DOCSLIB.ORG

Identification and Functional Characterization of Candidate Genes in Recurrently Gained Genomic Regions of Mantle Cell Lymphoma and Chronic Lymphocytic Leukemia

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Functional Characterization of Candidate Genes in Recurrently Gained Genomic Regions of Mantle Cell Lymphoma and Chronic Lymphocytic Leukemia DISSERTATION submitted to the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany for the degree of Doctor of Natural Sciences Identification and functional characterization of candidate genes in recurrently gained genomic regions of mantle cell lymphoma and chronic lymphocytic leukemia presented by Diplom-Biologin Alexandra Farfsing born in Iserlohn Heidelberg 2009 Accepted by the Combined Faculties for the Natural Sciences and for Mathematics of the Ruperto-Carola University of Heidelberg, Germany: May 12, 2009 Referees: Prof. Dr. Werner Buselmaier Prof. Dr. Peter Lichter Day of the oral examination: July 02, 2009 The investigations of the following dissertation were performed from February 2006 till January 2009 under the supervision of Prof. Dr. Peter Lichter and Dr. Armin Pscherer in the division of molecular genetics at the German Cancer Research Center (DKFZ), Heidelberg, Germany. Publication Farfsing A, Engel F, Seiffert M, Hartmann E, Ott G, Rosenwald A, Stilgenbauer S, Döhner H, Boutros M, Lichter P, Pscherer A Gene knockdown studies identified CCDC50 as candidate gene in mantle cell lymphoma and chronic lymphocytic leukemia In preparation. Declarations I hereby declare that I have written the submitted dissertation ‘Identification and functional characterization of candidate genes in recurrently gained genomic regions of mantle cell lymphoma and chronic lymphocytic leukemia’ myself and in this process have used no other sources or materials than those expressly indicated. I hereby declare that I have not applied to be examined at any other institution, nor have I used the dissertation in this or any other form at any other institution as an examination paper, nor submitted it to any other faculty as a dissertation. _____________________________ _____________________________ (Place, Date) Alexandra Farfsing To Jan & my family Contents Contents Abbreviations ................................................................................................................................................. iii Summary.......................................................................................................................................................... v Zusammenfassung .......................................................................................................................................... vi 1 Introduction ............................................................................................................................................ 1 1.1 Cancer ............................................................................................................................................ 1 1.1.1 The hallmarks of cancer ................................................................................................... 1 1.1.2 Oncogenes ....................................................................................................................... 2 1.1.3 Tumor suppressor genes .................................................................................................. 3 1.2 Leukemia ....................................................................................................................................... 4 1.2.1 Acute Leukemia ................................................................................................................ 4 1.2.2 Chronic Leukemia ............................................................................................................. 4 1.3 B-cell neoplasms ............................................................................................................................ 5 1.3.1 B-cell development .......................................................................................................... 6 1.3.2 The cellular origin of human B-cell lymphomas ............................................................... 8 1.4 Mantle cell lymphoma ................................................................................................................... 9 1.4.1 Oncogenic mechanisms in MCL ....................................................................................... 9 1.4.2 Secondary genetic alterations ........................................................................................ 10 1.5 B-cell chronic lymphocytic leukemia ........................................................................................... 