Catenin Expression in the Müllerian Duct Mesenchyme

Focal Müllerian duct retention in male mice with constitutively activated β-catenin expression in the Müllerian duct mesenchyme

Pradeep S. Tanwara, LiHua Zhanga, Yoshihiro Tanakaa, Makoto M. Taketob, Patricia K. Donahoec,1, and Jose M. Teixeiraa,1

aVincent Center For Reproductive Biology, Department of Obstetrics, Gynecology and Reproductive Biology, and cPediatric Surgical Research Laboratories, Department of Surgery, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02114; and bDepartment of Pharmacology, Graduate School of Medicine, Kyoto University, Kyoto 606-8501, Japan

Contributed by Patricia K. Donahoe, August 4, 2010 (sent for review April 23, 2010) Müllerian-inhibiting substance (MIS), which is produced by fetal β-catenin stabilization or a Wnt/Ca2+ pathway (12–14). The sta- Sertoli cells shortly after commitment of the bipotential gonads to bility of free β-catenin in the cytoplasm is regulated by a de- testicular differentiation, causes Müllerian duct (MD) regression. In struction complex formed by axin, adenomatosis polyposis the fetal female gonads, MIS is not expressed and the MDs will complex (APC), casein kinase 1, and glycogen synthase kinase 3-β differentiate into the internal female reproductive tract. We have (GSK3β), which binds and phosphorylates β-catenin, making it investigated whether dysregulated β-catenin activity affects MD re- a target for ubiquitination and degradation. During canonical Wnt gression by expressing a constitutively activated nuclear form of signaling, β-catenin escapes this complex and translocates to the β-catenin in the MD mesenchyme. We show that constitutively acti- nucleus to activate the transcription of various targeted genes in vated (CA) β-catenin causes focal retention of MD tissue in the epi- concert with members of the TCF/LEF family of transcription didymides and vasa deferentia. In adult mutant mice, the retained factors. Nuclear β-catenin expression in the MD mesenchyme has MD tissues express α-smooth muscle actin and desmin, which are been suggested as a mediator of MIS-induced MD regression (15). markers for uterine differentiation. MD retention inhibited the fold- We have previously shown that expression of a tissue-speciﬁc, ing complexity of the developing epididymides and usually led to constitutively activated (CA) form of β-catenin (16) driven by Cre BIOLOGY

