells. J Neurosci, 1999. 19(8): p. 2938-44.

45. Vardi, N., et al., Identification of a G-protein in depolarizing rod bipolar cells.

Vis Neurosci, 1993. 10(3): p. 473-8.

46. Vardi, N., Alpha subunit of Go localizes in the dendritic tips of ON bipolar cells. J

Comp Neurol, 1998. 395(1): p. 43-52.

47. Heidelberger, R., W.B. Thoreson, and P. Witkovsky, Synaptic transmission at

retinal ribbon synapses. Prog Retin Eye Res, 2005. 24(6): p. 682-720.

48. Philp, N.J., W. Chang, and K. Long, Light-stimulated protein movement in rod

photoreceptor cells of the rat retina. FEBS Lett, 1987. 225(1-2): p. 127-32.

49. Brann, M.R. and L.V. Cohen, Diurnal expression of transducin mRNA and

translocation of transducin in rods of rat retina. Science, 1987. 235(4788): p.

585-7.

50. van Genderen, M.M., et al., Mutations in TRPM1 are a common cause of

complete congenital stationary night blindness. Am J Hum Genet, 2009. 85(5): p.

730-6.

51. Audo, I., et al., TRPM1 is mutated in patients with autosomal-recessive complete

congenital stationary night blindness. Am J Hum Genet, 2009. 85(5): p. 720-9.

134

52. Li, Z., et al., Recessive mutations of the gene TRPM1 abrogate ON bipolar cell

function and cause complete congenital stationary night blindness in humans. Am

J Hum Genet, 2009. 85(5): p. 711-9.

53. Shen, Y., et al., A transient receptor potential-like channel mediates synaptic

transmission in rod bipolar cells. J Neurosci, 2009. 29(19): p. 6088-93.

54. Zeitz, C., et al., Mutations in GRM6 cause autosomal recessive congenital

stationary night blindness with a distinctive scotopic 15-Hz flicker

electroretinogram. Invest Ophthalmol Vis Sci, 2005. 46(11): p. 4328-35.

55. Dryja, T.P., et al., Night blindness and abnormal cone electroretinogram ON

responses in patients with mutations in the GRM6 gene encoding mGluR6. Proc

Natl Acad Sci U S A, 2005. 102(13): p. 4884-9.

56. O'Connor, E., et al., Congenital stationary night blindness associated with

mutations in GRM6 encoding glutamate receptor MGluR6. Br J Ophthalmol,

2006. 90(5): p. 653-4.

57. Spiegel, A.M., Defects in G protein-coupled signal transduction in human

disease. Annu Rev Physiol, 1996. 58: p. 143-70.

58. Spiegel, A.M., Mutations in G proteins and G protein-coupled receptors in

endocrine disease. J Clin Endocrinol Metab, 1996. 81(7): p. 2434-42.

59. Gettys, T.W., et al., Tissue-specific alterations in G protein expression in genetic

versus diet-induced models of non-insulin-dependent diabetes mellitus in the

mouse. Metabolism, 1995. 44(6): p. 771-8.

135

60. McLaughlin, M., et al., Robustness of G proteins in Alzheimer's disease: an

immunoblot study. J Neurochem, 1991. 57(1): p. 9-14.

61. O'Neill, C., et al., Regionally selective alterations in G protein subunit levels in

the Alzheimer's disease brain. Brain Res, 1994. 636(2): p. 193-201.

62. Natarajan, K. and B.C. Berk, Crosstalk coregulation mechanisms of G protein-

coupled receptors and receptor tyrosine kinases. Methods Mol Biol, 2006. 332: p.

51-77.

63. Cismowski, M.J., Non-receptor activators of heterotrimeric G-protein signaling

(AGS proteins). Semin Cell Dev Biol, 2006. 17(3): p. 334-44.

64. Cismowski, M.J. and S.M. Lanier, Activation of heterotrimeric G-proteins

independent of a G-protein coupled receptor and the implications for signal

processing. Rev Physiol Biochem Pharmacol, 2005. 155: p. 57-80.

