Institute of Physiological Chemistry, Ulm University Head of Institute: Prof. Dr. rer. nat. Thomas Wirth

Role of FOXO3 in classical Hodgkin lymphoma

Dissertation for the attainment of the Doctoral Degree of Medicine (Dr. med.) at the Faculty of Medicine, Ulm University, Germany

submitted by Franziska Herrmann born in Ehingen (Donau)

2018

Acting dean: Prof. Dr. rer. nat. Thomas Wirth

First correspondent: Prof. Dr. rer. nat. Thomas Wirth

Second correspondent: Prof. Dr. med. Thomas Barth

Day doctorate awarded: January 10, 2019

Table of contents Abbreviations ...... i 1 Introduction ...... 1 1.1 Hodgkin lymphoma...... 1 1.1.1 General information and histology ...... 1 1.1.2 Incidence and cancer statistics ...... 1 1.1.3 Origin and phenotype of HRS cells ...... 2 1.1.4 Deregulated transcription factor networks ...... 3 1.1.5 Genetic alterations and deregulated signaling pathways ...... 3 1.1.6 Tumor environment ...... 4 1.2 B cell development ...... 5 1.2.1 Early B cell development in bone marrow ...... 5 1.2.2 Germinal center reaction ...... 6 1.2.3 Transcription factors in early B cell development and GCR ...... 7 1.2.3.1 BCL6 transcription factor ...... 8 1.2.4 Transcription factors in terminal B cell differentiation ...... 10 1.3 FOXO family of transcription factors...... 13 1.3.1 Structure and general information ...... 13 1.3.2 Functions of FOXOs ...... 14 1.3.3 FOXOs in cell cycle arrest, apoptosis and oxidative stress ...... 16 1.3.4 FOXOs in B cell development and function ...... 16 1.3.5 Regulation of FOXOs ...... 17 1.3.6 FOXOs and tumorigenesis ...... 18 1.4 Aims of the study ...... 21 2 Material and methods ...... 22 2.1 Materials ...... 22 2.1.1 Cell lines ...... 22 2.1.2 General chemicals ...... 23 2.2 Methods ...... 29 2.2.1 FOXO3 induction ...... 29 2.2.2 RNA isolation and qRT-PCR...... 29 2.2.3 Preparation of the protein samples and immunoblot ...... 31 2.2.4 Electroporation and luciferase reporter assay ...... 33

2.2.5 Correlation analysis ...... 34 3 Results ...... 35 3.1 FOXO3 expression in normal B cells and in B cell lymphomas ...... 35 3.2 Correlation analysis of gene expression ...... 37 3.3 Influence of FOXO3 on PRDM1 expression ...... 38 3.4 Influence of FOXO3 on pro-apoptotic genes ...... 40 3.5 Influence of FOXO3 on BCL6 expression ...... 42 3.6 Summary ...... 44 4 Discussion ...... 45 4.1 FOXO3 expression in B cell lymphomas and normal B cells ...... 45 4.2 Positive correlation between PRDM1 and FOXO3 ...... 46 4.3 FOXO3 regulates PRDM1α expression ...... 47 4.4 FOXO3 influences expression of pro-apoptotic genes ...... 49 4.5 FOXO3 induces BCL6 transcription ...... 50 4.6 FOXO3 induces BCL6 and PRDM1 simultaneously ...... 51 4.7 Conclusions ...... 52 5 Summary ...... 54 6 Bibliography ...... 56 Acknowledgments ...... 75 Curriculum vitae ...... 76

Abbreviations

Abbreviations 4-OHT 4-hydroxytamoxifen

AKT v-akt murine thymoma viral oncogene homolog 1

AML acute myeloid leukemia

APS ammonium persulfate

ASC antigen-secreting cell

ATR ataxia telangiectasia and RAD3 related

BACH2 BTB and CNC homology 1, basic leucine zipper transcriptionfactor 2

BAFF B cell–activation factor

BAK BCL2-antagonist/killer

BCL3 B cell lymphoma 3

BCL6 B cell lymphoma 6

BCR B cell receptor

BIM BCL-2‑interacting mediator of cell death

BLIMP-1 B lymphocyte-induced maturation protein-1

BOB1 B cell Oct-binding protein 1

BSA bovine serum albumin

CD cluster of differentiation

CDKN1A cyclin-dependent kinase inhibitor 1A

CDKN1B cyclin-dependent kinase inhibitor 1B

CHEK1 checkpoint kinase 1

ChIP chromatin immunoprecipitation cHL classical Hodgkin lymphoma

CLP common lymphoid progenitor

CML chronic myeloid leukaemia

CON control

i Abbreviations

CSR class-switch recombination d distilled dd double distilled

DNA deoxyribonucleic acid dNTP deoxyribonucleotide triphosphate

DDB1 DNA damage-binding protein 1

DLBCL diffuse large B cell lymphoma

DZ dark zone

EBF early B cell factor

EBV Epstein-Barr virus

ECL enhanced chemoluminescence

ER endoplasmatic reticulum

ERK extracellular signal-regulated kinase

FASL Fas ligand

FBS fetal bovine serum

FDC follicular dendritic cell

Fkh fork head

FL follicular lymphoma

FOXO subclass “O” of the forkhead box (FOX) family of transcription factors

GADD45A growth arrest and DNA damage inducible 45 α

GATA3 GATA binding protein 3

GC germinal center

GCR germinal center reaction h.i. heat inactivated

HL Hodgkin lymphoma

HMT histone methyltransferase

HRP horseradish peroxidase

ii Abbreviations

HRS Hodgkin and Reed-Sternberg

IFN interferon

Ig immunoglobulin

IKK inhibitor of NF-κB kinase

IL-10 interleukin 10

IL-7R interleukin-7 receptor

IMDM Iscove's Modified Dulbecco's Medium

IRF4 interferon regulatory factor 4

IκB inhibitor of NF-κB

JAK Janus kinase

L&H lymphocytic and histiocytic

LIC leukemia-initiating cell

LMP1 latent membrane protein1

LZ light zone

MAPK mitogen-activated protein kinase

MDM2 murine double minute 2

MEF2B myocyte enhancer factor 2B

MEK mitogen-activated protein kinase kinase miR microRNA miRNA microRNA

MnSOD manganese superoxide dismutase

MST1 mammalian STE20-like kinase 1 mTORC2 mammalian target of rapamycin complex 2

MYC v-myc avian myelocytomatosis viral oncogene homolog

MZ marginal zone

ND not detected

NEMO NF-κB essential modifier

NF-κB nuclear factor-kappa B

iii Abbreviations

NHL Non-Hodgkin lymphoma

NIK nuclear factor-kappa B-inducing kinase

NK natural killer

NLPHL nodular lymphocyte-predominant Hodgkin lymphoma

OCT2 organic cation transporter 2

PAGE polyacrylamide gel electrophoresis

PAX5 paired box protein 5

PBS phosphate-buffered saline

PC plasma cell pHSC pluripotent haematopoietic stem cell

PI3K phosphatidylinositol-3-kinase

PIK3CA catalytic subunit α of PI3K

PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1

PMBL primary mediastinal B cell lymphoma

PPAR peroxisome proliferator-activated receptor

PR domain positive regulatory domain

PRDM1 PR domain-containing 1 with zinc finger domain

PTMs posttranslational modifications qRT-PCR quantitative real-time polymerase chain reaction

RAG recombination activating gene

RANK receptor activator of NF-κB

RNA ribonucleic acid

ROS reactive oxygen species

RPL13A ribosomal protein 13a

SD standard deviation

SDS sodium dodecyl sulfate

SERM selective estrogen receptor modulator

SGK serum- and glucocorticoid-inducible kinase

iv Abbreviations

SHM somatic hypermutation

SOCS1 suppressor of cytokine-signaling-1

STAT signal transducer and activator of transcription

TEMED tetramethylethylenediamine

TFH cells T follicular helper cells

TGF-β transforming growth factor-β

TH cell T helper cell

TLR toll-like receptor

TNF tumor necrosis factor

TNFAIP tumor necrosis factor- α-induced protein

TP53 tumor protein p53

TRAF tumor necrosis factor- α receptor-associated factor

TRAIL tumor necrosis factor related apoptosis inducing ligand

Tris trisaminomethane

TUBB β-tubulin

v Abbreviations

Units and prefixes

°C degrees Celsius

F farad g gram h hour k kilo l liter m meter

μ micro m milli min minute

M molar n nano s second

V volt

Nomenclature I used the nomenclature recommended by the HUGO Gene Nomenclature Committee and by Mouse Genome Informatics (MGI). Human and murine proteins were written in uppercase letters. Human genes were written in uppercase letters and were italicized. For murine genes, the first letter was written in uppercase and the rest in lowercase letters. They were also italicized.

vi Copyright Notice

Copyright Notice

I hereby declare that parts of my thesis have been published in the following article:

Osswald, C D, Xie, L, Guan, H, Herrmann, F, Pick, S M, Vogel, M J, Gehringer, F, Chan, F C, Steidl, C, Wirth, T & Ushmorov, A: Fine-tuning of FOXO3A in cHL as a survival mechanism and a hallmark of abortive plasma cell differentiation. Blood, 131(14): 1556-1567 (2018). DOI: 10.1182/blood-2017-07-795278

vii Introduction

1 Introduction

1.1 Hodgkin lymphoma 1.1.1 General information and histology Hodgkin lymphoma (HL) was first described in 1832 by Thomas Hodgkin who found certain lymphoid lesions in the lymph nodes and spleen in a case series of patients (Hodgkin 1832). This lymphoid tumor is still unique among lymphomas because of its pathognomonic tumor cells, the mononucleated Hodgkin cells and polynucleated Reed-Sternberg (HRS) cells, usually accounting for only less than 1 % of the cellular infiltrate (Küppers 2009).

Histologically, HL can be divided into five subtypes: nodular sclerosis, mixed cellularity, lymphocyte-rich, lymphocyte depleted, and nodular lymphocyte- predominant HL (NLPHL) according to their growth pattern, morphology of tumor cells and composition of cellular infiltrate. The first four are grouped together as classical Hodgkin lymphoma (cHL) accounting for about 95 % of all HL cases (Küppers 2009). Among these, nodular sclerosis is the most common subtype (around 80 %) followed by mixed cellularity (around 15 %) (Liu et al. 2014b). In the very rare NLPHL, the tumor cells are referred to as lymphocytic and histiocytic (L&H) cells. In my further study I will concentrate on cHL and HRS cells.

1.1.2 Incidence and cancer statistics With an incidence of 2 to 4 cases/ 100 000 in economically developed countries like Europe and the USA, it is one of the most common cancers in young adults aged 20 to 40 years and has a second peak in patients older than 55 years (Torre et al. 2015; Eichenauer et al. 2014). The overall incidence in undeveloped countries is lower with the exception in children at the age of 5 years and younger where a higher incidence can be found (Correa and O'Conor 1973).

About 80 to 90 % of HL patients achieve lasting complete remission with modern treatment strategies based on multiagent chemotherapy and involved field radiotherapy (Eichenauer et al. 2014; Torre et al. 2015). So the formerly lethal disease seems to be manageable, however, still about 10 to 20 % of patients cannot be cured and will finally die of HL. Additionally, also successfully treated patients may suffer from side effects of delayed toxicity of polychemotherapy 1 Introduction regimens and radiotherapy. Among these, secondary malignancy is a major issue of which solid tumors are the most frequent subtype (up to 75 to 80 %). Non- Hodgkin lymphoma (NHL) and leukemia were observed less frequently (Ng and Mauch 2009). Further therapy-associated harms are e.g. cardiovascular disease, noncoronary vascular complications, thyroid dysfunction and sterility.

During the last years, there were strong efforts to minimize or eliminate radiotherapy and to reduce the number of chemotherapy cycles in early-stage HL. The aim is to maintain the high efficacy and still to induce the least harm possible (Connors 2015; Armitage 2010). Additionally, it is important to identify biological markers that are prognostic factors for bad outcome (Küppers 2009) and promote research for targeted therapy.

1.1.3 Origin and phenotype of HRS cells Finding the cell of origin of HRS cells proved to be quite difficult since they are rare and reveal an inconsistent expression pattern of haematopoietic markers including the T cell markers CD3, NOTCH1, GATA3, markers typically for cytotoxic cells and B cell markers such as PAX5 and CD209 (Küppers et al. 2012).

CD30 in contrast, is expressed in nearly all cases of HL establishing it as a diagnostic marker (Mani and Jaffe 2009).

Many HRS cells carry a clonally rearranged IgV heavy chain with somatic hypermutation indicating germinal center B cells (GC B cells) as their cellular origin (Küppers et al. 1994; Kanzler et al. 1996). In about 25 % of cases, these somatic hypermutations lead to a non-functional IgV chain suggesting their progenitor cells being “crippled” GC B cells that should have undergone apoptosis (Küppers and Rajewsky 1998).

Additionally, both cHL cell lines and patient-derived material provide evidence that HRS cells might have undergone class switch recombination, which also points towards an origin of activated B cells (Irsch et al. 2001; Martin-Subero et al. 2006a). However, in rare cases HL may also derive from T cells (Willenbrock et al. 2006; Küppers 2009).

2 Introduction

1.1.4 Deregulated transcription factor networks The lack of certain transcription factors essential for B cell gene activation in the healthy status leads to the loss of B cell phenotype unique amongst lymphomas (Küppers 2009). In particular B cell specific transcription factors such as OCT2, PU.1, and BOB1 are absent or expressed at low levels (Stein et al. 2001; Torlakovic et al. 2001).

The B cell specific genes are inactivated for example by epigenetic mechanisms such as DNA hypermethylation in promoter regions (Doerr et al. 2005; Ushmorov et al. 2006). Another factor is the expression of master-regulators of other haematopoietic cell lineages such as NOTCH1 and ID2, which are specific for T cells and NK cells respectively where they suppress B cell-specific genes (Mathas et al. 2006; Küppers et al. 2012).

1.1.5 Genetic alterations and deregulated signaling pathways Regarding genetic alterations, HRS cells show hyperploid numerical chromosomal aberrations and chromosomal instability (Weber-Matthiesen et al. 1995). A variety of genetic lesions was observed contributing to deregulated signaling pathways and rescue from apoptosis. Among these, mutations leading to constitutive activation of nuclear factor-kappa B (NF-κB) and the JAK/STAT pathway are found most frequently. Other deregulated pathways include the PI3K/AKT, NOTCH1 and MAPK/ERK pathway (Dutton et al. 2005; Zheng et al. 2003; Jundt et al. 2002).

In NF-κB signaling, HRS cells show constitutive activity of both the canonical and alternative pathway. Normally, both pathways are tightly regulated. The canonical pathway can be activated by diverse stimuli such as proinflammatory cytokines, pathogen-associated molecular patterns binding to toll-like receptors (TLRs), CD30 and CD40 and receptor activator of NF- κB (RANK). They activate the inhibitor of NF-κB (IκB) kinase (IKK) complex with its components IKKα, IKKβ and IKKγ (or NEMO for NF-κB essential modifier). Upon activation, IKK phosphorylates IκB proteins causing IκB polyubiquitination leading to proteolytic degradation by the proteasome and release of NF-κB dimers. They translocate into the nucleus and activate transcription of their target genes (Jost and Ruland 2007).

The alternative pathway is activated via cell-surface receptors of the TNF cytokine family, such as CD40, lymphotoxin β and BAFF, leading through activation of

3 Introduction nuclear factor-kappa B-inducing kinase (NIK) to activation of IKKα (Bonizzi and Karin 2004). After phosphorylation of NF-κB2/p100, p100 is partially processed to p52 and forms heterodimers with RelB. It translocates to the nucleus, where the transcription of the NF-κB target genes starts (Küppers 2009; Jost and Ruland 2007).

Frequently found mutations in HRS cells are genomic gains of REL (Martin-Subero et al. 2002; Joos et al. 2002), mutations in the genes encoding NF-κB inhibitors IκBα and IκBε (Emmerich et al. 1999; Emmerich et al. 2003), mutations in further negative regulators of NF-κB activity such as TNFAIP (Kato et al. 2009; Schmitz et al. 2009) and the positive regulator NIK (Otto et al. 2012). Rarely found mutations include CYLD, TRAF and BCL3 (Martin-Subero et al. 2006b; Otto et al. 2012; Schmidt et al. 2010). Interestingly, in HL cell lines often multiple genetic alterations can be found indicating that more than one disrupted factor might be necessary for the maintenance of constitutive NF-κB activity (Küppers et al. 2012).

Additionally, EBV+ HRS cells express the latent membrane protein1 (LMP1). Its intracellular domain has high homology to the signaling domain of CD40 promoting CD40 signaling (Kilger et al. 1998; Jost and Ruland 2007).

The JAK/STAT pathway is the central pathway for cytokine signaling also regulating the formation of lymphocytes. In 30 % of HL cases the JAK2 locus is amplified or translocations can be found (Van Roosbroeck et al. 2011). STAT3, STAT5 and STAT6 are constitutively active in HRS cells pointing towards their role in the pathogenesis of this disease. Other frequently found lesions in this pathway are inactivating SOCS1 mutations (40 %) (Küppers et al. 2012; Weniger et al. 2006).

1.1.6 Tumor environment One unique feature of HL amongst lymphomas is that HRS cells are surrounded by a complex architecture of diverse cells of the immune system accounting for up to 99 % of cell mass in the tumor. Among these cells are T and B lymphocytes, neutrophils, macrophages, mast cells, eosinophils, fibroblasts and NK cells (Küppers et al. 2012). HRS cells are dependent on and actively interact with their microenvironment through secretion of cytokines which are responsible for the maintenance of the tumor stromal network (Steidl et al. 2011). HRS cells express

4 Introduction

TNF receptor ligands and secrete IL-10 and other factors promoting proliferation of the tumor-associated cell types and maintenance of immunosuppressive surrounding which is favorable for HRS cells (Diepstra et al. 2007; Gandhi et al. 2007). The reactive cells contribute and even amplify this reaction also secreting certain cytokines giving them survival signals and leading to an immune privilege for HRS cells (Ishida et al. 2006; Marshall et al. 2004).

1.2 B cell development 1.2.1 Early B cell development in bone marrow Early B cell development starts in primary lymphoid tissue, temporarily in the fetal liver, and continues life-long in the bone marrow providing niches and microenvironment for residency of pluripotent haematopoietic stem cells (pHSCs) (Melchers 2015). Here, the V(D)J recombination, the functional rearrangement of the Ig loci, takes places which is a fault-prone process. In this process, primary antibody diversity is established. The so created B cell receptor (BCR) is a membrane bound IgM-molecule first solitarily expressed on the cell surface. At this developmental stage, the first selection step takes place testing the immature B cell for central tolerance and thus for autoreactivity to self-antigens (Pelanda and Torres 2012). These immature B cells leave the bone marrow and further develop into mature naïve B cells.

A small proportion migrates to the white pulp of the spleen forming marginal zone (MZ) B cells. The higher proportion though develops into naïve follicular B cells circulating in the periphery to secondary lymphoid tissues waiting for antigen encounter (Carsetti et al. 2004; Radbruch et al. 2006). MZ B cells rapidly respond to T cell-independent antigens as a first line response whereas follicular B cells can also react to antigens with protein structure evoking a simultaneous CD4+ T helper cell (TH cell) activation. This second line response can be devided into a two-step process leading to the formation of plasmablasts and plasma cells (PC). The so called ‘extrafollicular response’ is a response to antigen receptor- dependent signals and initiates the development of short-lived plasmablasts with antibodies with moderate and unchanging affinity. Here, B lymphocytes undergo class-switch recombination (CSR) but only low-level hypermutation (MacLennan et al. 2003; Nutt et al. 2015).

5 Introduction

The second step of response to T cell-dependant antigen is charcterized by germinal center (GC) formation. In this setting, long-lived PCs are created producing high-affinity antibodies at high levels (Nutt et al. 2015). This error-prone process will be described in more detail in the following paragraphs.

1.2.2 Germinal center reaction

Upon contact to antigen, both activated B cells and T follicular helper cells (TFH cells) migrate to the interfollicular region where interaction takes place. B cells move to the center of the follicle, grow and differentiate into B cell blasts (centroblasts) and start to proliferate to form the early GC (De Silva and Klein 2015; MacLennan 1994).

GCs can be subdivided into dark zone (DZ) containing highly clonally expanding centroblasts and the less densely packed light zone (LZ) containing centrocytes dispersed with TFH cells, macrophages and follicular dendritic cells (FDCs) (Figure 1) (Basso and Dalla-Favera 2015; De Silva and Klein 2015). In the LZ the GC B cells undergo somatic hypermutation (SHM) to increase affinity for the antibody. The B cells with an improved BCR undergo positive selection, whereas the centrocytes which express a non-functional or non-binding BCR, lack pro survival signals and are prone to undergo apoptosis (Klein and Dalla-Favera 2008). Afterwards, BCR may undergo CSR or the B cell is directed to recirculate to the DZ for further rounds of SMH and proliferation to further increase affinity to antigen (De Silva and Klein 2015).

Amongst these antigen-selected GC B cells is also a small subgroup forming memory B cells with the ability to differentiate into antigen-secreting cells (ASCs) upon re-exposure to antigen (Nutt et al. 2015).