obstructive azoospermia by spermatoceles. The MDs of urogenital in the Amhr2 locus (AMHR2-Cre) did not result in MD regression DEVELOPMENTAL ridges from mutant female embryos showed less regression with in female mice (17), suggesting that β-catenin is not sufficient added MIS in organ culture compared with control MDs when ana- for regression. lyzed by whole mount in situ hybridization for Wnt7a as a marker We have previously reported that expression of CA β-catenin for the MD epithelium. CA β-catenin did not appear to affect expres- restricted to the uterine stroma and myometrium leads to myo- sion of either MIS in the embryonic testes or its type II receptor metrial smooth muscle cell hyperplasia and development of mes- (AMHR2) in the MD mesenchyme nor did it inhibit pSmad1/5/8 nu- enchymal tumors in murine uteri (17). We and others have also clear accumulation, suggesting that dysregulated β-catenin must in- shown that CA β-catenin causes sterility in males by inhibiting hibit MD regression independently of MIS signaling. These studies postnatal Sertoli maturation and spermatogenesis (18–20). Given suggest that dysregulated Wnt/β-catenin signaling in the MD mes- the requirement for Wnt signaling in MD development (21) and enchyme might also be a contributing factor in persistent Müllerian the relative paucity of reports linking Wnt signaling and Wolffian duct syndrome, a form of male pseudohermaphroditism, and devel- duct (WD) differentiation, we examined whether dysregulated opment of spermatoceles. β-catenin activity in the adjacent MD mesenchyme affected normal WD development into the epididymis, vas deferens, and seminal anti-Müllerian hormone | epididymis | Mullerian inhibiting substance type II vesicles (22, 23). We show that CA β-catenin expression in the MD receptor (MISRII or MISR2) | spermatocele | epididymis mesenchyme results in focal MD retention and adjacent WD ob- struction, which leads to azoospermia and infertility secondary to hortly after commitment of the bipotential embryonic mam- seminiferous tubule degeneration and defective spermatogenesis Smalian gonadal ridge to male development, Sertoli cells dif- that develops later in the adult (18, 19). ferentiate in the testes and produce Müllerian-inhibiting substance [MIS; also known as anti-Müllerian hormone (AMH)], a TGFβ Results β family member that causes Müllerian duct (MD) regression in To investigate whether dysregulated CA -catenin expression in males. MIS is not produced by the embryonic female gonads; thus, the MD mesenchyme affects differentiation of the adjacent WD, β-catenin the MDs differentiate into the oviduct, uterus, cervix, and upper we generated mutant mice that lack exon 3 of the gene Ctnnb1fl(ex3) portion of the vagina (1, 2). Persistent Müllerian duct syndrome ( ), which would otherwise contain the serine/threo- β (PMDS) is a form of human male pseudohermaphroditism that is nine residues normally phosphorylated by GSK3 before ubiq- the result of retained female reproductive tract tissue. Homozy- uitination (16), by mating with mice that express Cre recombinase Amhr2 fi β gous deletion or knockdown of either MIS (3); its type I receptors, in the locus (4). Con rmation of nuclear -catenin expression in the MD mesenchyme between the WD and MD of both BMPR1A (Alk3) (4) and ACVR1 (Alk2) (5, 6); or type II receptor, Δ(ex3) male and female urogenital ridges of Amhr2-Cre;Ctnnb1 mice AMHR2 (also known as MISRII) (7), in mice leads to retention of Ctnnb1fl(ex3) the MDs, and mutations in either MIS or MIS receptors are is shown in Fig. 1. In the urogenital ridges of control thought to account for 85% of patients with PMDS (8). Proper MD differentiation in females requires Wnt signaling. For example, the uteri of mice with a deletion of Wnt7a are de- Author contributions: P.S.T. and J.M.T. designed research; P.S.T., L.Z., and Y.T. performed fi research; M.M.T. and P.K.D. contributed new reagents/analytic tools; P.S.T., M.M.T., P.K.D., cient in myometrial tissue, endometrial glands, and oviductal and J.M.T. analyzed data; and P.S.T., P.K.D., and J.M.T. wrote the paper. coiling (9, 10), and mice lacking Wnt5a have shortened uterine The authors declare no conflict of interest. horns and defective development of cervices and vaginas (11). 1To whom correspondence may be addressed. E-mail: [email protected] or Wnts bind to their respective cell surface frizzled or low density [email protected]. lipoprotein-related protein (LRP) receptors and signal through This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. two intracellular pathways, a canonical pathway induced by 1073/pnas.1011606107/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1011606107 PNAS Early Edition | 1of6 Downloaded by guest on October 2, 2021 mice, we observed membranous expression of β-catenin in the AB MD epithelium at embryonic day (E) 14.5 of both females (Fig. 1 A and C) and males (Fig. 1 E and G). In ridges from Amhr2-Cre; Δ(ex3) Ctnnb1 mice, membranous β-catenin continued to be expressed in the MD epithelium and strong nuclear β-catenin expression was observed the MD mesenchyme (Fig. 1 B, D, F,andH). By P1, the MD has completely regressed in control male embryos (Fig. 2 A and B), but MD remnants are still observed in the epi- Δ(ex3) didymides and vasa deferentia of Amhr2-Cre;Ctnnb1 males (Fig. 2 C and D), which persisted through adulthood (Fig. 2 E and F C D and Fig. S1). Whereas membranous β-catenin expression was observed in epididymal epithelia, predominantly nuclear β-catenin was observed in the cells surrounding the retained MD-derived tissue of Δ( Amhr2-Cre;Ctnnb1 ex3) postnatal mice (Fig. 3 A and B). We also observed elevated expression of TCF1, LEF1, and cyclinD1, which have been shown to be up-regulated by Wnt/β-catenin signaling (24–28), in the P1 remnants of MD mesenchyme in the mutants E F compared with the normal surrounding tissue (Fig. S2), indicating that the nuclear β-catenin we observed was functionally active. The retained MD mesenchyme differentiates into an enlarged, simple tube-like structure resembling a uterus that expresses α-smooth muscle actin (αSMA) and desmin (Fig. 3 C and D), which are in- dicative of myometrium and endometrial stroma, respectively, but

Fig. 2. Focal inhibition of Müllerian duct regression in mice with constitu- AB tive activated β-catenin in the MD mesenchyme. Gross analyses of male reproductive tracts of a control Amhr2-Cre/+;YFP mouse (A and B) show complete MD regression by P1 and that of an Amhr2-Cre/+;Ctnnb1Δ(ex3)/+; YFP mouse show bilateral focal retention (C and D, indicated with arrowheads). Müllerian duct tissue is visible along side the epididymides of PND20 mutant mice (E and F, indicated with arrowheads) but not in control epididymides. T, testis; E, epididymis; V, vasa deferentia; Ex3, Amhr2-Cre/+; Ctnnb1Δ(ex3)/+;YFP; C, control.

