South Dakota State University Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange

Electronic Theses and Dissertations

2019 Development and Characterization of Wheat-Thinopyrum Junceiforme Chromosome Addition Lines Dilkaran Singh South Dakota State University

Follow this and additional works at: https://openprairie.sdstate.edu/etd Part of the Agronomy and Crop Sciences Commons, Biology Commons, Plant Biology Commons, and the Plant Breeding and Genetics Commons

Recommended Citation Singh, Dilkaran, "Development and Characterization of Wheat-Thinopyrum Junceiforme Chromosome Addition Lines" (2019). Electronic Theses and Dissertations. 3368. https://openprairie.sdstate.edu/etd/3368

This Thesis - Open Access is brought to you for free and open access by Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Open PRAIRIE: Open Public Research Access Institutional Repository and Information Exchange. For more information, please contact [email protected]. DEVELOPMENT AND CHARACTERIZATION OF WHEAT-THINOPYRUM

JUNCEIFORME CHROMOSOME ADDITION LINES

BY

DILKARAN SINGH

A thesis submitted in partial fulfillment of the requirements for the

Master of Science

Major in Biological Sciences

Specialization in Biology

South Dakota State University

2019

iii

This thesis is dedicated to my mother.

iv

ACKNOWLEDGMENTS

The thesis became possible with the help and support of many individuals and I would like to thank all of them.

Foremost, I am grateful to my mentor Dr. Wanlong Li for giving me the opportunity to work on this project. His valuable guidance, support, and love made my master’s work possible. I truly appreciate the time he devotes for helping and guiding his students and his care for the lab members. I am deeply thankful to him for everything I learned from him, which shaped me as a researcher and a better person.

I am also thankful to my committee members Dr. Marie Langham, Dr. Yajun Wu,

Dr. Karl Glover and Dr. Thomas Stenvig for their assistance during my graduate studies. I am thankful to Dr. Langham for her support and guidance in the experiments I conducted with her lab.

I am thankful to our collaborators Dr. Steven Xu (USDA ARS, Fargo, ND) and Dr.

Qijun Zhang (North Dakota State University) for their contribution.

My sincere thanks to my lab mates Dr. Lei Hua, Dr. Ghana Challa, Dr. Wenqiang

Li, Ajay Gupta and Abdullah Muhammad for their contributions and help. I am also thankful to Andrew, Samantha, and other members of Dr. Langham’s group for their help.

I am grateful to faculty, staff and students of the Department of Biology and

Microbiology at South Dakota State University for their assistance and contributions.

I would also like to extend thanks to my friends: Jagdeep, Teerath, Jasdeep, Navdeep,

Pratibha, Yeyan, Navreet, Abhinav, Harsimardeep, Arun and others who helped and encouraged me throughout my journey.

I owe to all scientists and people whose work has guided my thoughts and actions. v

Lastly, I am grateful to my family for their encouragement and love. I owe everything to my parents, grandparents and my sister. Without their blessings, this work would not have been possible.

vi

TABLE OF CONTENTS

ABBREVIATIONS ...... vii ABSTRACT ...... ix INTRODUCTION ...... 1 Chapter 1: Literature Review ...... 3 Wheat is an important cereal crop ...... 4 Evolution of wheat ...... 4 Demand for new germplasm ...... 6 Intergeneric gene transfer ...... 7 Barriers in alien gene transfer ...... 9 Genomic resources for alien gene transfer ...... 18 Thinopyrum juceiforme ...... 19 References Cited: ...... 20 Chapter 2: Development of Sea wheatgrass-specific Markers ...... 36 Abstract ...... 37 Introduction ...... 38 Materials and Methods ...... 40 Results ...... 41 Discussion...... 56 References Cited: ...... 58 Chapter 3: Identification and Characterization of Wheat-Thinopyrum junceiforme Addition Lines ...... 64 Abstract ...... 65 Introduction ...... 66 Materials and Methods ...... 67 Results ...... 68 Discussion...... 79 References Cited: ...... 81 Chapter 4: Conclusions and future directions ...... 85

vii

ABBREVIATIONS

BLASTn – Basic local alignment search tool nucleotide

CDS – Coding sequence

CS – Chinese Spring

CTAB – Cetyl trimethyl ammonium bromide

DNA – Deoxyribonucleic acid

EST – Expressed sequence tag

FAO – Food and Agriculture Organization

FHB – Fusarium head blight

GBS – Genotyping by sequencing

GISH – Genomic in situ hybridization

GSP – Genome specific primer

InDel – Insertion-Deletion

IWGSC – International wheat genome sequencing consortium

LMW – Low molecular weight

MUSCLE – Multiple sequence comparison by log-expectation

MYA – Million years ago

NTP – Nucleoside triphosphate

ONP – Oligo nucleotide polymorphism

PCR – Polymerase chain reaction

Ph – Pairing homoeologous

RNA – Ribonucleic acid

RobT – Robertsonian translocations viii

SDS – Sodium dodecyl sulfate

SLAF – Specific locus amplified fragment sequencing

SNP – Single nucleotide polymorphism

SSR – Simple sequence repeat

SWG – Sea wheatgrass

USD – United States Dollar

UV – Ultra violet

WSMV – Wheat streak mosaic virus

ix

ABSTRACT

DEVELOPMENT AND CHARACTERIZATION OF WHEAT-THINOPYRUM

JUNCEIFORME CHROMOSOME ADDITION LINES.

DILKARAN SINGH

2019

Production of wheat is challenged by dynamic biotic and abiotic stresses. Genetic improvement via alien gene transfer is an effective approach to tackle such challenges.

Alien gene transfer played an important role in the history of wheat crop improvement. Sea wheatgrass (SWG; Thinopyrum junceiforme, 2n = 28, genomes J1J1J2J2) is a wild relative of wheat. In our previous work, we have developed a complete amphiploid between cultivated emmer and SWG and shown that SWG is resistant to wheat streak mosaic virus,

Fusarium head blight and wheat stem sawflies (due to the solid stem) and tolerant to waterlogging, salinity, heat, and low nitrogen. At the same time, we produced 433 BC2F1 and BC2F2 individuals by crossing hexaploid wheat and the amphiploid. Our objective of this thesis study was to develop the wheat-SWG chromosome addition lines. To identify and characterize alien chromosomes, we developed 127 SWG-specific markers using a draft SWG genome assembly. These markers were used to screen the BC2F1 and BC2F2 populations and characterize the SWG chromosomes carried by these lines. Combining the genomic in situ hybridization data from Dr. Steven Xu’s group (USDA ARS, Fargo), with whom we are collaborating, we were able to identify a complete set of wheat-SWG chromosome addition lines and characterize all SWG chromosomes. The addition lines developed in the present study will serve as the SWG chromosome library in the wheat background. They can be used to map and identify useful genes present in SWG genome. x

The addition lines will further be used in the development of translocation lines facilitating the alien introgression into the wheat genome. The molecular markers developed in our study will be useful in the subsequent steps of chromosome engineering and gene mapping. 1

INTRODUCTION

Climate change poses an increasing threat to wheat production (Asseng et al., 2015;

Figueroa et al., 2018). The rising temperature adversely affects the wheat yield, and unpredictable precipitation patterns increase the frequency and intensity of floods and droughts (FAO 2018). Climate change also catalyzes the severity of pathogens and thus, worsens effects of the biotic stresses (Váry et al., 2015). Meanwhile, agricultural practices also contribute to climate change through the emission of greenhouse gases and other pollutants such as remnants of fertilizers. Development of cultivars with genetic capability to withstand the current and upcoming production challenges is a promising approach.

Genetic improvement requires the incorporation of genes into cultivated wheat making wheat resistant/tolerant to the stress that the crop is facing.

Wild relatives of wheat grow in a wide spectrum of natural conditions, thus, are an important source of superior genes against biotic and abiotic stresses. Apparently, all species belonging to the Triticeae tribe can be considered as relative species of wheat and can be used for the genetic improvement of wheat (Gill et al., 2006). Thinopyrum junceiforme (Sea wheatgrass; SWG) is a wild relative of wheat, which harbors genes for tolerance to waterlogging, manganese toxicity, low nitrogen, and heat. Also, it is resistant to wheat streak mosaic virus (WSMV) and Fusarium head blight (Li et al., 2019). Thus, it is a promising resource for the genetic improvement of wheat. Recently, our group developed a complete amphiploid between SWG and cultivated emmer (Li et al., 2019), which is the excellent starting material for transferring useful genes from SWG to wheat by the chromosome engineering approach. For the proper exploitation of this relatively 2 untapped wild species, the development of novel germplasm requires genomic resources, such as molecular markers. To dissect the SWG genome and simultaneously discover, map agriculturally important traits and quantitative trait loci, and transfer them to wheat, we initiated an effort to develop wheat-SWG addition lines and translocations lines. As part of this effort, this thesis project focused on two objectives: 1) development of the molecular markers specific for SWG genome and 2) development and characterization of the wheat-

SWG addition lines. Here I will review the background of the alien gene transfer and relevant literature in Chapter 1 and report the research results in Chapters 2 and 3.

3

Chapter 1: Literature Review

Transfer of Useful Traits from Wild Relatives into Wheat

4

Wheat is an important cereal crop

Wheat is a major cereal crop providing ~20% of the calories consumed worldwide (Tilman et al., 2011). It is an important source of carbohydrates, fiber, and protein. Among the ten major staple foods, wheat has the highest fiber content (USDA Food Composition

Databases; https://ndb.nal.usda.gov/ndb/search/list). The viscoelastic properties of wheat dough, (due to the presence of gluten protein) makes it an important ingredient of various processed foods such as pasta, bread, and noodles consumed widely around the world

(Shewry et al., 2002). In the year 2017, 771 million tons of wheat was produced from 218 million hectares worldwide, which is second highest after maize (1 billion tons) and area harvested highest compared to 197 million hectares of maize and 167 million hectares of rice (http://www.fao.org/faostat/en/#data/QC).

Evolution of wheat

Wheat belongs to the Tribe of Triticeae in the grass family (Poaceae). The Triticeae include numerous cereal and forage crops, such as wheat (Triticum), barley (Hordeum), rye

(Secale), and wheatgrass (Thinopyrum). The wheat lineage diverged from the barley lineage ~12 million years ago (MYA) and from the rye lineage ~7 MYA (Huang et al.,

2002). These relative taxa are important exotic sources for genetic improvement of wheat.

Within the genus Triticum, there are six species at three ploidy levels: T. monococum (2n = 2x = 14; genome AmAm) and T. urartu (2n = 2x = 14; genome AA) have diploid genome, T. timopheevii (2n = 4x = 28; genomes AAGG) and T. turgidum (2n = 4x

= 28; genomes AABB) have tetraploid genome, and T. aestivum (2n = 6x = 42, genomes

AABBDD) and T. zhukovskyi (2n = 6x = 42, genomes AAGGAmAm) have hexaploid 5 genome. Wheat genus (Triticum) and its closest relative goatgrass genus (Aegilops) diverged ~ 1.1 to 2.5 MYA from a common ancestor (Gornicki et al., 2014; Huang et al.,

2002). The two tetraploid species originated from the crosses between a close relative of

A. speltoides and T. urartu. One hybrid was wild emmer (T. turgidum subsp. dicoccoides) originated approximately 0.7 MYA, and the second tetraploid wheat, i.e., wild Timopheevi

(T. timopheevii subsp. armeniacum) originated from a separate hybridization ~0.4 MYA

(Gornicki et al., 2014). Approximately 10,000 years ago (Salamini et al., 2002), einkorn

(T. monococcum subsp. monococcum), a close relative of T. urartu, was domesticated from wild einkorn (T. monococcum subsp. aegilopoides) in southeastern Turkey (Heun et al.,

1997). About 9,000 ago (Salamini et al., 2002), emmer (T. turgidum subsp. dicoccum) was domesticated from the wild emmer also in southeastern Turkey (Ozkan et al., 2005).

During radiation of emmer, several cultivated forms of tetraploid wheat were formed, including durum wheat (T. turgidum subsp. durum). Common wheat or bread wheat (T. aestivum) is a hexaploid originated from one or two crosses between a cultivated form of

T. turgidum and A. tauschii ~8000 years in the west or southwest of Caspian Sea (Wang et al., 2013).

Therefore, three cultivated wheat crops at three ploidy level: diploid einkorn (T. monococcum subsp. monococcum), tetraploid durum (T. turgidum subsp. durum) and hexaploid bread wheat or common wheat (T. aestivum). Common wheat is the most widely grown and consumed among the three cultivated wheat species. 6

Demand for new germplasm

World population is expected to exceed 9 billion by the year 2050

(https://population.un.org/wpp/Publications/ retrieved June 26, 2019). To feed the increasing population, it is necessary to continuously improve wheat production. However, biotic and abiotic stresses pose serious challenges for wheat production. The wheat rusts are among major threats to wheat production. Rust pathogens cause multi-billion USD loss globally (reviewed by Figueroa et al., 2018). Fusarium head blight (FHB) alone caused a loss of 2.6 billion USD during 1990s’ epidemics (McMullen, Jones, and Gallenberg 1997).

Another devastating wheat disease is wheat streak mosaic virus (WSMV), which caused

76.8 million USD loss in Kansas in the year 2017 (http://kswheat.com/growers/wheat- streak-mosaic-virus?page=1). Furthermore, the negative factors of climate change will complicate wheat improvement efforts and intensify food security challenges (Narsai et al., 2013; Tigchelaar et al., 2018). Rising temperatures will have an adverse effect on wheat yield. Global wheat yield is projected to decline between 4.1% and 6.4% with an increase of 1⁰C temperature (Asseng et al., 2015). A warmer temperature is also linked to increased pressure from biotic stresses as it can accelerate the emergence of new races, the distribution pattern of pathogens (Garrett 2013), thus alter plant-pest interactions (Pandey et al., 2017; Tito et al., 2018). In addition to the gradual changes, extreme events such as floods, droughts, storms and disease outbreaks which can lead to famines in affected areas

(FAO 2018). Also, increased CO2 concentration reduces wheat’s nitrogen assimilation ability (Bloom et al., 2010) and increases disease severity (Váry et al., 2015). In contrast, 7 modern-day wheat cultivars are dependent on synthetic fertilizers for optimum yield, and the production of synthetic fertilizers adds to greenhouse gas emissions.

Food security depends on continuous yield gains by the development of new varieties that can withstand biotic and abiotic stresses. Genetic improvement in wheat was the major driver of yield gains in wheat during the green revolution. Cultivars developed in that era had genetics that fit within the environmental and economic conditions 40 years ago. But the challenges we are facing now are unprecedented. The elite cultivars of today may not fit the environment in the foreseeable future. The above-mentioned challenges demand novel genetic variation to support the development of better-fit cultivars. Thus, the available germplasm becomes obsolete with time. To tackle the new challenges, it is necessary to keep replenishing the germplasm with new traits, such as tolerance to drought, waterlogging, heat, low nitrogen conditions, and resistance to various pathogens.

Intergeneric gene transfer

Common wheat went through two polyploidization events during the last 700,000 years which significantly reduced genetic diversity (Akhunov et al., 2010; Haudry et al., 2007;

Halloran et al., 2008). Domestication and modern wheat breeding further reduced the genetic diversity in the hexaploid species (Thuillet et al., 2005; Haudry et al., 2007; Avni et al., 2017; Gaut et al., 2018). To improve wheat productivity and sustainability, we need to increase its genetic diversity and expand its gene pool (He et al., 2019).

Thus, it is necessary to incorporate the genetic variation from the related species of wheat. The wild relatives of wheat grow in diverse natural conditions and are capable of withstanding different environmental stresses, which may have lost during wheat 8 domestication due to genetic drift and human assistance for crop growth. The Triticeae tribe consists of over 20 genera and 300 species, share 12 million years of coevolutionary history and constitute a huge gene pool that is available for improvement of wheat crop.

These wild relatives can be classified into three groups based on their genome relationship to wheat, i.e., primary gene pool, secondary gene pool, and tertiary gene pool.

The primary gene pool contains species which share a common genome with wheat. This gene pool includes the progenitor species, such as T. urartu, T. turgidum and A. tauschii.

The secondary gene pool includes those species which have at least one genome in common with the wheat sub-genomes, such as T. timopheevi and T. zhukovskyi. Species in the tertiary gene pool are distinctly related to the wheat genome. Their genome is not homologous with the wheat genome and their hybrids with wheat usually need to be rescued by embryo culture (Friebe et al., 1996). Tertiary gene pool includes genus such as

Secale, Thinopyrum, and Agropyron (Pratap and Kumar 2014).

