Repression of the Type I Interferon Pathway Underlies MYC- and KRAS-Dependent Evasion of NK and B Cells in Pancreatic Ductal Adenocarcinoma

Published OnlineFirst March 21, 2020; DOI: 10.1158/2159-8290.CD-19-0620

Research Article

Nathiya Muthalagu1, Tiziana Monteverde2, Ximena Raffo-Iraolagoitia1, Robert Wiesheu2, Declan Whyte2, Ann Hedley1, Sarah Laing2, Björn Kruspig2, Rosanna Upstill-Goddard3, Robin Shaw1, Sarah Neidler2, Curtis Rink1, Saadia A. Karim1, Katarina Gyuraszova2, Colin Nixon1, William Clark1, Andrew V. Biankin3, Leo M. Carlin1,2, Seth B. Coffelt1,2, Owen J. Sansom1,2, Jennifer P. Morton1,2, and Daniel J. Murphy1,2

abstract MYC is implicated in the development and progression of pancreatic cancer, yet the precise level of MYC deregulation required to contribute to tumor development has been difficult to define. We used modestly elevated expression of human MYC, driven from the Rosa26 locus, to investigate the pancreatic phenotypes arising in mice from an approximation of MYC trisomy. We show that this level of MYC alone suffices to drive pancreatic neuroendocrine tumors, and to accelerate progression of KRAS-initiated precursor lesions to metastatic pancreatic ductal adenocarcinoma (PDAC). Our phenotype exposed suppression of the type I interferon (IFN) pathway by the combined actions of MYC and KRAS, and we present evidence of repressive MYC– MIZ1 complexes binding directly to the promoters of the genes encodiing the type I IFN regulators IRF5, IRF7, STAT1, and STAT2. Derepression of IFN regulator genes allows pancreatic tumor infiltration by B and natural killer (NK) cells, resulting in increased survival.

Significance: We define herein a novel mechanism of evasion of NK cell–mediated immunity through the combined actions of endogenously expressed mutant KRAS and modestly deregulated expression of MYC, via suppression of the type I IFN pathway. Restoration of IFN signaling may improve outcomes for patients with PDAC.

1CRUK Beatson Institute, Glasgow, Scotland, United Kingdom. 2Institute Kingdom. Phone: 4414-1330-8710; E-mail: [email protected]; of Cancer Sciences, University of Glasgow, Glasgow, Scotland, United and Jennifer P. Morton, Phone: 441-4133-02802; E-mail: Jennifer.morton@ Kingdom. 3Wolfson Wohl Translational Cancer Research Centre, University glasgow.ac.uk of Glasgow, Glasgow, Scotland, United Kingdom. Cancer Discov 2020;10:1–16 Note: Supplementary data for this article are available at Cancer Discovery doi: 10.1158/2159-8290.CD-19-0620 Online (http://cancerdiscovery.aacrjournals.org/). ©2020 American Association for Cancer Research. Corresponding Authors: Daniel J. Murphy, University of Glasgow, CRUK Beatson Institute, Switchback Road, Glasgow, Scotland G61 1BD, United

OF1 | CANCER DISCOVERY june 2020 AACRJournals.org

Introduction spontaneously progress to PDAC through the acquisition of additional mutations (6–8). Recent genomic characterization Cancers of the pancreas are projected to become the second of cell lines generated from such spontaneously progressing most frequent cause of cancer-related mortality worldwide tumors revealed increased KRASG12D allelic dosage as one of by 2030 (1). Ductal adenocarcinoma comprises up to 95% of the most frequently recurring genetic alterations associated pancreatic cancers, and neuroendocrine tumors (PNET) and with progression (9), suggesting that the volume of signal- other exocrine tumors account for remainder (https://www. ing flux through the RAS pathway is rate-limiting for PDAC pancreaticcancer.org.uk/; https://seer.cancer.gov/statistics/). progression, as was recently shown for KRAS-driven lung The 5-year survival rate for pancreatic ductal adenocarci- cancer (10–13). Interestingly, cell lines that lacked increased noma (PDAC) is extremely low at 3% to 5%, and although KRASG12D allelic dosage contained amplifications of alterna- that for PNET is considerably higher (30%–50%), neither can- tive oncogenes that encode proteins that may serve as poten- cer responds effectively to current treatment modalities (2). tially rate-limiting RAS effectors, including MYC, YAP1, and There is therefore a pressing need to further our understand- NF-κB (9, 14). MYC in particular is widely reported to be over- ing of the underlying biology of these cancers. expressed in PDAC, with a propensity for low-level amplifica- Activating mutations in KRAS occur in up to 93% of tion suggesting that subtle changes in MYC expression may PDAC, while the majority of KRAS wild-type (WT) cases bear suffice to affect PDAC development (15, 16). Accordingly, alternative genetic alterations predicted to result in ectopic expression of murine Myc from the Rosa26 locus was recently RAS–ERK pathway activity, implying a critical requirement shown to accelerate progression to PDAC; however, the use for this pathway in PDAC (3, 4). Experiments in genetically of murine Myc cDNA in the transgene precluded a precise altered mice have however demonstrated that KRAS activation determination of the level of MYC deregulation required for alone is insufficient for PDAC development: Cre-dependent tumor progression (17). Conversely, deletion/depletion of activation of the endogenously expressed Lsl-KrasG12D allele endogenous Myc profoundly delayed progression of PDAC (5) alone gives rise predominantly to low-grade pancreatic driven by KRASG12D and loss of p53 (18, 19), and RNAi- intraepithelial neoplasms (PanIN), a subset of which may mediated depletion of MYC in human PDAC cells suppressed

june 2020 CANCER DISCOVERY | OF2

RESEARCH ARTICLE Muthalagu et al. proliferation in vitro and xenograft tumorigenesis in vivo (20), A 6 consistent with the hypothesis that MYC is a critical rate- mMyc * limiting effector of KRAS in this cancer. hMYC Here, we directly investigated the level of MYC deregulation required for pancreatic tumor development using con- 4 ditional expression of human MYC from the Rosa26 locus at levels that approximate expression of endogenous Myc. We show that modestly deregulated expression of MYC alone 2

suffices to drive PNET development and dramatically acceler- B2M) of (% mRNA ates progression to metastatic PDAC when combined with ND KRAS activation. In PDAC, the combination of MYC and KRASG12D suppresses tumor infiltration of effector immune Rosa26 WT/WT MYC/WT MYC/MYC populations, as recently reported (21). Mechanistically, we G12D reveal that MYC and KRAS cooperatively regulate gene B 14 expression, with particular convergence on repression of the AV ** AV/PI type I interferon (IFN) pathway. We show that targeted sup- ** pression of the MYC–MIZ1 transcriptional repressor complex 10 (22) restores IFN-related gene expression and consequent B cell– and natural killer (NK) cell–mediated immune sur- 6 veillance. Our data reveal a mechanism of immune evasion driven by two of the most commonly dysregulated oncogenes

in human cancer. 2 Positive cells (% of total) of (% cells Positive

Results Ad-Cre −−++− + Ad-Lac ++−−+ − Rosa26-Driven MYC Is Expressed at Near-Physiologic Levels Rosa26 WT/WT MYC/WT MYC/MYC To define the level of MYC deregulation required for pan- C DM-lsl-MYC creatic tumor development, we used Rosa26 mice MYC wherein the human MYC cDNA, preceded by a floxed transla- 55 130 tional stop cassette, was inserted into the murine Rosa26 locus Vinculin by homologous recombination, as described previously (23). Use of the human cDNA facilitated the distinction between Lsl-KrasG12D − ++− endogenously expressed murine Myc and Rosa26-driven MYC. R26-Lsl-MYC ++− − RT-PCR demonstrated Cre-dependent expression of human MYC in Rosa26DM-lsl-MYC/+- and Rosa26DM-lsl-MYC/lsl-MYC-derived mouse embryonic fibroblasts (MEF) within 24 hours of Figure 1. Rosa26-driven MYC is expressed at near physiologic levels. infection with Adeno-Cre. Expression of one copy of human A, RT-PCR comparison of Rosa26-driven MYC with endogenously expressed Myc in Rosa26WT/WT, Rosa26DM-lsl-MYC/+, and Rosa26DM-lsl-MYC/lsl-MYC MEFs, 24 MYC mRNA was comparable with murine Myc, whereas two hours after infection with Adeno-Cre. N = 3; *, P < 0.05; ANOVA and post hoc copies yielded modestly supraphysiologic expression (Fig. Tukey test. ND, not detected. B, FACS analysis of Annexin V (AV), propidium 1A). Consistent with previous reports that MYC regulates iodide (PI) labeling of MEFs, infected as per A with Adeno-Cre or Adeno-LacZ its own transcription (24), Rosa26MYC/MYC MEFs exhibited and cultured overnight in 0.2% FBS. N = 3; **, P < 0.01; ANOVA with post hoc Tukey test. C, Immunoblot of MYC expression in WT, Rosa26DM-lsl-MYC/+, Lsl- reduced expression of endogenous Myc and were modestly KrasG12D, and Rosa26DM-lsl-MYC/+;Lsl-KrasG12D (double positive) MEFs 24 hours sensitized to apoptosis upon serum withdrawal (Fig. 1B). after Adeno-Cre infection. Image is representative of >3 experiments. At the protein level, activation of Rosa26DM-lsl-MYC/+ drove modestly higher expression of MYC compared with WT MYC to sustain the fitness of all PDAC lines examined, MEFs. Notably, Cre-dependent activation of endogenously including several lines that do not require KRAS (Sup- expressed Lsl-KrasG12D also drove higher expression of MYC plementary Fig. S1A). We asked whether MYC expressed protein, comparable to that arising from Rosa26MYC/+, and from the Rosa26 locus is sufficient for tumor formation. We expression was higher again upon combined activation of interbred Rosa26DM-lsl-MYC mice (M) with pancreas-specific both alleles (Fig. 1C). Pdx1-Cre mice (C), with and without the Lsl-KrasG12D allele (K), and aged mice until humane clinical endpoints were Deregulated MYC Drives Pancreatic Tumor reached. Pdx1-Cre–positive mice carrying one (MC) or two Development and Progression (M2C) copies of Rosa26DM-lsl-MYC developed pancreatic tumors RAS pathway activity elevates MYC expression in pan- requiring euthanasia at a median age of 297 or 180 days, creatic cancer, primarily via suppression of MYC protein respectively. The combination of Lsl-KrasG12D and one copy turnover, and MYC was previously shown using RNAi to of Rosa26DM-lsl-MYC (KMC) yielded a dramatically accelerated be required for proliferation of PDAC cells in culture (20, tumor phenotype requiring euthanasia at a median age of 25, 26). Use of the PICKLES database of CRISPR-mediated just 50 days, as compared with KC mice, which had a median essentiality screening (27) confirmed the requirement for survival >350 days (Fig. 2A–C). In contrast with KC mice,