C D without endometrial glands and luminal folds, and is similarly observed in mice homozygously deleted for either MIS or one of its receptors (3, 4). Histological analyses showed that the remaining Δ(ex3) MD-derived tissue in Amhr2-Cre;Ctnnb1 inhibited coiling and integrity of the ducts in the caput and corpus regions of the epididymides (Fig. 3 E–H). Analysis of cytokeratin expression also showed that the integrity of the pseudostratified columnar ductal epithelium in the cauda epididymides was compromised near the EF retained MD tissue in mutant mice (Fig. 3 I and J). Additionally, we observed fewer luminal epithelial folds in the vasa deferentia of Δ(ex3) adult Amhr2-Cre;Ctnnb1 mice (Fig. 3 K and L). However, neither proliferation nor apoptosis in the mutant epididymal epithelia were remarkably different when compared with controls by immunofluorescence with a PCNA antibody and by TUNEL, respectively (Fig. S3), suggesting that the effects observed on epididymal morphology in the mutants might be due to mechanical GH forces. The retained MD tissue was often accompanied by fibrosis near the adjacent tubules, which had the deleterious effect of causing obstructive azoospermia by formation of enlarged epididymal cysts (Fig. 4) of impacted sperm that resemble spermatoceles in most of the mutant mice with what little spermatogenesis was occurring in their testes before seminiferous tubule de- Δ(ex3) generation begins in Amhr2-Cre;Ctnnb1 mice when they are ∼4 wk old (18, 19). Differentiation of the WD into the epididymides and vasa def- Fig. 1. Nuclear β-catenin expression in the MD mesenchyme. Membranous erentia requires testicular testosterone. Although we observed the β fl expression of -catenin is observed by immuno uorescence (green) in E14.5 retention of the MD tissue well before any testicular phenotype male and female urogenital ridges of control Amhr2-Cre/+ (A, C, E, G)inthe was observed in those studies, to rule out a contribution of the epithelial cells but is largely nuclear in the MD mesenchyme of Amhr2-Cre/+; Δ Ctnnb1 (ex3)/+ (B, D, F, H) embryos. DAPI staining is shown in blue to mark mutant testis to the retained MD phenotype, we analyzed the nuclei. Gonocytes cells are shown by mvh immunofluorescence (red). O, ovary; histology and expression of testicular markers in fetal testes for T, testis; MDM, Müllerian duct mesenchyme; MDE, Müllerian duct epithelium; comparison with control mice (Fig. S4). The histology of the mu- WD, Wolffian duct. (Scale bars, 50 μm.) tant testes appeared normal and expression nuclear of β-catenin

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.1011606107 Tanwar et al. Downloaded by guest on October 2, 2021 AB A B

C D C D

E F Fig. 4. Spermatocele formation in mutant mice. The epididymides of adult Δ Amhr2-Cre/+;Ctnnb1 (ex3)/+ mice were analyzed by H&E. Obstructive azoospermia were observed upstream of retained ﬁbrotic (F) MD tissue (A). (B)An epididymis from another mutant with a large spermatocele (S). The boxes show the areas enlarged in C and D, which show the absence of sperm in the

