Characterization of Genetic Mutants Encoding Four Hydroxyproline

Galactosyltransferases (Hyp-galts) for Arabinogalactan-proteins in Arabidopsis

A thesis presented to

the faculty of

the College of Arts and Sciences of Ohio University

In partial fulfillment

of the requirements for the degree

Master of Science

Lu Tian

December 2015

This thesis titled

Characterization of Genetic Mutants Encoding Four Hydroxyproline

Galactosyltransferases (Hyp-galts) for Arabinogalactan-proteins in Arabidopsis

LU TIAN

has been approved for

the Department of Environmental and Plant Biology

and the College of Arts and Sciences by

Allan M. Showalter

Professor of Environmental and Plant Biology

Robert Frank

Dean, College of Arts and Sciences 3

ABSTRACT

TIAN, LU, M.S., December 2015, Molecular and Cellular Biology

Characterization of Genetic Mutants Encoding Four Hydroxyproline

Galactosyltransferases (Hyp-galts) for Arabinogalactan-proteins in Arabidopsis

Director of Thesis: Allan M. Showalter

Arabinogalactan-proteins (AGPs) are a family of highly glycosylated proteoglycans found in all plants as components of the cell wall, plasma membrane, and cellular secretions. AGPs function in a variety of cellular processes including cell proliferation, cell expansion, somatic embryogenesis, and cell death. They also possess valuable adhesive and emulsification properties that are utilized for commercial purposes. Up to

90% of a typical AGP’s mass corresponds to type II arabinogalactan (AG) polysaccharides which are attached to hydroxyproline (Hyp) residues in the protein backbone by glycosylltransferases (GTs). Of all the GTs involved in the O-glycosylation of AGPs, the GALTs that add the first galactose onto hydroxyproline residues in the protein backbone of AGPs are crucial as they initiate the glycosylation process and produce the substrate acceptor for further glycosylation enzymes. Since attempts to solubilize AGP-specific GALTs from Golgi enriched Arabidopsis microsomes were unsuccessful, a bioinformatics approach was adopted to identify and characterize putative

GALT genes responsible for synthesizing Hyp-Gal linkages. Six putative GALT genes were selected and named GALT 1-6. All six genes belong to the GT-31 family of the

Carbohydrate-Active Enzymes (CAZy) database. Recent studies in the Showalter lab demonstrated that two members of the six GALTs, namely GALT2 and GALT5, encode 4

Hyp-GALTs that are required for AGP biosynthesis. This thesis reports on the characterization the other four candidate GALT genes (i.e., GALT1, GALT3, GALT4, and

GALT6). Towards this goal, two allelic mutants for each gene (galt1-1, galt1-2, galt3-1, galt3-2, galt4-1, galt4-2, galt6-1, and galt6-2) in Arabidopsis were obtained, verified by molecular analyses, and subjected to phenotypic analysis. The four candidate GALT genes were heterologously expressed in tobacco epidermal leaves, and all showed Hyp-GALT enzyme activity except GALT1. Biochemically, galt3 and galt6 plants, and to a lesser extent galt4 plants, displayed reduced Hyp-GALT enzyme activity and reduced precipitation of AGPs by β-Gal Yariv reagent compared to wild type and galt1 plants.

This is consistent with the report that GALT1 is involved with N-glycosylation, and not O- glylcosylation of AGPs. Under optimal physiological conditions, all four mutants were identical to wild type with the exception that galt4, and to a lesser extent galt6, displayed reduced numbers of seeds per silique. However, under restrictive conditions, such as elevated NaCl, galt3 and galt6, and to a lesser extent galt4, exhibited salt hypersensitive root growth, delayed root bending, and swollen root tips. The galt1 mutants, however, did not show these conditional phenotypes. Primary root growth was also less sensitive to β-

Gal Yariv reagent in galt3, galt4, and galt6 plants compared to the wild type and galt1 plants. Thus, characterization of the GALTs by investigating the function of these four genes in their native setting will help to delineate the role of AGPs in plants and in manipulating the structure of AGPs for commercial purposes.

Another part of this thesis is devoted to delineating the potential signaling role of

AGPs in Arabidopsis root growth. The sos5 (salt overly sensitive 5) mutant, is a plasma 5 membrane-anchored fasciclin-ike AGP mutant, while fei1fei2 is a double mutant affecting two cell wall leucine-rich repeat, receptor-like kinases. These mutants displayed identical phenotypes, a swollen root tip in the presence of moderately high salt (100 mM NaCl).

Notably, this phenotype is also displayed by two AGP galt mutants, galt2 and galt5, as well as by galt2galt5 double mutants. It is hypothesized that the extracellular portion of the FEI/FEI2 kinase interacts with sugar residues on AGPs like those presumably added onto SOS5 by the action of GALT2 and GALT5 and other AGP glycosyltransferases.

Quintuple mutant plants (fei1fei2sos5galt2galt5) were generated and provided genetic evidence that these five genes act in a single genetic pathway in support of the proposed hypothesis. This work contributes to a better understanding of O-linked glycosylation in plants and more specifically to AGP biosynthesis and function.

ACKNOWLEDGMENTS

I am very grateful to my advisor, Dr. Allan Showalter, for giving me the opportunity to finish my MS. I am thankful for his patience, and that he never gave up on me. I am very honored and lucky to be his graduate student.

I am grateful to all my committee members for the suggestions related to my thesis.

I am very thankful to Debarati Basu, a past member of the Showalter lab who always helped me solve many difficult issues realted to my resreach.

I am grateful to Wuda Wang, another member of the Showalter lab who spent much time teaching me so many lab techniques.

Lastly, none of this would have been possible without my family.

TABLE OF CONTENTS

Page

Abstract ...... 3

Acknowledgments ...... 6

List of tables………………………………………………………………………………10

List of figures……………………………………………………………………………..11

List of abbreviations………………………………………………………………………13

Chapter 1: Introduction……………………………………………………………….15

1.1. Introduction……………………………………………………………………….15

1.1.1 Plant cell walls ...... 15

1.1.2. Cellulose ...... 15

1.1.3. Hemicellulose ...... 16

1.1.4. Pectin ...... 16

1.1.5. Glycoprotein ...... 17

1.1.6. Arabinogalactan-proteins (AGPs) ...... 17

1.2. Objectives ...... 20

1.3. Explaination of my contribution and that of others to this thesis research ...... 21

1.4. Organization of the Thesis ...... 22

Chapter 2: A small multigene hydroxyproline-O-galactosyltransferase family functions in arabinogalactan-protein Glycosylation ...... 23

