Jéssica Alves De Medeiros Araújo Roles of Zbtb20 in the Specification of Upper Layer Neurons and Astrocytes in the Neocortex N

JÉSSICA ALVES DE MEDEIROS ARAÚJO

ROLES OF ZBTB20 IN THE SPECIFICATION OF UPPER LAYER NEURONS AND ASTROCYTES IN THE NEOCORTEX

NATAL, RN DECEMBER 2019

JÉSSICA ALVES DE MEDEIROS ARAÚJO

ROLES OF ZBTB20 IN THE SPECIFICATION OF UPPER LAYER NEURONS AND ASTROCYTES IN THE NEOCORTEX

Ph.D. COMMITTEE Marcos Romualdo Costa (advisor) Ulrich Müller (co-advisor) Cecilia Hedin Pereira (FIOCRUZ-RJ) João Lacerda de Menezes (UFRJ) Kerstin Erika Schmidt (UFRN) Emelie Katarina Svahn Leão (UFRN)

UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE INSTITUTO DO CÉREBRO PROGRAMA DE PÓS-GRADUAÇÃO EM NEUROCIÊNCIAS

NATAL, RN DECEMBER 2019

Universidade Federal do Rio Grande do Norte - UFRN Sistema de Bibliotecas - SISBI Catalogação de Publicação na Fonte. UFRN - Biblioteca Setorial Árvore do Conhecimento - Instituto do Cérebro - ICE

Araújo, Jéssica Alves de Medeiros. Roles of ZBTB20 in the specification of upper layer neurons and astrocytes in the neocortex / Jéssica Alves de Medeiros Araújo. - Natal, 2019. 146f.: il.

Tese (Doutorado em Neurociências) - Universidade Federal do Rio Grande do Norte, Instituto do Cérebro, 2019. Orientador: Marcos Romualdo Costa. Coorientador: Ulrich Müller.

1. ZBTB20. 2. Neocortex. 3. Gene expression regulation, developmental. 4. Neuron specification. 5. Astrogliogenesis. I. Costa, Marcos Romualdo. II. Müller, Ulrich. III. Título.

RN/UF/BSICe CDU 612.822

Elaborado por ISMAEL SOARES PEREIRA - CRB-15/741

ACKNOWLEDGMENTS

This achievement would not be possible without the support of my family. Primeiramente, agradeço a minha família, pelo apoio, amor e dedicação; pelos inúmeros exemplos de perseverança, força e determinação. Essa e outras conquistas não seriam possíveis sem vocês ao meu lado. Mainha, painho, Jacquelinne, Janaynne, e Angela. Vocês são meu lar! Tia Gorda, obrigada pela amizade, generosidade e acolhimento. I wish to express my deepest gratitude to Charlie. Thank you for your unconditional support and encouragement and for being there when needed most. To all of my friends; Erin, Cindy, Desinha, Dyelle, Aninha, Soraia, Andre, Vivi, Pavão, Bryan, Ju, Dani, Bruna, Geissy, Annie, Day, Nathalie, Jeff, Romulo, Vanessa, Kharina and Diego, thank you all for easing my busy mind! I would like to thank my mentor Marcos for your guidance throughout my scientific journey; during undergrad, master, and Ph.D. It has been a privilege to have worked with you for all these years. I will be eternally grateful for the opportunities you’ve given me. Thank you for your dedication, advice, training, freedom, trust, accountability, wisdom, patience, support, and criticism. I wish to show my gratitude to all members of Marcos’ lab for being always present even when separated by thousands of kilometers. To my co-supervisor Uli, thank you for the opportunity to work in such outstanding institutions, the Scripps Research Institute and Johns Hopkins University. Thank you for always challenging me, for investing in my scientific growth, and giving me the freedom to pursue my goals. To Cristina, thank you for recognizing my potential and supporting me throughout this journey and for so freely giving your time, patience, friendship, and kindness. I wish to express my gratitude to the current and former members of Uli’s lab for sharing insightful discussions and indispensable assistance during experiments. Thank you to all the people whose assistance was fundamental in the completion of this project, especially; Ana Espinosa, Liyuan Wang, Diego Coelho, Yi-Ting Chang, Daniel O'Connor, Gabrielle Cannon, and Loyal Goff.

To the members of my committee, Cecilia Hedin, Tarciso Velho, João Menezes, Kerstin Schmidt and Kia Svahn Leão, thank you for sharing your expertise and wisdom. To Alex Kolodkin and all members of his lab, particularly Joelle and Randal, thank you for the pleasant scientific discussions and shared plasmids. To core facilities, all technicians and staff scientific, specifically Akaline and Michele, thank you for all the terrific technical assistance. Finally, I would like to thank all members of The Brain Institute, Scripps Research Institute, and Johns Hopkins University. Thank you all for providing me with an ideal combination of creativity, knowledge, and resources during my joint Ph.D. in Brazil and United States.

RESUMO

A organização dos circuitos neocorticais é fundamental para a percepção sensorial, aprendizado e integração multisensorial. Na área somatossensorial primária (S1), os neurônios da camada IV recebem entradas talâmicas e projetam para neurônios da camada II/III. Esses neurônios superficiais podem conectar outros neurônios dentro de S1 e dentro de outras áreas do hemisfério ipsi ou contralateral, cooperando assim para selecionar uma interpretação consistente com suas várias entradas corticais e subcorticais. Neste trabalho, nós mostramos que a expressão do fator de transcrição Zinc Finger And BTB Domain-Containing Protein 20 (Zbtb20) em progenitores neocorticais é necessária e suficiente para regular a geração e a conectividade de neurônios supragranulares. A deleção condicional do gene Zbtb20 nos progenitores leva a um aumento no número e distribuição radial de neurônios RORβ+ (camada IV) à custa dos neurônios BRN2+ (camadas II/III). Essa mudança na organização laminar do neocórtex é acompanhada por uma expansão da arborização axonal talâmica e da área do barril em S1. Além disso, os neurônios da camada superior aumentam suas projeções axonais intra-hemisféricas, enquanto reduzem a inervação contralateral na ausência da expressão de Zbtb20. Essas alterações também são observadas, embora em menor grau, após a deleção do Zbtb20 nos neurônios pós-mitóticos, indicando que o Zbtb20 atua em estágios sequenciais da progressão da linhagem dos progenitores neocorticais, ajustando os destinos neuronais nas camadas corticais superiores e contribuindo para a organização das projeções axonais dos neurônios calosos (CPN - do inglês, “callosal projection neurons”). Além desses efeitos na especificação de CPNs, também mostramos que o ZBTB20 regula a astrogliogênese de maneira temporal específica. A superexpressão de ZBTB20 em E14, mas não em E16, aumenta a astrogliogênese neocortical, enquanto a expressão de um ZBTB20 negativo-dominante (DN) em E16, mas não em E14, reduz a astrogliogênese. Em conjunto, nossos resultados indicam que o ZBTB20 é um importante regulador da especificação de tipos e subtipo celulares no neocórtex em desenvolvimento. Palavras-chave: ZBTB20; neocórtex; desenvolvimento; especificação neuronal; astrogliogênese

ABSTRACT

Organization of neocortical circuits is critical for sensory perception, learning and multisensory integration. In the primary somatosensory area (S1) layer IV neurons receive thalamic inputs and synapse onto layer II/III neurons. These superficial neurons may connect other neurons within S1 and within other areas in the ipsi- or contralateral hemisphere, thus cooperating to select an interpretation consistent with their various cortical and subcortical inputs. Here we show that expression of the transcription factor Zinc Finger and BTB Domain-Containing Protein 20 (Zbtb20) in neocortical progenitors is necessary and sufficient to regulate the generation and wiring patterns of upper layer neurons. Conditional deletion of the Zbtb20 gene in progenitors leads to an increase in the number and radial occupancy of RORβ+/layer IV neurons at the expense of BRN2+/layers II/III neurons. This change in the laminar organization of the neocortex is accompanied by an expansion of thalamic axonal arborization and barrel area in S1. Furthermore, upper layer neurons increase their intra-hemispheric axonal projections, while reducing contralateral innervation in the absence of Zbtb20 expression. These alterations are also observed, albeit at a lesser extent, after Zbtb20 deletion in post-mitotic neurons, indicating that Zbtb20 act at sequential stages of the lineage progression of neocortical progenitors, fine-tuning neuronal fates in upper cortical layers and contributing to the proper wiring of callosal projecting neurons (CPNs). Besides these effects in CPN fate specification, we also show that ZBTB20 regulates astrogliogenesis in a time-specific fashion. ZBTB20 overexpression at E14, but not at E16, increases neocortical astrogliogenesis, whereas expression of a dominant-negative (DN) ZBTB20 at E16, but not E14, reduces astrogliogenesis. Altogether, our results indicate that ZBTB20 is an important regulator of cell type/subtype specification in the developing neocortex.

Keywords: ZBTB20; neocortex; development; neuron specification; astrogliogenesis

SUMMARY

1 INTRODUCTION ...... 1

1.1 Cortical organization and cellular diversity ...... 2

1.2 Development of neocortical architecture ...... 5

1.2.1 Progenitor fate specification ...... 9

1.2.2 Neuronal subtype specification ...... 14

1.2.3 Astrocyte development ...... 16

1.3 Zbtb20 function during cortical development ...... 17

2 AIM ...... 20

2.1 Specific aims ...... 20

3 METHODS ...... 21

3.1 Mouse lines and breeding ...... 21

3.2 Mouse genotyping ...... 23

3.3 Plasmid constructs ...... 23

3.4 Cloning strategies and protocols ...... 26

3.5 In utero electroporation ...... 28

3.6 Immunohistochemistry ...... 29

3.7 Cresyl Violet (Nissl) staining...... 30

3.8 Flattened cortex and cytochrome oxidase ...... 31

3.9 RNA extraction and qPCR...... 31

3.10 Cell culture and Time-lapse Video-microscopy ...... 33

3.11 S1 recordings ...... 33

3.12 Image analysis and quantification ...... 35

3.13 Statistical analysis ...... 36

4 RESULTS ...... 37

4.1 Screen for transcription factors involved in fate specification ...... 37

4.2 ZBTB20 expression correlates with the generation of upper layer neurons and onset of astrogliogenesis ...... 41

4.3 Zbtb20 function in astrogliogenesis ...... 45

4.4 Zbtb20 function in neuronal specification and axon projection ...... 61

4.4.1 Zbtb20 overexpression in neocortical progenitors/post-mitotic neurons at mid-neurogenesis leads to a premature generation of CPNs ...... 61

4.4.2 Conditional genetic deletion of Zbtb20 in progenitors leads to laminar disorganization of the neocortex ...... 64

4.4.3 Barrel expansion in the primary somatosensory cortex of Zbtb20cKO mice 70

4.4.4 Local field potentials (LFPs) in the barrel cortex of Zbtb20cKO mice ...... 72

4.4.5 Interhemispheric connection of upper layer CPNs is compromised in Zbtb20cKO mice ...... 75

4.4.6 Cell autonomous and cell extrinsic effect of Zbtb20 in the axonal arborization of upper layer CPNs ...... 80

4.4.7 Conditional genetic deletion of Zbtb20 in intermediate progenitors and post- mitotic neurons impairs CPN differentiation ...... 82

5 DISCUSSION ...... 89

5.1 Summary of results ...... 89

5.2 ZBTB20 expression in the neocortex ...... 90

5.3 Role of Zbtb20 in gliogenesis ...... 90

5.4 Role of Zbtb20 in neurogenesis ...... 92

5.5 Role of Zbtb20 in progenitors versus intermediate progenitors and neurons ... 93

5.6 Role of Zbtb20 in the formation of callosal projections and neuronal circuit ..... 94

6 CONCLUSION ...... 98

7 REFERENCES ...... 99

LIST OF SCIENTIFIC PAPERS ...... 121

LIST OF ABBREVIATIONS ...... 122

LIST OF FIGURES ...... 125

LIST OF TABLES ...... 129

TABLES ...... 130

1 INTRODUCTION

The mammalian neocortex exhibits an amazing cellular diversity, containing numerous cell types that are precisely interconnected and assembled into neural circuits. The neocortex is a region of the forebrain unique to mammals, that is involved in higher functions such as control of motor commands, sensory perception, cognition, and consciousness. The application of high throughput methods to study single-cells has recently begun to unravel the unique molecular signatures associated with the diversity of morphologically and electrophysiologically defined neuronal subtypes, as well as microglial cell heterogeneity (Bayraktar et al. 2018; Marques et al. 2016; Zeisel et al. 2018; Zeisel et al. 2015). Understanding how this cellular diversity and such complexity arise during the development of the neocortex is essential for neuroscience. New studies addressing this question hold promise of identifying critical points in the formation of neocortical architecture that may be involved in the pathogenesis of several neurological and psychiatric disorders. The generation of cellular diversity in the neocortex requires complex sequential processes, precisely orchestrated by genetic and environmental influences (Miller and Gauthier 2007). Progress has been made during the last two decades in characterizing some of the mechanisms involved in these diversification processes. At early developmental stages, multipotent proliferative radial glial cells residing at the ventricular surface, give rise to intermediate progenitors and, ultimately, post-mitotic glutamatergic neurons that settle in the neocortex following an inside-out pattern (Molyneaux et al. 2007), and GABAergic neurons that disperse widely across the neocortex (Harwell et al. 2015). At the end of embryonic development, the radial glial cells begin to generate macroglial cells (astrocytes, oligodendrocytes and ependymal cells), and the peak of this process takes place during the first 3 weeks after birth in mice (Ge et al. 2012; Kessaris et al. 2006; Kriegstein and Alvarez-Buylla 2009; Spassky et al. 2005). The study included in this thesis aims to expand our understanding of progenitor diversity and molecular pathways involved in the specification of progenitor cells to generate cellular diversity in the neocortex hoping to provide a stronger foundation for future research on cortical development, cellular differentiation and their implications to 1

brain dysfunction. In the present study, using the mouse brain as a model, we identified a genetic program involved in the specification of dorsal progenitor cells to generate a subset of upper layer glutamatergic neurons and astroglial cells in the developing neocortex, and we investigated the direct effect of genetic perturbations of a transcription factor on neural circuit formation within the somatosensory cortex.

1.1 Cortical organization and cellular diversity The cerebral cortex can be divided into 3 phylogenetically-defined regions: paleocortex, archicortex, and neocortex. The paleocortex is located in the ventrolateral part of the telencephalon and comprising the olfactory piriform cortex. The archicortex includes hippocampus, entorhinal cortex, retrosplenial and subiculum. The paleocortex and archicortex together constitute the allocortex, which consists of three cortical laminae. The neocortex represents the great majority of the cerebral cortex and it is positioned between the two other regions. This region is characterized by six layers, radially organized, which themselves are often subdivided, each containing a heterogeneous population of cells. In its tangential dimension, the neocortex comprises numerous domains, each serving a specific function. These functionally unique subdivisions are distinguished from one another by differences in patterns of gene expression, cellular architecture, and neuronal projections. These properties determine the functional specializations that characterize and distinguish areas in the adult cortex. This study mainly discusses the development of the mammalian neocortex and its connectivity, with special attention to the mouse somatosensory cortex. The mammalian neocortex is composed of numerous types of cells, including neurons and glial cells that together create complex histological structures. There are two major distinct classes of cortical neurons: excitatory and inhibitory neurons. Most inhibitory neurons extend axons within the cortex making local connections and use γ- aminobutyric acid (GABA) as neurotransmitter. However, a small fraction of GABAergic neurons in the neocortex are long-projecting neurons (Melzer et al. 2017; Tamamaki and Tomioka 2010). Inhibitory interneurons constitute an extremely diverse population of cells comprising 15-20% of all cortical neurons, with very diverse morphologies, connectivity,

biochemistry, and physiological properties (Lim et al. 2018). These cells are dispersed across all cortical layers (Brandão and Romcy-Pereira 2015). Excitatory neurons mostly use the neurotransmitter glutamate and account for approximately 75-80% of all neurons in the neocortex, including both pyramidal neurons and spiny stellate neurons, which can be further divided into distinct cell types according to laminar, morphological, electrophysiological properties and patterns of gene expression (Costa and Müller 2015). They can make local connections or extend axons to different cortical areas or to subcortical and subcerebral structures (Douglas and Martin 2004; Molyneaux et al. 2007). Excitatory neurons can be subdivided into three broad classes that display layer- and subtype-specific differences in the morphology, gene expression and axonal targets: (1) the corticothalamic neurons (CTNs), which are predominantly located within layer VI and project axons to the thalamus; (2) the corticospinal motorneurons (CSMN) that are located within layer V and extend axons toward the brainstem and spinal cord; and (3) the most heterogeneous class, the cortico-cortical and callosal projection neurons (CPNs) that are present in layers II–VI, and extend axons toward targets in the contralateral and ipsilateral cortex, striatum, nucleus accumbens, septum and amygdala subnuclei (Kast and Levitt 2019). Excitatory neurons in the layer IV of the sensorial cortices receive the predominant synaptic input from the thalamus and are mostly connected to nearby neurons forming local circuits (Douglas and Martin 2004). Layer IV neurons can be subdivided further into spiny stellate cells and star pyramidal cells, depending on whether they have an apical dendrite (Zeng and Sanes 2017). Moreover, layer IV neurons develop callosal projections during development that are subsequently eliminated (De León Reyes et al. 2019). On the other hand, cortico‑cortical and callosal projection neurons are mostly concentrated in layer II/III but are also present in deeper layers V and VI. They project to multiple other cortical areas both ipsilaterally and contralaterally, with collateral connections to the striatum (Douglas and Martin 2004; Molyneaux et al. 2007). Thus, it is clear that a diverse population of neocortical projection neurons compose the neocortex and these classes can be further subdivided (Zeng and Sanes 2017).

Neuronal diversity has been described for more than 100 years, and it is now emerging that glia also exhibits important functional diversity. Actually, Ramón y Cajal and his colleagues extensively documented the morphological diversity of astrocytes and neurons in the human brain (Figure 1), suggesting the presence of cellular diversity. However, for more than a century, the field of astrocyte diversity was largely forgotten (Khakh and Deneen 2019). The diverse and dynamic functions of glial cells orchestrate essentially all aspects of nervous system formation and function: influencing nervous system development, neuronal migration, axon growth and specification, synaptogenesis, neural circuit maturation, synaptic plasticity and homeostasis (Allen and Lyons 2018; Schitine et al. 2015). The main types of glia include astrocytes, oligodendrocytes, ependymal cells, radial glia, and microglia. Astrocytes are the most numerous glial cell type in the central nervous system and play several key roles on neuronal activity and as neural stem cells in adult neurogenic zones (Wang and Bordey 2008). In the neocortex, most astrocytes are highly ramified with very fine processes that ensheath synapses, blood vessels, and other cells. They are classically divided into two main classes distinguished by morphology, molecular phenotype, and location. Protoplasmic astrocytes are found in gray matter and show many branching processes, which contact and ensheath synapses, and usually have one or two processes in contact with blood vessels. Fibrillary or fibrous astrocytes are found in white matter and they have a star-like appearance, with long and thin processes. Currently, a few markers are used routinely to identify astrocytes, including glial fibrillary acidic protein (GFAP), calcium-binding protein S100β, glutamate–aspartate transporter and glutamate transporter 1 (GLT-1) (Rothstein et al. 1994), and, more recently, aldehyde dehydrogenase 1 family member L1 (ALDH1L1) (Cahoy et al. 2008) and the transcription factor Sox9 (Sun et al. 2017). Astrocyte morphology and gene expression vary substantially among cortical regions (Bayraktar et al. 2018; Emsley and Macklis 2006; Regan et al. 2007), suggesting that astrocyte subpopulations could be specified to exhibit distinct physiologic properties (Chen et al. 2018; Emsley and Macklis 2006; Lin et al. 2017).

Figure 1 Representation of the morphological diversity of glia cells and neurons in the human cerebral cortex documented by Santiago Ramón y Cajal (1852–1934). Pictures were adapted from Khakh and Deneen, 2019 and Brian Hayes 2018.

1.2 Development of neocortical architecture During development, multiple progenitor zones contribute to the cellular diversity found in the neocortex. Excitatory neurons and astrocytes are both generated from progenitors of the germinal zone located in the dorsolateral wall of the telencephalon. Inhibitory neurons and Cajal-Retzius cells are generated from progenitors in the ventral telencephalon (Anderson et al. 1997; Miyoshi et al. 2007, 2010) and at multiple locations adjacent to the cortex (Hoerder-Suabedissen and Molnár 2013; Price et al. 1997; Takiguchi-Hayashi et al. 2004), respectively, and migrate tangentially to populate the cortex (Figure 2). Additionally, transient glutamatergic neurons composed of the subplate cells are born in the rostral medial telencephalic wall, ventricular zone (VZ) and subventricular zone (SVZ) (Hoerder-Suabedissen and Molnár 2015) (Figure 2). Proper laminar positioning and development of the mature cortical area map reflect interactions between intrinsic and extrinsic biological mechanisms that together coordinate the neuronal migration from their birthplace to a final location, where they assemble into functional circuits (Cadwell et al. 2019; Kast and Levitt 2019).

Figure 2 Multiple progenitor zones contribute to the cellular diversity found in the neocortex. A) Scheme of mouse brain at E11, showing several sources of Cajal–Retzius cells (septum, pallial-subpallial boundary and CMTW - caudo-medial telencephalic wall) and subplate (SP) neurons (RMTW - rostro-medial telencephalic wall). B) Illustration of a rostral coronal section, showing origin and generation of SP (VZ and RMTW) and Cajal–Retzius cells (septum and RMTW). C) Illustration of a caudal coronal section showing generation of SP at the SVZ, Cajal–Retzius at the pallial–subpallial boundary, and interneurons in the ventral telencephalon (medial and caudal ganglionic eminence, MGE and CGE). Image from Hoerder-Suabedissen and Molnár et al. 2015.

Studies have addressed two conflicting theories to explain the development of neocortical area map (O’Leary 1989; Rakic 1988). The protomap hypothesis theorizes that cortical progenitor cells are intrinsically specified early in development to give rise to a certain area, and their radially organized neural progeny inherit this spatial information (Bishop, Goudreau, and O’Leary 2000; Rakic 1988; Rubenstein and Rakic 1999). In contrast, the protocortex hypothesis suggests that the cortex is initially homogeneous corresponding to a tabula rasa, originated by equipotent progenitors. Distinct areas are formed in response to extrinsic signals, including incoming thalamocortical axons (Van Der Loos and Woolsey 1973; O’Leary 1989). Currently, there is evidence available supporting both models, and they will be discussed in the following sections. The early formation of cortical areas is best described by the protomap hypothesis. Data from independent studies demonstrated that normal patterns of cortical region- specific gene expression is stablished in spite of disturbed or absent thalamocortical innervation (Garel, Huffman, and Rubenstein 2003; Miyashita-Lin et al. 1999; Nakagawa,

Johnson, and O’Leary 1999), and suggested that the process of cortical area formation must depend on patterning mechanisms that operate within the telencephalon. The size and positioning of cortical areas are controlled by morphogens secreted from the patterning centers at the rostral and caudal ends of the cortical primordium. Expression of fibroblast growth factor 8 (FGF8) in the commissural plate at the rostromedial end of the telencephalon controls rostral neocortical identity (Fukuchi- Shimogori and Grove 2001). Over-expression of FGF8 causes expansion of rostral cortical areas (motor cortex), reduction and a posterior shift of caudal regions (somatosensory and visual cortex), conversely inhibition of Fgf8 signaling causes the opposite effect (Fukuchi-Shimogori and Grove 2001). Additionally, ectopic expression of FGF8 at the caudal end of the cortex elicits duplication of somatosensory barrels (Assimacopoulos et al. 2012; Fukuchi-Shimogori and Grove 2001). At the anterior end several FGF family members including FGF3, 17, and 18 overlap in expression and have been demonstrated to play complementary, yet distinct roles in patterning the cortex (Bachler and Neubüser 2001; Cholfin and Rubenstein 2007, 2008). Furthermore, multiple signaling molecules including Bone Morphogenetic Proteins (BMPs), WNT and their antagonist proteins are secreted from the cortical hem, another key patterning center that extends caudally along the midline of the cortical primordium (Bachiller et al. 2000; Grove et al. 1998; Hébert, Mishina, and McConnell 2002; Kiecker and Niehrs 2001; Nordström, Jessell, and Edlund 2002) (Figure 3).

Figure 3 Morphogens spatially pattern the mouse telencephalon. Illustration of progenitors patterned by the morphogens Wnt and BMPs from the dorsal hem and ventrally patterned by Shh. FGFs are secreted from a rostral signaling center. Lateral and medial ganglionic eminences (LGE and MGE) generate GABAergic interneurons. R, rostral; C, caudal; D, dorsal; V, ventral. Image from Holguera and Desplan 2018.

These signaling centers subsequently induce the expression of transcription factor gradients, which in turn establish the anterior-posterior and mediolateral axes within the ventricular zone (VZ) of the cortex, prior to the arrival of thalamic afferents. Chicken ovalbumin upstream promoter transcription factor 1 (Couptf1) and trans-acting transcription factor 8 (Sp8) are expressed in reciprocal rostromedial-to-caudolateral gradients (Liu, Dwyer, and O’Leary 2000; Sahara et al. 2007; Waclaw et al. 2006; Zhou, Tsai, and Tsai 2001), while empty spiracles homeobox 2 (Emx2) and paired box gene 6 (Pax6) are expressed in the VZ in reciprocal rostrolateral-to-caudomedial gradients (Gulisano 1996; Walther and Gruss 1991) (Figure 4). Manipulation of these transcription factor gradients results in dramatic changes in sizes and positions of cortical areas (Armentano et al. 2007; Bishop, Goudreau, and O’Leary 2000; Bishop, Rubenstein, and O’Leary 2002; Hamasaki et al. 2004; Mallamaci et al. 2000; Zhou, Tsai, and Tsai 2001). Nevertheless, lamination and connectivity of cortical areas appear to develop normally (Armentano et al. 2007; Bishop, Goudreau, and O’Leary 2000; Cholfin and Rubenstein 2007; Grove and Fukuchi-Shimogori 2003), suggesting that the mechanisms patterning the cortex also establish guidance cues necessary for cortical areas to connect with appropriate thalamic nuclei (Leingärtner et al. 2003; Shimogori and Grove 2005).

Figure 4 Transcription factors establish an area identity map. A) Morphogens and signaling molecules induce expression of transcription factor gradients in the VZ, in particular Pax6, Emx2, Sp8 and Couptf1. B) Gradients of expression are shown in schematized wholemount (top) and sagittal (bottom) views. Pax6 and Emx2 are highly expressed rostrolaterally and caudomedially, respectively. Sp8 and Couptf1 are highly expressed rostromedially and caudolaterally, respectively. Image from Greig and Woodworth et al 2013.

In addition to early patterning of the telencephalon, there is a large body of literature demonstrating the roles of thalamocortical innervation and activity-dependent mechanisms influencing the refinement and the formation of distinct functional areas of the neocortex, providing support for the protocortex hypothesis. One example is the existence of spontaneous thalamic calcium waves that propagate among sensory- modality thalamic nuclei up to the cortex prior to sensory information processing, and that these waves influence the size of specific cortical fields (Moreno-Juan et al. 2017). Another instance is signaling via early-born neurons, the Cajal-Retzius cells. The migration and distribution of Cajal-Retzius cells influence the size and connectivity of higher-order cortical areas in the postnatal cerebral cortex (Barber et al. 2015) and of the subplate neurons controlling radial migration of excitatory neurons (Ohtaka-Maruyama et al. 2018). Bilateral enucleation early in development in primates induces a reduction in the size of primary visual cortical areas and response to alternative sensory modalities, while adjacent cortical areas develop novel cytoarchitecture (Dehay et al. 1996; Dehay et al. 1989; Rakic 1981; Rakic 1988; Rakic, Suñer, and Williams 1991). Recent ablation studies have demonstrated that sensory thalamic input is essential to establish the genetic and functional distinctions between primary and higher-order cortical areas (Chou et al. 2013; Pouchelon et al. 2014).

1.2.1 Progenitor fate specification During early development, neuroepithelial cells form the telencephalic wall. These cells undergo symmetric cell divisions and expand in number, as well as differentiate into radial glia, creating the ventricular zone (VZ) (Götz and Huttner 2005). Radial glia cells generate outer radial glia and intermediate progenitors, which form the subventricular zone (SVZ) above the VZ (Beattie and Hippenmeyer 2017). Neocortical progenitors in the VZ and SVZ begin to produce excitatory projection neurons around embryonic day 10.5 (E10.5) (Angevine and Sidman 1961). The earliest-born neurons migrate away from the ventricular surface and form the preplate (Marin-Padilla 1978; Raedler and Raedler 1978). Cajal-Retzius and subplate cells are the first neurons to be generated and to migrate to the cortical plate (Angevine and Sidman 1961; Hevner et al. 2003; Meyer et al. 1998; Price et al. 1997). Newly born neurons migrate into the preplate, splitting it into the

marginal zone and subplate, and creating the cortical plate (Luskin and Shatz 1985; Menezes and Luskin 1994). The cortical plate begins to develop in between these two layers, and projection neurons of the different neocortical layers are generated in a closely controlled temporal order from E11.5 to E19.5 (Angevine and Sidman 1961; Caviness 1982; Caviness and Sidman 1973; Takahashi 1995). As neurogenesis proceeds, later born neurons (layer IV, then layer II/III) arriving at the cortical plate migrate past earlier born neurons (first layer VI, then layer V) in an ‘inside-out’ fashion (Figure 5) (Angevine and Sidman 1961).

Figure 5 Neocortical projection neurons are generated in an ‘inside-out’ fashion. The earliest born neurons form the preplate (PP). Newly born neurons migrate into the preplate, splitting it into the marginal zone (MZ) and subplate (SP), and creating the cortical plate (CP). Later born neurons arriving at the cortical plate migrate past earlier born neurons. Different projection neuron subtypes are born in overlapping temporal waves. CH, cortical hem; Ncx, neocortex; IZ, intermediate zone; LGE, lateral ganglionic eminence; MGE, medial ganglionic eminence; SVZ, subventricular zone; VZ, ventricular zone; WM, white matter. Image from Molyneaux and Arlotta et al., 2007.

Neocortical VZ and SVZ progenitor cells have distinct morphologies, express different genes and follows a specific pattern of cell division. Radial glia cells retain the

cell body positioned along the lateral ventricles, extent a long process to the ventricular (apical) surface and a second process to the pial (basal) surface (Figure 6). Radial glia cells are used as a scaffold by some newly born neurons as they migrate into the cortical plate (Rakic 1972). They mainly divide asymmetrically to self-renew, while also giving rise to outer radial glia, intermediate progenitors or neurons (Miyata et al. 2001; Noctor et al. 2001). Outer radial glia cells lack an apical process and undergo asymmetrical divisions to self-renew and generate neurons (Figure 6). Although they were first characterized in the outer SVZ of the developing human cortex (Hansen et al. 2010) and were thought to be present only in gyrencephalic animals (Fietz et al. 2010), they also exist in a small population in the SVZ of rodents (Martínez-Cerdeño et al. 2012; Wang et al. 2011). Intermediate progenitors have a multipolar morphology and are not anchored to either the apical or basal cortical surface (Figure 6). They undergo limited proliferative divisions and divide symmetrically to produce either two new intermediate progenitors or two post- mitotic neurons (Kowalczyk et al. 2009; Miyata et al. 2004; Sessa et al. 2008). Neocortical projection neurons subtypes are sequentially generated by this diverse progenitor types in the VZ and SVZ and migrate radially to establish the laminar structure of the neocortex (Greig et al. 2013; Molyneaux et al. 2007).