duct downstream of the spermatocele and the presence of sperm in the duct BIOLOGY upstream, respectively. (Scale bar = 50 μm.) DEVELOPMENTAL G H was not readily observed at this age. Markers for Sertoli cells, germ cells, and Leydig cells also appeared normal in the mutants. Most importantly, expression of MIS, the hormone required for normal MD regression, appeared normal (Fig. S4 G and H). These results suggest that the retained MD phenotype is not due to dysregulated testicular development or function and that MD differentiates into postnatal uterine tissues independently of gonadal sex. I J To ensure that the action of CA nuclear β-catenin in the MD mesenchyme is directly related to the inhibition of MIS signaling during MD regression, we performed organ culture assays with E13.5 female urogenital ridges from control and Amhr2-Cre; Δ(ex3) Ctnnb1 mice. Addition of MIS to the control female urogenital ridges causes nearly complete MD regression as evidenced by the lack of expression of Wnt7a, a MD epithelial marker, in whole mount in situ hybridization (Fig. 5A). In contrast, we ob- K L served varying degrees of MD retention of Wnt7a expression in the mutant urogenital ridges (Fig. 5B), as predicted. Qualitative analyses showed that MD regression in organ culture was inhibi- Δ(ex3) ted to varying degrees in the Amhr2-Cre;Ctnnb1 urogenital ridges (Table 1). We next examined whether AMHR2 expression was inhibited in the MD mesenchyme of the mutant urogenital ridges by CA β-catenin in the focal areas of retention. No expression of AMHR2 mRNA was observed by whole mount in situ hybridization in control male reproductive tracts at E16.5 when Δ Fig. 3. Müllerian duct remnants in Amhr2-Cre/+;Ctnnb1 (ex3)/+ male mice MD regression is completed (Fig. 5C). However, as shown in adversely affect the development and function of the epididymides and vasa Fig. 5D, AMHR2 is expressed in the mutant urogenital ridges, deferentia. Only membranous β-catenin immunoﬂuorescence was observed presumably in the areas of MD retention, suggesting that the Δ(ex3) Δ(ex3) in the control Ctnnb1 /+ and mutant Amhr2-Cre/+;Ctnnb1 /+ epi- phenotype is not due to CA β-catenin–mediated inhibition of didymal ductal epithelia of P1 mice (A and B). However, strong nuclear ac- AMHR2 expression. Lastly, to determine whether CA β-catenin cumulation of the β-catenin was observed in the uterine mesenchyme of the mutant animals (B). Desmin and αSMA were limited to the stroma and was inhibiting canonical MIS signaling during MD regression, we periductal cells, respectively, of the control and mutant epididymides (C and D) and to the inner and outer areas of the retained MD tissue (D). DAPI staining is shown in blue to mark nuclei. Histology of the caput epididymus shows fewer ducts in the areas with retained MD tissue of mutant mice mutants (I and J). In vasa deferentia, H&E staining showed that the presence compared with the controls (E and F). The number and quality of the ducts of the vestigial uterine tube markedly diminishes the luminal folding in the (evaluated by histology) appeared normal in the corpus epididymus near the neighboring vas deferens in the mutants compared with normal vas defer- retained MD tissue (G and H). However, immunostaining for keratins ens in control animals (K and L). (Scale bars, 50 μm.) U, vestigial uterine showed that the integrity of the ductal epithelium was compromised in the remnant; E, epididymis; V, vas deferens.