The wheat ancestors T. urartu, A. speltoides and A. tauschii are important sources of genetic improvement for wheat. Diploid wheat species harbor resistance genes against the common diseases in the polyploid wheat. For example, A. tauschii genetic map contains

160 defense-related genes (Boyko et al., 2002). A. tauschii is the most exploited progenitor for transferring genetic traits to hexaploid wheat through the production of synthetic wheat

(AABBDD) because its genome can freely recombine with the D genome of wheat.

The secondary gene pool species, such as T. timopheevi, have also been exploited to transfer powdery mildew resistance gene and leaf rust resistance gene into the wheat

(Brown-Guedira et al., 2003; Järve et al., 2000). Species within the secondary gene pool are also a valuable source of traits related to waxy proteins in wheat and quality-related 9 traits (LMW glutenin subunit genes) (Brwon-Guedira et al., 1997; Yan and Bhave 2001).

The transfer of genes from secondary gene pool can be carried out by direct hybridizations between wild relatives and wheat followed by backcrossing of F1 hybrids to the wheat parent (Järve et al., 2000).

The tertiary gene pool can also be used to break the genetic bottleneck and improve wheat yield substantially but due to the barrier imposed by the inability of homoeologous chromosomes to recombine, exploitation of the tertiary gene pool is restricted. Thus, the development of bridging germplasm (such as amphiploids, addition, substitution, and translocation lines) is important for developing new wheat varieties using wild relatives. It has been reported that 23 genomes have been exploited to transfer 100 genes from wild relatives of wheat (Mujeeb-Kazi et al., 2013). However, the inability to reduce the alien chromosome segment containing the gene of interest burdens developed genotypes with a yield penalty. Thus, distantly related species have not been successfully exploited to their potential. Developing genomic resources at the molecular level can be a good strategy to closely track genes of interest in alien segments and selectively transfer only the required alien segment.

Barriers in alien gene transfer

Incompatibility between the wheat and its wild relatives poses difficulties in producing viable hybrids. Hybrids produced between them are sterile. Wheat chromosomes and wild relatives’ chromosomes do not pair with each other during meiosis. This restricts the transfer of the genes from the alien chromosome to the crop’s chromosome (Able and

Langridge 2006; Chang and de Jong 2005). 10

Wheat is an allohexaploid crop with three homoeologous genomes. The homoeologous chromosomes in wheat do not recombine each other. Rather wheat has diploid-like meiosis. This is due to the presence of the Ph1 locus on the long arm of chromosome 5B (Okamoto 1957; Riley and Chapman 1958) and the Ph2 locus on 3DS

(Sears 1982). The Ph1 locus in wheat governs the recombination during meiosis. It only allows homologous chromosomes to recombine (Riley & Chapman, 1958). It is necessary for the stable diploid-like behavior of the wheat genome, but it also inhibits the recombination between alien homoeologous chromosomes and wheat chromosomes when required. Thus, transferring the alien gene into the wheat genome is difficult. Whereas, if the whole chromosome (harboring gene of interest) is transferred, it will also bring undesirable traits into the wheat genome (Qi et al., 2007). This association of undesirable traits with the gene of interest is called linkage drag and has an adverse effect on the plant.

Thus, it is necessary to use some strategy which can serve as a bridge to transfer genes from exotic resources to wheat.

Chromosome engineering is the strategy mainly used to transfer the genes from alien species to the wheat genome (Sears 1972). Chromosomal engineering involves the production of amphiploids, addition lines, exploitation of centric breakage-fusion behavior of univalent to produce Robertsonian translocations, and homoeologous recombination

(reviewed by Qi et al., 2007). It is coupled with embryo rescue to produce viable F1 hybrids between distantly related species(reviewed by Chaudhary et al., 2014; Molnár-Láng et al.,

2002). Secondly, homoeologous recombination can directly be used to transfer alien genes to wheat. It can be achieved using ph1b mutant (non-functional Ph1 mutant) or Ph1 gene suppressors such as Su1-Ph1 (Dvorak et al. 2006; Li et al., 2017), and recently discovered 11 suppressor present on chromosome 5Mg of A. geniculata (Koo et al., 2017). Lastly, irradiation was also reported to induce alien gene transfer (Sears 1956). It usually leads to non-homoeologous transfer, which is not genetically compensating in most cases but it can be effective when an alien chromosome is highly rearranged, such as chromosome 6R of rye, from which a 0.7-μm fragment carrying a Hessian fly resistance gene was inserted in the long arm of chromosome 4A (Mukai et al., 1993).

We will discuss the procedure of alien gene transfer via chromosome engineering with more details in the following sections. A graphical representation of chromosome engineering pipeline is given in Fig. 1.1.

Amphiploids - ‘transfer of an alien genome’

If the hybrid between the wild species and wheat is not viable, no further efforts for gene transfer are possible (Gill and Raupp 1987; Tikhenko et al., 2017). Furthermore, viable F1 hybrids are sterile due to the failure of chromosome pairing. Chromosome doubling by colchicine treatment is used to restore the fertility of hybrids, which leas to the formation of complete amphiploids. If genome compatibilities hinder the direct crosses between cultivated wheat and wild species of interest, a bridging species is used to generate partial amphiploids (Chhuneja et al., 2008; Delibes et al., 1993; Khrustaleva and Kik 1998). Many amphiploids have been developed since the development of Triticale derived from a cross between wheat and rye in 1875 (Lorenz and Pomeranz 1974; Mergoum et al., 2009).

Combining the advantages from wheat and rye, Triticale has been the most successful amphiploid ever created and a man-made crop.

12

Chromosome addition lines - ‘cloning alien chromosomes’

To reduce the alien chromatin, amphiploid is backcrossed with a wheat parent. Subsequent generations are backcrossed to wheat or allowed for self-pollination. Simultaneously, the plants containing one alien chromosome are selected. If a plant has all wheat chromosomes and one alien chromosome, such plant is called alien chromosome addition line. The presence and characterization of alien chromosome can be validated by chromosome counting, genomic in situ hybridization (GISH) and/or by molecular markers.

A set of addition lines serves as a library in which each alien chromosome is cloned in the wheat genome background. Addition lines can serve as a great material to study the various characteristics of the individual alien chromosome such as morphological traits controlled by the chromosome and biotic and abiotic stress-related genes (Forster et al.,

1988; Konnerup et al., 2017; Wang et al., 2016; Schneider et al., 2016). Using addition lines, rust resistances were characterized in Aegilops markgraffi (Niu et al., 2018), FHB resistance in Thinopyrum elongtum (Fu et al., 2012), Barley yellow dwarf virus and rust resistance in Thinopyrum intermedium (Larkin et al., 1995). Thinopyrum junceum addition lines were used to study salinity tolerance genes (Forster et al., 1988; Wang et al., 2003).

Liu et al., (2018) used 43 wheat-alien chromosome addition lines derived from Leymus,

Agropyron, Hordeum, Psathyrostachys, Aegilops, and Secale species to study nutrient use efficiency. Wheat-rye addition lines have been used in characterizing genes on the alien chromosome (Mori, Kishi-NIishizawa, and Fujugaki 1990; Nkongolo et al., 1990) and meiotic studies (Orellana, Cermeño, and Lacadena 1984). Wheat-barley addition lines have been employed to study genetic traits such as heading characters (Murai, Koba, and

Shimada 1997) and dissect the alien chromosome (Sakai et al., 2009). 13

Addition lines can be coupled with molecular studies such as transcriptional profiling to discover candidate genes for certain mechanisms on alien chromosomes.

Salvador-Moreno et al., (2018) identified aluminum tolerance genes among wheat-rye addition lines, and Bilgic et al. (2006) mapped barley genes in wheat-barley addition lines by transcript profiling. Transcriptome analysis was used to physically map barley genes in the wheat-barley addition lines (Cho et al., 2006).

Transfer of an alien chromosome arm-Robertsonian Translocations’

A characterized set of addition lines can be used to develop the wheat alien chromosome translocations (Zhang et al., 2017). The addition line can be crossed with cognate monosomic stocks. In the monosomic stocks, one chromosome is absent, thus, only one dose of that chromosome is present in the wheat genome (2n = 20” + 1’). In the F1 hybrid, two types of plants are expected with chromosome number 2n = 43 and 2n = 42. In the latter case, the alien chromosome and one of its homoeologous wheat chromosomes are present as univalents during meiosis I and have a tendency to break at centromeres transversely and fuse each other at the broken centromeres giving rise to whole arm translocations, i.e., Robertsonian translocations (RobTs) (Friebe et al., 2005). Centromeric break and fusion can lead to two types of translocations. In one case, the long arm of the alien chromosome replaces the long arm of a wheat chromosome or short arm replaces the short arm thus, the genetic balance of the chromosome remains maintained. This type of translocation is genetically compensating and is called compensating translocation. In another case, a long arm may replace a short arm, or vice versa, leading to the fusion of either long arm with long arm or short arm with short arm (one from the alien chromosome 14 and another from wheat). Such translocation is not genetically compensating due to duplication-deficiency. Among RobTs, a compensating translocation is of interest for alien gene transfer. Once translocations are developed, desired translocations can be selected using molecular and cytogenetic techniques. Plants with translocated chromosome from alien species are called translocation lines.

A well-known example of RobTs is the introduction of the short arm of rye chromosome 1R into wheat through translocation 1BL•1RS. Many disease resistance genes were introduced to wheat genome through this translocation, including Lr26, Sr31, Yr9, and Pm8 (Lukaszewski, 2000; Mago et al., 2005). Other examples of translocation lines bearing important traits include resistance to FHB from Leymus racemosus (Chen et al.,

2005), resistance to barley yellow dwarf virus resistance from Th. intermedium (Crasta et al., 2000), resistance to wheat spindle streak mosaic virus from Dasypyrum villosum

(Zhang et al., 2005), and resistance to powdery mildew from rye 4R chromosome (An et al., 2013).

Sub-arm transfer by homoeologous recombination

To transfer a desired trait from the alien chromosome arm of a RobT to wheat chromosome for further reducing the alien chromatin, it is necessary for the alien segment and wheat homoeologous chromosome to recombine during meiosis I. Such recombination in wheat is suppressed due to the presence of the Ph1 locus. To this end, the Ph1 locus needs to be deleted or to be suppressed. Ph1b; non-functional Ph1 locus due to a large deletion is commonly used. For induction of homoeologous recombination between alien chromosome and its wheat homoeologs, the RobT is crossed and backcrossed to the ph1b 15 mutant wheat plant and the ph1bph1b homozygotes carrying the RobT are selected and allowed to self-pollination. The BC1F2 population will be screened for homoeologous recombinant with reduced size of alien segments (Fig. 1.1). A recently discovered Ph1 suppressor on the 5Mg chromosome of A. geniculata allows the homoeologous chromosomes to recombine even in the presence of functional Ph1 locus (Koo et al., 2017).

Such suppressor can also be employed for induced homoeologous pairing. Depending on the size of the alien introgression desired and recombination frequency for the desired event, the size of the population can be estimated. The population thus produced can be screened using molecular markers and cytogenetic tools to identify plants carrying desired introgressions. Subsequent rounds of recombination can be employed to shorten the alien introgression.

Using chromosome engineering, wild relatives have also been exploited for broadening the wheat genetic base. For example, resistance to leaf rust, stripe rust, powdery mildew, and barley yellow dwarf virus have been transferred from Agropyron, Thinopyrum, and

Aegilops into wheat and resistance to powdery mildew and wheat curl mite from D. villosum to cultivated wheat (Kuraparthy et al., 2009; Marais et al., 2009; Petersen et al.,

2015; Qi et al., 1996; Repellin et al., 2001). Apart from disease resistance genes, traits related to yield potential and end-use quality are also transferred to wheat (Howell et al.,

2014; Ren et al., 2012; J. Zhang et al., 2015).

16

17

Figure 1.1 Graphical representation of the schematic gene transfer from wild species to cultivated wheat using chromosome engineering approach. Grey colored chromosomes represent the alien genome and white-colored represent the wheat chromosomes. Adopted from (Gill et al., 2006) 18

Genomic resources for alien gene transfer

While developing addition, substitution, and translocation lines, it is very important to analyze genetic constitution and characterize alien chromosomes present in those lines

(Han et al., 2014). This characterization is helpful in concluding which chromosome or loci on the chromosome are responsible for a certain phenotypic effect. Once a genetic trait is mapped to a particular chromosome, further mapping of that gene can be carried out depending upon the genetic and genomic resources available. With this knowledge, it is convenient to transfer precise chromosomal fragments to the wheat genome, avoiding the linkage drag.

Once a set of addition, substitution, or translocation lines are developed, cytogenetic and molecular tools can be used to characterize the alien chromosomes et al.,

2009; Kuraparthy et al., 2007; Li et al., 2016; Patokar et al., 2016). The most popular tool for chromosome characterization of the distantly related wild species is GISH

(Schwarzacher et al., 1992). GISH has been used to study the genome composition of amphiploids, addition lines and translocation lines (Jauhar et al., 2009; Kuraparthy et al.,

2007; Patokar et al., 2016). But GISH is a low-throughput method for chromosome detection (Li et al., 2016). Molecular markers are also employed for alien chromosome identification and characterization studies (Edet et al., 2018; Jauhar et al., 2009; Kong et al., 2018). In contrast to GISH, molecular markers are high throughput tools and would be a desirable tool for this purpose. Most of the markers are based on genomic resources of wheat. Genomic resources from wheat can rarely be used specifically for alien genome or chromosome characterization due to evolutionary and divergence impacts on the genome. 19

Thus, due to the lack of markers specific for alien genome, it is difficult to transfer small alien fragments. As a result, larger fragments are transferred to wheat causing linkage drag

(due to a large number of undesirable traits on larger fragment). Consequently, this confines the possibilities of developing an improved wheat cultivar derived from germplasm developed using a wild relative. In such a scenario where development of new genomic resources can open possibilities to better exploit the wild relatives, whole-genome sequencing of alien species can serve the purpose best.

With the advent of next-generation sequencing technologies, it is relatively cost- effective to sequence a whole genome. The whole-genome sequence can be used for local alignment of the specific regions on the wheat and wild relative genome. This alignment will help to identify regions of insertions, deletions and single or oligo nucleotides polymorphism between two genomes. Molecular markers specific for alien species can be designed from such regions.

Thinopyrum juceiforme

Th. junceiforme, commonly called sea wheatgrass (SWG), sand couch-grass, and Russian wheatgrass is a wild relative of wheat and belongs to the tertiary gene pool of wheat. It belongs to tribe Triticeae. SWG was originated from the western European, Mediterranean,

Atlantic and Baltic coasts. It is naturalized in the southeastern coast of Australia and the west coast of the USA in states of Oregon and California as an invasive species (Hanlon and Mesgaran, 2014).

Cytogenetically, Th. junceiforme is a tetraploid grass with a basic chromosome number of 7 and a total of 28 chromosomes. It is an allotetraploid and the two genome sets 20

are denoted as J1 and J2 (Dewey 1984). Th. bessarbicum and Th. elongatum are believed to be parents of Th. junceiforme and the respective donors of two genomes. J1 genome inherited from the Th. bessarbicum has gone through rearrangements as revealed by the C- banding patterns.

Thinopyrum species can be hybridized with Triticum species (Patokar et al., 2016).

SWG hybrids with durum wheat are evaluated for resistance to Fusarium head blight

(FHB). Hybrids have shown resistance to FHB and thus SWG can be a potential genetic resource for scab resistance in wheat (Jauhar & Peterson, 2001; Turner et al., 2013).

We recently developed an amphiploid from a cross between SWG and cultivated emmer. Compared to its emmer parent, the amphiploid showed many useful traits, including solid stem (resistance to sawflies) and resistance to WSMV, stem rust, and FHB.

It showed tolerance to the abiotic stresses such as waterlogging conditions, low nitrogen supply and tolerance to salinity (Li et al., 2019). Thus, SWG can be an invaluable source for the wheat genetic improvement and can serve to broaden the genetic base of the wheat crop.

References Cited: Able, J.A. and Langridge, P. (2006). Wild sex in the grasses. Trends Plant Sci. 11: 261–3.

Akhunov, E.D., Akhunova, A.R., Anderson, O.D., Anderson, J.A., Blake, N., Clegg, M.T.,

Coleman-Derr, D., Conley, E.J., Crossman, C.C., Deal, K.R., Dubcovsky, J., Gill,

B.S., Gu, Y.Q., Hadam, J., Heo, H., Huo, N., Lazo, G.R., Luo, M., Ma, Y.Q.,

Matthews, D.E., McGuire, P.E., Morrell, P.L., Qualset, C.O., Renfro, J., Tabanao, 21

D., Talbert, L.E., Tian, C., Toleno, D.M., Warburton, M.L., You, F.M., Zhang, W.,

Dvorak, J. (2010). Nucleotide diversity maps reveal variation in diversity among

wheat genomes and chromosomes. BMC Genomics 11: 702.