65. Cooray, S.N., et al., Accessory proteins are vital for the functional expression of

certain G protein-coupled receptors. Mol Cell Endocrinol, 2009. 300(1-2): p. 17-

24.

66. Marchese, A., et al., G protein-coupled receptor sorting to endosomes and

lysosomes. Annu Rev Pharmacol Toxicol, 2008. 48: p. 601-29.

67. Maggio, R., G. Innamorati, and M. Parenti, G protein-coupled receptor

oligomerization provides the framework for signal discrimination. J Neurochem,

2007. 103(5): p. 1741-52.

136

68. Razani, B., C.S. Rubin, and M.P. Lisanti, Regulation of cAMP-mediated signal

transduction via interaction of caveolins with the catalytic subunit of protein

kinase A. J Biol Chem, 1999. 274(37): p. 26353-60.

69. Benovic, J.L., et al., Beta-adrenergic receptor kinase: identification of a novel

protein kinase that phosphorylates the agonist-occupied form of the receptor.

Proc Natl Acad Sci U S A, 1986. 83(9): p. 2797-801.

70. Shenoy, S.K. and R.J. Lefkowitz, Multifaceted roles of beta-arrestins in the

regulation of seven-membrane-spanning receptor trafficking and signalling.

Biochem J, 2003. 375(Pt 3): p. 503-15.

71. Dong, C., et al., Regulation of G protein-coupled receptor export trafficking.

Biochim Biophys Acta, 2007. 1768(4): p. 853-70.

72. Tian, L. and P.J. Kammermeier, G protein coupling profile of mGluR6 and

expression of G alpha proteins in retinal ON bipolar cells. Vis Neurosci, 2006.

23(6): p. 909-16.

73. Masland, R.H., The fundamental plan of the retina. Nat Neurosci, 2001. 4(9): p.

877-86.

74. Weng, K., et al., Functional coupling of a human retinal metabotropic glutamate

receptor (hmGluR6) to bovine rod transducin and rat Go in an in vitro

reconstitution system. J Biol Chem, 1997. 272(52): p. 33100-4.

75. Dhingra, A., et al., Light response of retinal ON bipolar cells requires a specific

splice variant of Galpha(o). J Neurosci, 2002. 22(12): p. 4878-84.

137

76. Dhingra, A., et al., The light response of ON bipolar neurons requires G[alpha]o.

J Neurosci, 2000. 20(24): p. 9053-8.

77. Herlitze, S., et al., Modulation of Ca2+ channels by G-protein beta gamma

subunits. Nature, 1996. 380(6571): p. 258-62.

78. Ikeda, S.R., Voltage-dependent modulation of N-type calcium channels by G-

protein beta gamma subunits. Nature, 1996. 380(6571): p. 255-8.

79. Elmslie, K.S., W. Zhou, and S.W. Jones, LHRH and GTP-gamma-S modify

calcium current activation in bullfrog sympathetic neurons. Neuron, 1990. 5(1):

p. 75-80.

80. Bean, B.P., Neurotransmitter inhibition of neuronal calcium currents by changes

in channel voltage dependence. Nature, 1989. 340(6229): p. 153-6.

81. Garcia, D.E., et al., G-protein beta-subunit specificity in the fast membrane-

delimited inhibition of Ca2+ channels. J Neurosci, 1998. 18(22): p. 9163-70.

82. Ruiz-Velasco, V. and S.R. Ikeda, Multiple G-protein betagamma combinations

produce voltage-dependent inhibition of N-type calcium channels in rat superior

cervical ganglion neurons. J Neurosci, 2000. 20(6): p. 2183-91.

83. Kammermeier, P.J., M.I. Davis, and S.R. Ikeda, Specificity of metabotropic

glutamate receptor 2 coupling to G proteins. Mol Pharmacol, 2003. 63(1): p. 183-

91.

84. Jeong, S.W. and S.R. Ikeda, Endogenous regulator of G-protein signaling

proteins modify N-type calcium channel modulation in rat sympathetic neurons. J

Neurosci, 2000. 20(12): p. 4489-96.

138

85. Seifert, G., et al., AMPA receptor subunits expressed by single astrocytes in the

juvenile mouse hippocampus. Brain Res Mol Brain Res, 1997. 47(1-2): p. 286-94.

