Biological Activities of Recombinant Equine Luteinizing Hormone/Chorionic Gonadotropin (Elh/CG) Expressed in Sf9 and Mimic Insect Cell Lines

47 Biological activities of recombinant equine luteinizing hormone/chorionic gonadotropin (eLH/CG) expressed in Sf9 and Mimic insect cell lines

Sébastien Legardinier, Martine Duonor-Cérutti1, Gérard Devauchelle1, Yves Combarnous and Claire Cahoreau Unité de Physiologie de la Reproduction et des Comportements, Institut National de la Recherche Agronomique (INRA), Centre National de la Recherche Scientiﬁque (CNRS) et Université François Rabelais de Tours, 37 380 Nouzilly, France 1Unité de Pathologie Comparée, UMR INRA-CNRS, 30380 Saint-Christol-lez-Alès, France

(Requests for offprints should be addressed to S Legardinier; Email: [email protected])

Abstract

Equine luteinizing hormone (eLH) and chorionic gonadotropin (eCG) are composed of identical and polypeptide chains, but eCG subunits are much more heavily glycosylated and sialylated. Consequently, eCG exhibits a much longer half-life than eLH in blood. Recombinant eLH/CG, expressed in Sf9 and Mimic insect cells, were compared with one another and to the natural hormones eCG and eLH. Mimic cells are stably-transformed Sf9 cells, expressing five mammalian genes encoding glycosyltransferases involved in the synthesis of complex N-carbohydrate chains. Recombinant eLH/CG expressed in Mimic cells exhibited a higher apparent molecular weight (MW) than that expressed in Sf9 cells, suggesting that its N-glycosylation was, as expected, more complete. Nevertheless, the two recombinant eLH/CG exhibited lower MW than natural eCG from pregnant mare plasma. The two eLH/CG produced in Sf9 and Mimic cells were found to be active in in vitro LH and FSH bioassays, with potencies similar to those of eCG. By contrast, they exhibited no significant in vivo bioactivity, neither in the specific follicle-stimulating hormone (FSH) assay nor in the specific eCG assay. Although recombinant eLH/CG produced in Mimic cells bears more elaborate carbohydrate chains than recombinant eLH/CG from Sf9 cells, it exhibits no significant in vivo bioactivity, probably because of insufficient terminal sialylation of its carbohydrate chains, leading to its rapid removal from blood. Journal of Molecular Endocrinology (2005) 34, 47–60

Introduction 1984). Although eCG and eLH exhibit identical and polypeptide chains, their carbohydrate contents are Equine chorionic gonadotropin (eCG) formerly named different. Indeed, eCG is the most heavily glycosylated of pregnant mare serum gonadotropin (PMSG) belongs to all glycoprotein hormones, with 45% carbohydrate by the family of glycoprotein hormones. It is produced by weight (Harbon-Chabbat et al. 1961, Gospodarowicz trophoblast cells of endometrial cups in pregnant mares 1972) versus 30% for eLH (Roser et al. 1984, Butnev and plays a major role in the maintenance of early et al. 1996). The -subunit, composed of 96 amino acids, gestation (Allen & Moor 1972). Like the other members of bears two complex-type N-linked oligosaccharide chains the family, including luteinizing hormone (LH), follicle- located at asparagines (Asn) 56 and 82 whereas the stimulating hormone (FSH) and thyroid-stimulating -subunit composed of 149 amino acids has only one at hormone (TSH), eCG is composed of two dissimilar and Asn 13. In addition to N-glycans, both eLH and eCG noncovalently associated - and -subunits. Within the -subunits possess a carboxy-terminal peptide (CTP) of same species, the -subunit is encoded by a single gene 28 amino acids (122–149), which is O-glycosylated at and is common to all glycoprotein hormones, whereas the same twelve serine or threonine residues (Bousﬁeld different genes encode -subunits that confer speciﬁcity & Butnev 2001). Placental and pituitary hormones to the glycoprotein hormone heterodimers (Goverman & also strongly differ by their N-glycan termination with Pierce 1981, Combarnous 1992). In equids, in contrast sialic acids (Sia2,3 Gal) on eCG and sulphated N- to primates, both LH and CG -subunits are encoded acetylgalactosamines (SO4–4-GalNAc) on eLH (Smith by the same gene (Sherman et al. 1992) and consequently et al. 1993, Matsui et al. 1994). The remarkable difference the recombinant hormone is called eLH/CG. Both in their molecular weight is essentially due to the placental eCG and pituitary eLH exhibit dual LH and presence of longer disialylated poly-N-acetyllactosaminyl FSH in non equine species with identical FSH/LH O-glycans on eCG, with a greater percentage of activity ratios (Stewart & Allen 1979, Combarnous et al. O-glycans attached at serine and threonine sites

Journal of Molecular Endocrinology (2005) 34, 47–60 DOI: 10.1677/jme.1.01624 0952–5041/05/034–047 © 2005 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access 48 S LEGARDINIER and others · Bioactivities of eLH/CG expressed in insect cells

Figure 1 Schematic representation of N- and O-glycans attached on placental eCG, pituitary eLH and recombinant eLH/CG expressed in Sf9 and Mimic cells. Monosaccharides are represented with indicated speciﬁc symbols. The location of these oligosaccharide chains on and subunit with or without CTP is represented.

(Hokke et al. 1994, Bousﬁeld & Butnev 2001) (Fig. 1). therapeutic agents. Only recombinant gonadotropins These structural differences explain why eCG has such produced in mammalian cells have been shown so far to an exceptional half-life compared with eLH. Owing to exhibit in vivo biological activity. Such hormones, like its biological properties, eCG has been used for a long hFSH expressed in chinese hamster ovary (CHO) cells time in fertilization programs. Nevertheless, commercial (Keene et al. 1989), have even been put on the market as preparations of partially puriﬁed eCG from PMSG could Gonal-F (Serono, Geneva, Switzerland) and Puregon (NV contain contaminants with potential sanitary risks. It is of Organon, Oss, The Netherlands). However, the great great interest to produce, in large quantities, a bioactive advantage of non-mammalian systems like yeasts, insect substitute for eCG and other gonadotropins used as cell lines or plants would be to produce recombinant

Journal of Molecular Endocrinology (2005) 34, 47–60 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access Bioactivities of eLH/CG expressed in insect cells · S LEGARDINIER and others 49