An, D., Zheng, Q., Zhou, Y., Ma, P., Lv, Z., Li, L., Li, B., Luo, Q., Xu, H., and Xu, Y.

(2013). Molecular cytogenetic characterization of new wheat–rye 4R chromosome

translocation line resistant to powdery mildew. Chromosom. Res. 21: 419–432.

Asseng, S., Ewert, F., Martre, P., Rötter, R.P., Lobell, D.B., Cammarano, D., Kimball,

B.A., Ottman, M.J., Wall, G.W., White, J.W., Reynolds, M.P., Alderman, P.D.,

Prasad, P.V.V., Aggarwal, P.K., Anothai, J., Basso, B., Biernath, C., Challinor,

A.J., De Sanctis, G., Doltra, J., Fereres, E., Garcia-Vila, M., Gayler, S.,

Hoogenboom, G., Hunt, L.A., Izaurralde, R.C., Jabloun, M., Jones, C.D.,

Kersebaum, K.C., Koehler, A-K., Müller, C., Naresh Kumar, S., Nendel, C.,

O’Leary, G., Olesen, J.E., Palosuo, T., Priesack, E., Eyshi Rezaei, E., Ruane, A.C.,

Semenov, M.A., Shcherbak, I., Stöckle, C., Stratonovitch, P., Streck, T., Supit, I.,

Tao, F., Thorburn, P.J., Waha, K., Wang, E., Wallach, D., Wolf, J., Zhao, Z., Zhu,

Y. (2015). Rising temperatures reduce global wheat production. Nat. Clim. Chang.

5: 143–147.

Avni, R., Nave, M., Barad, O., Baruch, K., Twardziok, O., Gundlach, H., Hale, I., Mascher,

M., Spannagl, M., Wiebe, K., Jordan, K., Golan, G., Deek, J., Ben-Zvi, B., Ben-

Zvi, G., Himmelbach, A., Maclachlan, R., Sharpe, A., Fritz, A., Ben-David, R.,

Budak, H., Fahima, T., Korol, A., Faris, J., Hernandez, A., Mikel, M., Levy, A.,

Steffenson, B., Maccaferri, M., Tuberosa, R., Cattivelli, L., Faccioli, P., Ceriotti,

A., Kashkush, K., Pourkheirandish, M., Komatsuda, T., Eilam, T., Sela, H., Sharon, 22

A., Ohad, N., Chamovitz, D., Mayer, K., Stein, N., Ronen, G., Peleg, Z., Pozniak,

C., Akhunov, E., Distelfeld, A. (2017). Wild emmer genome architecture and

diversity elucidate wheat evolution and domestication. Science 357: 93–97.

Bilgic, H., Cho, S., Garvin, D.F., and Muehlbauer, G.J. (2006). Mapping barley genes to

chromosome arms by transcript profiling of wheat–barley ditelosomic chromosome

addition lines. Genome 50: 898–906.

Bloom, A.J., Burger, M., Rubio Asensio, J.S., and Cousins, A.B. (2010). Carbon dioxide

enrichment inhibits nitrate assimilation in wheat and Arabidopsis. Science 328:

899–903.

Boyko, E., Kalendar, R., Korzun, V., Fellers, J., Korol, A., Schulman, A.H., and Gill, B.S.

(2002). A high-density cytogenetic map of the Aegilops tauschii genome

incorporating retrotransposons and defense-related genes: insights into cereal

chromosome structure and function. Plant Mol. Biol. 48: 767–90.

Brown-Guedira, G.L., Singh, S., and Fritz, A.K. (2003) Genetics and Resistance

Performance and Mapping of Leaf Rust Resistance Transferred to Wheat from

Triticum timopheevii subsp. armeniacum. Phytopathology. 93: 784-789.

Brwon-Guedira, G.L., Gill, B.S., Cox, T.S., and Leath, S. (1997). Transfer of disease

resistance genes from Triticum araraticum to common wheat. Plant Breed. 116:

105–112.

Chang, S.-B. and de Jong, H. (2005). Production of alien chromosome additions and their

utility in plant genetics. Cytogenet. Genome Res. 109: 335–343. 23

Chaudhary, H.K., Kaila, V., Rather, S.A., Badiyal, A., Hussain, W., Jamwal, N.S., and

Mahato, A. (2014). Wheat. In Alien Gene Transfer in Crop Plants, Volume 2

(Springer New York: New York, NY), pp. 1–26.

Chen, P., Liu, W., Yuan, J., Wang, X., Zhou, B., Wang, S., Zhang, S., Feng, Y., Yang, B.,

Liu, G., Liu, D., Qi, L., Zhang, P., Friebe, B., Gill, B.S. (2005). Development and

characterization of wheat- Leymus racemosus translocation lines with resistance to

Fusarium Head Blight. Theor. Appl. Genet. 111: 941–948.

Chhuneja, P., Kaur, S., Garg, T., Ghai, M., Kaur, S., Prashar, M., Bains, N.S., Goel, R.K.,

Keller, B., Dhaliwal, H.S., and Singh, K. (2008). Mapping of adult plant stripe rust

resistance genes in diploid A genome wheat species and their transfer to bread

wheat. Theor. Appl. Genet. 116: 313–324.

Cho, S., Garvin, D.F., and Muehlbauer, G.J. (2006). Transcriptome analysis and physical

mapping of barley genes in wheat-barley chromosome addition lines. Genetics 172:

1277–1285.

Crasta, O.R., Francki, M.G., Bucholtz, D.B., Sharma, H.C., Zhang, J., Wang, R.-C., Ohm,

H.W., and Anderson, J.M. (2000). Identification and characterization of wheat-

wheatgrass translocation lines and localization of barley yellow dwarf virus

resistance. Genome 43: 698–706.

Delibes, A., Romero, D., Aguaded, S., Duce, A., Mena, M., Lopez-Braña, I., Andrés, M.F.,

Martin-Sanchez, J.-A., and García-Olmedo, F. (1993). Resistance to the cereal cyst

nematode (Heterodera avenae Woll.) transferred from the wild grass Aegilops

ventricosa to hexaploid wheat by a “stepping-stone” procedure. Theor. Appl.

Genet. Int. J. Plant Breed. Res. 87: 402–408. 24

Dewey, D.R. (1984). The genomic system of classification as a guide to intergeneric

hybridization with the perennial Triticeae. Gene Manipulation in Plant

Improvement (Springer, Boston, MA), pp. 209–279.

Dvorak, J., Deal, K.R., and Luo, M.-C. (2006). Discovery and mapping of wheat Ph1

suppressors. Genetics 174: 17–27.

Edet, O.U., Gorafi, Y.S.A., Cho, S., Kishii, M., and Tsujimoto, H. (2018). Novel molecular

marker-assisted strategy for the production of wheat–Leymus mollis chromosome

addition lines. Sci. Rep. 8: 16117.

Food and Agriculture Organization (FAO) (2018). The State of Agricultural Commodity

Markets 2018. Agricultural trade, climate change and food security. Rome.

Licence: CC BY-NC-SA 3.0 IGO.

Figueroa, M., Hammond-Kosack, K.E., and Solomon, P.S. (2018). A review of wheat

diseases-a field perspective. Mol. Plant Pathol. 19: 1523–1536.

Forster, B.P., Miller, T.E., and Law, C.N. (1988). Salt tolerance of two wheat – Agropyron

junceum disomic addition lines. Genome 30: 559–564.

Friebe, B., Jiang, J., Raupp, W.J., McIntosh, R.A., and Gill, B.S. (1996). Characterization

of wheat-alien translocations conferring resistance to diseases and pests: current

status. Euphytica 91: 59-87.

Friebe, B., Zhang, P., Linc, G., and Gill, B.S. (2005). Robertsonian translocations in wheat

arise by centric misdivision of univalents at anaphase I and rejoining of broken

centromeres during interkinesis of meiosis II. Cytogenet. Genome Res. 109: 293–

297. 25

Fu, S., Lv, Z., Qi, B., Guo, X., Li, J., Liu, B., and Han, F. (2012). Molecular Cytogenetic

Characterization of Wheat–Thinopyrum elongatum Addition, Substitution and

Translocation Lines with a Novel Source of Resistance to Wheat Fusarium Head

Blight. J. Genet. Genomics 39: 103–110.

Garrett, K.A. (2013). Big data insights into pest spread. Nat. Clim. Chang. 3: 955–957.

Gaut, B.S., Seymour, D.K., Liu, Q., and Zhou, Y. (2018). Demography and its effects on

genomic variation in crop domestication. Nat. Plants 4: 512–520.

Gill, B.S., Friebe, B., Raupp, W.J., Wilson, D.L., Cox, T.S., Sears, R.G., Brown-Guedira,

G.L., and Fritz, A.K. (2006). Wheat Genetics Resource Center: The first 25 years.

Adv. Agron. 89: 73–136.

Gill, B.S. and Raupp, W.J. (1987). Direct genetic gransfers from Aegilops squarrosa L. to

hexaploid wheat1. Crop Sci. 27: 445.

Gornicki, P., Zhu, H., Wang, J., Challa, G.S., Zhang, Z., Gill, B.S., and Li, W. (2014). The

chloroplast view of the evolution of polyploid wheat. New Phytol. 204: 704-714.

Halloran, G.M., Ogbonnaya, F.C., and Lagudah, E.S. (2008). Triticum (Aegilops) tauschii

in the natural and artificial synthesis of hexaploid wheat. Aust. J. Agric. Res. 59:

475.

Han, H., Bai, L., Su, J., Zhang, J., Song, L., Gao, A., Yang, X., Li, X., Liu, W., and Li, L.

(2014). Genetic rearrangements of six wheat–Agropyron cristatum 6P addition

lines revealed by molecular markers. PLoS One 9: e91066.

Hanlon, L.M., and Mesgaran, M. (2014). The biology of Australian weeds 63.

“Thinopyrum junceiforme” (A. Love and D. Love) A. Love. Plant Protection

Quarterly. 29: 120-126. 26

Haudry, A., Cenci, A., Ravel, C., Bataillon, T., Brunel, D., Poncet, C., Hochu, I., Poirier,

S., Santoni, S., Glémin, S., and David, J. (2007). Grinding up wheat: a massive loss

of nucleotide diversity since domestication. Mol. Biol. Evol. 24: 1506–1517.

He, F., Pasam, R., Shi, F., Kant, S., Keeble-Gagnere, G., Kay, P., Forrest, K., Fritz, A.,

Hucl, P., Wiebe, K., Knox, R., Cuthbert, R., Pozniak, C., Akhunova, A., Morrell,

P.L., Davies, J.P., Webb, S.R., Spangenberg, G., Hayes, B., Daetwyler, H., Tibbits,

J., Hayden, M., Akhunov, E. (2019). Exome sequencing highlights the role of wild-

relative introgression in shaping the adaptive landscape of the wheat genome. Nat.

Genet. 51: 896–904.

Heun, M., Schäfer-Pregl, R., Klawan, D., Castagna, R., Accerbi, M., Borghi, B., and

Salamini, F. (1997). Site of einkorn wheat domestication identified by DNA

fingerprinting. Science. 278: 1312-1314

Howell, T., Hale, I., Jankuloski, L., Bonafede, M., Gilbert, M., and Dubcovsky, J. (2014).

Mapping a region within the 1RS.1BL translocation in common wheat affecting

grain yield and canopy water status. Theor. Appl. Genet. 127: 2695–2709.

Huang, X., Börner, A., Röder, M., and Ganal, M. (2002). Assessing genetic diversity of

wheat (Triticum aestivum L.) germplasm using microsatellite markers. Theor.

Appl. Genet. 105: 699–707.

Järve, K., Peusha, H.O., Tsymbalova, J., Tamm, S., Devos, K.M., and Enno, T.M. (2000).

Chromosomal location of a Triticum timopheevii-derived powdery mildew

resistance gene transferred to common wheat. Genome. 43: 377-381.

Jauhar, P.P. and Peterson, T.S. (2001). Hybrids between durum wheat and Thinopyrum

junceiforme: Prospects for breeding for scab resistance. Euphytica 118: 127–136. 27

Jauhar, P.P., Peterson, T.S., and Xu, S.S. (2009). Cytogenetic and molecular

characterization of a durum alien disomic addition line with enhanced tolerance to

Fusarium head blight. Genome 52: 467–483.

Khrustaleva, L.I. and Kik, C. (1998). Cytogenetical studies in the bridge cross Allium

cepa× (A. fistulosum×A. roylei). Theor. Appl. Genet. 96: 8–14.

Kong, L., Song, X., Xiao, J., Sun, H., Dai, K., Lan, C., Singh, P., Yuan, C., Zhang, S.,

Singh, R., Wang, H., and Wang, X. (2018). Development and characterization of a

complete set of Triticum aestivum–Roegneria ciliaris disomic addition lines.

Theor. Appl. Genet. 131: 1793–1806.

Konnerup, D., Malik, A. l. I., Islam, A.K.M.R., and Colmer, T.D. (2017). Evaluation of

root porosity and radial oxygen loss of disomic addition lines of Hordeum marinum

in wheat. Funct. Plant Biol. 44: 400.

Koo, D.H., Liu, W., Friebe, B., and Gill, B.S. (2017). Homoeologous recombination in the

presence of Ph1 gene in wheat. Chromosoma 126: 531–540.

Kuraparthy, V., Chhuneja, P., Dhaliwal, H.S., Kaur, S., Bowden, R.L., and Gill, B.S.

(2007). Characterization and mapping of cryptic alien introgression from Aegilops

geniculata with new leaf rust and stripe rust resistance genes Lr57 and Yr40 in

wheat. Theor. Appl. Genet. 114: 1379–1389.

Kuraparthy, V., Sood, S., and Gill, B.S. (2009). Molecular genetic description of the cryptic

wheat– Aegilops geniculata introgression carrying rust resistance genes Lr57 and

Yr40 using wheat ESTs and synteny with rice. Genome 52: 1025–1036.

Larkin, P.J., Banks, P.M., Lagudah, E.S., Appels, R., Xiao, C., Zhiyong, X., Ohm, H.W.,

and McIntosh, R.A. (1995). Disomic Thinopyrum intermedium addition lines in 28

wheat with barley yellow dwarf virus resistance and with rust resistances. Genome

38: 385–394.

Li, H., Deal, K.R., Luo, M.-C., Ji, W., Distelfeld, A., and Dvorak, J. (2017). Introgression

of the Aegilops speltoides Su1-Ph1 suppressor into wheat. Front. Plant Sci. 8: 2163.

Li, Q., Lu, Y., Pan, C., Zhang, J., Liu, W., Yang, X., Li, X., Xi, Y., and Li, L. (2016).

Characterization of a novel wheat– 2p disomic addition line with powdery mildew

resistance. Crop Sci. 56: 2390.

Li, W., Zhang, Q., Wang, S., Langham, M.A., Singh, D., Bowden, R.L., and Xu, S.S.

(2019). Development and characterization of wheat–sea wheatgrass (Thinopyrum

junceiforme) amphiploids for biotic stress resistance and abiotic stress tolerance.

Theor. Appl. Genet. 132: 163–175.

Liu, C., Guo, T., Du, Y., and Hu, Y.-G. (2018). Nitrogen and phosphorus use efficiency of

43 wheat alien chromosome addition lines evaluated by hydroponic culture. J. Plant

Nutr. 41: 2470–2481.

Lorenz, K. and Pomeranz, Y. (1974). The history, development, and utilization of triticale.

C R C Crit. Rev. Food Technol. 5: 175–280.

Lukaszewski, A.J. (2000). Manipulation of the 1RS.1BL translocation in wheat by induced

homoeologous recombination. Crop Sci. 40: 216.

Mago, R., Miah, H., Lawrence, G.J., Wellings, C.R., Spielmeyer, W., Bariana, H.S.,

McIntosh, R.A., Pryor, A.J., and Ellis, J.G. (2005). High-resolution mapping and

mutation analysis separate the rust resistance genes Sr31, Lr26 and Yr9 on the short

arm of rye chromosome 1. Theor. Appl. Genet. 112: 41–50. 29

Marais, G.F. and Mccallum, B. (2009). Transfer of leaf rust and stripe rust resistance genes

Lr62 and Yr42 from Aegilops neglecta Req. ex Bertol. to common wheat. Crop

Science 49: 871-879.

