DOCSLIB.ORG

Biocontrol Traits of Bacillus Licheniformis GL174, a Culturable Endophyte of Vitis Vinifera Cv

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biocontrol Traits of Bacillus Licheniformis GL174, a Culturable Endophyte of Vitis Vinifera Cv Nigris et al. BMC Microbiology (2018) 18:133 https://doi.org/10.1186/s12866-018-1306-5 RESEARCH ARTICLE Open Access Biocontrol traits of Bacillus licheniformis GL174, a culturable endophyte of Vitis vinifera cv. Glera Sebastiano Nigris1, Enrico Baldan2, Alessandra Tondello2, Filippo Zanella2, Nicola Vitulo3, Gabriella Favaro4, Valerio Guidolin2, Nicola Bordin2, Andrea Telatin5, Elisabetta Barizza2, Stefania Marcato2, Michela Zottini2, Andrea Squartini6, Giorgio Valle2 and Barbara Baldan1* Abstract Background: Bacillus licheniformis GL174 is a culturable endophytic strain isolated from Vitis vinifera cultivar Glera, the grapevine mainly cultivated for the Prosecco wine production. This strain was previously demonstrated to possess some specific plant growth promoting traits but its endophytic attitude and its role in biocontrol was only partially explored. In this study, the potential biocontrol action of the strain was investigated in vitro and in vivo and, by genome sequence analyses, putative functions involved in biocontrol and plant-bacteria interaction were assessed. Results: Firstly, to confirm the endophytic behavior of the strain, its ability to colonize grapevine tissues was demonstrated and its biocontrol properties were analyzed. Antagonism test results showed that the strain could reduce and inhibit the mycelium growth of diverse plant pathogens in vitro and in vivo. The strain was demonstrated to produce different molecules of the lipopeptide class; moreover, its genome was sequenced, and analysis of the sequences revealed the presence of many protein-coding genes involved in the biocontrol process, such as transporters, plant-cell lytic enzymes, siderophores and other secondary metabolites. Conclusions: This step-by-step analysis shows that Bacillus licheniformis GL174 may be a good biocontrol agent candidate, and describes some distinguished traits and possible key elements involved in this process. The use of this strain could potentially help grapevine plants to cope with pathogen attacks and reduce the amount of chemicals used in the vineyard. Keywords: Grapevine, Endophytes, Biocontrol bacteria, Bacillus licheniformis, Bacterial genome sequencing Background Endophytes are bacteria that can live inside plant tissues Biological control is an increasingly successful and wide- and colonize their hosts without causing any signs of spread strategy [1] to decrease plant pathogens and the plant disease. They penetrate plants mainly from the soil negative effects of agricultural practices on the environ- and roots and spread into leaves, flowers and fruits ment. It uses beneficial microorganisms, either bacteria through the vascular plant system [3, 4]. These bacteria or fungi, that can counteract plant pathogens and limit spend part of (facultative endophytes) or all (obligate en- the use of chemicals in agriculture [2]. Among these di- dophytes) their life-cycle inside plants, exploiting this verse beneficial microorganisms, bacterial endophytes strategic interaction to their advantage [3, 5]. They may are powerful tools to protect plants from phytopatho- both promote the growth of plants and protect them gens due to their ability to enter and colonize plants. against harmful bacteria and fungi. Endophytes can en- hance plant-growth rate and biomass production largely through phytohormone synthesis, nitrogen fixation, * Correspondence: [email protected] 1Botanical Garden and Department of Biology, University of Padova, Padova, phosphate solubilization and ammonium ion production. Italy They protect hosts as biocontrol agents by interacting Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Nigris et al. BMC Microbiology (2018) 18:133 Page 2 of 16 directly with pathogens and producing many antimicro- stems and leaves, showing how GFP-tagged strains may bial molecules, and/or by competing for nutrients inside be used even to check grapevine colonization [12]. the colonized tissues [3, 6]. Biocontrol bacteria also act An important characteristic of endophytes is to secrete indirectly, eliciting Induced Systemic Resistance (ISR) in into the