Figure 6 Sequential generation of neocortical projection neuron subtypes. A) Illustration of radial glia (RG) in the ventricular zone (VZ) producing neurons, intermediate progenitors (IPs) and outer RG (oRG). IPs and oRG establish the subventricular zone (SVZ). Cajal–Retzius (CR) cells are generated at multiple locations adjacent to the cortex and migrate tangentially into layer I. Other projection neurons are born in the VZ and SVZ and migrate along radial glial processes to reach their final laminar position. B) Different projection neuron subtypes are born in sequential waves, in the following order: subplate neurons (SPN), corticothalamic projection neurons (CThPN), subcerebral projection neurons (SCPN), Layer IV granular neurons (GN), callosal projection neurons (CPN). NE, neuroepithelial cell. Image from Greig and Woodworth et al 2013.

Notably, several lines of evidences support the model that distinct subtypes of excitatory cortical neurons are generated in sequential order: 1) isolated progenitor cells in vitro recapitulate the normal order of neuronal subtype generation, even in a highly simplified environment (Shen et al. 2006), indicating the existence of a cell intrinsic control program. Changes in fate potential over time is also influenced by cell cycle length and the number of divisions undergone by progenitor cells before terminal differentiation (Calegari et al. 2005; Calegari and Huttner 2003; Pilaz et al. 2009). Genetic programs

regulating proliferation, differentiation, and survival of neural progenitor cells are thus essential aspects of progenitor competence; and (2) ventricular zone progenitors become more hyperpolarized as they generate successive subtypes of neurons in vivo, and manipulations of the membrane potential of these progenitors shift the transcriptional programs to a later developmental state, leading to changes in neuronal subtype identity (Vitali et al. 2018), providing a potential mechanism through which environmental signals might play a role in timing of cortical neurogenesis. In line with this interpretation, there is also evidence indicating that early-born neurons send feedback signals to progenitors controlling the switch to the generation of late-born neurons (Landeira 2017; Parthasarathy et al. 2014; Seuntjens et al. 2009; Toma et al. 2014). An intrinsic control for the sequential generation of neocortical neurons is also supported by the existence of TFs affecting this process. For example, the transcriptional repressor Forkhead Box transcription factor G1 (Foxg1, formerly known as brain-factor BF-1), regulates neurogenesis in the embryonic telencephalon as well as a number of other neurodevelopmental processes (Kumamoto and Hanashima 2017). Knock-out of Foxg1 leads to severe microcephaly, reduction of the dorsal telencephalic areas and complete loss of ventral telencephalic structures (Xuan et al. 1995). Conditional Foxg1 deletion in neocortical progenitors leads to an excess generation of Cajal-Retzius and decreased generation of later-born neurons (Hanashima et al. 2004). The depletion of the neural progenitor population via premature cell cycle exit and neuronal differentiation cause these abnormalities in Foxg1 mutants (Fasano et al. 2009; Manuel et al. 2011; Martynoga et al. 2005). COUP-TFI and II also play a role in the sequential generation of neuronal subtypes during neocortex development. Double knock-down of Coup-tf I/II in embryonic stem cell-derived neurospheres caused sustained neurogenesis and the prolonged generation of early-born neurons (Naka et al. 2008). It is noteworthy that the expression and, therefore, functions of both Foxg1 and Coup-tf I/II are under influence of environmental signals, such as cytokines (Naka et al. 2008; Toma et al. 2014). Therefore, an interplay between intrinsic and extrinsic signals might be the most parsimonious explanation to the sequential generation of neuronal subtypes in the developing neocortex. This collaborative mechanism may also help to understand the early plasticity observed at early developmental stages, both at the

progenitor levels (Landeira 2017; Naka et al. 2008; Toma et al. 2014) and in post-mitotic neurons (Díaz-Alonso et al. 2012; De La Rossa et al. 2013; Rouaux and Arlotta 2013).

1.2.2 Neuronal subtype specification Upon arrival at the cortical plate, projection neurons undergo further differentiation, showing distinct gene expression profile and axonal projection, that strongly correlates with the laminar position (Harris and Shepherd 2015; Lodato and Arlotta 2015; Molyneaux et al. 2015). The molecular mechanisms governing the acquisition of specific neuronal subtype fates in the neocortex have begun to be revealed over the past two decades. Several studies have contributed to the identification of laminar- and subtype-specific gene expression patterns in the neocortex (Paola Arlotta et al. 2005; Gray et al. 2004; Lein et al. 2007; Magdaleno et al. 2006; Visel 2004). Many of these transcription factors are expressed by early post-mitotic neurons migrating away from the germinal zone and some in progenitor cells (see details bellow), and reciprocal regulation among these genes progressively refines neuronal subtype identity (Figure 7) (Greig et al. 2013; Srinivasan et al. 2012).

Figure 7 Molecular programs direct subtype identity of postmitotic projection neurons. B) Key regulators have been identified to be part of a complex transcriptional network (top). Known interactions are indicated by arrows (bottom). C) Changes in expression of these molecular programs cause a shift in subtype identity, obtaining features of other neuronal classes. The boundaries between corticofugal projection neurons and callosal projection neurons might shift independently of one another (dashed lines). SCPN, subcerebral projection neurons. CThPN, corticothalamic projection neurons. CFuPN, corticofugal projection neurons. CPN, callosal projection neurons. Image from Greig and Woodworth et al 2013.

Forebrain Embryonic Zinc Finger-Like Protein 2 (Fezf2) is required for the specification of layer V corticospinal motor neurons (CSMNs) and other subcerebral projection neurons, which are absent from Fezf2 null mutant mice neocortex (Molyneaux et al. 2005). Overexpression of Fezf2 by electroporation at E13.5 results in excess production of subcerebral projection neurons that settle ectopically in the germinal zone (Molyneaux et al. 2005). Fezf2 expression in embryonic and early postnatal callosal projection neurons of layer II/III is sufficient to lineage reprogram these cells into layer V/VI corticofugal projection neurons (Rouaux and Arlotta 2013). Although it is not known whether FEZF2 acts in progenitors or postmitotically, Fezf2 mRNA is expressed by a subset of progenitors in the VZ and SVZ and also by postmitotic neurons (Guo et al. 2013). Another example of a transcription factor important for lineage specification is BAF Chromatin Remodeling Complex Subunit BCL11B, also known as CTIP2. CITP2 acts downstream of FEZF2 (Chen et al. 2008) and is also necessary and sufficient for the specification of CSMNs (Arlotta et al. 2008; Chen et al. 2008). On the other hand, the Special AT-Rich Sequence-Binding Protein 2 (SATB2) seems to function as a suppressor of CTIP2, regulating the acquisition of upper-layer fates including layer IV/RORβ+ and layers II/III Cux1+ neurons (Alcamo et al. 2008). T-Box Brain Transcription Factor 1 (Tbr1) promotes the identity of corticothalamic neurons while repressing subcerebral fates through reducing expression of Fezf2 and CTIP2 (Mckenna et al. 2011). Similarly, the SRY-Box Transcription Factor 5 (SOX5) is believed to control the sequential generation of distinct corticofugal neuron subtypes (Lai et al. 2008), likely through activation of Tbr1 expression and repression of Fezf2 expression (Greig et al. 2013). Genetic deletion of SOX5 in the developing neocortex impairs differentiation of layer VI corticothalamic neurons, while differentiation of layer V/VI subcerebral projection neurons is accelerated (Lai et al. 2008). Other noteworthy transcription factors that were not included in this representation of molecular programs controlling neuronal specification (Figure 7) are POU class 3 homeobox 2 (Pou3f2, also known as Brn2) and POU class 3 homeobox 3 (Pou3f3, also called Brn1). These transcription factors have been described to be expressed both postmitotically and in progenitor cells, governing neurogenesis and subtype identity

(Dominguez, Ayoub, and Rakic 2013; McEvilly et al. 2002; Sugitani et al. 2002). Brn2 and Brn1 play overlapping roles in the regulation of upper-layer neuronal migration and specification. Absence of Brn1/Brn2 genes in mice led to a dramatic reduction in the number of upper layer neurons and defective neuronal migration (McEvilly et al. 2002; Sugitani et al. 2002). Conversely, overexpression of either Brn1 or Brn2 in early neural progenitors was sufficient to induce the precocious generation of Satb2+ upper-layer neurons, possibly through regulation of neurogenesis by suppressing Notch effector Hes5 and promoting the expression of proneural transcription factors Ngn2 and Tbr1 (Dominguez, Ayoub, and Rakic 2013). As we will discuss in more detail in a separate chapter, the Zinc Finger and BTB Domain-Containing Protein 20 (ZBTB20) is also expressed by progenitors and post- mitotic neurons and has been associated with the temporal control of neuronal subtype generation and astrogliogenesis in the developing neocortex (Doeppner et al. 2019; Nagao et al. 2016; Tonchev et al. 2016).

1.2.3 Astrocyte development After neurogenesis, neural progenitors in the dorsal telencephalon progressively transition to a gliogenic fate, generating astrocytes (Gorski et al. 2002; Qian et al. 2000). Glial restricted progenitors start to appear around E15.5 (Costa et al. 2009). Intrinsic and extrinsic mechanisms have been proposed to orchestrate the switch from neuron production to astrogenesis (Miller and Gauthier 2007; Rowitch and Kriegstein 2010), including epigenetic regulation (Hirabayashi and Gotoh 2010; Song and Ghosh 2004; Takizawa et al. 2001); NOTCH signaling (Ge et al. 2002; Grandbarbe et al. 2003); JAK- STAT pathway (Kamakura et al. 2004); HES proteins through inhibition of neurogenic bHLH factors (Kamakura et al. 2004; Namihira et al. 2009; Nieto et al. 2001; Tomita et al. 2000); BMPs activate Smad transcription factors (Gross et al. 1996; Mabie, Mehler, and Kessler 1999; Nakashima et al. 2001); cytokines secreted by neurons – particularly members of the interleukin 6 (IL-6) family which activate JAK-STAT pathway, such as leukaemia inhibitory factor (LIF), CNTF and cardiotrophin 1 (CT1 or CTF1) (Barnabé- Heider et al. 2005; Bonni et al. 1997; Koblar et al. 1998; Nakashima et al. 1999; Ochiai et al. 2001); TGFβ-signaling induces differentiation of radial glia into astrocytes (Stipursky

et al. 2014; Stipursky, Francis, and Gomes 2012); SHP2-MEK-ERK-Rsk pathway and Neureglin-1–ErbB2/ErbB4 pathway are involved in the timing of glial differentiation (Gauthier et al. 2007; Sardi et al. 2006; Schmid et al. 2003). Astrocytes are generated from multiple sources in the dorsal telencephalon (Schitine et al. 2015). At late stages of embryonic development, cortical protoplasmic astrocytes begin to be generated in a spatially restricted manner from radial glial cell in the VZ that also give rise to columns of cortical projection neurons (Gao et al. 2014; García-Marqués and López-Mascaraque 2013; Magavi et al. 2012). At the end of cortical neurogenesis, a fraction of radial glia cells give rise to astrocytes by direct transformation, an event that is very well documented in different species including in humans (Alves et al. 2002; DeAzevedo et al. 2003; Schmechel and Rakic 1979; Voigt 1989). During this process, after a final asymmetric division, radial glial cells lose their apical process and move toward the pial surface, eventually transforming into astrocytes in the SVZ (Noctor et al. 2004). Another substantial portion of astrocytes seem to derive from intermediate astroglial progenitors in the postnatal SVZ and migrate radially to populate the cerebral cortex (Levison and Goldman 1993; Levison et al. 1993; Luskin and McDermott 1994; Zerlin, Levison, and Goldman 1995). During the first two postnatal weeks after birth, when they reach their destination, the immature cells still proliferate, locally generating the major source of astrocytes in the cortex (Ge et al. 2012). During embryonic and neonatal development, a distinct class of progenitors undergoes cell division in the marginal zone (MZ)/layer I and give rise to astrocytes, oligodendrocytes, and neurons (Breunig et al. 2012; Costa et al. 2007). These marginal zone MZ/layer I progenitors are derived both from dorsal telencephalic Emx1-expressing progenitors and ventral Gsh2- and Nkx2.1- expressing progenitors (Costa et al. 2007). Together with SVZ glial progenitors derived from the ganglionic eminences (Marshall and Goldman 2002; Marshall, Novitch, and Goldman 2005; Minocha et al. 2017), they can be considered as ventral sources of astrocytes in the neocortex.

1.3 Zbtb20 function during cortical development The Zinc Finger and BTB Domain-Containing Protein 20 (ZBTB20 - also known as DPZF, HOF, ODA8, ZFP288 and ZNF288) belongs to a family of transcription factors with

an N-terminal BTB/POZ domain and several C-terminal Krüppel-type zinc finger motifs. The BTB/POZ domain permits homo- and heterodimerization as well as protein-protein interactions, while DNA binding is mediated by the zinc fingers. The ZBTB (Zinc finger, Broad-complex, Tramtrack and Bric-à-brac) proteins are encoded by at least 49 genes in mouse and human and commonly serve as transcriptional repressors (Kelly and Daniel 2006; Siggs and Beutler 2012). Defects in Zbtb20 have been implicated in a wide range of neurodevelopmental disorders, such as autism spectrum disorder, intellectual disability and agenesis of the corpus callosum. Alterations in Zbtb20 gene have been found in patients with Primrose syndrome, chromosome 3q13.31 microdeletion, microduplication syndromes, and major depressive disorder (Casertano et al. 2017; Cleaver et al. 2019; Cordeddu et al. 2014; Davies et al. 2014; Jones et al. 2018; Koul 2014; Mattioli et al. 2016; Mulatinho et al. 2016; Rasmussen et al. 2014). Among them, Primrose syndrome patients presented the most severe phenotype, including macrocephaly, intellectual disability and other behavioral abnormalities, dysmorphic facial features, greater body height compared to the general population, progressive muscle wasting, hearing loss and ectopic calcification of the ears and brain during puberty or early adulthood (Cleaver et al. 2019; Cordeddu et al. 2014). Primrose syndrome is a rare autosomal dominant condition caused by heterozygous missense variants within Zbtb20. All affected codons in Primrose syndrome were located within the C-terminal zinc finger domain, affecting the DNA-binding domain of the transcription factor possibly through dominant-negative action (Cordeddu et al. 2014). However, the molecular mechanism of ZBTB20’s physiological function in the developing brain and implication in these disorders are largely unknown. ZBTB20 is required for the specification of the hippocampal CA1 field. Ectopic expression of ZBTB20 in projection neurons of the retrosplenial cortex and subiculum induces aberrant CA1-like molecular identity of projection neurons in the midline cerebral cortex (Nielsen et al. 2007; Nielsen et al. 2010; Xie et al. 2010). During development of hippocampal pyramidal neurons ZBTB20 represses several genes that control projection neuron development in the isocortex, including Cux1, Cux2, Fezf2, Foxp2, Mef2c, Rorβ, Satb2, Sox5, Tbr1, Tle4, and Zfpm2 (Nielsen et al. 2014).

Severe morphological defects of archicortex, reduced life span and growth rate have been reported in Zbtb20 full knock-out mice (Rosenthal 2010). Zbtb20 mRNA exhibits a ventral high-to-dorsal low gradient of expression in medial pallium progenitors at E14, and it’s expressed in upper-layer neurons of the retrosplenial cortex at P4. Loss of Zbtb20 function causes a progressive ventral displacement of retrosplenial cortex and molecularly specified fields in the medial pallium (Rosenthal et al. 2012). During development of the cerebral cortex, ZBTB20 has recently been associated with the sequential generation of neuronal subtypes (Tonchev et al. 2016) and astrocytes (Doeppner et al. 2019; Nagao et al. 2016). ZBTB20 protein is expressed in the VZ and SVZ from E14 to E18, adult SVZ, astrocytes, and transiently in neurons at early postnatal stages (Mitchelmore et al. 2002; Nagao et al. 2016; Tonchev et al. 2016). Zbtb20 overexpression and knock-down by in utero electroporation at E15.5 promotes and suppresses astrocytogenesis in the somatosensory cortex, respectively (assessed by S100β, GFAP, Aldh1l1-GFP expression at P7), possibly by repression of Brn2 expression in the astrocyte cell lineage (Nagao et al. 2016). Zbtb20 full knock-out showed a reduction of S100β+ astrocytes and normal expression of GFAP in the cerebral cortex at P12 (Doeppner et al. 2019). Zbtb20 loss of function leads to a reduction of the size of L2/3 and an increase of L4, 5 and 6 at early postnatal stages, likely caused by an extension of development window of this cells and migration defects of upper layer neurons (Tonchev et al. 2016). The findings that ZBTB20 regulates astrogliogenesis by repressing Brn2 expression (Nagao et al. 2016) and its ZBTB20 loss leads to a reduction of layer II/III BRN2+ neurons (Tonchev et al. 2016) are seemingly contradictory. A possible mechanism to conciliate these observations could be that ZBTB20 acts at different stages of the lineage progression of neocortical progenitor to generate upper layer neurons or astrocytes, likely in concert with other players, to regulate cell-fate acquisition. In this work, in order to disentangle the functions of this protein in neocortex development we used a combination of genetic techniques to perturb Zbtb20 expression either in progenitors or post-mitotic neurons. Furthermore, we evaluate the effect of Zbtb20 loss of function in neuronal projections and somatosensory circuit formation.

2 AIM

The main purpose of this project is to identify and characterize the molecular pathways involved in the specification of neocortical progenitor cells to generate upper layer neurons and macroglial cells.

2.1 Specific aims

Evaluate the expression of transcription factors in the proliferative zones of the dorsal telencephalon at different developmental stages; Pinpoint transcription factors expressed by progenitor cells that could be involved in the specification of upper layer neurons and/or astrocytes in the developing neocortex; Characterize the function of the candidate transcription factor by in utero electroporation and using conditional knock-out mice models.

3 METHODS

3.1 Mouse lines and breeding All mice experimentation were performed in accordance with the United States of America animal welfare regulations and were approved by The Scripps Research Institute (protocol number 08-0030) and The Johns Hopkins University (protocol number M016M273 and MO19255) Institutional Animal Care and Use Committee (IACUC). C57BL/6J wild-type (WT) mice were obtained from Charles River Laboratories for overexpression experiments and breeding with genetically modified mice described below. The date of the vaginal plug detection was designated embryonic day E0.5, and the date of birth P0 (postnatal day 0). Emx1-Cre (B6.129S2-Emx1tm1(cre)Krj) (Gorski et al. 2002), Ai9 (Madisen et al. 2010), DCX-Cre (Harris et al. 2014), NEX-Cre (Goebbels et al. 2006), Aldh1l1-eGFP (Tg(Aldh1l1-EGFP)OFC789Gsat) (Gong et al. 2003), and FLPe (B6.Cg- Tg(ACTFLPe)9205Dym/J) (Rodríguez et al. 2000) mice have been previously described. Emx1-Cre mice express Cre recombinase in Emx1-expressing cells of the developing forebrain. Emx1 is expressed in both progenitor cells (as early as E10.5) and postmitotic neurons of the medial, dorsal, and lateral pallia. In this transgenic mouse strain, excitatory neurons and glia cells are recombined in the hippocampus, neocortex and piriform cortex (Gorski et al. 2002). Nex-Cre mice express Cre recombinase under control of regulatory sequences of NEX, a gene that encodes a neuronal basic helix-loop-helix (bHLH) protein. The coding region of NEX (on exon 2) was replaced by a Cre expression cassette. NEX is expressed in progenitor cells in the SVZ and newly generated neurons of the dorsal telencephalon prior to their migration. In this transgenic mouse, Cre-mediated recombination is prominent in neocortex and hippocampus (Belvindrah et al. 2007; Goebbels et al. 2006; Wu et al. 2005). Dcx-Cre mice express Cre recombinase under control of regulatory sequences of doublecortin (Dcx), a microtubule-associated protein expressed in immature neurons (Harris et al. 2014).

Ai9 is a Cre reporter mouse line containing the CAG promoter followed by a loxP- flanked (‘floxed’) stop cassette and a fluorescent marker gene, tdTomato (Madisen et al. 2010). Removal of the stop cassette is induced by Cre recombination, allowing expression of tdTomato. This reporter mouse is useful in imaging and tracking specific cell populations in vivo, such as fate mapping of progenitor cells transfected with Cre by in utero electroporation. FLPe is a mouse strain expressing the site-specific flippase (FPL) recombinase driven by the human ACTB regulatory sequences. The ACTB promoter region drives expression in the germline. FLP recognizes a pair of FLP recombinase target (FRT) sequences that flank a genomic region of interest and mediates site-specific excisional recombination (Rodríguez et al. 2000). Aldh1l1-eGFP is a BAC (bacterial artificial chromosome) transgenic mice, in which enhanced green fluorescent protein (eGFP) is driven by the regulatory sequences of aldehyde dehydrogenase 1 family, member L1 (Aldh1l1) gene (Gong et al. 2003). Aldh1l1 is expressed in glial progenitors, postnatal neural stem cells, and adult astrocytes (Anthony and Heintz 2008; Cahoy et al. 2008; Foo and Dougherty 2013). Zbtb20 knockout-first allele with conditional potential embryonic stem (ES) cells (Zbtb20tm1a(EUCOMM)Hmgu) were obtained from the EUCOMM European Conditional Mouse Mutagenesis Program (ES clone HEPD0822_1_A11). It was designed to insert LoxP sites flanking a critical exon of the Zbtb20 gene, with upstream elements including a neomycin-resistance cassette (PGK-neo) and LacZ reporter flanked by two FRT sites. ES cells were transplanted into mouse blastocysts by The Scripps Research Murine Genetics Core (La Jolla, CA, United States) to produce transgenic mice. Heterozygous F1 mice (Zbtb20flox-neo/+) were mated with FLPe mice (The Jackson Laboratory) to remove the PGK-neo cassette and LacZ reporter. The resulting offspring were subsequently mated to C57BL/6J mice to remove the FLPe transgene. Crossing heterozygous mice generated Zbtb20flox/flox mice. Zbtb20flox/flox mice were crossed with Cre lines that were heterozygous for Zbtb20flox/+ to generate Cre Zbtb20flox/flox (conditional knockout or cKO), and Cre Zbtb20flox/+, Zbtb20flox/flox and Zbtb20flox/+ (control).

3.2 Mouse genotyping Genotyping was carried out using purified DNA preparation from mouse tail biopsies followed by polymerase chain reaction (PCR). Tails were digested overnight at 55°C with proteinase K (0.1mg/mL) in lysis buffer (10 mM EDTA, 0.5% SDS, 100 mM NaCl, 10 mM Tris-HCl, pH 8). Precipitation of DNA was performed with isopropanol, the DNA pellet was washed with ethanol to remove salts, air-dried and resuspended in water. PCR genotyping was performed according to previously described protocols by the Jackson Laboratory. For genotyping of Emx1-Cre, DCX-Cre, NEX-Cre, Aldh1l1-EGFP and FLPe were used a standard master mix containing Taq DNA Polymerase (#MB042- EUT-L, SYD Labs), buffer (#MB042-EUT-L, SYD Labs), 0.2mM dNTPs (#N0447L, New England Biolabs), and 0.25µM each primer (all primers used here were listed in Table 1). For the PCR genotyping of Ai9 and Zbtb20 mutant mice, we used 2X green mix (GoTaq® Green Master Mix, #M712C, Promega) containing DNA Polymerase, dNTPs, MgCl2 and reaction buffer. DNA amplicon was examined for size and quality through electrophoresis, using 1% to 2% agarose gel in TAE (0.04M Tris-acetate, 0.001M EDTA) with ethidium bromide (0.5 μg/mL) to visualize the DNA under ultraviolet light. A DNA molecular weight marker, 2- Log DNA Ladder (#N3200L, New England Biolabs), was used to identify the approximate size of the PCR product. The length of PCR products or amplicons are listed in Table 1.

3.3 Plasmid constructs pCIG2 or pCAG-IRES-GFP has been described (Hand et al. 2005). It contains an internal ribosome entry site (IRES) and enhanced green fluorescent protein (EGFP) expression cassette, under the control of a CMV-enhancer and a chicken β-actin promoter (pCAG). pCAG-YPet was a kind gift from Randal A. Hand. This construct contains a yellow fluorescent protein (YPet) under the control of pCAG. pBlueScriptIISK+ (Agilent Technologies) was used to subclone fragments. It was a kind gift from Vinicius Toledo Ribas. The piggyback (PB) transposon system was used to permanently label electroporated cells, in order to avoid dilution of reporter proteins after several rounds of

cell division. For this purpose, cells were co-electroporated with pPBCAG-mRFP, and PB- GLASTase or PB-CBAase (Chen and LoTurco 2012). PB-CBA-Klf15 and PB-CBA-Zbtb20 were cloned by Cristina Gil-Sanz, a former member of Müller’s lab. Coding sequences for Klf15 and Zbtb20 were amplified from mouse cDNA by PCR. Isoform 1 of Klf15 and Zbtb20 including the 9 first nucleotides before the ATG (Kozak sequence) were amplified. Restriction enzymes sites were added to the primer sequence, and fragments were cloned into PB-CAG-EGFP (Chen and LoTurco 2012). AgeI and NotI sites were added to Klf15 forward and reverse primers, respectively. EcoRI and BglII sites were added to Zbtb20 primers. pCIG-DCX or pDCX-Ires-GFP has been described (Franco et al. 2011). This construct contains a characterized promoter fragment from the Dcx gene (Wang et al. 2007) controlling the expression of IRES-EGFP. Coding sequences for Zbtb20 and Klf15 were inserted between the Dcx promoter and IRES-EGFP to allow expression in immature neurons (see cloning details in the next two paragraphs). For the generation of pDcx-zbtb20-Ires-GFP, the vector pCIG-DCX was cut with SmaI and EcoRI. The Zbtb20 sequence was extracted from PB-CBA-Zbtb20. This construct was cut with BglII, blunted to allow non-compatible ends to be joined (SmaI and BglII), and then cut with EcoRI. Vector (pDCX-Ires-GFP) and insert (Zbtb20) were connected by a ligation reaction, generating pDcx-zbtb20-Ires-GFP construct. pDcx-Klf15-Ires-GFP was generated by Gibson assembly method. pCIG-DCX was cut with EcoRI, and Klf15 was amplified by PCR. Vector (DCX-Ires-GFP) and insert (Klf15) were connected by Gibson assembly reaction, generating pDcx-Klf15-Ires-GFP. pDcx-Zbtb20-Ires-Cre was generated by Gibson assembly method. pCIG-DCX was cut with EcoRI and NotI. The fragments Zbtb20, Ires, and Cre were individually amplified by PCR. Vector (pDCX) and inserts (Zbtb20, Ires, and Cre) were connected by Gibson assembly reaction, generating pDcx-Zbtb20-Ires-Cre. pDcx-Klf15-Ires-Cre was generated by Gibson assembly method. pCIG-DCX was cut with EcoRI and NotI. The fragments Klf15-Ires and Cre were individually amplified by PCR. Vector (pDCX) and inserts (Klf15-Ires, and Cre) were connected by Gibson assembly reaction, generating pDcx-Klf15-Ires-Cre.

pCAG-Cre-Ires-GFP or pCIG2-NLSCre was cloned by Isabel Martinez-Garay, a former member of Müller’s lab. The N-terminal nuclear localization sequence (NLS) and the coding sequence of Cre recombinase (CRE) were inserted into pCIG2 between XhoI and EcoRI. To generate pCAG-Zbtb20-Ires-GFP construct, pCIG2 (pCAG-IRES-GFP) and pDcx-zbtb20-Ires-GFP were cut with EcoRI and NotI. Vector (pCAG) and insert (Zbtb20- IRES-GFP) were connected by a ligation reaction. pCAG-zbtb20wt-Ires-Cre was cloned using restriction enzymes. The CAG promoter was first subcloned into pBlueScriptIISK+. pBlueScriptIISK+ and PBCAG-eGFP (Chen and LoTurco 2012) were cut with SpeI and EcoRI. Vector (pBlueScriptIISK+) and insert (pCAG) were connected by a ligation reaction, generating pCAG-pBlueScriptIISK+ construct. Dcx-zbtb20-Ires-Cre and pCAG-pBlueScriptIISK+ were cut with EcoRI and SacI. Vector (zbtb20-Ires-Cre) and insert (pCAG) were connected by a ligation reaction, generating pCAG-zbtb20wt-Ires-Cre construct. Dominant negative mutations of Zbtb20 and Cre recombinase were expressed under the control of pCAG, through pCAG-zbtb20DN-Ires-Cre constructs. Human dominant negative mutations described by Cordeddu et al., 2014 were cloned by PCR amplification using mega primers. First, the Zbtb20 fragment was cut from CAG-zbtb20wt- Ires-Cre and subcloned into pBlueScriptIISK+ using the restriction enzymes SmaI and EcoRI. Vector (pBlueScriptIISK+) and insert (Zbtb20wt) were connected by a ligation reaction. The product pBlueScriptIISK+Zbtb20wt was used to introduce point mutations at Zbtb20 sequence. The dominant negative mutations (henceforth called DN) were generated by PCR using mega primers containing the Zbtb20 point mutation. Zbtb20DN was amplified through three rounds of PCR (Table 6 - Primers for cloning). The constructs pBlueScriptIISK+ with Zbtb20 DN were used to clone Zbtb20 DN back into CAG-Ires-Cre using the restriction enzymes, SpeI and XhoI. Thereby, CAG-zbtb20DN-Ires-Cre constructs were generated. All the constructs were sequenced to confirm the point mutations. We cloned seven different Zbtb20 DN mutations (Figure 8) described in patients with Primrose syndrome by Cordeddu and colleagues (2014), all mutations were located within the C-terminus zinc finger domain: in the first zinc finger (1768, 1771 and 1787),

second zinc finger (1861), or in the linker connecting these motifs (1802, 1805 and 1811). The numbers used here refer to the altered nucleotide position in the longer transcript variant sequence (NCBI Reference Sequence: NM_001164342.1). These mutations affect the DNA-binding domain of the transcription factor possibly through dominant- negative action (Cordeddu et al. 2014). We used the Zbtb20 DN mutation 1768 in all electroporation experiments, that correspond to the following nucleotide and amino acid change, respectively: 1768A>C and Lys590Gln (Figure 8). This DN mutation exhibited the strongest effect in reduced binding to DNA, impaired function in repressing luciferase reporter expression under the control of the promoter for AFP (encoding α-fetoprotein) known to contain a ZBTB20 recognition site and had a dominant-negative impact on wildtype ZBTB20 (Cordeddu et al. 2014).

Figure 8 Zbtb20 dominant negative mutations described in patients with Primrose syndrome by Cordeddu and colleagues (2014).