6 Introduction

Figure 1: Germinal center reaction (GCR). Upon antigen encounter, the now activated follicular B cell moves into the center of lymphoid follicles where GCR takes place governed by the master- regulator BCL6 (B cell lymphoma 6). In the dark zone (DZ), centrocytes rapidly proliferate and undergo somatic hypermutation (SHM). This leads to affinity maturation of BCR for the antigen encountered. The B cell then circulates to the light zone (LZ) of the lymphoid follicle and is selected for high antibody affinity getting pro-survival signals from T helper (TH) cells and follicular dendritic cells (FDCs). Afterwards, the B cell either undergoes further rounds of SHM and proliferation in the DZ or stays in the LZ for class switch recombination (CSR). Cells with low affinity or non-functional BCR should undergo apoptosis. This is the cell stage in which research data suggests that Hodgkin lymphoma (HL) originates. After GCR is finished, cells either develop into memory B cells or, under the influence of PRDM1 (PR-domain-containing-1 with zinc finger domain), into plasma cells. Adapted by permission from Macmillan Publishers Ltd: Nature Reviews Immunology (Basso and Dalla-Favera 2015), copyright 2015.

1.2.3 Transcription factors in early B cell development and GCR During B cell development, a whole network of transcription factors and cytokines is required to promote B cell lineage commitment and regulate gene expression starting with Ikaros and PU.1 at very early stages (Matthias and Rolink 2005), and E2A, early B cell factor (EBF) and PAX5 essential for differentiation from common lymphoid progenitors (CLPs) into pro B cells (Shapiro-Shelef and Calame 2005; Matthias and Rolink 2005).

7 Introduction

1.2.3.1 BCL6 transcription factor GC formation and GC reactions are dependent on a complex network of interacting transcription factors and regulating molecules. One of them is B cell lymphoma 6 (BCL6), which plays an essential role in GC formation and maintenance and is thus named as master-regulator of GC reactions (Basso and Dalla-Favera 2010).

BCL6 encodes a POZ/zinc finger transcriptional repressor that is in control of a large transcriptional network during GC formation, maintenance and T cell dependent antibody responses (Basso and Dalla-Favera 2012; Chang et al. 1996; Ye et al. 1997). It was shown that B GC precursor cells that are deficient in upregulating BCL6 could not enter the follicle (Kitano et al. 2011). Originally, it was discovered because of its involvement in lymphomagenesis as the target of chromosomal translocations affecting chromosome 3q27 in DLBCL (Basso and Dalla-Favera 2012; Ye et al. 1993).

The expression level of BCL6 reaches its peak in GC B cells (Allman et al. 1996). However, a first peak can be also observed in a small proportion of B cells interacting with T cells in the interfollicular zone prior to GC formation (Basso and Dalla-Favera 2015; Kerfoot et al. 2011). Its essential role for GC initiation is to enable pre GC B cells to move to the center of the follicle (Dent et al. 1997; Fukuda et al. 1997). With its important function in GC initiation, BCL6 is considered to be a master-regulator of GC reactions. BCL6 binds to regulatory regions of thousands of genes associated with the GC B cell stage (Basso et al. 2010; Ci et al. 2009).

It enables the high proliferation rate and SHM in GC B cells targeting genes involved in DNA damage response, cell cycle control, and apoptosis (Hatzi and Melnick 2014). The genes targeted include TP53 (Phan and Dalla-Favera 2004), CDKN1A (Phan et al. 2005), ATR (Ranuncolo et al. 2007), and CHEK1 (Ranuncolo et al. 2008). Additionally, BCL6 controls genes involved in B cell signaling and B-T cell interaction (CD80 and CD274), preventing premature activation (Basso et al. 2010; Niu et al. 2003). Furthermore, BCL6 blocks terminal PC differentiation at the GC B cell stage repressing the master-regulators of PC differentiation PRDM1 and IRF4 (Shaffer et al. 2000; Tunyaplin et al. 2004). Among BCL6 targets are also the proto-oncogenes MYC and BCL2 critical for

8 Introduction lymphomas derived from GC B cells. They are frequently object to translocations or are aberrantly expressed in lymphomas (Ci et al. 2009; Saito et al. 2009). Further targets are involved in cellular pathways such as in interferon (IFN) and cytokine, toll-like receptor (TLR), transforming growth factor-β (TGF-β) and WNT signaling (Basso and Dalla-Favera 2015).

BCL6 expression is regulated via induction through IRF4, IRF8 and MEF2B (Ying et al. 2013; Ochiai et al. 2013) and is adjusted through an autoregulatory circuit: BCL6 binds to its own promoter and negatively regulates its own transcription (Pasqualucci et al. 2003; Basso and Dalla-Favera 2015). Downregulation of BCL6 to exit the GC and for further differentiation is accomplished through CD40- mediated activation of the NF-κB pathway leading to induction of IRF4 (Saito et al. 2007). Interestingly, IRF4 acts in a dose-dependent manner low levels promoting GC and higher levels ASC fate (Nutt et al. 2015).

1.2.3.2 Other important transcription factors during GCR Besides BCL6, further factors regulate GCR. MYC is a transcription factor that globally drives proliferation and cell division. However, in GCs, it is repressed by BCL6 in the rapidly proliferating centroblasts. MYC is required for GC formation and reentry into the DZ and is expressed in a bimodal pattern, induced in early GC initiation, suppressed in DZ B cells and re-expressed in a subset of LZ B cells recirculating to the DZ. Though, its distinct functions in this context are not yet fully understood (Dominguez-Sola et al. 2012; Calado et al. 2012; Klein et al. 2003).

REL as a downstream target of the canonical NF-κB pathway seems to be necessary for recirculation of centrocytes to the DZ and for establishing a metabolic program for cell growth (Heise et al. 2014; De Silva and Klein 2015) although the majority of GC B cells show no NF-κB and CD40 signaling which may favor apoptosis (Basso et al. 2004; Shaffer et al. 2001).

PAX5 is a transcription factor essential for maintaining B cell commitment in all subsequent stages until PC stage (Nutt et al. 2001; Shapiro-Shelef and Calame 2005). Its targets include genes critical to B cell identity such as components of the B cell receptor and IRF8 and it represses genes associated with the stem cell and non B cell lineage programs such as NOTCH1 and M-CSF (Recaldin and Fear 2016). It also directly suppresses one of the main regulators of PC differentiation,

9 Introduction

XBP1, preventing premature PC commitment (Nera et al. 2006). Though, for final PC differentiation, PAX5 must be suppressed by PRDM1 (Shapiro-Shelef and Calame 2005; Lin et al. 2002).

BACH2 is a transcription factor that is expressed throughout B cell development as well as in mature B cells. In PC cells, however, it is repressed. In GCs, it mainly functions as a PRDM1 repressor reinforcing the PAX5/BCL6 mediated block of PC differentiation and is positively regulated by PAX5 and BCL6 (Alinikula et al. 2011; Schebesta et al. 2007; Recaldin and Fear 2016). IRF8 contributes to induction of BCL6 expression and seems to have a role in GC initiation (Lee et al. 2006).

1.2.4 Transcription factors in terminal B cell differentiation A complex network of transcription factors also initiates and controls PC differentiation. The PC program requires expression of a multitude of genes as it was shown by transcriptome analysis (Shi et al. 2015).

In the process of PC differentiation, the key regulators of B cell phenotype are repressed including PAX5, BCL6, BACH2, and IRF8 whereas levels of factors promoting PC differentiation start to increase including IRF4, PRDM1, and XBP1 (Nera et al. 2015). One of the first steps in this process is the downregulation of PAX5, a critical factor to maintain B cell identity and for commitment of lymphoid progenitor stages to the B cell lineage (Cobaleda et al. 2007). IRF4 is essential for both GCR and PC differentiation. Acting in a dose dependent manner, low levels are necessary for maintenance of the GC program and CSR, whereas high expression promotes PC differentiation releasing PRDM1 repression by repressing BCL6 (Nutt et al. 2015).

XBP1 is a transcription factor that can be induced through ER stress. In B cells it is repressed by PAX5 and is activated after PAX5 downregulation during PC differentiation (Nutt et al. 2015). It activates genes regulating the secretory apparatus and thus Ig production, expands the size of the endoplasmatic reticulum and increases protein synthesis (Reimold et al. 2001; Shaffer et al. 2004).

10 Introduction

1.2.4.1 PRDM1 transcription factor PRDM1 (PR domain-containing 1, with zinc finger domain) / BLIMP-1 (B lymphocyte-induced maturation protein-1) is regarded as master-regulator of PC development controlling the transcriptional network of terminal B cell differentiation. Initially, it was discovered as a repressor of beta-interferon gene expression (Keller and Maniatis 1991) but its major role during B cell development became only clear afterwards (Turner et al. 1994; Shapiro-Shelef et al. 2003).

It is a member of the PRDM protein family inheriting the highly conserved PR domain (Xie et al. 1997) and is a subclass of the SET domain showing histone methyltransferase (HMT) activity (Dillon et al. 2005). The human BLIMP1 protein also contains five Krüppel-type zinc finger domains for DNA-binding located at the C terminal end of the protein, the consensus binding site called PRDI site, a proline-rich region and two acidic regions (Figure 2). Via its zinc finger motif and the proline rich region, Blimp-1 can act as a transcriptional repressor (Keller and Maniatis 1991) through association with corepressors such as Groucho family members (Ren et al. 1999), histone deacetylases (Yu et al. 2000) and the histone H3 methyltransferase G9a leading to a silencing histone modification (Gyory et al. 2004). The PRDI site with a size of 11bp and the sequence (A/C)AG(T/C)GAAAG(T/C)(G/T) has analogies to the binding sites of IRF (interferon regulatory factor)1 and IRF2 and the ability to bind to the same regulatory sites (Kuo and Calame 2004; Boi et al. 2015).

In humans, BLIMP-1 is encoded by the PRDM1 gene located on chromosome 6q21-q22.1 (Mock et al. 1996).

11 Introduction

Figure 2: Schematic illustration of genomic structure and the two isoforms PRDM1α PRDM1β regarding functional domains and differences. The PRDM1β form lacks exons 1 to 3 and the N-terminal 101 amino acids but inherits exon 1β between 3 and 4 compared to PRDM1α. PR domain: positive regulatory domain, PRDM1: PR domain-containing 1 with zinc finger domain. Colors used in the diagram: Purple: PR domain, green: proline rich region, blue: DNA binding domain containing 5 Krüppel-type zinc finger domains, grey: acidic region. See Gyory et al. 2003 and Hangaishi and Kurokawa 2010.

The two major isoforms BLIMP-1α and BLIMP-1β originate from alternative transcription start sites (Figure 2). The full-length form is called BLIMP-1α. The shorter form BLIMP-1β lacks 101 amino acids at the amino terminal end and exons 1-3 leading to a disrupted PR domain and a loss of repressive activity on multiple target genes (Gyory et al. 2003). However, several qualities are conserved. It still has the ability for DNA binding, localizing to the nucleus, can associate with histone deacetylases, and exhibit deacetylase activity (Gyory et al. 2003).

In B cell development, PRDM1 is a transcriptional repressor that promotes final differentiation (Nutt et al. 2007; Nutt et al. 2015). In the B cell lineage, it is solely expressed in antibody secreting cells: at lower levels in plasmablasts and higher levels in long-lived PCs (Kallies et al. 2004; Soro et al. 1999; Angelin-Duclos et al. 2000). Different studies have shown that PRDM1 is required for normal PC differentiation and immunoglobulin (Ig) secretion (Shapiro-Shelef et al. 2003; Savitsky and Calame 2006). Shapiro-Shelef and collegues created mice with B cell specific deletion of Prdm1. Consistent with the expression pattern of PRDM1 mentioned above, this deletion resulted in normal peripheral B cell subsets and GC formation

12 Introduction upon T cell dependent antigen stimulation but strongly reduced secretion of all immunoglobulin isotypes and the absence of different types of ASCs in response to both T-dependant and -independent antigens (Shapiro-Shelef et al. 2003). Additionally, PRDM1 can induce plasmablastic features in transfected B cell lines in vitro (Turner et al. 1994). However, it was shown that the initial step of PC differentiation occurs independently of PRDM1 and is the result of PAX5 inactivation (Kallies and Nutt 2007). Thus, PRDM1 seems to be essential for further PC differentiation and high immunoglobulin production but not for the initiation of antibody secretion (Kallies et al. 2007; Klein and Dalla-Favera 2007). Many functions of PRDM1 have been found in ASCs including the repression of the key factors regulating the B cell transcriptional program such as BCL6 and PAX5 (Shaffer et al. 2002; Lin et al. 2002), induction of the secretory machine via de-repression of XBP1 (Reimold et al. 2001; Shaffer et al. 2004) and downregulation of factors involved in cell proliferation such as MYC (Lin et al. 1997).

1.3 FOXO family of transcription factors 1.3.1 Structure and general information Forkhead box O (FOXO) proteins belong to the FOX superfamily forming a group of transcriptional regulators named after the Drosophila melanogaster gene fork head (fkh) in which mutations lead to ectopic head structures in the fruitfly’s embryos (Weigel et al. 1989). They all have a highly evolutionarily conserved fork- head domain in common. This approximately 100 amino acid long DNA-binding domain is composed of three α-helices, three β-sheets and two winged regions surrounding one of the β-sheets (Clark et al. 1993). Based on sequence homology they are further divided into 19 subfamilies from FOXA to FOXS (Kaestner et al. 2000; Hannenhalli and Kaestner 2009).

FOXO proteins are conserved among different species. The FOXO subgroup in mammals consists of four members: FOXO1, FOXO3, FOXO4 and FOXO6. In invertebrates, however, there is only one FOXO species known to date: the orthologues DAF-16 in Caenorhabditis elegans (Ogg et al. 1997) and dFOXO in Drosophila melanogaster (Hwangbo et al. 2004; Giannakou et al. 2004).

13 Introduction

FOXO1, FOXO3 and FOXO4 are ubiquitously distributed at varying expression levels depending on tissue (Anderson et al. 1998; Biggs et al. 2001; Furuyama et al. 2000) whereas FOXO6 expression is restricted to the central nervous system (Jacobs et al. 2003).

Figure 3: Schematic structure of FOXO proteins. To point out main structural elements of FOXO proteins FOXO3 was drawn schematically highlighting regulatory elements. C: C-terminal end, DNA Binding: DNA binding domain (purple), N: N-terminal end; NES: Nuclear export sequence (orange); NLS: Nuclear localization signal (green), Transactivation domain (blue). See Obsil and Obsilova 2008.

The main structural elements of FOXO proteins are the DNA-binding domain localized to the N-terminal position, which recognizes the FOXO consensus DNA sequence 5’-GTAAA(T/C)AA-3’ (or 5’-TT(A/G)TTTAC-3’) (Figure 3) (Furuyama et al. 2000; Hedrick et al. 2012), the transactivation domain located in the C-terminal end, a nuclear localization signal and a nuclear export sequence for transport between the nucleus and the cytosol (Brownawell et al. 2001; Fu and Tindall 2008).

Besides the consensus sequence mentioned above, FOXO proteins can also bind to the insulin response element 5’(C/A)(A/C)AAA(C/T)AA-3’ with lower affinity (Brent et al. 2008).

The conserved functional structure among FOXO transcription factors mentioned above points towards some redundancy regarding interaction and binding partners (Eijkelenboom and Burgering 2013).

1.3.2 Functions of FOXOs FOXO transcription factors respond to a variety of stimuli including growth factors, oxidative stress, inflammation, and nutritional imbalances (Hedrick et al. 2012). They regulate versatile transcriptional programs affecting embryonal development,

14 Introduction longevity, cell cycle arrest, metabolism, homeostasis, and tumor suppression (Calnan and Brunet 2008; Eijkelenboom and Burgering 2013). They are at the branch point of numerous signaling pathways and function as integrators of information from multiple upstream pathways. Figure 4 gives a quick overview of important FOXO functions which will be discussed in more detail in the following paragraphs stressing their role in the immune system, in apoptosis and in cancer development.

Figure 4: Major functions of FOXO transcription factors and mediating target genes. FOXO proteins play a critical role in regulating a wide range of cellular and organismal processes: in apoptosis, cell cycle control and DNA repair, in inflammation, B cell development, differentiation, angiogenesis, glucose metabolism and oxidative detoxification. An overview of its major target genes involved is given above. Further details are explained in the following paragraphs. BIM: BCL-2‑ interacting mediator of cell death, BCL6 B cell lymphoma 6, DDB1: DNA damage-binding protein 1, FasL: Fas ligand, GADD45A: growth arrest and DNA damage inducible 45 α, IL-7R: interleukin-7 receptor, MnSOD: manganese superoxide dismutase, RAG1 and RAG2: recombination activating gene 1 and 2, TRAIL: tumor necrosis factor related apoptosis inducing ligand. Adapted by permission from Macmillan Publishers Ltd: Oncogene (Greer and Brunet 2005), copyright 2005.

15 Introduction

1.3.3 FOXOs in cell cycle arrest, apoptosis and oxidative stress FOXO proteins negatively regulate cell proliferation by inducing the expression of cell cycle inhibitors that control the G1/S phase transition including p21 and (de Keizer et al. 2010), p27 (Dijkers et al. 2000b). They also function as gatekeepers at the G2/M check point in cell cycle allowing DNA repair in stress response (Ho et al. 2008). Deficiencies can lead to genomic instability and carcinogenesis through subsequent accumulation of mutations (Lobrich and Jeggo 2007). The regulated genes include GADD45A (Tran et al. 2002) and Cyclin G2 (Fu and Peng 2011). FOXOs also actively promote apoptosis via genes such as FASL (Brunet et al. 1999) and TRAIL (Modur et al. 2002). Additionally, there are also members of the BCL2 family modulated by FOXOs including the activation of BIM, (Essafi et al. 2005) a pro-apoptotic target gene, and the suppression of the prosurvival gene BCL-XL via the regulation of BCL6 promoting intrinsic mitochondrial apoptosis (Fu and Tindall 2008; Tang et al. 2002).

In accordance with their role in cell cycle arrest, FOXO factors also upregulate genes involved in DNA repair (Ramaswamy et al. 2002; Tran et al. 2002) and help with detoxification of reactive oxygen species (ROS) (Kops et al. 2002; Nemoto and Finkel 2002). They are produced in peroxisomes and mitochondria during oxidative stress by upregulation of scavenger enzymes such as catalase and manganese superoxide dismutase (MnSOD). Prohibiting ROS accumulation in cells, FOXO may contribute to the prevention of tumorigenesis (Liu et al. 2005; Yang and Hung 2009).

1.3.4 FOXOs in B cell development and function In addition to the already mentioned role of FOXO proteins in cell cycle arrest and apoptosis, they fulfill an important task in the immune system (Dejean et al. 2011). They have specific functions in B cell progenitor commitment, development of early precursors, and terminal differentiation as well as peripheral B cell function (Szydlowski et al. 2014).

FOXO1 exerts some non-redundant roles during B cell development (Ushmorov and Wirth 2017). Selective FOXO1 deletion at early stages in B cell development led to impairment of differentiation and B cell function (Dengler et al. 2008). It promotes B cell lineage commitment in common lymphoid progenitor cells (Nutt

16 Introduction and Kee 2007; Lin et al. 2010). In pro-B cells, FOXO1 promotes IL-7 signaling via expression of IL-7Rα (Dengler et al. 2008). It induces the recombination of IgH gene segments through activation of RAG1 and RAG2 enabling V(D)J recombination (Amin and Schlissel 2008; Dengler et al. 2008). Furthermore, it initiates CSR and SHM driving antibody affinity maturation in peripheral B cells (Dengler et al. 2008; Omori et al. 2006).

For FOXO3, it was reported that germline inactivation of FOXO3 does not impair the generation of early B cells or differentiation into peripheral B cells and it was also shown with microarray studies that FOXO3 levels do not vary during B cell development whereas there is a strong upregulation of FOXO1 in early pro-B cells as reviewed by Dengler et al. (Hystad et al. 2007; Rumfelt et al. 2006; Dengler et al. 2008). However, gene expression profiling conducted by another group showed strongly increasing FOXO3 levels during PC differentiation (Tooze 2013).

1.3.5 Regulation of FOXOs FOXO proteins act in a context-sensitive manner depending on type of posttranslational modifications (PTMs) (Hedrick et al. 2012). PTMs include phosphorylation, acetylation, methylation, O-linked glycosylation and ubiquitination (Calnan and Brunet 2008; Hedrick 2009). This ‘FoxO code’ (Calnan and Brunet 2008) determines the level, activity and transcriptional specificity of FOXOs within the cell by conformational changes and the creation of specific recognition sequences for binding (Calnan and Brunet 2008).

PTMs are accomplished mainly by two major signaling pathways, the protein kinase B (PKB)- and Jun-N-terminal kinase (JNK)-pathway.

In order to obtain an inactive state of FOXO during normal cell growth, a negative regulation by insulin and growth factors is initiated through the PKB-pathway (Eijkelenboom and Burgering 2013). The activation via growth factor receptor tyrosin kinases leads to the production of phosphatidylinositol-3-phosphate creating a membrane-binding site for AKT and SGK1 which are then phosphorylated by PDPK1 and mTORC2 (Brunet et al. 2001; Guertin et al. 2006). AKT or SGK1 then phosphorylates FOXO at three consensus sites (at Thr24, Ser256, Ser319) (Kops et al. 1999) allowing the binding of 14-3-3 chaperon proteins leading to nuclear exclusion. In the cytoplasm, FOXOs stay sequestered

17 Introduction in a reversible inactive state or are polyubiquitinated and degraded (Brunet et al. 1999; Hedrick et al. 2012).