environment lytic enzymes that degrade many their plant hosts: a plethora of metabolites produced by biological polymers. Such enzymes, in particular endophytes activates plant defense priming responses cellulose-lytic enzymes, favor the entrance of endophytes against pathogens [7]. into plant tissues and the formation of stable colonies, giv- Many endophyte taxa produce lipopeptides (LPs) - mole- ing clear competitive advantage to bacteria with this ability cules that play a crucial role in biocontrol acting directly as [18]. Before evaluating biocontrol effects, and to develop antimicrobial/antifungal compounds and as ISR elicitors in bacteria inocula for agriculture, it is essential to show if plant hosts. These amphiphilic compounds are formed by a and how a particular strain colonizes inner plant tissues. short cyclic oligopeptide linked to a lipid tail [8]. The most In this work, the culturable strain GL174, previously iso- widely studied LPs belong to the surfactin, iturin and fengy- lated from Vitis vinifera cv. Glera [19] was investigated to cin families, according to their chemical structure. Surfac- identify both its endophytic ability and some of its biocon- tins are heptapeptides interlinked with a β-hydroxy fatty trol traits. GL174 was selected from a collection of puta- acid to form a cyclic lactone ring; due to their strong bio- tive grapevine endophytes for its plant-growth promotion surfactant activity, these molecules can readily associate abilities. Moreover, GL174 can produce ammonia and the and anchor themselves to the double layer of phospholipids plant hormone indole-3-acetic acid, and causes morpho- interfering with membrane integrity. Iturins are heptapep- logical changes to the plant roots when co-cultured with tides bound to a β-amino fatty acid chain 14–17 carbons Arabidopsis thaliana [20]. The strain was identified as Ba- long. Fengycins are lipodecapeptides with an internal lac- cillus licheniformis GL174 and its endophytic attitude was toneringinthepeptidicmoietyandaβ-hydroxy fatty acid validated by plating surface-sterilized inoculated cuttings. chain (C14-C18) that may be saturated or unsaturated [9]. Then, using confocal microscopy, we localized the These molecules, according to their chemical characteris- GFP-tagged strain within plant tissues of inoculated tics, fight bacteria, fungi, mycoplasmas and viruses. Due to grapevine Glera cuttings. Visualization of tagged bacteria their strong surfactant power, LPs enable and favor plant inside plant structures allowed us to identify the examined colonization by the producer strain hindering pathogenic strain as a true endophyte of the plants, and provided a re- tissue infection. Bacteria synthesize these families of lipo- liable protocol for cutting inoculation for further biocon- peptides in a non-ribosomal way through large enzymatic trol experiments. As the plant growth-promoting (PGP) complexes, namely, lipopeptide synthetases. These abilities of strain GL174 had already been demonstrated mega-enzymes are organized in iterative modules that [20], we focused on its potential biocontrol activity and catalyze reactions for lipopeptide production. antifungal properties. We reported both antifungal activity Visualization of bacteria inside plants is always diffi- against some grapevine fungal pathogens by an in vitro cult as plant tissues are complex and autofluorescent. bioassay and in vivo on grapevine leaves. Furthermore, we Recently, molecular techniques employing fluorescent reported an effective production of LPs, detected by mass probes that detect bacteria via hybridization have been spectrometric analyses and we also sequenced the entire used to localize and estimate microorganisms within genome. The results of this multidisciplinary approach en- plant organs [4, 10]. Inoculation with strains tagged with abled us to assess the complex pattern of biocontrol traits green fluorescent protein (GFP) and glucuronidase gene displayed by Bacillus licheniformis GL174. markers has enabled scientists to observe live bacteria inside tissues, which is particularly useful when follow- Methods ing bacterial colonization patterns and estimating endo- Bacterial strain and growth conditions phytic populations [11–13]. GFP-tagged bacteria are ThestrainGL174waspreviouslyisolatedfrom handy tools to examine endophyte–plant interactions surface-sterilized tissues of Vitis vinifera cv. Glera and iden- [14], as GFP does not require any substrate or cofactor tified as Bacillus licheniformis [19]. This strain was culti- to fluoresce. GFP cassettes for chromosomal integration vated routinely in Nutrient Broth (NB) or Nutrient Agar and expression of the reporter gene in many bacterial (NA) at 28 °C. species have been developed [15–17]. The transform- ation of bacteria with plasmids harboring