OF3 | CANCER DISCOVERY june 2020 AACRJournals.org

MYC and KRAS Suppress Type I Interferons in PDAC RESEARCH ARTICLE

100 2 A B M C C 100 KC

MC l MC Pdx1 Cre C KMC viva Rosa26 stop huMYC M 50 ** 50

* rcent sur Kras stop Exon1 K *** Pe Percent survival Percent

0 0 0 100 200 300 400 500 0 100 200 300 400 500 Age (days) Age (days) D WT KC MC M2C KMC H&E MYC G12D KRAS

E F 100 H Metastases Pdx1 Cre ER CER ** Liver Diaphragm MCER Rosa26 stop huMYC M *** M2CER 50 * KMCER Kras stop Exon1 K Percent survival Percent Hprt stop IRFP I 0 0 100 200 300 400 Days post induction G H&E tokeratin cy

PanIN-1 PanIN-2 PanIN-3 PDAC n- Pa Synaptophysin

Figure 2. Pancreatic cancer phenotypes induced by activation of Rosa26-driven MYC with and without KRASG12D. A, Schematic of alleles used in B–D. B, Overall survival of MC (N = 9) and M2C (N = 11) mice. Mantel–Cox log rank test (B, C, and F). C, Overall survival of KC (N = 65) versus MC (from B) and KMC (N = 19) mice. Black hash marks indicate mice that were euthanized for reasons unrelated to pancreatic cancer. D, Representative images show tumor histology [hematoxylin and eosin (H&E)] and IHC detection of total MYC and KRASG12D expression in end-stage tumors of mice of the indicated genotypes. Scale bar, 100 μm. E, Schematic of alleles used in F–H. F, Overall survival of MCER (N = 5), M2CER (N = 6), and KMCER (N = 10) mice measured in days post induction with tamoxifen. G, Representative H&E images of ductal tumor progression in KMCER mice. Scale bars, 100 μm. H, Licor PEARL fluorescent imaging of IRFP-expressing metastases in KMCER mice (top). Liver metastases (left), diaphragm metastases (right). H&E and IHC for pan-cytokeratin and synaptophysin (bottom). Scale bars, 100 μm. **, P < 0.01; ***, P < 0.001.

june 2020 CANCER DISCOVERY | OF4

RESEARCH ARTICLE Muthalagu et al. which developed mostly ductal epithelial PanIN lesions with Endogenous Myc Is Required for infrequent progression to PDAC, as reported previously (6), KMC Tumor Development 2 MC and M C pancreata showed no evidence of ductal epithe- Given the modest expression of Rosa26-driven MYC in lial phenotypes and instead presented with PNETs character- MEFs, we asked whether autochthonously expressed Myc ized by densely populated cells that stained strongly for the contributes meaningfully to the total pool of MYC protein neuroendocrine marker synaptophysin and faintly positive in the KMC model. Note that whereas KRAS activation for cytokeratin (Fig. 2D; Supplementary Fig. S1B). This does not affect transcription from the Rosa26 locus, which PNET phenotype was largely masked upon inclusion of the we previously showed is refractory to growth factor sign- G12D Lsl-Kras allele: Rapidly arising tumors in KMC mice dis- aling (31), post-translation regulation of MYC protein by played a predominantly ductal adenocarcinoma phenotype RAS pathway activation should affect murine and human (PDAC), complete with characteristic desmoplastic stroma, MYC protein equally (32). Accordingly, deletion of floxed whereas <5% of tissue area exhibited PNET features (Supple- murine Myc in MEFs reduced the total pool of MYC pro- mentary Fig. S1B and S1C). PNET regions in KMC tumors tein by approximately 50%, despite concurrent activation G12D expressed KRAS (Supplementary Fig. S1D), indicating of Rosa26DM-lsl-MYC and Lsl-KrasG12D alleles (Fig. 3A). KMC that the persistence of this phenotype does not arise from mice interbred with Mycfl/fl mice were aged until humane G12D failure to activate the Lsl-Kras allele in a subset of pancre- endpoints were reached. KMC mice heterozygous for floxed atic tumor–initiating cells. Myc showed significantly increased survival, and survival was fl/fl Sporadic Adult Activation of Rosa26DM-lsl-MYC and increased further in homozygous Myc mice (Fig. 3B and Lsl-KrasG12D Drives Metastatic Cancer C). Nevertheless, all mice developed PDAC. Examination of murine Myc by ISH revealed a mosaic pattern of continued The Pdx1 promoter is active from embryonic day 8.5 (28), expression of murine Myc in much of the ductal epithelium raising the possibility that blockade of pancreatic progeni- of all KMC-Mycfl/fl tumors examined, indicating escape from tor cell differentiation might explain the MYC-dependent Cre-mediated deletion and suggesting a selective pressure to neuroendocrine and accelerated PDAC phenotypes. To retain expression of endogenous Myc despite the presence of address this, we substituted the constitutively active Pdx1- Rosa26-driven MYC (Supplementary Fig. S2A and S2B). This ER Cre allele with a Pdx1-Cre-ER allele (C ) which expresses MYC dose dependence was also evident in human PDAC cell an inactive Cre–estrogen receptor ligand–binding domain lines, wherein depletion of MYC suppressed cell proliferation fusion protein that can be activated by the synthetic ligand (Supplementary Fig. S2C), consistent with previous reports ER tamoxifen (29). KMC mice were additionally interbred (20). These data strongly suggest that the level of MYC with mice carrying a Hprt-Lsl-IRFP Cre-reporter allele (30), expression is rate-limiting for pancreatic tumor progression to facilitate imaging of tumor populations (Fig. 2E). Cre- and, in KMC mice, both Rosa26-driven MYC and endog- ER was transiently activated in mice ages 5 to 6 weeks by 3 enously expressed Myc functionally contribute to the total days of tamoxifen injection, and mice were aged to clinical pool of MYC protein. endpoint. As was found using the constitutively active Cre, all M2CER mice developed neuroendocrine tumors, reaching median endpoint at 275 days from the date of induction, MYC Suppresses Immune Cell Infiltration although the majority of MCER mice failed to develop symp- in PDAC tomatic disease within 400 days. KMCER mice all developed To gain insight into the functional roles of MYC in PDAC, PDAC, reaching median endpoint at 128 days post-induc- we performed bulk-tumor RNA sequencing (RNA-seq) on tion (Fig. 2F). Periodic sampling of KMCER pancreatic tissue six KC, six KMC, and four KMC-Mycfl/+ end-stage tumors. following Cre-ER activation showed temporal progression Note that homozygous KMC-Mycfl/fl mice were omitted from of incipient tumors from PanIN-1 through PDAC (Fig. RNA-seq analysis given that the failure of Cre recombinase 2G). Furthermore, the IRFP allele revealed metastases in 6 to efficiently delete both copies of endogenousMyc would of 10 mice, of which 4 had liver metastases and 4 had dia- likely confound interpretation. MetaCore GeneGo analysis phragm metastases, including 2 mice with both (Fig. 2H). revealed a pronounced reduction in immune cell–related As observed with KMC tumors, KMCER tumors contained gene expression in KMC relative to KC tumors (Supplemen- regions (∼15% of tumor area) of PNET (Supplementary tary Fig. S3). Specifically, we found reduced expression of Fig. S1C). All liver metastases histologically resembled the genes encoding T-cell markers, including CD3, CD4, and CD8 PNET phenotype and all stained strongly for synaptophy- (Supplementary Fig. S4A); B-cell immunoglobulin genes, sin. In contrast, diaphragm metastases all histologically including those encoding multiple constant heavy and light resembled PDAC, but also contained discrete regions where chains along with joining regions; and NK-cell genes, includ- cells stained strongly for either cytokeratin or synaptophy- ing natural killer triggering receptor (Nktr) and killer-type sin, suggestive of phenotypic plasticity in the metastatic lectin receptor genes (Fig. 3D and E). IHC for markers of population (Fig. 2H). Accordingly, synaptophysin–cytokera- B (CD45R) and NK (NKp46) cells confirmed their reduced tin double-positive cells could be identified in the ductal presence in KMC PDAC (Fig. 3F and G). Reduction of total epithelium of primary tumors (Supplementary Fig. S1E), MYC by deletion of endogenous Myc reversed the exclu- as previously reported using the embryonically active Pdx1- sion of B and NK cells but did not significantly influence Cre allele (17). The accelerated tumor phenotypes observed T-cell infiltration (Fig. 3F and G; Supplementary Fig. S4B upon MYC deregulation can thus arise in fully developed and S4C). RNA-seq analysis showed increased expression adult tissues. of multiple killer-type lectin receptor genes, indicative of

OF5 | CANCER DISCOVERY june 2020 AACRJournals.org

MYC and KRAS Suppress Type I Interferons in PDAC RESEARCH ARTICLE

AB C 100 KMC G12D Pdx1 Cre C R26-Lsl-Myc;Lsl-Kras KMC Myc fl/+ * + Adeno-Cre *** KMC Myc fl/fl WT fl/fl Myc Rosa26 stop huMYC M 50 MYC * 55 Kras stop Exon1 K Percent survival Percent Actin cMyc Exon2 Exon3 42 0 050100 150 Age (days)