Tanwar et al. PNAS Early Edition | 3of6 Downloaded by guest on October 2, 2021 Discussion We have shown that dysregulated Wnt/β-catenin signaling in the AB MD mesenchyme can inhibit MD regression in embryonic urogenital ridges both in vivo and in organ culture. These results suggest that there might be another mechanism for PMDS in humans that is independent of normal MIS and AMHR2 expression and function or, more likely, that dysregulated β-catenin activity is interfering with MIS-mediated MD regression. For example, in Wnt7a knockout mice, males have retained MDs due to suppressed AMHR2 expression by an unknown mechanism (10). Alternatively, loss of MIS expression has also been shown in mice with fetal Sertoli cell-specific expression of CA β-catenin (20). However, we have shown that AMHR2 (Fig. 5) and MIS (Fig. S4) are still expressed in the retained MD tissue of male embryos and in fetal male Sertoli cells, respectively, in the Amhr2-Cre CA C D β-catenin mutant mice. Similar to bone morphogenetic proteins, MIS signaling occurs through phosphorylation of cytoplasmic Smads 1, 5, and 8 that translocate to the nucleus as heterodimers with Smad4 to activate transcriptional target genes (29). A requirement for active Smad signaling has been linked to normal fate patterning during early development due to Wnt/β-catenin activity E F (30). Conversely, canonical Wnt signaling has also been shown to limit the duration of transcriptionally active pSmad1 by inducing its ubiquitination via GSK3β (31). We have shown that pSMAD1/5/8 levels do not appear to be inhibited in the MD mesenchyme, suggesting another mechanism responsible for MD retention in the CA β-catenin mice. These studies have highlighted the importance of interplay between Wnt/β-catenin and MIS signaling pathways and our future efforts will be directed at pinpointing the molecular Fig. 5. Müllerian duct regression in mutant urogenital ridges is inhibited in mechanisms involved in their integration. organ culture. Urogenital ridges from E13.5 control and mutant female Müllerian duct regression is an exquisitely time-sensitive phe- fetuses were isolated, incubated for 48 h with 5 μg/mL MIS, and subjected to nomenon because adding MIS to female rat urogenital ridges later whole mount in situ hybridization with Wnt7a riboprobe detected by BM than E15.5 (the equivalent of E14.5 in the mouse) will not result in purple. (A) There is no Wnt7a mRNA expression in control female urogenital complete regression (32–34). This led us to speculate that the focal ridge with MIS, indicating complete regression of MD epithelium. (Inset) MD retention in mutant mice could result from delayed expression Wnt7a expression in a control female urogenital without added MIS (in- of CA β-catenin. Amhr2-Cre is expressed from a knockin mutation dicated with a white arrowhead). (B) Complete MD retention (indicated with Amhr2 a white arrowhead) with an Amhr2-Cre/+;Ctnnb1Δ(ex3)/+ female urogenital of the locus and its expression occurs only when the en- ridge similarly incubated with MIS. In situ hybridization for Amhr2 mRNA in dogenous AMHR2 is expressed (4, 35). However, Cre-mediated Δ control (C) and Amhr2-Cre/+;Ctnnb1 (ex3)/+ (D) E16.5 male reproductive tract excision of exon 3 from the floxed allele of β-catenin is likely to shows expression in the retained MD tissue in the mutant (indicated with occur later, perhaps after MD regression has already started. Ex- black arrowheads in the epididymis and a black arrow in the vas deferens). pression from the AMHR2 locus begins at E13 (35), and our Δ(ex3) pSmad1/5/8 expression was detected by immunofluorescence in control (E) preliminary results show that the recombined Ctnnb1 allele is and mutant (F) E14.5 male urogenital ridges. DAPI staining in blue indicates only detected at E13.5 (Fig. S5B). Focal retention of the MD could nuclei. O, ovary; T, testis; E, epididymis; MDM, Müllerian duct mesenchyme; β fi μ occur if expression and accumulation of CA -catenin is delayed MDE, Müllerian duct epithelium; WD, Wolf an duct. (Scale bars, 50 m.) until after E13.5 because removing MIS-producing testes from the organ culture assay after only 1 d of incubation still results in MD regression (33). Delayed expression of Amhr2-Cre could also analyzed the expression of phosphorylated Smad1/5/8 (pSmad1/5/ explain the discrepancy between the previously reported re- 8) in the MD mesenchyme of control and mutant E14.5 urogenital quirement for nuclear β-catenin during MD regression (15) and ridges. Nuclear pSMAD1/5/8 was observed in control and Amhr2- normal differentiation of reproductive tract tissues in female mice Δ(ex3) β Cre;Ctnnb1 MD mesenchyme (Fig. 5 E and F), indicating that with CA -catenin expression in the MD mesenchyme (17). This leads us to speculate whether induced expression of CA β-catenin MIS signaling is not perturbed by CA β-catenin. Additionally, earlier than that which we achieved by Cre expression in the Amhr2 ectopic Wnt7a expression was not detected in CA β-catenin mu- locus might result in greater MD retention. tant male urogenital ridges at E13.5, indicating that dysregulated Dysregulated Wnt/β-catenin signaling is commonly found in β -catenin was not causing development of more than one MD a variety of naturally occurring tumors, largely by mutations in epithelium that later fails to regress (Fig. S5A). APC or, less frequently, in β-catenin itself (36). In human patients,

Table 1. Müllerian duct regression in organ culture Genotype of embryos No. Complete regression (%) Partial regression (%) No regression (%)

Amhr2-Cre/+* 5 0 (0) 0 (0) 5 (100) Amhr2-Cre/+* +MIS 7 3 (42.8) 3 (42.8) 1 (14) Δ † Amhr2-Cre/+;Ctnnb1 (ex3)/+ +MIS 8 0 (0) 2 (25) 6 (75)

*Control. †Mutant.