In contrast, stress stimuli promote the re-localization of FOXO proteins into the nucleus where FOXOs function as transcription factors. This opposing regulatory pathway is also mediated by phosphorylation.

Mammalian STE20-like kinase 1 (MST1) phosphorylates FOXOs at Ser 207 and JUN N-terminal kinase 1 (JNK) at Thr 447 and Thr451 disturbing the interaction with 14-3-3 chaperon proteins and thus enable the re-localization into the nucleus (Essers et al. 2004; Lehtinen et al. 2006; Oh et al. 2005).

Besides, there are also regulatory mechanisms at transcriptional level (Essaghir et al. 2009), through microRNA (miRNA) and cofactor binding (Calnan and Brunet 2008; Fu and Tindall 2008). FOXOs can bind several nuclear receptors (e.g. androgen receptor, oestrogen receptor), and other molecules such as SMAD, STAT, PPAR, RUNX, and TP53 transcription factors (Eijkelenboom and Burgering 2013; van der Vos and Coffer 2008).

Additionally, regulation through miRNA binding also plays a role at post- transcriptional level. A growing number of miRNAs influencing FOXO localization and transcriptional activity are discovered. These findings show that miR-96, miR- 182 and miR-183 are regulators of FOXO transcription factors in several malignomas including HL (Xie et al. 2012), breast cancer (Guttilla and White 2009) and endometrial cancer (Myatt et al. 2010). Other miRNAs inhibiting FOXOs are miR-155 (Yamamoto et al. 2011) and miR-370 (Wu et al. 2012).

1.3.6 FOXOs and tumorigenesis There is evidence that FOXO transcription factors have a role in tumorigenesis. FOXOs were identified as genes involved in oncogenic chromosomal translocations. In particular, FOXO1 gene is either fused to the PAX3 or PAX7 gene in alveolar rhabdomyosarcoma (Galili et al. 1993; Davis et al. 1994; Barr 2001) giving the fusion protein more potent transcriptional activity than the wild type form (Fredericks et al. 1995). Besides, the FOXO3 gene at 6q21 and the FOXO4 gene at Xq13.1 are fused to the MLL gene in acute leukemia (Borkhardt et al. 1997; Hillion et al. 1997). Point mutations of FOXO1 gene are often present in

18 Introduction

NHL (Morin et al. 2011; Trinh et al. 2013) and correlate with a lower overall survival rate in patients (Coomans de Brachene and Demoulin 2016).

At the same, FOXOs can promote proliferation and survival in leukemic cells playing an essential role in the maintenance of leukemia-initiating cells (LICs) in CML (Naka et al. 2010) as well as in AML (Sykes et al. 2011) where high FOXO3a expression was also linked to a poorer prognosis in patients (Santamaria et al. 2009). However, in other tumor entities, the role of FOXOs is contradictory: In glioblastoma and colon cancer FOXO activation leads to apoptosis in stem cell-like cells (Sunayama et al. 2011; Prabhu et al. 2015).

Considering the already mentioned role of FOXO in the regulation of apoptosis, stress resistance, and cell cycle control, FOXO proteins could also function as tumor suppressors. Cancer cells may exhibit a higher level of cellular stress implying increased ROS levels. Under normal conditions, FOXO proteins can prohibit genomic instability and tumor suppression via cell cycle arrest and initiation of apoptosis. This notion is supported by the findings that a broad somatic deletion of all FOXO alleles leads to the occurrence of thymic lymphomas and hemangiomas (Paik et al. 2007).

Furthermore, FOXOs are inactivated in a wide range of malignomas including breast cancer (Hu et al. 2004), prostate cancer (Modur et al. 2002), different B cell lymphomas (Obrador-Hevia et al. 2012; Xie et al. 2012; Xie et al. 2014) and leukemia (Parry et al. 1994).

In different studies, reactivation of FOXO transcription factors either by ectopic expression or inhibition of PI3K in cancer cells, led to cell death (Ciechomska et al. 2003; Essafi et al. 2005; Yamamura et al. 2006). Additionally, it was reported that FOXO3A interacts with the tumor suppressor TP53, promotes the nuclear localization of TP53 and ultimately induces mitochondria-dependant apoptosis (You et al. 2006; Wang et al. 2008).

Furthermore, FOXO transcription factors can also take part in oncogene-induced cellular senescence limiting tumor progression in responsive cell types through a negative feedback loop upon constitutive RAS activation (Courtois-Cox et al. 2006).

19 Introduction

1.3.6.1 Role of FOXOs in deregulation of oncogenic pathways FOXO proteins function downstream of several pathways that are deregulated in cancers. Three oncogenic kinases (AKT, IKK and ERK) inactivate FOXO activity by phosphorylation at specific sites (Yang et al. 2008). The PI3K-AKT pathway is often constitutively active in cancers by activating mutations in the catalytic subunit α of PI3K (PIK3CA) (Samuels et al. 2005) or AKT (Carpten et al. 2007) or loss-of- function mutations of PTEN (Nakamura et al. 2000). The hyperactivity of PI3K- AKT leads to FOXO inactivation. Knockdown of PTEN or overexpression of PIK3CA leads to rescue from apoptosis in BCR-negative B cells (Srinivasan et al. 2009). Our group has shown that constitutive activation of AKT and ERK contributes to FOXO1 repression in cHL (Xie et al. 2012).

Constitutive activation of the RAS-MEK-ERK pathway is common in human cancers. In particular activating mutations of RAS or B-RAF are frequent in different tumor entities (Roberts and Der 2007). Constitutive ERK activity promotes tumorigenesis through phosphorylation and polyubiquitination of FOXO by MDM2 and subsequent degradation (Yang et al. 2008). The IKK activation also induces nuclear exclusion of FOXO and its degradation by proteasomes (Hu et al. 2004). In AML constitutive IKK activity was found as one mechanism contributing to leukemogenesis (Chapuis et al. 2010).

20 Introduction

1.4 Aims of the study The aim of the study was to investigate the role of FOXO3 in the oncogenic program of cHL. Our group had already identified FOXO1 as a tumor suppressor in cHL (Xie et al. 2012) and was able to find the underlying mechanisms that induce FOXO1 mediated growth arrest. Previously, we have shown that the master-regulator of PC differentiation, PRDM1, is induced by FOXO1 (Vogel et al. 2014).

Since FOXO proteins negatively regulate cell proliferation (Dijkers et al. 2000b) and promote apoptosis in cellular stress response (Eijkelenboom and Burgering 2013), FOXO3 activation in cHL may have similar effects.

FOXO3 has already been described as tumor suppressor in other lymphoid malignancies (Karube et al. 2011; Obrador-Hevia et al. 2012) and the consensus DNA sequence is strongly conserved among FOXO proteins (Furuyama et al. 2000). Thus, I wanted to investigate whether FOXO3 induces similar target genes or whether it has tumor suppressive effects in cHL as we have already shown for FOXO1 (Xie et al. 2012; Vogel et al. 2014). Supportingly, publications of the group of Steidl et al. reveal that in gene expression analysis of a set of microdissected HRS cells, deletions of the FOXO3 locus were detected in 18.9 % of samples (Steidl et al. 2012). This further suggests that FOXO3 is a potential tumor suppressor in HL.

Therefore, my specific aims to investigate the role of FOXO3 in cHL were:

- To study the influence of FOXO3 on pro-apoptotic targets in cHL - To investigate whether low PRDM1 levels in HL are due to codeletion of FOXO3 and PRDM1 or due to regulation by FOXO3 - To study the role of FOXO3 on PRDM1 and BCL6 expression in cHL

21 Material and methods

2 Material and methods

2.1 Materials 2.1.1 Cell lines Table 1: List of cell lines. cHL: classical Hodgkin lymphoma, DLBCL: diffuse large B cell lymphoma, FBS: fetal bovine serum, FL: follicular lymphoma, h.i.: heat inactivated, PMBL: primary mediastinal B cell lymphoma.

Cell line Origin Culture medium

Daudi 90 % RPMI 1640 + 10 % Burkitt lymphoma h.i. FBS 90 % RPMI 1640 + 10 % Follicular lymphoma (FL) DOHH2 h.i. FBS

Karpas-1106 Mediastinal lymphoblastic B cell 90 % RPMI 1640 + 10 % lymphoma h.i. FBS Karpas-422 Diffuse large B cell lymphoma 80 % RPMI 1640 + 20 % (DLBCL) h.i. FBS KM-H2 cHL, mixed cellularity type, B cell 90 % RPMI 1640 + 10 % derived h.i. FBS L-1236 cHL, mixed cellularity type B cell 90 % RPMI 1640 + 10 % derived h.i. FBS Classical Hodgkin lymphoma L428 90 % RPMI 1640 + 10 % (cHL), nodular sclerosis type, B h.i. FBS cell derived L540 cHL, nodular sclerosis type, T cell 80 % RPMI 1640 + 20 % derived h.i. FBS MedB-1 Primary mediastinal B cell 90 % RPMI 1640 + 10 % lymphoma (PMBL) h.i. FBS Namalwa 90 % RPMI 1640 + 10 % Burkitt lymphoma h.i. FBS Raji 90 % RPMI 1640 + 10 % Burkitt lymphoma h.i. FBS Ramos 80 % RPMI 1640 + 20 % Burkitt lymphoma h.i. FBS B cell precursor leukemia 90 % RPMI 1640+ 10-20 % REH h.i. FBS GCB-like lymphoma 80-90 % RPMI 1640 + 10- SU-DHL5 20 % h.i. FBS cHL, nodular sclerosis/lymphocyte SUP-HD1 80 % RPMI 1640 + 20 % depleted type, h.i. FBS B cell derived U-HO1 cHL, nodular sclerosis type, B cell 80 % IMDM + 20 % h.i. derived FBS 90 % RPMI 1640 + 10 % WSU-NHL Follicular lymphoma (FL) h.i. FBS

22 Material and methods

Cell lines were cultured in RPMI 1640 medium or IMDM medium depending on cell type (Table 1). As supplements 10 % or 20 % heat-inactivated fetal bovine serum, penicillin (100 U/mL), streptomycin (100 µg/mL), 2 mM L-glutamine, and 50 µM 2- mercaptoethanol were added, and cells were cultured at 37°C and 5 % CO2.

2.1.2 General chemicals General chemicals were obtained from the following companies:

 Applichem (Germany)  Fluka (Switzerland)  Invitrogen (UK)  Merck (Germany)  Roth (Germany)  Sigma-Aldrich (Germany)

2.1.2.1 Reagents and enzymes Table 2: List of reagents and enzymes

Reagents and enzymes Company iQtm SYBR® Green Supermix BioRad, USA M-MLV reverse transcriptase Promega, Germany RNasin Plus RNase inhibitor Promega, Germany West Dura Extended Duration Thermo Fisher Scientific, USA Substrate

2.1.2.2 Buffers Table 3: PBS buffer. dd: double distilled, PBS: phosphate-buffered saline.

10X PBS buffer NaCl 87.7 g

Na2PO4 11.7 g KCl 2 g

KH2PO4 2.4 g dd H2O to 1000 ml pH 7.3-7.4

23 Material and methods

Table 4: SDS-running buffer. dd: double distilled, SDS: sodium dodecyl sulfate, Tris: trisaminomethane.

SDS-running buffer Tris 12.1 g glycine 57.6 g 20 % SDS 20 ml dd H2O to 4000 ml

Table 5: Immunoblot running gel. APS: ammonium persulfate, dd: double distilled, SDS: sodium dodecyl sulfate, TEMED tetramethylethylenediamine, Tris: trisaminomethane.

Immunoblot running gel (7.5 % polyacrylamid) 40 % acrylamid/methyl-bisaceylamid 4.2 ml (37.5:1) 1.5 M Tris/HCl pH 8.8 5.625 ml dd H2O 12.3 ml 20 % SDS 225 µl 10 % APS 200 µl TEMED 15 µl

Table 6: Immunoblot stacking gel. APS: ammonium persulfate, dd: double distilled, SDS: sodium dodecyl sulfate, TEMED tetramethylethylenediamine, Tris: trisaminomethane.

Immunoblot stacking gel (5 % polyacrylamid) 40 % acrylamid/methyl-bisaceylamid 1.25 ml (37.5:1) 0.5 M Tris/HCl pH 6.8 2.55 ml dd H2O 6.15 ml 20 % SDS 50 µl 10 % APS 200 µl TEMED 13.5 µl

24 Material and methods

Table 7: Semi-dry transfer buffer. dd: double distilled, SDS: sodium dodecyl sulfate, Tris: trisaminomethane.

Semi-dry transfer buffer Tris 5.8 g glycine 2.9 g 20 % SDS 1.85 ml methanol 200 ml dd H2O to 1000 ml

Table 8: Laemmli buffer. dd: double distilled, SDS: sodium-dodecyl sulfate.

Laemmli buffer glycerol 10 % 10 ml urea 6 M 36 g 0.5 M Tris (pH 6.8) 62.5 mM 12.5 ml 5 % bromophenol blue 0.004 % 80 µl SDS 2 % 2 g β- mercaptoethanol 5 % 5 ml dd H2O to 1000 ml

2.1.2.3 Cell culture materials Table 9: Cell culture materials. 4-OHT: 4-hydroxytamoxifen, FBS: fetal bovine serum.

Cell culture materials Company 4-hydroxytamoxifen (4-OHT) Calbiochem, Germany FBS PAA, Austria G418 sulfate Calbiochem, Germany IMDM PAN Biotech, Germany L-glutamine Gibco, Life Technologies, UK penicillin/streptomycin Gibco, Life Technologies, UK RPMI Gibco, Life Technologies, UK

25 Material and methods

2.1.2.4 Kits Table 10: Kits

Kits Company Cell line nucleofector kit V Lonza, Germany Dual-Luciferase Reporter Assay Promega, Germany System High Pure RNA Isolation kit Roche Applied Science, Germany

2.1.2.5 Vectors Table 11: Vectors

Vectors Company pcDNA3.1 (+) Invitrogen, Life Technologies, USA pGL4.20 Promega, Germany

2.1.2.6 Antibodies Table 12: Antibodies. BCL6: B cell lymphoma 6, PRDM1: PR domain-containing 1 with zinc finger domain, TUBB: β-tubulin.

Antibodies Company anti-BCL6 #4242 Cell Signaling, USA anti-mouse s#c-2005 Santa Cruz, USA anti-PRDM1 #648202 BioLegend, UK anti-rabbit #31460 Thermo Fisher Scientific, USA anti-TUBB #ab6046 Abcam, UK

26 Material and methods

2.1.2.7 Plastic ware Table 13: Plastic ware

Plastic ware Company 6-well non-tissue culture treated Becton Dickinson, Falcon, USA plate cell culture flasks (25 cm2, 75 cm2) Greiner Bio-One, Germany Petri dishes Becton Dickinson, Falcon, USA

2.1.2.8 Laboratory equipment Table 14: Laboratory equipment

Laboratory equipment Company Amaxa Nucleofector Lonza, Germany Cell culture Incubator Hera-Safe Thermo Scientific, Heraeus, USA Gene Pulser II BioRad Laboratories, Germany Light Cycler 480 Roche Applied Science, Germany Lumat LB 9507 tube luminometer Berthold Technologies, Germany Nanodrop 1000 spectrophotometer Thermo Scientific, USA Thermocycler/ Primus 96 plus MWG Biotech, Germany Vi-CELL XR cell counter Beckman Coulter, USA

2.1.2.9 Software Table 15: Software

Software Company GenScript online software GenScript Biotech Corporation, China Office Professional 2010 plus Microsoft, USA Prism 6 GraphPad Software, Inc., La Jolla, CA

27 Material and methods

2.1.2.10 Other materials

Table 16: Other materials. ECL: enhanced chemoluminescence, dNTP: deoxyribonucleotide triphosphate.

Materials Company Ampuwa water Fresenius Kabi, Germany dNTPs Genaxxon, Germany Fuji medical X-ray film Fuji, Japan nitrocellulose membrane, Hybond Amersham, Germany ECL PageRuler prestained protein ladder Fermentas Life Sciences, USA primers Biomers, Germany

28 Material and methods

2.2 Methods 2.2.1 FOXO3 induction

For research on the role of FOXO3 in cHL, I used a constitutively active form of FOXO protein already established for FOXO1 in our laboratory (Xie et al. 2014). A fusion protein of FOXO3 and the ligand binding domain of an estrogen receptor was cloned in-frame into the lentiviral vector pcDNA3.1 by a member of our laboratory. The fusion protein used was obtained from pBABE-FOXO3(A3)ER vector (Bakker et al. 2007) donated by PJ Coffer (Utrecht, Netherlands). In this vector, AKT-phosphorylation sites were mutated to alanine leading to a constitutively active form of FOXO3. It was brought into the cell lines L428 and KM-H2 with help of a nucleofector device (Lonza, Germany). The obtained cell lines were named L428 FOXO3(AAA)ER and KM-H2 FOXO3(AAA)ER. Since pcDNA-FOXO3(A3)ER also inherits a gene leading to G418 sulfate resistance we used this property for selection adding 1 mg/mL.

By adding 4-hydroxytamoxifen (4-OHT), a selective estrogen receptor modulator (SERM), to a final concentration of 200 nM, the fusion protein translocates into the nucleus activating transcription of the FOXO3 target genes. As a control, cell lines transfected with empty vector were used.

For experiments, 2.0 x 106 cells were harvested and resuspended in 10 ml of the medium described above. After 2 hours of incubation time, 4-OHT was added to a final concentration of 200 nM. After additional 24 hours, total RNA and protein were extracted.

2.2.2 RNA isolation and qRT-PCR

Total RNA was isolated from 1 x 106 cells using the High Pure RNA Isolation Kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions. RNA quality was tested with Nanodrop 1000 spectrophotometer (Thermo Scientific, USA).

Reverse transcription was performed by adding 0.5 µg of oligo (dT)18 primer to 2 µg of RNA incubating at 70°C for 5 minutes to melt the secondary structure of the sample. After cooling on ice, first-strand cDNA was synthesized using Moloney

29 Material and methods murine leukemia virus reverse transcriptase (Promega, Madison, WI) incubating at 42 °C for 1 hour.

2.2.2.1 qRT-PCR The quantitative real time PCR was performed by a LightCycler 480 real-time PCR instrument using the iQtm SYBR® Green Supermix (Bio-Rad, USA) for probe amplification. All samples were measured in duplicates. Primers were designed with the Genscript online software (www.genscript.com) and synthesized by biomers.net (Ulm, Germany).

Samples were used at a 10:1 dilution with nuclease-free H20. A 10 µl reaction volume contained 5 µl iQ SYBR Green Supermix, 0.5 µM of both the forwards and reverse primer, and 1µl of cDNA sample. Annealing temperature was 60 °C.

The qRT-PCR was run with the following program:

Table 17: qRT-PCR program. qRT-PCR: quantitative real-time polymerase chain reaction.

Number of cycles Temperature Time 1 cycle 95°C 15 min

40 cycles 94°C 15 sec 60°C 30 sec 72°C 30 sec

1 cycle 95°C 1 sec 65°C 15 sec 95°C 40°C 30 sec

Relative changes of gene expression were calculated with the comparative CT -ΔΔC method (2 T) using the following formula (Livak and Schmittgen 2001)

ΔΔCT = (CT,Target- CT,RPL13A)Time x-( CT,Target-CT, RPL13A)Time 0. (1)

RPL13A served as internal control gene. Sequences of the primers used are documented in the following chart.

30 Material and methods

2.2.2.2 Sequence of primers used Table 18: Primers. BAK: BCL2-antagonist/killer, BCL6: B cell lymphoma 6, BIM: BCL- 2‑ interacting mediator of cell death, PRDM1α: PR domain-containing 1α with zinc finger domain, RPL13A: ribosomal protein 13a.

Gene Primers for-5´- GGTCCTGCTCAACTCTACCC BAK rev-5´- CCTGAGAGTCCAACTGCAAA for-5´- GTACAGTGGCCTGTCCACAC BCL6 rev-5´- ACATCCCGAAACTCCTCATC for-5´- ACTCTCGGACTGAGAAACGC BIM rev-5´- CCTTCTCGGTCACACTCAGA for-5´- GTTCAATGGGAGCTTGGAAT FOXO3 rev-5´- TGTGGAGATGAGGGAATCAA for-5´- GCTGGAAGTCGAGTGTGCTA NOXA rev-5´- CAGTCAGGTTCCTGAGCAGA for-5´- GGAGGATGCGGATATGACTC PRDM1α rev-5´- GGGTGGTCGTTCACAATGTA for-5´- CGGACCGTGCGAGGTAT RPL13A rev-5´- CACCATCCGCTTTTTCTTGTC

2.2.3 Preparation of the protein samples and immunoblot

For the whole cell lysates 1x 106 cells were harvested and washed with PBS. For lysis, 100 µl of Laemmli buffer containing 6 M urea and 5 % β-mercaptoethanol was added and incubated at 100°C for 10 minutes.

2.2.3.1 Polyacrylamide gel electrophoresis (PAGE) The protein samples were loaded into wells of a 7.5 % SDS-polyacrylamide gel in running buffer and separated through gel electrophoresis according to their molecular weight. The buffer was prepared with 25 mM Tris, 200 mM glycine and 0.1 % SDS. A voltage of 80 V was applied along the gel.

The separated proteins were transferred in transfer buffer on a 0.45 µm nitrocellulose membrane at 80 V for 65 minutes at 4 °C. Buffers used are documented in table 3 to 8.