3.4 Cloning strategies and protocols DNA construct maps were analyzed, and cloning strategies designed using SnapGene 4.0.4. Restriction enzymes and the appropriate buffer (New England Biolabs) were used to digest DNA plasmids or PCR products, according to the manufacturer's protocol (//nebcloner.neb.com/#!/redigest). The resulting fragments were analyzed by agarose gel electrophoresis. Vectors digested with only one restriction enzyme were dephosphorylated with calf intestine alkaline phosphatase (CIP) to prevent self-ligation of linearized plasmid DNA according to the manufacturer's protocol (New England Biolabs).

To clone fragments into blunt-end vectors, 5óverhangs of fragments were filled in with dNTP and 3óverhangs were removed by T4 DNA polymerase (#M0203S, New England Biolabs) in the appropriate buffer (NEBuffer™ 2.1 #B7202S, New England Biolabs) with 1mM dNTPs (#N0447L, New England Biolabs). The reaction was incubated at 12°C for 15 minutes and then inactivated at 75°C for 20 minutes. DNA fragments were PCR amplified from mouse genomic DNA using Phusion High- Fidelity DNA Polymerases (#F549L, Thermo Fisher Scientific). Some PCR products were designed to contain specific restriction enzyme sites compatible with the desired vector. In such cases, the PCR fragments were digested with the corresponding enzyme before ligation. In absence of restriction enzymes sites compatibility or difficult cloning, the PCR product containing 3Á overhangs was cloned into pGEM-T Easy vector (Promega) as described by the manufacturer. Mega primer-mediated cloning strategy was used to introduce point mutations at Zbtb20 sequence, through three rounds of PCR using multiple forward and reverse priming oligonucleotides (Table 6 - Primers for cloning). Insert and vector with compatible overhangs were ligated for two hours at room temperature or overnight at 4°C using T4 DNA Ligase (Thermo Fisher Scientific). The concentration of insert and vector was calculated based on the size of each fragment: Insert concentration (ng) = size (bp) X 0.03 Vector concentration (ng) = size (bp) X 0.01 Gibson assembly method was used to clone multiple DNA fragments into a vector, and to clone fragments with restrictions sites inside the fragment of interest. The strategy was designed using NEBuilder Assembly Tool (//nebuilder.neb.com/#!/) and Gibson Assembly cloning kits (#GA1100-50, Synthetic Genomics) were used following the manufacturer's protocol. Heat shock transformation was performed using DH5α competent E. coli. All plasmids used here contained an antibiotic resistance gene, either ampicillin or kanamycin. The transformation was plated onto LB agar plates containing the appropriate antibiotic and incubated overnight at 37°C. Isolated colonies were selected and inoculated in LB liquid containing antibiotics. Bacterial cultures were incubated overnight at 37°C in a shaking incubator.

Miniprep kit was used to purify endotoxin-free plasmid DNA (Biopioneer #PMIP-10) from bacterial cultures, and silica membrane columns were used to purify DNA fragments from agarose gels as well as to perform direct purification of PCR products (NucleoSpin Gel and PCR Clean-Up, Takara #740609.250). The plasmid cloned was verified by restriction analysis followed by DNA sequencing. DNA plasmids were purified using Endonuclease-Free Plasmid Kit (Takara #740420.50) following the manufacturer’s instructions. The final concentration of DNA was measured using a spectrophotometer (Thermo Scientific™ NanoDrop 2000) and adjusted to 2 μg/μL in endotoxin-free TE buffer.

3.5 In utero electroporation In utero electroporation has been extensively used to manipulate gene expression in vivo in the developing cortex, this technique allows spatial and temporal manipulation. The protocol described here was adapted from Saito and Nakatsuji 2001. Timed pregnant mice were placed in an induction chamber and anesthetized with 3% isoflurane in oxygen, eye lubricant (Puralube Vet Ointment) was applied to prevent damage, mice were then transferred to a heated blanket connected to the anesthesia machine with a nose mask. During the surgical procedure, mice were anesthetized with 2% isoflurane in oxygen and 5mg/kg Carprofen in saline (OstiFen Injection Sterile Injectable Solution 50 mg/mL) was injected subcutaneously for pain relief. Respiratory rate was closely observed and mouse’s response to a noxious stimulus (toe pinch) was verified to ensure adequate anesthesia before proceeding. The abdominal skin was shaved and disinfected with povidone-iodine and alcohol. An incision along the midline of the skin and the peritoneum was made. The skin was covered with a delicate wipe (Kimtech Science Kimwipes), sterile saline solution (37°C) was applied around the incision and their uterine horns exposed. Plasmid DNA (2 µg/μL) with 1/20 volume of 1% Fast Green (#F7252, Sigma) in TE buffer was injected into the embryos’ lateral ventricles through a beveled glass micropipette. Warm sterile saline solution was constantly applied to moisturize the embryos. Embryo’s head was held using tweezers with disk electrodes (3 or 5mm diameter electrode disk, respectively CUY650P3 and CUY650P5) with the positive

electrode contacting the dorsolateral region of the injected side (for selective targeting the somatosensory cortex). Five electric pulses of 30-50V and 50-80ms were delivered at a rate of one pulse per 950ms using an electroporation system (ECM 830 BTX, Harvard Apparatus) with a foot-controlled pedal. Details are described in Table 2. Upon completion of the injection and electroporation of all desired embryos, the uterine horns were carefully inserted back into the abdominal cavity. To allow embryos to slide back to their original position the abdominal cavity was filled with 2-3 mL warm saline solution. The surgical incision was closed with absorbable suture, then the skin was sutured (with suture or wound clips). Triple antibiotic ointment (containing Polymyxin B, Bacitracin and Neomycin) was applied to prevent infection. The females were kept warm to recovery from anesthesia, and they were closely monitored for the first few hours post- surgery. Embryos were allowed to develop in utero for the indicated time.

3.6 Immunohistochemistry Embryonic brains were fixed in 4% paraformaldehyde (PFA, #15710, and #15714, Electron Microscopy Sciences) in Phosphate-buffered saline (PBS, #MB1001, BioPioneer) 4-8 hours at 4°C. Postnatal and adult mice were transcardially perfused with 20-25 mL ice-cold 4% PFA using a peristaltic pump at a rate of 2-2.5 mL/min. Brains were dissected and postfixed in 4% PFA overnight at 4°C shaker. Brains were washed with PBS three times for 10 min, embedded in 4% low melting point agarose (#AGAL0050, MP Biomedicals; and #R0801, Thermo scientific) in PBS, and were sectioned coronally at 100 µm or 350 µm with a vibrating microtome (VT1200S, Leica). The adult brains were successfully sectioned without embedding in agarose (the tissue was directly attached to the chamber using super glue). The vibratome sectioning settings are detailed in Table 3. The sections were incubated for 1 h in blocking solution (10% normal goat serum or fetal bovine serum and 0.1% Triton X-100 in PBS). The primary antibodies, diluted in blocking solution, were applied, and the sections were incubated overnight (or 48h depending on the thickness of the section and antibody used) at 4°C shaker. The sections were then rinsed three times for 10min in PBS and subsequently incubated with the appropriate secondary antibodies diluted in blocking solution for 2 h at room temperature.

To label all cell nuclei, the fluorescent nuclear dye DAPI (1 μg/ml, Sigma) was included with the secondary antibody solution. After a final rinse three times for 10 min with PBS, the sections were mounted on slides with mounting medium (ProLong Gold, Thermo Fisher Scientific). All the antibodies and respective concentrations used in this project are listed in Table 4. Antigen retrieval was required to stain for BrdU and RORβ, and the method greatly improved other nuclear stainings such as NEUN, CUX1, CTIP2, SATB2, ZBTB20, TLE4 and BRN2. The protocol used here was a heat-induced citrate method (Tang et al., 2007). The free-floating sections were washed in PBS for 15 min and the sections were steamed in citrate buffer (10 mM sodium citrate, 0.05%Tween20, pH 6.0) for 15 min at 97-98°C (Black and Decker Handy Steamer). A thermometer was placed on the rack to allow continuous monitoring of the temperature (Digital Thermometer Fisher Scientific). After steaming, the sections were allowed to cool at room temperature for 2-5 min. Once again they were washed in PBS for 15 min at room temperature and followed the conventional immunohistochemistry protocol described above (application of blocking solution for 1h, etc.).

3.7 Cresyl Violet (Nissl) staining Cresyl Violet staining protocol used here was adapted from Martínez-Cerdeño, Cunningham and colleagues (2012). Vibratome coronal sections (50 µm) were mounted on Superfrost Plus slides (#12-550-15, Fisher Scientific) and dried at room temperature for 30 minutes. Slides were incubated in PBS for one hour to ensure sections were properly attached to the glass. Slides were hydrated in a series of two minutes incubations as follows: 100% ethyl alcohol (EtOH), 96% EtOH, 70% EtOH, 50% EtOH, and two incubations in water. Slides were then incubated for two minutes in 0.1% cresyl violet solution (0.1 g cresyl violet in 100 ml distilled water, and 0.3 ml of glacial acetic acid). Slides were dehydrated in a series of two minutes incubations as follows: twice in water, 50% EtOH, 70% EtOH, and 96% EtOH. Slides were then incubated in 100% chloroform for two minutes on a shaker. Cresyl Violet stain was differentiated in 95% EtOH+glacial acetic acid until nucleoli were visible (4 minutes). Slides were placed in 100% EtOH for two minutes, incubated in Safeclear (Fisher) for five minutes and mounted in mounting

medium (Fisher Chemical Permount Mounting Medium). Images were taken using a Keyence Microscope.

3.8 Flattened cortex and cytochrome oxidase Histochemical detection of cytochrome oxidase activity was first developed by (Wong-Riley 1979). Adult mice were transcardially perfused with 4% PFA. Brain hemispheres were separated, and subcortical structures were dissected out in cold PBS (Lauer et al. 2018). Each hemisphere was placed on a glass slide with the cortex facing down. A second glass slide was gently pressed on the cortex. Coverslips were placed between the two slides to control the thickness of the flattened cortex. A weight was placed on top of the second glass slide and cortex was flattened in PBS for 5 hours at 4°C. The pressure was released, and the glass slide removed. The flattened cortex was post-fixed in PFA on a shaker overnight at 4°C. Samples were washed three times in PBS for 15 minutes. The flattened cortex was cut tangentially at 100 µm on a vibratome. Best results were achieved without embedding adult tissue in agarose and gently pressing a glass slide against the cortex before fixing it in position (quickly before the superglue dried). Serial sections of each hemisphere were separately collected in PBS. Fresh cytochrome oxidase solution was prepared containing 1g sucrose (#S0389, Sigma), 10mg cytochrome C (#C2506, Sigma) and 250 µL of 20 mg/mL diaminobenzidine (DAB, #D8001, Sigma) in 25mL PBS. Free-floating sections were washed in PBS three times for 15 minutes and then incubated in cytochrome oxidase solution overnight on a shaker at 4°C. Sections were washed in PBS three times for 15 minutes and mounted on glass slides with mounting medium (Aquatex #108562, Millipore). Images were taken using a Keyence Microscope.

3.9 RNA extraction and qPCR E18.5 embryos were dissected in cold Hanks' Balanced Salt Solution (HBSS, #14175-095, GIBCO) with HEPES (#15630080, GIBCO). Embryos were kept on ice while dorsal telencephalon dissection was performed (B. Landeira et al. 2017). Tissue was collected in Eppendorf tubes on ice. RNA extraction was performed following the manufacturer’s instructions (Aurum™ Total RNA Mini Kit, #732-6820, BIO-RAD; and

QIAshredder #79654 Qiagen). During this procedure dissection tools, pipettes, lab bench, and gloves were decontaminated with RNaseZap (#R2020, Sigma). Only RNase free solutions, pipette tips, and tubes were used. RNA concentration was measured using the spectrophotometer. The samples were aliquoted and stored at -80°C. In this experiment, the dorsal telencephalon of six controls and four conditional knockout E18.5 embryos (Emx1-Cre; Zbtb20flox/flox) were used to verify the expression of Zbtb family members and other genes of interest. RNA samples were reverse transcribed into DNA using high-fidelity cDNA Synthesis Kit (iScript™ Select cDNA Synthesis Kit, #170-8897 or iScript cDNA Synthesis Kit, #1708890; both from Bio-Rad). The samples were diluted in endonuclease free water (4ng/µL). Real-time quantitative PCR (RT-qPCR) reactions were prepared using a 2X SYBR Green mix (SSoAdvanced universal SYBR Green Supermix, BIO-RAD), 5µM reverse primer, 5µM forward primer, and 625nM cDNA. 20 µL reaction per well was placed in a 96 well plate (MicroAmp™ Optical 96-Well Reaction Plate, #N8010560, Thermo Fisher Scientific). The RT-qPCR reactions were run on the QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems). The primers were designed using free online tools, each of them was chosen for a different reason as follows: 1) Integrated DNA Technologies’ RealTime qPCR tool (//idtdna.com/scitools/Applications/RealTimePCR/) is an easy platform and showed high- quality primers; 2) Universal ProbeLibrary Assay Design Center (//qpcr.probefinder.com/organism.jsp) is very useful to design common assays for all members of a gene family or splice variants of a particular gene; 3) Primer-BLAST (//ncbi.nlm.nih.gov/tools/primer-blast/) was used to check target specificity; and 4) NetPrimer (//premierbiosoft.com/NetPrimer/AnalyzePrimer.jsp) was used to analyze primers’ characteristics, such as melting temperature, secondary structure, and complementarity of each pair of primers. Nucleotide sequences of primers used in this project are listed in Table 5 . The qPCR reactions were performed with great help of Liyuan Wang, a rotating PhD student of Müller’s lab.

3.10 Cell culture and Time-lapse Video-microscopy E16.5 embryos of two Ai9 timed pregnant females were electroporated with CAG- Ires-Cre (n=6 embryos), CAG-zbtb20-Ires-Cre (n=7 embryos) or CAG-zbtb20dn1768- Ires-Cre (n=4 embryos). Two days after electroporation, E18.5 embryos were dissected in cold HBSS with HEPES. Brains were embedded in 4% agarose and 300 µm coronal sections were cut on the vibratome (see Table 2 - Conditions for Electroporation at Different Stages). The electroporated dorsal telencephalon was dissected under a Zeiss Axio Zoom microscope. Tissue was collected in Eppendorf tubes containing HBSS with HEPES on ice. Cells were digested with Trypsin-EDTA (0.05%) at 37°C for 10-15 minutes. Trypsin activity was stopped with Dulbecco Modified Eagle's Medium F12 (DMEM F12) with 10% Fetal Bovine Serum (FBS), and cells were mechanically dissociated with a fire-polished glass Pasteur pipette. Cell suspension was centrifuged (for 5 min at 4°C, 300 x g) and resuspended in DMEM F12 + 10% FBS twice. The number of viable cells was counted using a Neubauer chamber with a 1:1 dilution of the cell suspension and 0.4% Trypan Blue. Cells suspension was diluted in DMEM F12 + 10% FBS to contain 300.000 cells in each well of a 24-glass bottom well tissue culture plate (MatTek glass bottom multi-well culture plates) pre-treated with Poly-D-Lysine (50 μg/ml) for 2 hours at 37 °C. The plate was incubated at 37°C and 5% CO2 for two hours. The plate was then transferred to an inverted fluorescence microscope (Zeiss Cell Observer microscope) with an incubation chamber set at 37°C and 5% CO2. 55 positions were imaged, transmitted light pictures were taken every 10 minutes, and red channel pictures were taken every 90 minutes. The protocol described here was adapted from Landeira et al. 2017.

3.11 S1 recordings Acute neuronal recordings of the somatosensory cortex S1 were performed by Yi- Ting Chang in collaboration with Daniel O’Connor lab. Mice were implanted with titanium headposts for head fixation. 5-6 weeks old mice were placed in the induction chamber and anesthetized with 3% isoflurane in oxygen. Mice head was fixed to the nozzle under the microscope, eye lubricant (Puralube Vet Ointment) was applied to prevent damage and ketoprofen was injected intraperitoneally

to inhibit inflammation. Respiratory rate was closely observed, and mice were anesthetized with 1.5% isoflurane in oxygen during the surgical procedure. Mouse head was shaved and disinfected with povidone-iodine (Betadine) and lidocaine was applied under the scalp for topical anesthesia. An incision along the middle of the ears to the eyes was made, the skin and membranes above the skull were removed. The region surrounding somatosensory cortex was scratch off to remove remaining membrane, for better bonding with the glue. A ground screw was inserted above V1 (3.5 mm posterior, and 2.5 mm lateral to the bregma). The exposed skull was covered with a thin layer of cyanoacrylate glue. A titanium head-post was positioned directly onto the wet glue and fixed with dental acrylic (Jet Repair Acrylic). The headcap was sealed with a silicone adhesive (Kwik-Cast Sealant) and a thin layer of dental acrylic. And buprenorphine (opioid analgesic, 0.05 mg/kg) was injected into the intraperitoneal cavity. One or two days after surgery, intrinsic signal imaging was performed through the skull. Mice were anesthetized with isoflurane and standard aseptic procedures were used as described above. Sedative chlorprothixene hydrochloride was injected intramuscularly. Mice head was fixed under the microscope. Whiskers were trimmed, except for C2 whisker that was inserted into the glass tube of a piezo stimulator. The area of imaging was exposed by removing the silicone adhesive and somatosensory cortex was imaged during C2 whisker stimulation. Red and green channel images were taken by a CCD camera (QIClick CCD camera, Teledyne QImaging) controlled by MATLAB. Craniotomy and durotomy were performed in the area of interest (C2 barrel). Ketoprofen was injected intraperitoneally. For electrophysiological recording, mice were briefly anesthetized (2–3 min, 1.5% isoflurane) to remove the cement and silicone cap. Mice were then head-fixed in the recording apparatus and a silicon probe electrode (ASSY-77 H3, Cambridge NeuroTech) was gradually inserted down to 1250 μm. ACSF solution was regularly dropped into the cavity of the craniotomy to prevent dehydration. C2 whisker was stimulated in one direction and three amplitudes and two frequencies (20 and 40 Hz) of vibration. For a post-mortem histological verification of the recording location of the probe, the silicon probe was coated with fluorescent dye DiI (1,1'- Dioctadecyl-3,3,3',3'-Tetramethylindocarbocyanine Perchlorate, D-282, Thermo Fisher

Scientific) or DiD (1,1'-Dioctadecyl-3,3,3',3'-Tetramethylindodicarbocyanine Perchlorate, D307, Thermo Fisher Scientific) before insertion. 3.12 Image analysis and quantification Images were captured using the Keyence Microscope, the Zeiss Axio Zoom microscope, the Zeiss Cell Observer microscope system, the Nikon-A1 laser-scanning confocal, the Zeiss LSM 800 confocal, and the Zeiss LSM 700 confocal. Image analysis and cell quantification were performed using ZEN 2.3 lite, Imaris (8.4.1 and 9.0.0), ImageJ, Adobe Illustrator CC 2018 and Adobe Photoshop CS6. All immunohistochemistry data were acquired in at least three distinct rostro caudal sections of each brain. A series of z-stack (depth of 10 μm at z-plane) confocal tiled images were used for cell quantification at P10 and P40, 350 μm wide images that comprise the entire extension of cortical plate (approximately 1000-1400 μm long) were analyzed. In all fluorescence microscopy figures, different channels of image series were combined in pseudo-color, contrast and brightness were adjusted manually using ZEN 2.3 lite or Adobe Photoshop CS6. Maximum intensity projections were generated in ImageJ, ZEN 2.3 lite or Imaris. Total number of cells were quantified in a radial section of the somatosensory cortex and adjusted per area. To divide the cortical plate into longitudinal bins, a rectangle was drawn from the border of the white matter with layer VI to the pial surface. This rectangle was then divided in 10 equal bins and the number of cells within each been was quantified. The contribution of individual layers to the cortical thickness was measured by drawing a rectangle perpendicular to the pial surface and spanning layers I to VI. Next, the radial fraction of this rectangle occupied by neurons expressing BRN2 only was considered layers II/III; RORβ only, layer IV; CTIP2 only, layer V; TLE4 and CTIP2, layer VI; not labeled for any of those markers, layer 1. Callosal neurons axonal ramification in the contralateral hemisphere and BRN2 neuronal distribution in the same region was indirectly measured by fluorescence intensity using Fiji. A rectangular box of approximately 700 x 1400 um comprising the white matter and cortical layers I to VI was drawn and the profile of fluorescence distribution from the white matter to the pial surface was plot.

3.13 Statistical analysis Mean, standard deviation (SD), standard error of the mean (SEM) and statistical analysis were performed using GraphPad Prism 6. Statistically significant differences of means were assessed by Student’s unpaired t-test or one-way Analysis of variance (ANOVA), comparing two or more groups, respectively. P-value < 0.05 was considered a significant difference (*). Frequency distributions were compared using Kolmogorov- Smirnov test. The confidence interval (CI) used in this work is 95% (*p < 0.05; **p<0.01; ***p<0.001; ****p<0.0001).

4 RESULTS

4.1 Screen for transcription factors involved in fate specification Transcription factors (TFs) play key roles in cellular differentiation and drive expression of phenotype-specific genetic programs. To select for potential TFs involved in the sequential specification of progenitor cells to generate upper layer neurons as well as astrocytes in the cerebral cortex, we evaluate the temporal expression of TFs in the proliferative zones of the dorsal telencephalon by in situ hybridization using the Allen brain atlas database (//developingmouse.brain-map.org/). We compared the expression of 756 transcription factors across mouse brain development at E11.5, E13.5, E15.5, and E18.5 by visual inspection. We hypothesized that TFs differentially expressed in the proliferative zones of the dorsal telencephalon at intermediate stages of cortical neurogenesis (E14.5 and E15.5) could be involved in the specification of upper layer neurons and the onset of astrogliogenesis. We identified 6 TFs whose mRNAs were upregulated at E15.5 compared to E13.5: Klf15, Zbtb20, Ctbp2, Aebp2, Zhx2, and Etv5. The in situ hybridization images for these mRNAs are shown in Figure 9 (adapted from Allen Brain Atlas) together with other receptors, Notch1, and Notch2, whose proteins have been previously linked to astrogliogenesis (Kamakura et al. 2004; Nagao, Sugimori, and Nakafuku 2007).

Figure 9 Genes upregulated during the generation of upper layer neurons and the onset of gliogenesis. Coronal sections at different stages of developing mouse brain (E11, E13, E15 and E18) showing in situ hybridization for the transcription factors Zbtb20, Zhx2, Aebp2, Ctbp2, Etv5 and Klf15, as well as Notch1 and Notch2. In situ hybridization images were adapted from Allen Brain Atlas.

To test the potential of these genes to interfere with cell fate specification in the developing cerebral cortex, we first used an overexpression approach. We started our experiments performing overexpression of Kfl15 or Zbtb20 by in utero electroporation of mouse embryos at E15.5. These experiments were performed together with Cristina Gil- Sanz and Ana Espinosa, former members of Müller’s lab. To achieve stable expression of Kfl15 and Zbtb20, we used the Piggybac transposase system with plasmids encoding either Dsred alone (control) or both Dsred and Kfl15 or Zbtb20. When analyzed at P30, expression of both genes increased the number of electroporated cells with morphologies of astrocytes (Figure 10 and 11). Astrocyte identity was confirmed by expression of S100β and GFAP (Figure 11). We focused subsequent studies on Zbtb20.

Piggyback (PB) transposon system

Transposons PB-CAG-dsred PB-CAG-Klf15 Transposase PB-GLASTase

E15.5 P30

Control PB-CAG-Kfl15

Dsred

DAPI

Figure 10 Overexpression of Klf15 induces astrogliogenesis in the developing forebrain. Schematic illustration of the experimental procedure. In utero electroporation was performed at E15.5 using the Piggybac transposon system, and analysis performed in the somatosensory cortex at P30. Piggybac (PB) transposase (PB-GLASTase) induces genome integration of dsred (PB-CAG-dsred) and gene of interest, Klf15 (PB-CAG-Kfl15). Left panels show control condition (two different mice electroporated with PB-CAG- dsred and PB-GLASTase) and right panels display overexpression of Klf15 (with PB-CAG-dsred, PB- GLASTase, and PB-CAG-Klf15). Merged images are shown with DAPI (blue) and Dsred (red). 39

Transposons PB-CAG-dsred PB-CAG-Klf15 E15.5 P30 Transposase PB-GLASTase

Control PB-CAG-Zbtb20

Dsred

DAPI

Control PB-CAG-Zbtb20 Control PB-CAG-Zbtb20

dsred

GFAP GFAP S100

Figure 11 Overexpression of Zbtb20 induces astrogliogenesis in the developing forebrain. Schematic illustration of the experimental procedure. In utero electroporation was performed at E15.5 using the Piggybac transposon system, and analysis concluded in the somatosensory cortex at P30. Left panels show control condition (PB-CAG-dsred and PB-GLASTase) and right panels display overexpression of Zbtb20 (with PB-CAG-dsred, PB-GLASTase, and PB-CAG-Zbtb20). Upper panels show merged images of different mice with DAPI (blue) and Dsred (red). Lower panels show immunohistochemistry against astrocytes antigens in green, GFAP (left lower panels) and S100β (right lower panels).

4.2 ZBTB20 expression correlates with the generation of upper layer neurons and onset of astrogliogenesis To confirm that ZBTB20 protein, and not only the mRNA, is expressed in the developing mouse neocortex at mid-neurogenesis, we performed immunohistochemistry in E15.5 mouse brains using a ZBTB20 specific antibody. We observed that ZBTB20 is expressed in the ventricular and subventricular zone at E15.5 (Figure 12), consistent with recent reports (Nagao et al. 2016; Tonchev et al. 2016).

E15.5

Wt Dcx-Cre; Ai9

LV CP

Zbtb20

TdTomato

Tbr2

Zbtb20

Pax6

DAPI DAPI

Figure 12 ZBTB20 protein expression in progenitor cells at the time of upper layer neuron and astroglial cell generation. Left panels show protein expression of ZBTB20 (red), TBR2 (green), and PAX6 (magenta) in the developing forebrain at E15.5. PAX6 and TBR2 delineate the VZ and SVZ, respectively. Right panels show absence of ZBTB20 (green) expression in immature neurons (red – Ai9 reporter mice expressing TdTomato upon Cre recombination driven by Dcx promoter). DAPI (blue). LV, lateral ventricle. CP, cortical plate. Scale bars represent 50 μm.

We next assessed ZBTB20 protein expression in the astrocyte cell lineage. For this purpose, we took advantage of two transgenic mouse lines. One of these lines, Aldh1L1- eGFP expresses eGFP under the control of the Aldh1L1 promoter in astrocyte progenitors and their offspring (Anthony and Heintz 2008; Cahoy et al. 2008; Foo and Dougherty 2013). DCX-CRE:Ai9 mice express tdTomato in immature migrating neurons but not in astrocytes and their progenitors (Harris et al. 2014). Consistent with the observation that glial-restricted progenitors start to appear around E15.5 (Costa et al. 2009), Aldh1l1-

eGFP was detected in the VZ at E15.5 following a lateral to medial pattern. In DCX- CRE:Ai9 transgenic mice, neither ZBTB20 expression nor Aldh1l1 expression were observed in tdTomato positive migrating neurons (Figure 12 and 13, respectively). At P45, ZTBT20 was co-expressed with Aldh1l1-eGFP in astrocytes in the cerebral cortex, hippocampus, and cerebellum (Figure 14). Furthermore, some ZBTB20+ cells co- expressed the oligodendrocyte marker SOX10 in the adult brain (data not shown).

Dcx-Cre; Ai9 Aldh1l1-GFP

E13.5 E15.5 E17.5

Pax6 Aldh1l1-GFP TdTomato

LV LV LV

Figure 13 Expression of Aldh1l1 in the dorsal telencephalon correlates with the onset of gliogenesis. Coronal sections of Aldh1l1-eGFP;Dcx-Cre;Ai9 embryonic mice in different stages of development (E13.5, E15.5 and E17.7). Immunohistochemistry for PAX6 (blue) delineates the VZ. Immature migrating neurons are shown in red, Ai9 reporter mice expressing TdTomato upon Cre recombination driven by Dcx promoter. Aldh1L1-eGFP reporter mice express eGFP under the control of the Aldh1L1 promoter. Higher magnification images of the dorsal telencephalon are shown in the middle (merged) and lower panels (eGFP). LV, lateral ventricle 42

Somatosensory Cortex

Zbtb20

GFP

dh1l1

DAPI

Hippocampus

Zbtb20

GFP e

- Cerebellum

ldh1l1

DAPI

Figure 14 ZBTB20 expression in astrocytes in the cortex, hippocampus, and cerebellum. Immunohistochemistry for ZBTB20 (red) at P45 in the somatosensory cortex (top), hippocampus (middle) and cerebellum (bottom). Astrocytes are shown in green (Aldh1L1-eGFP reporter mice) and DAPI in blue. Scale bars represent 50 μm.

Besides expression in astrocytes, we also observed ZBTB20 expression in some neurons. In the adult brain, ZBTB20 was highly expressed in neurons of the hippocampus (Figure 15). In contrast, its expression was absent in neurons of the adult cerebral cortex

(Figure 15). None of the ZBTB20+ cells in adult mice expressed the neuronal cell marker NEUN (Figure 15). Interestingly, however, we found that ZBTB20 was transiently expressed in a subset of neurons in layer II/III during early postnatal stages of development (Figure 16).

Somatosensory Cortex

Upper Upper layers

Zbtb20

NeuN

DAPI Deep Deep layers

Hippocampus

Zbtb20

NeuN

DAPI

Figure 15 ZBTB20 is expressed in hippocampal neurons, and absent in the adult cerebral cortex. Immunohistochemistry for ZBTB20 (red), NEUN (green) at P45 in the somatosensory cortex (top and middle images represent upper layers and deep layers, respectively) and hippocampus (bottom). DAPI (blue). Scale bars represent 50 μm.

Somatosensory Cortex

NeuN

Zbtb20

Brn2

DAPI

Figure 16 ZBTB20 is transiently expressed in a subset of layer II/III neurons in the cerebral cortex during post-natal development. Immunohistochemistry for ZBTB20 (red), BRN2 (green), and NEUN (magenta) at P4 in the somatosensory cortex. Top and middle images represent low and high resolution, respectively. DAPI (blue). Scale bars represent 20 μm.

4.3 Zbtb20 function in astrogliogenesis The expression pattern of ZBTB20 promted us to study its function in astrogliogenesis. Previous investigations in our lab and others gave evidence for an increase of the astroglia output following Zbtb20 overexpression in progenitor cells at E15.5 (Figure 11; Nagao et al. 2016). However, this phenomenon was only documented during the onset of gliogenesis. Based on these findings, we hypothesized that Zbtb20 might control the time progression of neural stem cells towards glia fate. To test this hypothesis, we overexpressed Zbtb20 a day earlier, before the onset of gliogenesis. For this purpose, we overexpressed Zbtb20 or a dominant negative (DN) mutation of Zbtb20 (Cordeddu et al. 2014) by in utero electroporation at E14.5. Ai9 reporter mice were used to track progenitor cells transfected with Cre alone (CAG-Ires-CRE), Cre and Zbtb20 (CAG-ZBTB20-Ires-CRE), or Cre and Zbtb20 DN (CAG-ZBTB20DN1768-Ires-CRE), all cases allowing Cre recombination and therefore the expression of tdTomato. First, we verified CRE recombination efficiency and expression of ZBTB20 protein 24h after electroporation at E13.5 (Figure 17), then we investigated the fate of cells during postnatal ages. We found that, compared with controls, Zbtb20 overexpression led to an increased number of S100β+ cells at P22 (Figure 18 – p-value 0.0031; CAG-CRE 7.857 ± 6.419

and CAG-Zbtbt20-I-CRE 24.12 ± 7.836; n=3; Unpaired t test). While the Zbtb20 DN mutation showed a similar number of S100β+ cells, compared with controls (Figure 19 – p-value 0.7356; CAG-CRE 7.857 ± 6.419 and CAG-DN1768-I-CRE 6.902 ± 2.275; n=3; Unpaired t test). These data suggest that Zbtb20-mediated gene repression is sufficient to promote the generation of astrocytes in the neocortex.