Figure 2 Alignments of the ﬁrst 20 amino acids and corresponding nucleotide sequences for mature equine and donkey

gonadotropin alpha subunit (e and dk) and also the corresponding 16 first residues for human alpha subunit. The chimeric human/equine alpha-subunit (he) is also shown. The common Bsm I restriction site is underlined. proteins in larger amounts, at a lower cost, and in the Figure 2, with corresponding nucleotide sequences. The absence of fetal calf serum. Some gonadotropins of few human nucleotides of chimeric he cDNA zootechnical interest have already been expressed in (Chopineau et al. 1997) were replaced with those baculovirus systems (Huang et al. 1991, Inaba et al. 1998, encoding the equine -subunit (e) (Ward et al. 1982, Kato et al. 1998, van de Wiel et al. 1998), in the methylo- Chopineau & Stewart 1996) using common Bsm I tropic yeast Pichia pastoris (Fidler et al. 1998, 2003, Richard restriction sites. This construct was used as a template to et al. 1998), and in plants (Dirnberger et al. 2001). How- introduce XbaI restriction sites at each end and to ever, only in vitro biological activities have been reported remove the 3 untranslated region by PCR using primers in these studies, with no information concerning the in vivo A and B (Table 1). Then, the amplified fragment potencies of the recombinant hormones produced. (430 bp) was digested and inserted downstream of the Recently, single-chain eLH/CG (Galet et al. 2001) and polyhedrin promoter (PH) at a unique XbaI site in a bFSH (Coulibaly et al. 2002) have been produced in the modified pGmAc116T baculovirus transfer vector (Poul milk of transgenic rabbits. In vivo biological activity was et al. 1995) (Fig. 3A). determined only for eLH/CG, and it was found inactive A full-length cDNA encoding the equine LH/CG because its half-life was too short, most likely because the -subunit (e), including its signal peptide sequence and carbohydrate moieties of recombinant glycoproteins in previously cloned into pCDM8 (Chopineau et al. 1995), milk (Koles et al. 2004) are unusual compared with those was used. Its 3 untranslated region was removed and found in serum glycoproteins. The present study deals Bgl II and Hind III restriction sites were introduced at with the analysis of the biological activities of recom- its ends by PCR using primers C and D (Table 1). The binant eLH/CG produced in two insect cell lines, Sf9 digested PCR product (535 bp) was inserted downstream and Mimic cells, the latter derived from Sf9 cells and of the protein p10 promoter (P10) into baculovirus expressing several mammalian glycosyltransferase genes transfer vector p119 (Chaabihi et al. 1993) using the (Hollister et al. 2002). Mimic cells have been claimed Bgl II and Hind III cloning sites (Fig. 3B). to produce glycoproteins with complex biantennary Truncated cDNA encoding equine LH/CG -subunit N-oligosaccharide chains terminating with sialic acids on missing its 122–149 sequence corresponding to the CTP one branch, instead of truncated trimannose N-glycans (eCTP) was obtained from the full-length cDNA as a as usually found in insect cells (Fig. 1). The present work template by PCR using primers E and F, introducing a was undertaken to determine whether recombinant TGA stop codon at position 122 (Table 1). Then, the eLH/CG expressed in Mimic cells is more completely amplified product (446 bp) was subcloned into pGEM-T glycosylated than that expressed in Sf9 cells and and reinserted into baculovirus transfer vector p119 using whether, consequently, it exhibits in vivo bioactivities. the indicated restriction sites and sequenced (Fig. 3B). The e cDNA construct was also cloned in the mammalian expression vector pCDM8 and co-transfected Materials and methods with pCDM8-e (Chopineau et al. 1997) into COS-7 cells to produce the ee eLH/CG heterodimer in order Cloning of complementary DNAs to compare its in vitro bioactivity with that of the Alignments of conserved amino acid sequences of equine previously studied chimeric hee heterodimer. (e), donkey (dk), human (h) and chimeric human/ PCR was carried out using Taq polymerase (Promega, equine (he) gonadotropin -subunits are shown in Charbonnières, France) and amplified PCR products www.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 47–60

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access 50 S LEGARDINIER and others · Bioactivities of eLH/CG expressed in insect cells

Figure 3 Construction of baculovirus transfer vectors pGmAc116T-e (PH), p119-e (P10) and also p119-eCTP (P10). (A) The human 58 part (striped box) of initial chimeric he cDNA construct comprising its signal peptide sequence was replaced with the equivalent part of donkey glycoprotein dk cDNA (dotted box) using common Sac II (into pCDM8) and Bsm I restriction sites generating a chimeric donkey/equine cDNA (dke). This new construct encodes the native equine alpha-subunit (e) and was used as a template for PCR using primers A and B introducing Xba I restriction site at each end. Digested amplified fragment was inserted downstream of the polyhedrin promoter (PH) in the modified Xba I baculovirus transfer vector pGmAc116T. (B) Full-length cDNA encoding e comprising its signal peptide sequence was previously cloned into pCDM8. PCR was used to amplify full length -subunit cDNA (primers C and D) or truncated cDNA encoding eCTP (primers E and F), introducing Bgl II and Hind III at the 58 and 38 end respectively. Digested amplified fragments were separately inserted downstream of the protein p10 promoter (P10) into baculovirus transfer vector p119 using the Bgl II and Hind III cloning sites.

were subcloned into pGEM-T (Promega) and digested France). Restriction enzymes were purchased from using the restriction enzymes indicated (Fig. 3). Resulting Roche (Meylan, France) and oligonucleotides from fragments were low-melting gel-purified using NuSieve Eurogentec (Seraing, Belgium). GTG agarose (BMA, Tébu, Le Perray-en-Yvelines, France) and directly ligated into specific baculovirus Transient transfections of COS-7 cells transfer vectors as described above. The sequences of all the amplified products were checked by the dideoxy COS-7 monkey kidney cells (ATCC-CRL 1651) were chain termination method (Genome Express, Meylan, maintained at 37 C in Dulbecco’s modified Eagle’s

Table 1 Sequences of the primers used in PCR to amplify nucleotide sequences encoding the equivalent equine alpha subunit (A,B) and eLH/CG beta subunit with (C,D) or without CTP (betaCTP) (E,F). The initiation and stop codons are underlined and the restriction sites are in bold

Primers sequences Restriction sites

Primers names A=Alpha 58 TCTAGACTGCAAAAAATCCAGAGGAAGAAGA Xba I B=Alpha 38 GCTCTAGACTTTTAAATCTTGTGGTGAT Xba I C=Beta 58 GAAGATCTAGAACCAAGGATGGAG Bgl II D=Beta 38 CCCAAGCTTTGTAGTTCAAGAAG Hind III

E=BetaeCTP 58 CTAAGATCTAGAACCAAGGATGGAG Bgl II F=BetaeCTP 38 GTGAAAGCTTGGGATCAGGGATCC Hind III

Journal of Molecular Endocrinology (2005) 34, 47–60 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access Bioactivities of eLH/CG expressed in insect cells · S LEGARDINIER and others 51