31 Material and methods

To prevent non-specific binding, the membrane was blocked with 5 % nonfat milk in PBS at 37°C for 15 minutes. For detection, the membrane was probed with primary antibodies for the proteins of interest as listed in table 19 and incubated under gentle agitation at 4°C over night. For the β-Tubulin antibody, 1 hour of incubation time at room temperature was used.

The following day, the membrane was washed with PBS followed by two additional washing steps with PBS Tween (containing 0.05 % Tween-20) and one more with PBS. Each step lasted 5 min under gentle agitation. Afterwards, the secondary antibody linked to the reporter enzyme horseradish peroxidase (HRP) was added and incubated for 1 hour at room temperature (table 20). To wash the unbound antibody away, the membrane was washed again according to the steps described above. To visualize the proteins of interest, the membrane was treated with SuperSignal West Dura Extended Duration Substrate and developed in the dark room captured on a Fuji medical X-ray film.

2.2.3.2 Antibodies used for protein detection in immunoblot Table 19: Primary antibodies. BCL6: B cell lymphoma 6,BSA: bovine serum albumin, PBS: phosphate-buffered saline, PRDM1: PR domain-containing 1 with zinc finger domain, TUBB: β- tubulin.

Antibody Species Dilution Diluent BCL6 rabbit 1:1000 PBS, 5 % nonfat milk PRDM1 mouse 1:100 PBS, 2 % BSA TUBB rabbit 1:15 000 PBS, 5 % nonfat milk

Table 20: Secondary antibodies. PBS: phosphate-buffered saline.

Antibody Species Dilution Diluent mouse goat 1:5000 PBS with 5 % nonfat milk rabbit goat 1:10000 PBS with 5 % nonfat milk

32 Material and methods

2.2.4 Electroporation and luciferase reporter assay

Electroporation is a physical method that can introduce external molecules such as DNA into cells. Short electric impulses are applied making the cell membrane transiently more permeable (Neumann et al. 1982).

This artificial DNA transfer was used to study the role of FOXO3 in PRDM1α and PRDM1β promoter activation. The pGL4.20 served as reporter vector either expressing 5 copies of the consensus forkhead response element, the FOXO1 core promoter, PRDM1α or PRDM1β promoter (Vogel et al. 2014).

1x107 L428-FOXO3(AAA)ER cells were harvested and resuspended in 280 µl of culture medium. For transient transfection, 15 µg of a vector expressing either PRDM1α or PRDM1β promoter region or empty vector as negative control were added as well as 50 ng of a plasmid expressing Renilla luciferase reporter under the control of the ubiquitin promoter (Baumann et al. 2002; Vogel et al. 2014). Renilla luciferase activitiy served as reference and was measured to normalize for differences in transfection efficiencies (Maier et al. 2003). Cells were transfected using a Gene Pulser II device at 0,975 µF and 250 V.

After electroporation, cells were promptly resuspended in 10 ml of culture medium in 10 cm plates at 37 °C. After 2 hours, cells were treated either with or without 4- OHT incubating for 24 hours.

2.2.4.1 Luciferase reporter assay After 24 hours, luciferase activity was measured using the Dual-Luciferase Reporter Assay System with further preparation of the cells according to the manufacturer’s manual. For detection of luciferase activity, the Lumat LB 9507 tube luminometer was used. Firefly luciferase activity was normalized to the Renilla luciferase activity.

33 Material and methods

2.2.5 Correlation analysis 2.2.5.1 Correlation of gene expression To investigate the correlation between FOXO3 and PRDM1 gene expression, we reanalysed already published data obtained by Steidl and his group (Steidl et al. 2012). They generated gene expression profiles of 29 HL cases examining microdissected HRS cells. The data was obtained from http://www.ncbi.nlm.nih.gov/geo/ ; GSE39133 (Steidl et al. 2012). The probe sets (Human Genome U133 Plus 2.0 Array) FOXO3-224891_at and PRDM1- 228964_at were used for correlation analysis. Correlation analysis was performed using Prism 6 software (GraphPad Software, Inc., La Jolla, CA). P-values <0.05 were considered statistically significant.

2.2.5.2 Correlation of copy number Gene-centric copy number log ratio values of FOXO3 and PRDM1 were exclusively analysed by our collaborators Christian Steidl, Fong Chun Chan and Randy Gascoyne (Center for Lymphoid Cancers and the Center for Translational and Applied Genomics, Vancouver, Canada) in 29 samples of microdissected HRS cells from HL cases. The data were obtained from http://www.ncbi.nlm.nih.gov.geo/; GSE39133 (Steidl et al. 2012). They performed a Spearman’s rank correlation test and P-values < 0.05 were considered statistically significant (Osswald et al. 2018).

34 Results

3 Results

3.1 FOXO3 expression in normal B cells and in B cell lymphomas FOXO3 is shown to be deregulated in various tumor settings as mentioned in section 1.3.6. To provide an overview of FOXO3 mRNA expression levels in B cell lymphomas in comparison to healthy B cell samples, qRT-PCR was performed in 17 lymphoma cell lines and 3 samples of normal B cells from 3 different healthy donors. CD19+ tonsillar B cells, cHL derived cell lines and cell lines derived from different NHLs including Burkitt lymphoma, follicular B cell lymphoma, GCB-like lymphoma, primary mediastinal large B cell lymphoma (PMBL), diffuse large B cell lymphoma (DLBCL), and a cell line with B cell precursor leukemia origin (see table 1 for further information) were investigated. RNA and subsequently cDNA were isolated and qRT-PCR was performed in three independent experiments with technical duplicates.

Highest expression of FOXO3 could be observed in cHL cell lines KM-H2 with a ten-fold increase compared to normal B cells, U-HO1 and L1236 with a 4- to 9-fold increase respectively (Figure 5). KM-H2 and L1236 both belong to the mixed cellularity subtype, whereas U-HO1 is of nodular sclerosis subtype. In contrast, in L428 the FOXO3 expression level was much lower and more comparable to CD19+ B cells. L540, an HL cell line with T cell origin, reveals a 2.1-fold higher expression than normal B cells.

The PMBL cell line MedB-1 and Karpas-422 which is of DLBCL origin, both also display higher expression levels of FOXO3 mRNA compared to normal B cells.

However, the Burkitt lymphoma cell lines Namalwa, Ramos, and Raji, show similar expression levels of FOXO3 to CD19 positive B cells whereas the expression level of Daudi cells is slightly higher.

35 Results

0,00016

0,00012

0,00008 FOXO3/RPL13A 0,00004

0

REH

RAJI

L428 L540

L1236

U-H01

KM-H2 DAUDI

DOHH2

MedB-1

RAMOS

SUP-HD1

SU-DHL-5

WSU-NHL

NAMALWA

CD19+ B cell B CD19+ cell B CD19+ cell B CD19+ KARPAS-422

KARPAS-1106

Figure 5: FOXO3 is differentially expressed in normal B cells and in B cell lymphomas derived cell lines. Expression of FOXO3 mRNA in CD19+ tonsillar B cells and cell lines derived from cHL (L428, KM-H2, L1236, U-HO1, L540, SUP-HD1), Burkitt lymphoma (Namalwa, Ramos, Raji, Daudi), follicular lymphoma (DOHH2, WSU-NHL), DLBCL (Karpas-422), GCB-like lymphoma (SU-DHL-5), PMBCL (MedB-1), mediastinal lymphoblastic B cell lymphoma (Karpas-1106) and B cell precursor leukaemia (REH). For quantification qRT-PCR was used. qRT-PCR data were analysed using the comparative CT method. RPL13A, ribosomal protein 13a. Data are displayed as mean +/- SD of target gene to reference gene (FOXO3/RPL13A).

The cell lines Karpas-1106, derived from mediastinal lymphoblastic B cell lymphoma, and SU-DHL 5, derived from GCB-like lymphoma, show a 10-fold lower expression of FOXO3 mRNA compared to normal B cells (Figure 5).

In summary, FOXO3 expression is upregulated in all analysed cHL cell lines compared to normal B cells. However, cell lines of PMBL and DLBCL origin also reveal higher expression levels.

36 Results

3.2 Correlation analysis of gene expression To investigate whether FOXO3 modulates expression of PRDM1, we reanalysed data obtained from Steidl et al. His group had published gene expression analysis of microdissected HRS cells (Steidl et al. 2012). We reanalysed the data concerning correlation of PRDM1 to FOXO3 gene expression ratio. To assess statistical significance, Pearson correlation coefficient and two-tailed Student t-test were calculated for the results obtained.

8

r=0.4277 p<0.02 7

6 PRDM1, fluorescence log2 PRDM1,

5 7 8 9 10 FOXO3, log2 fluorescence

Figure 6: FOXO3 and PRDM1 gene expression levels show a positive correlation. Gene expression data from Steidl and his group were reanalysed as it was described in material and methods. Data was generated from microdissected HRS cells of 29 cHL patient samples (Steidl et al. 2012). The following probe sets were used for correlation analysis: source: Human Genome U133 Plus 2.0 Array, probe sets: FOXO3-224891_at; PRDM1-228964_at. As tests for statistical significance r-Pearson correlation coefficient and p-values were calculated (p<0.05) in two-tailed Student t-test. PRDM1, PR domain-containing 1 with zinc finger domain. This research was originally published in Blood 2018;131:1556-1567. © the American Society of Hematology.

Analysis showed a positive correlation in PRDM1 and FOXO3 mRNA levels with p <0.02 and r=0.4277 (Figure 6).

37 Results

3.3 Influence of FOXO3 on PRDM1 expression I examined PRDM1 as potential FOXO3 target gene in cHL. The two cHL cell lines used, KM-H2 and L428, express a constitutively active inducible version of FOXO3 which was activated by 4-OHT. Total RNA was isolated and PRDM1α expression was analyzed by qRT-PCR.

L428 KM-H2 12 50

10 40

8 α

α 30 6

CON PRDM1

PRDM1 20 4 4OHT 10 2

0 0

VECTOR

VECTOR FOXO3(A3)ER FOXO3(A3)ER

Figure 7: FOXO3 activates PRDM1 expression at mRNA levels. The ability of FOXO3 to induce PRDM1α expression was analysed in the two cHL derived cell lines KM-H2 and L428. The cell lines express either FOXO3(A3)ER or empty vector as control. Cells were treated with 200 nM 4-

OHT or vehicle. After 24 hours mRNA was extracted and analysed via qRT-PCR using the ΔΔCT method. RPL13A served as reference gene. 4-OHT, 4-hydroxytamoxifen; CON, control; PRDM1α, PR domain-containing 1α with zinc finger domain; RPL13A, ribosomal protein 13a; VECTOR, empty vector. Data are displayed as mean +/-SD. All measurements were conducted in triplicates. This research was originally published in Blood 2018;131:1556-1567. © the American Society of Hematology.

FOXO3 activation increased expression of PRDM1α in L428 8.5-fold and in KM- H2 29.9-fold (Figure 7). In order to investigate an effect on the protein level, immunoblot was performed.

38 Results

Figure 8: FOXO3 activates PRDM1α at protein levels. The cHL cell lines KM-H2 and L428 expressing the constitutively active FOXO3 construct FOXO3(A3)ER were treated with 200 nM 4- OHT or vehicle (ethanol). After 24 hours cells were lysed and PRDM1 expression was measured by immunoblot. β-tubulin (TUBB) was used as loading control. 4-OHT, 4-hydroxytamoxifen; CON, control; PRDM1, PR domain-containing 1 with zinc finger domain. The shown blot is a representative of three independent experiments with similar results. This research was originally published in Blood 2018;131:1556-1567. © the American Society of Hematology.

In both cell lines, an increase in PRDM1α but not PRDM1β could be observed upon FOXO3 activation (Figure 8). Thus, PRDM1 isoforms are regulated differently by FOXO3. PRDM1β seems to be slightly downregulated in KM-H2, in L428 no difference could be observed.

Then I investigated the influence of FOXO3 on PRDM1α and β promoter activity using luciferase reporter assay. L428 cells were transfected by electroporation with PRDM1α or PRDM1β promoter construct or with empty vector as negative control as well as ubi-Renilla. The latter served for normalization of the transfection efficiency. After 2 hours of incubation 4-OHT at concentration of 200 nM or vehicle were added and the cells were incubated additional 24 hours before luciferase activity was measured.

39 Results

L428 16 14 con 12 4OHT 10 8 6 4 2

0

relative luciferase activity relative

α β

EV

PRDM1 PRDM1

Figure 9: FOXO3 activates PRDM1α promoter. To study PRDM1α and PRDM1β promoter activation, L428 FOXO3(A3) cells were transiently transfected using electroporation with a vector either containing PRDM1α or PRDM1β promoter construct, or with empty vector as negative control. ubi-Renilla vector served as reference to normalize for differences in transfection efficiencies. After 2 hours of incubation, cells were treated with 4-OHT to a final concentration of 200 nM or with vehicle and luciferase assay was performed 24 hours after transfection. Firefly luciferase activity was normalized to Renilla luciferase activity. 4-OHT, 4-hydroxytamoxifen; CON, control; PRDM1, PR domain-containing 1 with zinc finger domain. Data are displayed as mean of relative expression +/-SD. All measurements were conducted in triplicates.

Cells transfected with PRDM1α showed a 10.5-fold increase of relative luciferase activity upon FOXO3 activation whereas cells transfected with PRDM1β only showed a 2.0-fold increase (Figure 9). However, the cells transfected with empty vector also showed a 4.1-fold increase of relative luciferase activity after addition of 4-OHT.

3.4 Influence of FOXO3 on pro-apoptotic genes To investigate the influence of FOXO3 in programmed cell death, I used the two cHL cell lines L428 and KM-H2 inheriting a constitutively active form of FOXO3 and analysed mRNA expression levels after 24 hours of FOXO3 induction using qRT-PCR.

In this setup, I studied the expression of known FOXO target genes associated with apoptosis in cHL cell lines such as the levels of three members of the pro- apoptotic Bcl-2 family BAK (BCL2-antagonist/killer), PMAIP1/NOXA (phorbol-12-

40 Results myristate-13-acetate-induced protein 1) and BCL2L11/BIM in the cHL cell lines KM-H2 and L428 expressing either empty vector or FOXO3(A3)ER. FOXO3 activation led to a 1.7-fold upregulation of BAK in KM-H2 cells and stayed similar with a 1.1-fold increase in L428 (Figure 10). NOXA levels showed a 4.1-fold increase in KM-H2 cells upon FOXO3 activation. In L428 there was a 2.2-fold increase observable. The mRNA of BIM, however, was only detectable in L428 but not in KM-H2 cells. L428 cells showed a 2.4-fold increase after FOXO3 activation. Expression levels of the targets observed in cell lines carrying empty vector showed minor variations before and after treatment with 4-OHT. Taken together, our data indicate an influence of FOXO3 on the transcription of apoptosis-associated genes.

41 Results

KM-H2 L428 2,5 2,5

2 2

1,5 1,5

BAK 1 1

0,5 0,5

0 0

5 5 4,5 4 4 3,5 3 3 2,5 2

NOXA 2 1,5 1 1 0,5 0 0 3 3

2,5

2,5 CON VECTOR 2 2 4OHT

FOXO3(A3)ER 1,5

1,5 BIM 1 1 0,5 0,5 N N 0 0 D D

VECTOR

VECTOR FOXO3(A3)ER FOXO3(A3)ER

Figure 10: Activation of FOXO3 increases expression of pro-apoptotic target genes. The cHL cell lines KM-H2 and L428 expressing the constitutively active form of FOXO3, FOXO3(A3)ER, or empty vector were treated with 200 nM 4-OHT or vehicle. After 24 hours, cells were harvested and total RNA was extracted. Expression analysis was performed using qRT-PCR. qRT-PCR data was analysed using the comparative CT method. RPL13A served as reference gene. 4-OHT, 4- hydroxytamoxifen; BAK, BCL2-antagonist/killer; BIM, BCL-2‑ interacting mediator of cell death; CON, control; N, not detected; RPL13A, ribosomal protein 13a; VECTOR, empty vector. Data are displayed as mean of relative expression +/- SD. All measurements were conducted in triplicates.

3.5 Influence of FOXO3 on BCL6 expression As a known FOXO target in GC, I investigated BCL6 expression after FOXO3 activation on mRNA and protein level in the two cHL cell lines KM-H2 and L428 stably expressing the FOXO3(A3)ER construct. Cells were treated with 4-OHT or vehicle as control. After 24 hours mRNA and protein were isolated. qRT-PCR was

42 Results performed to measure BCL6 mRNA levels and immunoblot to investigate the influence of FOXO3 on BCL6 protein levels.

KM-H2 L428 10 4

8 3

6 CON

4OHT 2 BCL6 4 BCL6

1 2

0 0

VECTOR

VECTOR FOXO3(A3)ER FOXO3(A3)ER Figure 11: Influence of FOXO3 on BCL6, the main regulator of GC formation and maintenance. BCL6 expression was analysed in two cHL derived cell lines KM-H2 and L428. The cell lines express either FOXO3(A3)ER or empty vector as a control. Cells were treated with 200 nM 4-OHT or vehicle. After 24 hours, total RNA was extracted and qRT-PCR was performed. Data was analysed using the comparative CT method. RPL13A served as reference gene. 4-OHT, 4- hydroxytamoxifen; BCL6, B cell lymphoma 6; CON, control; RPL13A, ribosomal protein 13a; VECTOR, empty vector. Data are displayed as mean of relative expression +/- SD. All measurements were conducted in triplicates. This research was originally published in Blood 2018;131:1556-1567. © the American Society of Hematology.

FOXO3 activation resulted in 6.8-fold and 2.7-fold increase of BCL6 expression in KM-H2 and in L428, respectively (Figure 11). Thus, both cell lines reveal an upregulation of BCL6 upon FOXO3 activation on mRNA level. The protein samples analysed via immunoblot show an increase in BCL6 on protein level in both cell lines (Figure 12). Thus, FOXO3 induction leads to an increase in BCL6 on both mRNA and protein level.

43 Results

Figure 12: Activation of BCL6 as a FOXO3 target gene on protein level. Immunoblot of the cHL cell lines KM-H2 and L428 expressing a constitutively active construct of FOXO3 (FOXO3(A3)ER). The cell lines express either FOXO3(A3)ER or empty vector as a control. Cells were treated with 200 nM 4-OHT or vehicle. After 24 hours, protein was extracted and immunoblot was performed. Β- Tubulin (TUBB) was used as loading control. 4-OHT, 4-hydroxytamoxifen; BCL6, B cell lymphoma 6; CON, control. The shown blot is a representative of three independent experiments with similar results. This research was originally published in Blood 2018;131:1556-1567. © the American Society of Hematology.

3.6 Summary In the present work, I investigated the role of FOXO3 expression in the oncogenic program of cHL. Gene expression levels were measured by qRT-PCR and compared between different B cell lymphoma cell lines and normal B cells. In contrast to other B cell lymphomas as well as healthy donor B cells, my measurements revealed significant upregulation of FOXO3 mRNA levels in cHL cell lines.

I was able to demonstrate that gene expression of the pro-apoptotic Bcl-2 family members BAK, NOXA and BIM is upregulated upon FOXO3 activation.

Furthermore I found that FOXO3 regulates two main B cell transcription factor PRDM1 and FOXO3. I was able to show FOXO3 dependent upregulation of BCL6 on protein and mRNA level.

Correlation analysis revealed a positive correlation between PRDM1 and FOXO3 in gene expression.

Additionally, FOXO3 also induced upregulation of PRDM1α, the full-lenghth and active variant of PRDM1, on protein and mRNA levels. I could also show by performing luciferase assay that upon FOXO3 activation PRDM1α but not PRDM1β promoter activity is increased.

44 Discussion

4 Discussion I found that there is a positive correlation between FOXO3 and PRDM1 in gene expression. FOXO3 expression was higher in cHL compared to other B cell lymphoma cell lines. Pro-apoptotic Bcl-2 family members were upregulated upon FOXO3 activation. Both the master-regulators of GCR and PC differentiation, BCL6 and PRDM1, were upregulated both on mRNA and protein levels, respectively. Regarding PRDM1 upregulation, FOXO3 exclusively increased activity of PRDM1α but not PRDM1β promoter, as was measured by luciferase reporter assay.

4.1 FOXO3 expression in B cell lymphomas and normal B cells I found that FOXO3 expression in cHL cell lines is higher than in other lymphoma entities and in CD19+ tonsillar B cells. In NHL cell lines, MedB-1 (PMBL) and Karpas-422 (DLBCL) I also revealed higher expression of FOXO3 than normal B cells. Cell lines originating from Burkitt lymphoma showed expression levels comparable to normal B cells.

The group of Steidl et al. performed gene expression profiling of microdissected HRS cells from 29 patients and 5 cHL derived cell lines (Steidl et al. 2012). They reported genetic deletion of one FOXO3 allele in 18.9 % of samples examined. Thus, I would have expected a downregulation of FOXO3 in a proportion of cHL samples compared to normal B cells accounting for partial deletion of FOXO3.

