Cutting Edge: Inhibiting Measles Virus Infection but Promoting

Cutting Edge: Inhibiting Measles Virus Infection but Promoting Reproduction: An Explanation for Splicing and Tissue-Specific Expression of CD46 This information is current as of September 28, 2021. Rebecca C. Riley, Pamela L. Tannenbaum, David H. Abbott and John P. Atkinson J Immunol 2002; 169:5405-5409; ; doi: 10.4049/jimmunol.169.10.5405 http://www.jimmunol.org/content/169/10/5405 Downloaded from

References This article cites 29 articles, 13 of which you can access for free at:

http://www.jimmunol.org/content/169/10/5405.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology ●

Cutting Edge: Inhibiting Measles Virus Infection but Promoting Reproduction: An Explanation for Splicing and Tissue-Speciﬁc Expression of CD461,2 Rebecca C. Riley,* Pamela L. Tannenbaum,† David H. Abbott,† and John P. Atkinson3*

control protein repeat (CCP) of MCP inhibited binding of human Membrane cofactor protein (MCP; CD46) regulates the com- sperm more efﬁciently than Abs to CCPs 2–4, which block complement cascade by inhibiting C3b and C4b deposited on self plement regulatory activity (Fig. 1) (9). tissue. This function resides in the complement control protein MCP is a receptor for the measles virus and several other patho- Downloaded from repeats (CCPs), with CCPs 2Ð4 essential for regulation. MCP gens (2, 11–14). During an investigation of natural variations in is expressed on the inner acrosomal membrane of human the MCP gene that affect measles virus infection, Hsu et al. (15) sperm, and Abs to CCP1 inhibit sperm-egg interactions. In examined eight species of New World monkeys covering seven of somatic tissues, New World monkeys express an alternatively the 16 genera and all major families. They noted that erythrocytes spliced form of MCP lacking CCP1. Although retaining com- of these New World monkeys did not hemagglutinate in the pres- plement-regulatory activity, this form is postulated to render ence of the Edmonston strain of the measles virus and determined these species less susceptible to strains of the measles virus that this was due to the absence of CCP1, which, with CCP2, http://www.jimmunol.org/ whose hemagglutinin requires CCP1 and CCP2 for attach- comprises the measles virus binding site in MCP (15–19). The lack ment. Using PCR, sequencing, Western blotting, and immuno- of CCP1 is due to an alternative splicing event that was postulated histochemistry, we characterized MCP expression in the testes to render the New World monkeys less susceptible to certain and sperm of two New World monkeys. In these species, sperm strains of the measles virus yet maintain MCP’s complement reg- express MCP bearing CCP1. The germ cell-speciﬁc expression ulatory activity (13, 15, 20). We hypothesized that expression of pattern of this domain strongly suggests an evolutionarily con- MCP bearing CCP1 would be evolutionarily conserved on sperm served role for MCP in fertilization. The Journal of Immu- of New World monkeys if MCP plays an important role in