11 1.5.1 Oncogenic mechanisms in CLL ....................................................................................... 11 1.5.2 Secondary genetic alterations ........................................................................................ 12 1.6 Recurrent genomic patterns in MCL and CLL .............................................................................. 12 1.6.1 Chromosomal gain of region 3q25-q29 ......................................................................... 13 1.6.2 Chromosomal gain of region 12q13-q14 ....................................................................... 13 1.6.3 Chromosomal gain of region 18q21-q22 ....................................................................... 14 1.7 Recombinase Mediated Cassette Exchange ................................................................................ 14 1.8 Cellular model systems ................................................................................................................ 15 1.9 RNA interference ......................................................................................................................... 16 1.9.1 Mechanisms of RNAi ...................................................................................................... 16 1.9.2 Loss-of-function screen .................................................................................................. 17 1.10 Aim of the work ........................................................................................................................... 19 2 Material and Methods .......................................................................................................................... 21 2.1 Material ....................................................................................................................................... 21 2.1.1 Chemicals and biochemicals .......................................................................................... 21 2.1.2 Enzymes ......................................................................................................................... 22 2.1.3 Kits.................................................................................................................................. 23 2.1.4 Other materials .............................................................................................................. 23 2.1.5 Solutions ........................................................................................................................ 24 2.1.6 siRNA sequences ............................................................................................................ 27 2.1.7 Vectors ........................................................................................................................... 28 2.1.8 Primers ........................................................................................................................... 28 2.1.9 Antibodies ...................................................................................................................... 29 2.1.10 Cell culture ..................................................................................................................... 30 2.1.11 Tumor samples ............................................................................................................... 31 2.1.12 Instruments .................................................................................................................... 33 2.1.13 Software ......................................................................................................................... 34 2.2 Methods ...................................................................................................................................... 35 2.2.1 Cell culture ..................................................................................................................... 35 2.2.2 Transfection methods .................................................................................................... 36 2.2.3 Molecular biological standard methods ........................................................................ 37 2.2.4 Expression arrays ........................................................................................................... 42 2.2.5 Southern blot analysis .................................................................................................... 43 i Contents 2.2.6 Western blot analysis ..................................................................................................... 45 2.2.7 Fluorescence in situ hybridization .................................................................................. 46 2.2.8 Functional assays ........................................................................................................... 48 3 Results .................................................................................................................................................. 51 3.1 Transfection of suspension cells .................................................................................................