D B lymphocyte markers 6 *** *** *** *** 4 *** *** *** 5 KC 5 *** *** *** KMC 3 4 *** 4 3 2 3

2 1 2 RNA-seq reads RNA-seq reads 1 RNA-seq reads 10 10 0 10 1 0 Log Log −1 −1 Log 0 Ighm Ighg1 Ighg2b Ighg2c Igha Ighj1 Ighj2 Ighj3 Ighj4 Iglc1 Iglc2

E NK-cell markers F Tumor infiltration

20 1.5 B cells NK cells *** KC 40 * 10 2

** KMC 2 15 ** 8 1 30 * 10 6 ce ll s/mm

*** ce ll s/mm

** 20

RNA-seq reads 0.5 RNA-seq reads 4 * 3 3 5 10

× 10 2 NKp46 × 10 CD45R 0 0 0 0 Nktr Klra4 Klrd1 Nkg7 KC KMC KMC KC KMC KMC Myc fl/fl Myc fl/fl

G KC KMC KMC Mycfl/fl H Killer-type lectin receptor genes 30 *

NKp46 * * 10 RNA-seq reads

0 Klra1 Klra7 Klrc2 KMC KMC Mycfl/+ CD45R

Figure 3. MYC expression levels modulate effector immune cell infiltration in PDAC. A, Genetic deletion of endogenous Myc in Rosa26DM-lsl-MYC; Lsl-KrasG12D MEFs. Lysates were prepared 24 hours after Adeno-Cre infection. Representative of two independent experiments. B, Schematic of alleles used in C–H. C, Overall survival of KMC mice with 0 (N = 19; from Fig. 2C), 1 (N = 13), or 2 (N = 8) copies of Mycfl. Mantel–Cox log rank test. D, Normalized RNA-seq reads of indicated B-cell markers in KC (N = 6) and KMC (N = 6) pancreatic tumors. Note that samples with zero reads are absent from log-scale graphics (pertains only to KMC samples). Adjusted P values were generated in R (D, E, and H). E, Normalized RNA-seq reads of indicated NK-cell markers in KC (N = 6) and KMC (N = 6) pancreatic tumors. F, Quantification of tumor-infiltrating NK (NKp46+) and B (CD45R+) cells in KC (N = 7), KMC (N = 10), and KMC-Mycfl/fl (N = 9 and 12, respectively) pancreatic tumors. Kruskal–Wallis and Dunn multiple comparison test. G, Representative images of IHC staining for NKp46+ NK cells (top) and CD45R+ B cells (bottom), as per F. Scale bars, 100 μm. H, RNA-seq reads of NK-cell killer-type lectin receptor genes in KMC (N = 6) versus KMC-Mycfl/+ (N = 4) tumors. For all panels, ***, P < 0.001; **, P < 0.01; *, P < 0.05.

june 2020 CANCER DISCOVERY | OF6

RESEARCH ARTICLE Muthalagu et al.

NK-cell activation and memory (33), upon reduction of MYC STAT1 and STAT2, which combine with IRF9 to form the in KMC tumors (Fig. 3H). Taken together with Figs. 1 and 2, ISGF3 complex (36). Although several of these effects were these data show that subtle differences in MYC expression evident with activation of either MYC or KRASG12D alone, profoundly modulate long-term immune cell infiltration in regulation was most pronounced upon combined oncogene PDAC, extending a recent report of acute immune modula- activation (Fig. 4A; Supplementary Fig. S5D). tion by MYC using a tamoxifen-dependent variant allele, We next compared the transcriptomic impact of acute Rosa26-Lsl-MycERT2 (21). depletion of MYC or KRAS from KMC-derived tumor cell lines. As was observed in MEFs, we found a pronounced Suppression of the Type I IFN Pathway by overlap in significantly regulated genes altered in murine MYC and KRAS PDAC cells upon depletion of either Myc or Kras (Fig. 4B; MYC was previously shown to modulate the immune Supplementary Fig. S5E). Notably, the type I IFN pathway landscape in KRAS-driven lung adenocarcinoma via CCL9- was again among the topmost regulated pathways in both dependent recruitment of protumor macrophages and instances (Supplementary Fig. S5F), with increased expres- IL23-dependent exclusion of T, B, and NK cells (34). Expres- sion of the ISGF3 complex subunits, multiple Irfs, IFN recep- sion of Ccl9 was not significantly altered in our RNA-seq tor genes, and IFN-induced genes detected upon depletion of datasets and we found no difference in the number of either oncogene. These effects were typically stronger upon macrophages present in end-stage KMC versus KMC-Mycfl/fl Kras depletion, and some Irf genes (e.g., Irf5) were regulated tumors (Supplementary Fig. S4D and S4E). Functional by KRAS but not by MYC in this analysis, perhaps reflecting IL23 comprises a heterodimer of p19 and p40 subunits, the limits of transcript detection at the sequencing read- encoded by IL23a and IL12b, respectively (35). Although depth used (Fig. 4C). To extend these data to the human Il23a expression was higher in KMC versus KC tumors setting, we treated PDAC cell lines with the MEK1/2 inhibi- and significantly reduced in KMC-Mycfl/+ tumors, the gene tor trametinib, which acutely reduced expression of MYC encoding its dimerization partner Il12b showed opposite downstream of KRAS (Fig. 4D). In both AsPC-1 and DAN-G regulation (Supplementary Fig. S4F), strongly suggesting cells, trametinib increased expression of IRF5, IRF7, IFNB1, that IL23 does not account for the immunosuppressive and a representative IFN-inducible gene, IFI44 (Fig. 4E). We phenotype driven by MYC in PDAC. Expression of Gas6, conclude from these experiments that MYC and KRAS coop- recently reported to be induced upon acute MYC activation erate to suppress the type I IFN pathway. in PanIN lesions (21), was unchanged in end-stage tumors (Supplementary Fig. S4G). We therefore sought an alterna- The Role of MIZ1 in Suppression of tive explanation for MYC-driven immunosuppression. IFN Regulators by MYC Type I IFN signaling via JAK–STAT was among the In many instances, MYC-dependent transcriptional most strongly suppressed pathways (ranked 6th) in KMC repression involves binding to the MYC-interacting zinc tumors relative to KC tumors (Supplementary Fig. S3). finger protein MIZ1, encoded byZBTB17 (18, 37). We there- Taking advantage of our ability to acutely induce expres- fore investigated the acute impact of Miz1 depletion in sion of floxed MYC and KRASG12D in otherwise WT primary KMC PDAC cells in vitro. Transcriptomic analysis revealed cells, we asked which pathways were regulated upon acute that depletion of Miz1 upregulated approximately 60% of activation of MYC and/or KRAS in MEFs. Early-passage the same genes upregulated upon depletion of MYC from MEFs carrying Rosa26-Lsl-MycDM, Lsl-KrasG12D, or both, were KMC cells (Fig. 5A; Supplementary Table S4). Using q-PCR, infected with Adeno-Cre overnight in full growth medium we determined that depletion of Miz1 or Myc specifically and their gene expression was compared with that of increased expression of Irf5, Irf7, Ifnb1, and Ifi44 (Figs. 5B; similarly infected WT littermate MEFs. Consistent with Supplementary Fig. S6A), as was found upon trametinib positive regulation of MYC by activated KRAS (Fig. 1), we treatment of human PDAC cells. Chromatin immunopre- found a pronounced overlap in the transcriptomic impact cipitation (ChIP) analyses showed MYC binding to the pro- of activation of either oncogene alone (Supplementary moters of STAT1, STAT2, IRF5, and IRF7 in DAN-G cells (Fig. Fig. S5A–S5C; Supplementary Tables S1–S3). Similar to 5C). ChIP–re-ChIP using a MIZ1 antibody showed efficient our comparison between KMC and KC tumors, GeneGo recovery of the same IRF and STAT promoter fragments analysis identified type I IFN signaling via JAK–STAT as initially precipitated a MYC but absent from control IgG the most significantly downregulated pathway upon com- precipitates, strongly suggesting that MYC and MIZ1 form bined activation of MYC and KRAS alleles (Supplementary repressive complexes on the STAT1, STAT2, IRF5, and IRF7 Fig. S5D). Interrogation of the data at the single-gene promoters (Fig. 5D; Supplementary Fig. S6B), as previously level showed reduced expression of multiple IFN-induced reported for the Stat1 promoter in murine KPC PDAC cells genes, multiple IFN regulatory factors, and genes encoding (18). To investigate the functional role of MIZ1 in vivo, we

Figure 4. MYC and KRASG12D suppress the type I IFN pathway. A, RNA-seq analysis of indicated gene expression in Rosa26WT/WT (WT), Rosa26DM-lsl-MYC/+ (MYC), Lsl-KrasG12D (KRAS), and Rosa26DM-lsl-MYC/+;Lsl-KrasG12D (MYC and KRAS) MEFs, 24 hours after infection with Adeno-Cre. Adjusted P values were generated in R (A and C). B, Heat map of significant gene-expression changes induced by depletion ofMYC and KRAS in KMC-derived cultured PDAC cells compared with nontargeting (NT) control, analyzed by RNA-seq. N = 4 biological replicates. C, RNA-seq analysis of the indicated genes upon depletion of MYC or KRAS in KMC PDAC cells, as per B. D, Reduced expression of MYC in human PDAC cells treated with trametinib (T), compared with DMSO vehicle (D). Representative of three individual experiments. E, RT-PCR analysis of IFN-related gene expression in human PDAC cell lines treated +/−trametinib. Mean and SEM shown for N = 3 biological replicates. For all panels, ***, P < 0.001; **, P < 0.01; *, P < 0.05; ns, not significant.