86. Doupnik, C.A., T. Xu, and J.M. Shinaman, Profile of RGS expression in single rat

atrial myocytes. Biochim Biophys Acta, 2001. 1522(2): p. 97-107.

87. Pan, Z.H. and S.A. Lipton, Multiple GABA receptor subtypes mediate inhibition

of calcium influx at rat retinal bipolar cell terminals. J Neurosci, 1995. 15(4): p.

2668-79.

88. Pan, Z.H. and H.J. Hu, Voltage-dependent Na(+) currents in mammalian retinal

cone bipolar cells. J Neurophysiol, 2000. 84(5): p. 2564-71.

89. Tachibana, M. and A. Kaneko, gamma-Aminobutyric acid exerts a local

inhibitory action on the axon terminal of bipolar cells: evidence for negative

feedback from amacrine cells. Proc Natl Acad Sci U S A, 1987. 84(10): p. 3501-

90. Yeh, H.H., M.B. Lee, and J.E. Cheun, Properties of GABA-activated whole-cell

currents in bipolar cells of the rat retina. Vis Neurosci, 1990. 4(4): p. 349-57.

91. Ikeda, S.R., et al., Heterologous expression of metabotropic glutamate receptors

in adult rat sympathetic neurons: subtype-specific coupling to ion channels.

Neuron, 1995. 14(5): p. 1029-38.

92. Hille, B., Modulation of ion-channel function by G-protein-coupled receptors.

Trends Neurosci, 1994. 17(12): p. 531-6.

139

93. Bahia, D.S., et al., Hydrophobicity of residue351 of the G protein Gi1 alpha

determines the extent of activation by the alpha 2A-adrenoceptor. Biochemistry,

1998. 37(33): p. 11555-62.

94. Dhami, G.K. and S.S. Ferguson, Regulation of metabotropic glutamate receptor

signaling, desensitization and endocytosis. Pharmacol Ther, 2006. 111(1): p. 260-

71.

95. Kammermeier, P.J., Surface clustering of metabotropic glutamate receptor 1

induced by long Homer proteins. BMC Neurosci, 2006. 7: p. 1.

96. Kammermeier, P.J., Endogenous homer proteins regulate metabotropic glutamate

receptor signaling in neurons. J Neurosci, 2008. 28(34): p. 8560-7.

97. Kammermeier, P.J. and P.F. Worley, Homer 1a uncouples metabotropic

glutamate receptor 5 from postsynaptic effectors. Proc Natl Acad Sci U S A,

2007. 104(14): p. 6055-60.

98. Kammermeier, P.J., et al., Homer proteins regulate coupling of group I

metabotropic glutamate receptors to N-type calcium and M-type potassium

channels. J Neurosci, 2000. 20(19): p. 7238-45.

99. Anborgh, P.H., et al., Inhibition of metabotropic glutamate receptor signaling by

the huntingtin-binding protein optineurin. J Biol Chem, 2005. 280(41): p. 34840-

100. Iacovelli, L., et al., Regulation of group II metabotropic glutamate receptors by G

protein-coupled receptor kinases: mGlu2 receptors are resistant to homologous

desensitization. Mol Pharmacol, 2009. 75(4): p. 991-1003.

140

101. Seebahn, A., M. Rose, and R. Enz, RanBPM is expressed in synaptic layers of the

mammalian retina and binds to metabotropic glutamate receptors. FEBS Lett,

2008. 582(16): p. 2453-7.

102. Enz, R. and C. Croci, Different binding motifs in metabotropic glutamate receptor

type 7b for filamin A, protein phosphatase 1C, protein interacting with protein

kinase C (PICK) 1 and syntenin allow the formation of multimeric protein

complexes. Biochem J, 2003. 372(Pt 1): p. 183-91.

103. Wilkinson, K.A., A. Nishimune, and J.M. Henley, Analysis of SUMO-1

modification of neuronal proteins containing consensus SUMOylation motifs.

Neurosci Lett, 2008. 436(2): p. 239-44.