2.1. Introduction ...... 23 8

2.2. Materials and Methods ...... 25

2.2.1. In silico analysis of temporal and spatial expression method of GALT1,

GALT2, GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3 ...... 25

2.2.2. Plant lines and plant growth conditions ...... 26

2.2.3. Mutant confirmation by PCR and RT-PCR ...... 26

2.2.4. Fluorescent protein fusion and subcellular localization ...... 30

2.2.5. Galactosyltranferase assay with microsomal preparations from transiently

expressed GALT1, GALT3, GALT4, GALT6 in tobacco epidermal cells ...... 30

2.2.6. Extraction of AGPs ...... 31

2.2.7. Evaluation of seed set ...... 31

2.3. Results ...... 31

2.3.1. In silico analysis of temporal and spatial expression of GALT1, GALT2,

GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3 ...... 31

2.3.2. Biochemical characterization of galt1, galt3, galt4, and galt6 genetic

mutants……………………………………………………………………………32

2.3.3. Phenotypic characterization of galt1, galt3, galt4, and galt6 genetic mutants

under normal (optimal) growth conditions………………………………………. 38

2.3.4. Phenotypic characterization of galt1, galt3, galt4, and galt6 genetic mutants

under abnormal (restrictive) growth conditions (i. e., Yariv reagent and NaCl)....43

2.3.5. Subcellular localization of GALT4 and

GALT6……………………………………………………………………………44 9

2.3.6. Generation and characterization of fei1fei2sos5galt2galt5 genetic mutants

...... …477

2.4. Discussion…………………………………………………………………………47

2.4.1. GALT3, GALT4, and GALT6 are localized to Golgi vesicles……………….47

2.4.2. The galt mutant phenotypes reveal functional roles of AGP glycosylation in

normal growth and development

...... ………………………………………………….522

2.4.3 Conditional phenotypes indicate GALT3, GALT4, and GALT6 function in tip

growth……………………………………………………………………………..52

2.4.4. GALT2, GALT5, SOS5, FEI1, and FEI2 act in a single genetic signaling

pathwa…………………………………………………………………………….53

Chapter 3: Conclusions and future work………………………………………………….56

References………………………………………………………………………………...58

LIST OF TABLES

Page

Table 2.1. List of primers used in this study…………………………………………...... 28

Table 2.2. Other primers used in this study……………………………………………....29

Table 2.3. GALT activity and amount of β-Yariv precipitated AGPs in WT and galt mutants……………………………………………………………………………...... 37

Table 2.4. Weight, length, and seed number from WT and galt siliques………………...41

LIST OF FIGURES

Page

Figure 1.1. A model structure of an AGP showing only one AG side chain for simplicity…………………………………………………………………………………19

Figure 2.1. Expression profiles of GALT2, GALT3, GALT4, GALT5, GALT6, HPGT1,

HPGT2, and HPGT3 in publicly available databases………………………………….…33

Figure 2.2. Expression patterns of GALT1, GALT2, GALT3, GALT4, GALT5, GALT6,

HPGT1, HPGT2, and HPGT3 in response to 150 mM NaCl treatment compiled from the eFP Browser. …………………………………………………………………………..…34

Figure 2.3. Expression patterns of GALT1, GALT2, GALT3, GALT4, GALT5, GALT6,

HPGT1, HPGT2, and HPGT3 in response to 300 mM mannitol treatment compiled from the eFP Browser…………………………………………………………………………..35

Figure 2.4. Gene structure of the four putative GALT genes and screening of homozygous mutants………..…………………………………………………………...... 36

Figure 2.5. Expression analysis of GALT candidate genes by RT-PCR in wild type (WT) and mutant plants……………………………………………………………………….....37

Figure 2.6. Reduced inhibition of primary root growth of galt3, galt4 and galt6 mutants in the presence of β-Gal-Yariv reagent……………………………………………………...39

Figure 2.7. Salt induced inhibition of primary root elongation in galt3, galt4, and galt6 mutants…………………………………………………………………………………....40

Page

Figure 2.8. Root hair length and density reduced in the galt3, galt4 and galt6 mutant...... 42

Figure 2.9. Root-bending assay of WT, galt1, galt3, galt4, and galt6 mutant seedlings…………………………………………………………………………………..45

Figure 2.10. Subcellular localization of GALT4-YFP and GALT6-YFP in transfected tobacco (N. tabacum) epidermal cells…………………………………………………….46

Figure 2.11. RT-PCR analysis of WT and galt mutants………………………………...... 49

Figure 2.12. The galt single and double mutants displaying swollen root tips in response to salt stress as seen for fei 1-1 and fei 2-2 single mutants, fei1fei2 double mutants, fei1fei2sos5 triple mutants, and galt2galt5fei1fei2sos5 quintuple mutants……………...... 50

Figure 2.13. Root-bending assay of WT, galt1, galt3, galt4, and galt6 mutant seedlings…………………………………………………………………………………..50

Figure 2.14. Analysis of root curvature in WT, galt, fei1, fei2, and sos5 mutant plants……………………………………………………………………………………...51

Figure 2.15 Proposed model linking GALT2 and GALT5 with SOS5/FEI1/FEI2 in cellular signaling of root growth………………………………………………………….55

LIST OF ABBREVIATIONS

AG: arabinogalactan

AGP: arabinogalactan-protein

Arabidopsis: Arabidopsis thaliana

CAZy: the Carbohydrate Active enZymes database

ER: endoplasmic reticulum

EXT: extensin

FLA: fasciclin-like arabinogalactan-protein

FEI1: leucine-rich repeat receptor-like cell wall kinase 1

FEI2: leucine-rich repeat receptor-like cell wall kinase 2

Gal: galactose

GFP: green fluorescent protein

GlcA: glucuronyltransferase

GPI: glycosylphosphatidylinositol

GT: glycosyltransferase

HRGP: hydroxyproline-rich glycoproteins

Hyp: hydroxyproline

N-glycan: N-linked oligosaccharide

PRP: proline-rich protein

RG-I: rhamnogalacturonan I

RG-II: rhamnogalacturonan I 14

Rha: rhamnose

RP-HPLC: reverse phase-high performance liquid chromatography

SOS5: salt overly sensitive 5 (also known as FLA4)

WT: wild type

β-Yariv reagent: (β-D-galactosyl)3 or (β-D-glucosyl)3 Yariv phenylglycosides

CHAPTER 1: INTRODUCTION

1.1. Introduction

1.1.1 Plant cell walls

The plant cell wall is an extracellular matrix comprised of polysaccharides, lignin and glycoproteins and has the ability to self-assemble. Cell walls not only determine the mechanical properties of plant cells but also play fundamental roles in plant growth, development and signaling. Walls also serve as the primary interface for pathogen interactions. Walls are not only indispensable for the survival of plants, but also have enormous economic importance to humans. Walls serve as a source of natural textile fibers, paper and wood products, and components of fine chemicals and medicinal products. The synthesis of cell wall polysaccharides requires sophisticated, well- coordinated biosynthetic machinery involving specialized enzymes called glycosyltransferases (GTs). There are three major structural polysaccharides in the cell wall: cellulose, hemicelluloses, and pectins. In addition to polysaccharides, structural proteins also play an important role in plant cell walls. The hydroxyproline-rich glycoproteins (HRGPs) are one such cell wall protein family, which is represented by a spectrum of molecules ranging from the highly glycosylated arabinogalactan-proteins

(AGPs) to the moderately glycosylated extensins (EXTs) and lastly to the lightly glycosylated proline-rich proteins (PRPs) (Showalter, 1993).