OF7 | CANCER DISCOVERY june 2020 AACRJournals.org

MYC and KRAS Suppress Type I Interferons in PDAC RESEARCH ARTICLE

A Acutely regulated by MYC and/or KRASG12D activation in MEFs STAT genes IFN regulatory factor genes IFN-induced genes *** *** *** WT ** MYC 15 12 ***** 20 **** *** *** KRAS *** MYC & KRAS 15 *** *** 10 8 * ** *** *** * ** *** 10 * *** *** RNA-seq reads RNA-seq reads RNA-seq reads *** *** 2 2 5 2 4 *** *** *** ** 5 × 10 × 10 × 10

0 0 0 Stat1Stat2 Irf1 Irf5 Irf7 Irf9 Ifit1 Ifih1 Ifi27 Ifi27l2b Ifi35 Ifi44

B KMC tumor cells C Acutely regulated upon depletion of MYC or KRAS in KMC cells gene expression IFN regulatory factor genes ISGF3 complex siNT 25 ns 1.2 7.2 ** *** *** *** *** siMYC siKRAS siNT 20 * *** 5.4 ** 0.8 *** 15 * 3.6 10 RNA-seq reads RNA-seq reads RNA-seq reads 2 2 0.4 2 ** 1.8 si MYC × 10 5 × 10 × 10

0 0 0 Irf1 Irf3 Irf5 Irf7 Irf9 Stat1 Stat2 IFN receptor genes IFN-induced genes si KRAS 5 *** *** 8 *** *** 35 *** *** *** *** 4 ** 28 *** Z 2 10−1 −2 6 ** 3 ** 21 *** 4 *** 2 *** 14 RNA-seq reads RNA-seq reads RNA-seq reads 2 2 3 *** 2

× 10 7 × 10

× 10 1

0 0 0 Ifnar1 Ifnar2 Ifngr2 Ifi27 Ifi35 Ifih1 Ifit2 Irgm1 Irgq

D AsPC-1 DAN-G E 5 AsPC-1 15 DAN-G pERK1/2 * 40 DMSO (Thr202/Tyr204) 4 ** 10 Trametinib 3 ERK1/2 * *** 40 2 ** * *** 5 Fold change Fold 1 change Fold 55 MYC 130 0 0 Vinculin IRF5 IRF7 IFI44 IFNB1 IRF5 IRF7 IFI44IFNB1

DDTT

june 2020 CANCER DISCOVERY | OF8

RESEARCH ARTICLE Muthalagu et al.

A siNTsiMYC siMiz1 C IRF5 D IRF5 Z 8 *** 0.4 2 * 6 0.3 1 4 0.2 0 Input (%) Input (%) 2 0.1 −1

KMC cell line 0 0.0

gene expression −2 IRF7 IRF7 2.0 15 *** *** B 1.5 Miz1 Irf5 Irf7 Ifi44 Ifnb1 10 1.0 6 * 6 4 8 1.0 * * 5

*** Input (%) 3 6 Input (%) 0.5 4 4 0.5 2 4 0 0.0 2 2 STAT1 0.8 STAT1 Fold change Fold *** 1 2 15 ** *** 0.6 0 0 0 0 0 10 0.4 siCon siCon siCon siCon siCon siMiz1 siMiz1 siMiz1 siMiz1 siMiz1 5 Input (%) Input (%) 0.2

E F 100 0 0.0 Pdx1 C Cre KMC STAT2 STAT2 fl/fl 20 KMC Miz *** *** 1.0 *** Rosa26 stop huMYC M 15 0.8 50 0.6 Kras * 10 stop Exon1 K 0.4 Input (%) Percent survival 5 Input (%) Zbtb17 0.2 Exon3 Exon4 Miz1fl/fl (Miz1) 0 0 0.0 0 100 200300 VAMP4 VAMP4 Age (days) 40 *** 2.5 *** G NKp46 CD45R 30 2.0 8 ** 50 ** 1.5 40 20 6 ns 1.0 Input (%) tumor tumor

30 Input (%) 2 2 10 4 0.5 20 0 0.0 2 10 rIgG MYC Cells/mm Cells/mm rIgG 0 0 MYC mIgG MIZ1 MIZ1 KMC KMC KMC KMC (Re-IP) Miz1fl/fl Miz1fl/fl H NKp46 CD45R fl/fl KMC Miz1

NT α IFNAR1 NT α IFNAR1

I NKp46 CD45R J 100 8 ** 60 * KMC Miz1fl/fl KMC Miz1fl/fl + αIFNAR-1 * 6 40 tumor tumor 2 4 2 50 20 2 Percent survival Cells/mm Cells/mm 0 0 NTα IFNAR1 NT α IFNAR1 0 0100 200 300 KMC Miz1fl/fl KMC Miz1fl/fl Age (days)

OF9 | CANCER DISCOVERY june 2020 AACRJournals.org

MYC and KRAS Suppress Type I Interferons in PDAC RESEARCH ARTICLE used Miz1ΔPOZ mice (38) in which the sequence encoding the (Fig. 6E–G), whereas isotype control antibody had no effect MYC-interacting POZ domain of MIZ1 is flanked byLoxP (Supplementary Fig. S6F). Depletion of NK cells likewise sites (Fig. 5E). Efficient deletion of the MIZ1 POZ domain negated the survival benefit, strongly suggesting that they in KMC-Miz1fl/fl mice was verified by ISH and significantly actively restrain the tumor phenotype (Fig. 6H; Supplemen- extended the life span of tumor-bearing mice (Fig. 5F; Sup- tary Fig. S6G). Accordingly, coculture of KMC tumor cells plementary Fig. S6C). PDAC subtype analysis performed as with in vitro–activated splenocytes enriched for NK cells per Bailey and colleagues (3) revealed that deletion of either showed that KMC tumor cells are efficiently killed by NK Myc or Miz1 significantly increased the immunogenic sub- cells, equivalent to the established NK target cell line YAC1 type signature but did not significantly alter any of the other (40), in contrast with primary fibroblasts that are largely subtypes (Supplementary Fig. S6D). As was observed upon resistant to NK-mediated killing (Fig. 6I). Taken together, deletion of endogenous Myc, deletion of Miz1 restored tumor these data delineate a pathway by which KRAS and MYC infiltration of NK and B cells (Fig. 5G). Antibody-mediated cooperate to evade NK-mediated antitumor activity in PDAC blockade of the type I IFN receptor IFNAR suppressed through suppression of the type I IFN pathway (Fig. 6J). NK- and B-cell infiltration and negated the survival benefit of Miz1 deletion in tumor-bearing KMC mice (Fig. 5H–J), implicating IFN signaling in lymphocyte recruitment and in Discussion the survival benefit observed uponMiz1 deletion. The evasion of antitumor immunity has emerged in recent years as a major hallmark of cancer that presents genuine IFN Signaling to NK and B Cells Is therapeutic opportunities through the targeted suppres- Mediated by CXCL13 sion of immune-evasion mechanisms, often with long-term Type I IFNs were recently shown to induce expression patient benefit. Most efforts to date have focused on mecha- of the B-cell chemokine CXCL13 (39). RNA-seq analysis nistic evasion of T lymphocyte–mediated tumor immunity, showed extremely high expression of Cxcl13 in KMC-Miz1fl/fl with targeted blockade of CTLA4 and PD-1/PD-L1 establish- tumors, as compared with KMC tumors, which express ing a paradigm for successful therapeutic exploitation of very little Cxcl13 (Fig. 6A). ISH analysis of KMC-Miz1fl/fl immuno-oncology. Here, we present evidence of a mechanism tumors showed Cxcl13 expression was restricted to a sub- of evasion of innate tumor immunity achieved through coop- set of F4/80-positive macrophages (Fig. 6B). Notably, only eration of the frequently dysregulated oncoproteins MYC and macrophages in close proximity to areas of ductal tumor KRAS via suppression of the type I IFN pathway. epithelium stained positive for Ccxl13 mRNA, suggesting We identified the type I IFN pathway as a major target paracrine signaling from tumor epithelium to adjacent of oncogene-mediated suppression through the unbiased macrophages. A similar, albeit weaker, pattern of Cxcl13 analysis of multiple RNA-seq datasets: comparing end-stage expression in F4/80-positive macrophages adjacent to ductal pancreatic tumors driven by KRASG12D alone with those epithelium was observed in KMC-Mycfl/fl tumors but was driven by the combination of KRASG12D and MYC; comparing absent from KMC tumors (Fig. 6A; Supplementary Fig. KMC-derived tumor cells depleted of Myc, Miz1, or Kras with S6E). We used exogenous mouse IFNβ1 treatment of bone mock-depleted parental cells; and comparing MEFs upon marrow–derived macrophages (BMDM) to confirm that IFN acute activation of Lsl-KrasG12D, Rosa26DM-lsl-MYC, or both, with can stimulate Cxcl13 expression in macrophages (Fig. 6C). WT littermate controls. In all such comparisons, the type I Next, we cultured macrophages with conditioned medium IFN pathway ranked among the pathways most significantly harvested from KMC tumor cells treated with nontargeting regulated. Although our mechanistic analysis here was per- or MYC-depleting siRNA and found that only media from formed exclusively in the context of pancreatic cancer, the MYC-depleted tumor cells could stimulate Cxcl13 expression. conservation of this regulation in MEFs suggests that sup- Importantly, pretreatment of macrophages with an IFNAR1- pression of type I IFNs may be a general feature of cancers blocking antibody completely abrogated Cxcl13 induction wherein MYC and KRAS are dysregulated. For instance, a (Fig. 6D), confirming that type I IFN released from MYC- strong negative correlation between tumors with an IRF8/9 depleted tumor cells drives CXCL13 production in mac- gene signature and those with a MAX gene signature (MAX rophages. Antibody-mediated depletion of CXCL13 from being the obligate heterodimerizing partner of MYC) was KMC-Miz1fl/fl mice suppressed infiltration of both B and recently reported in mesothelioma (41). Moreover, the type I NK cells and negated the survival benefit ofMiz1 deletion IFN gene cluster is syntenic with CDKN2A/B on chromosome