fertilization. by guest on September 28, 2021 nology, 2002, 169: 5405Ð5409. Materials and Methods embrane cofactor protein (MCP4; CD46) is a cofactor Tissue and sperm collection for the factor-I-mediated cleavage of C3b and C4b de- Marmoset (Callithrix jacchus) samples were obtained from the Wisconsin M posited on self tissue (1, 2). Human sperm express Regional Primate Center (Madison, WI). Experimental protocols involving MCP on the inner acrosomal membrane (IAM) as a hypoglycosy- these animals were reviewed and approved by the Graduate School Animal Care and Use Committee of the University of Wisconsin, Madison, and lated form that is not observed in other tissues (3–5). Sperm-spe- were in accordance with National Institutes of Health and U.S. Department cific abnormalities in MCP have been associated with infertility in of Agriculture animal care guidelines. The Wisconsin Regional Primate humans (6, 7). Furthermore, Abs to MCP inhibit both binding and Center is accredited by American Association of Laboratory Animal Care penetration of human sperm to zona-free hamster eggs (4, 8, 9) and as part of the University of Wisconsin, Madison, Graduate School. Boliv- to human zona (10). In particular, Abs to the first complement ian squirrel monkey (Saimiri boliviensis boliviensis) samples were obtained from the Squirrel Monkey Breeding and Research Resource at the University of South Alabama (Mobile, AL). For all experiments, samples from at least two different mature monkeys were examined. In each case, *Division of Rheumatology, Washington University School of Medicine, St. Louis, the marmoset and the squirrel monkey ejaculate and whole blood samples MO 63110; and †Wisconsin Regional Primate Center, University of Wisconsin, Mad- were collected from the same animal. For immunohistochemistry, sperm ison, WI 53715 were allowed to swim up from fresh ejaculate and immediately subjected Received for publication August 12, 2002. Accepted for publication September to the staining protocol. Human sperm samples were obtained from healthy 19, 2002. donors and prepared as previously reported (3). The costs of publication of this article were defrayed in part by the payment of page Abs, RNA and protein purification, Western blotting, and charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. glycosidase treatment 1 This work was supported by National Institutes of Health Grant R01 AI37618 (to The anti-MCP (CD46) rabbit polyclonal Ab was obtained from Millennium J.A.). Pharmaceuticals (Cambridge, MA) courtesy of G. Yeh. Protein fractions 2 This is Wisconsin Primate Research Center publication 42.006. and RNA were purified simultaneously from tissue samples or cell lines using the TRIzol reagent (Life Technologies, Grand Island, NY) (3). West- 3 Address correspondence and reprint requests to Dr. John P. Atkinson, Division of Rheu- matology, Washington University School of Medicine, 660 South Euclid Avenue, Cam- ern blots and glycosidase treatments were performed as previously de- pus Box 8045, St. Louis, MO 63110. E-mail address: [email protected] scribed (3). 4 Abbreviations used in this paper: MCP, membrane cofactor protein; IAM, inner RT-PCR and cloning and sequencing of MCP transcripts acrosomal membrane; CCP, complement control protein repeat; CYT, cytoplasmic region; AR, acrosome reacted; PNGase, peptide N-glycosidase; DAF, decay-acceler- RT-PCR was performed as previously described (3). The sequence for the ating factor; STP, serine, threonine, and proline rich. 5Ј primer in the signal peptide was CCTCCCAGCCGCCGCGAGTGT

● 5406 CUTTING EDGE: SPLICING AND TISSUE-SPECIFIC EXPRESSION OF CD46

CCC; the 5Ј primer that anneals in CCP2 was CCTTTACATGGCGAAGC AATCCTTGC; the 5Ј primer that anneals in CCP4 was GTGGTCAAA TGTCGATTTCCAGTA; the 3Ј primer that anneals in CCP4 was TACTGG AAATCGACATTTGACCAC; and the 3Ј primer that anneals in cytoplasmic region (CYT)-2 was TGAACTTGTCTGCTCTGCTACAGTGGC. RT-PCR products were cloned and sequenced as reported (3). Sequences were submit- ted to GenBank under the following accession nos.: AY157981, AY157982, AY157983, AY157984, and AY157985.