1.1.2. Cellulose

Cellulose is in both the primary and secondary plant cell walls. It is composed of β-

(1,4)-linked D-glucose chains, but it exists in the form of microfibrils in plant cell walls. A 16 microfibril consists of approximately 36 of the cellulose chains (Herth, 1983). The cellulose microfibril is synthesized by a multi-enzyme complex called the rosette (Delmer,

1999). Rosettes consist of six subunits, which each contains six of the cellulose synthase

(CesA) catalytic subunits that synthesize the β-(1,4)-glucan chain (Somerville, 2006). The result is 36 individual chains produced simultaneously that combine to form cellulose microfibrils.

1.1.3. Hemicellulose

Hemicellulose is in both primary and secondary cell walls. Hemicellulose crosslinks the cellulose microfibrils. The particular hemicellulose that predominates depends on the particular species. In dicots, such as Arabidopsis, xyloglucan predominates in the primary cell wall (Fry, 1988). Glucuronoxylan (GX) is mostly found in the secondary cell walls of dicots. In monocots, such as the grasses, the amount of xyloglucan present is as low as 4%

(Fry, 1988), but xylan is the major hemicellulose in the primary and secondary cell walls of grasses. In grasses, xylan is in the form of glucuronoarabinoxylan (GAX) (Carpita N,

1996). Based on whether xyloglucan or GAX is the primary hemicellulose present, plant cell walls can be classified into two types: Type I and Type II (Carpita and Gibeaut, 1993;

Yokoyama and Nishitani, 2004).

1.1.4. Pectin

Pectin is responsible for determining the wall porosity (Baron-Epel et al., 1988). homogalacturonan (HGA) and rhamnogalacturonan I (RG-I) are the common pectin molecules in the cell wall. HGA consists of α-(1,4)-linked D-galacturonic acid chains, while in RG-I every other galacturonic acid residues is replaced with rhamnose in the 17 form of an α-(1,4)-D-GalA-α-(1,2)-L-Rha repeating unit (Carpita and McCann, 2000).

HGA and RG-I can be further structurally modified to generate other less common pectins, such as xylogalacturonan and rhamnogalacturonan II (RG-II) (Carpita and

McCann, 2000).

1.1.5. Glycoprotein

Glycoproteins represent another component of the cell wall. The hydroproline-rich glycoproteins (HRGPs) are one such example. HRGPs are divided into three categories:

Arabinogalactan-proteins (AGPs), extensins (EXTs), and proline-rich proteins (PRPs)

(Showalter, 1993). These categories are based on their level of glycosylation with AGPs being highly glycosylated, EXTs moderately glycosylated, and PRPs only lightly glycosylated.

1.1.6. Arabinogalactan-proteins (AGPs)

AGPs are a class of highly glycosylated cell wall glycoproteins, present in all plant cells and in all plant species, from algae to angiosperms (Showalter 2001, Seifert and

Roberts 2007, Ellis et al 2010). Given that sugar side chains typically account for more than 90% of the molecular mass of AGPs, sugars are likely to define the interactive surface of the molecule and hence its function (Shi et al 2003, MacMillan et al 2010,

Geshi et al 2013, Pereira et al 2006, van Hengel and Roberts 2002). AGPs are decorated by AG polysaccharides as a result of post-translational modifications that mainly occur in the endomembrane system. Considerable research progress in recent years has led to the identification of two fucosyltransferases genes (FUT4 and FUT6), which are members of

CAZy GT-family-37 (Wu et al, 2008), five Hyp-galactosyltransferase genes (GALT2, 18

GALT5, HPGT1, HPGT2, and HPGT3), which are members of GT-family-31 (Basu et al.,

2013; Basu et al., 2015; Ogawa-Ohnishi and Matsubayashi, 2015), one β-(1,3) galactosyltransferase (At1g77810) (Qu et al. 2008), two β-(1,6) galactosyltransferases

(Geshi et al., 2013), one β-arabinosyltransferase (RAY1) (Gille et al., 2013), three β- glucuronosyltransferases (GlcAT), GlcAT14A, GlcAT14B, and GlcAT14C members of the

CAZy GT14 family (Knoch et al. 2013; Dilokpimol and Geshi 2014) (Figure 1.1).

Figure 1.1. A model structure of an AGP showing only one AG side chain for simplicity. GALT2, GALT5, HPGT1, HPGT2 and HPGT3 denote the hydroxyproline- glycosyltransferase enzymes that add galactose onto hydroxyproline residues in the AGP protein backbone.

1.2. Objectives

• In silico analysis of temporal and spatial expression of GALT1, GALT2, GALT3,

GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3 will be performed using

GENEVESTIGATOR and eFP Browser. In addition, expression patterns of GALT1,

GALT2, GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, HPGT3 in response to 150 mM NaCl and 300 mM mannitol treatment will be compiled from the eFP Browser.

• Biochemical characterization of galt1, galt3, galt4, and galt6 genetic mutants.

Homozygous mutants for the corresponding candidate Hyp-GALT genes will be generated and subsequently AGPs will be isolated and quantified from the mutants and compared to

WT AGPs.

• Phenotypic characterization of galt1, galt3, galt4, and galt6 genetic mutants.

Phenotypic analyses of single mutants corresponding to the four putative Hyp-GALT genes will be performed. This will involve standard soil and plate based phenotypic analysis measuring various growth parameters under optimal and stress-induced conditions like supplementing MS media with β-Gal-Yariv reagent or NaCl.

• Subcellular localization of YFP-tagged GALT4 and GALT6. To confirm the subcellular localization of GALT4 and GALT6, a transient expression system using YFP fusion protein constructs will be infiltrated into Nicotiana tabacum epidermal cells followed by visualization of fluorescence of YFP fused GALT4 and GALT6 along with known markers of ER (GFP-HDEL) and Golgi vesicles (ST-GFP) using confocal microscopy. 21

• Generation and characterization of fei1fei2sos5galt2galt5 quintuple mutant plants.

This deals with the proposed hypothesis that AGPs may be involved in cellular signaling by interacting with two cell wall leucine-rich repeat, receptor-like kinases, FEI1/FEI2, and a well-characterized fasciclin-like AGP, named SOS5/FLA4. To test this hypothesis that a linear genetic signaling pathway exists involving glycosylated SOS5 and FEI1/FEI2, a quintuple mutant plant will be generated. By examining the phenotype of homozygous quintuple fei1fei2sos5galt2galt5 mutants grown in media containing NaCl, it will be determined whether phenotypes (including reduced root growth and root tip swelling) are the same as that observed in galt2galt5 double mutants and fei1fei2sos5 triple mutants.

1.3. Explaination of my contribution and that of others to this thesis research

• I used GENEVESTIGATOR and eFP Browser to perform all the in silico analysis of the temporal and spatial expression of GALT1, GALT2, GALT3, GALT4, GALT5, GALT6,

HPGT1, HPGT2, and HPGT3.