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.1011606107 Tanwar et al. Downloaded by guest on October 2, 2021 because surgical removal of the MD derivatives is often carried out performed on genomic DNA collected from the gonadal ridges of 11.5, 12.5-13, when surgery in boys is also necessary for cryptorchid, nonpalpable and 13.5 dpc mutant embryos to demonstrate the wild-type and recombined testes and the vast majority of PMDS patients have mutations in knock-in alleles of β-catenin using following primers (β-catGF2: GGTAGGT- MIS signaling components (8), later consequences of MD re- GAAGCTCAGCGCAGAGC; β-catAS5: ACGTGTGGCAAGTTCCGCGTCATCC). Gross tention due to dysregulated Wnt/β-catenin signaling will be diffi- analyses were photographed using a Nikon SMZ1500 microscope with an at- cult to discern (37, 38). However, there is one reported case of tached Spot digital camera (Diagnostic Instruments). uterine adenosarcoma (39) and another of clear cell adenocarci- Histology Analysis, Immunofluorescence, Immunohistochemistry, and TUNEL noma (40) in human patients with PMDS. We did not observe Staining. Tissues were fixed overnight at 4 °C in Bouins fluid for histological evidence of neoplastic transformation in the retained MD tissue of analysis and in 4% paraformaldehyde for all other analyses. Methods used these mice by 3 mo. Long term studies will be needed to determine have been previously described in detail (17) using the following primary and whether these mice with retained MD remnants develop cancer. secondary antibodies: anti-β-catenin (1:250; BD Transduction Laboratories); Although sperm production in mice with homozygous dele- αSMA (1:1,000; Sigma Chemical); desmin (1:250; Neomarkers); cytokeratin tion of either the MIS or Amhr2 genes is normal, most males are (1:50; Neomarkers); anti-mouse vasa homolog (mvh) (1:250; Abcam); anti- infertile because of blocked sperm transmission due to the retained 3βHSD, anti-MIS (1:100; Santa Cruz Biotechnology); anti-PCNA (ready to use; MD-derived tissues (3, 7). Sperm transmission was similarly Zymed); anti-cyclinD1 (ready to use; Neomarkers); TCF-1, LEF-1, and pSmad1/5/ Δ(ex3) blocked in the epididymides of Amhr2-Cre;Ctnnb1 mutants, all 8 (1:250; Cell Signaling Technology); AlexaFluor secondary antibodies (1:500; of which developed spermatoceles. Although thought to be present Invitrogen); and Biotinylated donkey anti-mouse or anti-rabbit antibody Fab in 30% of men who are usually asymptomatic (41), these sperma- (1:1,000; Jackson ImmunoResearch Laboratories). TUNEL staining was per- toceles might account for about 4% of IVF patients with obstruc- formed according to the instructions provided with the Cell Death Detection tive azoospermia (42). Spermatocele pathogenesis is not well kit (Roche). Photomicrographs were taken with a Nikon TS2000 microscope understood; future studies of Wnt/β-catenin and MIS expression in equipped with a Spot digital camera (Diagnostic Instruments). surgical specimens from patients with spermatoceles might indicate Embryonic Urogenital Ridge Organ Culture. The method of culturing the em- previously unappreciated MD remnant involvement. fl In conclusion, we have shown that activation of Wnt/β-catenin bryonic gonadal ridge was previously described in detail (29). Brie y, E13.5 female urogenital ridges were collected from the appropriate genotypes and signaling partially inhibits MD regression and adversely affects cultured in CMRL1066 medium (Invitrogen) supplemented with 10% female WD morphogenesis; the molecular mechanisms of Wnt signaling FBS. Cultures were carried out in the presence or absence of recombinant

and Wnt antagonists involvement in MIS-mediated MD regression human MIS (44). At the end of the experiments, the urogenital ridges were BIOLOGY

or retention remain to be investigated. fixed overnight in 4% paraformaldehyde at 4 °C and used to perform whole DEVELOPMENTAL mount in situ hybridization as described elsewhere (29, 45). Briefly, Amhr2 (46) Materials and Methods and Wnt7a (10) riboprobes were prepared using a MaxiScript kit from Ambion Mouse Genetics and Husbandry. The mice used in this study were housed under with digoxigenin and detected with antidigoxigenin F(ab)2 fragments and BM standard animal housing conditions and all protocols involving animal experi- purple (all from Roche). Wnt7a staining was considered evidence of retained mentation were approved by the Institutional Animal Care and Use Committee MD epithelium and scored as either partial or complete if the length of MD at Massachusetts General Hospital. All of the mice used in this study were epithelium was equal to or greater than the length of the gonad. maintained on C57BL/6;129/SvEv mixed genetic background. The parental mice alleles Ctnnb1tm1Mmt (16), Gt(ROSA)26Sortm1(EYFP)Cos (43), and Amhr2tm3(cre)Bhr fl(ex3) Δ(ex3) ACKNOWLEDGMENTS. We thank Dr. Richard Behringer (MD Anderson, Hous- (4) were used in the crosses and are hereafter called Ctnnb1 or Ctnnb1 , ton, TX) for supplying us with the Amhr2-Cre mice and Dr. Barry Hinton for his YFP, and Amhr2-Cre, respectively. Genotyping was performed on DNA from tail help with the analysis of the epididymides. These studies were supported in biopsies using standard PCR protocols. The age of embryos was determined by part by National Institutes of Health Grant HD057201 (to J.M.T.) and by Vincent the day a vaginal plug was detected, which was considered as E0.5. PCR was Memorial research funds.