Load more

Recommended publications
  • Protein-Coding Variants Implicate Novel Genes Related to Lipid Homeostasis
    bioRxiv preprint doi: https://doi.org/10.1101/352674; this version posted June 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 PROTEIN-CODING VARIANTS IMPLICATE NOVEL GENES RELATED TO LIPID HOMEOSTASIS 2 CONTRIBUTING TO BODY FAT DISTRIBUTION 3 Anne E Justice¥,1,2, Tugce Karaderi¥,3,4, Heather M Highland¥,1,5, Kristin L Young¥,1, Mariaelisa Graff¥,1, 4 Yingchang Lu¥,6,7,8, Valérie Turcot9, Paul L Auer10, Rebecca S Fine11,12,13, Xiuqing Guo14, Claudia 5 Schurmann7,8, Adelheid Lempradl15, Eirini Marouli16, Anubha Mahajan3, Thomas W Winkler17, Adam E 6 Locke18,19, Carolina Medina-Gomez20,21, Tõnu Esko11,13,22, Sailaja Vedantam11,12,13, Ayush Giri23, Ken Sin 7 Lo9, Tamuno Alfred7, Poorva Mudgal24, Maggie CY Ng24,25, Nancy L Heard-Costa26,27, Mary F Feitosa28, 8 Alisa K Manning11,29,30 , Sara M Willems31, Suthesh Sivapalaratnam30,32,33, Goncalo Abecasis18, Dewan S 9 Alam34, Matthew Allison35, Philippe Amouyel36,37,38, Zorayr Arzumanyan14, Beverley Balkau39, Lisa 10 Bastarache40, Sven Bergmann41,42, Lawrence F Bielak43, Matthias Blüher44,45, Michael Boehnke18, Heiner 11 Boeing46, Eric Boerwinkle47,48, Carsten A Böger49, Jette Bork-Jensen50, Erwin P Bottinger7, Donald W 12 Bowden24,25,51, Ivan Brandslund52,53, Linda Broer21, Amber A Burt54, Adam S Butterworth55,56, Mark J 13 Caulfield16,57, Giancarlo Cesana58, John C Chambers59,60,61,62,63, Daniel I Chasman11,64,65,66, Yii-Der Ida 14 Chen14, Rajiv Chowdhury55, Cramer Christensen67,
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • Goat Anti-Ymer / CCDC50 Antibody Size: 100Μg Specific Antibody in 200Μl
    EB06551 - Goat Anti-Ymer / CCDC50 Antibody Size: 100µg specific antibody in 200µl Target Protein Principal Names: Ymer protein, coiled-coil domain containing 50, C3orf6, YMER, C3orf6, chromosome 3 open reading frame 6 UK Office Official Symbol: CCDC50 Accession Number(s): NP_848018.1; NP_777568.1 Everest Biotech Ltd Human GeneID(s): 152137 Cherwell Innovation Centre Important Comments: This antibody is expected to recognise both reported isoforms of 77 Heyford Park human Ymer protein. Upper Heyford Oxfordshire Immunogen OX25 5HD Peptide with sequence CFSKSESSHKGFHYK, from the internal region of the protein UK sequence according to NP_848018.1; NP_777568.1. Enquiries: Please note the peptide is available for sale. [email protected] Sales: Purification and Storage [email protected] Purified from goat serum by ammonium sulphate precipitation followed by antigen affinity Tech support: chromatography using the immunizing peptide. [email protected] Supplied at 0.5 mg/ml in Tris saline, 0.02% sodium azide, pH7.3 with 0.5% bovine serum albumin. Tel: +44 (0)1869 238326 Aliquot and store at -20°C. Minimize freezing and thawing. Fax: +44 (0)1869 238327 Applications Tested US Office Peptide ELISA: antibody detection limit dilution 1:32000. Everest Biotech c/o Abcore Western blot: Preliminary experiments gave an approx 18kDa band in Human Brain 405 Maple Street, Suite A106 lysates after 1µg/ml antibody staining. Please note that currently we cannot find an Ramona, explanation in the literature for the band we observe given the calculated size of 56.3kDa CA 92065 according to NP_848018.1 and 35.8kDa according to NP_777568.1. The 18kDa band was USA successfully blocked by incubation with the immunizing peptide.
    [Show full text]
  • Increased Microvascular Permeability in Mice Lacking Epac1 (Rapgef3)
    Increased microvascular permeability in mice lacking Epac1 (Rapgef3) Kopperud, R. K.; Rygh, C. Brekke; Karlsen, T. V.; Krakstad, C.; Kleppe, R.; Hoivik, E. A.; Bakke, M.; Tenstad, O.; Selheim, F.; Lidén, Å.; Madsen, Lise; Pavlin, T.; Taxt, T.; Kristiansen, Karsten; Curry, F. -R. E.; Reed, R. K.; Døskeland, S. O. Published in: Acta Physiologica DOI: 10.1111/apha.12697 Publication date: 2017 Document version Publisher's PDF, also known as Version of record Document license: CC BY-NC-ND Citation for published version (APA): Kopperud, R. K., Rygh, C. B., Karlsen, T. V., Krakstad, C., Kleppe, R., Hoivik, E. A., Bakke, M., Tenstad, O., Selheim, F., Lidén, Å., Madsen, L., Pavlin, T., Taxt, T., Kristiansen, K., Curry, F. -R. E., Reed, R. K., & Døskeland, S. O. (2017). Increased microvascular permeability in mice lacking Epac1 (Rapgef3). Acta Physiologica, 219(2), 441-452. https://doi.org/10.1111/apha.12697 Download date: 30. Sep. 2021 Acta Physiol 2017, 219, 441–452 Increased microvascular permeability in mice lacking Epac1 (Rapgef3) † § R. K. Kopperud,1,2,*, C. Brekke Rygh,1,*, T. V. Karlsen,1 C. Krakstad,1 R. Kleppe,1 † ¶ ‡ E. A. Hoivik,1, M. Bakke,1 O. Tenstad,1 F. Selheim,1 A. Liden, 1, L. Madsen,1,3, T. Pavlin,1 T. Taxt,1 K. Kristiansen,3 F.