Figure 5. Transcriptional repression of the type I IFN pathway by MYC–MIZ1. A, Heat map of gene-expression changes induced by RNAi-mediated depletion of MYC or Miz1 in KMC-derived cultured PDAC cells compared with nontargeting control, analyzed by RNA-seq. N = 4 biological replicates. B, RT-PCR analysis of IFN-related gene expression in KMC tumor cells upon siRNA-mediated depletion of Miz1 compared with nontargeting control. Mean and SEM of three independent experiments shown. t test. C, ChIP analysis of MYC and MIZ1 binding to the promoters of the indicated genes in human DAN-G PDAC cells compared with a known MYC–MIZ1 target, VAMP4. Mean and SEM of technical replicates from 1 of 3 independent experiments shown. ANOVA and Tukey multiple comparison test. D, Re-ChIP analysis of MIZ1 binding to anti-MYC–precipitated promoter regions. Mean and SEM of technical replicates from 1 of 3 independent experiments shown. t test. E, Schematic of alleles used in F–J. F, Overall survival of KMC (N = 19; from Fig. 2C) and KMC- Miz1fl/fl (N = 12) mice. ***, P < 0.001; Mantel–Cox log rank test (F and J). G, Quantification of tumor-infiltrating NK (NKp46+) and B (CD45R+) cells in KMC and KMC-Miz1fl/fl pancreatic tumors. Mann–Whitney test (G and I). H, IHC detection of tumor-infiltrating NK and B cells after 3 weeks of IFNAR1 blockade in KMC-Miz1fl/fl PDAC. Scale bars, 100 μm. I, Quantification of tumor-infiltrating NK (NKp46+) and B (CD45R+) cells in untreated (NT; N = 11 and 10, respectively; from G) versus IFNAR1 antibody–treated (aIFNAR1, 3 weeks’ treatment, N = 5) KMC-Miz1fl/fl PDAC. J, Overall survival of KMC-Miz1fl/fl mice treated with (N = 7) or without (N = 12, from F) anti-IFNAR1 blocking antibody. For all panels, ***, P < 0.001; **, P < 0.01; *, P < 0.05.

june 2020 CANCER DISCOVERY | OF10

RESEARCH ARTICLE Muthalagu et al.

A Cxcl13 B KMC KMC Miz1fl/fl C Cxcl13

25 ) 0.8

*** − 2 20 0.6 ** 0.4 15 mRNA 0.2 10 nd (% of Gus × 10 0 Cxcl13 (ISH) 3 5 NT IFNβ1 × 10 RNA-seq reads 0 D Cxcl13 ) 2.0

KMC KMC- − 4 Miz1fl/fl 1.5 ** 1.0

mRNA 0.5 nd nd nd F4/80 (% of Gus × 10 0 siConsiMyc ctrl IgG ++ αIFNAR1 ++

E NKp46 CD45R fl/fl KMC Miz1

NT αCXCL13 NT αCXCL13 F G NKp46 CD45R 100

r r 60 8 * * KMC-Mizfl/fl

mo mo fl/fl KMC-Miz CXCL13 *** tu 6 tu + α 40 of of 50 2 4 2 20 2

Percent survival Percent 0

Cells/ mm 0 Cells/ mm NT αCXCL13 NT αCXCL13 0 0 100 200 300 KMC-Miz1fl/fl KMC-Miz1fl/fl Age (days)

H 100 J KMC-Miz fl/fl fl/fl ** * al KMC-Miz + αNK1.1 CXCL13 iv surv

t 50 ercen P

0 0 100 200 300 Age (days) I In vitro cytolytic activity 80 RAS ns* KMC ns IFN YAC1

) ns 60 Fibroblasts (% h 40 MYC MIZ1 STAT/IRFs ll d eat

Ce 20 NK cell B lymphocyte Macrophage 0 0:1 5:1 10:1 Cancer cell Stroma Effector:target ratio

OF11 | CANCER DISCOVERY june 2020 AACRJournals.org

MYC and KRAS Suppress Type I Interferons in PDAC RESEARCH ARTICLE

9 and is frequently co-deleted with the latter in a spectrum recruitment, and a subset of NK cells express the CXCL13 of human cancers: Across multiple cancers, patients with co- receptor CXCR5 (47). Depletion of CXCL13 or blockade deletion show significantly reduced overall survival compared of the type I IFN receptor IFNAR each suppressed B- and with those who retain the IFN gene cluster, providing further NK-cell infiltration and reversed the survival benefit ofMiz1 evidence of an antitumor role for this pathway and a selective deletion in KMC tumors. Using coculture experiments, we pressure for cancers to reduce its activity (42). showed that NK cells can efficiently kill KMC tumor cells, Mechanistically, we present evidence of repressive MYC– and that their depletion also negated the survival benefit MIZ1 complexes binding to the promoters of STAT1, STAT2, observed upon Miz1 deletion. As is the case with cytotoxic T IRF5, and IRF7. These data are complemented by a previous cells, NK cells express a variety of activating and repressive report of MYC–MIZ1 binding to the Stat1 promoter in KPC surface markers that are amenable to extrinsic modulation. (KrasG12D;Trp53R172H) murine pancreatic tumor cells (18) and As such, targeted activation of NK cells is emerging as an MYC repression of STAT2 in breast cancer cells (43). Recent attractive therapeutic option, particularly in tumors with low work has shown that basal expression of many IFN-stimu- mutation burden or lack of PD-L1 expression (48). lated genes is regulated by STAT2–IRF9 complexes indepen- It would be implausible to suggest that the dramatic dently of IFNAR signaling. Upon IFN-dependent activation acceleration of PDAC development observed upon MYC and of IFNAR, signaling through JAK family kinases leads to KRASG12D coexpression is entirely explained by these effects STAT1 binding to STAT2–IRF9 to form the ISGF3 complex on the immune landscape. Indeed, these are highly pleio- (36), driving expression of, among other genes, IRF7, which in tropic oncoproteins with broad influence over many cell- turn is strictly required for IFNα/β production (44). Note that intrinsic and cell-extrinsic biological features (21, 45). It is other STAT family members may have very different effects, notable however that regulation of the type I IFN pathway as recently evidenced by STAT6 driving expression of Myc occurs upon physiologic expression of KRASG12D or upon during PDAC progression in response to Th2-derived ILs (45). very modest overexpression of MYC, suggesting that this MYC–MIZ1 thus attenuates the type I IFN cascade at multi- regulation may be present from the very outset of tumor ple points that would limit both basal and IFN-stimulated initiation. This raises the exciting possibility of early inter- gene expression. The effects of KRAS on this pathway appear vention to reactivate IFN signaling. Although we show that to be largely a consequence of MYC stabilization, at least in pharmacologic inhibition of the RAS pathway can restore PDAC cells (25); however, signaling cross-talk between the IFN-related gene expression in vitro, we would caution against RAS and JAK–STAT pathways likely contributes to some such an approach in vivo given that immune cells use the very of the MYC-independent effects observed, or indeed to the same RAS pathway to achieve their own rapid expansion (49). stronger effects of KRAS modulation in these systems (46). What is clear however is that a very modest increase in MYC Similarly, MIZ1 likely has additional roles in PDAC beyond suffices to dramatically accelerate KRAS-initiated tumors to its function as a MYC corepressor, evidenced by divergent metastatic PDAC, as we previously reported for lung adeno- regulation of some 40% of MYC-regulated genes upon acute carcinoma (12), or indeed to alone drive PNET formation. depletion of MIZ1 in KMC cells. The fact that Miz1 could The different etiologies of these phenotypes remain to be be efficiently deleted in ductal tumor epithelium, unlike fully explored. endogenous Myc, argues that its role in PDAC is more limited and likely explains the stronger impact of the floxedMiz1 genotype upon Cxcl13 induction in vivo, as compared with the Methods floxed Myc allele. Animal Studies We demonstrate that derepression of the type I IFN path- All experiments involving mice were approved by the local animal way in PDAC tumor cells stimulates production in nearby welfare committee [Animal Welfare Ethical Review Body (AWERB)] macrophages of the canonical B-cell chemokine CXCL13, and conducted under U.K. Home Office licenses PE47BC0BF, resulting in tumor infiltration by B and NK cells. Although 70/7950, and 70/8375. Mice were maintained on a constant 12-hour the recruitment of NK cells may well be an indirect conse- light/dark cycle, fed and watered ad libitum, and all were mixed quence of B-cell recruitment, as suggested by recent data (21), background (FVBN and C57BL/6). The following genetically modi- evidence is emerging of a direct role for CXCL13 in NK-cell fied mice were described previously:Lsl-Kras G12D (5); Rosa26DM-lsl-MYC

Figure 6. CXCL13 mediates IFN signaling to B and NK cells in PDAC. A, Normalized RNA-seq reads of Cxcl13 expression in KMC (N = 6) and KMC-Miz1fl/fl (N = 5) pancreatic tumors. B, ISH analysis of Cxcl13-expressing cells in KMC and KMC-Miz1fl/fl tumors. IHC for F4/80 (bottom). Scale bar, 100 μm. C, RT-PCR analysis of Cxcl13 gene expression in BMDMs upon treatment (10 ng/mL for 4 hours) with recombinant mouse IFNβ1. Mean and SEM of technical replicates from 1 of 3 independent experiments. t test; nd, none detected. D, RT-PCR analysis of Cxcl13 gene expression in BMDMs after 24 hours of treatment with conditioned medium from MYC-depleted or control KMC tumor cells. Macrophages were pretreated (20 μg/mL, overnight) with IFNAR1-blocking antibody or isotype control, where indicated. Mean and SEM of technical replicates from 1 of 3 independent experiments. ANOVA and Tukey post hoc test; nd, none detected. E, IHC detection of tumor-infiltrating NK and B cells after 3 weeks of blockade of CXCL13 in KMC-Miz1fl/fl PDAC. Scale bars, 100 μm. F, Quantification of tumor-infiltrating NK (NKp46+) and B (CD45R+) cells in untreated (NT; N = 11 and 10, respectively, from Fig. 5G) and anti-CXCL13–treated (N = 6) KMC-Miz1fl/fl PDAC. Mann–Whitney test. G, Overall survival of KMC-Miz1fl/fl mice treated with (N = 6) or without (N = 12, from Fig. 5F) anti-CXCL13 blocking antibody for 3 weeks. Mantel–Cox log rank test (G and H). H, Overall survival of KMC-Miz1fl/fl mice treated with (N = 6) or without (N = 12, from Fig. 5F) anti-NK1.1 depleting antibody for 4 weeks. I, FACS analysis of Zombie NIR labeling of target cells (KMC, YAC1, and fibroblasts) cocultured with IL2-stimulated, NK cell–enriched splenocytes for 4 hours. Mean and SEM of three independent experiments shown. Two-way ANOVA and Tukey multiple comparisons test. J, Model showing the mechanism of MYC–MIZ1-dependent immune evasion in PDAC. For all panels, ***, P < 0.001; **, P < 0.01; *, P < 0.05; ns, not significant.

june 2020 CANCER DISCOVERY | OF12

RESEARCH ARTICLE Muthalagu et al.