My results of high FOXO3 expression in cHL cell lines are consistent with the findings of the group of Ikeda et al. who performed immunohistochemical FOXO3 analysis on 137 patient samples on protein level revealing that only a limited number of patients with NHL expressed FOXO3 whereas 19 out of 27 cHL samples where FOXO3 positive (Ikeda et al. 2013). However, there may be differences between mRNA and protein levels as well as between protein level and the amount of active FOXO3 transcription factor. FOXO3 mRNA and protein levels may vary depending on mRNA stability and regulation of translation. Additionally, different regulatory mechanisms such as posttranslational modifications can influence localization and transcriptional activity (Calnan and Brunet 2008) and thereby alter the amount of active form of FOXO3 accordingly.

45 Discussion

However, our group had previously found that FOXO1 mRNA expression was lower in cHL cell lines compared to other lymphoma cell lines and CD19+ tonsillar B cells (Xie et al. 2012). These findings point towards differences in the role of FOXO3 and FOXO1 in cHL even though both transcription factors have structural similarity inheriting the highly conserved forkhead domain responsible for DNA binding and share various target genes (Eijkelenboom and Burgering 2013). This notion is supported by two microarray studies showing that FOXO3 levels do not vary during B cell development whereas FOXO1 levels increase in early pro B cells as reviewed by Dengler et al. (Dengler et al. 2008; Hystad et al. 2007; Rumfelt et al. 2006). In contrast, gene expression profiling conducted by Tooze and collegues showed a strong increase in FOXO3 levels during PC differentiation (Tooze 2013). Since the current literature knowledge is contradictory, it remains unclear whether the high FOXO3 mRNA levels obtained for cHL in this study could be comparable to levels in GC B cells or PCs. To further assess my results, gene expression profiling comparing FOXO3 levels in different normal B cell stages to HL should be performed.

4.2 Positive correlation between PRDM1 and FOXO3 Frequent deletion (18.9 %) of FOXO3 loci in patient samples of HL cases suggests FOXO3 as potential gene candidate with tumor-suppressive properties (Steidl et al. 2012). FOXO3 and PRDM1 are located in two regions in close proximity on chromosome 6q21. PRDM1 is known to be expressed at low levels in cHL (Tiacci et al. 2012; Buettner et al. 2005). We hypothesized that FOXO3 might influence PRDM1 expression and both genes could also be codeleted in the tumor setting.

At this, copy number analysis of microdissected HRS cells was exclusively performed by our collaborators Christian Steidl, Fong Chun Chan and Randy Gascoyne (Osswald et al. 2018).

The correlation analysis conducted shows positive correlation between FOXO3 and PRDM1 copy numbers with a Spearman’s R= 0.519 and p=0.004. These results point towards potential co-deletion of FOXO3 and PRDM1 alleles in some cHL cases also resulting in low PRDM1 expression levels.

This would go in line with findings reported by Boi Karube and Kucuk and their groups who described a deletion of the locus 6q21 in other malignancies such as

46 Discussion natural killer cell lymphoma and anaplastic large T-cell lymphoma (Boi et al. 2013; Karube et al. 2011; Kucuk et al. 2011).

Besides positive correlation at genomic level, we could also show that gene expression of PRDM1 and FOXO3 reveal a positive correlation which gives us a hint that FOXO3 might contribute to PRDM1 regulation in cHL.

However, also other mechanisms could contribute to this effect such as upstream regulators influencing expression of both genes analyzed and our RNA levels obtained could still differ from protein level since there is a machinery of translational and posttranslational regulatory mechanisms influencing the amount of active protein. As discussed above, my results show that FOXO3 is expressed at higher levels in cHL cell lines than in other lymphomas and normal B cells. Nevertheless, FOXO3 is probably not the only factor responsible for PRDM1 upregulation and other context dependent factors could still lead to PRDM1 downregulation in cHL.

4.3 FOXO3 regulates PRDM1α expression I found that FOXO3 induces PRDM1α, on mRNA and protein levels. PRDM1β showed no increase on protein level. PRDM1α is the active full-length form of PRDM1 and is essential for induction of plasma cell differentiation. The shorter less active PRDM1β form exhibits a disrupted PR domain leading to drastic reduction of repressive function on various target genes whereas DNA binding activity is retained (Gyory et al. 2003; Hangaishi and Kurokawa 2010). In my analysis, it was of interest to examine if there is general upregulation of PRDM1, or whether this effect is specific to either PRDM1α or PRDM1β upon FOXO3 induction.

My data suggest that FOXO3 induces PRDM1α but not PRDM1β in cHL. These results are in accordance with prior findings of our group where PRDM1α was induced upon FOXO1 induction on protein and mRNA levels (Vogel et al. 2014).

The results show a strong increase in luciferase activity in the cells transfected with PRDM1α but not in the cells transfected with the PRDM1β promoter construct. Thus, FOXO3 seems to activate PRDM1α but not PRDM1β promoter. My findings are in line with the results from qRT-PCR and immunoblot discussed above. It shows that FOXO3 induces PRDM1α on transcriptional level followed by

47 Discussion increasing levels of mRNA and protein. Similar effects were reported by our group for FOXO1 in cHL (Vogel et al. 2014).

Imbalances in the PRDM1α/PRDM1β ratio are reported in several other malignancies such as DLBCL and multiple myeloma, and PRDM1β expression is linked to chemoresistance (Liu et al. 2007; Ocana et al. 2006; Zhao et al. 2008). Zhang et al. found that aberrant methylation silencing of PRDM1α and hypomethylation activation of the β-form are frequent events in DLBCL (Zhang et al. 2015).

In order to interpret the role of upregulation of PRDM1 upon FOXO3 induction in cHL where it is known to be expressed at low levels (Tiacci et al. 2012; Buettner et al. 2005), it is necessary to review its role during B cell development. PRDM1 is referred to as the master-regulator of PC differentiation and governs late-stage B cell development. Hence, high level of PRDM1 expression is associated with PC commitment and increasing levels are observed in later stages towards antigen- secreting cell stages respectively (Kallies et al. 2004; Angelin-Duclos et al. 2000). Depending on the B cell stage, PRDM1 can have different effects: In immature stages, activation of PRDM1 induces apoptosis and in mature stages it promotes PC differentiation (Messika et al. 1998; Vrzalikova et al. 2012).

In general, higher expression of PRDM1 is linked to more mature B cell stages, which is of interest, since HRS cells are most likely “crippled" GC cells or post GC cells that have escaped from apoptosis (Küppers and Rajewsky 1998).

Thus, FOXO3 induced upregulation of PRDM1 could drive cHL cells towards later B cell stages. Previously, we could observe similar effects for FOXO1 induced PRDM1 upregulation including that also other genes of PC signature were enriched. Further experiments showed tumor-suppressive properties of PRDM1α in cHL and ectopically expressed PRDM1α had cytotoxic effects on cHL cell lines (Vogel et al. 2014).

Abnormal PRDM1 activity or regulation was already reported to contribute to lymphomagenesis (Boi et al. 2015; Nutt et al. 2007). Diverse mutations of the PRDM1 gene were found mainly in DLBCL resulting in either deletion or silencing of the gene (Hangaishi and Kurokawa 2010). Further research confirmed that PRDM1 is a bona fide tumor suppressor in DLBCL (Mandelbaum et al. 2010).

48 Discussion

Overall, FOXO3 could exhibit tumor-suppressive properties in cHL by contributing to upregulation of PRDM1α. Further experiments including analysis of expression levels of other transcription factors present in later stages of B cell development upon FOXO3 activation should be performed. Thus, it would be possible to identify additional targets that might contribute to tumor-suppressive effects of FOXO3 in cHL. Besides, to investigate whether enhanced activity of PRDM1α promoter is due to direct binding of FOXO3 or if there are other intermediate molecules involved, additional experiments such as chromatin immunoprecipitation (ChIP) should be conducted.

4.4 FOXO3 influences expression of pro-apoptotic genes I found that FOXO3 increases the expression of pro-apoptotic genes. Since the three targets analyzed belong to the pro-apoptotic BCL2 family, the results indicate that FOXO3 induction may lead to activation of cascades promoting apoptosis. BIM and NOXA are members of the BH3-only subgroup and the multidomain downstream effector protein BAK finally leads to mitochondrial membrane permeabilization (Hata et al. 2015; Labi and Erlacher 2015).

My findings are supported by previously published data. The group of Gilley et al. reported that BIM is a direct target of FOXO3a promoting apoptosis in sympathetic neurons (Gilley et al. 2003). This apoptotic pathway was also found by Dijkers et al. in a mouse pro-B cell line (Dijkers et al. 2000a). Similar effects have also been shown in cancer cells after treatment with chemotherapeutics such as in Paclitaxel-treated breast cancer cell lines (Sunters et al. 2003) and cisplatin- treated lung cancer cells (Liu et al. 2014a). Obexer et al. showed that FOXO3 induces apoptosis via BIM and NOXA in neuroblastoma (Obexer et al. 2007).

Taken together, these findings all point towards pro-apoptotic effect of FOXO3. However, since there are further regulating molecules involved in apoptotic cascades that could also shift the cell to an anti-apoptotic state my hypothesis needs to be further evaluated. Thus, to further confirm and quantify the role of FOXO3 in apoptosis in this tumor setting, additional experiments should be performed such as annexin V staining and viability counts upon FOXO3 induction.

49 Discussion

4.5 FOXO3 induces BCL6 transcription HRS cells, the malignant component on cHL, are most likely of GC or postgerminal origin even though only low expression levels of BCL6 were observed in HL (Buettner et al. 2005). I found that BCL6 is upregulated on mRNA and protein levels after FOXO3 induction. BCL6 plays an important role in inducing the GC formation and is known as the master-regulator of GC reaction (Basso and Dalla-Favera 2015; Dent et al. 1997). Additionally, it is necessary for affinity maturation and class switch recombination (Dent et al. 1997; Ye et al. 1997). BCL6 prevents premature PC differentiation in the GC and ensures complete GC reaction (Tunyaplin et al. 2004).

Similar results could be obtained by Fernandez de Mattos and his group in a Murine BaF3 cell line (Fernandez de Mattos et al. 2004). Miyaguchi and collegues found that FOXO3a expression increases BCL6 and BIM mRNA levels as oxidative stress response (Miyaguchi et al. 2009).

BCL6 is a known target of FOXO proteins in the context of apoptosis. Tang et al. reported that FOXO4 triggers cell death through BCL6 upregulation downregulating the pro-survival BCL2 family member BCL-XL (Tang et al. 2002).

Thus, upregulation of FOXO3 in cHL could contribute to cell death not just via upregulation of BIM, BAK and NOXA, but also via induction of BCL6 and concomittant downregulation of pro-survival factors.

Another possibility is that BCL6 is dysregulated upon FOXO3 induction. In lymphomagenesis, there is evidence for tumorigenic effects of BCL6 in DLBCL (Bunting and Melnick 2013). Previously, BCL6 was identified in DLBCL as a locus of translocation (Ye et al. 1993). Its function in GC leads to a massive proliferation rate as somatic hypermutation and class-switch recombination takes place (Klein and Dalla-Favera 2008). For the execution of this process, a tolerance to DNA damage is necessary which is mediated via BCL6 (Basso and Dalla-Favera 2012). BCL6 silences a variety of genes involved in DNA damage sensing such as TP53 (Phan and Dalla-Favera 2004) and also genes involved in proliferation checkpoints such as CDKN1A and CDKN1B (Cardenas et al. 2017; Phan et al. 2005; Shaffer et al. 2000). Thus, constitutive deregulation of BCL6 may promote malignant

50 Discussion transformation through a persistent tolerance to DNA damage (Basso and Dalla- Favera 2012).

Taking the different properties discussed above into account, BCL6 upregulation upon FOXO3 activation could possibly have either pro-apoptotic or pro-oncogenic effects. Regarding the upregulation of pro-apoptotic molecules such as BAK, BIM and NOXA in my setting, BCL6 could add to this pro-apoptotic component and an anti-proliferative effect seems to predominate in cHL cell lines.

4.6 FOXO3 induces BCL6 and PRDM1 simultaneously My finding that FOXO3 induces both BCL6 and PRDM1 simultaneously in cHL cell lines leads to the question whether there are physiological states and cells coexpressing the two factors. During normal B cell differentiation, there is a peak in BCL6 expression required for GC formation (Dent et al. 1997) followed by a peak in PRDM1 expression further driving cells towards PC cell phenotype. BCL6 mediated repression of PRDM1 seems to be important to decelerate PC differentiation in GC and facilitate the process of affinity maturation and class switch recombination (Reljic et al. 2000; Tunyaplin et al. 2004). Since PRDM1 also represses BCL6, there is a reciprocal regulatory loop both factors antagonizing each others expression (Shaffer et al. 2002).

Most B cells in the GC are BCL6+ and PRDM1- (Kallies et al. 2004; Allman et al. 1996). However, Angelin-Duclos and colleagues reported that there is a small B cell subset (4-15 %) in human tonsils and murine spleen that is BCL6- and PRDM1+ with partial PC phenotype (Angelin-Duclos et al. 2000). Ectopically expressed BCL6 inhibited PRDM1 expression and further PC differentiation in BCL1 cells (Reljic et al. 2000).

However, the synchronous induction of PRDM1 and BCL6 has been reported before in B cells and in a B cell lymphoma cell line (Diehl et al. 2008; Ozaki et al. 2004). Diehl et al. proposed that downregulation of BCL6 is required for completion of PC differentiation. They reported that cells expressing both PRDM1 and BCL6 show an intermediate plasma cell phenotype with increased Ig production but no full PC differentiation. Additionally, they found that BCL6 might not be the only repressor of PRDM1 in the context of B cell differentiation (Diehl et al. 2008).

51 Discussion

Taken together, in cHL, FOXO3 could play a role in the induction of either antagonist, PRDM1 and BCL6, but interaction with other factors could determine which gene is finally expressed in a context dependent manner as we have already proposed for FOXO1 (Vogel et al. 2014).

4.7 Conclusions Overall, my results suggest that there are hints to both tumor-suppressive and tumor-sustaining properties of FOXO3 in cHL. The partial deletion of the FOXO3 locus in 18.9 % of microdissected HL samples observed by Steidl and his group (Steidl et al. 2012) points towards a tumor-suppressive effect. After monoallelic deletion of FOXO3 there could be a loss of function through promoter methylation or additional mutations in the remaining allele. However, in the cHL cell lines examined, I found higher expression levels of FOXO3 compared to normal B cells and other lymphoma entities. The upregulation of pro-apoptotic factors upon FOXO3 activation indicates a tumor-suppressive activity in cHL. Upregulation of BCL6 could have both tumor-suppressive and sustaining properties by either downregulating anti-apoptotic Bcl2 family members or maintaining by delaying PC differentiation and exhibiting its functions that physiologically occur during GC reaction. These functions include induction of proliferation and tolerance to DNA damage as pointed out earlier. Upregulation of PRDM1α, however, indicates tumor-suppressive properties because PRDM1α is a known tumor suppressor in DLBCL (Mandelbaum et al. 2010) and other lymphomas (Nutt et al. 2007). Of note, our group also showed that tumor-suppressive properties exist in cHL for PRDM1 (Vogel et al. 2014).

Altogether, FOXO3 at levels present in cHL might contribute to the maintenance and pathogenesis of cHL. Based on the data obtained in this study, FOXO3 could act as either tumor suppressor or as oncogene in cHL. A context dependency of FOXO3 effects in a hierarchy of other transcription factors could explain induction of both BCL6 and PRDM1 in the experimental setting and it is possible that, depending on the differentiation stage, one gene is preferably expressed as a result of the interplay with other signaling cascades. However, further investigation is needed to provide a deeper understanding of the role of FOXO3 in cHL. Isolated HRS cells in cell culture might not completely reflect the gene expression network of primary HRS cells in their inflammatory microenvironment in vivo. Therefore, we

52 Discussion might benefit from additional studies of lymph node HRS cells where the crosstalk with the cellular infiltrate can also be taken into account to see a clearer picture of the role of FOXO3 in pathogenesis and maintenance of cHL.

53 Summary

5 Summary Hodgkin lymphoma (HL) is among the most common cancers in young adults. Although lasting complete remission can be achieved in the majority of patients, there is still 10 to 20 % that cannot be cured. Successfully treated patients may suffer from long-term side effects of polychemotherapy and radiotherapy. Classical Hodgkin lymphoma (cHL) is the most common subtype of HL. Its composition is unique among lymphoid malignancies because its cancer cells, the Hodgkin and Reed-Sternberg (HRS) cells, account for only less than 1 % of the tumor cell mass. The rest is mainly formed by inflammatory microenvironment. HRS cells that are most likely of germinal center (GC) or post GC B cell origin and have lost their B cell phenotype. Constitutive activity of JAK/STAT and NF-κB pathway and deregulation of various transcription factors are a hallmark of the disease. However, further research is needed to get an understanding of the mechanisms leading to HRS cell phenotype.

Previously, our group had identified FOXO1 as a tumor suppressor that is strongly repressed in cHL. Its reactivation led to growth arrest. Additionally, its repression is at least partially responsible for PRDM1α downregulation contributing to the arrest of plasma cell differentiation in cHL. Tumor-suppressive properties of FOXO3 have already been reported in other lymphoid malignancies and partial deletion of FOXO3 locus in a portion of microdissected HRS cell samples was observed. Since FOXOs functional structure is conserved among different members of the FOXO family of transcription factors, the aim of this study was to investigate whether FOXO3 is a tumor suppressor in cHL and whether it interacts in redundancy to FOXO1 with similar binding partners. I investigated the role of FOXO3 in regulation of BCL6, the master-regulator of GC reactions, and PRDM1, the master-regulator of plasma cell differentiation, as well as its role in induction of pro-apoptotic factors in cHL.

Analysis of mRNA expression levels of FOXO3 in different lymphomas and normal B cells showed an upregulation in cHL cell lines compared to normal B cells and some Non-Hodgkin lymphoma derived cell lines. This differs from the expression pattern of FOXO1 which we previously found to be lower in cHL cell lines than in normal B cells. Regarding low PRDM1 levels in HL, we wanted to investigate whether they are due to codeletion since the gene is located in close proximity to

54 Summary

FOXO3 on 6q21 in the genome or if FOXO3 partially regulates PRDM1 expression as we have shown earlier for FOXO1. Correlation analysis of copy number conducted by our collaborators Christian Steidl, Fong Chun Chan and Randy Gascoyne showed a positive correlation between PRDM1 and FOXO3 and we could show a positive correlation in gene expression. For further experiments, I used cHL cell lines harbouring a constitutively active form of FOXO3 that can be induced by adding 4-hydroxytamoxifen. qRT-PCR showed increased expression of PRDM1α on mRNA level and immunoblot showed that FOXO3 exclusively upregulates the full-length and active form of PRDM1, PRDM1α, but not the truncated PRDM1β form with reduced repressive function but retained DNA binding activity. I further investigated the interaction between FOXO3 and PRDM1 using luciferase reporter assay. PRDM1α but not PRDM1β promoter activity increased upon FOXO3 activation. To get a hint of its potential tumor-suppressive properties in cHL, I examined the effect of FOXO3 on expression levels of pro- apoptotic genes in cHL cell lines using qRT-PCR. mRNA levels of BAK, NOXA and BIM, pro-apoptotic Bcl-2 family members, were upregulated upon FOXO3 activation. I also investigated the role of FOXO3 on BCL6 expression. Using qRT- PCR and immunoblot I found that FOXO3 induction in cHL cell lines leads to upregulation of BCL6 both on mRNA and protein levels. Interestingly, BCL6 and PRDM1, master-regulators of two different developmental stages, GC B cells and plasma cells, were simultaneously upregulated upon FOXO3 induction.

Taken together, my data suggest that FOXO3 may exhibit both tumor-suppressive and oncogenic properties in cHL and FOXO3 levels present might contribute to the maintenance and pathogenesis of the disease. FOXO3 positively targets PRDM1α, even though PRDM1 levels were found to be low in cHL. Hence, further factors are possibly involved in its regulation in cHL. Context dependent interaction with different transcription factor networks depending on developmental stage could explain the synchronous upregulation of the two counteracting factors PRDM1 and BCL6 as observed in the experimental setting. Upregulating pro- apoptotic factors, FOXO3 may contribute to programmed cell death. However, further experiments are needed for verification of these findings and the interaction between PRDM1 and FOXO3 should be investigated in more detail.