104. Dhingra, A., et al., A retinal-specific regulator of G-protein signaling interacts

with Galpha(o) and accelerates an expressed metabotropic glutamate receptor 6

cascade. J Neurosci, 2004. 24(25): p. 5684-93.

105. Cismowski, M.J., et al., Identification of modulators of mammalian G-protein

signaling by functional screens in the yeast Saccharomyces cerevisiae. Methods

Enzymol, 2002. 344: p. 153-68.

106. Kim, E. and M. Sheng, PDZ domain proteins of synapses. Nat Rev Neurosci,

2004. 5(10): p. 771-81.

107. Yap, C.C., et al., CIP98, a novel PDZ domain protein, is expressed in the central

nervous system and interacts with calmodulin-dependent serine kinase. J

Neurochem, 2003. 85(1): p. 123-34.

141

108. Hsueh, Y.P., The role of the MAGUK protein CASK in neural development and

synaptic function. Curr Med Chem, 2006. 13(16): p. 1915-27.

109. Setou, M., et al., Kinesin superfamily motor protein KIF17 and mLin-10 in

NMDA receptor-containing vesicle transport. Science, 2000. 288(5472): p. 1796-

802.

110. Ebermann, I., et al., A novel gene for Usher syndrome type 2: mutations in the

long isoform of whirlin are associated with retinitis pigmentosa and

sensorineural hearing loss. Hum Genet, 2007. 121(2): p. 203-11.

111. van Wijk, E., et al., The DFNB31 gene product whirlin connects to the Usher

protein network in the cochlea and retina by direct association with USH2A and

VLGR1. Hum Mol Genet, 2006. 15(5): p. 751-65.

112. Mburu, P., et al., Defects in whirlin, a PDZ domain molecule involved in

stereocilia elongation, cause deafness in the whirler mouse and families with

DFNB31. Nat Genet, 2003. 34(4): p. 421-8.

113. Delprat, B., et al., Myosin XVa and whirlin, two deafness gene products required

for hair bundle growth, are located at the stereocilia tips and interact directly.

Hum Mol Genet, 2005. 14(3): p. 401-10.

114. Gastaldello, S., et al., Inhibition of proteasome activity promotes the correct

localization of disease-causing alpha-sarcoglycan mutants in HEK-293 cells

constitutively expressing beta-, gamma-, and delta-sarcoglycan. Am J Pathol,

2008. 173(1): p. 170-81.

142

115. Grimsey, N.L., et al., Specific detection of CB1 receptors; cannabinoid CB1

receptor antibodies are not all created equal! J Neurosci Methods, 2008. 171(1):

p. 78-86.

116. Huang, R., et al., Mechanisms of homomeric alpha1 glycine receptor endocytosis.

Biochemistry, 2007. 46(41): p. 11484-93.

117. Khattar, S.K., et al., Molecular cloning, stable expression and cellular

localization of human alpha1-adrenergic receptor subtypes: effect of

charcoal/dextran treated serum on expression and localization of alpha1D -

adrenergic receptor. Biotechnol Lett, 2006. 28(21): p. 1731-9.

118. Koryakina, Y.A., et al., Characterization of a panel of six beta2-adrenergic

receptor antibodies by indirect immunofluorescence microscopy. Respir Res,

2008. 9: p. 32.

119. Kroiss, M., et al., Transporter regulator RS1 (RSC1A1) coats the trans-Golgi

network and migrates into the nucleus. Am J Physiol Renal Physiol, 2006. 291(6):

p. F1201-12.

120. Meehan, T.P., et al., Point mutations in the melanocortin-4 receptor cause

variable obesity in mice. Mamm Genome, 2006. 17(12): p. 1162-71.

121. Rochdi, M.D., et al., Nm23-H2 interacts with a G protein-coupled receptor to

regulate its endocytosis through an Rac1-dependent mechanism. J Biol Chem,

2004. 279(18): p. 18981-9.

122. Wang, B., et al., Generation and characterization of novel human IRAS

monoclonal antibodies. J Biomed Biotechnol, 2009. 2009: p. 973754.

143

123. Boulware, M.I., et al., Estradiol activates group I and II metabotropic glutamate

receptor signaling, leading to opposing influences on cAMP response element-

binding protein. J Neurosci, 2005. 25(20): p. 5066-78.