Acrosome reaction and immunohistochemistry FIGURE 2. MCP protein expression patterns in humans and monkeys. ϳ ␮ The acrosome reaction was performed as described (3). Freshly washed Total protein extract ( 10 g) was separated by SDS-PAGE under non- sperm, either acrosome-reacted (AR) or nonreacted, were stained in the reducing conditions, transferred, and then incubated with a rabbit anti- fluid phase. The sperm were incubated with the primary Ab (rabbit antiserum to MCP (1/5000 dilution). An HRP-linked donkey anti-rabbit Ab MCP polyclonal antiserum at 1/500 dilution in PBS/1% BSA) for 30 min (1/3000 dilution) was used as a secondary Ab. The arrows indicate the at room temperature. The samples were pelleted at 1000 ϫ g for 7 min and doublet observed in the marmoset testes sample. washed with PBS. The sperm were then incubated with a tetramethylrhodamine isothiocyanate-conjugated goat anti-rabbit IgG Ab (diluted 1/50 in PBS/1% BSA) for 30 min. The stained sperm were washed and resus- human sperm display a single band that has a faster M (48 kDa) pended in PBS. r (Fig. 2, lane 1) (21). This human sperm-specific form contains all Results and Discussion four CCPs, the C exon of the serine, threonine, and proline-rich MCP expressed by marmoset and squirrel monkey sperm (STP) region and CYT-2 (the C2 isoform) (Fig. 1III) (3, 21). Its Downloaded from migrates similarly to MCP from human sperm N-linked sugars are trimmed during spermatogenesis to less com- plex structures, accounting for the smaller molecular mass. (3). Although MCP expressed in most human tissues forms a two-band MCP from blood cells, liver, and lung of the marmoset (Fig. 2, pattern with Mr values between 51 and 68 kDa on SDS-PAGE, lanes 3Ð5) and the blood cells of the squirrel monkey (lane 8)isa single band migrating at 60 kDa. Hsu et al. (15) determined by Ab specificity that this protein lacks CCP1. Its STP and cytoplasmic http://www.jimmunol.org/ tail regions (Fig. 1) were not evaluated. Other protein species were not observed by ourselves (Fig. 2) or Hsu et al. (13, 15). MCP expressed by sperm of the marmoset and the squirrel mon-

key is a single band migrating at 48 kDa, similar in Mr to human sperm MCP (Fig. 2, lanes 1, 2, and 7). If MCP expressed on monkey sperm lacked CCP1, one would expect an ϳ10 kDa difference in molecular mass compared with the human protein. Therefore,

the similar Mr was an initial observation suggesting that CCP1

might be retained in MCP of the New World monkey sperm. The by guest on September 28, 2021 Western blot of MCP from the testes of the marmoset exhibits a doublet, with one band migrating at 60 kDa and the other at 54 kDa (Fig. 2, lane 6, arrows). Because the 60-kDa protein migrates iden- tically to that observed on other cell types of the marmoset, it is likely derived from nongerm cells in the testes. Based on these data, we reasoned that the lower band at 54 kDa is derived from germ cells and contains CCP1. Presumably, this protein would undergo the same N-linked glycan “trimming” (3) to generate the hypoglycosylated form of MCP found on sperm (Fig. 1III, and Fig. 2, lane 2).

N-Linked glycosylation of MCP is similar for marmosets, squirrel monkeys, and humans To further examine the monkey MCP, we digested protein lysates from these tissues with peptide N-glycosidase (PNGase)F, an en-