CAG-GFP-I-CRE CAG-Zbtb20-I-CRE CAG-Zbtb20DN-I-CRE E13.5 E14.5 Ai9

CAG-GFP-I-CRE CAG-Zbtb20-I-CRE CAG-Zbtb20DN-I-CRE

Tdtomato

Zbtb20

DAPI

Zbtb20

Figure 17 CRE recombination efficiency and ZBTB20 overexpression in the developing neocortex. Schematic illustration of the experimental procedure. In utero electroporation was performed at E13.5 and analysis concluded 24 hours after in the ventricular zone. Ai9 reporter mice were used to track cells electroporated with Cre alone (CAG-GFP-I-CRE), Cre and Zbtb20 (CAG-ZBTB20-I-CRE), or Cre and Zbtb20 DN mutation (CAG-ZBTB20DN-I-CRE), allowing Cre recombination and therefore the expression of tdTomato (red). Immunohistochemistry for ZBTB20 (green). DAPI (blue). DN, dominant negative. I, IRES.

CAG-I-CRE CAG-Zbtb20-I-CRE

E14.5 P22 Ai9

CAG-I-CRE CAG-Zbtb20-I-CRE

Tdtomato

S100

DAPI

S 1 0 0 % C t v s Z b tb 2 0

CAG-I-CRE CAG*-*Zbtb20-I-CRE

/ 3 0

+ C A G -C R E

o t

) C A G -Z b tb 2 0 -I-C R E a

% S 1 0 0 % C t v s Z b tb 2 0

( m

2 0 o

+ **

o /

3 0

t +

Tdtomato C A G -C R E

a t

) C A G -Z b tb 2 0 -I-C R E

(

a 1 0 2 0

S100

a 1 0

0 S

0 1 S

DAPI 0

Figure 18 ZBTB20 overexpression enhances the generation of astrocytes in the developing neocortex. Schematic illustration of the experimental procedure. In utero electroporation was performed at E14.5 and analysis concluded at P22 in the somatosensory cortex. Ai9 reporter mice were used to track cells electroporated with Cre alone (CAG-I-CRE), or Cre and Zbtb20 (CAG-ZBTB20-I-CRE), allowing Cre recombination and therefore the expression of tdTomato (red). Immunohistochemistry for S100β (green). DAPI (blue). Top and middle images represent low and high resolution, respectively. I, IRES. (p-value 0.0031; CAG-I-CRE 7.857 ± 6.419 and CAG-Zbtbt20-I-CRE 24.12 ± 7.836; n=3; Unpaired t test)

pCAG-I-CRE pCAG-Zbtb20DN-I-CRE E14.5 P22 Ai9

CAG-I-CRE CAG-Zbtb20DN-I-CRE

Tdtomato

S100

DAPI

S 1 0 0 % C t v s Z b tb 2 0 D N 1 7 6 8

/ / + 1 5

C A G -I-C R E o

+ 1 5

t )

a C A G -I-C R E

o C A G -D N 1 7 6 8 -I-C R E

(

)

o 1 0 C A G -D N 1 7 6 8 -I-C R E

(

1 0 a

m S

5 0

+ T

0 0

Figure 19 ZBTB201 dominant negative mutation doesn’t affect generation of astrocytes in the developing neocortex at S E14.5. 0 Schematic illustration of the experimental procedure. In utero electroporation was performed at E14.5 and analysis concluded at P22 in the somatosensory cortex. Ai9 reporter mice were used to track cells electroporated with Cre alone (CAG-I-CRE), or Cre and Zbtb20 dominant negative mutation (CAG-ZBTB20DN-I-CRE), allowing Cre recombination and therefore the expression of tdTomato (red). Immunohistochemistry for S100β (green). DAPI (blue). DN, dominant negative. I, IRES. (p-value 0.7356; CAG-I-CRE 7.857 ± 6.419 and CAG-DN1768-I-CRE 6.902 ± 2.275; n=3; Unpaired t test)

To further evaluate the role of Zbtb20 in astrogliogenesis, we expressed its DN form later on in development, after the onset of gliogenesis and when most of the neural stem cells expressed Zbtb20 endogenously. For this aim, using the same approach described above, we expressed by in utero electroporation at E16.5 in progenitor cells Cre alone, or Cre together with Zbtb20 or a Zbtb20 DN mutation. We found that S100β+ cells derivatives of Zbtb20 DN mutation precursors were reduced compared with controls and

Zbtb20 overexpression (Figure 20 – p-value 0.0173; CAG-I-CRE 43.03 ±8.392 and CAG- DN1768-I-CRE 28.26 ± 2.003; n=3; Unpaired t test). Interestingly, Zbtb20 overexpression at E16.5 didn’t cause a significant increase in S100β+ cells (Figure 21 – p-value 0.7463; CAG-CRE 43.03 ± 8.392 and CAG-Zbtb20-I-CRE 56.11 ± 7.434; n=3; Unpaired t test). We also observed an increase in NeuN+ cells derivatives of Zbtb20 DN mutation precursors, suggesting that Zbtb20 is important for neural stem cells to shift from neurogenic towards astrogenic fates.

CAG-I-CRE CAG-Zbtb20DN-I-CRE

E16.5 P22 Ai9

CAG-I-CRE CAG-Zbtb20DN-I-CRE

Tdtomato

S100

DAPI

S 1 0 0 a n d R e d % C t v s Z b tb 2 0 D N 1 7 6 8 S 1 0 0 a n d R e d % C t v s Z b tb 2 0 D N 1 7 6 8

* *

/ /

+ 6 0 + 6 0

C A G -I-C R E o

t C A G -I-C R E

) t

a C A G -D N 1 7 6 8 -I-C R E

) a

% C A G -D N 1 7 6 8 -I-C R E

(

o 4 0

(

o o

4 0 t

d 2 0

2 0 1

o +

S 0

T 0

Figure 20 ZBTB200 dominant negative mutation impairs astrocytes generation in the developing neocortex 1 at E16.5. SchematicS 0 illustration of the experimental procedure. In utero electroporation was performed at E16.5 and analysis concluded at P22 in the somatosensory cortex. Ai9 reporter mice were used to track cells electroporated with Cre alone (CAG-I-CRE), or Cre and Zbtb20 dominant negative mutation (CAG- ZBTB20DN-I-CRE), allowing Cre recombination and therefore the expression of tdTomato (red). Immunohistochemistry for S100β (green). DAPI (blue). DN, dominant negative. I, IRES. (p-value 0.0173; CAG-I-CRE 43.03 ± 8.392 and CAG-DN1768-I-CRE 28.26 ± 2.003; n=3; Unpaired t test)

CAG-I-CRE CAG-Zbtb20-I-CRE E16.5 P22 Ai9

CAG-I-CRE CAG-Zbtb20-I-CRE

Tdtomato

S100

DAPI

S 1 0 0 a n d R e d % C t v s Z b tb 2 0

8 0

C A G -CAGC R E -I-CRE

+ C A G -Z b tb 2 0 -I-C R E

o )

t 6 0 CAG-Zbtb20-I-CRE

(

o o

T 4 0

tomato+(%) o

2 0

1 S100+and tomato+/ S 0 Figure 21 ZBTB20 overexpression doesn’t affect generation of astrocytes in the developing neocortex at E16.5. Schematic illustration of the experimental procedure. In utero electroporation was performed at E16.5 and analysis concluded at P22 in the somatosensory cortex. Ai9 reporter mice were used to track cells electroporated with Cre alone (CAG-I-CRE), or Cre and Zbtb20 (CAG-ZBTB20-I-CRE), allowing Cre recombination and therefore the expression of tdTomato (red). Immunohistochemistry for S100β (green). DAPI (blue). I, IRES. (p-value 0.7463; CAG-CRE 43.03 ± 8.392 and CAG-Zbtb20-I-CRE 56.11 ± 7.434; n=3; Unpaired t test)

To model the cellular mechanism underlying this activity, we investigated cell proliferation and differentiation in dissociated neural cell cultures. We repeated our assay at E16.5 restricting the manipulation of Zbtb20 levels in progenitor cells to the in vivo environment. Then, we dissected out the dorsal telencephalon and dissociated the cells two days after in utero electroporation. We followed the cells by time-lapse video-

microscopy, and we evaluated the number of cells every 24 hours for 4 days. Over time we observed an increase in the number of cell derivatives of Zbtb20 precursors and a significant increase in GFAP+ cells after 4 days in vitro (Figure 22 – p-value 0.0245; Control 0.02665±0.02407, DN1768 0.07669±0.05741, Zbtb20 0.03882±0.03017; n=3; Bonferroni's multiple comparisons test). Future clonal analysis of these precursors will help to understand the effect of Zbtb20 manipulations in different subtypes of progenitors and its influence on cellular behavior such as cell cycle length.

CAG-I-CRE 48h CAG-Zbtb20-I-CRE CAG-Zbtb20DN-I-CRE E16.5 Dissociate cells and Ai9 cultivate (4 days) # o f R e d c e ll

2 .0

DAPI s Tdtomato GFAP

l Z b tb 20 l

e # o f R e d c e ll

c D N 1 7 6 8

d 2 .0

s c o n tro l e

l Z b tb 20

1 .5 l

e f

c D N 1 7 6 8

o d

c o n tro l e

e 1 .5

Control t

1 .0 e

a t

e 1 .0

Tomato+cells

P 0 .5 0 .5 1 2 3 4 1 2 3 4 y y y y y y y y a a a a a a a a D D D D

D D D D Zbtb20 *G F A P /R e d

0 .1 0

0 .0 8

0 .0 6

0 .0 4

0 .0 2 Tomato+cells

Zbtb20DN 0 .0 0

l 0 8

GFAP and GFAP tomato+/ o r 2 6 t b 7 n t 1 o b Z N c D Figure 22 Cellular mechanism underlying Zbtb20 function in the developing neocortex at E16.5. Schematic illustration of the experimental procedure. In utero electroporation was performed at E16.5 in Ai9 mice, after 48 hours the dorsal telencephalon was dissected, and cells cultivated for 4 days. Control represents cells electroporated with CAG-I-CRE (top), Zbtb20 represents CAG-ZBTB20-Ires-CRE (middle), and Zbtb20DN is CAG-ZBTB20DN-Ires-CRE (bottom). Immunohistochemistry for GFAP (green). DAPI (blue). DN, dominant negative. I, IRES. (p-value 0.0245; Control 0.02665±0.02407, DN1768 0.07669±0.05741, Zbtb20 0.03882±0.03017; n=3; Bonferroni's multiple comparisons test)

Electroporation experiments lead to non-physiological expression levels of genes of interest. Thus, alternative strategies to perturb ZBTB20 function are important to confirm

their roles in the developing neocortex. However, Zbtb20 plays an essential role in animal survival and vital functions, and full Zbtb20 knock-out mice have been described to present an average lifespan of only 16 days; furthermore, the knock-out mice displayed a smaller body size (Rosenthal et al. 2012). To overcome the complications of constitutive loss of Zbtb20 and to assess its intrinsic role in cortical development, we used a conditional knockout (cKO) Zbtb20flox mouse line in which LoxP sites were flanking a critical exon of the Zbtb20 gene. Homozygous Zbtb20flox mice were viable and fertile and mated to the Emx1-Cre mouse line, which has been shown to drive recombination specifically in progenitor cell in the dorsal pallium during embryogenesis (Gorski et al. 2002). Mice homozygous for Zbtb20flox and heterozygous for Emx1-Cre (named Emx1- Cre Zbtb20fl/fl or Zbtb20cKO) were viable and showed specific ZBTB20 deletion in the dorsal telencephalon, as assessed by immunohistochemistry (Figure 23). In the following, we will refer to the mutant offspring that lack Zbtb20 expression in the dorsal pallium as Zbtb20cKO mice.

Zbtb20 flox allele E15.5 loxP loxP Emx1 Cre X Exon 1

Control Zbtb20 f/f Emx1-CRE

Zbtb20

DAPI

Zbtb20

Pax6

DAPI

Figure 23 Specific deletion of ZBTB20 in the dorsal telencephalon. Schematic illustration of the experimental procedure. Zbtb20flox mouse were mated to Emx1-Cre mouse line, which drive site-specific recombination in dorsal pallium during embryogenesis (Zbtb20fl/fl;Emx1-Cre; referred to in the following as Zbtb20cKO mice). Immunohistochemistry for ZBTB20 (red) and PAX6 (green) at E15.5. DAPI (blue). Higher magnification images of the dorsal telencephalon are shown in the middle and lower panels. LV, lateral ventricle.

To investigate the effect of Zbtb20 deletion in astrocyte cell lineage in vivo, we assessed the neural stem cells on the onset of gliogenesis and glial precursor cells in the postnatal cortex of Zbtb20cKO mice. Surprisingly, no obvious differences were observed at E15.5 in the number of cells positive for PAX6, TBR2, and SOX9 and TUJ1 between controls and Zbtb20cKO mice (Figure 24). Additionally, we examined the number of Aldh1L1-GFP and PAX6 cells at P0, and no apparent differences were detected between

Zbtb20cKO mice and controls (Figure 25). Quantification of these markers is currently in progress to confirm these preliminary observations.

Zbtb20 flox allele E15.5 loxP loxP

Emx1 Cre X Exon 1

Control

Zbtb20cKO

TUJ1 Sox9 DAPI

Control

Zbtb20cKO

Pax6 Tbr2 DAPI

Figure 24 Progenitor cells and immature neurons develop normally in Zbtb20 conditional knockout (cKO). Schematic illustration of the experimental procedure. Immunohistochemistry for SOX9 and TUJ1 (top panels); PAX6 and TBR2 (bottom panels) of control and Zbtb20cKO (Zbtb20fl/fl;Emx1-Cre) cortices at E15.5. DAPI (blue). Scale bars represent 20 μm.

Zbtb20 flox allele P0 loxP loxP

Emx1 Cre X Exon 1

Control

Zbtb20cKO

Pax6 Aldh1l1-GFP

Figure 25 Glia progenitor cells develop normally in Zbtb20 conditional knockout (cKO). Schematic illustration of the experimental procedure. Immunohistochemistry for PAX6 in Aldh1l1-eGFP mice (control) and Zbtb20cKO (Zbtb20fl/fl;Emx1-Cre; Aldh1l1-eGFP) cortices at P0.

To investigate the effect of Zbtb20 deletion in astroglia development we assessed the number of astrocytes in young-adult mice in Zbtb20cKO mice. For this purpose, we took advantage of S100β, a calcium-binding protein expressed by ependyma and glial lineages, mainly expressed by astroglial cells of perinatal neocortical tissue (Deloulme et al. 2004; Raponi et al. 2007). We observed no significant differences in the total number of S100β+ cells in the somatosensory cortex of Zbtb20cKO mice compared with controls at P40 (Figure 26 – S100 total number p-value 0.0550; Control 8.213 ± 0.9064 and Zbtb20cKO 8.968 ± 1.665; n=3; Unpaired t test). To further validate these results, we assessed the expression of other astrocytes markers, such as SOX9 and GFAP (Figures 26 and 27). SOX9 is an astrocyte-specific nuclear marker in all major areas of the central nervous system outside of the neurogenic regions (Sun et al. 2017). Again, we found no

differences in number and distribution of SOX9+ astrocytes in the somatosensory cortex of Zbtb20cKO mice compared with controls (Figure 26).

P40-42 Zbtb20 flox allele loxP loxP Emx1 Cre X Exon 1

Control S 1 0 0 B to ta l nZbtb20u m b e r cKOc tx /D A P I %

1 5 1 1 WControlt 2 2 ZZbtb20b tb 2 0 F cKOF E m x1 C re 3 S 1 0 0 B to ta l n u m b e r c tx /D A P I % 3 1 0 β 1 5 4 4 15 W t

5 5 Z b tb 2 0 F F E m x1 C re S100 101 0 6 5 6 7 7 DAPI DAPI 5 5 8 8

9 0 S100+/DAPI(%) 9 0 0

t e t r W 1 W 1 C 1 x re C m x 1 m 0 0 E E F F Control Zbtb20 cKOF 2 0 b F b t 0 Z 2 tb S100+/S100total b S 1 0 0 B

5 0 0(%) 55 10 15

1 S

1 0

3 0

4 S

1 0

B Sox9

e a

7 c

DAPI DAPI b

9 %

1 0

b 2

Figure 26 Astrocytes develop normally in Zbtb20 conditional knockout (cKO).E Schematic illustration of the m

experimental procedure. Immunohistochemistry for S100β, and SOX9 x in control and Zbtb20cKO

1 C

(Zbtb20fl/fl;Emx1-Cre) somatosensory cortex at P40-42. DAPI (blue). (S100 r total number p-value 0.0550; Control 8.213 ± 0.9064 and Zbtb20cKO 8.968 ± 1.665; n=3; Unpaired t test; S100e divided by bins; p-value 0.0195; 10th bin Control 11.03 and Zbtb20cKO 8.171; n=3; two way ANOVA)

GFAP is an intermediate filament protein, mainly confined to astrocytes of rodent neocortex (Middeldorp and Hol 2011) that only labels a subpopulation of astrocytes in the adult mouse brain. Interestingly, we found that GFAP expression was confined to the pial

surface and white matter in control cortex, while in Zbtb20cKO mice GFAP expression was upregulated throughout the entire extension of the cortex, particularly in layer I/marginal zone (MZ) and VI (Figure 27). This finding is indicative of a reactive gliosis in the cortex of Zbtb20cKO mice.

P40-42 Zbtb20 flox loxPallele loxP Emx1 Cre X Exon 1

Control Zbtb20 f/f Emx1-CRE

GFAP GFAP

Control Zbtb20 cKO

GFAP DAPI DAPI

Figure 27 GFAP expression is upregulated throughout the entire extension of the cortex in Zbtb20 conditional knockout (cKO). Schematic illustration of the experimental procedure. Immunohistochemistry for GFAP in control and Zbtb20cKO (Zbtb20fl/fl;Emx1-Cre) at P40-42. DAPI (blue). Top and bottom panels show low and high magnification (of the somatosensory cortex) images, respectively.

Last, to address whether increased GFAP immunoreactivity in the Zbtb20 cKO cortex is the result of altered neuroinflammatory responses, we examined the morphology and number of microglia by IBA1 immunohistochemistry. Remarkably, no differences were detected between Zbtb20 cKO and controls (Figure 28). These findings suggest that the overall distribution and morphology of the neuroimmune cells were not significantly affected by the loss of Zbtb20 in young-adult mice.

P40-42 Zbtb20 flox allele loxP loxP Emx1 Cre X Exon 1

Control Zbtb20 cKO Control Zbtb20 cKO

Iba1 DAPI DAPI

Figure 28 Microglia cells develop normally in Zbtb20 conditional knockout (cKO). Schematic illustration of the experimental procedure. Immunohistochemistry for IBA1 in control and Zbtb20cKO (Zbtb20fl/fl;Emx1- Cre) in the somatosensory cortex at P40-42. DAPI (blue). Left and right panels show low and high magnification (upper layers) images, respectively.

We hypothesized that the lack of phenotype observed in the total number of astrocytes in Zbtb20 cKO could be a consequence of genetic compensation. Genetic compensation has been documented in several model organisms (El-Brolosy and Stainier 2017). Loss of one gene may be compensated by another with overlapping functions and expression patterns, or it may alter the expression of other genes within the same

network. We therefore evaluate the expression of ZBTB family members, and our candidate list of genes involved in the onset of gliogenesis (Figure 9). Since ZBTB family members are highly conserved transcriptional repressors that contain a BTB (POZ) protein-binding domain and a Krüppel-Type Zinc Finger (ZF) DNA-binding domain (Siggs and Beutler 2012), members of this family could act compensating Zbtb20 function in astrocyte development in vivo. To assess this question, we measured the mRNA expression of 47 Zbtb family members and 8 genes with a similar expression pattern of Zbtb20 (listed in Table 5 - RT-qPCR primers list) by RT-qPCR. We found that the mRNA levels of Zbtb2, Zbtb3, Zbtb40, Zbtb48, Zbtb31, and aebp2 were upregulated at E18.5 in Zbtb20 cKO, compared to control mice (Figure 29 – p-value ****p<0.0001; ** p<0.01; * p<0.05; Control n=6; Zbtb20 cKO n=4; Unpaired t test). While the expression of Zbtb20, Zbtb7c, Zbtb45, Zbtb11, Zbtb4, Zbtb6, Zbtb27 and Sox9 were downregulated in Zbtb20 cKO, compared to controls (Figure 29). We also observed that Zbtb18, Zbtb10, Zbtb33, Zbtb38, Zbtb11, Zbtb31 showed high levels of expression in the wild type at E18.5, similar to Zbtb20 levels (Figure 29). The expression levels of the other Zbtb family members (Zbtb1, Zbtb5, zbtb7a, Zbtb7b, Zbtb8a, Zbtb8b, Zbtb9, Zbtb10, Zbtb12, Zbtb14, Zbtb16, Zbtb17, Zbtb18, Zbtb19, Zbtb21, Zbtb22, Zbtb23, Zbtb24, Zbtb25, Zbtb26, Zbtb28, Zbtb29, Zbtb30, Zbtb32, Zbtb33, Zbtb34, Zbtb37, Zbtb38, Zbtb39, Zbtb41, Zbtb42, Zbtb43, Zbtb44, Zbtb46 and Zbtb49) and candidate genes (Ctbp2, Etv5, Klf15, Zhx2, Nfia and Nfib) were unaffected in Zbtb20 cKO. Notably, in our in utero electroporation experiments, we observed that a dominant negative Zbtb20 construct affected gliogenesis. Since ZBTB20 was been shown to participate in homo- and heterotypic protein interactions via the BTB/POZ domain (Mitchelmore et al., 2002), this dominant negative construct could affect the function of other ZBTB family members. Further functional studies will therefore be necessary to determine the extent to which Zbtb20 function in gliogenesis can be compensated for by other Zbtb family members.

mRNA RT qPCR Emx1-CRE extraction Zbtb20fl/fl (Zbtb20 cKO) A L L Z b tb m e m b e rs c K O > 1 E18.5 3

2 WControlT * * * * * A L L Z b tb m e m b e rs c K O > 1 ZZbtb20b tb 2 0 ccKOK O 1 A L L Z b tb m e m b e rs c K OA

-4 -4 -4 -2 0 c 5 1 4 60 7c 50 21c 345 601 748 61 7 0 0 2 7 4 1 2 27 42 17 4 41 24 3 2 ZBTBs with high levels of expression 18, 10, 33, 38

Candidate genes involved in the onset of gliogenesis g lio g e n e s is

1 W T * Z b tb cK O E m x1 C R E * 0

-1

-2

9 A B 2 2 5 5 2 x I I p p v 1 x o F F b b t lf h S N N e t e K Z a c

Figure 29 Expression of Zbtb family members and our candidate genes involved in the onset of gliogenesis. Schematic illustration of the experimental procedure. mRNA levels of 47 Zbtb family members, 3 genes previously associated with gliogenesis (Sox9, NFIA and NFIB), and 5 candidate genes (highlighted in yellow) were measured by RT-qPCR in the dorsal telencephalon of control and Zbtbt20cKO (Zbtb20fl/fl;Emx1-Cre) at E18.5. Graphs on left and right show genes that were downregulated and upregulated, respectively in Zbtb20cKO. Genes highlighted in gray represent Zbtb family members with high levels of expression in the dorsal telencephalon. (p-value ****p<0.0001; ** p<0.01; * p<0.05; Control n=6; Zbtb20 cKO n=4; Unpaired t test)

4.4 Zbtb20 function in neuronal specification and axon projection

4.4.1 Zbtb20 overexpression in neocortical progenitors/post-mitotic neurons at mid- neurogenesis leads to a premature generation of CPNs We also investigated whether direct manipulation of Zbtb20 expression in progenitor cells might influence neuronal fate specification in vivo. To this end, we overexpressed Zbtb20 via in utero electroporation of a Zbtb20-expressing plasmid in cortical progenitors at embryonic day (E) 14.5, when granular layer IV neurons are being generated, and ZBTB20 expression is scarce. Ai9 reporter mice were used to track progenitor cells transfected with Cre alone (CAG-Ires-CRE), or both Cre and Zbtb20 (CAG-ZBTB20-Ires- CRE), both cases allowing recombination and therefore the expression of tdTomato in the Ai9 reporter (Madisen et al. 2010). After showing CRE recombination efficiency and expression of ZBTB20 protein 24h after electroporation at E13.5 (Figure 17), we investigated the fate of neurons during postnatal ages. We used BRN2 and RORβ protein expression at P10 to verify the specification in layer II/III and layer IV neurons, respectively. While in control-transfected animals neurons expressed BRN2 and/or RORβ and were evenly distributed throughout the layers II/III and IV, Zbtb20 overexpression led to the generation of neurons expressing BRN2, but not RORβ (Figure 30), suggesting that Zbtb20 induced the differentiation of layer II/III callosal projection neurons at the expense of layer IV neurons. The possible fate-switch from layer IV into layer II/III was also observed at P22 without affecting the total number of neurons NeuN+ (Figure 31 – p-value 0.4974; CAG-CRE 58.2±16.79, CAG-Zbtb20-I-CRE 68.06±6.999 and CAG- Zbtb20DN-I-CRE 65.64±15.26; n=3; ANOVA), arguing against a potential delay in the migration/differentiation of RORβ+/layer IV neurons. Whereas in Zbtb20 DN overexpression neurons showed a similar distribution throughout the layers II/III and IV, similar to controls (Figure 31).

CAG-I-CRE

CAG-Zbtb20-I-CRE E14.5 P10 Ai9

Somatosensory Cortex

L2-3

CRE

- I

- L4 pCAG

L2-3

CRE

I -

Zbtb20 -

L5 pCAG

DAPI Brn2 Tdtomato

Figure 30 Zbtb20 overexpression in neocortical progenitors/post-mitotic neurons at mid-neurogenesis leads to a premature generation of CPNs. Schematic illustration of the experimental procedure. In utero electroporation was performed at E14.5 and analysis concluded at P10 in the somatosensory cortex. Ai9 reporter mice were used to track cells electroporated with Cre alone (CAG-I-CRE), Cre and Zbtb20 (CAG- ZBTB20-Ires-CRE), allowing Cre recombination and therefore the expression of tdTomato (red). Immunohistochemistry for BRN2 (green) and RORβ (white). DAPI (blue). CPNs, callosal projection neurons. I, IRES. L, layer.

CAG-I-CRE CAG-Zbtb20-I-CRE CAG-Zbtb20DN-I-CRE E14.5 P22 Ai9

CAG-I-CRE CAG-Zbtb20-I-CRE CAG-Zbtb20DN-I-CRE

Tdtomato

NeuN

DAPI

N e u N % C tX Z b tb 2 0 X D N 1 7 6 8

/ 8 0

+ C A G -C R E

o t

) C A G -Z b tb 2 0 -I-C R E a

% 6 0 m

( C A G -D N 1 7 6 8 -I-C R E

t 4 0

N 2 0

u e

N 0 Figure 31 Zbtb20 overexpression in neocortical progenitors/post-mitotic neurons at mid-neurogenesis leads to a premature generation of CPNs without affecting total number of neurons. Schematic illustration of the experimental procedure. In utero electroporation was performed at E14.5 and analysis concluded at P22 in the somatosensory cortex. Ai9 reporter mice were used to track cells electroporated with Cre alone (CAG- I-CRE), Cre and Zbtb20 (CAG-ZBTB20-Ires-CRE) and Cre and Zbtb20DN (CAG-ZBTB20DN-Ires-CRE), allowing Cre recombination and therefore the expression of tdTomato (red). Immunohistochemistry for NEUN (green). DAPI (blue). CPNs, callosal projection neurons. I, IRES. DN, dominant negative. (p-value 0.4974; CAG-CRE 58.2±16.79, CAG-Zbtb20-I-CRE 68.06±6.999 and CAG-Zbtb20DN-I-CRE 65.64±15.26; n=3; ANOVA)

Altogether, these experiments suggest that Zbtb20 expression in progenitor cells/post-mitotic immature neurons at mid-corticogenesis is involved in the specification of BRN2+ layers II/III neurons. To further exploit this possibility, we took advantage of the Cre-lox system to conditionally knock out the expression of Zbtb20 in dorsal telencephalic progenitors.

4.4.2 Conditional genetic deletion of Zbtb20 in progenitors leads to laminar disorganization of the neocortex To investigate whether Zbtb20 regulates the fate of cortical projection neurons in the somatosensory cortex, we assessed the expression of neuron-subtype markers in Zbtb20cKO mice. We labeled cortical projection neurons using markers expressed in distinct and somewhat overlapping cortical laminae, as follow: CUX1 (expressed in all upper layer neurons and few cells in layer V), BRN2 (highly expressed in layer II/III and V), RORβ (highly expressed in layer IV), SATB2 (broadly expressed in all cortical layers), CTIP2 (highly expressed in layer V and VI), and TLE4 (specifically expressed in layer VI). The combination of these markers allowed us to distinguish the different layers: not labeled for any of those markers, layer I; neurons expressing BRN2 only distinguished layers II/III; RORβ only, layer IV; CTIP2+/TLE4-, layer V; and CTIP2+/TLE4+, layer VI. We used CUX1 immunostaining to analyze the organization of all upper layer neurons in coronal sections at P10 (Figure 33). And BRN2 and RORβ protein expression were used to distinguish the specification in layer II/III and layer IV neurons, respectively (Figure 32). Although we noticed a clear alteration in the distribution of BRN2+ and RORβ+ neurons (Figure 32), characterized by a clustering of cortical neurons resembling layer IV neuronal organization (densely packed granular cells) through layer II/III and IV, the number of CUX1+ did not differ significantly between genotypes (Figure 33). CUX1 expression is specific to the pyramidal neurons of all the upper layers (II/III and IV) and a few cells in layer V (Nieto et al. 2004). In contrast to controls, Zbtb20cKO showed a substantial increase in RORβ expression, which is highly expressed by layer IV neurons (Jabaudon et al. 2012), at the expense of BRN2+ neurons which is highly expressed in layer II/III (Dominguez, Ayoub, and Rakic 2013), these alterations were confirmed quantitatively (Figure 32 – DAPI p=0.0805 Ct 5.72±0.634 and cKO 6.23±0.583; BRN2 p=0.7404 Ct 1.025±0.199 and cKO 1.000±0.116; RORβ Ct 1.86±0.144 and cKO 2.78±0.402; Layer 2/3 Ct 48.2±9.03 and cKO 11.7±4.37; ****p<0.0001; n=3; Unpaired t test).