(23); Pdx1-Cre (6); Pdx1-CreER (29); MycFl (50); Hprt-Lsl-IRFP (30); counted manually using QuPath cell (https://qupath.github.io/) and Miz1ΔPOZ (38). All genotyping was performed by Transnetyx counter function and normalized to tumor area (PDAC + PNET) Inc. To induce allele recombination, CreERT2 was activated in the calculated as described above. pancreas of 5- to 6-week-old mice by intraperitoneal injection of 2 mg/kg tamoxifen (dissolved in peanut oil) for 3 consecutive days. For Cell Culture overall survival analysis, cohorts of mice were monitored and eutha- Human pancreatic cell lines were obtained from ATCC and were nized when clinical endpoint was reached. Endpoint monitoring maintained in DMEM (MIA PaCa-2) or RPMI (AsPC-1, DAN-G) was performed by facility staff without knowledge of genotype. For supplemented with 10% FBS and penicillin–streptomycin. All cell histologic analysis, mouse tissues were fixed with 10% neutral buff- lines were validated using an approved in-house validation service ered formalin overnight. At euthanasia, a small portion of pancreatic (CRUK-BICR) and tested periodically for Mycoplasma. Cell lines were tumor was snap-frozen for RNA analysis. To determine the influence thawed from primary stocks maintained under liquid nitrogen and of CXCL13, a cohort of randomly selected KMC-Miz1ΔPOZ mice were cultured for a maximum of 8 weeks (<20 passages), during which treated with CXCL13-blocking antibody (0.5 μg, i.v., AF470, R&D time all experiments were performed. Cells were treated with 10 Systems) or isotype control (goat IgG, AB-108-C, R&D Systems) nmol/L (DAN-G) or 50 nmol/L (AsPC-1) trametinib (MedChem from 6 weeks of age, twice weekly for 3 weeks, and sacrificed at Express) for 16 hours and used for protein and RNA analysis. Pri- clinical endpoint. To determine the influence of IFN signaling, a mary MEFs were generated from E13.5 embryos by interbreeding cohort of randomly selected KMC-Miz1ΔPOZ mice were treated with mice carrying Rosa26DM-lsl-MYC, Lsl-KrasG12D, and Mycfl/fl to obtain IFNAR1-blocking antibody (clone MAR1.5A3, BE0241, BioXCell) desired genotypes. MEFs were cultured in DMEM with 10% FBS intraperitoneally, 200 μg/20 g body mass on first dose and 100 μg/20 and penicillin–streptomycin in 3% oxygen. To activate floxed alleles, g for the following six doses, from 6 weeks of age, once every 3 days MEFs were infected with 300 pfu/cell of Adeno-Cre (University of for 3 weeks, and sacrificed at clinical endpoint. For NK-cell depletion, Iowa, Vector Core Facility, Iowa City, IA) and harvested at 24 hours. 6-week-old mice were treated with anti-NK1.1 (clone PK136, BP0036, Mouse pancreatic tumor lines were generated from end-stage KMC BioXCell), intraperitoneally, 100 μg/20 g, two doses in the first week mice. Tumors were disintegrated mechanically and cultured in and once per week for the following 3 weeks. To verify NK-cell deple- DMEM supplemented with 20% FBS and penicillin–streptomycin. tion following the NK1.1 antibody treatment, blood was sampled Once established, KMC cells were maintained in DMEM supple- by tail bleed from mice prior to and after 2 weeks of treatment. mented with 10% FBS and penicillin–streptomycin. For cell death Cells were stained with CD45 (10311, BioLegend), CD3 (100327, measurements, cells were trypsinized, quenched with 1% BSA fol- BioLegend), NK1.1 (108707, BioLegend), NKp46 (137612, BioLeg- lowed by replacement of original supernatant, and centrifuged at end), and Zombie NIR10311, (423106, BioLegend) after red blood 300 × g for 5 minutes; 200 μL of Annexin binding buffer (10 mmol/L cell lysis (eBioscience, 00-4333-57) and analyzed by flow cytometry HEPES pH 7.40, 140 mmol/L NaCl, 2.5 mmol/L CaCl ) and 2 μL of (BD Fortessa). FACS profiles were generated and quantified using 2 Annexin V-APC (BioLegend 640920) were added to the pellet and FlowJo (Tree Star). Rosa26DM-lsl-MYC mice are available from JAX Mice incubated for 15 minutes. Propidium iodide (10 μg/mL) was added at https://www.jax.org/strain/033805. immediately prior to FACS analysis. For immunoblotting, whole-cell lysates were prepared in RIPA buffer (150 mmol/L NaCl, 50 mmol/L IHC and Tissue Analysis Tris pH 7.5, 1% NP-40, 0.5% sodium deoxycholic acid, 1% SDS, plus complete protease and phosphatase inhibitor cocktail) followed All IHC and ISH staining was performed on 4-μm formalin-fixed, by sonication (40% Amp for 5 seconds). MYC (ab32072), vinculin paraffin-embedded sections, which had previously been heated to (ab129002), Antibodies to histone H2B (ab1790, Abcam), pERK1/2 60°C for 2 hours. Peroxidase blocking was performed for 10 min- (CST 4370), ERK1/2 (CST 4695, Cell Signaling Technology), and utes in 1% H O diluted in H O, followed by heat-mediated or 2 2 2 Actin (SC 47778, Santa Cruz Biotechnology) were used as primary enzyme-mediated antigen retrieval. Nonspecific antibody binding antibodies. Secondary HRP-conjugated antibodies (α-mouse IgG was blocked with up to 3% BSA or up to 5% normal goat serum for NA931V and α-rabbit IgG NA934V, both GE Healthcare; and α-goat 1 hour at room temperature. The following antibodies were used IgG, Vector Laboratories PI-9500) were detected by chemilumines- at the indicated dilution and indicated antigen retrieval method: cence (Bio-Rad Western blotting substrate 1705060). To deplete synaptophysin (ab8049, 1:50, pH 6), CD45R (ab64100, 1:200, ER2 MYC in human pancreatic cell lines, the following siRNAs were Leica), NKp46 (aF2225, 1:200, pH 6), F4/80 (ab6640, 1:100, Enzyme used: siMYC 5 (Qiagen SI00300902) and siMYC 9 (SI03101847). To 1 Leica), MYC (ab32072, 1:100, pH 6, Abcam), KRASG12D (CST14429, deplete MYC in mouse pancreatic tumor lines, a combination of 1:50, pH 9, Cell Signaling Technology), and pan-cytokeratin (MS- mouse and human siRNA was used as follows: Pool 1 (SI01321012 343, 1:100, pH 6, Thermo Fisher Scientific). NKp46, pan-cytokeratin, and SI00300902), Pool 2 (SI01321012 and SI03101847), Pool 3 and synaptophysin were stained on a Dako AutostainerLink48, (SI01320991 and SI00300902; all from Qiagen). To deplete Miz1 CD45R and F4/80 were stained on the Leica Bond Rx Autostainer, in mouse lines, SI01320991 (Qiagen) was used. To deplete Kras in and KRASG12D and MYC were stained manually. Mouse EnVision mouse lines, SI02742439 (Qiagen) was used. (Agilent), and goat ImmPRESS Kit and rabbit IgG (Vector Laborato- ries) were used as secondary antibodies. The horseradish peroxidase (HRP) signal was detected using liquid DAB (Agilent and Invitro- BMDM gen). Sections were counterstained with hematoxylin and cover- Bone marrow cells were isolated from WT mice by snipping the end slipped using DPX mount (CellPath). ISH detection of Cxcl13 (ACD of the femur and centrifuging at 5,000 rpm for 1 minute. Monocytes 406318), Miz1 (ACD 520288), and PP1β (ACD 313918; Advanced were differentiated into macrophages by culturing in non–TC-treated Cell Diagnostic) mRNA was performed using RNAscope 2.5 LS plates (Corning, 430597) for 6 days in RPMI medium containing Detection Kit (ACD). Detection of murine Myc (ACD 712368) was M-CSF (10 ng/mL). Medium containing M-CSF was replaced after 3 performed using a BaseScope 2.5 LS Detection Kit (ACD). Both days. Where indicated, BMDMs were treated with recombinant mouse techniques were performed on a Leica Bond Rx Autostainer, strictly IFNβ1 (8234-MB, R&D Systems) for 4 hours (10 ng/mL). KMC tumor adhering to ACD protocols. Tumor area was calculated using HALO cells were used to generate conditioned medium. Fresh medium Software (Indica Labs) as the percent area of pancreas occupied (DMEM + 20%FBS) were added 24 hours after transfection with by PDAC and PNET, measured on hematoxylin and eosin–stained siMYC or nontargeting control siRNA. Twenty-four hours later, con- sections. To quantify the immune infiltration, positive cells were ditioned medium from MYC or nontargeting control–depleted cells