zyme that removes N-linked sugars. Upon digestion, the Mr of the FIGURE 1. Diagram of MCP structure. The genomic organization is human sperm protein decreases to 41 kDa (Fig. 3, lanes 1 and 2). shown in Fig. 4C. There are three exons in the STP region whose translated This same decrease is observed for the sperm from both the mar- products are referred to as A, B, and C. The C terminus of MCP consists of one of two possible cytoplasmic tails referred to as CYT-1 or CYT-2. moset and the squirrel monkey (Fig. 3, lanes 3Ð4 and 9Ð10). This MCP is expressed as isoforms that arise via alternative splicing of the STP and cytoplasmic tail regions (28, 29). I, Common human isoforms. In humans, the C region is constitutively expressed while the B region is alternatively spliced. Combining the BC or C isoform with either CTY-1 or CYT-2 gives rise to the four typical isoforms (BC1, C1, BC2, and C2) observed in human tissue. The A STP region is rarely observed in humans (22). II, Somatic monkey form. MCP from somatic tissues of New World monkeys lacks CCP1 (15) and, as will be shown, expresses the ABC STP region. III, Sperm-speciﬁc form. Spermatozoa of both humans (3) and New FIGURE 3. Treatment of MCP from selected tissues with PNGase. Pro- World monkeys, as will be shown, express the C2 isoform of MCP with tein samples (ϳ15 ␮g) were incubated with PNGase for 24 h at 37°C trimmed N-linked sugars (3). CR, Complement regulation. MVB, Measles (comparable results with a 1-h digestion). Samples were then Western blot- virus-binding site. ted as described in Fig. 2. ϩ, PNGase-treated samples. The Journal of Immunology 5407 result suggests that the structure of MCP on sperm is similar for both monkeys and humans, implying the presence of CCP1 in monkey sperm MCP. Following PNGase digestion, the upper band of the marmoset testes sample aligns with the blood-derived protein, while the lower band aligns with the sperm band at 41 kDa (Fig. 3, lanes 7Ð8). The upper band protein correlates with the protein expressed on blood cells, while the lower band corresponds to the protein derived from germ cells (3). The faster Mr of MCP on the monkey sperm likely occurs secondary to a “trimming” of the N-linked FIGURE 5. Schematic representation of the acrosome reaction of hu- sugars as the sperm mature and exit the testes (3). This trimming man sperm. The acrosome reaction of capacitated sperm takes place after event has now been described for four other sperm proteins in- the binding to the zona pellucida or can be induced in vitro via the calcium cluding decay-accelerating factor (DAF), a complement regulator ionophore A23187. This reaction consists of the outer acrosomal membrane closely related to MCP (reviewed in Ref. 3). We previously spec- fusing with the plasma membrane, releasing the contents of the acrosome. ulated that this processing of N-linked glycans might be essential MCP is expressed on the IAM and thus is exposed after the acrosome reaction. to an egg-sperm interaction (3), and this idea is further supported PM, Plasma membrane; OAM, outer acrosomal membrane. by the apparent conservation of this process in the marmoset and squirrel monkey.

isoform would fold correctly, as it is lacking two of the cysteines Downloaded from CCP1 is present in mRNA from the testes of the marmoset required for the formation of the disulfide bonds. However, it is Using RNA from marmoset tissues, we next performed RT-PCR interesting to note that exon 4 codes for a part of the measles and sequencing to determine whether the mRNA species were con- virus-binding site (15–19). This isoform may represent a less ef- sistent with our interpretation of the protein data. Three primer sets ficient evolutionary attempt at prohibiting measles virus infection, were used (Fig. 4). The first set annealed in CCPs 2 and 4 (Fig. 4a). because the loss of exon 4 would also diminish complement reg-

As expected, these primers produced a single band for all three ulatory activity (20). http://www.jimmunol.org/ tissues analyzed, and in each case, the sequence was that of CCPs The third primer set anneals to CCP4 and to CYT-2 and was 2–4. The second primer set annealed in the signal peptide and designed to assess which STP and cytoplasmic tail region was CCP4. It was designed to produce different bands, depending on expressed (Fig. 4b). Two bands from the testes were obtained, and the presence or absence of CCP1. In the testes, three distinct bands the sequencing indicated that the lower band represents the C2 of 680, 580, and 500 bp were obtained (Fig. 4a). The sequence of isoform (Figs. 1 and 4). The latter is the same isoform observed on the 500-bp mRNA species, also observed in the liver and lung, human sperm. This result combined with those at the protein level represents the MCP isoform lacking CCP1 (as was predicted from establish that the C2 isoform is also the sperm-specific species of the band size). The 680-bp species is the anticipated size of the MCP in these New World monkeys. isoform containing CCP1, and this was confirmed by sequencing. The upper band produced by these primers is the ABC2 isoform. by guest on September 28, 2021 Therefore, CCP1 of MCP is specifically retained in testicular The major isoform expressed in the liver and the lung is also the mRNA of the marmoset. ABC2 isoform, establishing that MCP bearing all three STP re- The third band at 580 bp was not expected and sequencing es- gions is expressed on tissues of the marmoset (Fig. 1II). This result tablished it as a splice variant possessing CCP1 but lacking the accounts for why the Mr of monkey MCP in somatic tissues was 60 C-terminal half of CCP2 (exon 4) (Fig. 4c). CCP2 is the only CCP kDa, despite lacking CCP1, and is consistent with the Mr values of MCP encoded by two exons. It would migrate ϳ5 kDa faster obtained following digestion with PNGase F (Fig. 3). There is a than the protein containing the whole CCP, and no protein corre- low-level expression of BC and C isoforms in these tissues, based lating with this isoform has been observed. It is unlikely that this on mobility and sequencing of the minor bands in Fig. 4b. Whereas