1. Teixeira J, Maheswaran S, Donahoe PK (2001) Müllerian inhibiting substance: An 17. Tanwar PS, et al. (2009) Constitutive activation of Beta-catenin in uterine stroma and instructive developmental hormone with diagnostic and possible therapeutic smooth muscle leads to the development of mesenchymal tumors in mice. Biol applications. Endocr Rev 22:657–674. Reprod 81:545–552. 2. Josso N, Picard JY, Rey R, di Clemente N (2006) Testicular anti-Müllerian hormone: 18. Tanwar PS, et al. (2010) Constitutive WNT/beta-catenin signaling in murine Sertoli History, genetics, regulation and clinical applications. Pediatr Endocrinol Rev 3:347–358. cells disrupts their differentiation and ability to support spermatogenesis. Biol Reprod 3. Behringer RR, Finegold MJ, Cate RL (1994) Müllerian-inhibiting substance function 82:422–432. during mammalian sexual development. Cell 79:415–425. 19. Boyer A, Hermo L, Paquet M, Robaire B, Boerboom D (2008) Seminiferous tubule 4. Jamin SP, Arango NA, Mishina Y, Hanks MC, Behringer RR (2002) Requirement of Bmpr1a degeneration and infertility in mice with sustained activation of WNT/CTNNB1 – for Müllerian duct regression during male sexual development. Nat Genet 32:408–410. signaling in sertoli cells. Biol Reprod 79:475 485. 5. Clarke TR, et al. (2001) Mullerian inhibiting substance signaling uses a BMP-like pathway 20. Chang H, et al. (2008) Wt1 negatively regulates beta-catenin signaling during testis – mediated by ALK2 and induces Smad6 expression. Mol Endocrinol 15:946–959. development. Development 135:1875 1885. 6. Visser JA, et al. (2001) The serine/threonine transmembrane receptor ALK2 mediates 21. Kobayashi A, Behringer RR (2003) Developmental genetics of the female reproductive – Müllerian inhibiting substance signaling. Mol Endocrinol 15:936–945. tract in mammals. Nat Rev Genet 4:969 980. ﬁ 7. Mishina Y, et al. (1996) Genetic analysis of the Müllerian-inhibiting substance signal 22. Joseph A, Yao H, Hinton BT (2009) Development and morphogenesis of the Wolf an/ epididymal duct, more twists and turns. Dev Biol 325:6–14. transduction pathway in mammalian sexual differentiation. Genes Dev 10:2577–2587. 23. Archambeault DR, Tomaszewski J, Joseph A, Hinton BT, Yao HH (2009) Epithelial- 8. Josso N, Belville C, di Clemente N, Picard JY (2005) AMH and AMH receptor defects in mesenchymal crosstalk in Wolfﬁan duct and fetal testis cord development. Genesis persistent Müllerian duct syndrome. Hum Reprod Update 11:351–356. 47:40–48. 9. Miller C, Sassoon DA (1998) Wnt-7a maintains appropriate uterine patterning during the 24. Shtutman M, et al. (1999) The cyclin D1 gene is a target of the beta-catenin/LEF-1 development of the mouse female reproductive tract. Development 125:3201–3211. pathway. Proc Natl Acad Sci USA 96:5522–5527. 10. Parr BA, McMahon AP (1998) Sexually dimorphic development of the mammalian 25. Tetsu O, McCormick F (1999) Beta-catenin regulates expression of cyclin D1 in colon reproductive tract requires Wnt-7a. Nature 395:707–710. carcinoma cells. Nature 398:422–426. 11. Mericskay M, Kitajewski J, Sassoon D (2004) Wnt5a is required for proper epithelial- 26. Roose J, et al. (1999) Synergy between tumor suppressor APC and the beta-catenin- mesenchymal interactions in the uterus. Development 131:2061–2072. Tcf4 target Tcf1. Science 285:1923–1926. 12. Mikels AJ, Nusse R (2006) Wnts as ligands: Processing, secretion and reception. 27. Hovanes K, et al. (2001) Beta-catenin-sensitive isoforms of lymphoid enhancer factor- – Oncogene 25:7461 7468. 1 are selectively expressed in colon cancer. Nat Genet 28:53–57. – 13. Nusse R (2008) Wnt signaling and stem cell control. Cell Res 18:523 527. 28. Filali M, Cheng N, Abbott D, Leontiev V, Engelhardt JF (2002) Wnt-3A/beta-catenin 14. Wodarz A, Nusse R (1998) Mechanisms of Wnt signaling in development. Annu Rev signaling induces transcription from the LEF-1 promoter. J Biol Chem 277:33398–33410. – Cell Dev Biol 14:59 88. 29. Zhan Y, et al. (2006) Müllerian inhibiting substance regulates its receptor/SMAD 15. Allard S, et al. (2000) Molecular mechanisms of hormone-mediated Müllerian duct signaling and causes mesenchymal transition of the coelomic epithelial cells early in – regression: Involvement of beta-catenin. Development 127:3349 3360. Müllerian duct regression. Development 133:2359–2369. 16. Harada N, et al. (1999) Intestinal polyposis in mice with a dominant stable mutation of 30. Eivers E, Fuentealba LC, De Robertis EM (2008) Integrating positional information at – the beta-catenin gene. EMBO J 18:5931 5942. the level of Smad1/5/8. Curr Opin Genet Dev 18:304–310.