Figure 32 Conditional genetic deletion of Zbtb20 in progenitors leads to laminar disorganization of the neocortex. Schematic illustration of the experimental procedure. Immunohistochemistry for BRN2 (red) and RORβ (green) in control and Zbtb20cKO mice in the somatosensory cortex at P10. DAPI (blue). L, layer. (Cortical thickness µm p-value 0.2784, Control or Ct 1248±92.1 and Zbtb20cKO or cKO 1190±138; Cortical thickness % L1 p=0.0739, Ct 6.54±1.22 and cKO 5.3±1.7; L2/3 p<0.0001, Ct 16.2±3.11 and cKO 2.03±1.22; L4 p=0.0011, Ct 22.4±3.33 and cKO 28.7±4.06; L5 p=0.2815, Ct 22.3±2.07 and cKO 23.5±2.65; L6 p=0.0066, Ct 32.5±2.45 and cKO 36.5±3.42; Ectopic BRN2+ cells p=0.0003, Ct 0±0 and cKO 3.94±2.84; n=3; Unpaired t test) (DAPI p=0.0805 Ct 5.72±0.634 and cKO 6.23±0.583; BRN2 p=0.7404 Ct 1.025±0.199 and cKO 1.000±0.116; RORβ Ct 1.86±0.144 and cKO 2.78±0.402; Layer 2/3 Ct 48.2±9.03 and cKO 11.7±4.37; ****p<0.0001; n=3; Unpaired t test)

Whereas BRN2+ cells were ectopically present in deep layers of the somatosensory cortex of Zbtb20 cKO, including layer VI, these cells were absent in control mice (Figure 32 – Ectopic BRN2+ cells p=0.0003, Ct 0±0 and cKO 3.94±2.84; n=3; Unpaired t test). Furthermore, loss of Zbtb20 in progenitor cells lead to defects in migration of layer II/III neurons in various areas of the cortex. Zbtb20 cKO displayed a conspicuous accumulation of BRN2+ cells in the anterior cingulate, motor area, retrosplenial area and cingulum bungle (Figure 33).

Figure 33 Conditional genetic deletion of Zbtb20 in progenitors leads to migration defects in the neocortex. Schematic illustration of the experimental procedure. Immunohistochemistry for BRN2 (red) and Ctip2 (green) in control and Zbtb20 cKO (Zbtb20fl/fl;Emx1-Cre) in the anterior cingulate and motor area (left panels) and retrosplenial area and cingulum bundle (right panels) at P10. DAPI (blue). Scale bars represent 100µm.

Figure 34 Conditional genetic deletion of Zbtb20 in progenitors leads to laminar disorganization of the neocortex. Schematic illustration of the experimental procedure. Immunohistochemistry for CUX1 (green) and CTIP2 (red) in control and Zbtb20cKO mice in the somatosensory cortex at P10. DAPI (blue). L, layer.

Postnatal Zbtb20cKO mutants showed normal expression of TLE4 (Figure 35 – TLE4 p=0.4646, Ct 1.443±2.36 and cKO1.514±2.37; n=3; Unpaired t test), which is expressed by corticothalamic projections neurons in layer VI (Molyneaux et al. 2015). We observed normal expression of CTIP2 (Figure 35 – Ctip2 p=0.0505, Ct 1.757±0.195 and cKO 1.973±0.258; n=3; Unpaired t test), which is normally highly expressed by layer V corticofugal neurons and regulates subcortical projection neuron identity (Arlotta et al. 2008). Furthermore, we found that Zbtb20cKO showed normal expression of SATB2 (Figure 35 – Satb2 p= 0.1141, Ct 5.304±0.65 and cKO 5.665±0.36; n=3; Unpaired t test), which regulates callosal and subcerebral projection neuron identity (Alcamo et al. 2008; Leone et al. 2015).

Figure 35 Conditional genetic deletion of Zbtb20 in progenitors doesn’t affect deep layer neurons of the neocortex. Schematic illustration of the experimental procedure. Immunohistochemistry for SATB2 (magenta), TLE4 (red) and CTIP2 (green) in control and Zbtb20cKO mice in the somatosensory cortex at P10. DAPI (blue). L, layer. (TLE4 p=0.4646, Ct 1.443±2.36 and cKO1.514±2.37; Ctip2 p=0.0505, Ct 1.757±0.195 and cKO 1.973±0.258; Satb2 p= 0.1141, Ct 5.304±0.65 and cKO 5.665±0.36; n=3; Unpaired t test)

To rule out the possibility that the altered distribution of neuronal subtypes observed in P10 Zbtb20cKO mutants could be a consequence of delayed neuronal radial migration, we analyzed the distribution of NEUN-, CTIP2-, and CUX1-expressing neurons in the somatosensory cortex at P40-45 (Figure 36). For technical reasons (antibody does not work in adult brains), we could not analyze the distribution of RORβ+ neurons. Zbtb20cKO

mice showed higher cellular density in upper layers (Figure 36), closely resembling layer IV organization, and the presence of ectopic CUX1+ cells in deep layers, similarly to what we observed at P10. Taken together, these findings show expansion of layer IV in Zbtb20cKO mice at the expense of layer II/III neurons, suggesting that Zbtb20 is important for fate specification of layer II/III neurons.

Figure 36 Conditional genetic deletion of Zbtb20 in progenitors leads to laminar disorganization of the neocortex. Schematic illustration of the experimental procedure. Top panels show immunohistochemistry for NEUN (green) in control and Zbtb20cKO mice in the somatosensory cortex at P40-42. Bottom panels show immunohistochemistry for CUX1 (red) and CTIP2 (green). DAPI (blue). Extension of cortex was divided in 10 bins (from pia surface to the white matter). L, layer.

4.4.3 Barrel expansion in the primary somatosensory cortex of Zbtb20cKO mice In the rodent primary somatosensory cortex (S1), whiskers are topographically represented as discrete modules of layer IV granule cells (barrels) and thalamocortical afferent terminals, whose patterns are consolidated during the first postnatal week (O’Leary, Ruff, and Dyck 1994; Woolsey and Van der Loos 1970). Assembly of the barrel cortex circuit is critical for somatosensation. Thus, we investigated whether the expansion in RORβ/layer IV neurons in Zbtb20 cKO could lead to defects in somatosensory circuitry formation. Thalamocortical axons targeting the S1 area were identified by immunostaining of coronal sections for the vesicular glutamate transporter 2 (VGLUT2). In contrast with controls, Zbtb20cKO mice barrels were disproportionately increased in size: the area, height, and width of the VGLUT2-positive were significantly increased (Figure 37 – ****p<0.0001; Barrel area Ct 16.631±4.996 and cKO 29.215±14.298; Barrel height Ct 127±22.31 and cKO 166.1±39.34; Barrel width Ct 169.1±31.66 and cKO 226.3±29.47; n=3; Unpaired t test). To determine the role of Zbtb20 in the patterning of the anatomical somatosensory map in the barrel cortex, we assessed the expression of cytochrome C oxidase (CO) in tangential sections of flattened cortex. Although Zbtb20cKO mice showed similar layout of whiskers representation as in control animals, the barrel field was expanded (Figure 37).

Figure 37 Conditional genetic deletion of Zbtb20 in progenitors leads to barrel expansion in the primary somatosensory cortex. Schematic illustration of the experimental procedure. Top panels show immunohistochemistry for NEUN (red) and VGLUT2 (green) in control and Zbtb20cKO mice in the somatosensory cortex at P10. Bottom panels show cytochrome oxidase C staining (brown) on tangential sections of flatten cortices and a schematic illustration of the whisker’s representation in the barrel field. *represents C2 barrel. (****p<0.0001; Barrel area Ct 16.631±4.996 and cKO 29.215±14.298; Barrel height Ct 127±22.31 and cKO 166.1±39.34; Barrel width Ct 169.1±31.66 and cKO 226.3±29.47; n=3; Unpaired t test)

Further, we found that barrels remained expanded at P40-45, confirming that barrel formation and thalamocortical afferent terminals are permanently affected in Zbtb20cKO mice (Figure 38 – ****p<0.0001; Barrel area Ct 39.766±9.667 and cKO 53.238±14.570; n=3; Unpaired t test). 71

Figure 38 Conditional genetic deletion of Zbtb20 in progenitors leads to barrel expansion in the primary somatosensory cortex. Schematic illustration of the experimental procedure. Top panels show immunohistochemistry for NEUN (red) and VGLUT2 (green) in control and Zbtb20cKO mice in the somatosensory cortex at P40-42. Bottom panels show cytochrome oxidase C staining (brown) on tangential sections of flatten cortices. *represents C2 barrel. (****p<0.0001; Barrel area Ct 39.766±9.667 and cKO 53.238±14.570; n=3; Unpaired t test)

4.4.4 Local field potentials (LFPs) in the barrel cortex of Zbtb20cKO mice We further assessed the functional architecture of the columnar modules in Zbtb20cKO mice by in vivo electrophysiological recordings, using a multichannel probe at S1 to record multiple cortical layers simultaneously upon C2 whisker stimulation. We localized C2 barrel column using intrinsic signal imaging-based mapping. Post-mortem coronal sections stained with DiI and DiD were used to map the recording location of the

probe. All mice showed DiI and DiD-marked silicon probe recording tracts in S1 (Figure 39).

Figure 39 In vivo electrophysiological recordings in the barrel cortex of Zbtb20cKO mice. Schematic illustration of the experimental procedure. 64-multichannel silicon probe was inserted in C2 barrel column to record multiple cortical layers simultaneously, upon whisker stimulation in the contralateral side. Images show post-mortem coronal sections stained with DiI and DiD, probe was coated with these dyes each day of recording section. Two recording sections per mice, and 3 mice per group were used for this experiment. DAPI (blue).

We compared the current source densities (CSD) evoked by whisker stimulation in control and Zbtb20cKO awake mice (Figure 40). The CSD profiles across the depth of S1 following whisker stimulation showed that sink currents were first detected in layer IV in both groups. Surprisingly, no significant differences were observed in sink amplitude (p- value 0.39; two-sample t-test; n=3), and tactile responses of upper (from 0 to 600 µm) or deep (from 600 to 1200 µm) layer neurons (Figure 40). Analysis of the latency of the response will further help to understand the functional architecture of the Zbtb20cKO somatosensory cortex.

Figure 40 In vivo electrophysiological recordings in the barrel cortex of Zbtb20cKO. Current source density (CSD) analysis across the cortical depth in control (left) and Zbtb20cKO (right) upon C2 whisker stimulation. The strongest stimulus trial type (h40) were used to perform CSD analysis. The average traces of the linear 64 channels are arranged by depth (0 is the pia surface). Time 0 indicates the stimulus onset. Sink amplitude is the maximum amplitude within 50 ms from the stimulus onset (p-value 0.39; two-sample t-test; n=3). Tactile responses are shown for upper and deep layer neurons from six different stimuli (sinusoidal deflection at high, medium and low amplitudes; 40 Hz and 20 Hz frequencies). The responses of 40 Hz stimuli are mean firing rates from 0 to 75 ms (0 is stimulus onset) and the responses of 20 Hz stimuli are mean firing rates from 0 to 150 ms. Blue represents control mice (n =3) and red Zbtb20cKO mice (n=3). h40, high amplitude. m40, medium amplitude. l40, low amplitude. h20, high amplitude. m20, medium amplitude. l20, low amplitude.

4.4.5 Interhemispheric connection of upper layer CPNs is compromised in Zbtb20cKO mice Callosal projection neurons (CPNs) are excitatory pyramidal neurons that connect the cerebral hemispheres via the corpus callosum, whose cell bodies reside mainly in neocortical layers II/III, with less cells found in layer V, and a few cells in layers IV and VI (Catapano et al. 2001; Ivy and Killackey 1982; MacDonald et al. 2018; Wuttke et al. 2018). Since we observed a reduction in layer II/III neurons in Zbtb20cKO mice, we investigated the corpus callosum structure. To evaluate the morphology of callosal axons we labeled CPNs of the somatosensory cortex with fluorescent proteins through in utero electroporation. We performed these experiments at two different timepoints - E15.5 and E13.5, coincident with the generation of layers II/III neurons and layer V neurons, respectively. These callosal axons cross the midline and arborize the somatosensory cortex by the end of the second postnatal week when they achieve an innervation pattern similar to adult (Ivy and Killackey 1982; Wise and Jones 1978). Immunohistochemistry of electroporated cortex showed that electroporated cells at E15.5 were located in layers II/III of the somatosensory cortex and expressed BRN2 at P10, in both controls and Zbtb20cKO mice (Figure 41). We observed fibers crossing the corpus callosum in both control and Zbtb20cKO mice (Figure 41). However, quantification of number of axons crossing the midline is essential to confirm this observation.

Figure 41 Normal gross morphology of the corpus callosum of upper layer neurons in Zbtb20cKO mice. Schematic illustration of the experimental procedure. In utero electroporation was performed at E15.5 and analysis concluded at P10 in the somatosensory cortex. CPNs of control and Zbtb20fl/fl;Emx1-Cre mice were labeled with red fluorescent protein (pCAG-mRFP). Top and bottom panels show low and high magnification (of electroporated region) images, respectively. Immunohistochemistry for BRN2 (green). DAPI (blue). CPNs, callosal projection neurons.

Interestingly, loss of Zbtb20 function in progenitor cells resulted in a disruption of contralateral callosal projections to all cortical layers of the S1/S2 border region as compared to controls (Figure 42 – mRFP p<0.0001 Kolmogorov-Smirnov test). While axons of electroporated wild-type neurons targeted specific areas of the contralateral cortex, at the border between the primary somatosensory cortex (S1) and the secondary somatosensory cortex (S2), axons of electroporated Zbtb20cKO neurons distribute a

small number of fibers evenly across the extent of the contralateral cortex (Figure 42), some axons aberrantly target the hippocampus (Figure 43), and higher density of fibers were found in the ipsilateral cortex (Figure 43). In the absence of Zbtb20 function in progenitor cells, upper layer neurons fail to project to the correct target in the contralateral hemisphere.

Figure 42 Interhemispheric connection of upper layer CPNs is compromised in Zbtb20cKO mice. Schematic illustration of the experimental procedure. In utero electroporation was performed at E15.5 and analysis concluded at P10 in the somatosensory cortex (contralateral hemisphere). CPNs of control and Zbtb20cKO mice mice were labeled with red fluorescent protein (pCAG-mRFP). Immunohistochemistry for BRN2 (green). DAPI (blue). CPNs, callosal projection neurons. Quantification of fluorescence intensity from the

white matter (WM) to the pial surface for mRFP (p<0.0001 Kolmogorov-Smirnov test) and Brn2 (p=0.134 Kolmogorov-Smirnov test).

Figure 43 Ectopic fibers of upper layer CPNs in Zbtb20cKO mice. Schematic illustration of the experimental procedure. In utero electroporation was performed at E15.5 and analysis concluded at P10 in the somatosensory cortex. Only CPNs of Zbtb20cKO mouse are shown. CPNs were labeled with red fluorescent protein (pCAG-mRFP). Some axons aberrantly target the hippocampus (top) and higher density of fibers were found in the ipsilateral cortex (bottom). Immunohistochemistry for BRN2 (green). DAPI (blue). CPNs, callosal projection neurons.

We next set out to examine the effect of Zbtb20 loss of function on deep layers callosal projection to the contralateral somatosensory cortex. We found that progenitor cells electroporated at E13.5 with pCAG-YPET were mainly located in deep layers in controls and Zbtb20cKO mice at P10 (Figure 44), and deep layer neurons project normally to the contralateral hemisphere and subcortical areas in the absence of Zbtb20 (Figure 44). Analysis of the contralateral hemisphere of control and Zbtb20cKO mice revealed a similar distribution of GFP+ axons, indicating that, different from upper layer

cells, deep layer CPNs are able to project to their appropriate target area even after conditional knockout of Zbtb20 in progenitor cells. These data may suggest that ZBTB20 plays a unique role in the differentiation of layers II/III CPNs.

Figure 44 Interhemispheric connection of deep layer CPNs is not affected in Emx1-Cre/Zbtb20fl/fl mice. Schematic illustration of the experimental procedure. In utero electroporation was performed at E13.5 and analysis concluded at P10 in the somatosensory cortex. CPNs of control and Zbtb20fl/fl;Emx1-Cre mice were labeled with yellow fluorescent protein (pCAG-YPET is shown in green). Imagens show the

electroporated hemisphere (top), corpus callosum (bottom left) and contralateral hemisphere (bottom right). Immunohistochemistry for CTIP2 (red). DAPI (blue). CPNs, callosal projection neurons.

4.4.6 Cell autonomous and cell extrinsic effect of Zbtb20 in the axonal arborization of upper layer CPNs To investigate the possible cell-autonomous effect of Zbtb20 to control callosal axon targeting of layer II/III neurons, we knocked out Zbtb20 expression in progenitor cells by in utero electroporation of Cre-expressing plasmids in Zbtb20flox/flox mice, allowing for controlled spatiotemporal gene inactivation of cells in one hemisphere. We first analyzed CRE recombination efficiency 24 hours after in utero electroporation of pCAG-Cre-Ires-GFP and pCAG-mRFP, or pCAG-mRFP alone (control) at E15.5. We confirmed by immunohistochemistry that most cells transfected with pCAG-Cre-Ires-GFP were positive for CRE and lacked ZBTB20 expression (Figure 45). We then repeated this experiment and waited until P10 when cells have migrated to the cortical plate, extended axons to the contralateral hemisphere, and completed innervation. We found that electroporated cells occupied the upper layers of the somatosensory cortex and expressed BRN2 in both control and Cre-transfected animals (Figure 46). Contrary to our hypothesis, we observed that reporter-positive neurons in both control and experimental animals projected to the contralateral side and targeted a homotopic region of the somatosensory cortex (Figure 46). The arborization of the callosal fibers in the contralateral side seems to be reduced in Zbtb20fl/fl animals electroporated with Cre, although to a lesser extent compared to Zbtb20cKO animals. Measurements of axonal arborization are being carried out to further confirm these qualitative observations (Figure 46). Altogether, these observations may suggest that the altered axonal morphology of upper layer CPNs observed in Zbtb20cKO is likely due to a combination of cell- autonomous (loss of ZBTB20 in CPNs) and non-cell-autonomous (decrease number and altered distribution of CPNs in the contralateral side of Zbtb20cKO animals, but not in Cre-electroporated Zbtb20fl/fl animals) effects of Zbtb20 deletion.

Figure 45 CRE recombination efficiency and ZBTB20 expression in the developing neocortex of Zbtb20fl/fl mice. Schematic illustration of the experimental procedure. In utero electroporation was performed at E15.5 and analysis concluded after 12 hours in the ventricular zone. Cells were labeled with red fluorescent protein (pCAG-mRFP), alone (control) or together with Cre (CAG-CRE-Ires-GFP), allowing Cre recombination and therefore the deletion of Zbtb20 specifically in electroporated cells. Immunohistochemistry for ZBTB20 (blue) and CRE (magenta). Yellow and white arrowheads indicate ZBTB20 positive and negative cells, respectively. I, IRES.

Figure 46 Cell autonomous and cell extrinsic effect of Zbtb20 in the axonal arborization of upper layer CPNs. Schematic illustration of the experimental procedure. In utero electroporation was performed at E15.5 and analysis concluded at P10 in Zbtb20fl/fl mice. CPNs were labeled with red fluorescent protein (pCAG-mRFP), alone (control) or together with Cre (CAG-CRE-Ires-GFP), allowing Cre recombination and therefore the deletion of Zbtb20 specifically in electroporated cells. Imagens show the electroporated hemisphere (top) and contralateral hemisphere (bottom). Immunohistochemistry for BRN2 (green). DAPI (blue). I, IRES. CPNs, callosal projection neurons.

4.4.7 Conditional genetic deletion of Zbtb20 in intermediate progenitors and post-mitotic neurons impairs CPN differentiation Our results show that inducing deletion of Zbtb20 in the progenitor cells of the dorsal telencephalon leads to an expansion of layer IV at the expense of layer II/III neurons, enlargement of the barrel somatosensory cortex and callosal targeting defects in layer II/III neurons. However, the deletion of Zbtb20 in progenitor cells is inherited by their neuronal progeny, so that the effects observed in Zbtb20cKO mice could be explained by the absence of ZBTB20 in immature post-mitotic neurons. To directly address this possibility, we knocked out Zbtb20 gene using NEX-Cre mice. In this transgenic mouse,

Cre-mediated recombination is prominent in intermediate progenitor cells in the SVZ and newly generated neurons of the dorsal telencephalon (Belvindrah et al. 2007; Goebbels et al. 2006; Wu et al. 2005). In early postnatal mouse brain development, ZBTB20 is transiently expressed in a subset of neurons in layer II/III (Figure 16; Tonchev et al. 2016). We first confirmed that Zbtb20 deletion was restricted to postmitotic neurons, ZBTB20 expression was reduced in neurons in the cortex and hippocampus of NEX-Cre;Zbtb20fl/fl mice, compared to control mice (Figure 47).

Figure 47 Specific deletion of ZBTB20 in postmitotic neurons of the dorsal telencephalon. Schematic illustration of the experimental procedure. Zbtb20flox mouse were mated to Nex-Cre mouse line (Zbtb20fl/fl;Nex-Cre), which induces selective deletion of Zbtb20 in postmitotic neurons. Immunohistochemistry for ZBTB20 (red), BRN2 (green) and NEUN (magenta) at P4 in the somatosensory cortex. DAPI (blue). Top and bottom panels show somatosensory cortex and hippocampus, respectively. Higher magnification images of the dorsal telencephalon are shown in the middle and lower panels.

To determine the effect of Zbtb20 deletion in postmitotic neurons on the laminar organization of the neocortex, we assessed the expression of neuron-subtype markers by immunohistochemistry. We observed a decrease in the number of BRN2+/RORβ- (layer II/III) neurons in NEX-Cre;Zbtb20fl/fl at P10, compared to control mice (Figure 49). In contrast, the number of RORβ+ neurons was increased (Figure 49). No differences were observed in the number of CUX1+ (Figure 48), CTIP2+ and TLE4+ neurons in NEX- Cre;Zbtb20fl/fl mice (Figure 50). These alterations are similar to those observed in Emx1- Cre;Zbtb20fl/fl mice, although to a lesser extent.

Figure 48 Cortical laminar organization of Zbtb20fl/fl;Nex-Cre mice. Schematic illustration of the experimental procedure. Immunohistochemistry for CUX1 (red) and CTIP2 (green) in control and Zbtb20fl/fl;Nex-Cre in the somatosensory cortex at P10. DAPI (blue). L, layer.

Figure 49 Conditional genetic deletion of Zbtb20 in post-mitotic neurons impairs CPN differentiation. Schematic illustration of the experimental procedure. Immunohistochemistry for BRN2 (red), CTIP2 (green) and RORβ (white) in control and Zbtb20fl/fl;Nex-Cre in the somatosensory cortex at P10. DAPI (blue). L, layer.

Figure 50 Conditional genetic deletion of Zbtb20 post-mitotic neurons doesn’t affect deep layer neurons of the neocortex. Schematic illustration of the experimental procedure. Immunohistochemistry for TLE4 (red) and CTIP2 (green) in control and Zbtb20fl/fl;Nex-Cre in the somatosensory cortex at P10. DAPI (blue). L, layer.

We next evaluated the axon projections of neurons in layer II/III in NEX-Cre Zbtb20fl/fl mice through pCAG-mRFP expression by in utero electroporation at E15.5 and analysis at P14. We found that cells electroporated at E15.5 were mainly located in layers II/III in controls and NEX-Cre Zbtb20fl/fl mice at P14, and upper layer neurons projected axons towards the midline and the contralateral white matter (Figure 51). However, a prominent reduction in the amount of axonal fibers was observed in the homotopic contralateral cortex in NEX-Cre Zbtb20fl/fl mice compared to controls (Figure 51). Together, our results from both the Emx1-Cre Zbtb20fl/fl and NEX-Cre Zbtb20fl/fl indicate that ZBTB20 regulates the acquisition of layer II/III neuronal-fates at multiple stages of

cell lineage progression, starting from VZ/SVZ progenitors and continuing in early post- mitotic neurons.

Figure 51 Interhemispheric connection of upper layer CPNs is compromised in Nex-Cre/Zbtb20fl/fl mice. Schematic illustration of the experimental procedure. In utero electroporation was performed at E15.5 and analysis concluded at P14 in the somatosensory cortex. CPNs of control and Zbtb20fl/fl;Nex-Cre mice were labeled with red fluorescent protein (pCAG-mRFP). Top and bottom panels show electroporated and contralateral side, respectively. Immunohistochemistry for BRN2 (green). DAPI (blue). CPNs, callosal projection neurons.

5 DISCUSSION

5.1 Summary of results The development of the mammalian neocortex is a tightly orchestrate process allowing multipotent neural progenitor cells to generate a high diversity of neurons and macroglia (astrocytes, oligodendrocytes and ependymal cells). This process takes months in primates, including humans, and about 3-4 weeks in mice and rats, making these models extremely attractive for the study of the molecular mechanisms governing neuronal and macroglial differentiation (Cadwell et al. 2019). In this work, we unravel the roles of transcriptional repressor ZBTB20 in astrogliogenesis and specification of CPNs of the layers II/III. To the best of our knowledge, this is the first description of a transcription factor regulating both the acquisition of a specific neuronal phenotype and astrogliogenesis in the developing neocortex. We show that ZBTB20 acts in multipotent progenitors and post-mitotic neurons, regulating multiple steps of CPN differentiation from fate-specification to axonal targeting. Finally, we show that the effects of ZBTB20 in regulating the total number of astrocytes in the neocortex are time-dependent and can be partially compensated for at late postnatal life. Together, our results indicate that ZBTB20 is a central regulator of cell type/subtype specification in the developing neocortex. The role of Zbtb20 in neocortex described in this thesis in comparison with other literature findings are summarized in Table 7 and will be discussed in more detail in the following sections.

5.2 ZBTB20 expression in the neocortex We show here, in agreement with previous work (Nagao et al. 2016; Tonchev et al. 2016), that ZBTB20 expression can be detected in the neocortical germinative zones of mice around E14.5-15.5. It has also been described that ZBTB20 expression in the dorsal telencephalon follows a latero-medial distribution (Tonchev et al. 2016) resembling the well described neurogenic gradient in the developing neocortex (Caviness, Nowakowski, and Bhide 2009). This temporal pattern of expression correlates with the switch from layer IV to layers II/III neuronal generation and the beginning of astrogliogenesis (Molyneaux et al. 2007; Qian et al. 2000). At early neonatal stage (P4), we observe that ZBTB20 is transiently expressed by layer II/III BRN2+ neurons, and it becomes exclusively expressed by astroglial cells in the adult neocortex. Similar findings have been recently described in the literature (Nagao et al. 2016). They show ZBTB20 expression by Sox9- cells (likely neurons) in neocortex layer II/III and by Sox9+ astroglial cells spread out across the cortical plate at P3. At P7, ZBTB20 expression is restricted mostly to Sox9+, S100β+ and GFAP+ astroglial cells, but still some expression in Sox9- cells is observed. Finally, ZBTB20 expression becomes restricted to Sox9+, S100β+ and GFAP+ cells in the adult neocortex (Nagao et al. 2016).

5.3 Role of Zbtb20 in gliogenesis It has been proposed that Zbtb20 instructs astrogliogenesis onset (Nagao et al. 2016). Using in utero electroporation at E15.5, overexpression and knockdown of Zbtb20 promote and suppress astrocytogenesis, respectively. The authors suggested that Zbtb20 acts in part through the repression of Brn2 expression, together with Sox9 and NFIA (Nagao et al. 2016). We found similar results with overexpression of ZBTB20 at

E14.5, leading to an increase of astroglial cells at P22. In contrast, overexpression of ZBTB20 at a later developmental stage (E16.5), when ZBTB20 is endogenously expressed, did not increase the number of astroglial cells. This indicates that ZBTB20 regulates astrogliogenesis in a time-specific fashion. To further exploit this hypothesis, we took advantage of the Cre-LoxP system to conditionally delete the expression of Zbtb20 in early neocortical multipotent progenitors and their progeny (neurons and macroglia). This was achieved by crossing Zbtb20fl/fl with

Emx1-Cre mice, which led to a complete removal of ZBTB20 in the dorsal telencephalon. Then we assessed the expression of different astrocyte markers in young-adult mice in Zbtb20cKO mice. We observed no differences in number and distribution of SOX9+ and S100β+ cells in the somatosensory cortex of Zbtb20cKO mice compared with controls. Altogether, our data indicate that other factors might compensate ZBTB20 function to equilibrate astrogliogenesis. In fact, we observe that several genes of the ZBTB gene family, as well as other TFs involved in astrogliogenesis, are differently expressed in the Zbtb20cKO at late embryogenesis. Significantly, we observed that the expression of DN- ZBTB20 after the onset of gliogenesis (E16.5) reduced the number of astroglial cells, while no difference was observed in DN-ZBTB20 and control animals electroporated before the gliogenesis onset (E14.5). Suggesting that Zbtb20 might regulate the onset of gliogenesis in combination with other TFs of the Zbtb family that were likely also inhibited by DN-ZBTB20. Another possible explanation for the normal number of astrocytes observed in the Zbtb20cKO mice could be a compensatory astrogliogenesis from ventral-derived glial progenitors (not recombined in the Emx1-lineage – see Figure 23). Glial progenitors derived from the ventral telencephalon migrate through the SVZ (Marshall, Novitch, and Goldman 2005) and marginal zone/layer I (Costa et al. 2007) where they contribute to generate astrocytes, oligodendrocytes and a small subset of neurons in the neonatal neocortex (Breunig et al. 2012; Minocha et al. 2017). These ventral-derived glial progenitors could show an increase in local proliferation after the first postnatal week, explaining the normal number of astrocytes observed in Zbtb20cKO mice our study. Remarkably, we observed that GFAP expression was upregulated throughout the entire extension of the cortex in Zbtb20cKO mice, particularly in layer I/marginal zone (MZ) and layer VI, an indicative of a reactive gliosis. Although microglia morphology remained unchanged as compared to controls during the time examined, it is possible that different states of microglia activation are present over the course of the inflammatory process. Further analysis will be essential to elucidate Zbtb20 function in reactive gliosis. ZBTB20 has been recently implicated in regulation of gliogenesis after adult brain injury, although the results seemed inconsistent. The authors showed normal levels of GFAP expression and reduced S100β+ cells at P12 in Zbtb20 full KO, whereas a

reduction of ischemia-induced astrocytic reaction was observed in heterozygous Zbtb20 mice (Doeppner et al. 2019). It’s difficult to interpret these results without measurements and normalization of the injured size and, more importantly, it would be essential to evaluate gliogenesis after adult brain injury in homozygous Zbtb20 KO mice. Other possibilities might also need to be addressed. For example, Zbtb20 could directly regulate GFAP expression in adult astrocytes or could be involved in astrocyte differentiation and diversity. Astrocyte morphology and gene expression vary substantially among cortical regions, suggesting distinct physiologic properties (Bayraktar et al. 2018; Emsley and Macklis 2006; Lin et al. 2017; Regan et al. 2007; Rosenberg et al. 2018). Interestingly, the GFAP expression in Zbtb20 cKO resemble the early pattern of astrocyte distribution in the human fetal brain, forming a bilaminar distribution, GFAP is expressed in the marginal zone and subplate (DeAzevedo et al. 2003). Additional studies are crucial to determine Zbtb20 function in astrocyte differentiation and diversity.