medium (DMEM) without sodium pyruvate; supple- and p119-eCTP were used. In each case, recombinant mented with 10% heat-inactivated fetal bovine serum baculoviruses were selected by plaque assay and (FBS), 10 mM HEPES buffer, 2 mM L-glutamine (Gln), distinguished from the wild-type progeny by their 100 units/ml penicillin and 100 µg/ml streptomycin. occlusion body-negative phenotype. The screening and COS-7 cells were transiently transfected using the purification of the recombinant baculoviruses NPV-e calcium phosphate precipitation procedure. Briefly, cells (PH), SLP10-e (P10) and SLP10-eCTP (P10) were were cotransfected at 75% of confluency in duplicate in carried out as previously described (Summers & Smith 6 cm diameter Petri dishes with 1 µg of each construct in 1987). serum-free media. pCDM8-e was co-transfected with pCDM8 containing ,or cDNAs. After 48 h he e Quantitation of expressed recombinant hormones in incubation at 37 C, media were recovered by enzyme-linked immunosorbent assay (ELISA) centrifugation at 100 g for 5 min and stored at 20 C until assayed. Unless otherwise stated, all other reagents The concentrations of the recombinant eLH/CG used in cell culture were purchased from Invitrogen dimeric hormones produced in COS-7 cells or insect (Cergy Pontoise, France). cells culture media were determined in a sandwich ELISA as previously described (Galet et al. 2000). The microtitration plates from Nunc (Maxisorp, VWR, Cells and virus infection Strasbourg, France) were coated overnight at 4 C with The Sf9 subclone of Spodoptera frugiperda Sf21 cells 100µl per well 89A2 mouse monoclonal antibody (Vaughn et al. 1977) was maintained at 28 Cin (1µg/ml) (Intervet, Boxmeer, Holland) recognizing the supplemented TC-100 growth medium containing 5% alpha chain as single subunit and as heterodimer in eCG heat-inactivated FBS, 50 units/ml penicillin G and (Chopineau et al. 1993). After five washes in 0·1% 50 µg/ml streptomycin. Mimic cells (Invitrogen) were Tween 20–PBS (1·15 g/l Na2HPO4, 0·2 g/l KH2P04, cultured in complete Grace’s Insect Medium, supple- 8 g/l NaCl, 0·2 g/l KCl, Dulbecco) and saturation of mented with 10% FBS and antibiotics as above. Both non-specific sites with 0·2% bovine serum albumin insect cell lines were maintained as adherent cells at a (BSA) (Sigma, Saint-Quentin Fallavier, France) in 0·1% density of 2·0106 to 2·5106 cells per ml in 25 cm2 Tween 20–PBS, 100 µl per well of standard eCG flasks (Falcon) and passed over 80% confluency three NZY-01 (1500 IU/mg) (Lecompte et al. 1998) or media times a week. To reach the same cell density as that containing recombinant eLH/CG were incubated at obtained with Sf9 cells, more Mimic cells had to be different concentrations for 1 h at 4 C. After five washes passed because of their slower growth (but never more with 0·1% Tween20-PBS, a rabbit polyclonal antibody than 30 times, as recommended by the manufacturer). raised against highly-purified eCG (Cahoreau & The viruses were propagated in both cell lines and Combarnous 1987) was added at a 1:100 000 dilution recovered as described previously (Summers & Smith for 1 h at 4 C. A peroxidase-conjugated goat anti-rabbit 1987). Cells were infected or co-infected with recom- IgG (Jackson ImmunoResearch, Interchim, Montluçon, binant baculoviruses at a multiplicity of infection (MOI) France) added at 1:10 000 dilution for 1 h at 4 C and, ranging from 5 to 10 plaque forming units (Pfu) per cell. after five washes, 100 µl/well SureBlue TMB peroxidase After 45 min incubation with viral suspensions, fresh substrate was added (KPL, Eurobio, Les Ulis, France) culture media were added and cells were incubated at and the mixture was incubated for 20 min at room 28 C until day 5 post-infection. The viral titers were temperature in the dark. The reaction was stopped with determined by plaque assay (Summers & Smith 1987). 50 µl 2N H2SO4 and the absorbance was measured at 450 nm using a SpectraCount (Packard, Downers Grove, IL, USA) spectrophotometer and data were Construction of the recombinant baculoviruses analyzed by the I-SMART software (Packard, Downers Sf9 cells were cotransfected with 5 µg transfer vector Grove, IL, USA). and 500 ng purified viral DNA using a lipofection method (DOTAP, Roche, Meylan, France). Two Western blot analysis of the recombinant dimeric distinct viral DNA preparations were used: (i) viral DNA hormones and free - and -subunits extracted from the wild-type Autographa californica multiple nucleocapsid polyhedrosis virus (AcMNPV), Sf9 or transgenic Mimic insect cells were seeded in when a polyhedrin-specific transfer vector such as 25 cm2 flasks and inoculated separately or simul- pGmAc116T-e was used or (ii) viral DNA extracted taneously with recombinant NPV-e (PH), SLP10-e from the baculovirus AcSLP10 (Chaabihi et al. 1993) (P10) and SLP10-eCTP (P10). Supernatants were which possesses only one very late promoter, the P10 recovered by centrifugation at 100 g for 5 min and promoter, driving the expression of the polyhedrin gene aliquots (30 µl) were diluted in Laemmli’s 4 buffer when the P10 specific transfer vectors such as p119-e (Laemmli 1970) under non reducing or reducing www.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 47–60

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access 52 S LEGARDINIER and others · Bioactivities of eLH/CG expressed in insect cells

conditions (5% -mercaptoethanol). Unheated or heated (HS), 2·5% FBS, 2 mM L-Gln and 80µg/ml Geneticin samples were electrophoresed in 10 or 14% sodium (G418) in 48-well plates and incubated at 37 Cfor3or dodecyl sulphate polyacrylamide gels (SDS-PAGE). 4 days. Twenty-four hours before the stimulation, cells After separation, proteins were transferred overnight were cultured in 0·5 ml F10 media that was poorer in at 4 C onto reinforced nitrocellulose membranes serum (5% HS, 0·8% FBS, 2 mM Gln and 80µg/ml (Schleicher and Shuell, Ecquevilly, France) within a G418). Finally, Y1 cells were stimulated with 0·5 ml of mini-transblot apparatus in 20% v/v propanol-2/Tris– the same samples as above in serum-free F10 medium glycine (25 mM Tris, 0·192 M glycine) buffer from containing 1 mg/ml BSA and 2 mM L-Gln. After an Amresco (Interchim, Montluçon, France). Membranes incubation of 4 h at 37 C, media were stored at were satured for 30 min at room temperature in Tris 20 C until assayed. buffer saline (TBS; 25 mM Tris, 140 mM NaCl, 3 mM Secreted progesterone recovered in media from KCl pH 7·4) Amresco containing 0·05% Tween 20 and MLTC-1 or Y1 cells was measured by a specific 5% non-fat milk and then incubated for 2 h with specific radioimmunoassay (Saumande & Batra 1985). Relative antibodies. Dimeric hormones were specifically revealed LH and FSH potencies of recombinant hormones in using rabbit polyclonal anti-eCG antibody (Cahoreau & COS-7 cells and in insect cells were determined Combarnous 1987) at 1: 50 000 dilution. Free and respectively with hee and standard eCG NZY-01 as subunits with or without CTP were revealed using 10 ml references. Relative biopotencies were calculated on the mouse monoclonal antibody 89A2 (1µg/ml) (Intervet) basis of ED50 corresponding to the dose necessary to (Chopineau et al. 1993) and a rabbit polyclonal antibody obtain 50% of the maximal production. (dilution 1:5000) raised against a synthetic LH/CG 1–9 peptide representing the nine N-terminal residues of LH and CG -subunits from numerous species Animals (M Chopineau & C Galet, unpublished). This peptide Immature 25-day old female Wistar rats were obtained with highly-conserved sequence among all LH and CG from the animal breeding facility of the laboratory. All -subunits was conjugated to Keyhole Limpet hemo- the procedures used in this paper were in compliance cyanin using carbodiimide as the coupling agent. The with the European Community Council Directive of membranes were washed three times for 10 min in 24 November 1986 (86/609/EEC). TBS–0·05% Tween 20 and incubated for 45 min with peroxidase-conjugated goat anti-rabbit or anti-mouse IgG (Jackson ImmunoResearch; Interchim, Montluçon, In vivo eCG and FSH bioassays France) diluted 1:5000. After three washes, the membranes were analysed using SuperSignal, West Pico Supernatants containing recombinant eLH/CG from (Pierce). Sf9 or Mimic cells were harvested 5 days postinfection and were centrifuged for 10 min at 1000 g. After dialysis, the samples were frozen at 80 C, lyophilised In vitro LH and FSH bioassays and diluted in 0·15 M saline on the basis of their LH and FSH bioactivities of recombinant hormones immunoactivity in ELISA. The in vivo eCG bioactivity of were estimated by the in vitro stimulation of progesterone recombinant hormones expressed in insect cells was production respectively in mouse Leydig tumoral cells determined in the eCG test of the Pharmacopoeia (Cole & MLTC-1 (ATCCCRL 2065) and in a mouse adrenal Erway 1941). The in vivo FSH bioactivity was evaluated cortex tumor stably expressing the human FSH receptor, using a specific FSH bioassay of the Pharmacopoeia referred to as Y1 cells (kindly given by Ares Serono, (Steelman & Pohley 1953). Five animals were injected Geneva, Switzerland) (Kelton et al. 1992). For the in vitro s.c. for each dose of hormone and one to four doses were LH bioassay, about 1·5105 MLTC-1 cells per well used per hormone to be tested. were incubated at 37 C in 0·5 ml supplemented RPMI growth medium (10% FBS, 50 µg/ml gentamicin, 10 units/ml penicillin and 10 µg/ml streptomycin) in Results 48-well plates until 80% confluency. Just before Production of recombinant eLH/CG expressed in stimulation, cells were incubated for 2 h in 0·5 ml COS-7 and insect cells serum-free RPMI media and then stimulated for 2 h with 0·5 ml serum-free RMPI media containing samples The quantities of recombinant hormones secreted by of recombinant hormones at different concentrations. COS-7 and insect cells were estimated in a sandwich The supernatants were recovered and stored at 20 C ELISA using standard eCG NZY-01 (1500 IU/mg) as until assayed. To estimate the in vitro FSH bioactivity, reference and also compared with pituitary eLH (Fig. 4). 5 1·5 10 Y1 cells were seeded in 0·5 ml Ham’s F10 Briefly, the pCDM8-e was cotransfected in COS-7 cells growth medium (supplemented with 15% horse serum in serum free medium, either with pCDM8-he or with