OF13 | CANCER DISCOVERY june 2020 AACRJournals.org

MYC and KRAS Suppress Type I Interferons in PDAC RESEARCH ARTICLE was collected, centrifuged (1,200 rpm, 5 minutes), and supplemented mean and SEM values of biological replicates were calculated using with M-CSF and, where indicated, anti-IFNAR1–blocking antibody the calculator function. Graphical representation of such data was (20 ng/mL, BE0241, BioXCell) or mIgG (BE0083) prior to BMDM produced in Excel or GraphPad Prism. Statistical significance was treatment. BMDMs were additionally pretreated with anti-IFNAR1 determined by the Student t test. For multiple comparisons, ANOVA or mIgG overnight. BMDMs were treated with conditioned medium was used with a post hoc Turkey test or post hoc Fischer LSD test. For for 24 hours. To detect Cxcl13 expression in BMDMs, cDNA was syn- non–normally distributed data (e.g., survival benefit and immune cell thesized with Oligo-dT primer (M510, Promega), and preamplified infiltration), Mantel–Cox (two-way comparison), or Kruskal–Wal- (40 nmol/L of each primer, SYBR Green buffer, 1 mg/mL BSA, 2.5% lis (multiple comparison) tests were performed. For RNA-seq data, glycerol) for GusB and Cxcl13 for 20 cycles. Diluted cDNA (1:20 in 10 adjusted P values calculated in R are shown. *, P < 0.05; **, P < 0.01; mmol/L Tris and 1 mmol/L EDTA) was quantified by real-time PCR ***, P < 0.005. using SYBR Green method (VWR QUNT95072). Disclosure of Potential Conflicts of Interest In Vitro Cytotoxicity Assay O.J. Sansom reports receiving commercial research grants from NK cells were activated ex vivo as described previously (51): AstraZeneca, Novartis, and Cancer Research Technology. D.J. Mur- Freshly isolated splenocytes of naïve mice at 3 × 106 cells/mL were phy reports receiving commercial research grants from Puma Bio- treated for 72 hours with 50 ng/mL of IL2 (BioLegend, catalog technology and Merck Pharmaceutical Group. No potential conflicts number 575404). Target cells, stained with a cell trace dye (Thermo of interest were disclosed by the other authors. Fisher Scientific, catalog number C34567 or V12883) following the manufacturer’s instructions, were cocultured with different ratios (0, 5, and 10) of IL2-stimulated splenocytes, enriched for activated Authors’ Contributions NK cells. After 4-hour coincubation, cells were harvested, stained Conception and design: N. Muthalagu, S.B. Coffelt, O.J. Sansom, with Zombie NIR (BioLegend, catalog number 423106), and ana- D.J. Murphy lyzed by flow cytometry (BD Fortessa). FlowJo (Tree Star) software Development of methodology: N. Muthalagu, R. Wiesheu, S. Neidler, was used for analysis. S.B. Coffelt, O.J. Sansom Acquisition of data (provided animals, acquired and managed ChIP patients, provided facilities, etc.): N. Muthalagu, T. Monteverde, Dan-G cells were cross-linked with formaldehyde (1% final concen- X. Raffo-Iraolagoitia, R. Wiesheu, D. Whyte, S. Laing, B. Kruspig, S.A. tration) for 10 minutes at 37°C. Cells were scraped in PBS containing Karim, K. Gyuraszova, L.M. Carlin, J.P. Morton protease inhibitors and centrifuged at 300 × g for 5 minutes (4°C). Analysis and interpretation of data (e.g., statistical analy- Cells were resuspended in lysis buffer 1 (5 mmol/L PIPES pH 8, 85 sis, biostatistics, computational analysis): N. Muthalagu, mmol/L KCl, 0.5% NP40) and incubated on ice for 20 minutes. After X. Raffo-Iraolagoitia, R. Wiesheu, D. Whyte, A. Hedley, R. Upstill- lysis, cells were centrifuged at 300 × g for 5 minutes (4°C) and the Goddard, R. Shaw, C. Rink, A.V. Biankin, S.B. Coffelt, J.P. Morton, pellets were resuspended in lysis buffer II (RIPA). After 10-minute D.J. Murphy incubation, lysates were sonicated to fragment DNA. Chromatin Writing, review, and/or revision of the manuscript: N. Muthalagu, was precleared and immunoprecipitated with 5 μg of MYC (N262, T. Monteverde, A. Hedley, R. Shaw, C. Nixon, A.V. Biankin, S.B. Coffelt, SC764) or MIZ1 (B10, SC136985) antibody overnight at 4°C fol- O.J. Sansom, J.P. Morton, D.J. Murphy lowed by incubation with 60 μL of Protein G beads (17-0618-01, Administrative, technical, or material support (i.e., reporting GE Healthcare). Rabbit IgG (CS2729) or mouse IgG (BE0083) was or organizing data, constructing databases): C. Nixon, W. Clark, used as antibody control. DNA was then eluted using elution buffer S.B. Coffelt

(1% SDS, 0.1 mol/L NaHCO3), de–cross-linked and purified using Study supervision: N. Muthalagu, S.B. Coffelt, O.J. Sansom, J.P. Qiagen PCR Purification Kit for q-PCR analysis. For Re-ChIP, α- Morton, D.J. Murphy MYC or RIgG control immunoprecipitated chromatin was eluted Other (supervised the work on this paper of one of the co-authors): with Re-ChIP elution buffer (1× TE, 2% SDS, 15 mmol/L DTT) L.M. Carlin at 37°C for 30 minutes, immunoprecipitated with 5 μg of MIZ1 (B10, Sc136985) antibody overnight at 4°C. The immunoprecipitated Acknowledgments DNA was eluted as described above. The following primer sets were The authors thank all members of the Murphy Lab past and pre- used: IRF7 promoter: gacaccagcctgaccaacatag, acaatcttggcccaccacaac; sent who contributed to the development of this work. We would IRF5 promoter: aagagcaagagttaccaagcga, taaagaacctcaccccagaacc; like to thank the core services at the CRUK Beatson Institute with IRF5 intronic region: ctctggctttctcctgcagacc, cccattgaagccctgggtact; particular thanks to the Biological Services Unit and histology core STAT1 promoter: gctggtcgtcactctcacaa, tcgcctactcttaaggggct; STAT2 facility. Thanks to Kirsteen Campbell, Florian Bock, and the Stephen promoter: tccaggctcctcaagctagt, gcactttctacgaggggagg; and VAMP4 Tait laboratories for helpful discussions and to Catherine Winches- promoter: cagtggttgttcctcccta, ccgagccctattcacctaaa. ter for critical reading of the manuscript. Artwork was provided by Sara Zanivan using images from https://smart.servier.com/. Miz1ΔPOZ RNA-seq Analysis mice were provided by Martin Eilers. Funding for this work was Ribosome-depleted total RNA was used for analysis of MEF gene provided by Worldwide Cancer Research grant AICR 15-0279; Pan- expression. Poly-A enriched RNA was analyzed for bulk tumor and creatic Cancer UK Future Leaders Academy 2017; European Com- KMC cell line gene expression. Datasets are available from ArrayEx- mission Marie-Curie actions PCIG13-GA-2013-618448, SERPLUC, press under accession numbers E-MTAB 6824 (MEFs); E-MTAB 8792 and H2020-MCSA-IF-2015-705190-NuSiCC; and Cancer Research (KMC cell lines), and E-MTAB 8797 (PDAC tumors). Full details of UK grants A21139 (to O.J. Sansom) and A23983 (to L.M. Carlin). next-generation sequencing protocols and downstream analysis are N. Muthalagu received a L’Oreal/UNESCO Women in Science 2018 provided in the Supplementary Materials and Methods. award. T. Monteverde was funded through a British Lung Founda- tion studentship (BLF-APHD13-5). Additional support was provided Statistical Analysis by Wellcome Trust grant 105614/Z/14/Z; CRUK Glasgow Cancer Raw data obtained from qRT-PCR, FACS, and growth curves were Centre grant A25142; and CRUK Beatson Institute core facilities copied into Excel (Microsoft) or GraphPad prism spreadsheets. All grant A17196.

june 2020 CANCER DISCOVERY | OF14

RESEARCH ARTICLE Muthalagu et al.