Load more

Recommended publications
  • Interplay Between Ompa and Rpon Regulates Flagellar Synthesis in Stenotrophomonas Maltophilia
    microorganisms Article Interplay between OmpA and RpoN Regulates Flagellar Synthesis in Stenotrophomonas maltophilia Chun-Hsing Liao 1,2,†, Chia-Lun Chang 3,†, Hsin-Hui Huang 3, Yi-Tsung Lin 2,4, Li-Hua Li 5,6 and Tsuey-Ching Yang 3,* 1 Division of Infectious Disease, Far Eastern Memorial Hospital, New Taipei City 220, Taiwan; [email protected] 2 Department of Medicine, National Yang Ming Chiao Tung University, Taipei 112, Taiwan; [email protected] 3 Department of Biotechnology and Laboratory Science in Medicine, National Yang Ming Chiao Tung University, Taipei 112, Taiwan; [email protected] (C.-L.C.); [email protected] (H.-H.H.) 4 Division of Infectious Diseases, Department of Medicine, Taipei Veterans General Hospital, Taipei 112, Taiwan 5 Department of Pathology and Laboratory Medicine, Taipei Veterans General Hosiptal, Taipei 112, Taiwan; [email protected] 6 Ph.D. Program in Medical Biotechnology, Taipei Medical University, Taipei 110, Taiwan * Correspondence: [email protected] † Liao, C.-H. and Chang, C.-L. contributed equally to this work. Abstract: OmpA, which encodes outer membrane protein A (OmpA), is the most abundant transcript in Stenotrophomonas maltophilia based on transcriptome analyses. The functions of OmpA, including adhesion, biofilm formation, drug resistance, and immune response targets, have been reported in some microorganisms, but few functions are known in S. maltophilia. This study aimed to elucidate the relationship between OmpA and swimming motility in S. maltophilia. KJDOmpA, an ompA mutant, Citation: Liao, C.-H.; Chang, C.-L.; displayed compromised swimming and failure of conjugation-mediated plasmid transportation. The Huang, H.-H.; Lin, Y.-T.; Li, L.-H.; hierarchical organization of flagella synthesis genes in S.
    [Show full text]
  • Basys: a Web Server for Automated Bacterial Genome Annotation Gary H
    Nucleic Acids Research, 2005, Vol. 33, Web Server issue W455–W459 doi:10.1093/nar/gki593 BASys: a web server for automated bacterial genome annotation Gary H. Van Domselaar, Paul Stothard, Savita Shrivastava, Joseph A. Cruz, AnChi Guo, Xiaoli Dong, Paul Lu, Duane Szafron, Russ Greiner and David S. Wishart* Departments of Biological Sciences and Computing Science, University of Alberta, Edmonton, AB, T6G 2E8, Canada Received February 13, 2005; Revised April 14, 2005; Accepted May 6, 2005 ABSTRACT life; to develop novel vaccines, to discover new antimicrobial compounds or therapeutics; and to develop effective strategies Downloaded from BASys (Bacterial Annotation System) is a web for re-engineering bacteria for such applications as biore- server that supports automated, in-depth annotation mediation. However, distilling useful knowledge from the of bacterial genomic (chromosomal and plasmid) enormous volume of data is a growing challenge for both sequences. It accepts raw DNA sequence data and bioinformaticians and microbiologists alike. To assist with an optional list of gene identification information the interpretation of genomic data, a number of automated http://nar.oxfordjournals.org/ and provides extensive textual annotation and hyper- genome annotation tools have been created, including Gene- linked image output. BASys uses .30 programs to Quiz (1), PEDANT (2), Genotator (3), MAGPIE/BLUEJAY determine 60 annotation subfields for each gene, (4,5), GenDB (6) and the TIGR CMR (7). In order for these including gene/protein name, GO function, COG func- systems to perform at a high level of quality and throughput, tion, possible paralogues and orthologues, molecular these annotation systems are quite sophisticated that require a high degree of skill to implement and maintain, and also weight, isoelectric point, operon structure, sub- require considerable computing power to operate.