Journal of Molecular Endocrinology (2005) 34, 47–60 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access Bioactivities of eLH/CG expressed in insect cells · S LEGARDINIER and others 53

Figure 4 Quantiﬁcation of recombinant eLH/CG by ELISA. Different dilutions of culture media of Mimic cells producing eLH/CG after three days infection (h) and culture media of m COS-7 cells producing ee after 48 h incubation ( ) were tested in a speciﬁc sandwich ELISA. The eCG NZY-01 (1500 IU/mg) was used as a standard (◆). Pituitary eLH was also tested (e). Supernatant from Mimic cells infected with wild-type baculovirus AcMNPV was used as a negative control ("). All other hormones (from Sf9 media and hee from COS-7 cells) give curves parallel to standard hormones. Values±S.E.M. are indicated.

the pCDM8-e plasmid. After 48 h incubation, the media were recovered and assayed by ELISA. The productions of recombinant hee and ee were 0·1230·003 µg/ml and 0·0940·006 µg/ml respect- Figure 5 Western blot analysis of eLH/CG and its free subunits ively. Mimic cells and Sf9 cells were both coinfected expressed in Sf9 and Mimic cells. After being subjected to a SDS-PAGE, supernatants from infected cells producing (A), with NPV- (PH) and SLP10- (P10) recombinant e e (B), (C) or eCTP (D), eLH/CG were incubated with speciﬁc baculoviruses. Supernatants from infected cells were antibodies under non-reducing (A, B) or reducing (C, D) conditions. recovered by centrifugation at 100 g for 5 min, 5 days For each panel, lane 1 corresponds to infected cells with wild-type post-infection and assayed by ELISA. Maximal produc- baculovirus used as a negative control, lane 2 to unheated (A) or heated (B, C, D) eCG NZY-01 used as positive controls. Increasing tions of eLH/CG in Sf9 and Mimic cells were found to quantities (10, 20, 40 µl) of media from infected Sf9 (lanes 3–5) be 4·150·49 µg/ml and 5·331·32 µg/ml, respect- and Mimic cells (lanes 6–8) were compared. Membranes were ively, 5 days post infection (n=5) and thus 30–50 fold probed with a rabbit polyclonal antibody against eCG (A) or 89A2 more than in COS-7 cells (not shown). mouse monoclonal antibody directed against eCG -subunit (B) or a rabbit LH/CG beta (1–9) peptide antibody (C, D). Molecular weight (MW) standard proteins, 14 to 97 kDa, are shown. Characterization of eLH/CG and its free subunits expressed in Sf9 and Mimic cells were seeded in 25 cm2 ﬂasks and infected with To express free and subunits with or without CTP in recombinant NPV-e(PH), SLP10-e(P10) and SLP10- the baculovirus insect cell system, Sf9 or Mimic cells eCTP(P10) respectively. Complete eLH/CG was www.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 47–60

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access 54 S LEGARDINIER and others · Bioactivities of eLH/CG expressed in insect cells

Table 2 Summary of relative LH and FSH in vitro potencies of recombinant eLH/CG expressed in COS-7 cells and in insect cells as determined in Figures 6 and 7

Relative Relative FSH/LH LH biopotency FSH biopotency ratio

Hormone COS-7 cells

hee eLH/CG 100 100 1 dkee eLH/CG 66±1 54±26 0·8 Insect cells standard eCG 100 100 1 eLH/CG Sf9 27±5 54±1 2 eLH/CG Mimic 80±10 100 1·2

produced by coinfection of insect cells with NPV-e(PH) and SLP10-e(P10). After five days incubation at 28 C, supernatants were collected and analysed by Western blotting using specific antibodies. Standard and recombinant dimeric hormones were detected using rabbit antisera directed against native eCG (Cahoreau & Combarnous 1987). Standard eCG exhibited a complex range of bands between 80 and 100 kDa while the recombinant dimeric hormones expressed in Sf9 cells and Mimic cells were more homogenous appearing as a doublet at about 45 and 50 kDa respectively (Fig. 5A). A strong specific signal was revealed at about 26 kDa for the -subunit, with native heated eCG using 89A2 monoclonal antibody recognizing conformational -subunit under non reducing conditions (Fig. 5B) (Chopineau et al. 1993). Recombinant -subunit appeared as a major band at about 22 kDa in Sf9 cells versus 26 kDa in Mimic cells. Using rabbit LH/CG beta (1–9) peptide antibody (C Galet & M Chopineau, unpublished observations), a specific immunoreactive band was detected under reducing conditions at about 50 kDa for the -subunit of the native heated eCG. Equine LH/CG -subunit expressed in Sf9 cells exhibited a doublet at about 26 kDa, whereas several immunoreactive bands were observed for that expressed in Mimic cells: a positive band appears at the same MW as that of the beta-chain expressed in Sf9 cells and another one at 28 kDa (Fig. 5C). A single band was detected for the eCTP at about 16 kDa in Sf9 cells and a doublet at the same MW in Mimic cells (Fig. 5D).

Figure 6 In vitro LH and FSH bioactivities of recombinant dimeric hormones expressed in COS-7 cells. These activities were determined by the production of progesterone in MLTC-1 cells (A) and Y1 cells (B), measured in speciﬁc progesterone radioimmunoassay (RIA). Concentrations of each dimeric m hormone hee (h), ee ( ) were estimated by ELISA and each point corresponds to the mean±S.E.M. of three experiments.