• I extracted AGPs from the various galt mutants and conducted AGP quantification on these mutants using a AGP standard curve. For the Hyp-galactosyltranferase enzymes assay, I was involved in the transient infiltration of the gene constructs and the isolation of the microsomes from the infiltrated tobacco leaf sections, but my lab mate, Debarati Basu, performed the radioactive enzyme assay.

• I performed the physiological characterization of all the genetic mutants in this thesis and compared them to wild type (WT) plants.

• For subcellular localization, GALT2, GALT3, and GALT5 were already done (Basu et al 2013, Basu et al 2015). Thus, to confirm the subcellular localization of GALT4 and 22

GALT6, I infiltrated the YFP fusion protein constructs into N. tabacum leaves and determined their localization with a confocal microcope.

• I was involved in generating quintuple mutant plants (fei1fei2sos5galt2galt5) to provide genetic evidence that these five genes act in a single genetic pathway in support of the proposed hypothesis.

1.4. Organization of the thesis

This thesis is divided into three chapters. Chapter 1 contains a brief review of the plant cell wall and AGPs. Chapter 2 deals with the characterization of four Hyp-GALT genes and the genotypic and phenotypic analysis of their corresponding genetic mutants.

Chapter 2 also contains information regarding the cellular signaling role of AGPs by taking advantage of a GPI-anchored FLA, SOS5, and two well characterized cell wall leucine-rich repeat, receptor-like kinases, namely FEI1/FEI2, and two AGP-specific Hyp-

GALTs, GALT2 and GALT5. Chapter 3 consists of a summary of this thesis work and ends with future research suggestions.

CHAPTER 2: A SMALL MULTIGENE HYDROXYPROLINE-O-

GALACTOSYLTRANSFERASE FAMILY FUNCTIONS IN

ARABINOGALACTAN-PROTEIN GLYCOSYLATION

2.1. Introduction

Arabinogalactan-proteins (AGPs) are members of the hydroxyproline (Hyp)-rich cell wall glycoprotein superfamily and are glycosylated by O-linked AG polysaccharides.

Using bioinformatics (Showalter et al., 2010) reported that Arabidopsis contains 85 AGP genes. AGPs function in various aspects of plant growth and development (Seifert and

Roberts, 2007; Ellis et al., 2010; Tan et al., 2012; Tan et al., 2013; Pereira et al., 2015;

Nguema-Ona et al., 2012; Seifert et al., 2014). However, there remains a lack of understanding of the detailed biochemical modes of action (i.e., mechanism) of any individual AGP.

Given the importance of understanding plant cell wall biosynthesis as it relates to biofuel production, much work on AGP biosynthesis has been done. Till now, several glycosyltransferase (GT) genes/enzymes that are responsible for AG polysaccharide production have been identified (Tan et al., 2013, Knoch et al., 2014, Wu et al, 2010). In particular, two hydroxyproline-O-galactosyltransferases, GALT2 and GALT5, which are members of GT-31 and contain a galectin domain (Basu et al., 2013; Basu et al., 2015) and three other hydroxyproline-O-galactosyltransferases，HPGT1-HPGT3, which are members of GT-31 but lack a galectin domain (Ogawa-Ohnishi and Matsubayashi, 2015) have been identified and characterized. 24

Hyp-GALTs that add galactose (Gal) onto the Hyp residues in AGP core proteins represent the first committed step in AG polysaccharide biosynthesis. Previously, Basu et al. showed that GALT2 (At4g21060) and GALT5 (At1g74800) are members of a small multigene family and encode Hyp-GALTs (Basu et al., 2013; Basu et al., 2015). In addition, extensive phenotypic characterization of galt2 and galt5 single mutants as well as galt2galt5 double mutants at the biochemical and physiological levels was performed which corroborated the roles of these two enzymes in AG biosynthesis and elucidated the contributions of AG polysaccharides to AGP function. Here, this work was extended by characterizing the remaining GALT genes, namely GALT1, GALT3, GALT4, and GALT6, of this small, six-membered gene family.

Fasciclin-like arabinogalactan-proteins (FLAs) are a subfamily of AGPs. They are frequently predicted to have a glycosylphosphatidylinositol (GPI) anchor, which would allow for their localization to the plasma membrane, making them ideal candidates for signal perception and transduction. They are implicated in cell wall biosynthesis, cell wall remodeling, and signaling (Seifert and Roberts, 2007). fla11fla12 double mutants display a substantial reduction in cellulose content accompanied by reduced tensile strength and tensile modulus of elasticity (MacMillan et al., 2010). Another characterized fasciclin-like AGP is SOS5 (salt overly sensitive), also known as FLA4, reported to be involved in root growth under elevated salt or sucrose containing media (Shi et al., 2003).

Xu et al. (2008) demonstrated that SOS5 acts upstream of cell wall deposition in a non- additive genetic pathway by interacting with FEI1/FEI2, two cell wall leucine-rich repeat receptor-like kinases (RLKs), based on the identical phenotypes displayed by sos5, 25 fei1fei2, and sos5fei1fei2 loss-of-function mutants (Xu et al., 2008). These mutants also showed root tip swelling when grown under the restrictive conditions of salt. The recent characterization of two genetic mutants namely, galt2 and galt5, which encode two Hyp-

GALT enzymes responsible for adding the first Gal onto AGP protein backbones also displayed identical phenotypes as observed in sos5 and fei1 fei2 mutants (Basu et al.,

2015). Since these galt mutants have reduced glycosylation of AGPs, it is hypothesized that glycosylation of the AGP domain of SOS5 is required for it to function in the

SOS5/FEI1/FEI2 pathway to signal normal root growth under non-permissive conditions.

I hypothesize that glycosylation of the AGP is essential for the cellular signaling of normal root growth. Here, I address this hypothesis by generating quintuple mutant plants

(galt2galt5sos5fei1fei2) and conducting their phenotypic functional characterization with respect to other related mutants, such as galt2galt5 double mutants and sos5fei1fei2 triple mutants.

2.2. Materials and methods

2.2.1. In silico analysis of temporal and spatial expression method of GALT1, GALT2,

GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3

Expression under normal conditions was determined by analysis with

GENEVESTIGATOR (https://genevestigator.com/gv/); whereas expression under abiotic conditions was determined by analysis with the eFP Browser

(http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi). 26

2.2.2. Plant lines and plant growth conditions

Arabidopsis thaliana accession Columbia-0 (Col-0) and two T-DNA insertion lines for At1g26180-(galt1-1, Sail_170_A08 and galt1-2, Salk_006871), At3g06440 (galt3-1,

Salk_085633 and galt3-2, Salk_005178), At1g127120 (galt4-1, Salk_136251 and galt4-2,

Salk_131723), and At5g62620 galt6-1, Sail_59_D08 and galt6-2, Sail_70_B02) were obtained from the Arabidopsis Biological Resource Center (ABRC, Ohio State

University). The triple mutant sos5fei1fei2 was the kind gift of Dr. Joseph Keiber,

University of North Carolina Chapel Hill, North Carolina, USA.