FIGURE 4. Comparison of MCP mRNA splice variants in marmoset tissues. Using primers located in CCP2 and CCP4 (a), the signal peptide and CCP4 (a), or CCP4 and CYT-2 (b), the mRNA transcripts that code the isoforms of MCP can be distinguished. RNA samples from the indicated tissues were subjected to RT-PCR, and the products were separated in a 3% agarose gel. c, Genomic organization of the MCP gene and location of primers used in a and b. The gene consists of 14 exons and differential splicing of the STP and CYT exons gives rise to the major protein isoforms (Fig. 1). CCP2 is encoded by two exons (28, 29). 5408 CUTTING EDGE: SPLICING AND TISSUE-SPECIFIC EXPRESSION OF CD46

FIGURE 6. Localization of human and marmoset MCP on sperm. Acrosome reaction was induced with the calcium ionophore A23187. The rabbit polyclonal Ab to human MCP was used at a 1/500 dilution and the secondary Ab was a tetramethylrhodamine isothiocyanate-linked sheep anti-rabbit Ab at a 1/50 dilution. Secondary Ab controls were negative in all cases. aÐd, Non-acrosome-reacted (NAR) sperm; eÐh, AR sperm. a, c, e, and g, Fluorescent microscopy; b, d, f, and h, bright-ﬁeld microscopy.