Journal of Molecular Endocrinology (2005) 34, 47–60 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access Bioactivities of eLH/CG expressed in insect cells · S LEGARDINIER and others 55

In vitro bioactivities In vitro LH and FSH bioactivities of recombinant hormones were determined by their ability to stimulate progesterone production by MLTC-1 and Y1 cells, respectively. The dimeric ee hormone expressed in COS-7 cells exhibited LH and FSH potencies, respectively 22 and 27% lower than those of hee (Figs 6A and B, respectively) leading to a slight non-signiﬁcant decrease in its FSH/LH activity ratio (Table 2). The ability of eLH/CG expressed in Sf9 cells to stimulate the production of progesterone in MLTC-1 and Y1 cells was lowered by 73 and 46% respectively compared with standard eCG (Fig. 7A). The in vitro LH biopotency of eLH/CG expressed in Mimic cells was only 20% lower than that of natural eCG and its in vitro FSH biopotency was unaffected (Fig. 7B). Equine LH/CG produced in Mimic cells possessed a FSH/LH ratio of 1·2, versus 2·0 when expressed in Sf9 cells (Table 2).

In vivo bioassays The eCG in vivo bioassay (Cole & Erway 1941) was used to compare the biopotency of eLH/CG produced in Sf9 cells with that produced in Mimic cells. The unique injection of standard eCG leads to a dose-dependent increase in ovarian weight. Equine LH/CG expressed by Sf9 or Mimic cells had no effect on ovary growth (Fig. 8). Pituitary eLH was also compared with eCG in this in vivo bioassay, on the basis of their respective potencies in the sandwich ELISA. Equine LH isoforms were found to be 10–30 fold less active than natural eCG in the in vivo eCG assay (not shown). The FSH in vivo bioassay (Steelman & Pohley 1953) was carried out to speciﬁcally test FSH bioactivity of Mimic eLH/CG. The repeated injection of standard hFSH or eCG NZY-01 over 4 days induced a dose-dependent increase in ovarian weight under hCG stimulation. However, both recombinant eLH/CG had no effect on ovary growth (Fig. 9).

Discussion

Equine CG from pregnant mare serum possesses extensive N- and O-glycosylation with 45% of its mass

Figure 7 In vitro LH and FSH bioactivities of recombinant dimeric hormones expressed in insect cells. These activities are determined by the production of progesterone in MLTC-1 cells (A) and Y1 cells (B), measured in speciﬁc progesterone RIA. Standard eCG was used as a control (◆) in comparison with eLH/CG expressed in Sf9 (h) and in Mimic cells (•). The concentrations were estimated by ELISA and each point corresponds to the mean±S.E.M. of three experiments. www.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 47–60

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access 56 S LEGARDINIER and others · Bioactivities of eLH/CG expressed in insect cells

Figure 8 eCG in vivo bioactivity of eLH/CG in insect cell media. These activities were determined by the Cole and Erway assay (Cole & Erway 1941). In brief, −5 dayØold rat females received a unique subcutaneous injection of standard eCG as a positive control (◆) or different doses of eLH/CG produced in Sf9 (h) and Mimic (•) cells. Ovaries were collected from ﬁve animals per dose and their weight determined 48 h post injection. Each point corresponds to the mean±S.E.M. of ﬁve animals. The quantity of eLH/CG was determined by ELISA.

due to its carbohydrate moiety (Harbon-Chabbat et al. 1961, Gospodarowicz 1972), whereas equine LH exhibits the same sites of glycosylation but with only 30% of its mass as carbohydrate side chains (Roser et al. 1984, Butnev et al. 1996). In addition to complex sialylated biantennary N-glycans (Smith et al. 1993, Matsui et al. 1994), eCG possesses 12 uncommon disialylated poly-N-acetyllactosaminyl O-glycans located at the C-terminus of the -subunit (Hokke et al. 1994, Bousfield & Butnev 2001). The N-glycans of eLH occupy the same three sites as those in eCG (Fig. 1) but exhibit sulfated terminal N-acetyl-galactosamine residues in addition to, or in place, of sialic acid residues (Smith et al. 1993, Matsui et al. 1994). The sites of O-glycosylation of eLH are also the same as is eCG but, on average, they represent a smaller proportion and the chains are shorter (Bousfield & Butnev 2001). Equine CG presents a much longer half-life (6 days) than eLH (1 h) in mares (Cole et al. 1967, Ginther et al. 1974) in Figure 9 FSH in vivo bioactivity of eLH/CG in insect cell relation to its carbohydrate content. Indeed, enzymatic media. These activities were determined by the Steelman and removal of terminal sialic acid residues of eCG leads to a Pohley assay (Steelman & Pohley 1953). In brief, 25 day-old rat females were injected six times with a constant dose of dramatic drop in its in vivo bioactivity in various species, hCG of 20 IU and different doses of eLH/CG produced in Sf9 including sheep (Martinuk et al. 1991) and rats (Rafelson (h) and Mimic (•) insect cells or standard hormones (◆, eCG; et al. 1961). Consequently, the structure of carbohydrate m, hFSH) used as positive controls. Ovaries were collected side-chains in recombinant eLH/CG is expected to be from five animals per dose and their weight determined 24 h an important issue for its clearance from blood, and after the last injection. Medium containing 10% BFS was tested as control ("). Each point corresponds to the mean±S.E.M. of consequently for its in vivo bioactivity. The present paper five animals. The quantity of eLH/CG was determined in a reports the production and biological characterization specific sandwich ELISA.