The quintuple mutant was generated by crossing a galt2galt5 double mutant with a sos5fei1fei2 triple mutant. All plants used in this study were germinated after 4 days of stratification in the dark at 4°C and were grown under long-day conditions (16h of light/8h of dark, 22 °C, 60% humidity) in growth chambers.

2.2.3. Mutant confirmation by PCR and RT-PCR

Genomic DNA was isolated from leaves of the mutants and WT plants using the 2X

CTAB method, and subsequent PCR analysis was carried out using gene specific primers in in conjunction with the T-DNA primers. For sequencing purposes, PCR products were purified by gel extraction (Wizard® SV Gel and PCR Clean-Up System, Promega,

Madison, WI, USA) and sequenced by the Ohio University Genomics

(http://www.dna.ohio.edu/) Facility. To analyze transcript levels of GALT1, GALT3,

GALT4 and GALT6, total RNA was isolated from 2 week old seedlings of wild-type and mutant plants using Trizol (Life Technologies, Grand Island, NY, USA) and Direct- zol™ RNA MiniPrep (Zymo Research, Irvine, CA, USA). First-strand cDNA synthesis 27 was performed from 2 µg of total RNA using oligo-dT (IDT, Coralville, Iowa, USA) and

GoScript reverse transcriptase (Promega, Madison, WI, USA). RT-PCR was performed using OneTaq DNA polymerase (New England Biolabs, Ipswich, MA, USA) and gene- specific RT primers (Table 2.1). The number of amplification cycles was 28 to evaluate and quantify differences among transcript levels before the reaction reached saturation.

Total RNA was isolated from 14-d-old WT, fei1, fei2, sos5, fei1fei2, sos5fei1fei2, galt2galt5, and quintuple mutant seedlings using the RNeasy kit (Qiagen). First-strand cDNA was synthesized from 1 µg of the total RNA pretreated with RNase-free DNase

(Promega) using the Go script reverse transcriptase (Promega) with oligo dT, according to the manufacturer's instructions. qRT-PCR was performed with Brilliant III SYBR MM with ROX according to the manufacturer's instructions (Agilent Technologies) using gene-specific primers (Table 2.2). Expression levels were calculated using the comparative CT method, which involves normalizing against the geometric mean of the two housekeeping genes (UBQ10 (Polyubiquitin 10, At4g05320) and PP2A (Protein phosphatase2, At1g13320) for each tissue type (Schmittgen and Livak, 2008).

Table 2.1 List of primers used in this study

Purpose Forward Reverse Screening for T-DNA galt1-1 galt1-1RP GALT1-1LP TTTTTCACAGCCGAAAATC TTGGGAACTTGTTTTTAC AC CCC galt3-1 galt3-1RP- GALT3-1LP- AGGCAAATGGAATAACTT TGGGGTTACTTCGCTTA GGC CATG galt3-2 GALT3-2RP- GALT3-2LP- ACTGGTTTCTTCGTGGTTG TGAATTGGTGCAGAAAG TG GATC galt4-1 GALT4-1RP GALT4-1LP GATTAAACCCGAATCGAGT TTTGAACTTGGAATTTG CC GTCC galt4-2 GALT4-2RP GALT4-2LP GACTTCCTTTCTTGCATGC GGACTCGATTCGGGTTT TG AATC galt6-1 GALT6-1RP GALT6-1LP AGAACACGAGTTTGTCCCA TTTTGGTCGATTTGCTTA TG ACC galt6-2 GALT6-2RP GALT6-2LP GATGCAAAGGTGTCACAC CTCGAGTTTTGACAACT ATG TGGG LBa1.3 ATTTTGCCGATTTCGGAAC LB3 TAGCATCTGAATTTCATAA CCAATCTCGATACAC RT-PCR GALT1 RTF- RTR- CATCTTCGGGACAGAGGTTG AAACCAAACGCTCTCTTTG CTGCRTR- GALT3 RTF- RTR- GTTGACTACTATGGTTTACTT RTR- AGCTTG TTATTCGCAGCAAATAGAT TGGTTCTC GALT4 RTF- RTR- CTTTGTGGCATTGCATGCAAG CCATCTTGAATAATCTTAA AAAG TCGCTTTTG GALT6 RTF- RTR- GCAATTTGCGAGTACGGGGC CGCCGTCAAGTAATTCTCT TCATCAG ATGC UBQ10 RTF- RTR- TCGACCCTTCACTTGGTGT ATAAGCTGGTGTTGACAG GCA

Table 2.2 Other primers used in this study

Purpose Forward Reverse Screening of homozygous mutants GALT2 TCACTTGGTCATTCCCTTTTG CAAATCGATGGAGTCTCT CCA GALT5 TTTCCACTTTCGACAATTTG CTAATTACATGGTTTTGC G GGG Lba1.3 ATTTTGCCGATTTCGGAAC SOS5 ATGGCCGCCGCAATTAACGT GCCGGAAGAAACTATCT CACC CACGC FEI1 GAAGCTGGAAATGTTGAAT TTAATCAGAGCTGGAATC GAAGA ATAAAATTC FEI2 ACAAATCGATATTGTGTGCA TCAATCGGAGCTGGAGT ATGACAG CGTAGAAG

T-DNA left GGCAATCAGCTGTTGCCCGT border primer- CTCACTGGTG JMLB1(fei1) T-DNA left TTACCCAACTTAATCGCCTT border primer- GCAGCACAT JMLB1(fei2) GALT2 TCTTAGACATCGTCCTCTTA ACACAGCTGGAAATTTTG GA CC GALT5 TATGTGAACACGGAGCTCTT TCCATCTTGAACAGCCGT GCATTC AATTTATGTCT SOS5 CACCATGGCGAACGTAATCT TACCAAAACATAACAAAA CAATTTCC TGCTATAC FEI1 ATATGGAGCAATACCTACAG TTAATCAGAGCTGGAATC C ATAAAATTC FEI2 GAAACTGGAATCTCTTAATG TCAATCGGAGCTGGAGTC AAGAGC GTAGAAGT UBQ10 GTCGACCCTTCACTTGGTGT ATCCTCAAGCTGCTTTCCA G

2.2.4. Fluorescent protein fusion and subcellular localization

Full length GALT3, GALT4, and GALT6 devoid of stop codons were cloned into the pENTR/D-TOPO vector (Life technologies, Grand Island, NY, USA) and sequenced. The resulting plasmids were cloned in the destination vector pEarlyGate 101 by the Gateway cloning strategy, using the LR clonase enzyme mix (Life Technologies Grand Island,

NY, USA) to generate the YFP N-terminal fusion constructs. These constructs were transformed into Agrobacterium strain GV3101 and infiltrated into tobacco leaves except that the bacterial concentration was lower (OD600 = 0.05). The AtGALT3-YFP,

AtGALT4-YFP, and AtGALT6-YFP constructs were co-expressed with either the ER marker GFP-HDEL or the Golgi marker sialic acid transferase (ST)-GFP to ascribe subcellular localization. Transformed plants were incubated under normal growth conditions and imaged after 2 days post-infiltration using an upright Zeiss LSM 510

META laser scanning confocal microscope (Jena, Germany), using a 40 X oil immersion lens and an argon laser. For imaging the expression of YFP constructs, the excitation line was 514 nm, and emission data were collected at 535–590 nm, whereas for GFP constructs, the excitation line was 458 nm and the emission data were collected at 505-

530 nm.