    [Show full text]
  • Xanthomonas Fuscans Subsp
    Darrasse et al. BMC Genomics 2013, 14:761 http://www.biomedcentral.com/1471-2164/14/761 RESEARCH ARTICLE Open Access Genome sequence of Xanthomonas fuscans subsp. fuscans strain 4834-R reveals that flagellar motility is not a general feature of xanthomonads Armelle Darrasse1,2,3, Sébastien Carrère4,5, Valérie Barbe6, Tristan Boureau1,2,3, Mario L Arrieta-Ortiz7,14, Sophie Bonneau1,2,3, Martial Briand1,2,3, Chrystelle Brin1,2,3, Stéphane Cociancich8, Karine Durand1,2,3, Stéphanie Fouteau6, Lionel Gagnevin9,10, Fabien Guérin9,10, Endrick Guy4,5, Arnaud Indiana1,2,3, Ralf Koebnik11, Emmanuelle Lauber4,5, Alejandra Munoz7, Laurent D Noël4,5, Isabelle Pieretti8, Stéphane Poussier1,2,3,10, Olivier Pruvost9,10, Isabelle Robène-Soustrade9,10, Philippe Rott8, Monique Royer8, Laurana Serres-Giardi1,2,3, Boris Szurek11, Marie-Anne van Sluys12, Valérie Verdier11, Christian Vernière9,10, Matthieu Arlat4,5,13, Charles Manceau1,2,3,15 and Marie-Agnès Jacques1,2,3* Abstract Background: Xanthomonads are plant-associated bacteria responsible for diseases on economically important crops. Xanthomonas fuscans subsp. fuscans (Xff) is one of the causal agents of common bacterial blight of bean. In this study, the complete genome sequence of strain Xff 4834-R was determined and compared to other Xanthomonas genome sequences. Results: Comparative genomics analyses revealed core characteristics shared between Xff 4834-R and other xanthomonads including chemotaxis elements, two-component systems, TonB-dependent transporters, secretion systems (from T1SS to T6SS) and multiple effectors. For instance a repertoire of 29 Type 3 Effectors (T3Es) with two Transcription Activator-Like Effectors was predicted. Mobile elements were associated with major modifications in the genome structure and gene content in comparison to other Xanthomonas genomes.
    [Show full text]
  • In Situ Structures of Periplasmic Flagella Reveal a Distinct Cytoplasmic Atpase Complex in Borrelia Burgdorferi
    bioRxiv preprint doi: https://doi.org/10.1101/303222; this version posted April 17, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 In situ structures of periplasmic flagella reveal a distinct cytoplasmic ATPase complex in Borrelia 2 burgdorferi 3 4 Zhuan Qin1, 2*, Akarsh Manne3*, Jiagang Tu2*, Zhou Yu3, Kathryn Lees3, Aaron Yerke3, Tao Lin2, 5 Chunhao Li4, Steven J. Norris2, Md A. Motaleb3#, Jun Liu1, 2# 6 7 1 Department of Microbial Pathogenesis & Microbial Sciences Institute, Yale University, New 8 Haven, CT 06519 9 2 Department of Pathology and Laboratory Medicine, McGovern Medical School, Houston, TX 10 77030. 11 3 Department of Microbiology and Immunology, Brody School of Medicine, East Carolina 12 University, Greenville, NC 27834 13 4 Philips Research Institute, School of Dental Medicine, Virginia Commonwealth University, 14 Richmond, VA 23298 15 16 17 * Z. Q., A.M., and J.T. contributed equally to this work. 18 19 # Corresponding authors: 20 [email protected] (J. L.); 21 [email protected] (M.A.M.) 22 23 24 Running title: Novel ATPase complex structure in periplasmic flagella 25 26 1 bioRxiv preprint doi: https://doi.org/10.1101/303222; this version posted April 17, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
    [Show full text]
  • The Nonequilibrium Mechanism for Ultrasensitivity in a Biological Switch: Sensing by Maxwell’S Demons
    The nonequilibrium mechanism for ultrasensitivity in a biological switch: Sensing by Maxwell’s demons Yuhai Tu* T. J. Watson Research Center, IBM, P. O. Box 218, Yorktown Heights, NY 10598 Communicated by Charles H. Bennett, IBM Thomas J. Watson Research Center, Yorktown Heights, NY, May 20, 2008 (received for review December 19, 2007) The Escherichia coli flagellar motor senses the intracellular concen- focusing on understanding the mechanism for E. coli flagellar tration of the response regulator CheY-P and responds by varying motor’s ultrasensitive response to CheY-P. Our choice of this the bias between its counterclockwise (CCW) and clockwise (CW) particular system is motivated by the recent experimental mea- rotational states. The response is ultrasensitive with a large Hill surements of detailed single motor switching statistics (13). coefficient (Ϸ10). Recently, the detailed distribution functions of the CW and the CCW dwell times have been measured for different Results CW biases. Based on a general result on the properties of the Nonexponential Dwell-Time Statistics and the Breakdown of Detailed dwell-time statistics for all equilibrium models, we show that the Balance. The observable state of the flagellar motor is repre- observed dwell-time statistics imply that the flagellar motor switch sented by a binary variable s: s ϭ 0, 1 corresponds to the CW and operates out of equilibrium, with energy dissipation. We propose CCW rotational states of the motor. The internal state of the a dissipative allosteric model that generates dwell-time statistics switch is described by an integer variable n: n ϭ 0,1,2,...,N consistent with the experimental results.