Journal of Molecular Endocrinology (2005) 34, 47–60 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access Bioactivities of eLH/CG expressed in insect cells · S LEGARDINIER and others 57 of recombinant eLH/CG produced in Sf9 and Mimic the -subunit and eLH/CG exhibited significantly lower insect cell lines using the baculovirus expression system. MW than their natural counterparts, suggesting that the The correction of the original chimeric he sequence major effect on MW arises from weaker O-glycosylation into fully e sequence permitted the production of of the CTP. Indeed, the CTP is O-glycosylated in insect eLH/CG with its genuine sequence in COS-7 cells, as cells since its elimination in eCTP leads to a single well as in Sf9 and Mimic cells. The replacement of the band, while full-length -subunit exhibits higher and human N-terminal APDV sequence in he by the equine heterogeneous MW. In Sf9 cells, O-glycans are consti- N-terminal FPDGEFTT sequence in e led to a slight tuted by single N-acetylgalactosamine (GalNAc) residues decrease in both LH and FSH in vitro activities of the or by GalNAc-Gal disaccharides (Thomsen et al. 1990) recombinant heterodimer formed with e. Since the but for the time being no information on this matter is quantity of hormones tested in bioassays are determined available for Mimic cells. Recombinant glycoproteins by ELISA, this decrease actually relates to the bioactivity produced in Mimic cells referred to as SfSWT-1 were to immunoactivity ratio. Therefore, it cannot be ruled claimed to bear sialylated biantennary N-glycans out that the observed decrease could in fact be due to a (Hollister et al. 2002, 2003). Sialylation in Mimic cells slightly better recognition of ee than hee in the is unexpected since Sf9 cells do not synthesize the ELISA. This would not be unexpected, as the -specific CMP-sialic acid nucleotidic donor (CMP-NeuAc) as a 89A2 monoclonal antibody used in the sandwich ELISA substrate for 2,6-sialyltransferase. Our observation that was raised against authentic eCG, thus having an recombinant eLH/CG from Mimic cells do not exhibit N-terminal FPDGEFTT sequence in its -subunit. any in vivo activity in spite of full in vitro activity strongly Moreover, the -subunit N-termini of hCG and hFSH suggests that the hormone is probably not sialylated. are known to be on the opposite side relative to their Indeed, desialylation of natural eCG leads to the hormone binding sites to their cognate receptors complete loss of its in vivo activity without affecting its (Lapthorn et al. 1994, Wu et al. 1994, Fox et al. 2001). in vitro activity (Morell et al. 1971). The in vivo biological activity of eCG strongly depends Both eLH/CGs expressed in Sf9 and Mimic cells on the presence of sialylated complex saccharide side exhibited full in vitro LH and FSH bioactivities, chains leading to its slow rate of elimination from blood confirming that recombinant hormones possess a (Klett et al. 2003). The baculovirus expression system conformation similar to that of natural eCG. Equine allows high levels of production of recombinant proteins, LH/CG expressed in Mimic cells and Sf9 cells exhibit but N-glycans processed in insect cells such as Sf9 cells in vitro FSH/LH ratios that are not significantly different. are not complex and sialylated N-glycans such as those On the basis of their concentrations measured by found in placental eCG. To overcome this problem, we ELISA, their in vivo bioactivity was not detectable at the expressed recombinant eLH/CG in Mimic cells that doses used and they are less than 1% of that of natural have been designed to produce biantennary, terminally eCG. Recombinant eLH/CG produced in Mimic cells sialylated N-glycans (Hollister et al. 2002). Recombinant was also found to be inactive in the FSH in vivo bioassay eLH/CG with both subunits possessing the native amino (Steelman & Pohley 1953) that does not require a acid equine sequences was successfully produced in two hormone with a very long half-life, in contrast to the insect cell lines using the baculovirus expression system, eCG in vivo bioassay (Cole & Erway 1941). The absence with yields of 4–5 mg/l that are similar to those of in vivo bioactivity of recombinant eLH/CG may be previously reported for the production of porcine FSH the result of a rapid clearance of the hormone in the in insect cells (1 mg/l) (Kato et al. 1998) and of bovine plasma, as is the case for single-chain eLH/CG FSH (1–5 mg/l) (van de Wiel et al. 1998). expressed in the milk of transgenic rabbits (Galet et al. Recombinant eLH/CG and its subunits expressed in 2001). Sialic acids are mainly responsible for prolonged Sf9 and Mimic cells exhibited lower apparent molecular half-life in plasma, suggesting they are partially or totally weights compared with natural eCG and its subunits, lacking on eLH/CG produced in Sf9 cells and in Mimic highlighting the presence of shorter glycans in these cells. Native eLH is known to bear sulphated N-glycans cells. Nevertheless, the higher apparent molecular and sialylated O-glycans. Although displaying a similar weights found for eLH/CG and its subunits expressed in in vitro FSH/LH ratio (Guillou & Combarnous 1983), Mimic cells compared with Sf9 cells strongly suggest that native eLH that bears fewer sialic acids compared with glycosylation was indeed improved in Mimic cells as eCG exhibits a much shorter half life. The presence of expected (Hollister et al. 2002). The major differences in sialylated O-glycans is also involved in the half-life, since MW between natural and recombinant hormones seem the elimination of the O-glycosylated CTP from hCG led to be essentially due to very short O-glycans in the CTP to a drastic decrease of its half-life (Matzuk et al. 1990). of eLH/CG produced in insect cells. Indeed, the The absence of in vivo bioactivity of eLH/CG expressed -subunit, which is only N-glycosylated, exhibited the in Sf9 cells can be explained by the presence of same apparent MW when expressed in Mimic cells as trimannose side-chains that can be recognized by the that of -subunit from natural eCG. On the contrary, macrophage mannose receptor (Childs et al. 1990), www.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 47–60

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access 58 S LEGARDINIER and others · Bioactivities of eLH/CG expressed in insect cells

leading to removal of the hormone from blood. (Beaucouzé, France). This paper is dedicated to the Although eLH/CGs expressed in Mimic cells present memory of Pierre Mauléon, former director of the more elaborate carbohydrate side chains, they might still Station de Physiologie de la Reproduction (INRA be recognized by the MMR, since its carbohydrate Tours-Nouzilly), deceased on 10 August 2004. recognition domains bind fucose and N-acetyl- The authors are grateful to D Aguer and MA glucosamine in addition to mannose, and its cystine-rich Driancourt (Intervet Pharma R&D, Beaucouzé, domain binds sulfated GalNAc and various sulfated France) and P Sondermeijer (Intervet, Boxmeer, The carbohydrates (Leteux et al. 2000). The rapid elimination Netherlands) for valuable discussions. We are thankful to of porcine LH from blood in rats has been shown to C Cahier, J C Braguer and J C Poirier (INRA Nouzilly occur by rapid trapping by kidneys (Klett et al. 2003) but France) for skilfull technical assistance. We acknowledge it does not seem to involve MMR, since the half-life of M Chopineau and C Galet (INRA Nouzilly, France) for pLH is not increased in MMR-/- mice compared with the gift of donkey cDNA constructs and antipeptide wild-type mice (Lee et al. 2002). Nevertheless, we have serum. We also thank A Ythier (Serono Ares, Geneva) no clue at the moment whether recombinant hormones for the gift of Y1 cells expressing the human FSH expressed in insect cells are eliminated from the receptor. circulation in the same way as pLH. We have shown in the present paper that eLH exhibits low in vivo bioactivity (3–10% that of eCG) but this activity is easily References detectable, in contrast to that of recombinant eLH/CG. This indicates that recombinant hormones are, indeed Allen WR & Moor RM 1972 The origin of the equine endometrial cups. Production of PMSG by fetal trophoblast cells. Journal of probably eliminated from blood more rapidly than pLH Reproduction and Fertility 29 313–316. and eLH. Therefore, the involvement of MMR present Bousfield GR & Butnev VY 2001 Identification of twelve at the surface of macrophages cannot be ruled out in the O-glycosylation sites in equine chorionic gonadotropin beta and elimination of recombinant eLH/CG. equine luteinizing hormone ss by solid-phase Edman degradation. In brief, we succeeded in producing two recombinant Biology of Reproduction 64 136–147. Butnev VY, Gotschall RR, Baker VL, Moore WT & Bousfield GR eLH/CG in the baculovirus expression system using Sf9 1996 Negative influence of O-linked oligosaccharides of high cells and their transgenic progeny Mimic cells. Although molecular weight equine chorionic gonadotropin on its luteinizing having full in vitro LH and FSH bioactivities, eLH/CG hormone and follicle-stimulating hormone receptor-binding expressed in both cell lines did not exhibit significant activities. Endocrinology 137 2530–2542. CahoreauC&Combarnous Y 1987 Comparison of two reference in vivo bioactivity. Nevertheless, our results clearly show preparations for horse chorionic gonadotrophin in four in-vivo that the glycosyltransferase activities in Mimic cells lead and in-vitro assays. Journal of Reproduction and Fertility 79 281–287. to larger carbohydrate moieties on baculovirus- Chaabihi H, Ogliastro MH, Martin M, Giraud C, Devauchelle G & expressed proteins. However, other modifications such Cerutti M 1993 Competition between baculovirus polyhedrin and as the addition of O-glycans and sialic acid residues are p10 gene expression during infection of insect cells. Journal of Virology 67 2664–2671. still very incomplete and will need further attention. Chang GD, Chen CJ, Lin CY, Chen HC & Chen H 2003 At the least, Mimic cells are expected to synthesize Improvement of glycosylation in insect cells with mammalian glycoproteins with N-glycans up to terminal galactose glycosyltransferases. Journal of Biotechnology 102 61–71. residues and so are good substrates for a more complete Childs RA, Feizi T, Yuen CT, DrickamerK&Quesenberry MS in vitro sialylation in contrast to those of eLH/CG from 1990 Differential recognition of core and terminal portions of oligosaccharide ligands by carbohydrate-recognition domains of Sf9 cells. Two strategies can be proposed to engineer N- two mannose-binding proteins. Journal of Biological Chemistry 265 and O-glycosylation: one by modifying the cell genome 20770–20777. of insect cells and the other by introducing all necessary Chopineau M & Stewart F 1996 Cloning and analysis of the cDNA glycosyltransferase genes in the baculovirus genome. for the common alpha-subunit of the donkey pituitary A recent study showed the successful production of glycoprotein hormones. Journal of Molecular Endocrinology 16 9–13. Chopineau M, Maurel MC, CombarnousY&Durand P 1993 sialylated human 1-antitrypsin in Estigmene acrea Ea4 Topography of equine chorionic gonadotropin epitopes relative to cells transfected by a single recombinant baculo- the luteinizing hormone and follicle-stimulating hormone receptor virus co-expressing N-acetylglucosaminyl transferase II, interaction sites. Molecular and Cellular Endocrinology 92 229–239. 1,4-galactosyl transferase and 2,6-sialyltransferase in Chopineau M, StewartF&Allen WR 1995 Cloning and analysis of the cDNA encoding the horse and donkey luteinizing hormone addition to human 1-antitrypsin (Chang et al. 2003). beta-subunits. Gene 160 253–256. Chopineau M, Martinat N, Troispoux C, Marichatou H, Combarnous Y, StewartF&Guillou F 1997 Expression of horse Acknowledgements and donkey LH in COS-7 cells: evidence for low FSH activity in donkey LH compared with horse LH. Journal of Endocrinology 152 371–377. S Legardinier is recipient of a CIFRE PhD grant from Cole HH & Erway J 1941 48-Hour assay test for equine the Agence Nationale de la Recherche et de la gonadotropin with results expressed in international units. Technologie (ANRT) and INTERVET Pharma R&D Endocrinology 29 514–519.