55 Bibliography

6 Bibliography

1. Alinikula J, Nera K P, Junttila S, Lassila O: Alternate pathways for Bcl6-mediated regulation of B cell to plasma cell differentiation. European journal of immunology, 41: 2404-2413 (2011)

2. Allman D, Jain A, Dent A, Maile R R, Selvaggi T, Kehry M R, Staudt L M: BCL-6 expression during B-cell activation. Blood, 87: 5257-5268 (1996)

3. Amin R H, Schlissel M S: Foxo1 directly regulates the transcription of recombination- activating genes during B cell development. Nature immunology, 9: 613-622 (2008)

4. Anderson M J, Viars C S, Czekay S, Cavenee W K, Arden K C: Cloning and characterization of three human forkhead genes that comprise an FKHR-like gene subfamily. Genomics, 47: 187-199 (1998)

5. Angelin-Duclos C, Cattoretti G, Lin K I, Calame K: Commitment of B lymphocytes to a plasma cell fate is associated with Blimp-1 expression in vivo. Journal of immunology (Baltimore, Md.: 1950), 165: 5462-5471 (2000)

6. Armitage J O: Early-stage Hodgkin's lymphoma. The New England journal of medicine, 363: 653-662 (2010)

7. Bakker W J, van Dijk T B, Parren-van Amelsvoort M, Kolbus A, Yamamoto K, Steinlein P, Verhaak R G, Mak T W, Beug H, Lowenberg B, von Lindern M: Differential regulation of Foxo3a target genes in erythropoiesis. Molecular and cellular biology, 27: 3839-3854 (2007)

8. Barr F G: Gene fusions involving PAX and FOX family members in alveolar rhabdomyosarcoma. Oncogene, 20: 5736-5746 (2001)

9. Basso K, Dalla-Favera R: Germinal centres and B cell lymphomagenesis. Nature reviews.Immunology, 15: 172-184 (2015)

10. Basso K, Dalla-Favera R: Roles of BCL6 in normal and transformed germinal center B cells. Immunological reviews, 247: 172-183 (2012)

11. Basso K, Dalla-Favera R: BCL6: master regulator of the germinal center reaction and key oncogene in B cell lymphomagenesis. Advances in Immunology, 105: 193-210 (2010)

12. Basso K, Saito M, Sumazin P, Margolin A A, Wang K, Lim W K, Kitagawa Y, Schneider C, Alvarez M J, Califano A, Dalla-Favera R: Integrated biochemical and computational approach identifies BCL6 direct target genes controlling multiple pathways in normal germinal center B cells. Blood, 115: 975-984 (2010)

13. Basso K, Klein U, Niu H, Stolovitzky G A, Tu Y, Califano A, Cattoretti G, Dalla-Favera R: Tracking CD40 signaling during germinal center development. Blood, 104: 4088-4096 (2004)

14. Baumann B, Bohnenstengel F, Siegmund D, Wajant H, Weber C, Herr I, Debatin K M, Proksch P, Wirth T: Rocaglamide derivatives are potent inhibitors of NF-kappa B activation in T-cells. The Journal of biological chemistry, 277: 44791-44800 (2002)

56 Bibliography

15. Biggs W H,3rd, Cavenee W K, Arden K C: Identification and characterization of members of the FKHR (FOX O) subclass of winged-helix transcription factors in the mouse. Mammalian genome : official journal of the International Mammalian Genome Society, 12: 416-425 (2001)

16. Boi M, Rinaldi A, Kwee I, Bonetti P, Todaro M, Tabbo F, Piva R, Rancoita P M, Matolcsy A, Timar B, Tousseyn T, Rodriguez-Pinilla S M, Piris M A, Bea S, Campo E, Bhagat G, Swerdlow S H, Rosenwald A, Ponzoni M, Young K H, Piccaluga P P, Dummer R, Pileri S, Zucca E, Inghirami G, Bertoni F: PRDM1/BLIMP1 is commonly inactivated in anaplastic large T-cell lymphoma. Blood, 122: 2683-2693 (2013)

17. Boi M, Zucca E, Inghirami G, Bertoni F: PRDM1/BLIMP1: a tumor suppressor gene in B and T cell lymphomas. Leukemia & lymphoma, 56: 1223-1228 (2015)

18. Bonizzi G, Karin M: The two NF-kappaB activation pathways and their role in innate and adaptive immunity. Trends in immunology, 25: 280-288 (2004)

19. Borkhardt A, Repp R, Haas O A, Leis T, Harbott J, Kreuder J, Hammermann J, Henn T, Lampert F: Cloning and characterization of AFX, the gene that fuses to MLL in acute leukemias with a t(X;11)(q13;q23). Oncogene, 14: 195-202 (1997)

20. Brent M M, Anand R, Marmorstein R: Structural basis for DNA recognition by FoxO1 and its regulation by posttranslational modification. Structure (London, England : 1993), 16: 1407-1416 (2008)

21. Brownawell A M, Kops G J, Macara I G, Burgering B M: Inhibition of nuclear import by protein kinase B (Akt) regulates the subcellular distribution and activity of the forkhead transcription factor AFX. Molecular and cellular biology, 21: 3534-3546 (2001)

22. Brunet A, Bonni A, Zigmond M J, Lin M Z, Juo P, Hu L S, Anderson M J, Arden K C, Blenis J, Greenberg M E: Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell, 96: 857-868 (1999)

23. Brunet A, Park J, Tran H, Hu L S, Hemmings B A, Greenberg M E: Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Molecular and cellular biology, 21: 952-965 (2001)

24. Buettner M, Greiner A, Avramidou A, Jack H M, Niedobitek G: Evidence of abortive plasma cell differentiation in Hodgkin and Reed-Sternberg cells of classical Hodgkin lymphoma. Hematological oncology, 23: 127-132 (2005)

25. Bunting K L, Melnick A M: New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes. Current opinion in immunology, 25: 339-346 (2013)

26. Calado D P, Sasaki Y, Godinho S A, Pellerin A, Kochert K, Sleckman B P, de Alboran I M, Janz M, Rodig S, Rajewsky K: The cell-cycle regulator c-Myc is essential for the formation and maintenance of germinal centers. Nature immunology, 13: 1092-1100 (2012)

27. Calnan D R, Brunet A: The FoxO code. Oncogene, 27: 2276-2288 (2008)

28. Cardenas M G, Oswald E, Yu W, Xue F, MacKerell A D,Jr, Melnick A M: The Expanding Role of the BCL6 Oncoprotein as a Cancer Therapeutic Target. Clinical cancer research : an official journal of the American Association for Cancer Research, 23: 885- 893 (2017)

57 Bibliography

29. Carpten J D, Faber A L, Horn C, Donoho G P, Briggs S L, Robbins C M, Hostetter G, Boguslawski S, Moses T Y, Savage S, Uhlik M, Lin A, Du J, Qian Y W, Zeckner D J, Tucker-Kellogg G, Touchman J, Patel K, Mousses S, Bittner M, Schevitz R, Lai M H, Blanchard K L, Thomas J E: A transforming mutation in the pleckstrin homology domain of AKT1 in cancer. Nature, 448: 439-444 (2007)

30. Carsetti R, Rosado M M, Wardmann H: Peripheral development of B cells in mouse and man. Immunological reviews, 197: 179-191 (2004)

31. Chang C C, Ye B H, Chaganti R S, Dalla-Favera R: BCL-6, a POZ/zinc-finger protein, is a sequence-specific transcriptional repressor. Proceedings of the National Academy of Sciences of the United States of America, 93: 6947-6952 (1996)

32. Chapuis N, Park S, Leotoing L, Tamburini J, Verdier F, Bardet V, Green A S, Willems L, Agou F, Ifrah N, Dreyfus F, Bismuth G, Baud V, Lacombe C, Mayeux P, Bouscary D: IkappaB kinase overcomes PI3K/Akt and ERK/MAPK to control FOXO3a activity in acute myeloid leukemia. Blood, 116: 4240-4250 (2010)

33. Ci W, Polo J M, Cerchietti L, Shaknovich R, Wang L, Yang S N, Ye K, Farinha P, Horsman D E, Gascoyne R D, Elemento O, Melnick A: The BCL6 transcriptional program features repression of multiple oncogenes in primary B cells and is deregulated in DLBCL. Blood, 113: 5536-5548 (2009)

34. Ciechomska I, Pyrzynska B, Kazmierczak P, Kaminska B: Inhibition of Akt kinase signalling and activation of Forkhead are indispensable for upregulation of FasL expression in apoptosis of glioma cells. Oncogene, 22: 7617-7627 (2003)

35. Clark K L, Halay E D, Lai E, Burley S K: Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5. Nature, 364: 412-420 (1993)

36. Cobaleda C, Schebesta A, Delogu A, Busslinger M: Pax5: the guardian of B cell identity and function. Nature immunology, 8: 463-470 (2007)

37. Connors J M: Risk assessment in the management of newly diagnosed classical Hodgkin lymphoma. Blood, 125: 1693-1702 (2015)

38. Coomans de Brachene A, Demoulin J B: FOXO transcription factors in cancer development and therapy. Cellular and molecular life sciences : CMLS, 73: 1159-1172 (2016)

39. Correa P, O'Conor G T: Geographic pathology of lymphoreticular tumors: summary of survey from the geographic pathology committee of the international union against cancer. Journal of the National Cancer Institute, 50: 1609-1617 (1973)

40. Courtois-Cox S, Genther Williams S M, Reczek E E, Johnson B W, McGillicuddy L T, Johannessen C M, Hollstein P E, MacCollin M, Cichowski K: A negative feedback signaling network underlies oncogene-induced senescence. Cancer cell, 10: 459-472 (2006)

41. Davis R J, D'Cruz C M, Lovell M A, Biegel J A, Barr F G: Fusion of PAX7 to FKHR by the variant t(1;13)(p36;q14) translocation in alveolar rhabdomyosarcoma. Cancer research, 54: 2869-2872 (1994)

42. de Keizer P L, Packer L M, Szypowska A A, Riedl-Polderman P E, van den Broek N J, de Bruin A, Dansen T B, Marais R, Brenkman A B, Burgering B M: Activation of forkhead

58 Bibliography box O transcription factors by oncogenic BRAF promotes p21cip1-dependent senescence. Cancer research, 70: 8526-8536 (2010)

43. De Silva N S, Klein U: Dynamics of B cells in germinal centres. Nature reviews.Immunology, 15: 137-148 (2015)

44. Dejean A S, Hedrick S M, Kerdiles Y M: Highly specialized role of Forkhead box O transcription factors in the immune system. Antioxidants & redox signaling, 14: 663-674 (2011)

45. Dengler H S, Baracho G V, Omori S A, Bruckner S, Arden K C, Castrillon D H, DePinho R A, Rickert R C: Distinct functions for the transcription factor Foxo1 at various stages of B cell differentiation. Nature immunology, 9: 1388-1398 (2008)

46. Dent A L, Shaffer A L, Yu X, Allman D, Staudt L M: Control of inflammation, cytokine expression, and germinal center formation by BCL-6. Science (New York, N.Y.), 276: 589- 592 (1997)

47. Diehl S A, Schmidlin H, Nagasawa M, van Haren S D, Kwakkenbos M J, Yasuda E, Beaumont T, Scheeren F A, Spits H: STAT3-mediated up-regulation of BLIMP1 Is coordinated with BCL6 down-regulation to control human plasma cell differentiation. Journal of immunology (Baltimore, Md.: 1950), 180: 4805-4815 (2008)

48. Diepstra A, van Imhoff G W, Karim-Kos H E, van den Berg A, te Meerman G J, Niens M, Nolte I M, Bastiaannet E, Schaapveld M, Vellenga E, Poppema S: HLA class II expression by Hodgkin Reed-Sternberg cells is an independent prognostic factor in classical Hodgkin's lymphoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology, 25: 3101-3108 (2007)

49. Dijkers P F, Medema R H, Lammers J W, Koenderman L, Coffer P J: Expression of the pro-apoptotic Bcl-2 family member Bim is regulated by the forkhead transcription factor FKHR-L1. Current biology : CB, 10: 1201-1204 (2000a)

50. Dijkers P F, Medema R H, Pals C, Banerji L, Thomas N S, Lam E W, Burgering B M, Raaijmakers J A, Lammers J W, Koenderman L, Coffer P J: Forkhead transcription factor FKHR-L1 modulates cytokine-dependent transcriptional regulation of p27(KIP1). Molecular and cellular biology, 20: 9138-9148 (2000b)

51. Dillon S C, Zhang X, Trievel R C, Cheng X: The SET-domain protein superfamily: protein lysine methyltransferases. Genome biology, 6: 227 (2005)

52. Doerr J R, Malone C S, Fike F M, Gordon M S, Soghomonian S V, Thomas R K, Tao Q, Murray P G, Diehl V, Teitell M A, Wall R: Patterned CpG methylation of silenced B cell gene promoters in classical Hodgkin lymphoma-derived and primary effusion lymphoma cell lines. Journal of Molecular Biology, 350: 631-640 (2005)

53. Dominguez-Sola D, Victora G D, Ying C Y, Phan R T, Saito M, Nussenzweig M C, Dalla-Favera R: The proto-oncogene MYC is required for selection in the germinal center and cyclic reentry. Nature immunology, 13: 1083-1091 (2012)

54. Dutton A, Reynolds G M, Dawson C W, Young L S, Murray P G: Constitutive activation of phosphatidyl-inositide 3 kinase contributes to the survival of Hodgkin's lymphoma cells through a mechanism involving Akt kinase and mTOR. The Journal of pathology, 205: 498-506 (2005)

59 Bibliography

55. Eichenauer D A, Engert A, Andre M, Federico M, Illidge T, Hutchings M, Ladetto M, ESMO Guidelines Working Group: Hodgkin's lymphoma: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Annals of Oncology : Official Journal of the European Society for Medical Oncology / ESMO, 25 Suppl 3: iii70-5 (2014)

56. Eijkelenboom A, Burgering B M: FOXOs: signalling integrators for homeostasis maintenance. Nature reviews.Molecular cell biology, 14: 83-97 (2013)

57. Emmerich F, Meiser M, Hummel M, Demel G, Foss H D, Jundt F, Mathas S, Krappmann D, Scheidereit C, Stein H, Dorken B: Overexpression of I kappa B alpha without inhibition of NF-kappaB activity and mutations in the I kappa B alpha gene in Reed-Sternberg cells. Blood, 94: 3129-3134 (1999)

58. Emmerich F, Theurich S, Hummel M, Haeffker A, Vry M S, Dohner K, Bommert K, Stein H, Dorken B: Inactivating I kappa B epsilon mutations in Hodgkin/Reed-Sternberg cells. The Journal of pathology, 201: 413-420 (2003)

59. Essafi A, Fernandez de Mattos S, Hassen Y A, Soeiro I, Mufti G J, Thomas N S, Medema R H, Lam E W: Direct transcriptional regulation of Bim by FoxO3a mediates STI571-induced apoptosis in Bcr-Abl-expressing cells. Oncogene, 24: 2317-2329 (2005)

60. Essaghir A, Dif N, Marbehant C Y, Coffer P J, Demoulin J B: The transcription of FOXO genes is stimulated by FOXO3 and repressed by growth factors. The Journal of biological chemistry, 284: 10334-10342 (2009)

61. Essers M A, Weijzen S, de Vries-Smits A M, Saarloos I, de Ruiter N D, Bos J L, Burgering B M: FOXO transcription factor activation by oxidative stress mediated by the small GTPase Ral and JNK. The EMBO journal, 23: 4802-4812 (2004)

62. Fernandez de Mattos S, Essafi A, Soeiro I, Pietersen A M, Birkenkamp K U, Edwards C S, Martino A, Nelson B H, Francis J M, Jones M C, Brosens J J, Coffer P J, Lam E W: FoxO3a and BCR-ABL regulate cyclin D2 transcription through a STAT5/BCL6-dependent mechanism. Molecular and cellular biology, 24: 10058-10071 (2004)

63. Fredericks W J, Galili N, Mukhopadhyay S, Rovera G, Bennicelli J, Barr F G, Rauscher F J,3rd: The PAX3-FKHR fusion protein created by the t(2;13) translocation in alveolar rhabdomyosarcomas is a more potent transcriptional activator than PAX3. Molecular and cellular biology, 15: 1522-1535 (1995)

64. Fu G, Peng C: Nodal enhances the activity of FoxO3a and its synergistic interaction with Smads to regulate cyclin G2 transcription in ovarian cancer cells. Oncogene, 30: 3953-3966 (2011)

65. Fu Z, Tindall D J: FOXOs, cancer and regulation of apoptosis. Oncogene, 27: 2312- 2319 (2008)

66. Fukuda T, Yoshida T, Okada S, Hatano M, Miki T, Ishibashi K, Okabe S, Koseki H, Hirosawa S, Taniguchi M, Miyasaka N, Tokuhisa T: Disruption of the Bcl6 gene results in an impaired germinal center formation. The Journal of experimental medicine, 186: 439- 448 (1997)

67. Furuyama T, Nakazawa T, Nakano I, Mori N: Identification of the differential distribution patterns of mRNAs and consensus binding sequences for mouse DAF-16 homologues. The Biochemical journal, 349: 629-634 (2000)

60 Bibliography

68. Galili N, Davis R J, Fredericks W J, Mukhopadhyay S, Rauscher F J,3rd, Emanuel B S, Rovera G, Barr F G: Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nature genetics, 5: 230-235 (1993)

69. Gandhi M K, Moll G, Smith C, Dua U, Lambley E, Ramuz O, Gill D, Marlton P, Seymour J F, Khanna R: Galectin-1 mediated suppression of Epstein-Barr virus specific T-cell immunity in classic Hodgkin lymphoma. Blood, 110: 1326-1329 (2007)

70. Giannakou M E, Goss M, Junger M A, Hafen E, Leevers S J, Partridge L: Long-lived Drosophila with overexpressed dFOXO in adult fat body. Science (New York, N.Y.), 305: 361 (2004)

71. Gilley J, Coffer P J, Ham J: FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons. The Journal of cell biology, 162: 613-622 (2003)

72. Greer E L, Brunet A: FOXO transcription factors at the interface between longevity and tumor suppression. Oncogene, 24: 7410-7425 (2005)

73. Guertin D A, Stevens D M, Thoreen C C, Burds A A, Kalaany N Y, Moffat J, Brown M, Fitzgerald K J, Sabatini D M: Ablation in mice of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is required for signaling to Akt-FOXO and PKCalpha, but not S6K1. Developmental cell, 11: 859-871 (2006)

74. Guttilla I K, White B A: Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. The Journal of biological chemistry, 284: 23204-23216 (2009)

75. Gyory I, Fejer G, Ghosh N, Seto E, Wright K L: Identification of a functionally impaired positive regulatory domain I binding factor 1 transcription repressor in myeloma cell lines. Journal of immunology (Baltimore, Md.: 1950), 170: 3125-3133 (2003)

76. Gyory I, Wu J, Fejer G, Seto E, Wright K L: PRDI-BF1 recruits the histone H3 methyltransferase G9a in transcriptional silencing. Nature immunology, 5: 299-308 (2004)

77. Hangaishi A, Kurokawa M: Blimp-1 is a tumor suppressor gene in lymphoid malignancies. International journal of hematology, 91: 46-53 (2010)

78. Hannenhalli S, Kaestner K H: The evolution of Fox genes and their role in development and disease. Nature Reviews Genetics, 10: 233-240 (2009)

79. Hata A N, Engelman J A, Faber A C: The BCL2 Family: Key Mediators of the Apoptotic Response to Targeted Anticancer Therapeutics. Cancer discovery, 5: 475-487 (2015)

80. Hatzi K, Melnick A: Breaking bad in the germinal center: how deregulation of BCL6 contributes to lymphomagenesis. Trends in molecular medicine, 20: 343-352 (2014)

81. Hedrick S M: The cunning little vixen: Foxo and the cycle of life and death. Nature immunology, 10: 1057-1063 (2009)

82. Hedrick S M, Hess Michelini R, Doedens A L, Goldrath A W, Stone E L: FOXO transcription factors throughout T cell biology. Nature reviews.Immunology, 12: 649-661 (2012)

61 Bibliography

83. Heise N, De Silva N S, Silva K, Carette A, Simonetti G, Pasparakis M, Klein U: Germinal center B cell maintenance and differentiation are controlled by distinct NF- kappaB transcription factor subunits. The Journal of experimental medicine, 211: 2103- 2118 (2014)

84. Hillion J, Le Coniat M, Jonveaux P, Berger R, Bernard O A: AF6q21, a novel partner of the MLL gene in t(6;11)(q21;q23), defines a forkhead transcriptional factor subfamily. Blood, 90: 3714-3719 (1997)

85. Ho K K, Myatt S S, Lam E W: Many forks in the path: cycling with FoxO. Oncogene, 27: 2300-2311 (2008)

86. Hodgkin: On some Morbid Appearances of the Absorbent Glands and Spleen. Medico-chirurgical transactions, 17: 68-114 (1832)

87. Hu M C, Lee D F, Xia W, Golfman L S, Ou-Yang F, Yang J Y, Zou Y, Bao S, Hanada N, Saso H, Kobayashi R, Hung M C: IkappaB kinase promotes tumorigenesis through inhibition of forkhead FOXO3a. Cell, 117: 225-237 (2004)

88. Hwangbo D S, Gershman B, Tu M P, Palmer M, Tatar M: Drosophila dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature, 429: 562-566 (2004)

89. Hystad M E, Myklebust J H, Bo T H, Sivertsen E A, Rian E, Forfang L, Munthe E, Rosenwald A, Chiorazzi M, Jonassen I, Staudt L M, Smeland E B: Characterization of early stages of human B cell development by gene expression profiling. Journal of immunology (Baltimore, Md.: 1950), 179: 3662-3671 (2007)

90. Ikeda J, Tian T, Wang Y, Hori Y, Honma K, Wada N, Morii E: Expression of FoxO3a in clinical cases of malignant lymphoma. Pathology, research and practice, 209: 716-720 (2013)

91. Irsch J, Wolf J, Tesch H, Diehl V, Radbruch A, Staratschek-Jox A: Class switch recombination was specifically targeted to immunoglobulin (Ig)G4 or IgA in Hodgkin's disease-derived cell lines. British journal of haematology, 113: 785-793 (2001)

92. Ishida T, Ishii T, Inagaki A, Yano H, Komatsu H, Iida S, Inagaki H, Ueda R: Specific recruitment of CC chemokine receptor 4-positive regulatory T cells in Hodgkin lymphoma fosters immune privilege. Cancer research, 66: 5716-5722 (2006)

93. Jacobs F M, van der Heide L P, Wijchers P J, Burbach J P, Hoekman M F, Smidt M P: FoxO6, a novel member of the FoxO class of transcription factors with distinct shuttling dynamics. The Journal of biological chemistry, 278: 35959-35967 (2003)