2.2.5. Galactosyltranferase assay with microsomal preparations from transiently expressed GALT1, GALT3, GALT4, GALT6 in tobacco epidermal cells

The standard GALT reaction was performed as described in Basu et al. (2013) using detergent permealized microsomes from transiently expressed AtGALT1, AtGALT3,

AtGALT4, and AtGALT6. Three reactions were included as controls, one with no 31 substrate acceptor, one with permeabilized microsomal membranes from WT tobacco leaves infiltrated with Agrobacterium GV3101 transformed with the empty expression vector (pMDC32), and one with tobacco leaves infiltrated with the ST-GFP constructs as a negative control.

2.2.6. Extraction of AGPs

AGPs were extracted from the WT, galt1-1, galt1-2, galt3-1, galt3-2, galt4-1, galt4-2, galt6-1, and galt6-2 mutant plants as described in Schultz et al. (2000) and quantified as described by Gao et al. (1999).

2.2.7. Evaluation of seed set

Mature siliques from 6-weeks old WT, galt1, galt3, galt4, and galt6 plants were collected, and silique length and weight were measured. For seed number, siliques were decolorized by incubation in 100% ethanol at 37°C overnight before dissection of the siliques.

2.3. Results

2.3.1. In silico analysis of temporal and spatial expression of GALT1, GALT2,

GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3

In silico analysis indicates that these nine Hyp-GALT genes have overlapping but unique expression profiles. HPGT3 was expressed the most in seed coat. Overall, all these genes are expressed ubiquitously in all organs throughout the plant life cycle.

(Figure 2.1A, Figure 2.1B)

Under 150 mM NaCl and 300 mM mannitol treatments, these nine Hyp-GALTs were all expressed (Figure 2.2, Figure 2.3). 32

2.3.2. Biochemical characterization of galt1, galt3, galt4, and galt6 genetic mutants.

A reverse genetics approach was adopted to perform in vivo characterization of four the putative GALT genes. In this strategy, galt mutants were identified and examined for their physiological phenotypes. The physiological phenotypes will help to determine the contribution of galactosylation to AGP function. Allelic T-DNA insertional mutant lines for the four putative GALT genes were selected using the SIGnaL database

(http://signal.salk.edu/). T-DNA primers flanking the insertion site in conjunction with gene-specific left and right primers were used for confirmation of homozygous mutant lines (Figure 2.4). To determine the effect of the insertion on expression of the transcripts, a reverse transcription PCR (RT- PCR) was performed (Figure 2.5).

AGPs were isolated from WT as well as the four galt mutants from 14-d-old seedlings using β-Gal-Yariv reagent. The data indicate that except for the galt1 mutant alleles, the other allelic sets of galt mutants have reduced amounts of AGPs (Table 2.3)

Figure 2.1. Expression profiles of GALT2, GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3 in publicly available databases. Expression profiles of GALT2, GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3 as depicted by (A) Genevestigator and (B) eFP browser. The new GeneChip Operating Software (GCOS) platform enables researchers to perform gene expression analysis. 34

Figure 2.2. Expression patterns of GALT1, GALT2, GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3 in response to 150 mM NaCl treatment compiled from the eFP Browser. The level of gene expression is color coded according to the intensity of expression as indicated by the scale located at the left. Red represents the highest level of gene expression, while grey represents the lowest level of gene expression. The time course of the treatment is below each data set.

Figure 2.3. Expression patterns of GALT1, GALT2, GALT3, GALT4, GALT5, GALT6, HPGT1, HPGT2, and HPGT3 in response to 300 mM mannitol treatment compiled from the eFP Browser. The level of gene expression is color coded according to the intensity of expression as indicated by the scale located at the left. Red represents the highest level of gene expression, while grey represents the lowest level of gene expression. The time course of the treatment is below each data set.

Figure 2.4. Gene structure of the four putative GALT genes and screening of homozygous mutants. Triangles indicate sites of T-DNA insertion, white boxes indicate exons, black lines indicate introns and arrows indicate positions of the primers used for screening. RP and LP are gene-specific primers, whereas LBa1 and LB3 are T-DNA specific primers for the Salk and Sail lines respectively.

Figure 2.5. Expression analysis of GALT candidate genes by RT-PCR in wild type (WT) and mutant plants. RT-PCR was performed with gene-specific primers using leaf RNA from 14-day-old plants. Transcripts in the mutants were not detected indicating that the T-DNA insertion resulted in null mutants. UBQ10 was used as a positive control. The gene-specific primers for confirming disruption of the gene were designed downstream of the site of insertion.

Table 2.3. Detergent-solubilized microsomal fractions were used for performing a standard GALT assay, and AGPs were extracted, precipitated by β-Yariv reagent, and quantified from 14-d-old seedlings.

The values are averages of at least two independent experiments from two biological replicates. Student’s t tests were performed to determine statistical significance (a denotes P <0.01compared to WT and b denotes P < 0.05 compared to WT).

2.3.3. Phenotypic characterization of galt1, galt3, galt4, and galt6 genetic mutants under normal (optimal) growth conditions

Biological functions of AGPs remain elusive. The galt mutants were analyzed for physiological phenotypes with the hope of elucidating the role of AGP galactosylation and AGP function. Two strategies were used for comprehensive mutant analysis: 1) soil- based growth analysis and 2) plate-based growth analysis. The galt mutants were first visualized for significant growth phenotypes in comparison to wild type (WT) Col 0

(Figure 2.6, Figure 2.7). No significant phenotypic differences were observed when plants were grown in optimal conditions in soil and on MS plates with a few exceptions as presented below.

For seed number, the galt4 and galt6 mutants were observed to have a reduced number of seeds compared to WT or galt3 mutants (Table 2.4).

Single mutant knock-out lines for GALT3, GALT4, GALT6, as well as for GALT2 and

GALT5 and the galt2galt5 double mutant, displayed shorter and less dense root hairs compared to WT (Figure 2.8).

Figure 2.6. Reduced inhibition of primary root growth of galt3, galt4, and galt6 mutants in the presence of β-Gal-Yariv reagent. Root lengths of WT, galt1, galt3, galt4, and galt6 plants were measured 7, 14, and 21 d after germination and seedling establishment for 5 d on MS plates, on MS plates supplemented with 50 µM α-Gal-Yariv reagent, and on MS plates supplemented with 50 µM β-Gal-Yariv reagent. ‘*’ denotes a significant difference of root length compared to WT (P<0.05); ‘**’ denotes a significant difference of root length compared to WT (P<0.01). Vertical bars represent mean ± SE of the experimental means from at least three independent experiments (n =5), where experimental means were obtained from 10 to 15 seedlings per experiment.