MCP bearing the ABC STP region has been observed in human References tissues, it is rare, with most tissues expressing the BC and C STP 1. Cole, J. L., G. A. Housley, Jr., T. R. Dykman, R. P. MacDermott, and regions (Fig. 1I) (22). In contrast, in these monkeys, it is the major J. P. Atkinson. 1985. Identification of an additional class of C3-binding mem- Downloaded from brane proteins of human peripheral blood leukocytes and cell lines. Proc. Natl. isoform expressed. Acad. Sci. USA 82:859. 2. Hourcade, D., M. K. Liszewski, M. Krych-Goldberg, and J. P. Atkinson. 2000. MCP is expressed on the IAM in the marmoset Functional domains, structural variations and pathogen interactions of MCP, DAF, and CR1. Immunopharmacology 49:103. Human MCP is expressed on the IAM of sperm (Fig. 5). This 3. Riley, R. C., C. Kemper, M. Leung, and J. P. Atkinson. 2002. Characterization of membrane is exposed only after sperm have bound to the zona human membrane cofactor protein (MCP; CD46) on spermatozoa. Mol. Reprod. pellucida of the egg and undergone an exocytosis event referred to Dev. 62:534. http://www.jimmunol.org/ 4. Anderson, D. J., J. S. Michaelson, and P. M. Johnson. 1989. Trophoblast/leuko- as the acrosome reaction. Only AR human sperm stain for MCP cyte-common antigen is expressed by human testicular germ cells and appears on (Fig. 6e). The same pattern was observed for the marmoset sperm the surface of acrosome-reacted sperm. Biol. Reprod. 41:285. (Fig. 6g), indicating expression on the IAM. 5. Fenichel, P., G. Dohr, C. Grivaux, F. Cervoni, M. Donzeau, and B. L. Hsi. 1990. Localization and characterization of the acrosomal antigen recognized by GB24 A unique role for MCP in fertilization has been suspected for on human spermatozoa. Mol. Reprod. Dev. 27:173. several reasons. First, because sperm express MCP solely on the 6. Kitamura, M., K. Matsumiya, M. Yamanaka, S. Takahara, T. Hara, M. Matsumoto, IAM, it cannot protect these germ cells from complement in the M. Namiki, A. Okuyama, and T. Seya. 1997. Possible association of infertility with female reproductive tract until after the acrosome reaction. How- sperm-specific abnormality of CD46. J. Reprod. Immunol. 33:83. 7. Nomura, M., M. Kitamura, K. Matsumiya, A. Tsujimura, A. Okuyama, M. Matsu- ever, sperm express two other complement regulators, DAF and moto, K. Toyoshima, and T. Seya. 2001. Genomic analysis of idiopathic infertile by guest on September 28, 2021 CD59. CD59 expression is limited to the plasma membrane, and patients with sperm-specific depletion of CD46. Exp. Clin. Immunogenet. 18:42. DAF is expressed on both the plasma membrane and the IAM. 8. Anderson, D. J., A. F. Abbott, and R. M. Jack. 1993. The role of complement component C3b and its receptors in sperm-oocyte interaction. Proc. Natl. Acad. (23). Second, the hypoglycosylated form of MCP expressed on Sci. USA 90:10051. human and New World monkey sperm (Fig. 1III) is not observed 9. Taylor, C. T., M. M. Biljan, C. R. Kingsland, and P. M. Johnson. 1994. Inhibition in other tissues and is independent of the inherited polymorphism of human spermatozoon-oocyte interaction in vitro by monoclonal antibodies to CD46 (membrane cofactor protein). Hum. Reprod. 9:907. controlling the splicing of the STP exons. (3, 21). Third, in mice 10. D’Cruz, O. J., H. Lambert, and G. G. Haas, Jr. 1997. Expression of CD15 (24), rats (25), and guinea pigs (26), MCP is prominently ex- (LewisX) antigen on human sperm and its role in sperm-egg interaction. pressed only in the testes. In these species, a different complement Am. J. Reprod. Immunol. 37:172. regulator known as Crry is widely expressed and has complement 11. Naniche, D., G. Varior-Krishnan, F. Cervoni, T. F. Wild, B. Rossi, C. Rabourdin- Combe, and D. Gerlier. 1993. Human membrane cofactor protein (CD46) acts as a regulatory activity similar to that of MCP. This further suggests a cellular receptor for measles virus. J. Virol. 67:6025. pivotal role for MCP on sperm that cannot be fulfilled by simply 12. Dorig, R. E., A. Marcil, A. Chopra, and C. D. Richardson. 1993. The human replacing its complement regulatory activity (27). Fourth, sperm- CD46 molecule is a receptor for measles virus (Edmonston strain). Cell 75:295. 13. Hsu, E. C., F. Sarangi, C. Iorio, M. Sidhu, S., S. A. Udem, D. L. Dillehay, W. Xu, specific abnormalities in MCP have been associated with infertility P. A. Rot, W. J. Bellini, and C. D. Richardson. 1998. A single amino acid change in humans (6, 7). Fifth, Abs to MCP, specifically those to CCP1, in the hemagglutinin protein of measles virus determines its ability to bind CD46 inhibit sperm-egg interactions (4, 8–10). These data, combined and reveals another receptor on marmoset B cells. J. Virol. 72:2905. 14. Santoro, F., P. E. Kennedy, G. Locatelli, M. S. Malnati, E. A. Berger, and with those presented in this report, indicate that MCP likely plays P. Lusso. 1999. CD46 is a cellular receptor for human herpes virus 6. Cell 99: a more direct role in fertilization. They are consistent with MCP 817. being both a complement regulator and a participant in germ cell 15. Hsu, E. C., R. E. Dorig, F. Sarangi, A. Marcil, C. Iorio, and C. D. Richardson. 1997. Artificial mutations and natural variations in the CD46 molecules from interactions. Moreover, these functions map to different regions of human and monkey cells define regions important for measles virus binding. MCP, with CCP1 likely important for reproduction and CCPs 2–4 J. Virol. 71:6144. necessary for complement regulation. Thus, an evolutionarily con- 16. Manchester, M., A. Valsamakis, R. Kaufman, M. K. Liszewski, J. Alvarez, J. P. Atkinson, D. M. Lublin, and M. B. A. Oldstone. 1995. Measles virus and C3 served role for MCP in reproduction is further implied by the male binding sites are distinct on membrane cofactor protein (MCP; CD46). Proc. germ cell-specific retention of CCP1 in New World monkeys. Natl. Acad. Sci. USA 92:2303. 17. Manchester, M., J. E. Gairin, J. Alvarez, M. K. Liszewski, J. P. Atkinson, and M. B. A. Oldstone. 1997. Measles virus recognizes its receptor, CD46, via two Acknowledgments distinct binding domains within SCR1–2. Virology 233:174. We thank Drs. Christian Abee and Larry Fields at the Squirrel Monkey 18. Buchholz, C. J., D. Koller, P. Devaux, C. Mumenthaler, J. Schneider-Schaulies, Breeding and Research Resource at the University of South Alabama for W. Braun, D. Gerlier, and R. Cattaneo. 1997. Mapping of the primary binding site sample procurement and Dr. Thomas Pugh from the University of Wis- of measles virus to its receptor CD46. J. Biol. Chem. 272:22072. consin, Madison, for the use of the fluorescent microscope. Dennis 19. Iwata, K., T. Seya, Y. Yanagi, J. M. Pesando, P. M. Johnson, M. Okabe, S. Ueda, H. Ariga, and S. Nagasawa. 1995. Diversity of sites for measles virus binding and Hourcade and Kathy Liszewski critically reviewed the manuscript, and for inactivation of complement C3b and C4b on membrane cofactor protein Madonna Bogacki provided excellent secretarial support. CD46. J. Biol. Chem. 270:15148. The Journal of Immunology 5409