    [Show full text]
  • SUPPLEMENTARY INFORMATION Sequence Analysis of Hypothetical Proteins from Helicobacter Pylori 26695 to Identify Potential Virule
    SUPPLEMENTARY INFORMATION Sequence Analysis of Hypothetical Proteins from Helicobacter pylori 26695 to Identify Potential Virulence Factors Ahmad Abu Turab Naqvi1§, Farah Anjum2§, Faez Iqbal Khan3, Asimul Islam1, Faizan Ahmad1, Md. Imtaiyaz Hassan1* 1Center for Interdisciplinary Research in Basic Sciences, Jamia Millia Islamia, Jamia Nagar, New Delhi 110025, India, 2Female College of Applied Medical Science, Taif University, Al-Taif 21974, Kingdom of Saudi Arabia, 3School of Chemistry and Chemical Engineering, Henan University of Technology, Henan 450001, China http://www.genominfo.org/src/sm/gni-14-125-s001.pdf. Supplementary Table 4. List of annotated function of 340 hypothetical proteins (HPs) from Helicobacter pylori using BLASTp, STRING, SMART, InterProScan and Motif Motif found Predicted functional partner No. UniProt ID Major BLAST hit SMART (STRING) InterProScan Motif 1 O24859 Valyl-tRNA synthetase DNA primase No result No result Protein similar to CwfJ C-terminus 1 2 O24860 TrbC/VIRB2 family VirB4 homolog TrbC/VIRB2 family Conjugal transfer TrbC/VIRB2 family protein TrbC/type IV secretion VirB2 (pfam) 3 O24861 ComB3 competence VirB4 homolog Transmembrane region Membrane-bound protein Photosystem I psaA/psaB protein protein Predicted membrane protein 4 O24863 No result Lipoprotein signal peptidase No result Prokaryotic membrane Prokaryotic membrane lipoprotein lipid lipoprotein lipid attachment site profile attachment site profile 5 O24869 No result No result No result No result No result 6 O24871 No result Isocitrate dehydrogenase
    [Show full text]
  • Genomic Insights from Monoglobus Pectinilyticus: a Pectin-Degrading Specialist Bacterium in the Human Colon
    The ISME Journal (2019) 13:1437–1456 https://doi.org/10.1038/s41396-019-0363-6 ARTICLE Genomic insights from Monoglobus pectinilyticus: a pectin-degrading specialist bacterium in the human colon 1,2 1,3 4 2 2 5 Caroline C. Kim ● Genelle R. Healey ● William J. Kelly ● Mark L. Patchett ● Zoe Jordens ● Gerald W. Tannock ● 6 6 1 7,8,9 1 Ian M. Sims ● Tracey J. Bell ● Duncan Hedderley ● Bernard Henrissat ● Douglas I. Rosendale Received: 19 April 2018 / Revised: 7 January 2019 / Accepted: 19 January 2019 / Published online: 6 February 2019 © International Society for Microbial Ecology 2019 Abstract Pectin is abundant in modern day diets, as it comprises the middle lamellae and one-third of the dry carbohydrate weight of fruit and vegetable cell walls. Currently there is no specialized model organism for studying pectin fermentation in the human colon, as our collective understanding is informed by versatile glycan-degrading bacteria rather than by specialist pectin degraders. Here we show that the genome of Monoglobus pectinilyticus possesses a highly specialized glycobiome for pectin degradation, unique amongst Firmicutes known to be in the human gut. Its genome encodes a simple set of metabolic pathways relevant to pectin sugar utilization, and its predicted glycobiome comprises an unusual distribution of carbohydrate- 1234567890();,: 1234567890();,: active enzymes (CAZymes) with numerous extracellular methyl/acetyl esterases and pectate lyases. We predict the M. pectinilyticus degradative process is facilitated by cell-surface S-layer homology (SLH) domain-containing proteins, which proteomics analysis shows are differentially expressed in response to pectin. Some of these abundant cell surface proteins of M.