5.4 Role of Zbtb20 in neurogenesis It has been proposed that ZBTB20 plays a role in the sequential generation of neuronal layers in developing cortex (Tonchev et al. 2016). Zbtb20 full KO leads to a reduction of layer II/III and an increase of layer IV, V and VI neurons at early postnatal stages, likely caused by an extension of development window of progenitor cells and migration defects of upper layer neurons (Tonchev et al. 2016). The findings that ZBTB20 regulate astrogliogenesis by repressing Brn2 expression (Nagao et al. 2016) and that the loss of ZBTB20 leads to a reduction of layer II/III BRN2+ neurons (Tonchev et al. 2016) are seemingly contradictory. A possible mechanism to conciliate these observations could be that ZBTB20 act at different stages of the lineage progression in concert with other players. To further exploit this hypothesis, we perturb Zbtb20 expression either in progenitors or post-mitotic neurons to unravel the functions of this protein in neocortical development. Conditional knockout (cKO) of Zbtb20 in neocortical progenitors led to a severe disorganization of cortical layers, with an expansion in the number and radial distribution of RORβ+ neurons towards the pial surface at the expense of BRN2+ neurons at P10, without affecting CTIP2+ and TLE4+ neurons. As mentioned before, Tonchev and

collaborators (2016) have also shown a similar phenotype using a full knockout of Zbtb20. However, they also described an increase in the Tbr1+, Ctip2+ and Foxp2+ at the beginning of post-natal development (P4), which led the authors to propose ZBTB20 as a regulator of the sequential specification of neuronal classes in the neocortex (Tonchev et al. 2016). Our results do not support this notion, but rather points to ZBTB20 as an instructive factor for the specification of layers II/III BRN2+ neurons while suppressing the acquisition of a layer IV RORβ+ fate. In support of our interpretation, we show that overexpression of ZBTB20 by in utero electroporation at E14.5 is sufficient to induce the differentiation of BRN2+ neurons at the expense of RORβ+ neurons. Moreover, conditional knock-out of Zbtb20 in immature post-mitotic neurons and intermediate progenitor, by crossing Zbtb20fl/fl with Nex-Cre mice, led to an increase in the number of RORβ+ neurons at the expense of BRN2+ neurons, without affecting CTIP2+ and TLE4+ neurons. Indicating that ZBTB20 is necessary in postmitotic cells and SVZ progenitors for the differentiation of layer II/III BRN2+ neurons. We also observed ectopic BRN2+ neurons in different neocortical areas of the Zbtb20cKO mice (and to a lesser extent in Nex-Cre/Zbtb20fl/fl mice), indicating that the lack of ZBTB20 may be affecting not only the acquisition of a BRN2+ upper layer fate, but also the radial migration of these cells to their correct position. Future experiments using BrdU-chasing and time-lapse video microscopy will be necessary to further confirm the role of ZBTB20 in the regulation of neuronal radial migration.

5.5 Role of Zbtb20 in progenitors versus intermediate progenitors and neurons The specification of excitatory neuronal subtypes in the developing neocortex is controlled by an elaborate regulatory network (Greig et al. 2013; Molyneaux et al. 2007). For instance, Fezf2 and Ctip2 are required for the specification of subcerebral projection neurons (Molyneaux et al. 2005; Arlotta et al. 2008; Chen et al. 2008), Tbr1 and Sox5 promotes the identity of corticothalamic neurons (Lai et al. 2008; Greig et al. 2013; Lai et al. 2008), Satb2 is essential for callosal projection and layer IV neuron development (Alcamo et al. 2008), and Brn1 and Brn2, govern neurogenesis and subtype identity of upper layer neurons (Dominguez, Ayoub, and Rakic 2013; McEvilly et al. 2002; Sugitani et al. 2002). Overall, only a small number of transcription factors controlling neuronal

subtype development have been elucidated and further important regulators remain to be identified. Our data suggest that Zbtb20 is another player in this regulatory network, directing the acquisition of a specific neuronal fate, namely layer II/III BRN2+ neurons. Although the precise mechanism of ZBTB20-mediated neuronal fate specification remains to be elucidated, our data suggest that ZBTB20 acts both in progenitors and neurons. We observed similar alterations in cell fate when deleting Zbtb20 specifically in VZ neocortical progenitors or SVZ intermediate progenitors and post-mitotic neurons, albeit the phenotype seemed more severe after Zbtb20 deletion in progenitor cells. Similar to what we observe for ZBTB20, other key regulators of neuronal fate have been described to be expressed both in progenitors and post-mitotic neurons, such as Fezf2, Brn1 and Brn2. Although it is not known whether these TFs act in proliferating progenitors or postmitotic cells.

5.6 Role of Zbtb20 in the formation of callosal projections and neuronal circuit Although changes in the distribution of neurons expressing layer-specific molecular markers imply alterations in the organization of the neocortex, it is important to understand whether this change in layering also affect circuit formation and function. We show here that the loss of ZBTB20 in progenitors and immature neurons affects two important aspects of neuronal circuit formation: 1) organization of thalamocortical projections; and 2) inter-hemispheric connection. In the Zbtb20 cKO animals, the increased radial distribution of RORβ+ neurons was accompanied by an increase in the arborization of thalamocortical fibers, leading to an expansion of barrel areas in S1. Whether a causal relation exist between these two phenomena remains to be determined. However, some interesting data in the literature may help us to understand this phenotype. Decreased thalamocortical axonal arborization is observed in Ephrin-A5 KO mice (Uziel, Mühlfriedel, and Bolz 2008) and it is stimulated by molecules produced by layer IV neurons, including Ephrins (Mann et al. 2002). Furthermore, loss of CTIP1 function in the developing neocortex impairs differentiation of layer IV neurons and reduces innervation

by thalamocortical axons while increasing callosal projection neurons terminals (Greig et al. 2016). Notably, preliminary data in the laboratory using gene regulatory network analysis (SCENIC Single-Cell rEgulatory Network Inference and Clustering/GRNboost2) (Aibar et al. 2017) of single-cell RNA sequencing data obtained from the literature of brains cells at E18 (10X Genomics E18.5) and P2 (Rosenberg et al. 2018) show Ephrin Type-A Receptor 4 (Epha4) in our gene regulatory network analysis for Zbtb20 (data not shown), suggesting that the expression of these two genes might be co-regulated. Thus, it is possible that the role of Zbtb20 in the specification of layer IV/RORβ+ neuronal fate involves the repression of Ephrin receptors. On the other hand, there is evidence indicating that thalamocortical axons are instructive for layer IV neuronal phenotypes. Li and colleagues (2013) used a genetic model to remove glutamatergic thalamocortical neurotransmission and showed that this manipulation prevented the formation of barrel columns in the somatosensory cortex. Interestingly, based on cytoarchitectonic criteria, the authors also showed that blocking thalamocortical neurotransmission reduced the radial expansion of layer IV (Li et al. 2013), suggesting that cortical lamination and neuronal differentiation could be influenced by extrinsic activity. Accordingly, spontaneous calcium waves in thalamic nuclei regulate cortical area size (Antón-bolaños et al. 2019; Moreno-Juan et al. 2017). Silencing calcium waves in the auditory thalamus induces Rorβ upregulation in a neighboring somatosensory nucleus and leads to an enlargement of the barrel-field (Moreno-Juan et al. 2017), further suggesting that thalamocortical axons convey instructive information to cortical neurons. Altogether, these works may suggest that the specification of layer IV neurons and innervation by thalamocortical axons are complementary processes. In other words, both intrinsic mechanisms controlling the expression of RORβ by layer IV neurons and extrinsic electrical signals provided by thalamocortical axons are necessary for the proper specification of layer IV and barrel formation. Our observations in Zbtb20 cKO mice could, therefore, be explained by a primary defect in neuronal specification – increased generation of layer IV RORβ+ neurons, leading to an expansion of thalamocortical axon terminals. Alternatively, the lack of BRN2+ neurons could lead to the expansion of

thalamocortical terminals, which would then influence the differentiation of RORβ+ neurons. These two possible explanations may not be mutually exclusive. In fact, there is evidence suggesting that BRN2 suppress RORβ expression, and vice-versa, and that this negative feedback loop is important for the specification of neuronal fates in layer II/III or IV (Oishi, Aramaki, and Nakajima 2016). In the absence of BRN2+ neurons, contralateral callosal projections would also be reduced, decreasing the competition for synaptic partners with thalamocortical axons. Indeed, there are evidence showing that thalamocortical terminal are expanded in the absence of callosal projections and vice- versa (Greig et al. 2016). In line with this latter suggestion, we did observe a severe reduction in the callosal axonal projections of upper layer neurons in the contralateral hemisphere of Zbtb20 cKO mice. This effect was more severe after Zbtb20 deletion in progenitor cells but could also be observed following Zbtb20 knockout in immature post-mitotic neurons. Unilateral decrease of Zbtb20 expression in layer II/III neurons also decreased contralateral callosal projections, although to a much lesser extent, indicating that ZBTB20 regulates axonal growth in upper layer CPNs. Interestingly, axons of Zbtb20 KO CPNs are able to cross the midline and reach the contralateral homotopic white matter but fail to invade the cortical plate, reach superficial layers and ramify as control CPNs. Although the mechanisms controlling early stages of callosal axon growth are relatively well known, the same is not true for the later stages including the invasion of the contralateral grey matter and terminal branching (Leyva-Díaz and López-Bendito 2013). Nevertheless, compelling evidence indicate that Wnt5/Ryk-mediated signaling is key for these processes (Hutchins, Li, and Kalil 2011). In vivo knockout mice lacking the Wnt5a Ryk receptor show guidance errors in callosal axons only after they cross the midline (Keeble et al. 2006). Interestingly, Ryk knockdown in CPNs leads to reduced frequencies of Ca2+ transients and guidance errors in post-crossing axons that deviated inappropriately toward the septum or prematurely turned toward the overlying cortex (Li, Hutchins, and Kalil 2009), which we also observe in the lack of Zbtb20. Wnt/calcium signaling activates CaMKII and this activation is necessary for the outgrowth of post- crossing callosal axons (Li, Hutchins, and Kalil 2009).

Noteworthy, we found Camk2b in our gene regulatory network analysis for Zbtb20- associated genes. Other genes that were also identified in this analysis and could play a role in axonal growth are Mapt (promotes microtubule assembly and stability); Unc5d (receptor for the netrin NTN4, which plays a role in axon guidance in the developing neocortex); Nrxn3 (neuronal cell surface protein that may be involved in cell recognition and cell adhesion); Nrg3 (activate the tyrosine phosphorylation of its cognate receptor, ERBB4); Grik2 and 3 (receptor for glutamate that functions as ligand-gated ion channel in the central nervous system and plays an important role in excitatory synaptic transmission; could be involved in the generation of calcium waves important for axonal guidance). Related to the latter candidate, Zbtb20 knockout in CA1 neurons reduce NMDA receptor (NMDAR)-mediated excitatory post-synaptic currents (Ren et al. 2012). It is tempting to speculate that at least some of the roles of Zbtb20 in neuronal fate specification and axon guidance could be related to changes in neuronal activity/calcium transients. According to this interpretation, Zbtb20 knockout could first affect neocortical progenitor polarization, which is important for neuronal fate specification (Vitali et al. 2018). Next, lack of Zbtb20 in late-born neurons could affect neuronal radial migration (Bando et al. 2016), leading to the ectopic settling of BRN2+ neurons observed in our study. Lastly, Zbtb20 knockout in CPNs would decrease calcium transients in post- crossing callosal axons, reducing terminal extension and branching in the contralateral hemisphere. This decreased callosal innervation would make room to the expansion of thalamocortical axon terminals, thus explaining all the different phenotypes observed in Zbtb20 cKO mice. Future experiments should help to clarify this possibility, for example by using DREADDs (Designer Receptors Exclusively Activated by Designer Drugs) (Roth 2016; Urban and Roth 2015) to stimulate calcium transients in progenitors and post- mitotic neurons.

6 CONCLUSION

In this work, we unravel the roles of the transcriptional repressor ZBTB20 in astrogliogenesis and specification of CPNs. Zbtb20 controls the acquisition of a specific neuronal fate, namely layer II/III BRN2+ neuronal identity while suppressing the acquisition of a layer IV RORβ+ fate. We show that ZBTB20 acts in multipotent progenitors and post-mitotic neurons, regulating multiple steps of layer II/III CPN differentiation from fate-specification to axonal targeting. Finally, we show that the effects of ZBTB20 in regulating the total number of astrocytes in the neocortex are time- dependent and can be partially compensated at late postnatal life. Together, our results indicate that ZBTB20 is a central regulator of cell type/subtype specification in the developing neocortex.

7 REFERENCES

Aibar, Sara et al. 2017. “SCENIC: Single-Cell Regulatory Network Inference and Clustering.” Nature Methods 14(11): 1083–86. Alcamo, Elizabeth A. et al. 2008. “Satb2 Regulates Callosal Projection Neuron Identity in the Developing Cerebral Cortex.” Neuron 57(3): 364–77. Allen, Nicola J., and David A. Lyons. 2018. “Glia as Architects of Central Nervous System Formation and Function.” Science 362(6411): 181–85. Alves, José A.J. et al. 2002. “Initial Stages of Radial Glia Astrocytic Transformation in the Early Postnatal Anterior Subventricular Zone.” Journal of Neurobiology 52(3): 251– 65. Anderson, S. A., D. D. Eisenstat, L. Shi, and J. L.R. Rubenstein. 1997. “Interneuron Migration from Basal Forebrain to Neocortex: Dependence on Dlx Genes.” Science 278(5337): 474–76. Angevine, J., and R. Sidman. 1961. “Autoradiographic Study of Cell Migration during Histogenesis of Cerebral Cortex in the Mouse.” Nature: 766–68. Anthony, Todd E., and Nathaniel Heintz. 2008. “Genetic Lineage Tracing Defines Distinct Neurogenic and Gliogenic Stages of Ventral Telencephalic Radial Glial Development.” Neural Development 3(1): 0–10. Antón-bolaños, Noelia et al. 2019. “Prenatal Activity from Thalamic Neurons Governs the Emergence of Functional Cortical Maps in Mice.” Science 364(6444): 987–90. Arlotta, P et al. 2008. “Ctip2 Controls the Differentiation of Medium Spiny Neurons and the Establishment of the Cellular Architecture of the Striatum.” Journal of Neuroscience 28(3): 622–32. Arlotta, Paola et al. 2005. “Neuronal Subtype-Specific Genes That Control Corticospinal Motor Neuron Development in Vivo.” Neuron 45(2): 207–21. Armentano, Maria et al. 2007. “COUP-TFI Regulates the Balance of Cortical Patterning between Frontal/Motor and Sensory Areas.” Nature Neuroscience 10(10): 1277–86. Assimacopoulos, Stavroula, Tina Kao, Naoum P. Issa, and Elizabeth A. Grove. 2012. “Fibroblast Growth Factor 8 Organizes the Neocortical Area Map and Regulates Sensory Map Topography.” Journal of Neuroscience 32(21): 7191–7201.

Bachiller, Daniel et al. 2000. “The Organizer Factors Chordin and Noggin Are Required for Mouse Forebrain Development.” Nature 403(6770): 658–61. Bachler, Monika, and Annette Neubüser. 2001. “Expression of Members of the Fgf Family and Their Receptors during Midfacial Development.” Mechanisms of Development 100(2): 313–16. Bando, Yuki et al. 2016. “Control of Spontaneous Ca2+ Transients Is Critical for Neuronal Maturation in the Developing Neocortex.” Cerebral Cortex 26(1): 106–17. Barber, Melissa et al. 2015. “Migration Speed of Cajal-Retzius Cells Modulated by Vesicular Trafficking Controls the Size of Higher-Order Cortical Areas.” Current Biology 25(19): 2466–78. Barnabé-Heider, Fanie et al. 2005. “Evidence That Embryonic Neurons Regulate the Onset of Cortical Gliogenesis via Cardiotrophin-1.” Neuron 48(2): 253–65. Bayraktar, Omer Ali et al. 2018. “Single-Cell in Situ Transcriptomic Map of Astrocyte Cortical Layer Diversity.” bioRxiv preprint: 1–54. Beattie, Robert, and Simon Hippenmeyer. 2017. “Mechanisms of Radial Glia Progenitor Cell Lineage Progression.” FEBS Letters 591(24): 3993–4008. Belvindrah, Richard et al. 2007. “Β1 Integrins in Radial Glia But Not in Migrating Neurons Are Essential for the Formation of Cell Layers in the Cerebral Cortex.” Journal of Neuroscience 27(50): 13854–65. Bishop, Kathie M., Guy Goudreau, and Dennis D.M. O’Leary. 2000. “Regulation of Area Identity in the Mammalian Neocortex by Emx2 and Pax6.” Science 288(5464): 344– 49. Bishop, Kathie M., John L.R. Rubenstein, and Dennis D.M. O’Leary. 2002. “Distinct Actions of Emx1, Emx2, and Pax6 in Regulating the Specification of Areas in the Developing Neocortex.” Journal of Neuroscience 22(17): 7627–38. Bonni, Azad et al. 1997. “Regulation of Gliogenesis in the Central Nervous System by the JAK-STAT Signaling Pathway.” Science 278(5337): 477–83. Brandão, Juliana A., and Rodrigo N. Romcy-Pereira. 2015. “Interplay of Environmental Signals and Progenitor Diversity on Fate Specification of Cortical GABaergic Neurons.” Frontiers in Cellular Neuroscience 9(APR): 1–11. Breunig, Joshua J. et al. 2012. “Rapid Genetic Targeting of Pial Surface Neural

100

Progenitors and Immature Neurons by Neonatal Electroporation.” Neural Development 7(1): 1. Neural Development. Cadwell, Cathryn R. et al. 2019. “Development and Arealization of the Cerebral Cortex.” Neuron 103(6): 980–1004. Cahoy, John D. et al. 2008. “A Transcriptome Database for Astrocytes, Neurons, and Oligodendrocytes: A New Resource for Understanding Brain Development and Function.” Journal of Neuroscience 28(1): 264–78. Calegari, Federico, Wulf Haubensak, Christiane Haffher, and Wieland B. Huttner. 2005. “Selective Lengthening of the Cell Cycle in the Neurogenic Subpopulation of Neural Progenitor Cells during Mouse Brain Development.” Journal of Neuroscience 25(28): 6533–38. Calegari, Federico, and Wieland B. Huttner. 2003. “An Inhibition of Cyclin-Dependent Kinases That Lengthens, but Does Not Arrest, Neuroepithelial Cell Cycle Induces Premature Neurogenesis.” Journal of Cell Science 116(24): 4947–55. Casertano, Alberto et al. 2017. “Alterations in Metabolic Patterns Have a Key Role in Diagnosis and Progression of Primrose Syndrome.” American Journal of Medical Genetics, Part A 173(7): 1896–1902. Catapano, Lisa A., Matthew W. Arnold, Francisco A. Perez, and Jeffrey D. Macklis. 2001. “Specific Neurotrophic Factors Support the Survival of Cortical Projection Neurons at Distinct Stages of Development.” Journal of Neuroscience 21(22): 8863–72. Caviness, V S. 1982. “Neocortical Histogenesis in Normal and Reeler Mice: A Developmental Study Based upon [3H]Thymidine Autoradiography.” Developmental Brain Research 4(3): 293–302. Caviness, V S, and R L Sidman. 1973. “Time of Origin of Corresponding Cell Classes in the Cerebral Cortex of Normal and Reeler Mutant Mice: An Autoradiographic Analysis.” Journal of Comparative Neurology 148(2): 141–51. Caviness, Verne S., Richard S. Nowakowski, and Pradeep G. Bhide. 2009. “Neocortical Neurogenesis: Morphogenetic Gradients and Beyond.” Trends in Neurosciences 32(8): 443–50. Chen, Bin et al. 2008. “The Fezf2-Ctip2 Genetic Pathway Regulates the Fate Choice of Subcortical Projection Neurons in the Developing Cerebral Cortex.” Proceedings of

101

the National Academy of Sciences of the United States of America 105(32): 11382– 87. Chen, Fuyi, and Joseph LoTurco. 2012. “A Method for Stable Transgenesis of Radial Glia Lineage in Rat Neocortex by PiggyBac Mediated Transposition.” Journal of Neuroscience Methods 207(2): 172–80. Chen, Jessie et al. 2018. “BMP-Responsive Protease HtrA1 Is Differentially Expressed in Astrocytes and Regulates Astrocytic Development and Injury Response.” Journal of Neuroscience 38(15): 3840–57. Chen, Meifan et al. 2018. “Leucine Zipper-Bearing Kinase Is a Critical Regulator of Astrocyte Reactivity in the Adult Mammalian CNS.” Cell Reports 22(13): 3587–97. Cholfin, Jeremy A., and J. L R Rubenstein. 2007. “Patterning of Frontal Cortex Subdivisions by Fgf17.” Proceedings of the National Academy of Sciences of the United States of America 104(18): 7652–57. Cholfin, Jeremy A., and John L.R. Rubenstein. 2008. “Frontal Cortex Subdivision Patterning Is Coordinately Regulated by Fgf8, Fgf17, and Emx2.” Journal of Comparative Neurology 509(2): 144–55. Chou, Shen Ju et al. 2013. “Geniculocortical Input Drives Genetic Distinctions between Primary and Higher-Order Visual Areas.” Science 340(6137): 1239–42. Cleaver, Ruth et al. 2019. “Refining the Primrose Syndrome Phenotype: A Study of Five Patients with ZBTB20 de Novo Variants and a Review of the Literature.” American Journal of Medical Genetics, Part A 179(3): 344–49. Cordeddu, Viviana et al. 2014. “Mutations in ZBTB20 Cause Primrose Syndrome.” Nature Genetics 46(8): 815–17. Costa, Marcos R., and Ulrich Müller. 2015. “Specification of Excitatory Neurons in the Developing Cerebral Cortex: Progenitor Diversity and Environmental Influences.” Frontiers in Cellular Neuroscience. Costa, Marcos R et al. 2007. “The Marginal Zone / Layer I as a Novel Niche for Neurogenesis and Gliogenesis in Developing Cerebral Cortex.” Cell Proliferation 27(42): 11376–88. Costa, Marcos R, Oliver Bucholz, Timm Schroeder, and Magdalena Gotz. 2009. “Late Origin of Glia-Restricted Progenitors in the Developing Mouse Cerebral Cortex.”

102

Cerebral Cortex: 135–43. Davies, Matthew N. et al. 2014. “Hypermethylation in the ZBTB20 Gene Is Associated with Major Depressive Disorder.” Genome Biology 15(4): 1–12. DeAzevedo, Leonardo C. et al. 2003. “Cortical Radial Glial Cells in Human Fetuses: Depth-Correlated Transformation into Astrocytes.” Journal of Neurobiology 55(3): 288–98. Dehay, C et al. 1996. “Phenotypic Characterisation of Respecified Visual Cortex Subsequent to Prenatal Enucleation in the Monkey: Development of Acetylcholinesterase and Cytochrome Oxidase Patterns.” Journal of Comparative Neurology 376(3): 386–402. Dehay, Colette et al. 1989. “Maturation and Connectivity of the Visual Cortex in Monkey Is Altered by Prenatal Removal of Retinal Input.” Nature 337(6204): 265–67. Deloulme, Jean Christophe et al. 2004. “Nuclear Expression of S100B in Oligodendrocyte Progenitor Cells Correlates with Differentiation toward the Oligodendroglial Lineage and Modulates Oligodendrocytes Maturation.” Molecular and Cellular Neuroscience 27(4): 453–65. Díaz-Alonso, Javier et al. 2012. “The CB1 Cannabinoid Receptor Drives Corticospinal Motor Neuron Differentiation through the Ctip2/Satb2 Transcriptional Regulation Axis.” Journal of Neuroscience 32(47): 16651–65. Doeppner, Thorsten R. et al. 2019. “Zbtb20 Regulates Developmental Neurogenesis in the Olfactory Bulb and Gliogenesis After Adult Brain Injury.” Molecular Neurobiology 56(1): 567–82. Dominguez, Martin H., Albert E. Ayoub, and Pasko Rakic. 2013. “POU-III Transcription Factors (Brn1, Brn2, and Oct6) Influence Neurogenesis, Molecular Identity, and Migratory Destination of Upper-Layer Cells of the Cerebral Cortex.” Cerebral Cortex 23(11): 2632–43. Douglas, Rodney J., and Kevan A.C. Martin. 2004. “Neuronal Circuits of the Neocortex.” Annual Review of Neuroscience 27(1): 419–51. El-Brolosy, Mohamed A., and Didier Y.R. Stainier. 2017. “Genetic Compensation: A Phenomenon in Search of Mechanisms.” PLoS Genetics 13(7): 1–17. Emsley, Jason G., and Jeffrey D. Macklis. 2006. “Astroglial Heterogeneity Closely

103

Reflects the Neuronal-Defined Anatomy of the Adult Murine CNS.” Neuron Glia Biology 2(3): 175–86. Fasano, Christopher A. et al. 2009. “Bmi-1 Cooperates with Foxgl to Maintain Neural Stem Cell Self-Renewal in the Forebrain.” Genes and Development 23(5): 561–74. Fietz, Simone A. et al. 2010. “OSVZ Progenitors of Human and Ferret Neocortex Are Epithelial-like and Expand by Integrin Signaling.” Nature Neuroscience 13(6): 690– 99. Foo, Lynette C., and Joseph D. Dougherty. 2013. “Aldh1L1 Is Expressed by Postnatal Neural Stem Cells In Vivo.” Glia 61(9): 1533–41. Franco, Santos J. et al. 2011. “Reelin Regulates Cadherin Function via Dab1/Rap1 to Control Neuronal Migration and Lamination in the Neocortex.” Neuron 69(3): 482– 97. Fukuchi-Shimogori, T., and E. A. Grove. 2001. “Neocortex Patterning by the Secreted Signaling Molecute FGF8.” Science 294(5544): 1071–74. Gao, Peng et al. 2014. “Deterministic Progenitor Behavior and Unitary Production of Neurons in the Neocortex.” Cell 159(4): 775–88. García-Marqués, Jorge, and Laura López-Mascaraque. 2013. “Clonal Identity Determines Astrocyte Cortical Heterogeneity.” Cerebral Cortex 23(6): 1463–72. Garel, Sonia, Kelly J. Huffman, and John L.R. Rubenstein. 2003. “Molecular Regionalization of the Neocortex Is Disrupted in Fgf8 Hypomorphic Mutants.” Development 130(9): 1903–14. Gauthier, Andrée S. et al. 2007. “Control of CNS Cell-Fate Decisions by SHP-2 and Its Dysregulation in Noonan Syndrome.” Neuron 54(2): 245–62. Ge, Weihong et al. 2002. “Notch Signaling Promotes Astrogliogenesis via Direct CSL- Mediated Glial Gene Activation.” Journal of Neuroscience Research 69(6): 848–60. Ge, Woo Ping et al. 2012. “Local Generation of Glia Is a Major Astrocyte Source in Postnatal Cortex.” Nature 484(7394): 376–80. Goebbels, Sandra et al. 2006. “Genetic Targeting of Principal Neurons in Neocortex and Hippocampus of NEX-Cre Mice.” Wiley InterScience 44: 611–21. Gong, Shiaoching et al. 2003. “A Gene Expression Atlas of the Central Nervous System Based on Bacterial Artificial Chromosomes.” Nature 425(6961): 917–25.

104

Gorski, Jessica A. et al. 2002. “Cortical Excitatory Neurons and Glia, but Not GABAergic Neurons, Are Produced in the Emx1-Expressing Lineage.” Journal of Neuroscience 22(15): 6309–14. Götz, Magdalena, and Wieland B. Huttner. 2005. “The Cell Biology of Neurogenesis.” Nature Reviews Molecular Cell Biology 6(10): 777–88. Grandbarbe, Luc et al. 2003. “Delta-Notch Signaling Controls the Generation of Neurons/Glia from Neural Stem Cells in a Stepwise Process.” Development 130(7): 1391–1402. Gray, Paul A. et al. 2004. “Mouse Brain Organization Revealed through Direct Genome- Scale TF Expression Analysis.” Science 306(5705): 2255–57. Greig, Luciano C., Mollie B. Woodworth, Chloé Greppi, and Jeffrey D. Macklis. 2016. “Ctip1 Controls Acquisition of Sensory Area Identity and Establishment of Sensory Input Fields in the Developing Neocortex.” Neuron 90(2): 261–77. Greig, Luciano Custo et al. 2013. “Molecular Logic of Neocortical Projection Neuron Specification, Development and Diversity.” Nature Reviews Neuroscience 14(11): 755–69. Gross, Robert E. et al. 1996. “Bone Morphogenetic Proteins Promote Astroglial Lineage Commitment by Mammalian Subventricular Zone Progenitor Cells.” Neuron 17(4): 595–606. Grove, Elizabeth A. et al. 1998. “The Hem of the Embryonic Cerebral Cortex Is Defined by the Expression of Multiple Wnt Genes and Is Compromised in Gli3-Deficient Mice.” Development 125(12): 2315–25. Grove, Elizabeth A., and Tomomi Fukuchi-Shimogori. 2003. “Generating the Cerebral Cortical Area Map.” Annual Review of Neuroscience 26(1): 355–80. Gulisano, Massimo. 1996. “Emx1 and Emx2 Show Different Patterns of Expression during Proliferation and Differentiation of the Developing Cerebral Cortex in the Mouse.” European Journal of Neuroscience 8(5): 1037–50. Guo, Chao et al. 2013. “Fezf2 Expression Identifies a Multipotent Progenitor for Neocortical Projection Neurons, Astrocytes, and Oligodendrocytes.” Neuron 80(5): 1167–74. Hamasaki, Tadashi, Axel Leingärtner, Thomas Ringstedt, and Dennis D.M. O’Leary.