McMullen, M., Jones, R., and Gallenberg, D. (1997). Scab of wheat and barley: a re-

emerging disease of devastating impact. Plant Dis. 81: 1340–1348.

Mergoum, M., Singh, P.K., Peña, R.J., Lozano-del Río, A.J., Cooper, K.V., Salmon, D.F.,

and Gómez Macpherson, H. (2009). Triticale: A “New” Crop with Old Challenges.

In Cereals (Springer US: New York, NY), pp. 267–287.

Molnár-Láng, M., Linc, G., Logojan, A., and Sutka, J. (2002). Production and meiotic

pairing behavior of new hybrids of winter wheat (Triticum aestivum) × winter

barley (Hordeum vulgare). Genome 43: 1045–1054.

Mori, S., Kishi-NIishizawa, N., and Fujugaki, J. (1990). Identification of rye chromosome

5R as a carrier of the genes for mugineic acid synthetase and 3-hydroxymugineic

acid synthetase using wheat-rye addition lines. Japanese J. Genet. 65: 343–352.

Mujeeb-Kazi, A., Kazi, A.G., Dundas, I., Rasheed, A., Ogbonnaya, F., Kishii, M., Bonnett,

D., Wang, R.R.-C., Xu, S., Chen, P., Mahmood, T., Bux, H., Farrakh, S. (2013).

Genetic diversity for wheat improvement as a conduit to food security. In Advances

in Agronomy, Volume 122 (Elsevier), pp. 179-257.

Mukai, Y., Friebe, B., Hatchett, J.H., Yamamoto, M., and Gill, B.S. (1993). Molecular

cytogenetic analysis of radiation-induced wheat-rye terminal and intercalary

chromosomal translocations and the detection of rye chromatin specifying

resistance to Hessian fly. Chromosoma 102: 88-95. 30

Murai, K., Koba, T., and Shimada, T. (1997). Effects of barley chromosome on heading

characters in wheat-barley chromosome addition lines. Euphytica 96: 281–287.

Narsai, R., Wang, C., Chen, J., Wu, J., Shou, H., and Whelan, J. (2013). Antagonistic,

overlapping and distinct responses to biotic stress in rice (Oryza sativa) and

interactions with abiotic stress. BMC Genomics 14: 93.

Niu, Z., Chao, S., Cai, X., Whetten, R.B., Breiland, M., Cowger, C., Chen, X., Friebe, B.,

Gill, B.S., Rasmussen, J.B., Klindworth, D.L., and Xu, S.S. (2018). Molecular and

cytogenetic characterization of six wheat-Aegilops markgrafii disomic addition

lines and their resistance to rusts and powdery mildew. Front. Plant Sci. 9: 1616.

Nkongolo, K.K., Quick, J.S., Peairs, F.B., and Meyer, W.L. (1990). Gene location for

Russian wheat aphid resistance of “imperial” rye using wheat - rye addition lines.

Cereal Res. Commun. 18: 307–313.

Okamoto, M. (1957). Asynaptic effect of chromosome V. Wheat Inf. Serv. 5: 6.

Orellana, J., Cermeño, M.C., and Lacadena, J.R. (1984). Meiotic pairing in wheat–rye

addition and substitution lines. Can. J. Genet. Cytol. 26: 25–33.

Ozkan, H., Brandolini, A., Pozzi, C., Effgen, S., Wunder, J., and Salamini, F. (2005). A

reconsideration of the domestication geography of tetraploid wheats. Theor. Appl.

Genet. 110: 1052–1060.

Pandey, P., Irulappan, V., Bagavathiannan, M. V, and Senthil-Kumar, M. (2017). Impact

of combined abiotic and biotic stresses on plant growth and avenues for crop

improvement by exploiting physio-morphological traits. Front. Plant Sci. 8: 537. 31

Patokar, C., Sepsi, A., Schwarzacher, T., Kishii, M., and Heslop-Harrison, J.S. (2016).

Molecular cytogenetic characterization of novel wheat-Thinopyrum bessarabicum

recombinant lines carrying intercalary translocations. Chromosoma 125: 163–172.

Petersen, S., Lyerly, J.H., Worthington, M.L., Parks, W.R., Cowger, C., Marshall, D.S.,

Brown-Guedira, G., and Murphy, J.P. (2015). Mapping of powdery mildew

resistance gene Pm53 introgressed from Aegilops speltoides into soft red winter

wheat. Theor. Appl. Genet. 128: 303–312.

Pratap, A. and Kumar, J. (2014). Alien Gene Transfer in Crop Plants: An Introduction. In

Alien Gene Transfer in Crop Plants, Volume 1 (Springer New York: New York,

NY), pp. 1–23.

Qi, L., Cao, M., Chen, P., Li, W., and Liu, D. (1996). Identification, mapping, and

application of polymorphic DNA associated with resistance gene Pm21 of wheat.

Genome 39: 191–7.

Qi, L., Friebe, B., Zhang, P., and Gill, B.S. (2007). Homoeologous recombination,

chromosome engineering and crop improvement. Chromosom. Res. 15: 3–19.

Ren, T.-H., Chen, F., Yan, B.-J., Zhang, H.-Q., and Ren, Z.-L. (2012). Genetic diversity of

wheat–rye 1BL.1RS translocation lines derived from different wheat and rye

sources. Euphytica 183: 133–146.

Repellin, A., Båga, M., Jauhar, P.P., and Chibbar, R.N. (2001). Genetic enrichment of

cereal crops via alien gene transfer: New challenges. Plant Cell. Tissue Organ Cult.

64: 159–183.

Riley, R. and Chapman, V. (1958). Genetic control of the cytologically diploid behaviour

of hexaploid wheat. Nature 182: 713–715. 32

Sakai, K., Nasuda, S., Sato, K., and Endo, T.R. (2009). Dissection of barley chromosome

3H in common wheat and a comparison of 3H physical and genetic maps. Genes

Genet. Syst. 84: 25–34.

Salamini, F., Özkan, H., Brandolini, A., Schäfer-Pregl, R., and Martin, W. (2002). Genetics

and geography of wild cereal domestication in the near east. Nat. Rev. Genet. 3:

429-441.

Salvador-Moreno, N., Ryan, P.R., Holguín, I., Delhaize, E., Benito, C., and Gallego, F.J.

(2018). Transcriptional profiling of wheat and wheat-rye addition lines to identify

candidate genes for aluminum tolerance. Biol. Plant. 62: 741–749.

Schneider, A., Rakszegi, M., Molnár-Láng, M., and Szakács, É. (2016). Production and

cytomolecular identification of new wheat-perennial rye (Secale cereanum)

disomic addition lines with yellow rust resistance (6R) and increased arabinoxylan

and protein content (1R, 4R, 6R). Theor. Appl. Genet. 129: 1045–1059.

Schwarzacher, T., Anamthawat-Jónsson, K., Harrison, G.E., Islam, A.K.M.R., Jia, J.Z.,

King, I.P., Leitch, A.R., Miller, T.E., Reader, S.M., Rogers, W.J., Shi, M., and

Heslop-Harrison, J.S. (1992). Genomic in situ hybridization to identify alien

chromosomes and chromosome segments in wheat. Theor. Appl. Genet. 84–84:

778–786.

Sears, E.R. (1956). The transfer of leaf-rust resistance from Aegilops umbellulata to wheat.

In Genetics in plant breeding. Brookhaven Symp. Biol. Volume 9, pp. 1–21.

Sears, E.R. (1972). Chromosome Engineering in Wheat. Stadler Symposia, Volume 4, pp.

23–38. 33

Sears, E.R. 1982. A wheat mutant conditioning an intermediate level of homoeologous

chromosome pairing. Canadian Journal of Genetics and Cytology 24: 715-719.

Shewry, P.R., Halford, N.G., Belton, P.S., and Tatham, A.S. (2002). The structure and

properties of gluten: an elastic protein from wheat grain. Philos. Trans. R. Soc.

Lond. B. Biol. Sci. 357: 133–42.

Thuillet, A.-C., Bataillon, T., Poirier, S., Santoni, S., and David, J.L. (2005). Estimation of

long-term effective population sizes through the history of durum wheat using

microsatellite data. Genetics 169: 1589–99.

Tigchelaar, M., Battisti, D.S., Naylor, R.L., and Ray, D.K. (2018). Future warming

increases the probability of globally synchronized maize production shocks. Proc.

Natl. Acad. Sci. U. S. A. 115: 6644–6649.

Tikhenko, N., Rutten, T., Senula, A., Rubtsova, M., Keller, E.R.J., and Börner, A. (2017).

The changes in the reproductive barrier between hexaploid wheat (Triticum

aestivum L.) and rye (Secale cereale L.): different states lead to different fates.

Planta 246: 377–388.

Tilman, D., Balzer, C., Hill, J., and Befort, B.L. (2011). Global food demand and the

sustainable intensification of agriculture. Proc. Natl. Acad. Sci. U. S. A. 108:

20260–4.

Tito, R., Vasconcelos, H.L., and Feeley, K.J. (2018). Global climate change increases the

risk of crop yield losses and food insecurity in the tropical Andes. Glob. Chang.

Biol. 24: e592–e602. 34

Turner, M.K., DeHaan, L.R., Jin, Y., and Anderson, J.A. (2013). Wheatgrass–wheat partial

amphiploids as a novel source of stem rust and fusarium head blight resistance.

Crop Sci. 53: 1994.

Váry, Z., Mullins, E., McElwain, J.C., and Doohan, F.M. (2015). The severity of wheat

diseases increases when plants and pathogens are acclimatized to elevated carbon

dioxide. Glob. Chang. Biol. 21: 2661–2669.

Wang, R.R. ‐C., Li, X., Hu, Z., Zhang, J., Larson, S.R., Zhang, X., Grieve, C.M., and

Shannon, M.C. (2003). Development of Salinity‐Tolerant Wheat Recombinant

Lines from a Wheat Disomic Addition Line Carrying a Thinopyrum junceum

Chromosome. Int. J. Plant Sci. 164: 25–33.

Wang, J., Luo, M.C., Chen, Z., You, F.M., Wei, Y., Zheng, Y., and Dvorak, J. (2013).

Aegilops tauschii single nucleotide polymorphisms shed light on the origins of

wheat D-genome genetic diversity and pinpoint the geographic origin of hexaploid

wheat. New Phytol. 198: 925-937.

Wang, X., Wang, Y., Wang, C., Chen, Y., Chen, Y., Feng, S., Zhao, T., and Zhou, B.

(2016). Characterization of eleven monosomic alien addition lines added from

Gossypium anomalum to Gossypium hirsutum using improved GISH and SSR

markers. BMC Plant Biol. 16: 218.

Yan, L. and Bhave, M. (2001). Characterization of waxy proteins and waxy genes of

Triticum timopheevii and T. zhukovskyi and implications for the evolution of wheat.

Genome. 44: 582-588.

Zhang, J., Zhang, J., Liu, W., Han, H., Lu, Y., Yang, X., Li, X., and Li, L. (2015).

Introgression of Agropyron cristatum 6P chromosome segment into common wheat 35

for enhanced thousand-grain weight and spike length. Theor. Appl. Genet. 128:

1827–1837.

Zhang, P., Dundas, I.S., Xu, S.S., Friebe, B., McIntosh, R.A., and Raupp, W.J. (2017).

Chromosome Engineering Techniques for Targeted Introgression of Rust

Resistance from Wild Wheat Relatives. In (Humana Press, New York, NY), pp.

163–172.

Zhang, Q., Li, Q., Wang, X., Wang, H., Lang, S., Wang, Y., Wang, S., Chen, P., and Liu,

D. (2005). Development and characterization of a Triticum aestivum-Haynaldia

villosa translocation line T4VS·4DL conferring resistance to wheat spindle streak

mosaic virus. Euphytica 145: 317–320. 36

Chapter 2: Development of Sea wheatgrass-specific Markers

37

Abstract

Molecular markers are powerful tools to screen large populations for desirable genotypes in a high throughput manner. The SWG genome, however, is so distinct from the wheat genome that molecular markers available from wheat cannot be applied to SWG genome studies. To design SWG-specific molecular markers, we used a draft assembly of the SWG genome. We retrieved SWG sequence contigs using single copy expressed sequence tags

(ESTs) of wheat, genic regions of A. tauschii harboring microsatellites and predicted high confidence coding sequence (CDS) of A. tauschii as queries and then aligned the SWG sequences with their wheat homoeologs for insertions/deletions (indels). Targeting these indels, we designed a total of 227 markers, out of which 127 markers are specific to SWG and amphiploid developed from SWG. Mapping the markers to the wheat and A. tauschii genomes located their chromosomal positions based on the hypothesis of high-level collinearity between the SWG and wheat genomes. We also tested the transferability of these markers to the species related to SWG, including Th. bessarabicum, Th. elongatum and D. villosum. Results showed that Th. bessarabicum was specific to the highest number of markers applied, and Th. elongatum was specific to the highest number of markers applied. Our results demonstrated that the markers developed are robust and reproducible and an important genomic resource for wheatgrass species.

38

Introduction

There are no tools for the molecular level selection, excision, and transfer of the precise alien chromatin to the wheat genome. Rather, transfer of an alien gene is largely by chance events occurring randomly. Given the variables such as independent segregation of chromosomes and irregularities during meiosis, chances for obtaining the desired genotypes are low (Sears 1972). In order to obtain the desired genotypes, large segregating populations and multiple generations are required. Production and handling of large plant populations can be costly, and phenotype screening of the large populations are time- consuming and laborious. Thus, a cost-effective and high throughput screening platform is necessary for successful and effective transfer of useful genes from wild species to crops.

Most commonly employed method for the screening of alien chromosomes derived from wild relatives is genomic in situ hybridization (GISH) (Schwarzacher et al., 1992,

Schwarzacher et al., 1989). GISH has been used to characterize addition lines and alien introgressions (Kuraparthy et al., 2007; Jauhar et al., 2009; Patokar et al., 2016). GISH readily identifies the alien chromosomes in amphiploids, addition lines, substitution lines, and translocation lines but it is a low throughput approach (Li et al., 2016). Slide preparation and microscopic observation cannot be multiplexed and applied to automation and required to be viewed individually and manually. Whereas, the DNA-based molecular markers are high throughput technologies and have been applied to screen the segregating populations (Edet et al., 2018; Jauhar et al., 2009; Kong et al., 2018). As divergence between the wild species and a crop species increases, transfer of a marker from the crop to the wild species becomes challenging. The genomes of the wild species in the tertiary gene pools of wheat can be very distinct from wheat due to relatively low sequence 39 similarity or structural rearrangements. This limits the suitability of existing molecular markers in wheat for developing germplasm from the tertiary gene pool. To solve the problem, it is necessary to develop genomic resources for the alien species of interest.

Whole-genome sequencing, genotyping by sequencing (GBS), individual chromosome sequencing, specific locus amplified fragment sequencing (SLAF-seq) markers, and RNA sequencing can be employed to obtain structural data of alien genome or transcriptome (Brozynska, Furtado, and Henry 2016; Edae et al., 2017; Edet et al., 2018;

Li et al., 2014, 2016; Li et al., 2019; Xiao et al., 2017; Y. Zhang et al., 2015). These methods provide precise knowledge of alien genome’s DNA information that enables the development of DNA-based molecular markers. Molecular markers have two major advantages over the cytogenetic techniques: 1) The process can be multiplexed and thus reduces costs and saves time, and 2) molecular markers (such as SNPs, indels and SSRs) are abundant across the genome. A large number of molecular markers can be designed, allowing the introgression and identification of smaller alien gene fragments. Furthermore, molecular markers can be employed to screen early generations of backcrossing populations. With the information about the genomic constitution of the backcrossing progenies, in the further steps, selective backcrosses can be made to get precise outcomes.

In this study, we used the SWG genome sequences to design specific molecular markers. The molecular markers thus designed were used to identify and characterize wheat-SWG chromosome addition lines. These molecular markers will also assist in further steps of chromosome engineering, gene introgression, and gene mapping. 40

Materials and Methods

Plant materials

A complete wheat-SWG amphiploid 13G819 was developed from a cross between emmer wheat 13G139 and Th. junceiforme accession PI 414667 (Li et al., 2019). Th. junceiforme

(PI 414667), Th. bessarabicum (PI 531711), and Th. elongatum (PI 531718) were provided by Dr. David Stout of USDA-ARS (Pullman, WA), and Chinese Spring (CS) was obtained from Dr. Bikram S. Gill of Kansas State University (Manhattan, KS).