    [Show full text]
  • Basys: a Web Server for Automated Bacterial Genome Annotation Gary Van Domselaar†, Paul Stothard, Savita Shrivastava, Joseph A
    BASys: A Web Server for Automated Bacterial Genome Annotation Gary Van Domselaar†, Paul Stothard, Savita Shrivastava, Joseph A. Cruz, AnChi Guo, Xiaoli Dong, Paul Lu, Duane Szafron, Russ Greiner, and David S. Wishart‡ Departments of Computing Science and Biological Sciences University of Alberta Edmonton AB T6E 2E9 †[email protected] ‡[email protected] Abstract Head Node Annotation Reports BASys uses CGView [3] to generate BASys (Bacterial Annotation System) is a web server that clickable genome maps for navigating supports automated, in- depth annotation of bacterial the genome data. An HTML- formatted tabular summary is also provided. The genomic (chromosomal, plasmid, and contig) sequences. Genomic Annotation genome maps are prerendered as a It accepts raw DNA sequence data and an optional list of Sequence Data Reports series of hyperlinked PNG image files. gene identification information and provides extensive Each gene label is hyperlinked to its textual and hyperlinked image output. BASys uses more corresponding HTML- formatted “gene card”. The card is hyperlinked where than 30 programs to determine nearly 60 annotation applicable to external references. Text- subfields for each gene, including gene/ protein name, only gene cards are also provided. BASys GO function, COG function, possible paralogues and also supplies an 'evidence card' (Optional) Data Scheduling describing how each annotation was orthologues, molecular weight, isoelectric point, operon generated. The gene cards, evidence Gene BASys is implemented as a distributed structure, subcellular localization, signal peptides, Identification cards, and graphical genome maps are system. The head node monitors and downloadable for offline viewing. transmembrane regions, secondary structure, 3- D Data manages the job scheduling.
    [Show full text]
  • Genome Annotation
    Genome Annotation! Bioinformatics 301! David Wishart! [email protected]! Notes at: http://wishartlab.com! Objectives*! • To demonstrate the growing importance of gene and genome annotation in biology and the role bioinformatics plays! • To make students aware of new trends in gene and genome annotation (i.e. “deep” annotation)! • To make students aware of the methods, algorithms and tools used for gene and genome annotation! Genome Sequence! >P12345 Yeast chromosome1! GATTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGATTACAGAT! TACAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATTAC! AGATTACAGATTACAGATTACAGATTACAGATTACA! GATTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGATTACAGAT! Predict Genes! The Result…! >P12346 Sequence 1! ATGTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGAT! ! >P12347 Sequence 2! ATGAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATT! ! >P12348 Sequence 3! ATGTTACAGATTACAGATTACAGATTACAGATTACA! GATTACAGATTACAGATTACAGATTACA...! ! Is This Annotated?! >P12346 Sequence 1! ATGTACAGATTACAGATTACAGATTACAGATTACAG! ATTACAGATTACAGATTACAGATTACAGATTACAGA! TTACAGATTACAGATTACAGATTACAGAT! ! >P12347 Sequence 2! ATGAGATTAGAGATTACAGATTACAGATTACAGATT! ACAGATTACAGATTACAGATTACAGATTACAGATTA! CAGATTACAGATTACAGATTACAGATTACAGATT! ! >P12348 Sequence 3! ATGTTACAGATTACAGATTACAGATTACAGATTACA!