94. Joos S, Menz C K, Wrobel G, Siebert R, Gesk S, Ohl S, Mechtersheimer G, Trumper L, Moller P, Lichter P, Barth T F: Classical Hodgkin lymphoma is characterized by recurrent copy number gains of the short arm of chromosome 2. Blood, 99: 1381-1387 (2002)

95. Jost P J, Ruland J: Aberrant NF-kappaB signaling in lymphoma: mechanisms, consequences, and therapeutic implications. Blood, 109: 2700-2707 (2007)

96. Jundt F, Anagnostopoulos I, Forster R, Mathas S, Stein H, Dorken B: Activated Notch1 signaling promotes tumor cell proliferation and survival in Hodgkin and anaplastic large cell lymphoma. Blood, 99: 3398-3403 (2002)

62 Bibliography

97. Kaestner K H, Knochel W, Martinez D E: Unified nomenclature for the winged helix/forkhead transcription factors. Genes & development, 14: 142-146 (2000)

98. Kallies A, Hasbold J, Fairfax K, Pridans C, Emslie D, McKenzie B S, Lew A M, Corcoran L M, Hodgkin P D, Tarlinton D M, Nutt S L: Initiation of plasma-cell differentiation is independent of the transcription factor Blimp-1. Immunity, 26: 555-566 (2007)

99. Kallies A, Hasbold J, Tarlinton D M, Dietrich W, Corcoran L M, Hodgkin P D, Nutt S L: Plasma cell ontogeny defined by quantitative changes in blimp-1 expression. The Journal of experimental medicine, 200: 967-977 (2004)

100. Kallies A, Nutt S L: Terminal differentiation of lymphocytes depends on Blimp-1. Current opinion in immunology, 19: 156-162 (2007)

101. Kanzler H, Küppers R, Hansmann M L, Rajewsky K: Hodgkin and Reed-Sternberg cells in Hodgkin's disease represent the outgrowth of a dominant tumor clone derived from (crippled) germinal center B cells. The Journal of experimental medicine, 184: 1495-1505 (1996)

102. Karube K, Nakagawa M, Tsuzuki S, Takeuchi I, Honma K, Nakashima Y, Shimizu N, Ko Y H, Morishima Y, Ohshima K, Nakamura S, Seto M: Identification of FOXO3 and PRDM1 as tumor-suppressor gene candidates in NK-cell neoplasms by genomic and functional analyses. Blood, 118: 3195-3204 (2011)

103. Kato M, Sanada M, Kato I, Sato Y, Takita J, Takeuchi K, Niwa A, Chen Y, Nakazaki K, Nomoto J, Asakura Y, Muto S, Tamura A, Iio M, Akatsuka Y, Hayashi Y, Mori H, Igarashi T, Kurokawa M, Chiba S, Mori S, Ishikawa Y, Okamoto K, Tobinai K, Nakagama H, Nakahata T, Yoshino T, Kobayashi Y, Ogawa S: Frequent inactivation of A20 in B-cell lymphomas. Nature, 459: 712-716 (2009)

104. Keller A D, Maniatis T: Identification and characterization of a novel repressor of beta-interferon gene expression. Genes & development, 5: 868-879 (1991)

105. Kerfoot S M, Yaari G, Patel J R, Johnson K L, Gonzalez D G, Kleinstein S H, Haberman A M: Germinal center B cell and T follicular helper cell development initiates in the interfollicular zone. Immunity, 34: 947-960 (2011)

106. Kilger E, Kieser A, Baumann M, Hammerschmidt W: Epstein-Barr virus-mediated B- cell proliferation is dependent upon latent membrane protein 1, which simulates an activated CD40 receptor. The EMBO journal, 17: 1700-1709 (1998)

107. Kitano M, Moriyama S, Ando Y, Hikida M, Mori Y, Kurosaki T, Okada T: Bcl6 protein expression shapes pre-germinal center B cell dynamics and follicular helper T cell heterogeneity. Immunity, 34: 961-972 (2011)

108. Klein U, Dalla-Favera R: Germinal centres: role in B-cell physiology and malignancy. Nature reviews.Immunology, 8: 22-33 (2008)

109. Klein U, Tu Y, Stolovitzky G A, Keller J L, Haddad J,Jr, Miljkovic V, Cattoretti G, Califano A, Dalla-Favera R: Transcriptional analysis of the B cell germinal center reaction. Proceedings of the National Academy of Sciences of the United States of America, 100: 2639-2644 (2003)

63 Bibliography

110. Klein U, Dalla-Favera R: Unexpected Steps in Plasma-Cell Differentiation. Immunity, 26: 543-544 (2007)

111. Kops G J, Dansen T B, Polderman P E, Saarloos I, Wirtz K W, Coffer P J, Huang T T, Bos J L, Medema R H, Burgering B M: Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature, 419: 316-321 (2002)

112. Kops G J, de Ruiter N D, De Vries-Smits A M, Powell D R, Bos J L, Burgering B M: Direct control of the Forkhead transcription factor AFX by protein kinase B. Nature, 398: 630-634 (1999)

113. Kucuk C, Iqbal J, Hu X, Gaulard P, De Leval L, Srivastava G, Au W Y, McKeithan T W, Chan W C: PRDM1 is a tumor suppressor gene in natural killer cell malignancies. Proceedings of the National Academy of Sciences of the United States of America, 108: 20119-20124 (2011)

114. Kuo T C, Calame K L: B lymphocyte-induced maturation protein (Blimp)-1, IFN regulatory factor (IRF)-1, and IRF-2 can bind to the same regulatory sites. Journal of immunology (Baltimore, Md.: 1950), 173: 5556-5563 (2004)

115. Küppers R: The biology of Hodgkin's lymphoma. Nature reviews.Cancer, 9: 15-27 (2009)

116. Küppers R, Engert A, Hansmann M L: Hodgkin lymphoma. The Journal of clinical investigation, 122: 3439-3447 (2012)

117. Küppers R, Rajewsky K: The origin of Hodgkin and Reed/Sternberg cells in Hodgkin's disease. Annual Review of Immunology, 16: 471-493 (1998)

118. Küppers R, Rajewsky K, Zhao M, Simons G, Laumann R, Fischer R, Hansmann M L: Hodgkin disease: Hodgkin and Reed-Sternberg cells picked from histological sections show clonal immunoglobulin gene rearrangements and appear to be derived from B cells at various stages of development. Proceedings of the National Academy of Sciences of the United States of America, 91: 10962-10966 (1994)

119. Labi V, Erlacher M: How cell death shapes cancer. Cell Death and Disease, 6: e1675 (2015)

120. Lee C H, Melchers M, Wang H, Torrey T A, Slota R, Qi C F, Kim J Y, Lugar P, Kong H J, Farrington L, van der Zouwen B, Zhou J X, Lougaris V, Lipsky P E, Grammer A C, Morse H C,3rd: Regulation of the germinal center gene program by interferon (IFN) regulatory factor 8/IFN consensus sequence-binding protein. The Journal of experimental medicine, 203: 63-72 (2006)

121. Lehtinen M K, Yuan Z, Boag P R, Yang Y, Villen J, Becker E B, DiBacco S, de la Iglesia N, Gygi S, Blackwell T K, Bonni A: A conserved MST-FOXO signaling pathway mediates oxidative-stress responses and extends life span. Cell, 125: 987-1001 (2006)

122. Lin K I, Angelin-Duclos C, Kuo T C, Calame K: Blimp-1-dependent repression of Pax- 5 is required for differentiation of B cells to immunoglobulin M-secreting plasma cells. Molecular and cellular biology, 22: 4771-4780 (2002)

123. Lin Y, Wong K, Calame K: Repression of c-myc transcription by Blimp-1, an inducer of terminal B cell differentiation. Science (New York, N.Y.), 276: 596-599 (1997)

64 Bibliography

124. Lin Y C, Jhunjhunwala S, Benner C, Heinz S, Welinder E, Mansson R, Sigvardsson M, Hagman J, Espinoza C A, Dutkowski J, Ideker T, Glass C K, Murre C: A global network of transcription factors, involving E2A, EBF1 and Foxo1, that orchestrates B cell fate. Nature immunology, 11: 635-643 (2010)

125. Liu H, Yin J, Wang C, Gu Y, Deng M, He Z: FOXO3a mediates the cytotoxic effects of cisplatin in lung cancer cells. Anti-Cancer Drugs, 25: 898-907 (2014a)

126. Liu J W, Chandra D, Rudd M D, Butler A P, Pallotta V, Brown D, Coffer P J, Tang D G: Induction of prosurvival molecules by apoptotic stimuli: involvement of FOXO3a and ROS. Oncogene, 24: 2020-2031 (2005)

127. Liu Y, Sattarzadeh A, Diepstra A, Visser L, van den Berg A: The microenvironment in classical Hodgkin lymphoma: an actively shaped and essential tumor component. Seminars in cancer biology, 24: 15-22 (2014b)

128. Liu Y Y, Leboeuf C, Shi J Y, Li J M, Wang L, Shen Y, Garcia J F, Shen Z X, Chen Z, Janin A, Chen S J, Zhao W L: Rituximab plus CHOP (R-CHOP) overcomes PRDM1- associated resistance to chemotherapy in patients with diffuse large B-cell lymphoma. Blood, 110: 339-344 (2007)

129. Livak K J, Schmittgen T D: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.), 25: 402-408 (2001)

130. Lobrich M, Jeggo P A: The impact of a negligent G2/M checkpoint on genomic instability and cancer induction. Nature reviews.Cancer, 7: 861-869 (2007)

131. MacLennan I C: Germinal centers. Annual Review of Immunology, 12: 117-139 (1994)

132. MacLennan I C, Toellner K M, Cunningham A F, Serre K, Sze D M, Zuniga E, Cook M C, Vinuesa C G: Extrafollicular antibody responses. Immunological reviews, 194: 8-18 (2003)

133. Maier H J, Marienfeld R, Wirth T, Baumann B: Critical role of RelB serine 368 for dimerization and p100 stabilization. The Journal of biological chemistry, 278: 39242- 39250 (2003)

134. Mandelbaum J, Bhagat G, Tang H, Mo T, Brahmachary M, Shen Q, Chadburn A, Rajewsky K, Tarakhovsky A, Pasqualucci L, Dalla-Favera R: BLIMP1 is a tumor suppressor gene frequently disrupted in activated B cell-like diffuse large B cell lymphoma. Cancer cell, 18: 568-579 (2010)

135. Mani H, Jaffe E S: Hodgkin lymphoma: an update on its biology with new insights into classification. Clinical lymphoma & myeloma, 9: 206-216 (2009)

136. Marshall N A, Christie L E, Munro L R, Culligan D J, Johnston P W, Barker R N, Vickers M A: Immunosuppressive regulatory T cells are abundant in the reactive lymphocytes of Hodgkin lymphoma. Blood, 103: 1755-1762 (2004)

137. Martin-Subero J I, Gesk S, Harder L, Sonoki T, Tucker P W, Schlegelberger B, Grote W, Novo F J, Calasanz M J, Hansmann M L, Dyer M J, Siebert R: Recurrent involvement of the REL and BCL11A loci in classical Hodgkin lymphoma. Blood, 99: 1474-1477 (2002)

65 Bibliography

138. Martin-Subero J I, Klapper W, Sotnikova A, Callet-Bauchu E, Harder L, Bastard C, Schmitz R, Grohmann S, Hoppner J, Riemke J, Barth T F, Berger F, Bernd H W, Claviez A, Gesk S, Frank G A, Kaplanskaya I B, Moller P, Parwaresch R M, Rudiger T, Stein H, Küppers R, Hansmann M L, Siebert R, Deutsche Krebshilfe Network Project Molecular Mechanisms in Malignant Lymphomas: Chromosomal breakpoints affecting immunoglobulin loci are recurrent in Hodgkin and Reed-Sternberg cells of classical Hodgkin lymphoma. Cancer research, 66: 10332-10338 (2006a)

139. Martin-Subero J I, Wlodarska I, Bastard C, Picquenot J M, Hoppner J, Giefing M, Klapper W, Siebert R: Chromosomal rearrangements involving the BCL3 locus are recurrent in classical Hodgkin and peripheral T-cell lymphoma. Blood, 108: 401-2; author reply 402-3 (2006b)

140. Mathas S, Janz M, Hummel F, Hummel M, Wollert-Wulf B, Lusatis S, Anagnostopoulos I, Lietz A, Sigvardsson M, Jundt F, Johrens K, Bommert K, Stein H, Dorken B: Intrinsic inhibition of transcription factor E2A by HLH proteins ABF-1 and Id2 mediates reprogramming of neoplastic B cells in Hodgkin lymphoma. Nature immunology, 7: 207-215 (2006)

141. Matthias P, Rolink A G: Transcriptional networks in developing and mature B cells. Nature reviews.Immunology, 5: 497-508 (2005)

142. Melchers F: Checkpoints that control B cell development. The Journal of clinical investigation, 125: 2203-2210 (2015)

143. Messika E J, Lu P S, Sung Y J, Yao T, Chi J T, Chien Y H, Davis M M: Differential effect of B lymphocyte-induced maturation protein (Blimp-1) expression on cell fate during B cell development. The Journal of experimental medicine, 188: 515-525 (1998)

144. Miyaguchi Y, Tsuchiya K, Sakamoto K: P53 negatively regulates the transcriptional activity of FOXO3a under oxidative stress. Cell biology international, 33: 853-860 (2009)

145. Mock B A, Liu L, LePaslier D, Huang S: The B-lymphocyte maturation promoting transcription factor BLIMP1/PRDI-BF1 maps to D6S447 on human chromosome 6q21- q22.1 and the syntenic region of mouse chromosome 10. Genomics, 37: 24-28 (1996)

146. Modur V, Nagarajan R, Evers B M, Milbrandt J: FOXO proteins regulate tumor necrosis factor-related apoptosis inducing ligand expression. Implications for PTEN mutation in prostate cancer. The Journal of biological chemistry, 277: 47928-47937 (2002)

147. Morin R D, Mendez-Lago M, Mungall A J, Goya R, Mungall K L, Corbett R D, Johnson N A, Severson T M, Chiu R, Field M, Jackman S, Krzywinski M, Scott D W, Trinh D L, Tamura-Wells J, Li S, Firme M R, Rogic S, Griffith M, Chan S, Yakovenko O, Meyer I M, Zhao E Y, Smailus D, Moksa M, Chittaranjan S, Rimsza L, Brooks-Wilson A, Spinelli J J, Ben-Neriah S, Meissner B, Woolcock B, Boyle M, McDonald H, Tam A, Zhao Y, Delaney A, Zeng T, Tse K, Butterfield Y, Birol I, Holt R, Schein J, Horsman D E, Moore R, Jones S J, Connors J M, Hirst M, Gascoyne R D, Marra M A: Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma. Nature, 476: 298-303 (2011)

148. Myatt S S, Wang J, Monteiro L J, Christian M, Ho K K, Fusi L, Dina R E, Brosens J J, Ghaem-Maghami S, Lam E W: Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer. Cancer research, 70: 367-377 (2010)

66 Bibliography

149. Naka K, Hoshii T, Muraguchi T, Tadokoro Y, Ooshio T, Kondo Y, Nakao S, Motoyama N, Hirao A: TGF-beta-FOXO signalling maintains leukaemia-initiating cells in chronic myeloid leukaemia. Nature, 463: 676-680 (2010)

150. Nakamura N, Ramaswamy S, Vazquez F, Signoretti S, Loda M, Sellers W R: Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Molecular and cellular biology, 20: 8969-8982 (2000)

151. Nemoto S, Finkel T: Redox regulation of forkhead proteins through a p66shc- dependent signaling pathway. Science (New York, N.Y.), 295: 2450-2452 (2002)

152. Nera K P, Kohonen P, Narvi E, Peippo A, Mustonen L, Terho P, Koskela K, Buerstedde J M, Lassila O: Loss of Pax5 promotes plasma cell differentiation. Immunity, 24: 283-293 (2006)

153. Nera K P, Kylaniemi M K, Lassila O: Regulation of B Cell to Plasma Cell Transition within the Follicular B Cell Response. Scandinavian Journal of Immunology, 82: 225-234 (2015)

154. Neumann E, Schaefer-Ridder M, Wang Y, Hofschneider P H: Gene transfer into mouse lyoma cells by electroporation in high electric fields. The EMBO journal, 1: 841-845 (1982)

155. Ng A K, Mauch P M: Late effects of Hodgkin's disease and its treatment. The Cancer Journal, 15: 164-168 (2009)

156. Niu H, Cattoretti G, Dalla-Favera R: BCL6 controls the expression of the B7-1/CD80 costimulatory receptor in germinal center B cells. The Journal of experimental medicine, 198: 211-221 (2003)

157. Nutt S L, Eberhard D, Horcher M, Rolink A G, Busslinger M: Pax5 determines the identity of B cells from the beginning to the end of B-lymphopoiesis. International reviews of immunology, 20: 65-82 (2001)

158. Nutt S L, Fairfax K A, Kallies A: BLIMP1 guides the fate of effector B and T cells. Nature reviews.Immunology, 7: 923-927 (2007)

159. Nutt S L, Hodgkin P D, Tarlinton D M, Corcoran L M: The generation of antibody- secreting plasma cells. Nature reviews.Immunology, 15: 160-171 (2015)

160. Nutt S L, Kee B L: The transcriptional regulation of B cell lineage commitment. Immunity, 26: 715-725 (2007)

161. Obexer P, Geiger K, Ambros P F, Meister B, Ausserlechner M J: FKHRL1-mediated expression of Noxa and Bim induces apoptosis via the mitochondria in neuroblastoma cells. Cell death and differentiation, 14: 534-547 (2007)

162. Obrador-Hevia A, Serra-Sitjar M, Rodriguez J, Villalonga P, Fernandez de Mattos S: The tumour suppressor FOXO3 is a key regulator of mantle cell lymphoma proliferation and survival. British journal of haematology, 156: 334-345 (2012)

163. Obsil T, Obsilova V: Structure/function relationships underlying regulation of FOXO transcription factors. Oncogene, 27: 2263-2275 (2008)

67 Bibliography

164. Ocana E, Gonzalez-Garcia I, Gutierrez N C, Mora-Lopez F, Brieva J A, Campos- Caro A: The expression of PRDI-BF1 beta isoform in multiple myeloma plasma cells. Haematologica, 91: 1579-1580 (2006)

165. Ochiai K, Maienschein-Cline M, Simonetti G, Chen J, Rosenthal R, Brink R, Chong A S, Klein U, Dinner A R, Singh H, Sciammas R: Transcriptional regulation of germinal center B and plasma cell fates by dynamical control of IRF4. Immunity, 38: 918-929 (2013)

166. Ogg S, Paradis S, Gottlieb S, Patterson G I, Lee L, Tissenbaum H A, Ruvkun G: The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature, 389: 994-999 (1997)

167. Oh S W, Mukhopadhyay A, Svrzikapa N, Jiang F, Davis R J, Tissenbaum H A: JNK regulates lifespan in Caenorhabditis elegans by modulating nuclear translocation of forkhead transcription factor/DAF-16. Proceedings of the National Academy of Sciences of the United States of America, 102: 4494-4499 (2005)

168. Omori S A, Cato M H, Anzelon-Mills A, Puri K D, Shapiro-Shelef M, Calame K, Rickert R C: Regulation of class-switch recombination and plasma cell differentiation by phosphatidylinositol 3-kinase signaling. Immunity, 25: 545-557 (2006)

169. Osswald C D, Xie L, Guan H, Herrmann F, Pick S M, Vogel M J, Gehringer F, Chan F C, Steidl C, Wirth T, Ushmorov A: Fine-tuning of FOXO3A in cHL as a survival mechanism and a hallmark of abortive plasma cell differentiation. Blood, 131: 1556-1567 (2018)

170. Otto C, Giefing M, Massow A, Vater I, Gesk S, Schlesner M, Richter J, Klapper W, Hansmann M L, Siebert R, Küppers R: Genetic lesions of the TRAF3 and MAP3K14 genes in classical Hodgkin lymphoma. British journal of haematology, 157: 702-708 (2012)

171. Ozaki K, Spolski R, Ettinger R, Kim H P, Wang G, Qi C F, Hwu P, Shaffer D J, Akilesh S, Roopenian D C, Morse H C,3rd, Lipsky P E, Leonard W J: Regulation of B cell differentiation and plasma cell generation by IL-21, a novel inducer of Blimp-1 and Bcl-6. Journal of immunology (Baltimore, Md.: 1950), 173: 5361-5371 (2004)

172. Paik J H, Kollipara R, Chu G, Ji H, Xiao Y, Ding Z, Miao L, Tothova Z, Horner J W, Carrasco D R, Jiang S, Gilliland D G, Chin L, Wong W H, Castrillon D H, DePinho R A: FoxOs are lineage-restricted redundant tumor suppressors and regulate endothelial cell homeostasis. Cell, 128: 309-323 (2007)

173. Parry P, Wei Y, Evans G: Cloning and characterization of the t(X;11) breakpoint from a leukemic cell line identify a new member of the forkhead gene family. Genes, chromosomes & cancer, 11: 79-84 (1994)

174. Pasqualucci L, Migliazza A, Basso K, Houldsworth J, Chaganti R S, Dalla-Favera R: Mutations of the BCL6 proto-oncogene disrupt its negative autoregulation in diffuse large B-cell lymphoma. Blood, 101: 2914-2923 (2003)