105

2004. “EMX2 Regulates Sizes and Positioning of the Primary Sensory and Motor Areas in Neocortex by Direct Specification of Cortical Progenitors.” Neuron 43(3): 359–72. Hanashima, Carina et al. 2004. “Foxg1 Suppresses Early Cortical Cell Fate.” Science 303(5654): 56–59. Hand, Randal et al. 2005. “Phosphorylation of Neurogenin2 Specifies the Migration Properties and the Dendritic Morphology of Pyramidal Neurons in the Neocortex.” Neuron 48(1): 45–62. Hansen, David V., Jan H. Lui, Philip R.L. Parker, and Arnold R. Kriegstein. 2010. “Neurogenic Radial Glia in the Outer Subventricular Zone of Human Neocortex.” Nature 464(7288): 554–61. Harris, Julie A. et al. 2014. “Anatomical Characterization of Cre Driver Mice for Neural Circuit Mapping and Manipulation.” Frontiers in Neural Circuits 8(JULY): 1–16. Harris, Kenneth D., and Gordon M.G. Shepherd. 2015. “The Neocortical Circuit: Themes and Variations.” Nature Neuroscience 18(2): 170–81. Harwell, Corey C. et al. 2015. “Wide Dispersion and Diversity of Clonally Related Inhibitory Interneurons.” Neuron 87(5): 999–1007. Hébert, Jean M., Yuji Mishina, and Susan K. McConnell. 2002. “BMP Signaling Is Required Locally to Pattern the Dorsal Telencephalic Midline.” Neuron 35(6): 1029– 41. Hevner, Robert F. et al. 2003. “Beyond Laminar Fate: Toward a Molecular Classification of Cortical Projection/Pyramidal Neurons.” Developmental Neuroscience 25(2–4): 139–51. Hirabayashi, Yusuke, and Yukiko Gotoh. 2010. “Epigenetic Control of Neural Precursor Cell Fate during Development.” Hoerder-Suabedissen, A, and Z Molnár. 2015. “Development, Evolution and Pathology of Neocortical Subplate Neurons.” Nature Reviews Neuroscience 16(3): 133–46. Hoerder-Suabedissen, Anna, and Zoltán Molnár. 2013. “Molecular Diversity of Early-Born Subplate Neurons.” Cerebral Cortex 23(6): 1473–83. Hutchins, B. Ian, Li Li, and Katherine Kalil. 2011. “Wnt/Calcium Signaling Mediates Axon Growth and Guidance in the Developing Corpus Callosum.” Developmental

106

Neurobiology 71(4): 269–83. Ivy, G. O., and H. P. Killackey. 1982. “Ontogenetic Changes in the Projections of Neocortical Neurons.” Journal of Neuroscience 2(6): 735–43. Jabaudon, Denis et al. 2012. “RORβ Induces Barrel-like Neuronal Clusters in the Developing Neocortex.” Cerebral Cortex 22(5): 996–1006. Jones, Kelly A. et al. 2018. “Neurodevelopmental Disorder-Associated ZBTB20 Gene Variants Affect Dendritic and Synaptic Structure.” PLoS ONE 13(10): 1–13. Kamakura, Sachiko et al. 2004. “Hes Binding to STAT3 Mediates Crosstalk between Notch and JAK-STAT Signalling.” Nature Cell Biology 6(6): 547–54. Kast, Ryan J., and Pat Levitt. 2019. “Precision in the Development of Neocortical Architecture: From Progenitors to Cortical Networks.” Progress in Neurobiology 175(January): 77–95. Keeble, Thomas R. et al. 2006. “The Wnt Receptor Ryk Is Required for Wnt5a-Mediated Axon Guidance on the Contralateral Side of the Corpus Callosum.” Journal of Neuroscience 26(21): 5840–48. Kelly, Kevin F., and Juliet M. Daniel. 2006. “POZ for Effect - POZ-ZF Transcription Factors in Cancer and Development.” Trends in Cell Biology 16(11): 578–87. Kessaris, Nicoletta et al. 2006. “Competing Waves of Oligodendrocytes in the Forebrain and Postnatal Elimination of an Embryonic Lineage.” Nature Neuroscience 9(2): 173–79. Khakh, Baljit S., and Benjamin Deneen. 2019. “The Emerging Nature of Astrocyte Diversity.” Annual Review of Neuroscience 42(1): 187–207. Kiecker, C., and C. Niehrs. 2001. “A Morphogen Gradient of Wnt/β-Catenin Signalling Regulates Anteroposterior Neural Patterning in Xenopus.” Development 128(21): 4189–4201. Koblar, S. A. et al. 1998. “Neural Precursor Differentiation into Astrocytes Requires Signaling through the Leukemia Inhibitory Factor Receptor.” Proceedings of the National Academy of Sciences of the United States of America 95(6): 3178–81. Koul, Richa. 2014. “Functional Characterization of ZBTB20 and the Role of ZBTB20- Dependent Transcription Regulation in Autism Spectrum Disorders and Intellectual Disability.” Clemson University.

107

Kowalczyk, Tom et al. 2009. “Intermediate Neuronal Progenitors (Basal Progenitors) Produce Pyramidal-Projection Neurons for All Layers of Cerebral Cortex.” Cerebral Cortex 19(10): 2439–50. Kriegstein, Arnold, and Arturo Alvarez-Buylla. 2009. “The Glial Nature of Embryonic and Adult Neural Stem Cells.” Annual review of neuroscience 32: 149–84. Kumamoto, Takuma, and Carina Hanashima. 2017. “Evolutionary Conservation and Conversion of Foxg1 Function in Brain Development.” Development Growth and Differentiation 59(4): 258–69. De La Rossa, Andres et al. 2013. “In Vivo Reprogramming of Circuit Connectivity in Postmitotic Neocortical Neurons.” Nature Neuroscience 16(2): 193–200. Lai, Tina et al. 2008. “SOX5 Controls the Sequential Generation of Distinct Corticofugal Neuron Subtypes.” Neuron 57(2): 232–47. Landeira, Bruna Soares. 2017. 01 “Eliminação de Neurônios Infragranulares Afeta a Especificação de Neurônios Granulares e Supragranulares do Córtex Cerebral em Desenvolvimento.” Universidade Federal do Rio Grande do Norte. Landeira, BS et al. 2017. “Live Imaging of Primary Cerebral Cortex Cells Using a 2D Culture System.” Journal of Visualized Experiments 2017(126): 1–14. Lauer, Simon M., Undine Schneeweiß, Michael Brecht, and Saikat Ray. 2018. “Visualization of Cortical Modules in Flattened Mammalian Cortices.” Journal of Visualized Experiments 2018(131): 1–9. Lein, Ed S. et al. 2007. “Genome-Wide Atlas of Gene Expression in the Adult Mouse Brain.” Nature 445(7124): 168–76. Leingärtner, Axel et al. 2003. “Cloning and Cortical Expression of Rat Emx2 and Adenovirus-Mediated Overexpression to Assess Its Regulation of Area-Specific Targeting of Thalamocortical Axons.” Cerebral Cortex 13(6): 648–60. De León Reyes, N. S. et al. 2019. “Transient Callosal Projections of L4 Neurons Are Eliminated for the Acquisition of Local Connectivity.” Nature Communications 10(1): 1–15. Leone, Dino P. et al. 2015. “Satb2 Regulates the Differentiation of Both Callosal and Subcerebral Projection Neurons in the Developing Cerebral Cortex.” Cerebral Cortex 25(10): 3406–19.

108

Levison, S. W., C. Chuang, B. J. Abramson, and J. E. Goldman. 1993. “The Migrational Patterns and Developmental Fates of Glial Precursors in the Rat Subventricular Zone Are Temporally Regulated.” Development 119(3): 611–22. Levison, SW, and JE Goldman. 1993. “Both Oligodendrocytes and Astrocytes Develop from Progenitors in the Subventricular Zone of Postnatal Rat Forebrain.” Neuron 10: 201–12. Leyva-Díaz, E., and G. López-Bendito. 2013. “In and out from the Cortex: Development of Major Forebrain Connections.” Neuroscience 254: 26–44. Li, Hong et al. 2013. “Laminar and Columnar Development of Barrel Cortex Relies on Thalamocortical Neurotransmission.” Neuron 79(5): 970–86. Li, Li, B. Ian Hutchins, and Katherine Kalil. 2009. “Wnt5a Induces Simultaneous Cortical Axon Outgrowth and Repulsive Axon Guidance through Distinct Signaling Mechanisms.” Journal of Neuroscience 29(18): 5873–83. Lim, Lynette et al. 2018. “Optimization of Interneuron Function by Direct Coupling of Cell Migration and Axonal Targeting.” Nature Neuroscience 21(7): 920–31. Lin, Chia Ching John et al. 2017. “Identification of Diverse Astrocyte Populations and Their Malignant Analogs.” Nature Neuroscience 20(3): 396–405. Liu, Q., N. D. Dwyer, and D. D.M. O’Leary. 2000. “Differential Expression of COUP-TFI, CHL1, and Two Novel Genes in Developing Neocortex Identified by Differential Display PCR.” Journal of Neuroscience 20(20): 7682–90. Lodato, Simona, and Paola Arlotta. 2015. “Generating Neuronal Diversity in the Mammalian Cerebral Cortex.” Annual Review of Cell and Developmental Biology 31(1): 699–720. Van Der Loos, Hendrik, and Thomas A. Woolsey. 1973. “Somatosensory Cortex: Structural Alterations Following Early Injury to Sense Organs.” Science 179(4071): 395–98. Luskin, M. B., and C. J. Shatz. 1985. “Studies of the Earliest Generated Cells of the Cat’s Visual Cortex: Cogeneration of Subplate and Marginal Zones.” Journal of Neuroscience 5(4): 1062–75. Luskin, Marla B., and Kieran McDermott. 1994. “Divergent Lineages for Oligodendrocytes and Astrocytes Originating in the Neonatal Forebrain Subventricular Zone.” Glia

109

11(3): 211–26. Mabie, Peter C, Mark F Mehler, and John A Kessler. 1999. “Multiple Roles of Bone Morphogenetic Protein Signaling in the Regulation of Cortical Cell Number and Phenotype.” The Journal of Neuroscience 19(16): 7077–88. MacDonald, Jessica L., Ryann M. Fame, Eva M. Gillis-Buck, and Jeffrey D. Macklis. 2018. “Caveolin1 Identifies a Specific Subpopulation of Cerebral Cortex Callosal Projection Neurons (CPN) Including Dual Projecting Cortical Callosal/Frontal Projection Neurons (CPN/FPN).” eNeuro 5(1): 1–17. Madisen, Linda et al. 2010. “A Robust and High-Throughput Cre Reporting and Characterization System for the Whole Mouse Brain.” Nature Neuroscience 13(1): 133–40. Magavi, Sanjay et al. 2012. “Coincident Generation of Pyramidal Neurons and Protoplasmic Astrocytes in Neocortical Columns.” Journal of Neuroscience 32(14): 4762–72. Magdaleno, Susan et al. 2006. “BGEM: An in Situ Hybridization Database of Gene Expression in the Embryonic and Adult Mouse Nervous System.” PLoS Biology 4(4): 497–500. Mallamaci, Antonello et al. 2000. “Area Identity Shifts in the Early Cerebral Cortex of Emx2(-/-) Mutant Mice.” Nature Neuroscience 3(7): 679–86. Mann, Fanny et al. 2002. “Ephrins Regulate the Formation of Terminal Axonal Arbors during the Development of Thalamocortical Projections.” Development 129(16): 3945–55. Manuel, Martine N. et al. 2011. “The Transcription Factor Foxg1 Regulates Telencephalic Progenitor Proliferation Cell Autonomously, in Part by Controlling Pax6 Expression Levels.” Neural Development. Marin-Padilla, Miguel. 1978. “Dual Origin of the Mammalian Neocortex and Evolution of the Cortical Plate.” Anatomy and Embryology 152(2): 109–26. Marques, Sueli et al. 2016. “Oligodendrocyte Heterogeneity in the Mouse Juvenile and Adult Central Nervous System.” Science 352(6291): 1326–29. Marshall, Christine A.G., and James E. Goldman. 2002. “Subpallial Dlx2-Expressing Cells Give Rise to Astrocytes and Oligodendrocytes in the Cerebral Cortex and White

110

Matter.” Journal of Neuroscience 22(22): 9821–30. Marshall, Christine A.G., Bennett G. Novitch, and James E. Goldman. 2005. “Olig2 Directs Astrocyte and Oligodendrocyte Formation in Postnatal Subventricular Zone Cells.” Journal of Neuroscience 25(32): 7289–98. Martínez-Cerdeño, Verónica et al. 2012. “Comparative Analysis of the Subventricular Zone in Rat, Ferret and Macaque: Evidence for an Outer Subventricular Zone in Rodents.” PLoS ONE 7(1). Martynoga, Ben, Harris Morrison, David J. Price, and John O. Mason. 2005. “Foxg1 Is Required for Specification of Ventral Telencephalon and Region-Specific Regulation of Dorsal Telencephalic Precursor Proliferation and Apoptosis.” Developmental Biology 283(1): 113–27. Mattioli, Francesca et al. 2016. “Novel de Novo Mutations in ZBTB20 in Primrose Syndrome with Congenital Hypothyroidism.” American Journal of Medical Genetics, Part A 170(6): 1626–29. McEvilly, Robert J. et al. 2002. “Transcriptional Regulation of Cortical Neuron Migration by POU Domain Factors.” Science 295(5559): 1528–32. Mckenna, William L et al. 2011. “Tbr1 and Fezf2 Regulate Alternate Corticofugal Neuronal Identities during Neocortical Development.” Identities 31(2): 549–64. Melzer, Sarah et al. 2017. “Distinct Corticostriatal GABAergic Neurons Modulate Striatal Output Neurons and Motor Activity.” Cell Reports 19(5): 1045–55. Menezes, J R, and M B Luskin. 1994. “Expression of Neuron-Specific Tubulin Defines a Novel Population in the Proliferative Layers of the Developing Telencephalon.” The Journal of neuroscience : the official journal of the Society for Neuroscience 14(9): 5399–5416. Meyer, Gundela et al. 1998. “Different Origins and Developmental Histories of Transient Neurons in the Marginal Zone of the Fetal and Neonatal Rat Cortex.” Journal of Comparative Neurology 397(4): 493–518. Middeldorp, J., and E. M. Hol. 2011. “GFAP in Health and Disease.” Progress in Neurobiology 93(3): 421–43. Miller, Freda D., and Andrée S. Gauthier. 2007. “Timing Is Everything: Making Neurons versus Glia in the Developing Cortex.” Neuron 54(3): 357–69.

111

Minocha, Shilpi et al. 2017. “Nkx2.1 Regulates the Generation of Telencephalic Astrocytes during Embryonic Development.” Scientific Reports 7(August 2016): 1– 20. Mitchelmore, Cathy et al. 2002. “Characterization of Two Novel Nuclear BTB/POZ Domain Zinc Finger Isoforms. Association with Differentiation of Hippocampal Neurons, Cerebellar Granule Cells, and Macroglia.” Journal of Biological Chemistry 277(9): 7598–7609. Miyashita-Lin, Emily M. et al. 1999. “Early Neocortical Regionalization in the Absence of Thalamic Innervation.” Science 285(5429): 906–9. Miyata, Takaki et al. 2004. “Asymmetric Production of Surface-Dividing and Non-Surface- Dividing Cortical Progenitor Cells.” Development 131(13): 3133–45. Miyata, Takaki, Ayano Kawaguchi, Hideyuki Okano, and Masaharu Ogawa. 2001. “Asymmetric Inheritance of Radial Glial Fibers by Cortical Neurons.” Neuron 31(5): 727–41. Miyoshi, Goichi et al. 2010. “Genetic Fate Mapping Reveals That the Caudal Ganglionic Eminence Produces a Large and Diverse Population of Superficial Cortical Interneurons.” Journal of Neuroscience 30(5): 1582–94. Miyoshi, Goichi, Simon J.B. Butt, Hirohide Takebayashi, and Gord Fishell. 2007. “Physiologically Distinct Temporal Cohorts of Cortical Interneurons Arise from Telencephalic Olig2-Expressing Precursors.” Journal of Neuroscience 27(29): 7786– 98. Molyneaux, BJ et al. 2015. “DeCoN: Genome-Wide Analysis of Invivo Transcriptional Dynamics during Pyramidal Neuron Fate Selection in Neocortex.” Neuron 85(2): 275–88. Molyneaux, Bradley J. et al. 2005. “Fezl Is Required for the Birth and Specification of Corticospinal Motor Neurons.” Neuron 47(6): 817–31. Molyneaux, Bradley J., Paola Arlotta, Joao R.L. Menezes, and Jeffrey D. Macklis. 2007. “Neuronal Subtype Specification in the Cerebral Cortex.” Nature Reviews Neuroscience 8(6): 427–37. Moreno-Juan, Verónica et al. 2017. “Prenatal Thalamic Waves Regulate Cortical Area Size Prior to Sensory Processing.” Nature Communications 8.

112

Mulatinho, Milene, Jessica Tenney, Eric Vilain, and Fabiola Quintero-Rivera. 2016. “Microdeletion of ZBTB20 Results in a Phenotype Overlapping With That of the Microdeletion 3q13.31 Syndrome.” Cancer Genetics 209(5): 244–45. Nagao, M., M. Sugimori, and M. Nakafuku. 2007. “Cross Talk between Notch and Growth Factor/Cytokine Signaling Pathways in Neural Stem Cells.” Molecular and Cellular Biology 27(11): 3982–94. Nagao, Motoshi, Toru Ogata, Yasuhiro Sawada, and Yukiko Gotoh. 2016. “Zbtb20 Promotes Astrocytogenesis during Neocortical Development.” Nature Communications 7: 1–14. Naka, Hayato, Shiho Nakamura, Takuya Shimazaki, and Hideyuki Okano. 2008. “Requirement for COUP-TFI and II in the Temporal Specification of Neural Stem Cells in CNS Development.” Nature Neuroscience 11(9): 1014–23. Nakagawa, Yasushi, Jane E. Johnson, and Dennis D.M. O’Leary. 1999. “Graded and Areal Expression Patterns of Regulatory Genes and Cadherins in Embryonic Neocortex Independent of Thalamocortical Input.” Journal of Neuroscience 19(24): 10877–85. Nakashima, K et al. 2001. “BMP2-Mediated Alteration in the Developmental Pathway of Fetal Mouse Brain Cells from Neurogenesis to Astrocytogenesis.” Proceedings of the National Academy of Sciences of the United States of America 98(10): 5868–73. Nakashima, Kinichi et al. 1999. “Synergistic Signaling in Fetal Brain by STAT3-Smad1 Complex Bridged by P300.” Science 284(5413): 479–82. Namihira, Masakazu et al. 2009. “Committed Neuronal Precursors Confer Astrocytic Potential on Residual Neural Precursor Cells.” Developmental Cell 16(2): 245–55. Nielsen, Jacob V. et al. 2007. “Hippocampus-like Corticoneurogenesis Induced by Two Isoforms of the BTB-Zinc Finger Gene Zbtb20 in Mice.” Development 134(6): 1133– 40. Nielsen, Jakob V. et al. 2014. “Zbtb20 Defines a Hippocampal Neuronal Identity through Direct Repression of Genes That Control Projection Neuron Development in the Isocortex.” Cerebral Cortex 24(5): 1216–29. Nielsen, Jakob V., Jonas B. Blom, Jens Noraberg, and Niels A. Jensen. 2010. “Zbtb20- Induced CA1 Pyramidal Neuron Development and Area Enlargement in the Cerebral

113

Midline Cortex of Mice.” Cerebral Cortex 20(8): 1904–14. Nieto, Marta et al. 2004. “Expression of Cux-1 and Cux-2 in the Subventricular Zone and Upper Layers II-IV of the Cerebral Cortex.” Journal of Comparative Neurology 479(2): 168–80. Nieto, Marta, Carol Schuurmans, Olivier Britz, and FranÇois Guillemot. 2001. “Neural BHLH Genes Control the Neuronal versus Glial Fate Decision in Cortical Progenitors.” Neuron 29(2): 401–13. Noctor, Stephen C. et al. 2001. “Neurons Derived from Radial Glial Cells Establish Radial Units in Neocortex.” Nature 409(6821): 714–20. Noctor, Stephen C., Verónica Martinez-Cerdeño, Lidija Ivic, and Arnold R. Kriegstein. 2004. “Cortical Neurons Arise in Symmetric and Asymmetric Division Zones and Migrate through Specific Phases.” Nature Neuroscience 7(2): 136–44. Nordström, Ulrika, Thomas M. Jessell, and Thomas Edlund. 2002. “Progressive Induction of Caudal Neural Character by Graded Wnt Signaling.” Nature Neuroscience 5(6): 525–32. O’Leary, Dennis D.M. 1989. “Do Cortical Areas Emerge from a Protocortex?” Trends in Neurosciences 12(10): 400–406. O’Leary, Dennis D.M., Naomi L. Ruff, and Richard H. Dyck. 1994. “Development, Critical Period Plasticity, and Adult Reorganizations of Mammalian Somatosensory Systems.” Current Opinion in Neurobiology 4(4): 535–44. Ochiai, Wataru et al. 2001. “Astrocyte Differentiation of Fetal Neuroepithelial Cells Involving Cardiotrophin-1-Induced Activation of STAT3.” Cytokine 14(5): 264–71. Ohtaka-Maruyama, Chiaki et al. 2018. “Synaptic Transmission from Subplate Neurons Controls Radial Migration of Neocortical Neurons.” Science 360(6386): 313–17. Oishi, Koji, Michihiko Aramaki, and Kazunori Nakajima. 2016. “Mutually Repressive Interaction between Brn1/2 and Rorb Contributes to the Establishment of Neocortical Layer 2/3 and Layer 4.” Proceedings of the National Academy of Sciences of the United States of America 113(12): 3371–76. Parthasarathy, Srinivas, Swathi Srivatsa, Anjana Nityanandam, and Victor Tarabykin. 2014. “Ntf3 Acts Downstream of Sip1 in Cortical Postmitotic Neurons to Control Progenitor Cell Fate through Feedback Signaling.” Development (Cambridge)

114

141(17): 3324–30. Pilaz, Louis Jan et al. 2009. “Forced G1-Phase Reduction Alters Mode of Division, Neuron Number, and Laminar Phenotype in the Cerebral Cortex.” Proceedings of the National Academy of Sciences of the United States of America 106(51): 21924–29. Pouchelon, Gabrielle et al. 2014. “Modality-Specific Thalamocortical Inputs Instruct the Identity of Postsynaptic L4 Neurons.” Nature 511(7510): 471–74. Price, David J., Samina Aslam, Laura Tasker, and Katy Gillies. 1997. “Fates of the Earliest Generated Cells in the Developing Murine Neocortex.” Journal of Comparative Neurology 377(3): 414–22. Qian, Xueming et al. 2000. “Timing of CNS Cell Generation: A Programmed Sequence of Neuron and Glial Cell Production from Isolated Murine Cortical Stem Cells.” Neuron 28(1): 69–80. Raedler, Elisabeth, and Andreas Raedler. 1978. “Autoradiographic Study of Early Neurogenesis in Rat Neocortex.” Anatomy and Embryology 154(3): 267–84. Rakic, Pasko. 1981. “Development of Visual Centers in the Primate Brain Depends on Binocular Competition before Birth.” Science 214(4523): 928–31. Rakic, Pasko. 1972. “Mode of Cell Migration to the Superficial Layers of Fetal Monkey Neocortex.” Journal of Comparative Neurology 145(1): 61–83. Rakin, Pasko. 1988. “Specification of Cerebral Cortical Areas.” Science 241: 170–76. Rakic, Pasko, Ivan Suñer, and Robert W. Williams. 1991. “A Novel Cytoarchitectonic Area Induced Experimentally within the Primate Visual Cortex.” Proceedings of the National Academy of Sciences of the United States of America 88(6): 2083–87. Raponi, Eric et al. 2007. “S100B Expression Defines a State in Which GFAP- Expressing Cells Lose Their Neural Stem Cell Potential and Acquire a More Mature Developmental Stage.” Glia 55(14): 165–77. Rasmussen, Malene B. et al. 2014. “Neurodevelopmental Disorders Associated with Dosage Imbalance of ZBTB20 Correlate with the Morbidity Spectrum of ZBTB20 Candidate Target Genes.” Journal of Medical Genetics 51(9): 605–13. Regan, Melissa R. et al. 2007. “Variations in Promoter Activity Reveal a Differential Expression and Physiology of Glutamate Transporters by Glia in the Developing and Mature CNS.” Journal of Neuroscience 27(25): 6607–19.

115

Ren, Anjing et al. 2012. “Regulation of Hippocampus-Dependent Memory by the Zinc Finger Protein Zbtb20 in Mature CA1 Neurons.” Journal of Physiology 590(19): 4917–32. Rodríguez, Carolyn I. et al. 2000. “High-Efficiency Deleter Mice Show That FLPe Is an Alternative to Cre- LoxP.” Nature Genetics 25(2): 139–40. Rosenberg, Alexander B. et al. 2018. “Single-Cell Profiling of the Developing Mouse Brain and Spinal Cord with Split-Pool Barcoding.” Science 360(6385): 176–82. Rosenthal, E. 2010. “Transcription Factor {Zbtb}20 Controls Regional Specification of Mammalian Archicortex.” Rosenthal, Eva H., Anton B. Tonchev, Anastassia Stoykova, and Kamal Chowdhury. 2012. “Regulation of Archicortical Arealization by the Transcription Factor Zbtb20.” Hippocampus 22(11): 2144–56. Roth, Bryan L. 2016. “DREADDs for Neuroscientists.” Neuron 89(4): 683–94. Rothstein, Jeffrey D. et al. 1994. “Localization of Neuronal and Glial Glutamate Transporters.” Neuron 13(3): 713–25. Rouaux, Caroline, and Paola Arlotta. 2013. “Direct Lineage Reprogramming of Post- Mitotic Callosal Neurons into Corticofugal Neurons in Vivo.” Nature Cell Biology 15(2): 214–21. Rowitch, David H., and Arnold R. Kriegstein. 2010. “Developmental Genetics of Vertebrate Glial-Cell Specification.” Nature 468(7321): 214–22. Rubenstein, John L.R., and Pasko Rakic. 1999. “Genetic Control of Cortical Development.” Cerebral Cortex 9(6): 521–523. Sahara, Setsuko, Yasuhiko Kawakami, Juan Carlos Izpisua Belmonte, and Dennis D.M. O’Leary. 2007. “Sp8 Exhibits Reciprocal Induction with Fgf8 but Has an Opposing Effect on Anterior-Posterior Cortical Area Patterning.” Neural Development 2(1): 1– 22. Saito, Tetsuichiro, and Norio Nakatsuji. 2001. “Efficient Gene Transfer into the Embryonic Mouse Brain Using in Vivo Electroporation.” Developmental Biology 240(1): 237–46. Sardi, S. Pablo et al. 2006. “Presenilin-Dependent ErbB4 Nuclear Signaling Regulates the Timing of Astrogenesis in the Developing Brain.” Cell 127(1): 185–97. Schitine, Clarissa, Luciana Nogaroli, Marcos R. Costa, and Cecilia Hedin-Pereira. 2015.

116

“Astrocyte Heterogeneity in the Brain: From Development to Disease.” Frontiers in Cellular Neuroscience 9(March): 1–11. Schmechel, DE, and Pasko Rakic. 1979. “A Golgi Study of Radial Glial Cells in Developing Monkey Telencephalon: Morphogenesis and Transformation into Astrocytes.” Anat Embryol (Berl). 156(2): 115–52. Schmid, Ralf S. et al. 2003. “Neuregulin 1-ErbB2 Signaling Is Required for the Establishment of Radial Glia and Their Transformation into Astrocytes in Cerebral Cortex.” Proceedings of the National Academy of Sciences of the United States of America 100(7): 4251–56. Sessa, Alessandro et al. 2008. “Tbr2 Directs Conversion of Radial Glia into Basal Precursors and Guides Neuronal Amplification by Indirect Neurogenesis in the Developing Neocortex.” Neuron 60(1): 56–69. Seuntjens, Eve et al. 2009. “Sip1 Regulates Sequential Fate Decisions by Feedback Signaling from Postmitotic Neurons to Progenitors.” Nature Neuroscience 12(11): 1373–80. Shen, Qin et al. 2006. “The Timing of Cortical Neurogenesis Is Encoded within Lineages of Individual Progenitor Cells.” Nature Neuroscience 9(6): 743–51. Shimogori, Tomomi, and Elizabeth A. Grove. 2005. “Fibroblast Growth Factor 8 Regulates Neocortical Guidance of Area-Specific Thalamic Innervation.” Journal of Neuroscience 25(28): 6550–60. Siggs, Owen M, and Bruce Beutler. 2012. “The BTB-ZF Transcription Factors.” 11(18): 3358–69. Song, Mi Ryoung, and Anirvan Ghosh. 2004. “FGF2-Induced Chromatin Remodeling Regulates CNTF-Mediated Gene Expression and Astrocyte Differentiation.” Nature Neuroscience 7(3): 229–35. Spassky, Nathalie et al. 2005. “Adult Ependymal Cells Are Postmitotic and Are Derived from Radial Glial Cells during Embryogenesis.” Journal of Neuroscience 25(1): 10– 18. Srinivasan, Karpagam et al. 2012. “A Network of Genetic Repression and Derepression Specifies Projection Fates in the Developing Neocortex.” Proceedings of the National Academy of Sciences of the United States of America 109(47): 19071–78.