124. Chavis, P., et al., Visualization of cyclic AMP-regulated presynaptic activity at

cerebellar granule cells. Neuron, 1998. 20(4): p. 773-81.

125. Kurisaki, A., et al., Activin induces long-lasting N-methyl-D-aspartate receptor

activation via scaffolding PDZ protein activin receptor interacting protein 1.

Neuroscience, 2008. 151(4): p. 1225-35.

126. Olalla, L., et al., Expression of the scaffolding PDZ protein glutaminase-

interacting protein in mammalian brain. J Neurosci Res, 2008. 86(2): p. 281-92.

127. Utepbergenov, D.I., A.S. Fanning, and J.M. Anderson, Dimerization of the

scaffolding protein ZO-1 through the second PDZ domain. J Biol Chem, 2006.

281(34): p. 24671-7.

128. Glynne, P.A. and T.J. Evans, Role of the PDZ scaffolding protein in tubule cells

in maintenance of polarised function. Exp Nephrol, 2002. 10(5-6): p. 307-12.

129. Hillier, B.J., et al., Unexpected modes of PDZ domain scaffolding revealed by

structure of nNOS-syntrophin complex. Science, 1999. 284(5415): p. 812-5.

130. Vardi, N.e.a., Localization of mGluR6 to Dendrites of ON Bipolar Cells in

Primate Retina. THE JOURNAL OF COMPARATIVE NEUROLOGY 2000.

423: p. 402–412.

131. Touchman, J.W., et al., The genomic region encompassing the nephropathic

cystinosis gene (CTNS): complete sequencing of a 200-kb segment and discovery

144

of a novel gene within the common cystinosis-causing deletion. Genome Res,

2000. 10(2): p. 165-73.

132. Kardon, T., et al., Characterization of mammalian sedoheptulokinase and

mechanism of formation of erythritol in sedoheptulokinase deficiency. FEBS Lett,

2008. 582(23-24): p. 3330-4.

133. Wamelink, M.M., et al., Sedoheptulokinase deficiency due to a 57-kb deletion in

cystinosis patients causes urinary accumulation of sedoheptulose: elucidation of

the CARKL gene. Hum Mutat, 2008. 29(4): p. 532-6.

134. Worley, K.C., et al., Identification of new members of a carbohydrate kinase-

encoding gene family. J Comput Biol, 1995. 2(3): p. 451-8.

135. Ashley, R.H., Challenging accepted ion channel biology: p64 and the CLIC

family of putative intracellular anion channel proteins (Review). Mol Membr

Biol, 2003. 20(1): p. 1-11.

136. Tulk, B.M., S. Kapadia, and J.C. Edwards, CLIC1 inserts from the aqueous phase

into phospholipid membranes, where it functions as an anion channel. Am J

Physiol Cell Physiol, 2002. 282(5): p. C1103-12.

137. Cromer, B.A., et al., From glutathione transferase to pore in a CLIC. Eur

Biophys J, 2002. 31(5): p. 356-64.

138. Ulmasov, B., et al., Tissue and subcellular distribution of CLIC1. BMC Cell Biol,

2007. 8: p. 8.

139. Chen, L., et al., Light damage induced changes in mouse retinal gene expression.

Exp Eye Res, 2004. 79(2): p. 239-47.

145

140. Littler, D.R., et al., The intracellular chloride ion channel protein CLIC1

undergoes a redox-controlled structural transition. J Biol Chem, 2004. 279(10):

p. 9298-305.

141. Novarino, G., et al., Involvement of the intracellular ion channel CLIC1 in

microglia-mediated beta-amyloid-induced neurotoxicity. J Neurosci, 2004.

24(23): p. 5322-30.

142. Tulk, B.M., et al., CLIC-1 functions as a chloride channel when expressed and

purified from bacteria. J Biol Chem, 2000. 275(35): p. 26986-93.

143. Blackmon, S.M., et al., Early loss of synaptic protein PSD-95 from rod terminals

of rhodopsin P347L transgenic porcine retina. Brain Res, 2000. 885(1): p. 53-61.