-R. E. Curry,4 R. K. Reed1,2 and S. O. Døskeland1 1 Department of Biomedicine, University of Bergen, Bergen, Norway 2 Centre for Cancer Biomarkers (CCBIO), University of Bergen, Bergen, Norway 3 Department of Biology, University of Copenhagen, Copenhagen, Denmark 4 Department of Physiology and Membrane Biology, School of Medicine, University of California, Davis, CA, USA Received 18 February 2016, Abstract revision requested 15 March Aim: Maintenance of the blood and extracellular volume requires tight con- 2016, trol of endothelial macromolecule permeability, which is regulated by cAMP revision received 12 April 2016, signalling.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Selective Small-Molecule EPAC Activators
    Heriot-Watt University Research Gateway Selective small-molecule EPAC activators Citation for published version: Luchowska-Staska, U, Morgan, D, Yarwood, SJ & Barker, G 2019, 'Selective small-molecule EPAC activators', Biochemical Society Transactions, vol. 47, no. 5, pp. 1415-1427. https://doi.org/10.1042/BST20190254 Digital Object Identifier (DOI): 10.1042/BST20190254 Link: Link to publication record in Heriot-Watt Research Portal Document Version: Publisher's PDF, also known as Version of record Published In: Biochemical Society Transactions Publisher Rights Statement: © 2019 The Author(s). This is an open access article published by Portland Press Limited on behalf of the Biochemical Society and distributed under the Creative Commons Attribution License 4.0 (CC BY). General rights Copyright for the publications made accessible via Heriot-Watt Research Portal is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy Heriot-Watt University has made every reasonable effort to ensure that the content in Heriot-Watt Research Portal complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 30. Sep. 2021 Biochemical Society Transactions (2019) https://doi.org/10.1042/BST20190254 Review Article Selective small-molecule EPAC activators Urszula Luchowska-Stanská 1, David Morgan2, Stephen J. Yarwood1 and Graeme Barker2 1 2 Institute of Biological Chemistry, Biophysics, and Bioengineering, Heriot-Watt University, Edinburgh EH14 4AS, U.K.; Institute of Chemical Sciences, Heriot-Watt University, Downloaded from https://portlandpress.com/biochemsoctrans/article-pdf/doi/10.1042/BST20190254/857286/bst-2019-0254c.pdf by Heriot-Watt University user on 21 October 2019 Edinburgh EH14 4AS, U.K.
    [Show full text]
  • Identification of a Novel Deletion Region in 3Q29 Microdeletion Syndrome by Oligonucleotide Array Comparative Genomic Hybridization
    Korean J Lab Med 2010;30:70-5 � Original Article∙Diagnostic Genetics � DOI 10.3343/kjlm.2010.30.1.70 Identification of a Novel Deletion Region in 3q29 Microdeletion Syndrome by Oligonucleotide Array Comparative Genomic Hybridization Eul-Ju Seo, M.D.1, Kyung Ran Jun, M.D.1, Han-Wook Yoo, M.D.2, Hanik K. Yoo, M.D.3, and Jin-Ok Lee, M.S.4 Departments of Laboratory Medicine1, Pediatrics2, and Psychiatry3, University of Ulsan College of Medicine and Asan Medical Center, Seoul; Asan Institute for Life Sciences4, Seoul, Korea Background : The 3q29 microdeletion syndrome is a genomic disorder characterized by mental retardation, developmental delay, microcephaly, and slight facial dysmorphism. In most cases, the microdeletion spans a 1.6-Mb region between low-copy repeats (LCRs). We identified a novel 4.0- Mb deletion using oligonucleotide array comparative genomic hybridization (array CGH) in monozy- gotic twin sisters. Methods : G-banded chromosome analysis was performed in the twins and their parents. High- resolution oligonucleotide array CGH was performed using the human whole genome 244K CGH microarray (Agilent Technologies, USA) followed by validation using FISH, and the obtained results were analyzed using the genome database resources. Results : G-banding revealed that the twins had de novo 46,XX,del(3)(q29) karyotype. Array CGH showed a 4.0-Mb interstitial deletion on 3q29, which contained 39 genes and no breakpoints flanked by LCRs. In addition to the typical characteristics of the 3q29 microdeletion syndrome, the twins had attention deficit-hyperactivity disorder, strabismus, congenital heart defect, and gray hair. Besides the p21-activated protein kinase (PAK2) and discs large homolog 1 (DLG1) genes, which are known to play a critical role in mental retardation, the hairy and enhancer of split 1 (HES1) and antigen p97 (melanoma associated; MFI2) genes might be possible candidate genes associated with strabis- mus, congenital heart defect, and gray hair.