Marker development

With the support of a USDA NIFA-funded project, our lab sequenced the SWG genome and developed a draft assembly. The 2.7 billion paired-end reads were assembled, and the draft assembly contains 24 million contigs (>200bp) with a total assembled size of ~10 Gb

(Li, unpublished). The SWG contigs were retrieved using unique query sequences from the wheat EST database (https://wheat.pw.usda.gov/westsql/index.html), wheat genome assembly (IWGSC, 2018; IWGSC, 2014), A. tauschii microsatellite/Simple sequence repeat (SSR) pseudomolecules database and A. tauschii high confidence CDS database

(Luo et al., 2017). The SWG sequences retrieved were aligned with their wheat homoeologs using computer program Multiple Sequence Comparison by Log-Expectation

(MUSCLE) (Edgar 2004) to identify indels. The alignments were feed to the genome- specific primer (GSP) tool (Wang et al., 2016) to design primers. Primer3 (Kõressaar et al., 2018) was also used to pick primers from the SWG sequence. 41

The specificity of the markers for SWG genome was tested by carrying out polymerase chain reaction (PCR) using genomic DNA of CS, emmer wheat (13G139),

SWG and wheat-SWG amphiploid (13G819). Genomic DNA was isolated from the plant leaves according to (Li et. al, 2008) with some modifications using DNA extraction buffer containing CTAB (Cetyl Trimethyl Ammonium Bromide) rather than SDS (Sodium

Dodecyl Sulfate). The genomic DNA was diluted to concentration ~100ng/µl to carry out

PCR. A 15µl reaction contained 100 ng of genomic DNA, 0.2 µM primers, 1x GoTaq® buffer (Promega), 0.25mM dNTPs, and 1 unit of Taq polymerase. The PCR was carried out on the GeneAmp® PCR System 9700 and Veriti thermocyclers (ThermoFisher

Scientific). PCR profile consisted of initial denaturation for 4 min at 94⁰C, 35 cycles of 30 sec at 94⁰C, 30 sec at 51-59⁰C, 55-60 sec at 72⁰C, and 7 min of final extension at 72⁰C. The

PCR products were separated on the 3% agarose gel or 6% polyacrylamide gel. The gel was stained using Ethidium bromide and viewed under UV light in a Gel documentation system U: GENIUS (SYNGENE).

Results

Our pipeline for designing the SWG-specific primers included the selection of wheat or A. tauschii sequences as queries to retrieve SWG sequences by standalone BLASTn searches, alignment of the SWG sequences and wheat homoeologs using ‘MUSCLE’ tool to identify the indels or ONPs, and design primers targeting the indels or ONPs using GSP or Primer3.

Three types of queries were used in the time course. At the beginning of the project, we selected the mapped single-copy ESTs (https://wheat.pw.usda.gov/westsql/index.html), and 56 pairs of primers were designed using the wheat ESTs as queries. After the 42 annotation of A. tauschii genome sequences became available (Luo et al., 2017), we used the microsatellite-containing genes as queries based on the hypothesis that microsatellite sequences are highly variable, and 68 primer pairs were designed using this approach. We also selected 78 primer pairs using A. tauschii high confidence CDS database. Four markers were designed using known gene sequences, two from the puroindoline A sequence

(Lillemo, Cosimo, and Morris 2002), one from the TaEXPB1 sequence (Liu et al., 2007), and one from the TthV sequence (Castagnaro et al., 1992). In addition, 14 primer pairs were adopted from published literature (He et al., 2013; Kaur et al., 2008; Ali et al., 2016;

Cao et al., 2009; Zhang et al., 2018).

A total of 227 markers were designed. Out of 227 markers, 140 markers specific amplified from SWG, of which 127 markers amplified a fragment from both SWG and amphiploid (13G819) (Fig. 2.1a), and 13 markers amplified fragments specifically from the SWG DNA only and did not amplify any fragment from the amphiploid (13G819) DNA

(Fig. 2.1b). Remaining 87 markers were monomorphic for the CS, 13G139, 13G819, and

SWG DNA (Fig. 2.1c). 43

Figure 2.1. Validation of genome specificity of the designed markers. a) Marker is specific for SWG and amphiploid. b) Marker is specific for SWG. c) Marker is monomorphic for all parents. Names of markers are indicated at the bottom, and the DNA samples are indicated on the top of the figure. Marker at the left side of the figure is a 100bp ladder. 44

Out of the 127 markers, 22 markers were designed using the EST-based pipeline, 50 using the A. tauschii high confidence CDS as queries, 48 using the A. tauschii microsatellite- containing genes as queries, and one marker using puroindoline A sequence. The remaining six markers were transferred from D. villosum (four markers) and Leymus (two markers) by adopting the primer sequences from the published literature (He et al., 2013; Kaur et al., 2008). Out of 127 markers, 19 are co-dominant, which amplified polymorphic fragments from the SWG and wheat genomes. Thus, amphiploid (13G819) DNA had both the fragments amplified.

We tried to select the queries more or less evenly from the wheat/A. tauschii genomes, but not all the SWG sequences retrieved produced specific markers. We placed the 127 SWG-specific markers to 7 chromosomes of A. tauschii, the core genome of

Triticeae species, by BLASTn searches of its annotated genome (Fig. 2.2). We found that most of the genic sequences of wheat or A. tauschii have identity ranging from 87% to 98% when aligned to sea wheatgrass genome.

We randomly selected 32 SWG-specific markers and applied to the DNA of Th. bessarabicum, Th. elongatum, and D. villosum (Table 2.1). Out of 32, 21 were positive for

Th. bessarabicum, 10 markers were positive for D. villosum, and nine markers were positive for Th. elongatum. Only two markers were specific to all four species (Th. junceiforme, Th. bessarabicum, D. villosum, and Th. elongatum). This result represents the variation among the species closely related to SWG and transferability of markers designed to the SWG’s related species.

45

Table 2.1. Distribution of the number of markers specific to each subset of the species tested.

Species positive for markers Number of markers

SWG 2

SWG, TB 14

SWG, DV 6

SWG, TE 3

SWG, TB, TE 3

SWG, TB, DV 1

SWG, TE, DV 1

SWG, TB, TE, DV 2

SWG- Sea wheatgrass, TB- Th. bessarabicum, TE- Th. elongatum and DV- D. villosum.

46

Figure 2.2. Location of the SWG markers on Aegilops tauschii chromosomes. The position is determined by aligning SWG contig (from which the marker was designed) to

A. tauschii genome. The green-colored text represents markers are specific for J1 genome, the blue-colored text represents markers are specific for J2 genome, purple colored markers are specific to both genomes and black colored is not assigned to any sub-genome. Four markers at the bottom were not assigned any position because WL5053, WL5055, and

WL5009 are specific to multiple locations on SWG genome and WL4830 was designed from a group three chromosome sequence (A. tauschii) but was specific to 5J2 of SWG and we were not able to locate the marker’s position on chromosome 5 of A. tauschii.

We assigned 127 SWG-specific markers to individual SWG chromosomes (Table

2.2). Out of 127, 41 markers were assigned to the J1 genome and 48 markers were specific 47

to the J2 genome. Eleven markers were specific to both genomes. Remaining 27 markers have not assigned to a particular subgenome.

Table 2.2. Numbers of markers specific for each SWG chromosome.

Homoeologous J1 genome- J2 genome- J1 and J2 To be Total

groups specific specific markers assigned

markers markers

1 5 10 1 3 19

2 8 6 1 4 19

3 9 5 2 2 18

4 4 4 4 3 15

5 8 7 1 8 24

6 5 7 1 3 16

7 2 9 1 4 16

Total 41 48 11 27 127

J1 and J2 represent two subgenomes of Sea wheatgrass. 48

Table 2.3. Primer sequences, homoeologous group, product size and annealing temperature of SWG-specific markers.

Annealing

Marker Forward Primer Reverse Primer Homoeologous group Product Size (bp) temperature (⁰C)

WL4503 TACAACAGCAACAGAAGTGT AGACACAGCTCCTCATCAACG 7 386 55

WL4505 GTAAGCTGCTCTCACCTGCAT GGCCCATAAACTGGAACCCT 7 487 57

WL4511 TGCCTACACAAAGATGGAAGC GCTCTGCAATTCTGCTTGTT 3 373 53

WL4513 GCTGTTTGCATTCACTTGCT TTGTGTGAGTTTATGTGTGTGTG 3 449 53

WL4515 AAGTTCTAGGGGCAAAAAGGA CTACGGAGATGCCGATCAA 4 310 53

WL4517 ATCCAACTAATTTTGTAAGCGTTAGC CTACGAGAGCAAGCAGGAGG 5 167 53

WL4523 GCAGAACCATCGCCATCTC GGGAAGCGGACTCTAAAAGAA 4 355 53

WL4531 ATATGGAAGAATAACGAACAGCA GGTTCGGATTGCAGGGTT 6 680 54

WL4533 ATATGGAAGAATAACGAACAGCA GGGCCTTTATGAATTGGCT 6 267 56

WL4537 AGATTTGCACTAACACGGGAA TCGTTCCCCTCGCTTGTAGT 5 400 54

WL4539 ATCCAGGGGGTAAGCAACA GTGCTGAATCGGTGTGGTTT 4 443 54

WL4569 GAGGCAGCACATCTAAAACAGC GCAGAGAGAAAACCAGCTTCA 1 439 54

WL4581 GCAGGGAGAAATCAAAGAGGAA TCTAATAAACCGCACGCAAATA 1 309 54

WL4583 CAAAGAAAAAGCTATCACTGGGT ATTTGCGTGGCTGGTGAA 1 493 54

WL4591 CTTGCCCCGTCGATTTAC ATTGTTAATGGTGGATGAGAAAG 2 306 55

WL4593 TTAATGCTGGAAGACGCC TTTCCTTTGCGGATAGCAGATAG 2 330 55 49

Annealing

Marker Forward Primer Reverse Primer Homoeologous group Product Size (bp) temperature (⁰C)

WL4619 GTTATGGGTGTCAGTGAGGTG GTGAACATCGCTGGAATTGG 2 290 55

WL4623 GCGAATAACGGACATCACTAGC GATCGAGGTCATGGTACACTTGG 7 475 55

WL4625 TATGGCTTCATTACCTGTGTTG CTTTGTTCCCATCATTCTCCTTG 5 639 55

WL4627 ACTTGCTGGAAAAACAAGCGATA GGGACTTTGTTTAGATTTCCAAC 5 216 55

WL4661 ATGCTGTGATCGGTTCGGT TTTTTGGCACGAAACAAACT 4 530 55

WL4663 AATGCCTATGAAGACAGGGTAAA GTTGTGTGGCAGTTGTCGTATAG 4 316 55

WL4665 CTTGAAACGGCCCCTACTTTTT GCTTTTCATGTGCCTAGTTATTG 2 600 55

WL4830 TACCATCCAGCCTAACCGAC CTGGCCCTCTCTATGCACAT 5 717 54

WL4832 GGGACGGTACTCCCTCTTCT TCCAACGGATAGTTCCTGGT 3 153 54

WL4880 TAGCACACCTACCACGGACA GGCAAATAAGGCTGAGGTGA 2 166 54

WL4902 AGACCTTGCCGGAATCAAC CAACCCACATTGCCTTCTCT 6 201 54

WL4904 TCTGGAGGCCCACTATTGC GGTTCGCCAGTTTGCTCTT 6 246 54

WL4908 TTTGCCTCCCAACCATTTAC ACAACCTCTGCTTCCCTCTG 1 218 57

WL4914 TCTTATCCGCACGTTACAGC GATTTCCCAGGATGCAACAC 4 210 54

WL4918 ATCACGACTGAGAGGGGAAA TTGGTGTGAGCTTGGTTTGA 6 215 57

WL4922 TTTTCTTGTTGCTGCGAGTG GTCCCTTTCGTCACACCCTA 1 248 57

WL4930 CAACGGATTTCATCGAGTGT GTGGTGTTCTTGCTCCCTCT 5 212 57

WL4934 TATCCCATTGTCACCACGAA AGGCTGAGGGTTTGTACCAG 7 247 57 50

Annealing

Marker Forward Primer Reverse Primer Homoeologous group Product Size (bp) temperature (⁰C)

WL4938 CATTGCCATTCACAGCATTT TAGGTTTCGCGGTGAGAATA 2 246 54

WL4940 AGAGTTTGGGGCTGAATCCT TCCACCAAGGTCAGAACACA 3 218 54

WL4966 TTTATGCCCAATCTTGTGTTCAT CCAAAGCCCTTCCTGCAA 1 206 57

WL4968 CGCGAATCGTCTTGCTGAAA AGTCGAAGTTGCATTCCAGTG 2 166 57

WL4972 ACCATGAATCGGGCACAGTA AGATCAGATTACACACCTGCAA 4 299 57

WL4974 ACAGCTTGGGTCCATTCTCT GCTAGTCCACTTAATTCCACCA 5 249 57

WL4976 GACTCGTACAAACACCATCTGA CTGTTCCTCACACCCCTCTA 6 880 57

WL5009 GTCGATGTTCAGCTGGCA GACGAGGGTGGGGAAGTG 5 700 57

WL5031 AAGTCCCCATTCCTCAGCAT TCGCCATCAAAACCCTCTAC 2 166 59

WL5033 AATCTCATGTGCGTGCAATG CACAAAGCTTAACGTGTACTGT 4 442 57

WL5035 GGAAAGGCGTCGATGGATAC GGTAGAGCTGTAGACCGTCG 4 201 57

WL5039 CTACTACGAGCGATTGGTGC CTACTTTATTACCCGGCGCG 6 240 57

WL5041 GAATAGGGTTGGCGTCGTTC TCTGGGTCTGAACTTGCACT 7 214 57

WL5043 GAGGGTGTGGTAGGCTTAGTAA GCATAACAAAGCATCGTCTGT 7 365 57

WL5049 CCCACCCGTATCCATCCTC GCCGAAGAGCAGGAAGGT 1 177 57

WL5051 AGACGTTCAACCTCGATAGCA TGTGAATTGCAGGTAGGGGA 2 248 59

WL5053** CTCAGCGAGGATCAGACAATGC AATGGCCAGAGAAACGAGAAAGAG 4 145 53

WL5055** TGTATGTATGTTTGTTTCGTCCTTTG CTGTGAGCACACATCACGAGTAAG 4 82 53 51

Annealing

Marker Forward Primer Reverse Primer Homoeologous group Product Size (bp) temperature (⁰C)

WL5057 AGTCCTCTTCCTCATGCCAG GTCCGCCTAGCCTTCAGTT 3 371 57

WL5059 GGTAAGTTGGTAACCCTGTAAGT CTCGTTCAAGGCCAGTATTTGA 4 474 57

WL5063 AGAAAAGCCACACACACACA CGACCCAGAACGACACCAT 1 242 57

WL5065 GGACAGCAGGACACAAAGTAAG TGTTCTTCATTTTACCCCAGTGA 1 474 57

WL5067 CCCTACACGCCTGTTTTGTC TGCAGAGTCACAGCCTTACA 6 163 57

WL5071 CGTTTATGTGCTGGATCGGG GGCCCAGCTTGTCATTTTGA 7 197 57

WL5073 GCTCATTCGCAAATTCACCG GCAGACCGGCCAAATCAA 7 564 57

WL5079 TGTAAACACCTAACAACCGCT AATGCGCCATACAACTCAGG 3 340 57

WL5081 TGAACTTGAAGTGGATGCTCA AGGAACGAGACAACATCACATAT 3 181 57

WL5083 GACGGAGAGCGGAGTGTACC TTTTGCTCCATACCATCCACCT 5 163 57

WL5085 TGGAATTACAAATGGATCGATGG TCATTCAGAAAGCTTGGACAATA 5 270 57

WL5087 TGAACTGAAGAGTGCAGAGCAAG CGAGCGTTCTTTGTATTTGATTT 1 317 57

WL5091 CATCTCATTATCACCACTGTTCG GGGCCTGATGCTAATCTCTT 2 527 57

WL5093 GTCGGTTCCTTGATTGCGTC AGTAAGATTTGACTGCGTGCA 3 218 57

WL5123 GTCCGCCACAACGTATGA TCGAGACAACATTCAGCGAA 4 358 57

WL5125 AGCAGAAAGAGAGAGGTGAAGT GAGCATCCTAGTCAAAGTAACCA 4 286 57

WL5129 TCGAGCGAGCCTTACGATTC GGGGCTGCAAACGTTCTTAA 3 234 57

WL5133 CGATACATAGCACCCTCCGT CTTTGCTTAGCCAGGTCCAC 3 169 57 52

Annealing

Marker Forward Primer Reverse Primer Homoeologous group Product Size (bp) temperature (⁰C)