Journal of Molecular Endocrinology (2005) 34, 47–60 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access Bioactivities of eLH/CG expressed in insect cells · S LEGARDINIER and others 59

Cole HH, Bigelow M, Finkel J & Rupp GR 1967 Biological half-life Hollister J, Conradt H & Jarvis DL 2003 Evidence for a sialic acid of endogenous PMS following hysterectomy and studies on losses salvaging pathway in lepidopteran insect cells. Glycobiology 13 in urine and milk. Endocrinology 81 927–930. 487–495. Combarnous Y 1992 Molecular basis of the specificity of binding of Huang CJ, Huang FL, Chang GD, Chang YS, Lo CF, Fraser MJ & glycoprotein hormones to their receptors. Endocrine Reviews 13 Lo TB 1991 Expression of two forms of carp gonadotropin alpha 670–691. subunit in insect cells by recombinant baculovirus. PNAS 88 Combarnous Y, GuillouF&Martinat N 1984 Comparison of in 7486–7490. vitro follicle-stimulating hormone (FSH) activity of equine Inaba T, Mori J, Ohmura M, Tani H, Kato Y, Tomizawa K, Kato gonadotropins (luteinizing hormone, FSH, and chorionic T, Ihara T, SatoI&UedaS1998 Recombinant porcine follicle gonadotropin) in male and female rats. Endocrinology 115 stimulating hormone produced in baculovirus-insect cells induces 1821–1827. rat ovulation in vivo and gene expression of tissue plasminogen Coulibaly S, Besenfelder U, Miller I, Zinovieva N, Lassnig C, Kotler activator in vitro. Research in Veterinary Science 64 25–29. T, Jameson JL, Gemeiner M, Muller M & Brem G 2002 Kato Y, Sato I, Ihara T, Tomizawa K, Mori J, Geshi M, Nagai T, Expression and characterization of functional recombinant bovine OkudaK,KatoT&UedaS1998 Expression and purification of follicle-stimulating hormone (boFSHalpha/beta) produced in the biologically active porcine follicle-stimulating hormone in insect milk of transgenic rabbits. Molecular Reproduction and Development 63 cells bearing a baculovirus vector. Journal of Molecular Endocrinology 300–308. 20 55–65. Dirnberger D, Steinkellner H, Abdennebi L, Remy JJ & van de Wiel Keene JL, Matzuk MM, Otani T, Fauser BC, Galway AB, Hsueh D 2001 Secretion of biologically active glycoforms of bovine AJ & Boime I 1989 Expression of biologically active human follicle stimulating hormone in plants. European Journal of follitropin in Chinese hamster ovary cells. Journal of Biological Biochemistry 268 4570–4579. Chemistry 264 4769–4775. Fidler AE, Lun S, Young W & McNatty KP 1998 Expression and Kelton CA, Cheng SV, Nugent NP, Schweickhardt RL, Rosenthal secretion of a biologically active glycoprotein hormone, ovine JL, Overton SA, Wands GD, Kuzeja JB, Luchette CA & Chappel follicle stimulating hormone, by Pichia pastoris. Journal of Molecular SC 1992 The cloning of the human follicle stimulating hormone Endocrinology 21 327–336. receptor and its expression in COS-7, CHO, and Y-1 cells. Fidler AE, Lin JS, Lun S, Ng Chie W, Western A, Stent V & Molecular and Cellular Endocrinology 89 141–151. McNatty KP 2003 Production of biologically active tethered ovine Klett D, Bernard S, Lecompte F, Leroux H, Magallon T, Locatelli FSHbetaalpha by the methylotrophic yeast Pichia pastoris. Journal A, Lepape A & Combarnous Y 2003 Fast renal trapping of of Molecular Endocrinology 30 213–225. porcine luteinizing hormone (pLH) shown by 123I-scintigraphic Fox KM, Dias JA & Van Roey P 2001 Three-dimensional structure imaging in rats explains its short circulatory half-life. Reproductive of human follicle-stimulating hormone. Molecular Endocrinology 15 Biology and Endocrinology 1 64. 378–389. Koles K, van Berkel PH, Pieper FR, Nuijens JH, Mannesse ML, Vliegenthart JF & Kamerling JP 2004 N- and O-glycans of Galet C, Chopineau M, Martinat N, Combarnous Y & Guillou F recombinant human C1 inhibitor expressed in the milk of 2000 Expression of an in vitro biologically active equine LH/CG transgenic rabbits. Glycobiology 14 51–64. without C-terminal peptide (CTP) and/or beta26–110 disulphide Laemmli UK 1970 Cleavage of structural proteins during the bridge. Journal of Endocrinology 167 117–124. assembly of the head of bacteriophage T4. Nature 227 680–685. Galet C, Le Bourhis CM, Chopineau M, Le Griec G, Perrin A, Lapthorn AJ, Harris DC, Littlejohn A, Lustbader JW, Canfield RE, Magallon T, Attal J, Viglietta C, Houdebine LM & Guillou F Machin KJ, Morgan FJ & Isaacs NW 1994 Crystal structure of 2001 Expression of a single betaalpha chain protein of equine human chorionic gonadotropin. Nature 369 455–461. LH/CG in milk of transgenic rabbits and its biological activity. LecompteF,RoyF&Combarnous Y 1998 International Molecular and Cellular Endocrinology 174 31–40. collaborative calibration of a preparation of equine chorionic Ginther OJ, Pineda MH, Wentworth BC & Nuti L 1974 Rate of gonadotrophin (eCG NZY-01) proposed as a new standard. disappearance of exogenous LH from the blood in mares. Journal Journal of Reproduction and Fertility 113 145–150. of Animal Science 397–403. 39 Lee SJ, Evers S, Roeder D, Parlow AF, Risteli J, Risteli L, Lee YC, Gospodarowicz D 1972 Purification and physicochemical properties Feizi T, LangenH&Nussenzweig MC 2002 Mannose of the pregnant mare serum gonadotropin (PMSG). Endocrinology receptor-mediated regulation of serum glycoprotein homeostasis. 91 101–106. Science 295 1898–1901. Goverman JM & Pierce JG 1981 Differential effects of alkylation of Leteux C, Chai W, Loveless RW, Yuen CT, Uhlin-Hansen L, methionine residues on the activities of pituitary thyrotropin and Combarnous Y, Jankovic M, Maric SC, Misulovin Z, lutropin. Journal of Biological Chemistry 256 9431–9435. Nussenzweig MC et al. 2000 The cysteine-rich domain of the GuillouF&CombarnousY1983Purification of equine macrophage mannose receptor is a multispecific lectin that gonadotropins and comparative study of their acid-dissociation recognizes chondroitin sulfates A and B and sulfated and receptor-binding specificity. Biochimica et Biophysica Acta 755 oligosaccharides of blood group Lewis(a) and Lewis(x) types in 229–236. addition to the sulfated N-glycans of lutropin. Journal of Experimental Harbon-Chabbat S, Legault-Demare J, JollesP&ClauserH1961 Medicine 191 1117–1126. Chemical study of a pure serum gonadotropic hormone Martinuk SD, Manning AW, Black WD & Murphy BD 1991 Effects preparation (PMSG). Bulletin de la Socie´te´ de Chimie Biologique (Paris) of carbohydrates on the pharmacokinetics and biological activity 43 13391345. of equine chorionic gonadotropin in vivo. Biology of Reproduction 45 Hokke CH, Roosenboom MJ, Thomas-Oates JE, Kamerling JP & 598–604. Vliegenthart JF 1994 Structure determination of the disialylated Matsui T, Mizuochi T, Titani K, Okinaga T, Hoshi M, Bousfield poly-(N-acetyllactosamine)- containing O-linked carbohydrate GR,SuginoH&WardDN1994 Structural analysis of N-linked chains of equine chorionic gonadotropin. Glycoconjugate Journal 11 oligosaccharides of equine chorionic gonadotropin and lutropin 35–41. beta-subunits. Biochemistry 33 14039–14048. Hollister J, Grabenhorst E, Nimtz M, Conradt H & Jarvis DL 2002 Matzuk MM, Hsueh AJ, Lapolt P, Tsafriri A, Keene JL & Boime I Engineering the protein N-glycosylation pathway in insect cells for 1990 The biological role of the carboxyl-terminal extension of production of biantennary, complex N-glycans. Biochemistry 41 human chorionic gonadotropin [corrected] beta-subunit. 15093–15104. Endocrinology 126 376–383. www.endocrinology-journals.org Journal of Molecular Endocrinology (2005) 34, 47–60