    [Show full text]
  • Table SII. Significantly Differentially Expressed Mrnas of GSE23558 Data Series with the Criteria of Adjusted P<0.05 And
    Table SII. Significantly differentially expressed mRNAs of GSE23558 data series with the criteria of adjusted P<0.05 and logFC>1.5. Probe ID Adjusted P-value logFC Gene symbol Gene title A_23_P157793 1.52x10-5 6.91 CA9 carbonic anhydrase 9 A_23_P161698 1.14x10-4 5.86 MMP3 matrix metallopeptidase 3 A_23_P25150 1.49x10-9 5.67 HOXC9 homeobox C9 A_23_P13094 3.26x10-4 5.56 MMP10 matrix metallopeptidase 10 A_23_P48570 2.36x10-5 5.48 DHRS2 dehydrogenase A_23_P125278 3.03x10-3 5.40 CXCL11 C-X-C motif chemokine ligand 11 A_23_P321501 1.63x10-5 5.38 DHRS2 dehydrogenase A_23_P431388 2.27x10-6 5.33 SPOCD1 SPOC domain containing 1 A_24_P20607 5.13x10-4 5.32 CXCL11 C-X-C motif chemokine ligand 11 A_24_P11061 3.70x10-3 5.30 CSAG1 chondrosarcoma associated gene 1 A_23_P87700 1.03x10-4 5.25 MFAP5 microfibrillar associated protein 5 A_23_P150979 1.81x10-2 5.25 MUCL1 mucin like 1 A_23_P1691 2.71x10-8 5.12 MMP1 matrix metallopeptidase 1 A_23_P350005 2.53x10-4 5.12 TRIML2 tripartite motif family like 2 A_24_P303091 1.23x10-3 4.99 CXCL10 C-X-C motif chemokine ligand 10 A_24_P923612 1.60x10-5 4.95 PTHLH parathyroid hormone like hormone A_23_P7313 6.03x10-5 4.94 SPP1 secreted phosphoprotein 1 A_23_P122924 2.45x10-8 4.93 INHBA inhibin A subunit A_32_P155460 6.56x10-3 4.91 PICSAR P38 inhibited cutaneous squamous cell carcinoma associated lincRNA A_24_P686965 8.75x10-7 4.82 SH2D5 SH2 domain containing 5 A_23_P105475 7.74x10-3 4.70 SLCO1B3 solute carrier organic anion transporter family member 1B3 A_24_P85099 4.82x10-5 4.67 HMGA2 high mobility group AT-hook 2 A_24_P101651
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • A Genome-Wide in Vitro Bacterial-Infection Screen Reveals Human Variation in the Host Response Associated with Inflammatory Disease
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ARTICLE A Genome-wide In Vitro Bacterial-Infection Screen Reveals Human Variation in the Host Response Associated with Inflammatory Disease Dennis C. Ko,1 Kajal P. Shukla,1 Christine Fong,1 Michael Wasnick,1 Mitchell J. Brittnacher,1 Mark M. Wurfel,2 Tarah D. Holden,2 Grant E. O’Keefe,5 Brian Van Yserloo,2 Joshua M. Akey,3 and Samuel I. Miller1,2,3,4,* Recent progress in cataloguing common genetic variation has made possible genome-wide studies that are beginning to elucidate the causes and consequences of our genetic differences. Approaches that provide a mechanistic understanding of how genetic variants func- tion to alter disease susceptibility and why they were substrates of natural selection would complement other approaches to human- genome analysis. Here we use a novel cell-based screen of bacterial infection to identify human variation in Salmonella-induced cell death. A loss-of-function allele of CARD8, a reported inhibitor of the proinflammatory protease caspase-1, was associated with increased cell death in vitro (p ¼ 0.013). The validity of this association was demonstrated through overexpression of alternative alleles and RNA interference in cells of varying genotype. Comparison of mammalian CARD8 orthologs and examination of variation among different human populations suggest that the increase in infectious-disease burden associated with larger animal groups (i.e., herds and colonies), and possibly human population expansion, may have naturally selected for loss of CARD8. We also find that the loss-of-function CARD8 allele shows a modest association with an increased risk of systemic inflammatory response syndrome in a small study (p ¼ 0.05).
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]