Tanwar et al. PNAS Early Edition | 5of6 Downloaded by guest on October 2, 2021 31. Fuentealba LC, et al. (2007) Integrating patterning signals: Wnt/GSK3 regulates the 40. Shinmura Y, Yokoi T, Tsutsui Y (2002) A case of clear cell adenocarcinoma of the duration of the BMP/Smad1 signal. Cell 131:980–993. müllerian duct in persistent müllerian duct syndrome: The ﬁrst reported case. Am J 32. Josso N, Picard JY, Tran D (1977) The anti-Müllerian hormone. Birth Defects Orig Artic Surg Pathol 26:1231–1234. Ser 13:59–84. 41. Rubenstein RA, Dogra VS, Seftel AD, Resnick MI (2004) Benign intrascrotal lesions. 33. Donahoe PK, Ito Y, Hendren WH, 3rd (1977) A graded organ culture assay for the J Urol 171:1765–1772. detection of Mullerian inhibiting substance. J Surg Res 23:141–148. 42. Hirsh AV, Dean NL, Mohan PJ, Shaker AG, Bekir JS (1996) Natural spermatoceles in 34. Picon R (1969) Action of the fetal testis on the development in vitro of the Müllerian irreversible obstructive azoospermia—reservoirs of viable spermatozoa for assisted ducts in the rat. Arch Anat Microsc Morphol Exp 58:1–19. conception. Hum Reprod 11:1919–1922. 35. Arango NA, et al. (2008) A mesenchymal perspective of Müllerian duct differentiation 43. Srinivas S, et al. (2001) Cre reporter strains produced by targeted insertion of EYFP and regression in Amhr2-lacZ mice. Mol Reprod Dev 75:1154–1162. and ECFP into the ROSA26 locus. BMC Dev Biol 1:4. 36. Clevers H (2006) Wnt/beta-catenin signaling in development and disease. Cell 127: 44. Lorenzo HK, et al. (2002) New approaches for high-yield puriﬁcation of Müllerian 469–480. inhibiting substance improve its bioactivity. J Chromatogr B Analyt Technol Biomed 37. Donahoe PK, Crawford JD, Hendren WH (1977) Management of neonates and Life Sci 766:89–98. children with male pseudohermaphroditism. J Pediatr Surg 12:1045–1057. 45. Arango NA, et al. (2005) Conditional deletion of beta-catenin in the mesenchyme of 38. Donahoe PK (1988) Neoseminal vesicle created from retained mullerian duct to the developing mouse uterus results in a switch to adipogenesis in the myometrium. preserve the vas in male infants. J Pediatr Surg 23:272–274. Dev Biol 288:276–283. 39. Thiel DD, Erhard MJ (2005) Uterine adenosarcoma in a boy with persistent müllerian 46. Teixeira J, et al. (1996) Developmental expression of a candidate müllerian inhibiting duct syndrome: First reported case. J Pediatr Surg 40:e29–e31. substance type II receptor. Endocrinology 137:160–165.

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.1011606107 Tanwar et al. Downloaded by guest on October 2, 2021