    [Show full text]
  • Shape Dependent Physical Mutilation and Lethal Effects of Silver
    www.nature.com/scientificreports OPEN Shape dependent physical mutilation and lethal efects of silver nanoparticles on bacteria Received: 1 February 2017 Debashish Acharya1, K. Malabika Singha2, Piyush Pandey2, Bidhan Mohanta1, Jina Rajkumari2 Accepted: 14 December 2017 & L. Paikhomba Singha2 Published: xx xx xxxx In this report, spherical silver nanoparticle (AgNP-sp) and rod-shaped silver nanoparticle (AgNR) were prepared by chemical reduction method and their antibacterial activity against various Gram-positive and Gram-negative bacteria had been evaluated for their efciency. Minimal inhibitory concentration (MIC) tests were conducted to study the antibacterial properties, and substantiated with killing kinetics of silver nanoparticles (AgNPs). The study revealed that both AgNP-sp and AgNRs are good antibacterial candidates. Bacterial sensitivity to nanoparticles (NPs) was found to vary depending on microbial species. Disc difusion studies revealed the greater efectiveness of AgNP-sp and AgNR against Klebsiella pneumoniae AWD5 at the doses of 249 and 392 µg. The dose dependent activities of prepared NPs were also observed on the batch studies of disc difusion and MIC with various strains. The optical and morphological structures of NPs were analyzed by UV-visible, XRD, FE-SEM and TEM. Further, FESEM of bacterial culture treated with AgNPs confrmed antibacterial activity of NPs by showing rupture of bacterial cell wall. Also, the genome of test organism was found to have CusCFBA and CusRS operons. The killing kinetics confrmed that the death rate of K. pneumoniae was higher against AgNP-sp as compared to AgNR. Te metal nanoparticles such as silver, gold are becoming indispensable in various felds because of their vast applications against various diseases and environmental applications.
    [Show full text]
  • Bacterial Flagellar Filament: a Supramolecular Multifunctional Nanostructure
    International Journal of Molecular Sciences Review Bacterial Flagellar Filament: A Supramolecular Multifunctional Nanostructure Marko Nedeljkovi´c,Diego Emiliano Sastre and Eric John Sundberg * Department of Biochemistry, Emory University School of Medicine, Atlanta, GA 30322, USA; [email protected] (M.N.); [email protected] (D.E.S.) * Correspondence: [email protected] Abstract: The bacterial flagellum is a complex and dynamic nanomachine that propels bacteria through liquids. It consists of a basal body, a hook, and a long filament. The flagellar filament is composed of thousands of copies of the protein flagellin (FliC) arranged helically and ending with a filament cap composed of an oligomer of the protein FliD. The overall structure of the filament core is preserved across bacterial species, while the outer domains exhibit high variability, and in some cases are even completely absent. Flagellar assembly is a complex and energetically costly process triggered by environmental stimuli and, accordingly, highly regulated on transcriptional, translational and post-translational levels. Apart from its role in locomotion, the filament is critically important in several other aspects of bacterial survival, reproduction and pathogenicity, such as adhesion to surfaces, secretion of virulence factors and formation of biofilms. Additionally, due to its ability to provoke potent immune responses, flagellins have a role as adjuvants in vaccine development. In this review, we summarize the latest knowledge on the structure of flagellins, capping proteins and filaments, as well as their regulation and role during the colonization and infection of the host. Citation: Nedeljkovi´c,M.; Sastre, D.E.; Sundberg, E.J. Bacterial Flagellar Keywords: bacterial flagella; flagellin; filament; FliD Filament: A Supramolecular Multifunctional Nanostructure.
    [Show full text]
  • Functional Dynamics of the Bacterial Flagellar Motor Driven by Fluorescent Protein Tagged Stators and by Evolutionary Modified Foreign Stators Minyoung Heo
    Functional dynamics of the bacterial flagellar motor driven by fluorescent protein tagged stators and by evolutionary modified foreign stators Minyoung Heo To cite this version: Minyoung Heo. Functional dynamics of the bacterial flagellar motor driven by fluorescent protein tagged stators and by evolutionary modified foreign stators. Molecular biology. Université Montpellier, 2016. English. NNT : 2016MONTT080. tel-01972611 HAL Id: tel-01972611 https://tel.archives-ouvertes.fr/tel-01972611 Submitted on 7 Jan 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Délivré par l’Université de Montpellier Préparée au sein de l’école doctorale Sciences Chimiques et Biologiques pour la Santé (ED168) Et de l’unité de recherche Centre de Biochimie Structurale (CBS) - CNRS UMR 5048 Spécialité : Biophysique de la molécule unique, la microscopie à fluorescence et évolution expérimentale Présentée par Minyoung HEO Dynamique fonctionnelle du moteur flagellaire bactérien entraîné par des stators marqués par des protéines fluorescentes et par des stators étrangers modifiés par évolution Soutenue le 25 Novembre 2016 devant le jury composé de M. Francesco PEDACI, Directeur de recherche, Directeur de thèse Centre de biochimie Structurale (CNRS INSERM) M. Emmanuel MARGEAT, Directeur de recherche, Directeur de thèse Centre de biochimie Structurale (CNRS INSERM) M.
    [Show full text]