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access 60 S LEGARDINIER and others · Bioactivities of eLH/CG expressed in insect cells

Morell AG, Gregoriadis G, Scheinberg IH, HickmanJ&AshwellG terminating with SO4–4-GalNAc and Sia alpha 2,3 Gal, 1971 The role of sialic acid in determining the survival of respectively. Journal of Biological Chemistry 268 795–802. glycoproteins in the circulation. Journal of Biological Chemistry 246 Steelman SL & Pohley FM 1953 Assay of the follicle stimulating 1461–1467. hormone based on the augmentation with human chorionic Poul MA, Cerutti M, Chaabihi H, Devauchelle G, Kaczorek M & gonadotropin. Endocrinology 53 604–616. Lefranc MP 1995 Design of cassette baculovirus vectors for the StewartF&Allen WR 1979 The binding of FSH, LH and PMSG production of therapeutic antibodies in insect cells. to equine gonadal tissues. Journal of Reproduction and Fertility. Suppl Immunotechnology 1 189–196. 431–440. Rafelson ME Jr., ClauserH&Legault-Demare J 1961 Removal of Summers MD & Smith GE 1987 A manual of methods for sialic acid from serum gonadotropin by acidic and enzymic baculovirus vectors and insect cell culture procedures. Texas hydrolysis. Biochimica et Biophysica Acta 47 406–407. Agricultural Experimental Station Bulletin No. 1555. Richard F, Robert P, Remy JJ, Martinat N, Bidart JM, Salesse R & Thomsen DR, Post LE & Elhammer AP 1990 Structure of Combarnous Y 1998 High-level secretion of biologically active O-glycosidically linked oligosaccharides synthesized by the insect recombinant porcine follicle-stimulating hormone by the cell line Sf9. Journal of Cellular Biochemistry 43 67–79. methylotrophic yeast Pichia pastoris. Biochemical and Biophysical van de Wiel DF, van Rijn PA, Meloen RH & Moormann RJ 1998 Research Communications 245 847–852. High-level expression of biologically active recombinant bovine Roser JF, Papkoff H, Murthy HM, Chang YS, Chloupek RC & follicle stimulating hormone in a baculovirus system. Journal of Potes JA 1984 Chemical, biological and immunological properties Molecular Endocrinology 20 83–98. of pituitary gonadotropins from the donkey (Equus asinus): Vaughn JL, Goodwin RH, Tompkins GJ & McCawley P 1977 The comparison with the horse (Equus caballus). Biology of Reproduction establishment of two cell lines from the insect Spodoptera 30 1253–1262. frugiperda (Lepidoptera; Noctuidae). In Vitro 13 213–217. SaumandeJ&Batra SK 1985 Superovulation in the cow: Ward DN, Moore WT & Burleigh BD 1982 Structural studies on comparison of oestradiol-17 beta and progesterone patterns in equine chorionic gonadotropin. Journal of Protein Chemistry 1 263–280. plasma and milk of cows induced to superovulate; relationships Wu H, Lustbader JW, Liu Y, Canﬁeld RE & Hendrickson WA 1994 with ovarian responses. Journal of Endocrinology 107 259–264. Structure of human chorionic gonadotropin at 2·6 Ar resolution Sherman GB, Wolfe MW, Farmerie TA, Clay CM, Threadgill DS, from MAD analysis of the selenomethionyl protein. Structure 2 Sharp DC & Nilson JH 1992 A single gene encodes the 545–558. beta-subunits of equine luteinizing hormone and chorionic gonadotropin. Molecular Endocrinology 6 951–959. Received 1 September 2004 Smith PL, Bousﬁeld GR, Kumar S, FieteD&Baenziger JU 1993 Accepted 27 September 2004 Equine lutropin and chorionic gonadotropin bear oligosaccharides Made available online as an Accepted Preprint 4 October 2004

Journal of Molecular Endocrinology (2005) 34, 47–60 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/27/2021 11:21:21AM via free access