WL5135 ACCCGTAACGAACACTTGATG CTCACCCGTTTCTGCGTC 3 248 57

WL5137 TTGTGGAATGATCAGTAAACGC ACACACACCCCAATTCCTGT 5 500 57

WL5160 GGCAATCGGAGCATACACAT ATACGGGGAAATGCGAGGTT 4 248 59

WL5166 GCGATTGGTGCAAGTAAACT TCATGTTCAGCCCAGATTAGC 1 242 57

WL5170 CCCTTCTTCGACCTACAGCT GTGATCGACGGGGCTAGAG 5 248 57

WL5172 ATAACGCTAGAGACTCCGCC GAGATCTACGCCACGACTGA 5 196 57

WL5174 GTGCAAGCGTCGGTGAATT TGGTTTATTCGTTTTCAGCCGT 7 215 57

WL5312 CTGCTTGGTCGCTGTATGTC CTCGATCAACCGCTTACCAC 6 202 57

WL5314 TGTCAGTTGGCCCATCAGAA GTACTGGCCTATCGGAGCAG 6 169 53

WL5316 CAGAGCGACAGATTCAACGG CTGGAGCCATTGAAGCAGTG 6 239 57

WL5337 GATCAGCCCTATCCAAGCAA AGGTACAAGCAGCCTTAGTGT 7 180 57

WL5341 GCCGCTAACCATCCTCAACT GCCTAGATGACCAGCCCTTA 7 152 57

WL5356 TAAGGTCAGGTTGGCTTCGG TTCGTCGCGGCCCTAAAA 7 242 57

WL5358 GCAATCAGGTGTGGGTTTCC AACTGAGCGAGCTGGATGAT 7 250 57

WL5384 TGGTTAGGGTCGTACTCACTG CGACACGCACGTTATAGAGA 3 177 57

WL5388 GGAACACCCTTTCTTCAGTCC TAGCTATGTGGGCCAAGGAA 3 159 57

WL5390 AGAAGATCGACCGCCACAA GTCGCTGTTGTGCTACTCG 3 203 57

WL5392 ACGGGACACTCAATAGAACTGT GTAAGCCCTAACCCGTTGC 3 283 57 53

Annealing

Marker Forward Primer Reverse Primer Homoeologous group Product Size (bp) temperature (⁰C)

WL5396 CCGAATCTGCTGCGAAATAATT ACCCTTGTCCGTTTAGTTCAC 2 130 57

WL5400 CACAGGCAGACTCGCAATT AGTCACACAGCTCAGTACCC 2 220 57

WL5406 TGCGCCCAGTGTATATAGCA TGCATCTCCCACACTCATCA 1 237 57

WL5410 GCGTTTATTGAGCTTCCGGT TTTTCCTCCGTTCCAGTGTT 1 650 57

WL5412 GCCTCTAGAAACTCCCCTCC GTTTTGAATCGGGCAGCGAT 1 229 57

WL5414 ACCGGTTCACCCTTGGAAAA TGGACTGAGAGGAAGTTCGG 1 194 57

WL5416 TCACCTGTTCACCCTTGGAA TTTGCAGACGATGATTGGGG 1 157 57

WL5422 ACCGAATCCAAGCTGATCCT CTCCTGTTCTGAGTTGGTGC 1 204 57

WL5428 CGCCATGTCTACGAAAGCAT GCAGGCACACATACGATCTC 7 240 57

WL5430 TGACAGTGGCGGATCTAGAA AAGACCCTATCGTGTGGCAG 1 207 57

WL5432 GATTTCCGCACTAACTCTTTGC ACCAGTCATGTACAACCATCAA 1 198 57

WL5436 TGGGAATTAATGTGGGGCCT CGCTCTAAATTTCCCACGGG 5 166 57

WL5438 ACCGTCTCACAGCATATGGT TCGATACCCAGCATCTCCAT 5 157 57

WL5440 TAATGTTGGCTTGCATCCGG ATGACCTCGGCTATGACTGG 5 245 57

WL5497* GAAGACTGGTAGCGATGCAGTCA AGAACAGATACACCTCCACTGACCA 6 362 52

WL5499* TCAGTTGATGTTACTGAAGATCTGAAGT TTCGGATACATCAGATGGACCAT 6 119 52

WL5501* CCAGGAGGGCCTCCAGGA CTGGGAGCTCCTGCTGCGT 6 390 55

WL5503* CCAACTCTAGCTGACCGCAGACTA ATTCCATGGTGTAATAGCTCCAACTAC 6 459 52 54

Annealing

Marker Forward Primer Reverse Primer Homoeologous group Product Size (bp) temperature (⁰C)

WL5607 CCTTCGAGTGCCACTAACCT CAAGAGCAAGTGACTAGCGC 2 243 57

WL5609 TGGAACCGGATGATTTGGGG GGACTATTGGATTGCGACTCG 2 113 57

WL5611 GCAACCAGTGAGATCGTTCA AACGCCAGACCCCAAATCAT 2 143 57

WL5613 CAGAACGCTCACAGTGACC ACTTGACTGGCCCTGTATTG 2 106 57

WL5615 CTAAGTTTGTGCGTTGCCTG CGTGTATCTGTCGTGAGTGG 2 298 57

WL5617 GCGGTCAATGGCTTTAATTTCC GCCAAACCTTTTCCTGCCTA 2 291 57

WL5619 CGGGTAAACTCGCTAATGAAACT TGTGATGTGTCTGTGTTGTGT 2 156 57

WL5623 GCTTTCGGTCAATAAATCTAGCG TCAAACTAAAAGTCCGCAACAA 3 176 57

WL5627 GGACGACAGTTTACCAGACATC ACATCTACCCAACTGCCCG 3 503 57

WL5631 TTCCGTTCTCTGACACTCCC AGAGAGAGAGAGGGAGGTGG 3 105 57

WL5633 GGACCTGCCCTGCCTAAAT TGGAGAGTTGACCGGTTGAT 5 224 57

WL5635 GTTCAGTCATGGCCTTCTCG ATGCAAACAACTACCCCAGC 5 123 57

WL5637 AAAATCTGTGCCCGACGTAT AGAAGGGTGGTTGCTGACTA 5 154 57

WL5643 TCTCTCCCTCTCTCTCTTAGA GGCAACGCACCAAGATAATC 6 133 57

WL5645 GACACGAAGGATTGAACCCG GGGATGAATACGCGGAGACT 7 300 57

WL5647 TGGACAGATAGCCCGATCAC CAGGGCAGTCGATTTGATGG 7 211 57

WL5651 GGCCCTCAAAGATATAACGGTTT AGTCGCGGCCTCATAGTTTT 2 136 57

WL5673 GGAGACAGGCTGGACAGAAA TTTTACCAAGCACGAACGTT 5 170 57 55

Annealing

Marker Forward Primer Reverse Primer Homoeologous group Product Size (bp) temperature (⁰C)

WL5675 GGGTTGCTCATCTTCCGAATAC TGTCCTACTTGTTCTGCACA 5 190 57

WL5677 CGGCTATCTAACCATGAATCCC CTCTTGCTTCTACGGACTGA 5 122 57

WL5679 CCCTCTAGGCTTCTGTGGG GCTGAGATGAAAGTCGGACA 5 943 57

* Adopted from (He et al., 2013)

** Adopted from (Kaur et al., 2008) 56

Discussion

The objective of this research was to design SWG-specific markers that can cover its entire genome with some uniformity. We developed 127 functional markers with each SWG chromosome having at least three specific markers. All three query types were successfully used to design functional primers. Use of microsatellite-containing genes offered more chances for polymorphism. Use of the A. tauschii genes as queries offered better control over the chromosomal location of the markers (assuming the high genic collinearity between A. tauschii and SWG). Although the positions of wheat ESTs can also be retrieved, it makes the method very time-consuming. Therefore, after the release of Aegilops tauschii genome data (Luo et al., 2017), we shifted to A. tauschii-based marker development.

Out of 140 markers specific to the SWG genome, 127 markers amplified on amphiploid (13G819) DNA. This indicates that the SWG genome is heterozygous, and

13G819 may not have inherited all the genomic content present in SWG accession

PI414667. Based on the ratio of markers specific to both amphiploid and sea wheatgrass,

~ 90% of the heterozygosity in the SWG was captured in the amphiploid 13G819.

Otherwise, these marker loci were deleted during the formation of the amphiploid as observed in other amphiploids derived from crosses between the Triticeae species

(Kashkush et al., 2002; Han et al., 2005, Han et al., 2004).

PCR product size amplified by all markers was consistent between SWG and amphiploid DNA except for six markers. Of these six markers, four were designed using microsatellite-containing genes as queries, and two were designed using the high confidence CDS of A. tauschii. The difference in product size ranged from ~300bp 57

(WL5633) to ~15bp (WL5043). These results suggest most of the DNA content for SWG remained unchanged while transmitted to the amphiploid but certain rearrangements or variations also occurred in a very small portion of the genome when transmitted to amphiploid. These changes can be attributed to DNA polymerase stuttering while synthesizing DNA from microsatellite region and genomic changes occurring as the effect of wide hybridization such as sequence elimination and DNA methylation (Levy and

Feldman, 2004; Ozkan et al., 2001). However, WL5633 and WL5356 (non-SSR markers) amplified a larger fragment in the amphiploid compared to fragment amplified in SWG, so it seems the addition of sequence rather than elimination. Thus, it would be interesting to study the molecular mechanisms causing such changes.

From the designed markers, 32 markers were also applied to three other wild species: Th. bessarabicum, Th. elongatum and D. villosum. We selected these species because they are reported as putative parents of SWG (Liu and Wang, 1992). Out of these

32 markers, 21 markers were specific to Th. bessarabicum and nine for Th. elongatum genome (Table 2.2). This indicates the SWG genome is more related to Th. bessarabicum than Th. elongatum which is consistent with the previous study (Nieto-López et al., 2003).

This result implies that markers designed in our study can be transferred to closely related species of SWG as well. As SWG is an allotetraploid, these markers can be useful to shed more light on the donor of each genome. Thus, markers designed in our study, combined with more SWG specific markers have the potential to draw evolutionary relationships among Thinopyrum and related species.

Markers designed here are a novel genetic resource for the exploitation of SWG.

They are roughly distributed across the entire SWG genome. They serve as a unique 58 identification feature of each SWG chromosome (or genomic region) thus can be used to characterize SWG chromosomes or chromosome fragments. Lastly, our work demonstrated the usability of markers designed in the chromosome engineering steps for transferring SWG genes to wheat.

References Cited: International Wheat Genome Sequencing Consortium (IWGSC) (2018). Shifting the limits

in wheat research and breeding using a fully annotated reference genome. Science.

361: eaar7191.

Ali, N., Heslop-Harrison, J., Ahmad, H., Graybosch, R.A., Hein, G.L., and Schwarzacher,

T. (2016). Introgression of chromosome segments from multiple alien species in

wheat breeding lines with wheat streak mosaic virus resistance. Heredity (Edinb).

117: 114–123.

Brozynska, M., Furtado, A., and Henry, R.J. (2016). Genomics of crop wild relatives:

expanding the gene pool for crop improvement. Plant Biotechnol. J. 14: 1070–

1085.

Cao, Y.P., Cao, A.Z., Wang, X.E., and Chen, P.D. (2009). Screening and application of

EST-based PCR markers specific to individual chromosomes of Haynaldia villosa.

Acta Agron. Sin. 35: 1–10.

Castagnaro, A., Maraña, C., Carbonero, P., and García-Olmedo, F. (1992). Extreme

divergence of a novel wheat thionin generated by a mutational burst specifically

affecting the mature protein domain of the precursor. J. Mol. Biol. 224: 1003–1009. 59

Edae, E.A., Olivera, P.D., Jin, Y., and Rouse, M.N. (2017). Genotyping-by-sequencing

facilitates a high-density consensus linkage map for Aegilops umbellulata, a wild

relative of cultivated wheat. G3 Genes, Genomes, Genet. 7: 1551–1561.

Edet, O.U., Gorafi, Y.S.A., Cho, S., Kishii, M., and Tsujimoto, H. (2018). Novel molecular

marker-assisted strategy for the production of wheat–Leymus mollis chromosome

addition lines. Sci. Rep. 8: 16117.

Edgar, R.C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Res. 32: 1792–7.

Han, F., Fedak, G., Guo, W., and Liu, B. (2005). Rapid and repeatable elimination of a

parental genome-specific DNA repeat (pGc1R-1a) in newly synthesized wheat

allopolyploids. Genetics 170: 1239–45.

Han, F., Liu, B., Fedak, G., and Liu, Z. (2004). Genomic constitution and variation in five

partial amphiploids of wheat-Thinopyrum intermedium as revealed by GISH,

multicolor GISH and seed storage protein analysis. Theor. Appl. Genet. 109: 1070–

1076.

He, H., Zhu, S., Sun, W., Gao, D., and Bie, T. (2013). Efficient development of Haynaldia

villosa chromosome 6vs-specific DNA markers using a cisp-is strategy. Plant

Breed. 132: 290–294.

International Wheat Genome Sequencing Consortium (IWGSC) (2014). A chromosome-

based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome.

Science 345: 1251788. 60

Jauhar, P.P., Peterson, T.S., and Xu, S.S. (2009). Cytogenetic and molecular

characterization of a durum alien disomic addition line with enhanced tolerance to

Fusarium head blight. Genome 52: 467–483.

Kashkush, K., Feldman, M., and Levy, A.A. (2002). Gene loss, silencing and activation in

a newly synthesized wheat allotetraploid. Genetics 160: 1651 LP-1659.

Kaur, P., Larson, S.R., Shaun Bushman, B., Wang, R.R.-C., Mott, I.W., Hole, D.,

Thimmapuram, J., Gong, G., and Liu, L. (2008). Genes controlling plant growth

habit in Leymus (Triticeae): maize barren stalk1 (ba1), rice lax panicle, and wheat

tiller inhibition (tin3) genes as possible candidates. Funct. Integr. Genomics 8: 375–

386.

Kong, L., Song, X., Xiao, J., Sun, H., Dai, K., Lan, C., Singh, P., Yuan, C., Zhang, S.,

Singh, R., Wang, H., and Wang, X. (2018). Development and characterization of a

complete set of Triticum aestivum–Roegneria ciliaris disomic addition lines.

Theor. Appl. Genet. 131: 1793–1806.

Kõressaar, T., Lepamets, M., Kaplinski, L., Raime, K., Andreson, R., and Remm, M.

(2018). Primer3_masker: integrating masking of template sequence with primer

design software. Bioinformatics 34: 1937–1938.

Kuraparthy, V., Chhuneja, P., Dhaliwal, H.S., Kaur, S., Bowden, R.L., and Gill, B.S.

(2007). Characterization and mapping of cryptic alien introgression from Aegilops

geniculata with new leaf rust and stripe rust resistance genes Lr57 and Yr40 in

wheat. Theor. Appl. Genet. 114: 1379–1389.

Levy, A.A. and Feldman, M. (2004). Genetic and epigenetic reprogramming of the wheat

genome upon allopolyploidization. Biol. J. Linn. Soc. 82: 607–613. 61

Li, Q., Lu, Y., Pan, C., Zhang, J., Liu, W., Yang, X., Li, X., Xi, Y., and Li, L. (2016).

Characterization of a novel wheat– 2p disomic addition line with powdery mildew

resistance. Crop Sci. 56: 2390-2400.

Li, S., Wang, J., Wang, K., Chen, J., Wang, K., Du, L., Ni, Z., Lin, Z., and Ye, X. (2019).

Development of PCR markers specific to Dasypyrum villosum genome based on

transcriptome data and their application in breeding Triticum aestivum-D.

villosum#4 alien chromosome lines. BMC Genomics 20: 289.

Li, W., Huang, L., and Gill, B.S. (2008). Recurrent deletions of puroindoline genes at the

grain hardness locus in four independent lineages of polyploid wheat. Plant Physiol.

146: 200–212.

Li, Y., Zhou, G., Ma, J., Jiang, W., Jin, L., Zhang, Z., Guo, Y., Zhang, J., Sui, Y., Zheng,

L., Zhang, S., Zuo, Q., Shi, X., Li, Y., Zhang, W., Hu, Y., Kong, G., Hong, H., Tan,

B., Song, J., Liu, Z. Wang, Y., Ruan, H., Yeung, C., Liu, J., Wang, H., Zhang, L.,

Guan, R., Wang, K., Li, W., Chen, S., Chang, R., Jiang, Z., Jackson, S., Li, R., Qiu,

L. (2014). De novo assembly of soybean wild relatives for pan-genome analysis of

diversity and agronomic traits. Nat. Biotechnol. 32: 1045–1052.