Figure 2.7. Salt-induced inhibition of primary root elongation in galt3, galt4, and galt6 mutants. Five-day-old wild-type, galt1, galt3, galt4, and galt6 seedlings germinated on MS medium were transferred onto media containing 100 mM NaCl and grown vertically. Root elongation (i.e., increase in length after transfer) was measured after 7, 14, and 21 d of growth. ‘*’ denotes a significant difference of increasing in root length compared to WT (P<0.05); ‘**’ denotes a significant difference of increasing in root length compared to WT (P<0.01). Data are the means ± SE of measurements from five independent experiments (total n = 100).

Table 2.4. Weight, length, and seed number from wild-type, galt1-2, galt3-1, galt3-2, galt4-1, galt4-2, galt6-1, and galt6-2 siliques obtained from 6-week-old plants (n=20).

Letter ‘a’ and ‘b’ denotes a significant difference from the wild type (P <0.05, P<0.01), respectively

Figure 2.8. Root hair length and density reduced in the galt3, galt4, and galt6 mutants. (A) Wild type, galt1, galt3, galt4 and galt6 plants were grown on MS agar plates for 10 d. Bars = 1mm. (B) Quantification of root hair length and (C) density of the galt mutants. The asterisks indicate significantly reduced root hair length and density compared with wild-type controls according to a Student's t test (*, P < 0.05; **, P < 0.01; n > 300).

2.3.4. Phenotypic characterization of galt1, galt3, galt4, and galt6 genetic mutants under abnormal (restrictive) growth conditions (i. e., Yariv reagent and NaCl)

For monitoring root growth in response to Yariv reagent, wild-type, galt1-1, galt1-2, galt3-1, galt3-2, galt4-1, galt4-2, galt6-1 and galt6-2 were grown on MS plates for 7 d before they were transferred to MS plates supplemented with 50 µM α-Gal-Yariv reagent or 50 µM β-Gal-Yariv reagent. β-Yariv treatment is known to bind AGPs, specifically to their β-1,3-galactan chains, and inhibit root elongation. This inhibition is alleviated in the single mutants, which have reduced AGP glycosylation due to the lack of a specific

GALT (Figure 2.6).

AGPs are known to be involved in abiotic stress and if the mutants lack the GALT involved in AGP glycosylation, this might interfere or impair the function of AGPs. With this in mind, the response of the wild type and the galt mutants towards abiotic stress was examined by subjecting plants to saline stress. For seedling growth in salt, 7-d-old seedlings of wild-type, galt1-1, galt1-2, galt3-1, gal3-2, galt4-1, galt4-2, galt6-1 and galt6-2 plants were transferred to MS medium containing 1% agar and 100 mM NaCl.

Root length was determined on low-magnification (×10) digital images captured using a

CCD camera and image analysis freeware (ImageJ; http://rsb.info.nih.gov/ij/). The resulting data demonstrated that the single galt3, galt4, and galt6 mutants had reduced root growth while the galt1 mutant did not (Figure 2.7).

For an additional analysis of salt hypersensitivity of the mutant plants, root growth was monitored using a root bending assay (Zhu et al., 1998), and images were taken under a Nikon SMZ1500 stereomicroscope coupled with a CCD Infinity 2 camera and 44 analysis software. The single mutants were salt hypersensitive, demonstrating significantly delayed root bending, further corroborating the functional contribution of the carbohydrate moiety of AGPs to root growth (Figure 2.9).

2.3.5. Subcellular localization of GALT4 and GALT6

Full length GALT4 and GALT6 were cloned into the pENTR/D-TOPO vector (Life technologies, Grand Island, NY, USA) and sequenced. The resulting plasmids were cloned in the destination vector pEarlyGate 101 to generate the YFP N-terminal fusion constructs (Earley et al., 2006). These constructs were then transformed into

Agrobacterium strain GV3101. The GALT4-YFP and GALT6-YFP constructs were co- incubated under normal growth conditions and imaged 2 days post-infiltration using a confocal microscopy. For imaging, the expression of YFP constructs, the excitation line was 514 nm, and emission data were collected at 535–590 nm, whereas for GFP constructs, the excitation line was 458 nm, and the emission data were collected at 505-

530 nm. Confocal microscopy was used for determining the localization of these recombinant proteins. The data indicated that GALT4 and GALT6 are localized in Golgi vesicles (Figure 2.10)

E WT

100 * 80 * * * * * * * * 60 40 20 0 Root (degrees) Root curvature WT

galt1 galt2-1 galt2-1 galt2-2 galt3-1 galt3-2 galt4-1 galt4-2 galt5-1 galt5-2 galt6-1 galt6-2

galt2galt5 Figure 2.9. Root-bending assay of WT, galt1, galt3, galt4, and galt6 mutant seedlings. Five-day-old seedlings grown on MS plates were transferred to MS plates with 100 mM NaCl and reoriented at an angle of 180° (upside down). The photographs were taken 5d after reorientation. Bar = 10 mm. ‘*’ denotes a significant difference of root curvature compared to WT (P<0.05). 46

Figure 2.10. Subcellular localization of GALT4-YFP and GALT6-YFP in transfected tobacco (N. tabacum) epidermal cells. The expression of GALT4-YFP and GALT6-YFP fusion proteins are shown as red dots and the expression of HDEL-GFP (an ER marker) and sialic acid transferase (ST)-GFP (a Golgi marker) are shown as green dots. The merged images show co-localization of GALT4, GALT6, and the Golgi marker (yellow dots) confirming the Golgi location for the GALT4 and GALT6 proteins. Bar=10µm.

2.3.6. Generation and characterization of fei1fei2sos5galt2galt5 genetic mutants

Arabinogalactan-proteins (AGPs) are found on the surface of virtually all plant cells.

Much is known about the structure of these ubiquitous glycoproteins and their genes, but little is known about their function, particularly their potential roles in cell signaling. This part describes novel approaches to elucidate the role of AGPs in cellular signaling of root growth via a cell wall-associated leucine-rich repeat receptor-like kinase. Specifically, a well-known Fasciclin-Like AGP named FLA4 (also known as SOS5) and two cell wall- associated receptor-like kinases, called FEI1 and FEI2, are implicated in the cellular signaling of root growth in Arabidopsis (Xu et al 2008; Shi et al 2003). Quintuple mutants were made by crossing homozygous galt2galt5 mutants with homozygous fei1fei2sos5 mutants. F1 plants were selfed and the resulting plants were verified first by

PCR followed by sequencing and transcript analysis. After further selfing, quintuple mutant plants were obtained that were homozygous knockout plants (Figure 2.11). The quintuple mutants displayed swollen root tips identical to that of the sos5, fei1fei2sos5, and galt2galt5 mutants as well as delayed root bending in response to salt stress (Figures

2.12, 2.13, and 2.14).

2.4. Discussion

2.4.1. GALT3, GALT4, and GALT6 are localized to Golgi vesicles

Based on the localization studies performed with GALT2 and GALT5 (Basu et al.,

2015), GALT3, GALT4, and GALT6 were expected to reside in the Golgi vesicles, and this was confirmed by heterologous expression of fluorescently tagged protein fusions in tobacco leaves (Figure 2.10). Interestingly, only GALT2 is found in both the ER and 48

Golgi, indicating that Hyp-galactosylation may be initiated in the ER, but completed in the Golgi where the bulk of the Hyp-GALTs are located (Basu et al., 2015).