175. Pelanda R, Torres R M: Central B-cell tolerance: where selection begins. Cold Spring Harbor perspectives in biology, 4: a007146 (2012)

176. Phan R T, Dalla-Favera R: The BCL6 proto-oncogene suppresses p53 expression in germinal-centre B cells. Nature, 432: 635-639 (2004)

68 Bibliography

177. Phan R T, Saito M, Basso K, Niu H, Dalla-Favera R: BCL6 interacts with the transcription factor Miz-1 to suppress the cyclin-dependent kinase inhibitor p21 and cell cycle arrest in germinal center B cells. Nature immunology, 6: 1054-1060 (2005)

178. Prabhu V V, Allen J E, Dicker D T, El-Deiry W S: Small-Molecule ONC201/TIC10 Targets Chemotherapy-Resistant Colorectal Cancer Stem-like Cells in an Akt/Foxo3a/TRAIL-Dependent Manner. Cancer research, 75: 1423-1432 (2015)

179. Radbruch A, Muehlinghaus G, Luger E O, Inamine A, Smith K G, Dorner T, Hiepe F: Competence and competition: the challenge of becoming a long-lived plasma cell. Nature reviews.Immunology, 6: 741-750 (2006)

180. Ramaswamy S, Nakamura N, Sansal I, Bergeron L, Sellers W R: A novel mechanism of gene regulation and tumor suppression by the transcription factor FKHR. Cancer cell, 2: 81-91 (2002)

181. Ranuncolo S M, Polo J M, Dierov J, Singer M, Kuo T, Greally J, Green R, Carroll M, Melnick A: Bcl-6 mediates the germinal center B cell phenotype and lymphomagenesis through transcriptional repression of the DNA-damage sensor ATR. Nature immunology, 8: 705-714 (2007)

182. Ranuncolo S M, Polo J M, Melnick A: BCL6 represses CHEK1 and suppresses DNA damage pathways in normal and malignant B-cells. Blood cells, molecules & diseases, 41: 95-99 (2008)

183. Recaldin T, Fear D J: Transcription factors regulating B cell fate in the germinal centre. Clinical and experimental immunology, 183: 65-75 (2016)

184. Reimold A M, Iwakoshi N N, Manis J, Vallabhajosyula P, Szomolanyi-Tsuda E, Gravallese E M, Friend D, Grusby M J, Alt F, Glimcher L H: Plasma cell differentiation requires the transcription factor XBP-1. Nature, 412: 300-307 (2001)

185. Reljic R, Wagner S D, Peakman L J, Fearon D T: Suppression of signal transducer and activator of transcription 3-dependent B lymphocyte terminal differentiation by BCL-6. The Journal of experimental medicine, 192: 1841-1848 (2000)

186. Ren B, Chee K J, Kim T H, Maniatis T: PRDI-BF1/Blimp-1 repression is mediated by corepressors of the Groucho family of proteins. Genes & development, 13: 125-137 (1999)

187. Roberts P J, Der C J: Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene, 26: 3291-3310 (2007)

188. Rumfelt L L, Zhou Y, Rowley B M, Shinton S A, Hardy R R: Lineage specification and plasticity in CD19- early B cell precursors. The Journal of experimental medicine, 203: 675-687 (2006)

189. Saito M, Gao J, Basso K, Kitagawa Y, Smith P M, Bhagat G, Pernis A, Pasqualucci L, Dalla-Favera R: A signaling pathway mediating downregulation of BCL6 in germinal center B cells is blocked by BCL6 gene alterations in B cell lymphoma. Cancer cell, 12: 280-292 (2007)

190. Saito M, Novak U, Piovan E, Basso K, Sumazin P, Schneider C, Crespo M, Shen Q, Bhagat G, Califano A, Chadburn A, Pasqualucci L, Dalla-Favera R: BCL6 suppression of

69 Bibliography

BCL2 via Miz1 and its disruption in diffuse large B cell lymphoma. Proceedings of the National Academy of Sciences of the United States of America, 106: 11294-11299 (2009)

191. Samuels Y, Diaz L A,Jr, Schmidt-Kittler O, Cummins J M, Delong L, Cheong I, Rago C, Huso D L, Lengauer C, Kinzler K W, Vogelstein B, Velculescu V E: Mutant PIK3CA promotes cell growth and invasion of human cancer cells. Cancer cell, 7: 561-573 (2005)

192. Santamaria C M, Chillon M C, Garcia-Sanz R, Perez C, Caballero M D, Ramos F, de Coca A G, Alonso J M, Giraldo P, Bernal T, Queizan J A, Rodriguez J N, Fernandez- Abellan P, Barez A, Penarrubia M J, Vidriales M B, Balanzategui A, Sarasquete M E, Alcoceba M, Diaz-Mediavilla J, San Miguel J F, Gonzalez M: High FOXO3a expression is associated with a poorer prognosis in AML with normal cytogenetics. Leukemia research, 33: 1706-1709 (2009)

193. Savitsky D, Calame K: B-1 B lymphocytes require Blimp-1 for immunoglobulin secretion. The Journal of experimental medicine, 203: 2305-2314 (2006)

194. Schebesta A, McManus S, Salvagiotto G, Delogu A, Busslinger G A, Busslinger M: Transcription factor Pax5 activates the chromatin of key genes involved in B cell signaling, adhesion, migration, and immune function. Immunity, 27: 49-63 (2007)

195. Schmidt A, Schmitz R, Giefing M, Martin-Subero J I, Gesk S, Vater I, Massow A, Maggio E, Schneider M, Hansmann M L, Siebert R, Küppers R: Rare occurrence of biallelic CYLD gene mutations in classical Hodgkin lymphoma. Genes, chromosomes & cancer, 49: 803-809 (2010)

196. Schmitz R, Hansmann M L, Bohle V, Martin-Subero J I, Hartmann S, Mechtersheimer G, Klapper W, Vater I, Giefing M, Gesk S, Stanelle J, Siebert R, Küppers R: TNFAIP3 (A20) is a tumor suppressor gene in Hodgkin lymphoma and primary mediastinal B cell lymphoma. The Journal of experimental medicine, 206: 981-989 (2009)

197. Shaffer A L, Lin K I, Kuo T C, Yu X, Hurt E M, Rosenwald A, Giltnane J M, Yang L, Zhao H, Calame K, Staudt L M: Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity, 17: 51-62 (2002)

198. Shaffer A L, Rosenwald A, Hurt E M, Giltnane J M, Lam L T, Pickeral O K, Staudt L M: Signatures of the Immune Response. Immunity, 15: 375-385 (2001)

199. Shaffer A L, Shapiro-Shelef M, Iwakoshi N N, Lee A H, Qian S B, Zhao H, Yu X, Yang L, Tan B K, Rosenwald A, Hurt E M, Petroulakis E, Sonenberg N, Yewdell J W, Calame K, Glimcher L H, Staudt L M: XBP1, downstream of Blimp-1, expands the secretory apparatus and other organelles, and increases protein synthesis in plasma cell differentiation. Immunity, 21: 81-93 (2004)

200. Shaffer A L, Yu X, He Y, Boldrick J, Chan E P, Staudt L M: BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity, 13: 199-212 (2000)

201. Shapiro-Shelef M, Calame K: Regulation of plasma-cell development. Nature reviews.Immunology, 5: 230-242 (2005)

202. Shapiro-Shelef M, Lin K I, McHeyzer-Williams L J, Liao J, McHeyzer-Williams M G, Calame K: Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity, 19: 607-620 (2003)

70 Bibliography

203. Shi W, Liao Y, Willis S N, Taubenheim N, Inouye M, Tarlinton D M, Smyth G K, Hodgkin P D, Nutt S L, Corcoran L M: Transcriptional profiling of mouse B cell terminal differentiation defines a signature for antibody-secreting plasma cells. Nature immunology, 16: 663-673 (2015)

204. Soro P G, Morales-A P, Martinez-M J A, Morales-A S, Copin S G, Marcos M A, Gaspar M L: Differential involvement of the transcription factor Blimp-1 in T cell- independent and -dependent B cell differentiation to plasma cells. Journal of immunology, 163: 611-617 (1999)

205. Srinivasan L, Sasaki Y, Calado D P, Zhang B, Paik J H, DePinho R A, Kutok J L, Kearney J F, Otipoby K L, Rajewsky K: PI3 kinase signals BCR-dependent mature B cell survival. Cell, 139: 573-586 (2009)

206. Steidl C, Connors J M, Gascoyne R D: Molecular pathogenesis of Hodgkin's lymphoma: increasing evidence of the importance of the microenvironment. Journal of clinical oncology : official journal of the American Society of Clinical Oncology, 29: 1812- 1826 (2011)

207. Steidl C, Diepstra A, Lee T, Chan F C, Farinha P, Tan K, Telenius A, Barclay L, Shah S P, Connors J M, van den Berg A, Gascoyne R D: Gene expression profiling of microdissected Hodgkin Reed-Sternberg cells correlates with treatment outcome in classical Hodgkin lymphoma. Blood, 120: 3530-3540 (2012)

208. Stein H, Marafioti T, Foss H D, Laumen H, Hummel M, Anagnostopoulos I, Wirth T, Demel G, Falini B: Down-regulation of BOB.1/OBF.1 and Oct2 in classical Hodgkin disease but not in lymphocyte predominant Hodgkin disease correlates with immunoglobulin transcription. Blood, 97: 496-501 (2001)

209. Sunayama J, Sato A, Matsuda K, Tachibana K, Watanabe E, Seino S, Suzuki K, Narita Y, Shibui S, Sakurada K, Kayama T, Tomiyama A, Kitanaka C: FoxO3a functions as a key integrator of cellular signals that control glioblastoma stem-like cell differentiation and tumorigenicity. Stem cells (Dayton, Ohio), 29: 1327-1337 (2011)

210. Sunters A, Fernandez de Mattos S, Stahl M, Brosens J J, Zoumpoulidou G, Saunders C A, Coffer P J, Medema R H, Coombes R C, Lam E W: FoxO3a transcriptional regulation of Bim controls apoptosis in paclitaxel-treated breast cancer cell lines. The Journal of biological chemistry, 278: 49795-49805 (2003)

211. Sykes S M, Lane S W, Bullinger L, Kalaitzidis D, Yusuf R, Saez B, Ferraro F, Mercier F, Singh H, Brumme K M, Acharya S S, Scholl C, Tothova Z, Attar E C, Frohling S, DePinho R A, Armstrong S A, Gilliland D G, Scadden D T: AKT/FOXO signaling enforces reversible differentiation blockade in myeloid leukemias. Cell, 146: 697-708 (2011)

212. Szydlowski M, Jablonska E, Juszczynski P: FOXO1 transcription factor: a critical effector of the PI3K-AKT axis in B-cell development. International reviews of immunology, 33: 146-157 (2014)

213. Tang T T, Dowbenko D, Jackson A, Toney L, Lewin D A, Dent A L, Lasky L A: The forkhead transcription factor AFX activates apoptosis by induction of the BCL-6 transcriptional repressor. The Journal of biological chemistry, 277: 14255-14265 (2002)

214. Tiacci E, Doring C, Brune V, van Noesel C J, Klapper W, Mechtersheimer G, Falini B, Küppers R, Hansmann M L: Analyzing primary Hodgkin and Reed-Sternberg cells to

71 Bibliography capture the molecular and cellular pathogenesis of classical Hodgkin lymphoma. Blood, 120: 4609-4620 (2012)

215. Tooze R M: A replicative self-renewal model for long-lived plasma cells: questioning irreversible cell cycle exit. Frontiers in immunology, 4: 460 (2013)

216. Torlakovic E, Tierens A, Dang H D, Delabie J: The transcription factor PU.1, necessary for B-cell development is expressed in lymphocyte predominance, but not classical Hodgkin's disease. The American journal of pathology, 159: 1807-1814 (2001)

217. Torre L A, Bray F, Siegel R L, Ferlay J, Lortet-Tieulent J, Jemal A: Global cancer statistics, 2012. CA: a cancer journal for clinicians, 65: 87-108 (2015)

218. Tran H, Brunet A, Grenier J M, Datta S R, Fornace A J,Jr, DiStefano P S, Chiang L W, Greenberg M E: DNA repair pathway stimulated by the forkhead transcription factor FOXO3a through the Gadd45 protein. Science (New York, N.Y.), 296: 530-534 (2002)

219. Trinh D L, Scott D W, Morin R D, Mendez-Lago M, An J, Jones S J, Mungall A J, Zhao Y, Schein J, Steidl C, Connors J M, Gascoyne R D, Marra M A: Analysis of FOXO1 mutations in diffuse large B-cell lymphoma. Blood, 121: 3666-3674 (2013)

220. Tunyaplin C, Shaffer A L, Angelin-Duclos C D, Yu X, Staudt L M, Calame K L: Direct repression of prdm1 by Bcl-6 inhibits plasmacytic differentiation. Journal of immunology (Baltimore, Md.: 1950), 173: 1158-1165 (2004)

221. Turner C A,Jr, Mack D H, Davis M M: Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell, 77: 297-306 (1994)

222. Ushmorov A, Leithauser F, Sakk O, Weinhausel A, Popov S W, Moller P, Wirth T: Epigenetic processes play a major role in B-cell-specific gene silencing in classical Hodgkin lymphoma. Blood, 107: 2493-2500 (2006)

223. Ushmorov A, Wirth T: FOXO in B-cell lymphopoiesis and B cell neoplasia. Seminars in cancer biology, (2017)

224. van der Vos K E, Coffer P J: FOXO-binding partners: it takes two to tango. Oncogene, 27: 2289-2299 (2008)

225. Van Roosbroeck K, Cox L, Tousseyn T, Lahortiga I, Gielen O, Cauwelier B, De Paepe P, Verhoef G, Marynen P, Vandenberghe P, De Wolf-Peeters C, Cools J, Wlodarska I: JAK2 rearrangements, including the novel SEC31A-JAK2 fusion, are recurrent in classical Hodgkin lymphoma. Blood, 117: 4056-4064 (2011)

226. Vogel M J, Xie L, Guan H, Tooze R M, Maier T, Kostezka U, Maier H J, Holzmann K, Chan F C, Steidl C, Reichel J B, Weitzer C D, Gehringer F, Kick A B, Cesarman E, Roshal M, Gascoyne R D, Moller P, Wirth T, Ushmorov A: FOXO1 repression contributes to block of plasma cell differentiation in classical Hodgkin lymphoma. Blood, 124: 3118-3129 (2014)

227. Vrzalikova K, Woodman C B, Murray P G: BLIMP1alpha, the master regulator of plasma cell differentiation is a tumor supressor gene in B cell lymphomas. Biomedical papers of the Medical Faculty of the University Palacky, Olomouc, Czechoslovakia, 156: 1-6 (2012)

72 Bibliography

228. Wang F, Marshall C B, Yamamoto K, Li G Y, Plevin M J, You H, Mak T W, Ikura M: Biochemical and structural characterization of an intramolecular interaction in FOXO3a and its binding with p53. Journal of Molecular Biology, 384: 590-603 (2008)

229. Weber-Matthiesen K, Deerberg J, Poetsch M, Grote W, Schlegelberger B: Numerical chromosome aberrations are present within the CD30+ Hodgkin and Reed-Sternberg cells in 100% of analyzed cases of Hodgkin's disease. Blood, 86: 1464-1468 (1995)

230. Weigel D, Jurgens G, Kuttner F, Seifert E, Jackle H: The homeotic gene fork head encodes a nuclear protein and is expressed in the terminal regions of the Drosophila embryo. Cell, 57: 645-658 (1989)

231. Weniger M A, Melzner I, Menz C K, Wegener S, Bucur A J, Dorsch K, Mattfeldt T, Barth T F, Moller P: Mutations of the tumor suppressor gene SOCS-1 in classical Hodgkin lymphoma are frequent and associated with nuclear phospho-STAT5 accumulation. Oncogene, 25: 2679-2684 (2006)

232. Willenbrock K, Küppers R, Renne C, Brune V, Eckerle S, Weidmann E, Brauninger A, Hansmann M L: Common features and differences in the transcriptome of large cell anaplastic lymphoma and classical Hodgkin's lymphoma. Haematologica, 91: 596-604 (2006)

233. Wu Z, Sun H, Zeng W, He J, Mao X: Upregulation of MircoRNA-370 induces proliferation in human prostate cancer cells by downregulating the transcription factor FOXO1. PloS one, 7: e45825 (2012)

234. Xie L, Ritz O, Leithauser F, Guan H, Farbinger J, Weitzer C D, Gehringer F, Bruederlein S, Holzmann K, Vogel M J, Moller P, Wirth T, Ushmorov A: FOXO1 downregulation contributes to the oncogenic program of primary mediastinal B-cell lymphoma. Oncotarget, 5: 5392-5402 (2014)

235. Xie L, Ushmorov A, Leithauser F, Guan H, Steidl C, Farbinger J, Pelzer C, Vogel M J, Maier H J, Gascoyne R D, Moller P, Wirth T: FOXO1 is a tumor suppressor in classical Hodgkin lymphoma. Blood, 119: 3503-3511 (2012)

236. Xie M, Shao G, Buyse I M, Huang S: Transcriptional Repression Mediated by the PR Domain Zinc Finger Gene RIZ. Journal of Biological Chemistry, 272: 26360-26366 (1997)

237. Yamamoto M, Kondo E, Takeuchi M, Harashima A, Otani T, Tsuji-Takayama K, Yamasaki F, Kumon H, Kibata M, Nakamura S: miR-155, a Modulator of FOXO3a Protein Expression, Is Underexpressed and Cannot Be Upregulated by Stimulation of HOZOT, a Line of Multifunctional Treg. PloS one, 6: e16841 (2011)

238. Yamamura Y, Lee W L, Inoue K, Ida H, Ito Y: RUNX3 cooperates with FoxO3a to induce apoptosis in gastric cancer cells. The Journal of biological chemistry, 281: 5267- 5276 (2006)

239. Yang J Y, Hung M C: A new fork for clinical application: targeting forkhead transcription factors in cancer. Clinical cancer research : an official journal of the American Association for Cancer Research, 15: 752-757 (2009)

240. Yang J Y, Zong C S, Xia W, Yamaguchi H, Ding Q, Xie X, Lang J Y, Lai C C, Chang C J, Huang W C, Huang H, Kuo H P, Lee D F, Li L Y, Lien H C, Cheng X, Chang K J, Hsiao C D, Tsai F J, Tsai C H, Sahin A A, Muller W J, Mills G B, Yu D, Hortobagyi G N,

73 Bibliography

Hung M C: ERK promotes tumorigenesis by inhibiting FOXO3a via MDM2-mediated degradation. Nature cell biology, 10: 138-148 (2008)

241. Ye B H, Cattoretti G, Shen Q, Zhang J, Hawe N, de Waard R, Leung C, Nouri-Shirazi M, Orazi A, Chaganti R S, Rothman P, Stall A M, Pandolfi P P, Dalla-Favera R: The BCL- 6 proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nature genetics, 16: 161-170 (1997)

242. Ye B H, Lista F, Lo Coco F, Knowles D M, Offit K, Chaganti R S, Dalla-Favera R: Alterations of a zinc finger-encoding gene, BCL-6, in diffuse large-cell lymphoma. Science (New York, N.Y.), 262: 747-750 (1993)

243. Ying C Y, Dominguez-Sola D, Fabi M, Lorenz I C, Hussein S, Bansal M, Califano A, Pasqualucci L, Basso K, Dalla-Favera R: MEF2B mutations lead to deregulated expression of the oncogene BCL6 in diffuse large B cell lymphoma. Nature immunology, 14: 1084-1092 (2013)

244. You H, Yamamoto K, Mak T W: Regulation of transactivation-independent proapoptotic activity of p53 by FOXO3a. Proceedings of the National Academy of Sciences of the United States of America, 103: 9051-9056 (2006)

245. Yu J, Angelin-Duclos C, Greenwood J, Liao J, Calame K: Transcriptional repression by blimp-1 (PRDI-BF1) involves recruitment of histone deacetylase. Molecular and cellular biology, 20: 2592-2603 (2000)

246. Zhang Y W, Zhang J, Li J, Zhu J F, Yang Y L, Zhou L L, Hu Z L, Zhang F: Methylation contributes to imbalance of PRDM1alpha/PRDM1bbeta expression in diffuse large B-cell lymphoma. Leukemia & lymphoma, 56: 2429-2438 (2015)

247. Zhao W L, Liu Y Y, Zhang Q L, Wang L, Leboeuf C, Zhang Y W, Ma J, Garcia J F, Song Y P, Li J M, Shen Z X, Chen Z, Janin A, Chen S J: PRDM1 is involved in chemoresistance of T-cell lymphoma and down-regulated by the proteasome inhibitor. Blood, 111: 3867-3871 (2008)

248. Zheng B, Fiumara P, Li Y V, Georgakis G, Snell V, Younes M, Vauthey J N, Carbone A, Younes A: MEK/ERK pathway is aberrantly active in Hodgkin disease: a signaling pathway shared by CD30, CD40, and RANK that regulates cell proliferation and survival. Blood, 102: 1019-1027 (2003)

74 Acknowledgments

Acknowledgments Acknowledgments were removed for data privacy protection reasons.

75 Curriculum vitae

Curriculum vitae CV was removed for data privacy protection reasons.

76 Curriculum vitae

77