Lillemo, M., Cosimo Simeone, M., and Morris, C.F. (2002). Analysis of puroindoline a

and b sequences from Triticum aestivum cv. `Penawawa’ and related diploid taxa.

Euphytica 126: 321–331.

Liu, Y., Liu, D., Zhang, H., Gao, H., Guo, X., Wang, D., Zhang, X., and Zhang, A. (2007).

The α- and β-expansin and xyloglucan endotransglucosylase/hydrolase gene

families of wheat: Molecular cloning, gene expression, and EST data mining.

Genomics 90: 516–529. 62

Liu, Z.-W. and Wang, R.R.-C. (1992). Genome analysis of Thinopyrum junceiforme and

T. sartorii. Genome 35: 758–764.

Luo, M.-C., Gu, Y. Q., Puiu, D., Wang, H., Twardziok, S. O., Deal, K. R., Huo, N., Zhu,

T., Wang, L., Wang, Y., McGuire, P. E., Liu, S., Long, H., Ramasamy, R. K.,

Rodriguez, J. C., Van, S. L., Yuan, L., Wang, Z., Xia, Z., Xiao, L. Anderson, O.

D., Ouyang, S., Liang, Y., Zimin, A. V., Pertea, G., Qi, P., Bennetzen, J. L., Dai,

X., Dawson, M. W., Müller, H.-G., Kugler, K., Rivarola-Duarte, L., Spannagl, M.,

Mayer, K., Lu, F.-H., Bevan, M. W., Leroy, P., Li, P., You, F. M., Sun, Q., Liu, Z.,

Lyons, E., Wicker, T., Salzberg, S. L., Devos, K. M., Dvořák, J. (2017). Genome

sequence of the progenitor of the wheat D genome Aegilops tauschii. Nature 551:

498–502.

Nieto-López, R.M., Soler, C., and García, P. (2003). Genetic diversity in wild Spanish

populations of Thinopyrum junceum and Thinopyrum junceiforme using endosperm

proteins and PCR-based markers. Hereditas 139: 18–27.

Ozkan, H., Levy, A.A., Feldman, M., Feldman, M., and Levy, A.A. (2001). Plant Cell 13:

1735–1747.

Patokar, C., Sepsi, A., Schwarzacher, T., Kishii, M., and Heslop-Harrison, J.S. (2016).

Molecular cytogenetic characterization of novel wheat-Thinopyrum bessarabicum

recombinant lines carrying intercalary translocations. Chromosoma 125: 163–172.

Schwarzacher, T., Anamthawat-Jónsson, K., Harrison, G.E., Islam, A.K.M.R., Jia, J.Z.,

King, I.P., Leitch, A.R., Miller, T.E., Reader, S.M., Rogers, W.J., Shi, M., and

Heslop-Harrison, J.S. (1992). Genomic in situ hybridization to identify alien 63

chromosomes and chromosome segments in wheat. Theor. Appl. Genet. 84–84:

778–786.

Schwarzacher, T., Leitch, A.R., Bennett, M.D., and Heslop-harrison, J.S. (1989). In Situ

localization of parental genomes in a wide hybrid. Ann. Bot. 64: 315–324.

Sears, E. R. (1972). Chromosome Engineering in Wheat. Stadler Symposia, Volume 4, pp.

23–38.

Wang, Y., Tiwari, V.K., Rawat, N., Gill, B.S., Huo, N., You, F.M., Coleman-Derr, D., and

Gu, Y.Q. (2016). GSP: a web-based platform for designing genome-specific

primers in polyploids. Bioinformatics 32: 2382–2383.

Xiao, J., Dai, K., Fu, L., Vrána, J., Kubaláková, M., Wan, W., Sun, H., Zhao, J., Yu, C.,

Wu, Y., Abrouk, M., Wang, H., Doležel, J., Wang, X. (2017). Sequencing flow-

sorted short arm of Haynaldia villosa chromosome 4V provides insights into its

molecular structure and virtual gene order. BMC Genomics 18: 791.

Zhang, J., Jiang, Y., Wang, Y., Guo, Y., Long, H., Deng, G., Chen, Q., and Xuan, P. (2018).

Molecular markers and cytogenetics to characterize a wheat-Dasypyrum villosum

3V (3D) substitution line conferring resistance to stripe rust. PLoS One 13:

e0202033.

Zhang, Y., Zhang, J., Huang, L., Gao, A., Zhang, J., Yang, X., Liu, W., Li, X., and Li, L.

(2015). A high-density genetic map for P genome of Agropyron Gaertn. based on

specific-locus amplified fragment sequencing (SLAF-seq). Planta 242: 1335–1347.

64

Chapter 3: Identification and Characterization of Wheat-

Thinopyrum junceiforme Addition Lines

65

Abstract

Wild relatives are important sources for improving wheat resistance to biotic stresses and tolerance to abiotic stresses. Due to divergence in genomes, however, gene transfer via direct hybridization is not possible from the species tertiary gene pool to wheat. We employed chromosome engineering, the best approach of choice, to facilitate the transfer of traits from Sea wheatgrass (SWG) to cultivated wheat. In this research, our objective was to develop a set of addition lines containing SWG chromosomes in wheat background.

We screened 433 plants from backcrossing populations using SWG-specific markers and selected 24 plants with one or two SWG chromosomes. GISH analysis of the progenies for

24 plants by our collaborators (Dr. Qijun Zhang and Steven Xu) confirmed that 37 plants among the progenies carry one or two SWG chromosomes. We further validated these 37 addition lines using the SWG specific molecular markers developed and indicated the identification of a complete set of addition lines for 14 SWG chromosomes. Except for 3J2 chromosome, we have developed either monosomic or disomic addition lines for 13 SWG chromosomes. For 3J2, we were able to identify a double monosomic addition line.

Preliminary phenotyping results showed that 2J1 chromosome carries genes for resistance to WSMV, and 1J1 carries genes for waterlogging tolerance. Furthermore, the stem solid trait was assigned to the chromosome 3J1. These addition lines developed in the present study can be used to study other useful traits present in the SWG genome (low N tolerance,

FHB resistance, etc.) and explore new traits.

66

Introduction

Chromosome engineering is the well-established approach for the transfer of alien genes from wild relatives to cultivated wheat (Ali et al., 2016; Lu et al., 2016; Zhang et al., 2016).

Development of alien chromosome addition lines is an important step in the alien gene transfer (Jauhar et al., 2009; Kong et al., 2018). Addition lines lower the complexity of the alien genome by reducing the alien chromosome numbers and allows to study them individually. Many genes of agronomic importance have been identified and characterized using addition lines (An et al., 2015; Liu et al., 2018b; Niu et al., 2018). More importantly, addition lines allow the transfer of alien chromatin (useful genes) into the wheat genome through the development of translocation lines (Ali et al., 2016; Liu et al., 2017).

Addition lines are usually developed by backcrossing the F1 hybrids or amphiploids to recurrent parents of the cultivated crops (O’Mara 1940). Molecular markers and GISH is used to characterize addition lines (Liu et al., 2018b; Sibikeev et al., 2017; Kruppa et al., 2016). Molecular markers and GISH will help identify the alien chromosomes and characterize the homoeologous group and the sub-genome to which they belong (in case species is allopolyploid). Such characterization is necessary to establish a homoeologous relation between wheat and alien chromosomes (Kong et al., 2018), which is required for developing compensating RobTs by crossing the addition lines with the monosomic stocks of corresponding homoeologous groups. Characterization also reveals whether the alien genome has any chromosomal rearrangements (in comparison to wheat chromosomes).

SWG (2n=28, J1J1J2J2) is an important wild relative of wheat. It belongs to the tertiary gene pool of the wheat. Wheat-SWG amphiploid has shown resistance/tolerance to different pathogens/pests (WSMV, sawflies, and FHB), waterlogging stress, salinity, heat 67 and low nitrogen stress (Li et al., 2019). Thus, it is desirable to introgress these useful traits from SWG to wheat. But due to its distant relation with wheat, transferring genes by homologous recombination, which is inhibited by the Ph loci, is not possible (Greer et al.,

2012; Riley and Chapman 1958). Chromosome engineering can be employed to transfer the genes from SWG to the wheat genome (Gill et al., 2006; Qi et al., 2007). So far, no addition, translocation or introgression line has been developed for the SWG chromosomes. Only one complete amphiploid between sea wheatgrass and tetraploid wheat T. turgidum has been developed (Li et al., 2019). SWG is a tetraploid, thus two subgenomes (J1 and J2) increases complexity to identify and characterize alien chromosomes in wheat background. We sequenced the SWG genome; thus, we were able to develop robust and specific markers for SWG chromosomes. We had developed 127

SWG specific molecular markers.

Our objective was to screen the populations derived from the crosses and backcrosses of hexaploid wheat to the wheat-SWG amphiploid, identify the wheat-SWG chromosome addition lines, and characterize the SWG chromosomes present in the addition lines. Here we report the identification and characterization of a complete set of wheat-SWG chromosome addition lines.

Materials and Methods

Plant materials

Wheat-SWG amphiploid, pedigree number 13G819 was used in this study to develop the addition lines. Wheat-SWG amphiploid was crossed with hexaploid wheat variety Louis and subsequently backcrossed to Louis and Chinese Spring to develop large populations 68

segregating for the SWG chromosomes. For the present study, 433 plants of BC2F1 and

BC2F2 generations were screened.

Molecular marker genotyping

Genomic DNA was isolated from the plant leaves according to Li et. al., (2008) with some modifications using DNA extraction buffer containing CTAB rather than SDS. The genomic DNA was diluted to concentration ~100ng/µl to carry out PCR. A 15µl volume reaction contained 100 ng of genomic DNA, 0.2 µM primers, 1x GoTaq® buffer

(Promega), 0.25mM dNTPs and 1 unit of Taq polymerase. The reaction was carried out on the GeneAmp® PCR System 9700 and Veriti thermocyclers (ThermoFisher Scientific).

PCR profile consisted of the initial denaturation for 4 min at 94⁰C, 35 cycles of 30 sec at

94⁰C, 30 sec at 51-59⁰C, 55-60 sec at 72⁰C, and 7 min of final extension at 72⁰C. The PCR products were separated on the 3% agarose gel or 6% polyacrylamide gel. The DNA inside the gel was stained using Ethidium bromide. The gel was viewed and pictured under UV light in a gel documentation system (U: GENIUS, SYNGENE). Gel images were manually scored.

Results

We screened 433 BC2F1 and BC2F2 individuals using seven SWG-specific markers, each of which specific to a distinct homoeologous group of SWG. In this initial screening, the positive number of markers per plant ranged from zero to six (Fig. 3.1). Of the 433 plant

DNA samples, 94 were negative for all the seven markers, and 101 were positive for one marker. We decided to further analyze these 195 (94 + 101) plants based on a hypothesis 69 that with the application of additional markers, some samples will show positive amplification to the newer markers. For further molecular analysis, we selected 71 DNA samples out of 101 DNA samples positive to one marker (Fig. 3.1) based on the pedigree.

Remaining 30 DNA samples shared family and marker with one of the 71 DNA samples.

We applied this selection to decrease the representation from one particular family. We tried to select 12 samples from each homoeologous group. But for groups 2, 5 and 7, we only had eight, eight and seven samples, respectively, with one positive marker. Therefore, we selected four samples for groups 2 and 5 and five samples for group 7 with two markers positive to make the count of 12 plant samples for each homoeologous group. These 84 samples were then screened with 18 additional markers. With the application of new markers, we were able to perform a second round of selection among the samples screened.

Secondly, markers from the same chromosome showed similar segregation patterns forming different groups in the scoring data. We were able to visualize ten different groups formed in the data based on the markers’ segregation, where these groups were representing the ten of the SWG chromosomes (total chromosomes 14). From the 84 plants, we selected a total of 25 samples with 19 samples having markers positive from one group only and six with two groups. We selected plants with markers positive for two groups based on the hypothesis that two chromosomes will segregate in the subsequent generation thus we may recover addition lines among them as well. Furthermore, to identify the remaining four chromosome groups we screened 81 out of 94 plants samples that had zero markers positive in the initial screening (Fig. 3.1). We found 18 candidate addition lines, which include the ten groups we already discovered. Regarding the remaining four chromosome groups, we had either no markers or just one marker for them, so we were not 70 able to confidentially demarcate all 14 groups in our data. The 18 samples along with 25 former samples were further screened with 19 new molecular markers. Here we shortlisted

24 samples out containing one or two SWG chromosomes based on marker analysis.

While we were genotyping the 165 (84 + 81) plants with the 18 markers, we submitted seeds of 72 plants to Dr. Steven Xu’s Lab at USDA ARS, to whom we are collaborating in an AFRI-funded project. These 72 lines contain four lines from waterlogging tests and 68 selected based-on the incomplete genotyping data at the time.

The 24 lines carrying one or two SWG chromosomes based on the 44 markers were included in the 68 plant samples.

Dr. Zhang at Xu Lab performed the multi-color GISH (mcGISH) on the seedlings of the lines shortlisted. Their results revealed monosomic addition lines (MAL), disomic addition lines (DAL), and double monosomic addition lines (DMAL). Their results also assigned the sub-genome notation to the addition lines. We assigned the homoeologous chromosome group to the addition lines by marker genotyping.

Plants containing one or two SWG chromosomes and negative for the existing marker groups were our candidates for the remaining four unidentified chromosomes, i.e.,

1J1, 7J1, 3J2, and 5J2. Therefore, we targeted marker designing for chromosomes 1, 3, 5, and 7. With a greater number of markers for the chromosomes mentioned, we were able to identify addition lines among the progenies of 24 shortlisted plants and two waterlogging tolerant lines. 71

120 112 101

100 94

80 59

60 40

40 NUMBER OF PLANTS OF NUMBER

20 17

7 0 0 0 1 2 3 4 5 6 7 NUMBER OF POSITIVE MARKERS

Figure 3.1. Distribution of the seven markers among the 433 backcrossing individuals. The numbers of plants are indicated at the left of the figure, and the numbers of markers per plant are indicated at the bottom of the figure.

Table 3.1. The number of addition lines identified for each chromosome.

Chromosome Monosomic Disomic lines Double addition - Addition lines

Group lines lines identified

1J1 0 1 1 2

1J2 3 0 0 3

2J1 1 0 3 4

2J2 1 0 0 1

3J1 2 0 1 3

3J2 0 0 1 1

4J1 4 2 1 7

4J2 3 0 0 3 72

5J1 2 2 0 4

5J2 1 1 0 2

6J1 2 0 0 2

6J2 1 0 1 2

7J1 0 2 0 2

7J2 1 0 0 1

Total Lines 21 8 8 37

Totally, we identified 37 plants which were characterized as addition lines, and constitute a complete set of 14 wheat-SWG chromosome addition lines (Table 3.1). Out of the 14 SWG chromosomes, we identified disomic addition lines for five SWG chromosomes, monosomic addition lines for 11 SWG chromosomes, and double monosomic addition lines for seven SWG chromosomes, and only a double addition line was identified for chromosome 3J2 (Table 3.1). We used 96 markers to characterize the addition lines. The chromosomal location of these markers is given in Fig. 2.2. Distribution of the 96 markers among the addition lines is given in Table 3.2. Based on the marker genotyping data, we have obtained at least one addition line for each of the 14 SWG chromosomes.

Group-1 addition lines

For chromosome 1J1, we had one disomic line and one double monosomic addition line

(Table 3.1) and six markers specific for it (Table 2.2). The disomic addition line F18-54 was positive to all the six 1J1 markers. Double monosomic addition line F18-56 was 73

positive to five of the six 1J1 markers. Phenotyping of 1J1 addition lines under waterlogging condition indicated that 1J1 carries the gene(s) responsible for waterlogging tolerance.

For chromosome 1J2, we identified three monosomic addition lines (Table 3.1). A total of 11 markers were designed for chromosome 1J2 (Table 2.2). We applied 10 markers to characterize three lines. F18-3 was positive for all 10 markers and another two lines, but

F18-98 and F18-7 showed positive amplification just for four markers.

Group-2 addition lines

For chromosome 2J1, one monosomic addition line and three double monosomic addition lines (Table 3.1). A double monosomic addition line was also identified and selected from

WSMV screening. We had nine 2J1-specific markers (Table 2.2). Seven markers were applied to characterize the addition lines. 2J1 addition line 17-175-R3 selected by WSMV screening was positive to all the seven markers. It remains to be validated by GISH. It was resistant to WSMV. Monosomic addition line F18-8 was specific to six markers, and three double monosomic addition lines F18-2, F18-4, and F18-5 were positive to three out of the seven markers.