Received May 30, 2019; revised February 7, 2020; accepted March 21. Sodir NM, Kortlever RM, Barthet VJA, Campos T, Pellegrinet L, Kup- 18, 2020; published first March 21, 2020. czak S, et al. Myc instructs and maintains pancreatic adenocarcinoma phenotype. Cancer Discov 2020;10:588–607. 22. Herold S, Wanzel M, Beuger V, Frohme C, Beul D, Hillukkala T, et al. Negative regulation of the mammalian UV response by Myc through References association with Miz-1. Mol Cell 2002;10:509–21. . 1 Rahib L, Smith BD, Aizenberg R, Rosenzweig AB, Fleshman JM, Mat- 23. Neidler S, Kruspig B, Hewit K, Monteverde T, Gyuraszova K, Braun risian LM. Projecting cancer incidence and deaths to 2030: the unex- A, et al. Identification of a clinically relevant signature for early pro- pected burden of thyroid, liver, and pancreas cancers in the United gression in KRAS-driven lung adenocarcinoma. Cancers 2019;11: States. Cancer Res 2014;74:2913–21. pii:E600. 2. Neoptolemos JP, Kleeff J, Michl P, Costello E, Greenhalf W, Palmer 24. Facchini LM, Chen S, Marhin WW, Lear JN, Penn LZ. The Myc nega- DH. Therapeutic developments in pancreatic cancer: current and tive autoregulation mechanism requires Myc-Max association and future perspectives. Nat Rev Gastroenterol Hepatol 2018;15:333–48. involves the c-myc P2 minimal promoter. Mol Cell Biol 1997;17: 3. Bailey P, Chang DK, Nones K, Johns AL, Patch AM, Gingras MC, et al. 100–14. Genomic analyses identify molecular subtypes of pancreatic cancer. 25. Vaseva AV, Blake DR, Gilbert TSK, Ng S, Hostetter G, Azam SH, et al. Nature 2016;531:47–52. KRAS suppression-induced degradation of MYC is antagonized by a 4. Cancer Genome Atlas Research Network. Integrated genomic charac- MEK5-ERK5 compensatory mechanism. Cancer Cell 2018;34:807–22. terization of pancreatic ductal adenocarcinoma. Cancer Cell 2017;32: 26. Santana-Codina N, Roeth AA, Zhang Y, Yang A, Mashadova O, Asara 185–203. JM, et al. Oncogenic KRAS supports pancreatic cancer through regu- 5. Jackson EL, Willis N, Mercer K, Bronson RT, Crowley D, Montoya R, lation of nucleotide synthesis. Nat Commun 2018;9:4945. et al. Analysis of lung tumor initiation and progression using condi- 27. Lenoir WF, Lim TL, Hart T. PICKLES: the database of pooled in tional expression of oncogenic K-ras. Genes Dev 2001;15:3243–8. vitro CRISPR knockout library essentiality screens. Nucleic Acids Res 6. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C, Jacobetz 2018;46:D776–D80. MA, et al. Preinvasive and invasive ductal pancreatic cancer and its 28. Wilson ME, Scheel D, German MS. Gene expression cascades in pan- early detection in the mouse. Cancer Cell 2003;4:437–50. creatic development. Mech Dev 2003;120:65–80. 7. Aguirre AJ, Bardeesy N, Sinha M, Lopez L, Tuveson DA, Horner J, et al. 29. Gu G, Dubauskaite J, Melton DA. Direct evidence for the pancreatic Activated Kras and Ink4a/Arf deficiency cooperate to produce meta- lineage: NGN3+ cells are islet progenitors and are distinct from duct static pancreatic ductal adenocarcinoma. Genes Dev 2003;17:3112–26. progenitors. Development 2002;129:2447–57. 8. Morton JP, Timpson P, Karim SA, Ridgway RA, Athineos D, Doyle B, 30. Hock AK, Cheung EC, Humpton TJ, Monteverde T, Paulus-Hock V, et al. Mutant p53 drives metastasis and overcomes growth arrest/senes- Lee P, et al. Development of an inducible mouse model of iRFP713 to cence in pancreatic cancer. Proc Natl Acad Sci U S A 2010;107:246–51. track recombinase activity and tumour development in vivo. Sci Rep 9. Mueller S, Engleitner T, Maresch R, Zukowska M, Lange S, Kalten- 2017;7:1837. bacher T, et al. Evolutionary routes and KRAS dosage define pancre- 31. Murphy DJ, Junttila MR, Pouyet L, Karnezis A, Shchors K, Bui DA, atic cancer phenotypes. Nature 2018;554:62–8. et al. Distinct thresholds govern Myc’s biological output in vivo. 10. Cicchini M, Buza EL, Sagal KM, Gudiel AA, Durham AC, Feldser DM. Cancer Cell 2008;14:447–57. Context-dependent effects of amplified MAPK signaling during lung 32. Sears R, Nuckolls F, Haura E, Taya Y, Tamai K, Nevins JR. Multiple adenocarcinoma initiation and progression. Cell Rep 2017;18:1958–69. Ras-dependent phosphorylation pathways regulate Myc protein sta- 11. Kerr EM, Gaude E, Turrell FK, Frezza C, Martins CP. Mutant Kras bility. Genes Dev 2000;14:2501–14. copy number defines metabolic reprogramming and therapeutic sus- 33. Ram DR, Manickam C, Hueber B, Itell HL, Permar SR, Varner V, ceptibilities. Nature 2016;531:110–3. et al. Tracking KLRC2 (NKG2C)+ memory-like NK cells in SIV+ and 12. Kruspig B, Monteverde T, Neidler S, Hock A, Kerr E, Nixon C, et al. rhCMV+ rhesus macaques. PLoS Pathog 2018;14:e1007104. The ERBB network facilitates KRAS-driven lung tumorigenesis. Sci 34. Kortlever RM, Sodir NM, Wilson CH, Burkhart DL, Pellegrinet L, Transl Med 2018;10:pii:eaao2565. Brown Swigart L, et al. Myc cooperates with Ras by programming 13. Moll HP, Pranz K, Musteanu M, Grabner B, Hruschka N, Mohrherr J, inflammation and immune suppression. Cell 2017;171:1301–15. et al. Afatinib restrains K-RAS-driven lung tumorigenesis. Sci Transl 35. Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, et al. Med 2018;10:pii:eaao2301. Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with 14. Kapoor A, Yao W, Ying H, Hua S, Liewen A, Wang Q, et al. Yap1 activa- biological activities similar as well as distinct from IL-12. Immunity tion enables bypass of oncogenic Kras addiction in pancreatic cancer. 2000;13:715–25. Cell 2014;158:185–97. 36. Platanitis E, Demiroz D, Schneller A, Fischer K, Capelle C, Hartl 15. Wirth M, Schneider G. MYC: a stratification marker for pancreatic M, et al. A molecular switch from STAT2-IRF9 to ISGF3 underlies cancer therapy. Trends Cancer 2016;2:1–3. interferon-induced gene transcription. Nat Commun 2019;10:2921. 16. Schleger C, Verbeke C, Hildenbrand R, Zentgraf H, Bleyl U. c-MYC 37. Lorenzin F, Benary U, Baluapuri A, Walz S, Jung LA, von Eyss B, activation in primary and metastatic ductal adenocarcinoma of the et al. Different promoter affinities account for specificity in MYC- pancreas: incidence, mechanisms, and clinical significance. Mod dependent gene regulation. Elife 2016;5:pii:e15161. Pathol 2002;15:462–9. 38. Kosan C, Saba I, Godmann M, Herold S, Herkert B, Eilers M, et al. 17. Farrell AS, Joly MM, Allen-Petersen BL, Worth PJ, Lanciault C, Sauer Transcription factor miz-1 is required to regulate interleukin-7 recep- D, et al. MYC regulates ductal-neuroendocrine lineage plasticity in tor signaling at early commitment stages of B cell differentiation. pancreatic ductal adenocarcinoma associated with poor outcome and Immunity 2010;33:917–28. chemoresistance. Nat Commun 2017;8:1728. 39. Denton AE, Innocentin S, Carr EJ, Bradford BM, Lafouresse F, Mab- 18. Walz S, Lorenzin F, Morton J, Wiese KE, von Eyss B, Herold S, et al. bott NA, et al. Type I interferon induces CXCL13 to support ectopic Activation and repression by oncogenic MYC shape tumour-specific germinal center formation. J Exp Med 2019;216:621–37. gene expression profiles. Nature 2014;511:483–7. 40. Nieswandt B, Hafner M, Echtenacher B, Mannel DN. Lysis of tumor 19. Saborowski M, Saborowski A, Morris JPt, Bosbach B, Dow LE, Pel- cells by natural killer cells in mice is impeded by platelets. Cancer Res letier J, et al. A modular and flexible ESC-based mouse model of 1999;59:1295–300. pancreatic cancer. Genes Dev 2014;28:85–97. 41. Hmeljak J, Sanchez-Vega F, Hoadley KA, Shih J, Stewart C, Heiman 20. Hayes TK, Neel NF, Hu C, Gautam P, Chenard M, Long B, et al. Long- D, et al. Integrative molecular characterization of malignant pleural term ERK inhibition in KRAS-mutant pancreatic cancer is associ- mesothelioma. Cancer Discov 2018;8:1548–65. ated with MYC degradation and senescence-like growth suppression. 42. Ye Z, Dong H, Li Y, Ma T, Huang H, Leong HS, et al. Prevalent Cancer Cell 2016;29:75–89. homozygous deletions of type i interferon and defensin genes in

OF15 | CANCER DISCOVERY june 2020 AACRJournals.org

MYC and KRAS Suppress Type I Interferons in PDAC RESEARCH ARTICLE

human cancers associate with immunotherapy resistance. Clin Can- 47. Yang CL, Zhang P, Liu RT, Zhang N, Zhang M, Li H, et al. CXCR5- cer Res 2018;24:3299–308. negative natural killer cells ameliorate experimental autoimmune 43. Qiao X, Liu Y, Llamazares Prada M, Mohan AK, Gupta A, Jaiswal A, myasthenia gravis by suppressing follicular helper T cells. J Neuroin- et al. UBR5 is co-amplified with MYC in breast tumors and encodes flammation 2019;16:282. an ubiquitin ligase that limits MYC-dependent apoptosis. Cancer Res 48. Chiossone L, Dumas PY, Vienne M, Vivier E. Natural killer cells and 2020;80:1414–27. other innate lymphoid cells in cancer. Nat Rev Immunol 2018;18: 44. Honda K, Yanai H, Negishi H, Asagiri M, Sato M, Mizutani T, et al. 671–88. IRF-7 is the master regulator of type-I interferon-dependent immune 49. Berridge MJ. Lymphocyte activation in health and disease. Crit Rev responses. Nature 2005;434:772–7. Immunol 2017;37:439–62. 45. Dey P, Li J, Zhang J, Chaurasiya S, Strom A, Wang H, et al. Onco- 50. de Alboran IM, O’Hagan RC, Gartner F, Malynn B, Davidson L, genic Kras driven metabolic reprogramming in pancreas cancer cells Rickert R, et al. Analysis of C-MYC function in normal cells via con- utilizes cytokines from the tumor microenvironment. Cancer Discov ditional gene-targeted mutation. Immunity 2001;14:45–55. 2020;10:608–25. 51. Lafreniere R, Rosenberg SA. Successful immunotherapy of murine 46. Thomas SJ, Snowden JA, Zeidler MP, Danson SJ. The role of JAK/ experimental hepatic metastases with lymphokine-activated STAT signalling in the pathogenesis, prognosis and treatment of killer cells and recombinant interleukin 2. Cancer Res 1985;45: solid tumours. Br J Cancer 2015;113:365–71. 3735–41.

june 2020 CANCER DISCOVERY | OF16

Repression of the Type I Interferon Pathway Underlies MYC- and KRAS-Dependent Evasion of NK and B Cells in Pancreatic Ductal Adenocarcinoma

Nathiya Muthalagu, Tiziana Monteverde, Ximena Raffo-Iraolagoitia, et al.

Cancer Discov Published OnlineFirst March 21, 2020.

Updated version Access the most recent version of this article at: doi:10.1158/2159-8290.CD-19-0620

Supplementary Access the most recent supplemental material at: Material http://cancerdiscovery.aacrjournals.org/content/suppl/2020/03/21/2159-8290.CD-19-0620.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerdiscovery.aacrjournals.org/content/early/2020/05/11/2159-8290.CD-19-0620. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.