117

Stipursky, Joice et al. 2014. “TGF-Β1 Promotes Promotes Cerebral Cortex Radial Glia- Astrocyte Differentiation in Vivo.” Frontiers in Cellular Neuroscience 8(November): 1–13. Stipursky, Joice, Daniel Francis, and Flávia Carvalho Alcantara Gomes. 2012. “Activation of MAPK/PI3K/SMAD Pathways by TGF-Β1 Controls Differentiation of Radial Glia into Astrocytes in Vitro.” Developmental Neuroscience 34(1): 68–81. Sugitani, Yoshinobu et al. 2002. “Brn-1 and Brn-2 Share Crucial Roles in the Production and Positioning of Mouse Neocortical Neurons.” Genes and Development 16(14): 1760–65. Sun, Wei et al. 2017. “SOX9 Is an Astrocyte-Specific Nuclear Marker in the Adult Brain Outside the Neurogenic Regions.” Journal of Neuroscience 37(17): 4493–4507. Takahashi, Takao. 1995. “The Cell Cycle of the Pseudostratified Embryonic Murine Cerebral Wall.” J. Neurosci. 15(September): 6046–57. Takiguchi-Hayashi, Keiko et al. 2004. “Generation of Reelin-Positive Marginal Zone Cells from the Caudomedial Wall of Telencephalic Vesicles.” Journal of Neuroscience 24(9): 2286–95. Takizawa, Takumi et al. 2001. “DNA Methylation Is a Critical Cell-Intrinsic Determinant of Astrocyte Differentiation in the Fetal Brain.” Developmental Cell 1(6): 749–58. Tamamaki, Nobuaki, and Ryohei Tomioka. 2010. “Long-Range GABAergic Connections Distributed throughout the Neocortex and Their Possible Function.” Frontiers in Neuroscience 4(DEC): 1–8. Toma, Kenichi et al. 2014. “The Timing of Upper-Layer Neurogenesis Is Conferred by Sequential Derepression and Negative Feedback from Deep-Layer Neurons.” Journal of Neuroscience 34(39): 13259–76. Tomita, Koichi et al. 2000. “Mammalian Achaete–Scute and Atonal Homologs Regulate Neuronal versus Glial Fate Determination in the Central Nervous System.” The EMBO journal 19(20): 5460–72. files/146/tomita 2000.pdf. Tonchev, Anton B. et al. 2016. “Zbtb20 Modulates the Sequential Generation of Neuronal Layers in Developing Cortex.” Molecular Brain 9(1): 1–15. Urban, Daniel J., and Bryan L. Roth. 2015. “DREADDs (Designer Receptors Exclusively Activated by Designer Drugs): Chemogenetic Tools with Therapeutic Utility.” Annual

118

Review of Pharmacology and Toxicology 55(1): 399–417. Uziel, Daniela, Sven Mühlfriedel, and Jürgen Bolz. 2008. “Ephrin-A5 Promotes the Formation of Terminal Thalamocortical Arbors.” NeuroReport 19(8): 877–81. Visel, A. 2004. “GenePaint.Org: An Atlas of Gene Expression Patterns in the Mouse Embryo.” Nucleic Acids Research 32(90001): 552D – 556. Vitali, Ilaria et al. 2018. “Progenitor Hyperpolarization Regulates the Sequential Generation of Neuronal Subtypes in the Developing Neocortex.” Cell 174(5): 1264- 1276.e15. Voigt, Thomas. 1989. “Development of Glial Cells in the Cerebral Wall of Ferrets: Direct Tracing of Their Transformation from Radial Glia into Astrocytes.” Journal of Comparative Neurology 289(1): 74–88. Waclaw, Ronald R. et al. 2006. “The Zinc Finger Transcription Factor Sp8 Regulates the Generation and Diversity of Olfactory Bulb Interneurons.” Neuron 49(4): 503–16. Walther, C., and P. Gruss. 1991. “Pax-6, a Murine Paired Box Gene, Is Expressed in the Developing CNS.” Development 113(4): 1435–50. Wang, Congmin et al. 2011. “Identification and Characterization of Neuroblasts in the Subventricular Zone and Rostral Migratory Stream of the Adult Human Brain.” Cell Research 21(11): 1534–50. Wang, Doris D., and Angélique Bordey. 2008. “The Astrocyte Odyssey.” Progress in Neurobiology 86(4): 342–67. Wang, Xiuyun, Runxiang Qiu, Walter Tsark, and Qiang Lu. 2007. “Rapid Promoter Analysis in Developing Mouse Brain and Genetic Labeling of Young Neurons by Doublecortin-DsRed-Express.” Journal of neuroscience research 85(16): 3567–73. Wise, S. P., and E. G. Jones. 1978. “Developmental Studies of Thalamocortical and Commissural Connections in the Rat Somatic Sensory Cortex.” Journal of Comparative Neurology 178(2): 187–208. Wong-Riley, M. 1979. “Changes in the Visual System of Monocularly Sutured or Enucleated Cats Demonstrable with Cytochrome Oxidase Histochemistry.” Brain Research 171: 11–28. Woolsey, Thomas A., and Hendrik Van der Loos. 1970. “The Structural Organization of Layer IV in the Somatosensory Region (S I) of Mouse Cerebral Cortex. The

119

Description of a Cortical Field Composed of Discrete Cytoarchitectonic Units.” Brain Research 17(2): 205–42. Wu, Sheng Xi et al. 2005. “Pyramidal Neurons of Upper Cortical Layers Generated by NEX-Positive Progenitor Cells in the Subventricular Zone.” Proceedings of the National Academy of Sciences of the United States of America 102(47): 17172–77. Wuttke, Thomas V. et al. 2018. “Developmentally Primed Cortical Neurons Maintain Fidelity of Differentiation and Establish Appropriate Functional Connectivity after Transplantation.” Nature Neuroscience 21(4): 517–29. Xie, Zhifang et al. 2010. “Zbtb20 Is Essential for the Specification of CA1 Field Identity in the Developing Hippocampus.” Proceedings of the National Academy of Sciences of the United States of America 107(14): 6510–15. Xuan, Shouhong et al. 1995. “Winged Helix Transcription Factor BF-1 Is Essential for the Development of the Cerebral Hemispheres.” Neuron 14(6): 1141–52. Zeisel, A et al. 2018. “Molecular Architecture of the Mouse Nervous System.” Cell 174(4): 999-1014.e22. Zeisel, Amit et al. 2015. “Cell Types in the Mouse Cortex and Hippocampus Revealed by Single-Cell RNA-Seq.” Science 347(6226): 1138–42. Zeng, Hongkui, and Joshua R. Sanes. 2017. “Neuronal Cell-Type Classification: Challenges, Opportunities and the Path Forward.” Nature Reviews Neuroscience 18(9): 530–46. Zerlin, Marielba, Steven W. Levison, and James E. Goldman. 1995. “Early Patterns of Migration, Morphogenesis, and Intermediate Filament Expression of Subventricular Zone Cells in the Postnatal Rat Forebrain.” Journal of Neuroscience 15(11): 7238– 49. Zhou, C., S. Y. Tsai, and M. J. Tsai. 2001. “COUP-TFI: An Intrinsic Factor for Early Regionalization of the Neocortex.” Genes and Development 15(16): 2054–59.

120

LIST OF SCIENTIFIC PAPERS

1. Araújo, Jéssica AM; Gil-Sanz, Cristina; Chang, Yi-Ting; Marques-Coelho, Diego; Espinosa, Ana; Wang, Liyuan; O'Connor, Daniel; Costa, Marcos R*; Müller, Ulrich*. Function of Zbtb20 in the Development of the Cerebral Cortex. Manuscript in preparation

Scientific papers not included in this thesis

2. Landeira, Bruna S*; Santana, Themis TS*; Araújo, Jéssica AM.; Tabet, Elie I; Tannous, Bakhos A; Schroeder, Timm; Costa, Marcos R. Activity-Independent Effects of CREB on Neuronal Survival and Differentiation during Mouse Cerebral Cortex Development. Cerebral Cortex, 2016; 1–11. 10.1093/cercor/bhw387. 3. Landeira, Bruna S; Araújo, Jéssica AM; Schroeder, Timm; Müller, Ulrich; Costa, Marcos. Live Imaging of Primary Cerebral Cortex Cells Using a 2D Culture System. Journal of Visualized Experiments, 2017. 10.3791/56063. 4. Araújo, Jéssica AM; Hilscher, Markus M; Marques-Coelho, Diego; Golbert, Daiane CF; Cornelio, Deborah A; Batistuzzo de Medeiros, Silvia R; Leão, Richardson N; Costa, Marcos R. Direct Reprogramming of Adult Human Somatic Stem Cells into Functional Neurons Using Sox2, Ascl1, and Neurog2. Front. Cell. Neurosci. 2018; 12:155. doi: 10.3389/fncel.2018.00155 5. Araújo, Jéssica AM; Costa, Marcos R; Marques-Coelho D; Cannon, Gabrielle H; Goff, Loyal A; Gil-Sanz, Cristina*; Müller, Ulrich*. Identification of Subpopulations of Radial Glia Cell in the Mammalian Cerebral Cortex. Manuscript in preparation

*These authors contributed equally to this work.

121

LIST OF ABBREVIATIONS

ACTB - actin beta promoter Aebp2 - adipocyte enhancer-binding protein 2 ALDH1L1 - aldehyde dehydrogenase 1 family member l1 BAC - bacterial artificial chromosome bHLH - basic helix-loop-helix BrdU - bromodeoxyuridine Brn2 - brain-2 BTB - broad-complex, tramtrack and bric a brac C - Celsius CA - Cornu Ammonis cDNA - complementary DNA CIP - calf intestine alkaline phosphatase cKO - conditional knockout CMV - cytomegalovirus CO - cytochrome c oxidase CSD - current source density Ctbp2 - C-terminal-binding protein 2 Ctip2 - COUP-TF-interacting protein 2 Cux1 - cut like homeobox 1 DAPI - 4′,6-diamidino-2-phenylindole DCX - doublecortin DMEM - dulbecco modified eagle's medium DN - dominant negative mutations DNA - deoxyribonucleic acid dNTP - deoxyribonucleotide triphosphate E - embryonic day EMX1 - empty spiracles homeobox 1 ES - embryonic stem EtOH - ethyl alcohol

122

Etv5 - ETS translocation variant 5 EUCOMM - European Conditional Mouse Mutagenesis Program F1 - first filial generation FBS - fetal bovine serum FLOX - flanked by LoxP sites FLP - flippase FRT - flippase recognition target sites GFAP - glial fibrillary acidic protein GFP - green fluorescent protein HBSS - Hanks' Balanced Salt Solution IACUC - Institutional Animal Care and Use Committee IBA1 - ionized calcium binding adaptor molecule 1 IRES - internal ribosome entry site KLF15 - Krüppel like factor 15 KO - knockout L - layer LacZ - β-galactosidase LB - lysogeny broth LFP - local field potentials mRFP - monomeric red fluorescent proteins MZ - marginal zone NEO - neomycin resistance gene NeuN - neuronal nuclei NEX - neuronal basic helix-loop-helix proteins NGS - normal goat serum NLS - N-terminal nuclear localization sequence P - postnatal day p - promoter p value - probability value PAX6 - paired box protein PB - piggyback

123

PBS - phosphate-buffered saline pCAG - chicken beta-actin promoter PCR - polymerase chain reaction PFA - paraformaldehyde PGK - phosphoglycerate kinase I promoter PMBSF - posterior medial barrel subfield RNA - ribonucleic acid RORβ - RAR-related orphan receptor beta RT-qPCR - real-time quantitative PCR S1 - primary somatosensory cortex S100β - calcium-binding protein beta S2 - secondary somatosensory cortex Satb2 - special AT-rich sequence-binding protein 2 SD - standard deviation SEM - standard error of the mean SOX - sex-determining region Y (Sry)-related HMG box SVZ - subventricular zone Taq - Thermus aquaticus TBR2 - T-box brain protein 2 TE - Tris-EDTA TF - transcription factor TLE4 - transducin-like enhancer of split 4 TUJ1 - class III beta-tubulin V1 - primary visual cortex VGLUT2 - vesicular glutamate transporter 2 VZ - ventricular zone WT - wild-type YPet - yellow fluorescent protein Zbtb - zinc finger and BTB domain containing ZF - zinc finger Zhx2 - zinc fingers and homeoboxes protein 2

124

LIST OF FIGURES

Figure 1 Representation of the morphological diversity of glia cells and neurons in the human cerebral cortex documented by Santiago Ramón y Cajal (1852–1934)...... 5 Figure 2 Multiple progenitor zones contribute to the cellular diversity found in the neocortex...... 6 Figure 3 Morphogens spatially pattern the mouse telencephalon...... 7 Figure 4 Transcription factors establish an area identity map...... 8 Figure 5 Neocortical projection neurons are generated in an ‘inside-out’ fashion...... 10 Figure 6 Sequential generation of neocortical projection neuron subtypes...... 12 Figure 7 Molecular programs direct subtype identity of postmitotic projection neurons...... 14 Figure 8 Zbtb20 dominant negative mutations described in patients with Primrose syndrome by Cordeddu and colleagues (2014)...... 26 Figure 9 Genes upregulated during the generation of upper layer neurons and the onset of gliogenesis...... 38 Figure 10 Overexpression of Klf15 induces astrogliogenesis in the developing forebrain. Schematic illustration of the experimental procedure...... 39 Figure 11 Overexpression of Zbtb20 induces astrogliogenesis in the developing forebrain. Schematic illustration of the experimental procedure...... 40 Figure 12 ZBTB20 protein expression in progenitor cells at the time of upper layer neuron and astroglial cell generation...... 41 Figure 13 Expression of Aldh1l1 in the dorsal telencephalon correlates with the onset of gliogenesis...... 42 Figure 14 ZBTB20 expression in astrocytes in the cortex, hippocampus, and cerebellum...... 43 Figure 15 ZBTB20 is expressed in hippocampal neurons, and absent in the adult cerebral cortex...... 44 Figure 16 ZBTB20 is transiently expressed in a subset of layer II/III neurons in the cerebral cortex during post-natal development...... 45

125

Figure 17 CRE recombination efficiency and ZBTB20 overexpression in the developing neocortex...... 46 Figure 18 ZBTB20 overexpression enhances the generation of astrocytes in the developing neocortex...... 47 Figure 19 ZBTB20 dominant negative mutation doesn’t affect generation of astrocytes in the developing neocortex at E14.5...... 48 Figure 20 ZBTB20 dominant negative mutation impairs astrocytes generation in the developing neocortex at E16.5...... 49 Figure 21 ZBTB20 overexpression doesn’t affect generation of astrocytes in the developing neocortex at E16.5...... 50 Figure 22 Cellular mechanism underlying Zbtb20 function in the developing neocortex at E16.5...... 51 Figure 23 Specific deletion of ZBTB20 in the dorsal telencephalon...... 53 Figure 24 Progenitor cells and immature neurons develop normally in Zbtb20 conditional knockout (cKO)...... 54 Figure 25 Glia progenitor cells develop normally in Zbtb20 conditional knockout (cKO)...... 55 Figure 26 Astrocytes develop normally in Zbtb20 conditional knockout (cKO)...... 56 Figure 27 GFAP expression is upregulated throughout the entire extension of the cortex in Zbtb20 conditional knockout (cKO)...... 57 Figure 28 Microglia cells develop normally in Zbtb20 conditional knockout (cKO)...... 58 Figure 29 Expression of Zbtb family members and our candidate genes involved in the onset of gliogenesis...... 60 Figure 30 Zbtb20 overexpression in neocortical progenitors/post-mitotic neurons at mid- neurogenesis leads to a premature generation of CPNs...... 62 Figure 31 Zbtb20 overexpression in neocortical progenitors/post-mitotic neurons at mid- neurogenesis leads to a premature generation of CPNs without affecting total number of neurons...... 63 Figure 32 Conditional genetic deletion of Zbtb20 in progenitors leads to laminar disorganization of the neocortex...... 65

126

Figure 33 Conditional genetic deletion of Zbtb20 in progenitors leads to migration defects in the neocortex...... 66 Figure 34 Conditional genetic deletion of Zbtb20 in progenitors leads to laminar disorganization of the neocortex...... 67 Figure 35 Conditional genetic deletion of Zbtb20 in progenitors doesn’t affect deep layer neurons of the neocortex...... 68 Figure 36 Conditional genetic deletion of Zbtb20 in progenitors leads to laminar disorganization of the neocortex...... 69 Figure 37 Conditional genetic deletion of Zbtb20 in progenitors leads to barrel expansion in the primary somatosensory cortex...... 71 Figure 38 Conditional genetic deletion of Zbtb20 in progenitors leads to barrel expansion in the primary somatosensory cortex...... 72 Figure 39 In vivo electrophysiological recordings in the barrel cortex of Zbtb20cKO mice...... 73 Figure 40 In vivo electrophysiological recordings in the barrel cortex of Zbtb20cKO. ... 74 Figure 41 Normal gross morphology of the corpus callosum of upper layer neurons in Zbtb20cKO mice...... 76 Figure 42 Interhemispheric connection of upper layer CPNs is compromised in Zbtb20cKO mice...... 77 Figure 43 Ectopic fibers of upper layer CPNs in Zbtb20cKO mice. Schematic illustration of the experimental procedure...... 78 Figure 44 Interhemispheric connection of deep layer CPNs is not affected in Emx1- Cre/Zbtb20fl/fl mice...... 79 Figure 45 CRE recombination efficiency and ZBTB20 expression in the developing neocortex of Zbtb20fl/fl mice...... 81 Figure 46 Cell autonomous and cell extrinsic effect of Zbtb20 in the axonal arborization of upper layer CPNs...... 82 Figure 47 Specific deletion of ZBTB20 in postmitotic neurons of the dorsal telencephalon...... 84 Figure 48 Cortical laminar organization of Zbtb20fl/fl;Nex-Cre mice...... 85

127

Figure 49 Conditional genetic deletion of Zbtb20 in post-mitotic neurons impairs CPN differentiation...... 86 Figure 50 Conditional genetic deletion of Zbtb20 post-mitotic neurons doesn’t affect deep layer neurons of the neocortex...... 87 Figure 51 Interhemispheric connection of upper layer CPNs is compromised in Nex- Cre/Zbtb20fl/fl mice...... 88

128

LIST OF TABLES

Table 1 Genotyping primer list ...... 130 Table 2 Conditions for Electroporation at Different Stages ...... 131 Table 3 Conditions for Vibratome at Different Stages ...... 131 Table 4 Antibodies information ...... 132 Table 5 RT-qPCR primers list ...... 133 Table 6 Primers for cloning ...... 135 Table 7 Role of Zbtb20 in the neocortex ...... 137

129

TABLES

Table 1 Genotyping primer list Mouse strain Sequence 5’-3’ Amplicon (bp) Aldh1l1-GFP CCTCTGGCTGCTCCTTCAACAG Mutant 300 GGTCGGGGTAGCGGCTGAA ZBTB20flox/flox* ATACAGAAGCAGCCAGAAAGTGGG Mutant 280

AGTGAGGCAAATACAAGACAGGGC Wildtype 507

CAACGGGTTCTTCTGTTAGTCC ZBTB20flox/flox CACCTTTACTGCACAGCTGCCAGC Mutant 344

TGAACTGATGGCGAGCTCAGACC Nex-CRE* GAGTCCTGGAATCAGTCTTTTTC Wildtype 770

AGAATGTGGAGTAGGGTGAC Mutant 525 CCGCATAACCAGTGAAACAG Ai9* CTCTGCTGCCTCCTGGCTTCT Wildtype 330 CGAGGCGGATCACAAGCAATA Mutant 250 TCAATGGGCGGGGGTCGTT FLPe CCCATTCCATGCGGGGTATCG Mutant 760

GCATCTGGGAGATCACTGAG Emx1-CRE* GCGGTCTGGCAGTAA AAACTATC Mutant 102 GTGAAACAGCATTGCTGTCACTT Wildtype 378

AAGGTGTGGTTCCAGAATCG CTCTCCACCAGAAGGCTGAG Emx1-CRE and GACATGTTCAGGGATCGCCAGGCG Mutant 597 DCX-Cre GACGGAAATCCATCGCTCGACCAG *The PCR protocol allows distinguishing among the genotypes of wildtype, heterozygous and homozygous mutant samples.

130

Table 2 Conditions for Electroporation at Different Stages Embryonic stage Diameter electrode (mm) Voltage (V) Duration (ms) E12.5 3 30 50 E13.5 3 35 50 E14.5 5 45 75 E15.5 5 50 80 E16.5 5 50 80 Five electric pulses were delivered at a rate of one pulse per 950 ms for all embryonic stages.

Table 3 Conditions for Vibratome at Different Stages Stage Fixation Speed (mm/s) Amplitude (mm) Thickness with 4% PFA (µm) Embryonic None* 0.34 0.65 300 Embryonic 4-8 hours 0.60 0.60 100 Post-natal overnight 0.60 0.60 100 Adult overnight 0.80 0.50 50 or 100 *Live tissue was used for cell culture experiments.

131

Table 4 Antibodies information Antigen Host Company Catalog # Working Dilution BrdU* Rat Abcam AB6326 1:500 Brn2 Rabbit Thermo Scientific PA530124 1:1000 Calbindin Mouse Swant CB300 1:4000 Calretinin Rabbit Millipore AB5054 1:5000 Cre Mouse Millipore MAB3120 1:100 Cre Rabbit Cell Signaling 12830 1:500 Ctip2 Rat Abcam AB18465 1:1000 or 1:500 Cux1 Rabbit Proteintech 11733-1-AP 1:1000 Cux1 Rabbit Santa cruz sc-13024 1:1000 GFAP Rabbit Dako Z0334 1:2000 Iba1 Rabbit Wako 019-19741 1:1000 Map2 Rabbit Halpain Lab 1:2000 mCherry Goat Sicgen AB0040-200 1:500 NeuN Mouse Millipore MAB377 1:250 or 1:500 Olig2 Rabbit Millipore AB9610 1:1000 Olig2 Goat R&D Systems AF2418 1:200 Pax6 Mouse Thermo Scientific MA1-109 1:500 Pax6 Rabbit Covance/Biolegend PRB-278P/901301 1:500 RFP Rabbit Chemicon AB3216 1:500 RFP Rabbit Abcam AB62341 1:200 RORβ* Mouse Perseus Proteomics PP-H3925-00 1:1000 RORβ* Mouse Perseus Proteomics PP-N7927-00 1:1000 S100 Rabbit Dako Z0311 1:500 S100β Rabbit Abcam AB52642 1:500 Satb2 Rabbit Abcam AB34735 1:2000 Satb2 Mouse Abcam AB51502 1:2000 Sox10 Goat Scbt SC17342 1:100 Sox9 Rabbit Abcam AB185966 1:1000 TBR1 Rabbit Abcam AB31940 1:1000 TLE4 Rabbit Abcam AB64833 1:500 TUJ1 Mouse Covance/Biolegend MMS-435P/801202 1:500 VGlut2 Guinea pig Millipore AB2251-I 1:1000 Zbtb20 Rabbit Sigma HPA016815 1:200 *Antigen retrieval was required.

132

Table 5 RT-qPCR primers list Genes Forward primer Reverse primer Amplicon aebp2 cggaggacagcataagcagta agcaacagttataggcaatgtgt 132 Brn1 ctggagcagttcgctaagcagt tgcgagaacacgttgccata 107 Brn2 gcaagctgaagcctttgttga ggtccgctttttccgtttg 113 ctbp2 tcggtagtggctacgacaac cgccgatacagattgagaatgt 133 etv5 tcagtctgataacttggtgcttc ctacaggacgacaactcggag 90 GAPDH gcaaagtggagattgttgccat ccttgactgtgccgttgaattt 108 HPRT tggccatctgcctagtaaagc ggctcatagtgcaaatcaaaagtc 111 Klf15 gagaccttctcgtcaccgaaa gctggagacatcgctgtcat 117 NFIA ttggacctcgtcatggtgatc tggacacagagccctggatta 107 NFIB agaagcccgaaatcaagcaga gccagtcacggtaagcacaaa 104 Sox10 tctcacgaccccagtttgact gccccatgtaagaaaaggctg 105 Sox2 aacggcagctacagcatgatgc cgagctggtcatggagttgtac 138 Sox9 ccaacattgagaccttcgacgt atgccgtaactgccagtgtagg 112 Zbtb1 gccctcaactccataaaacct agctgctgcaggacatagc 105 Zbtb2 ggctagagcaagggatcaaat tgaatgccgtacaaggatgag 127 Zbtb3 ctaccctcctcctgagtatgaa ggcatgtcgccttagtgtataa 121 Zbtb4 ccatgttggctatgctctca aggaggccagggctaatg 89 Zbtb5 gaaggagcacatgagagtggtg gctgaggtctatcttctcggca 151 Zbtb6 gctgccagttaccttcagatgg gtatctgaagactgacacaagtc 125 zbtb7a gtaacatctgtaaagttcgatt tcttcaggtcgtagttgtg 129 Zbtb7b cacactggtgagaagccctttg gttctcctgtgtgcttccgcat 97 Zbtb7c ggagaagccgtacatgtgcagc acgaacttggcgttgcagtgaa 126 Zbtb8a tctgagtagccatttccgaac ttacatagtctgtagcgcctggt 126 Zbtb8b ctctgggccggagataaataag catactcttgccacctcttcag 102 Zbtb9 cctccagcctcacacttattt tagaagcagaggagcgtact 93 Zbtb10 aagagaacacgtaaaaagacattcc gcgtcgagaaccatgttttat 121 Zbtb11 ggaagaaaggaagagcaaagc agcactcgaaaggcttaacg 126 Zbtb12 aaaatcagcacgcggaac cacggagctggttcatgtt 128 Zbtb14 tagctagaggtgatgggttagg acgctgtaaattgccacaaag 108 Zbtb16 tgcccagttctcaaaggagga gctttgtgcctgaaagcgttt 109 Zbtb17 tgacagctgacgagacggaagt acaagcgtagaggatgtgggtg 98 Zbtb18 ctgtcaagtccagcctttcagg cactctcatcacaggacgcctc 123 Zbtb19 tgtagcatctgtaaccgaggtc tctttgttgccataggtcctg 93 Zbtb20_1 aacgcaatgaatccgaggagt cccaaactgttgctccactga 140

133

Genes Forward primer Reverse primer Amplicon Zbtb20_2 gcactctctgcaacaagact gcgtcaccatgtgcttgataag 144 Zbtb21 acaaacactcgggagaggaa gctgggttgatgtaatgcag 91 Zbtb22 caacagtcaggttgtgctagt gcgtatccttcaagaggagaaag 103 Zbtb23 ccagcatattaaagtccacacg gctggagggcatttacctg 86 Zbtb24 tcttctgggtgtctctgact gagggaaacaaggtctgtatgt 110 Zbtb25 gatgatttttattcaccaaacaagtg tgtacataatatgcaacaagtagctga 95 Zbtb26 gcaatagtcgctgagtctcttta cctagtctgctagtgcttcaac 99 Zbtb27 tgaggtcgtggagaacaatatg gagatggctgtacatgggataag 124 Zbtb28 gttcccatctaactgccctatc tcaaaccaccttctcatgtctc 92 Zbtb29 cctatcctgagcccaactttag agagcctgtgtacagagtagag 98 Zbtb30 ccaaaggcttccctgattct ggagggtgtggttctcaataaa 124 Zbtb31 tcttatcactcattctcggaaaca ttccacataattcacagataaatgg 62 Zbtb32 attaccgagtccacacaggag acagagggcatcgataggg 126 Zbtb33 ctgacaagcttgcgaagaca gcggtattctgcaagaggaa 96 Zbtb34 gccagctttcttcagatgcagtg ctcttcagcaccaatggtaaca 114 Zbtb37 aaacaaacaataacgctttggaa tcccacttttctccatggtc 80 Zbtb38 gcttgaagcctactgtctatcc gactgcttccttgagcactta 117 Zbtb39 gccgggatagtgactttgtaa gcttgtgtgccatttcttctc 99 Zbtb40 ggactgtggaaagggcttc tcttgcagtcataagggtcttcta 92 Zbtb41 ctcccgtcatcattcagaacagc cactcaaaaggcttctcacctg 127 Zbtb42 cacaacctacctgtcgaggac cacttgactgctctgcaacg 131 Zbtb43 gagaataaggccttggtacgg tggccatcaaagagcagtct 90 Zbtb44 tagtgcatctcagagctcactg gaagtgtaggcaatccttcagt 140 Zbtb45 agctcgcggaaaaactacacc caggtaatcgcgtagcgagaa 102 Zbtb46 gagagcacatgaagcgacata acgagagccgtgcttaatg 116 Zbtb48 aatgtcccacatgtcacaaaaa tttctccccagtgtgtttcc 77 Zbtb49 tcaaagcacacaagaatgtcct ttctggctggaagagttctga 76 Zhx2 ggagcacatccgaatctggtt tgccgttaaacatcttcttccg 101

134

Table 6 Primers for cloning Construct Fragment Primer sequence 5’-3’ pDcx-Klf15-I- ccaagctcaagcttcgCCAGGCCAGCATGGTGGA Klf15 GFP taccgtcgactgcagTCAGTTGATGGCGCGTACTG ttgctgtggttccaccaagctcaagcttcgGAATTCTTCCTGACAAATGC Zbtb20 gtcgactgcagaattGATCTTTATCCGTCAGACAC pDcx-zbtb20- tgacggataaagatcAATTCTGCAGTCGACGGTAC Ires Ires-Cre cccatggtggttctcGGTTGTGGCCATATTATCATC aatatggccacaaccGAGAACCACCATGGGCCC NLS-Cre taggcagcctgcacctgaggagtgaattgcCTAATCGCCATCTTCCAGCAG ccaagctcaagcttcgCCAGGCCAGCATGGTGGA Klf15-Ires pDcx-Klf15- tggttctcTTATCATCGTGTTTTTCAAAGGAAAACCAC Ires-Cre cgatgataaGAGAACCACCATGGGCCC NLS-Cre ctgaggagtgaattgcCTAATCGCCATCTTCCAGCAG ttgaattcttcctgacaaatgctag Reaction one Zbtb20 ctgttgggctgtgaaagtc DN1768 agcccaacagaactacgtcaag Reaction two ttcccgggttatccgtcagacacatgcatc ttgaattcttcctgacaaatgctag Reaction one Zbtb20 aacatgcgcttgacgtagttc DN1787 agcgcatgttcgtacatacagg Reaction two ttcccgggttatccgtcagacacatgcatc ttgaattcttcctgacaaatgctag Reaction one Zbtb20 cgtagttctctttggctgt DN1771 aagagaactacgtcaagcacat Reaction two ttcccgggttatccgtcagacacatgcatc ttgaattcttcctgacaaatgctag Reaction one Zbtb20 tcaagcacatgttcgtacatataggtgagaagccccaccagt DN1802 actggtggggcttctcacctatatgtacgaacatgtgcttgacgt Reaction two ttcccgggttatccgtcagacacatgcatc ttgaattcttcctgacaaatgctag Reaction one Zbtb20 tcaagcacatgttcgtacatataggtgagaagccccaccagt DN1805 tgcactggtggggcttctcagctgtatgtacgaacatgtgcttga Reaction two ttcccgggttatccgtcagacacatgcatc Zbtb20 ttgaattcttcctgacaaatgctag Reaction one DN1811 tgttcgtacatacaggtgagacgccccaccagtgcagcatctgct

135

Construct Fragment Primer sequence 5’-3’ agatgctgcactggtggggcgtctcacctgtatgtacgaacatgt Reaction two ttcccgggttatccgtcagacacatgcatc ttgaattcttcctgacaaatgctag Reaction one Zbtb20 ctccttctccttgaaggattactttatcaagcacatggtgacgca DN1861 tgcgtcaccatgtgcttgataaagtaatccttcaaggagaaggagcgcca Reaction two ttcccgggttatccgtcagacacatgcatc Zbtb20 DN Reaction ttgaattcttcctgacaaatgctagaacgg full length* three ttcccgggttatccgtcagacacat *Reaction 3 was used to amplify all Zbtb20 DN full length after reaction 1 and 2.

136

Table 7 Role of Zbtb20 in the neocortex

Zbtb20 Role of Zbtb20 in the neocortex expression Callosal Neuronal References Progenitors in the Gliogenesis Neurogenesis projections circuit versus neurons neocortex formation formation E16, P5, Mitchelmore adult SVZ Not Not addressed Not addressed Not addressed Not addressed et al., 2002 and addressed astrocytes P4 KO mice Progressive exhibited decrease of the enhanced progenitor pool populations of and Tonchev et Not E14 and P4 Not addressed early born upregulation of Not addressed al. 2016 addressed neurons (L6, L5 CoupTF1 and L4) and expression in reduction of KO mice at E12 L3/L2 neurons and P4

Zbtb20 overexpression E14 to E18, Zbtb20 and knockdown P3, P7, regulates Brn2 Nagao et al. promotes and Not adult SVZ Not addressed expression in Not addressed 2016 suppresses addressed and progenitor cells astrocytogenesis at astrocytes (in vitro) E15, respectively

Neocortex not Reduced glial reaction addressed, to stroke in Zbtb20 main finding is Adult SVZ heterozygous Doeppner et that Zbtb20 Not and (quantification is not Not addressed Not addressed al., 2019 regulates addressed astrocytes shown). Normal GFAP neurogenesis in and reduction of S100β the olfactory cells at P12 in KO bulb

Zbtb20 overexpression at Similar E14, but not at E16, Increase in the alterations, Reduced increases number and albeit at a contralateral Expansion of astrogliogenesis. radial lesser extent, innervation of thalamic Expression of occupancy of E15, P4 after Zbtb20 L2/3 CPNs, axonal ZBTB20 DN at E16, L4 neurons at This thesis and deletion in while deep arborization but not E14, reduces the expense of astrocytes intermediate layers CPNs and barrel astrocytogenesis. L2/3 neurons progenitors project area in S1 in GFAP upregulation, in cKO. Normal and post- normally in cKO and normal L5 and L6 in mitotic cKO expression of S100β cKO neurons and Sox9 in cKO at P45

137