20. Liszewski, M. K., M. Leung, W. Cui, V. Bala Subramanian, J. Parkinson, 25. Mead, R., S. J. Hinchliffe, and B. P. Morgan. 1999. Molecular cloning, expression P. N. Barlow, M. Manchester, and J. P. Atkinson. 2000. Dissecting sites impor- and characterization of the rat analogue of human membrane cofactor protein tant for complement regulatory activity in membrane cofactor protein (MCP; (MCP/CD46). Immunology 98:137. CD46). J. Biol. Chem. 275:37692. 26. Hosokawa, M., M. Nonaka, N. Okada, and H. Okada. 1996. Molecular cloning of 21. Cervoni, F., T. J. Oglesby, E. M. Adams, C. Milesi-Fluet, M. W. Nickells, guinea pig membrane cofactor protein: preferential expression in testis. J. Im- P. Fenichel, J. P. Atkinson, and B. L. Hsi. 1992. Identiﬁcation and characteriza- munol. 157:4946. tion of membrane cofactor protein (MCP) on human spermatozoa. J. Immunol. 27. Molina, H. 2002. The murine complement regulator Crry: new insights into the 148:1431. immunobiology of complement regulation. Cell. Mol. Life Sci. 59:220. 22. Xing, P.-X., S. Russell, J. Prenzoska, and I. F. C. McKenzie. 1994. Discrimina- tion between alternatively spliced STP-A and -B isoforms of CD46. Immunology 28. Post, T. W., M. K. Liszewski, E. M. Adams, I. Tedja, E. A. Miller, and 83:122. J. P. Atkinson. 1991. Membrane cofactor protein of the complement system: 23. Rooney, I. A., T. J. Oglesby, and J. P. Atkinson. 1993. Complement in human alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails reproduction: activation and control. Immunol. Res. 12:276. produces multiple isoforms which correlate with protein phenotype. J. Exp. Med. 24. Tsujimura, A., K. Shida, M. Kitamura, M. Nomura, J. Takeda, H. Tanaka, 174:93. M. Matsumoto, K. Matsumiya, A. Okuyama, Y. Nishimune, et al. 1998. Molec- 29. Russell, S. M., R. L. Sparrow, I. F. C. McKenzie, and D. F. J. Purcell. 1992. ular cloning of a murine homologue of membrane cofactor protein (CD46): pref- Tissue-speciﬁc and allelic expression of the complement regulator CD46 is con- erential expression in testicular germ cells. Biochem. J. 330:163. trolled by alternative splicing. Eur. J. Immunol. 22:1513. Downloaded from http://www.jimmunol.org/ by guest on September 28, 2021