We had one monosomic addition line for chromosome 2J2 (Table3.1) and seven

2J2-specific markers were designed (Table 2.2). We applied all the seven markers to the addition line F18-90, and it was positive for six of the seven markers. The marker

(WL4968; Fig. 2.2) specific to both 2J1 and 2J2 did not amplify a specific fragment from the 2J2 addition line. The lines positive to 2J2 markers had long peduncles (compared to other lines understudy). 74

Group-3 addition lines

Two monosomic lines and one double monosomic addition line were identified for 3J1 group (Table 3.1). Eleven markers were designed specifically to chromosome 3J1 (Table

2.2). We applied ten of the eleven markers to a 3J1 monosomic addition line (F18-53). It showed positive amplification to all ten markers. Three markers were applied to the remaining two lines (F18-23 and F18-51). F18-51 was positive for all three markers, and

F18-23 was positive to two markers (Table 3.3). Lines that had positive amplification for

3J1 markers showed solid stem phenotype (Fig. 3.2).

For chromosome 3J2, we had one double monosomic addition line (Table 3.1). We designed seven markers specific for this chromosome (Table 2.2). The 3J2 addition line

F18-57 was characterized using seven markers, and it was positive for all markers. It is a double monosomic addition line, and another monosomic chromosome present in it is 1J1.

Group-4 addition lines

We had eight markers specific for 4J1 (Table 2.2) and to seven different addition lines of

4J1 (Table 3.1). Seven out of the eight markers were applied for characterizing seven addition lines. Three lines, F18-99, F18-101, and F18-103 were positive to all the markers.

Addition line F18-102 was positive to six markers. The remaining three addition lines F18-

112, F18-114, and F18-116 were positive to five of the seven markers. Among the three lines positive for all the seven markers, two are disomic addition lines, and one is monosomic addition line (Table 3.3). 75

For 4J2 chromosome, we identified three monosomic addition lines (Table 3.1).

They were characterized using eight 4J2-specific markers (Table 2.2). Two of the addition lines F18-73 and F18-119 were positive to six markers with four markers common for both lines, but out of the other four markers, WL4972 and WL5033 (Fig. 2.2) were unique to

F18-73 and WL4661 and WL5123 (Fig. 2.2) were unique to F18-119. The third monosomic addition line F18-105 was positive to three markers only.

Group-5 addition lines

We designed nine 5J1-specific markers (Table 2.2) and identified four addition lines. Two addition lines were disomic, and the other two were monosomic (Table 3.1). The monosomic addition lines F18-39 and F18-41 were positive for all nine markers. The disomic addition lines F18-38 and F18-40 were tested using six markers and were positive to four markers. The marker amplification patterns between disomic and monosomic lines were different although all four lines were derived from the same parental line.

For chromosome 5J2, we obtained a monosomic addition line and a disomic addition line (Table 3.1). We designed eight markers specific for 5J2. The addition lines were tested using seven markers. The disomic addition line F18-19 was positive to five out of the seven markers. Monosomic addition line F18-59 was positive to three markers. Two of these three markers did not amplify any fragment in the 5J2 disomic addition line F18-

19. Thus, these two lines covered seven markers 5J2 specific markers. 76

Group-6 addition lines

For chromosome 6J1, we obtained two monosomic addition lines (Table 3.1) and six molecular markers specific for this group (Table 2.2). We tested addition lines using five markers specific for 6J1. Addition line F18-81 was positive to all five markers, while addition line F18-80 was positive to three markers.

For chromosome 6J2, a monosomic addition line and a double addition line were identified (Table 3.1). We had eight markers designed specifically for 6J2 (Table 2.2). The two addition lines were characterized using four molecular markers. The monosomic addition line F18-97 was positive to four markers, and the double monosomic addition line

F18-96 was positive to only two markers.

Group-7 addition lines

For 7J1 chromosome, we had three specific markers (Table 2.2). Two disomic addition lines

F18-84 and F18-85 were identified for this group (Table 3.1). They were screened using three molecular markers and showed positive amplification for all three markers.

For 7J2 chromosome, we had ten specific markers (Table 2.2). One monosomic addition line F18-62 was identified for this group (Table 3.1). All ten markers amplified a specific fragment from the 7J2 addition line.

Table 3.2. Distribution of the 96 markers across the addition lines of each chromosome group

Genome Homoeologous Group 77

1 2 3 4 5 6 7

J1 6 7 10 7 9 5 3

J2 10 4 7 8 6 4 10

Figure 3.2 Segregation of solid stem phenotype. The stem on the right is from plant positive to 3J1 specific markers and the stem on the left is from plant showing no amplification for 3J1 specific markers. Table 3.3 Addition lines for each chromosome group and their marker characterization summary Chromosome Pedigree Total markers Positive Type of

group markers addition line

1J1 F18-54 6 6 DAL

F18-56 6 5 DMAL

1J2 F18-3 10 10 MAL 78

Chromosome Pedigree Total markers Positive Type of

group markers addition line

F18-98 10 4 MAL

F18-7 10 4 MAL

2J1 F18-8 7 6 MAL

F18-2 7 3 DMAL

F18-4 7 3 DMAL

F18-5 7 3 DMAL

2J2 F18-90 7 6 MAL

3J1 F18-53 10 10 MAL

F18-23 3 2 MAL

F18-51 3 3 DMAL

3J2 F18-57 7 7 DMAL

4J1 F18-99 7 7 DAL

F18-101 7 7 DAL

F18-103 7 7 MAL

F18-102 7 6 MAL

F18-112 7 5 MAL

F18-114 7 5 MAL

F18-116 7 5 DMAL

4J2 F18-73 8 6 MAL

F18-119 8 6 MAL

F18-105 8 3 MAL 79

Chromosome Pedigree Total markers Positive Type of

group markers addition line

5J1 F18-39 9 9 MAL

F18-41 9 9 MAL

F18-38 6 4 DAL

F18-40 6 4 DAL

5J2 F18-19 7 5 DAL

F18-59 7 3 MAL

6J1 F18-81 5 5 MAL

F18-80 5 3 MAL

6J2 F18-97 4 4 MAL

F18-96 4 2 DMAL

7J1 F18-84 3 3 DAL

F18-85 3 3 DAL

7J2 F18-62 10 10 MAL

MAL - Monosomic addition lines DAL - Disomic addition lines DMAL – Double monosomic addition line

Discussion

SWG is an important source for improving wheat resistance to biotic stresses and tolerance to abiotic stresses. The development of wheat-SWG addition lines is challenging due to its alloploid nature, which imposes complexity in characterizing each of its 14 chromosomes.

Use of SWG specific markers accelerated and simplified the process for identification of the addition lines. We were able to quickly shrink the population size under study using 80 the molecular markers. Because the markers were unique to the sub-genomes, we were able to characterize each SWG chromosome. Combining marker genotyping and GISH visualization, we have developed a complete set of wheat-SWG addition lines. Among addition lines, 3J2 is the chromosome for which we have only identified a double monosomic addition line. For the rest of the SWG chromosomes, we have identified either disomic or monosomic addition lines.

While characterizing the addition lines, we noticed that there might be very few inter-chromosomal rearrangements while comparing synteny to A. tauschii. Most of the markers designed from a sequence of A. tauschii chromosome belonged to the same homoeologous group in SWG. Only two markers were specific to the SWG chromosomes different from which were designed based on homoeology (collinearity) to the wheat chromosomes. This indicates that SWG chromosomes largely maintained intact collinearity with the wheat homoeologous chromosomes in course of coevolution.

Otherwise, those two markers were amplified from paralogs.

Addition lines carrying the same SWG chromosomes showed a difference in the number of positive markers. For each chromosome, we had at least one line which was positive to all the markers specific to that group except for 4J2. We have two 4J2 addition lines which are positive to four 4J2-specific markers out of total eight markers. Remaining four markers are present in either of them but not in both addition lines. This shows there is either loss of genomic constituents or recombination has changed the marker patterns.

So, one addition line may not have all the genomic constitution of SWG chromosome, but multiple addition lines for that group may capture all genomic constitution. 81

Our preliminary phenotypic analysis showed that 2J1 chromosome carries the gene(s) for resistance to WSMV and 1J1 carries the gene(s) for waterlogging tolerance.

Furthermore, lines carrying 3J1 chromosome had the solid stem phenotype. This phenotyping analysis will help to transfer these traits into wheat via RobTs.

The development of a complete set of wheat-SWG chromosome addition lines is an important milestone to dissect the SWG genome and to transfer the useful traits into wheat. The addition lines set can also be used for discovery of new traits using the high throughput phenotyping platforms. We characterized the addition lines for all 14 SWG chromosomes. This will facilitate transfer and mapping of traits of agronomic importance to the SWG genome. Addition lines will also allow identification of chromosomes that harbor genes that control essential functions such as fertility. SWG has shown resistance/tolerance to WSMV, heat, salinity, waterlogging and low nitrogen conditions.

With this complete set of addition lines, the SWG genome can be better dissected to identify novel genes/traits present in SWG genome. Most importantly, translocation lines can be developed from here on, which will transfer the desired traits into the wheat genome.

References Cited: Ali, N., Heslop-Harrison, J., Ahmad, H., Graybosch, R.A., Hein, G.L., and Schwarzacher,

T. (2016). Introgression of chromosome segments from multiple alien species in

wheat breeding lines with wheat streak mosaic virus resistance. Heredity (Edinb).

117: 114–123. 82

An, D., Zheng, Q., Luo, Q., Ma, P., Zhang, H., Li, L., Han, F., Xu, H., Xu, Y., Zhang, X.,

and Zhou, Y. (2015). Molecular cytogenetic identification of a new wheat-rye 6r

chromosome disomic addition line with powdery mildew resistance. PLoS One 10:

e0134534.

Gill, B.S., Friebe, B., Raupp, W.J., Wilson, D.L., Cox, T.S., Sears, R.G., Brown-Guedira,

G.L., and Fritz, A.K. (2006). Wheat genetics resource center: the first 25 years.

Greer, E., Martín, A.C., Pendle, A., Colas, I., Jones, A.M.E., Moore, G., and Shaw, P.

(2012). The Ph1 locus suppresses Cdk2-type activity during premeiosis and meiosis

in wheat. Plant Cell 24: 152–62.

Jauhar, P.P., Peterson, T.S., and Xu, S.S. (2009). Cytogenetic and molecular

characterization of a durum alien disomic addition line with enhanced tolerance to

Fusarium head blight. Genome 52: 467–483.

Kong, L., Song, X., Xiao, J., Sun, H., Dai, K., Lan, C., Singh, P., Yuan, C., Zhang, S.,

Singh, R., Wang, H., and Wang, X. (2018). Development and characterization of a

complete set of Triticum aestivum–Roegneria ciliaris disomic addition lines.

Theor. Appl. Genet. 131: 1793–1806.

Kruppa, K., Türkösi, E., Mayer, M., Tóth, V., Vida, G., Szakács, É., and Molnár-Láng, M.

(2016). McGISH identification and phenotypic description of leaf rust and yellow

rust resistant partial amphiploids originating from a wheat × Thinopyrum synthetic

hybrid cross. J. Appl. Genet. 57: 427–437.

Li, W., Huang, L., and Gill, B.S. (2008). Recurrent deletions of puroindoline genes at the

grain hardness locus in four independent lineages of polyploid wheat. Plant Physiol.

146: 200–212. 83

Li, W., Zhang, Q., Wang, S., Langham, M.A., Singh, D., Bowden, R.L., and Xu, S.S.

(2019). Development and characterization of wheat–sea wheatgrass (Thinopyrum

junceiforme) amphiploids for biotic stress resistance and abiotic stress tolerance.

Theor. Appl. Genet. 132: 163–175.

Liu, C., Guo, T., Du, Y., and Hu, Y.-G. (2018a). Nitrogen and phosphorus use efficiency

of 43 wheat alien chromosome addition lines evaluated by hydroponic culture. J.

Plant Nutr. 41: 2470–2481.

Liu, L., Luo, Q., Teng, W., Li, B., Li, H., Li, Y., Li, Z., and Zheng, Q. (2018b).

Development of Thinopyrum ponticum-specific molecular markers and FISH

probes based on SLAF-seq technology. Planta 247: 1099–1108.

Liu, W., Koo, D.-H., Xia, Q., Li, C., Bai, F., Song, Y., Friebe, B., and Gill, B.S. (2017).

Homoeologous recombination-based transfer and molecular cytogenetic mapping

of powdery mildew-resistant gene Pm57 from Aegilops searsii into wheat. Theor.

Appl. Genet. 130: 841–848.

Lu, M., Lu, Y., Li, H., Pan, C., Guo, Y., Zhang, J., Yang, X., Li, X., Liu, W., and Li, L.

(2016). Transferring desirable genes from Agropyron cristatum 7p chromosome

into common wheat. PLoS One 11: e0159577.

Niu, Z., Chao, S., Cai, X., Whetten, R.B., Breiland, M., Cowger, C., Chen, X., Friebe, B.,

Gill, B.S., Rasmussen, J.B., Klindworth, D.L., and Xu, S.S. (2018). Molecular and

cytogenetic characterization of six wheat-Aegilops markgrafii disomic addition

lines and their resistance to rusts and powdery mildew. Front. Plant Sci. 9: 1616.

O’mara, J.G. (1940). Cytogenetic studies on triticale. I. a method for determining the

effects of individual secale chromosomes on Triticum. Genetics 25: 401–408. 84

Qi, L., Friebe, B., Zhang, P., and Gill, B.S. (2007). Homoeologous recombination,

chromosome engineering and crop improvement. Chromosom. Res. 15: 3–19.

Riley, R. and Chapman, V. (1958). genetic control of the cytologically diploid behaviour

of hexaploid wheat. Nature 182: 713–715.

Sibikeev, S.N., Badaeva, E.D., Gultyaeva, E.I., Druzhin, A.E., Shishkina, A.A., Dragovich,

A.Y., Kroupin, P.Y., Karlov, G.I., Khuat, T.M., and Divashuk, M.G. (2017).

Comparative analysis of Agropyron intermedium (Host) Beauv 6Agi and 6Agi2

chromosomes in bread wheat cultivars and lines with wheat–wheatgrass

substitutions. Russ. J. Genet. 53: 314–324.

Zhang, R., Sun, B., Chen, J., Cao, A., Xing, L., Feng, Y., Lan, C., and Chen, P. (2016).

Pm55, a developmental-stage and tissue-specific powdery mildew resistance gene

introgressed from Dasypyrum villosum into common wheat. Theor. Appl. Genet.

129: 1975–1984.

85

Chapter 4: Conclusions and future directions

86

Sea wheatgrass (SWG) is an excellent resource for genetic improvement of wheat. It is distantly related to wheat and belongs to the tertiary gene pool. DNA sequence diversity and chromosome structure changes among distantly related species hinder chromosome pairing and gene transfer. In wheat, ph loci hinder the paring of homoeologous (non- identical) chromosomes. To overcome the barrier imposed by ph loci, chromosome engineering has been successfully used in the past to transfer alien chromosome fragments to the wheat genome. To transfer the alien chromosomes from SWG to wheat, we also employed chromosome engineering. One objective of this study was to design molecular markers specific to SWG which can assist in the effective selections during the chromosome engineering process. The second objective was to develop addition lines, which is the initial step of chromosome engineering.

In the present study, we developed 127 markers which are specific to the SWG genome. We used these markers to characterize backcrossing populations to select tentative wheat-SWG chromosome addition line for GISH validation. These markers are validated and repeated multiple times, indicating that they are reproducible.

We also developed a complete set of wheat-SWG chromosome addition lines. A total of 37 plants were identified as monosomic addition lines, disomic addition lines or double addition lines covering all SWG chromosomes. This set of addition lines will serve as a library for SWG chromosomes, thus each chromosome can be studied and exploited individually.

In the future, more SWG specific markers can be designed to densely cover the

SWG genome. Newly developed addition lines and molecular markers will set the basis 87 for further chromosome engineering steps such as the development of RobT translocations and introgression lines thus, progressing the alien chromatin transfer into the wheat genome. Addition lines can be used to localize important SWG traits onto SWG chromosomes. They can also be used to discover newer traits that might be present in SWG genome. Molecular markers will also assist in gene mapping which will be crucial for marker-assisted selection from a breeding point of view and gene cloning from molecular studies perspective. Collectively our work has developed newer genetic resources for wheat crop improvement. Also, our work generated resources for molecular and physiological studies of various SWG traits.