WT fei1 fei2 sos5 fei1fei2 fei1fei2sos5 galt2galt5 quintuple

FEI1

FEI2

SOS5

GALT2

GALT5

UBQ10

Figure 2.11. RT-PCR analysis of the quintuple mutants to confirm null status. RT-PCR analysis of galt2galt5sos5fei1fei2 quintuple mutants was used to confirm null status. Total RNA was extracted from rosette leaves of 2-week-old WT and homozygous mutant plants of the indicated genotypes. UBQ10 was used as the loading control. Experiments were repeated at least twice with virtually identical results.

WT galt2-1 galt2-2 galt5-1 galt5-2 galt2 galt5

sos5 fei1-1 fei2-2 fei1fei2 fei1fei2sos5 galt2galt5fei1fei2sos5

Figure 2.12. Quintuple mutant displays a conditional root anisotropic growth defect. Root tips of the indicated seedlings four days after transfer from MS medium containing 0% sucrose to MS medium containing 100 mM NaCl as imaged by dark field microscopy.

Figure 2.13. Salt hypersensitivity assessed by the root bending assay. Five-day-old seedlings grown on MS plates were transferred to MS plates with 100 mM NaCl and reoriented at an angle of 180° (upside down). The photographs were taken 7 d after reorientation.

120 *** ** 100 ** ** 80 * 60 40 20 0

(degree) curvature Root

Figure 2.14. Analysis of root curvature in WT, galt, fei1, fei2, and sos5 mutant plants. Statistical differences were determined by one way ANOVA and ‘*’ denotes a significant difference of root curvature (P<0.05) between WT and fei1fei2 mutants, ‘**’ denotes a significant difference of root curvature (P<0.01) between WT and galt2galt5, sos5, and fei1fei2sos5 mutants, and ‘***’ denotes a significant difference of root curvature (P<0.001) between WT and quintuple mutants. Vertical bars represent mean ± SE of the experimental means from at least two independent experiments (n=5), where experimental means were obtained from 15 seedlings per experiment.

2.4.2. The galt mutant phenotypes reveal functional roles of AGP glycosylation in normal growth and development

Genetic mutant analysis was used to investigate and compare the in vivo functional contributions of AGP glycosylation by GALT3, GALT4, and GALT6 with that of GALT2 and GALT5. Like galt2 and galt5, galt3, galt4 and galt6 single mutants for the most part did not have detectable growth phenotypes under normal soil-based growth conditions, which is likely attributed to the functional redundancy within the GALT2-6 gene family

(Basu et al., 2015). The only subtle phenotypes that were displayed by the single mutants included reduced seed set for galt4 and galt6 (Table 2.4) and shorter and less dense root hairs (Figure 2.8). It is anticipated that double and multiple galt mutants will show more pronounced mutant phenotypes, as was the case when galt2galt5 double mutants were produced and characterized (Basu et al., 2015).

Any defect leading to reduced AG glycosylation is likely to impair the function of multiple AGPs. At least some of the genes involved in AGP glycosylation, however, exist in small redundant or partially redundant genes families and may compensate for one another when a given gene in the family is knocked out (Basu et al., 2013; Basu et al.,

2015). In some cases, aberrant phenotypes may not be discernable under normal conditions, but may be revealed under suboptimal (restrictive) growth conditions.

2.4.3 Conditional phenotypes indicate GALT3, GALT4, and GALT6 function in tip growth

The galt3, galt4, and galt6 mutants displayed several root phenotypes in response to

β-Yariv and salt treatment. β-Yariv treatment is known to bind AGPs, specifically to 53 their β-1,3-galactan chains, and inhibit pollen tube and root elongation, indicating AGPs are important for such growth (Willats and Knox 1996, Mollet et al., 2002). This inhibition is alleviated in single mutants, which have reduced AGP glycosylation due to the lack of individual GALTs (Figure 2.6). Thus, GALT3, GALT4, and GALT6, like

GALT2 and GALT5, are important for root growth and indicate that the AG polysaccharides are required for these growth functions.

In roots, salt treatment results in reduced root growth, which can be measured directly or alternatively by the root bending assay (Zhu et al., 1998). The galt3, galt4, and galt6 mutants display salt hypersensitive root growth in both of these assays (Figure 2.7 and

2.9). Thus, GALT3, 4, and 6, like GALT2 and 5, function in root growth and indicate the importance of AG polysaccharides in this process.

Clearly, biochemical and genetic evidence presented here indicates that GALT3,

GALT4, and GALT6, like GALT2 and GALT5, function as AGP-specific Hyp-GALTs.

These Hyp-GALT genes function in a largely redundant manner, and it is anticipated that more severe biochemical and physiological phenotypes will occur when multiple genetic mutants are studied, revealing additional AGP functions.

2.4.4. GALT2, GALT5, SOS5, FEI1, and FEI2 act in a single genetic signaling pathway

Several studies in Arabidopsis have reported that loss-of-function mutants of SOS5, a

GPI anchored fasciclin-like AGP, two cell wall receptor-like kinases, FEI1 and FEI2, and two AGP specific galactosyltransferases, GALT2 and GALT5, share similar phenotypes

(Xu et al., 2008; Harpaz-Saad et al., 2011; Basu et al., 2015). Moreover, fei1fei2sos5 54 triple mutants were shown to act in a single, non-additive genetic pathway (Xu et al.,

2008). This information led to the hypothesis that these five genes act in the same linear genetic pathway, as envisioned in our proposed model (Figure 2.15). In order to test this hypothesis and the model, quintuple mutants were generated and a subjected to functional characterization and comparison of their phenotypes with that of the two parental lines, galt2galt5 and sos5fei1fei2.

SOS5, FEI1 and FEI2, prevent root tip swelling and delayed root bending (Figure

2.12, 2.13 and 2.14), and are in the same genetic pathway as GALT2 and GALT5. It appears that AGP glycosylation via any of the five GALTs (GALT2-5) likely generates a carbohydrate signal on SOS5, which is detected and transduced by the FEI1/FEI2 kinases to promote cell wall integrity (Shi et al., 2003; Basu et al., 2015; Xu et al., 2008). The genetic evidence provided here that indicates the five genes act in a single, non-additive genetic pathway, consistent with our model in which GALT2 and GALT5 function in the glycosylation of SOS5.

In conclusion, this study corroborates, links, and extends previous biochemical and genetic studies designed to understand the roles of FEI1/FEI2, SOS5, and

GALT2/GALT5 (Xu et al., 2008; Shi et al., 2003; Basu et al., 2015). The current work provides genetic evidence supporting a role for AGPs in cellular signaling of root growth, particularly with respect to their carbohydrate moieties or AG polysaccharides.

Figure 2.15 Proposed model linking GALT2 and GALT5 with SOS5/FEI1/FEI2 in cellular signaling of root growth. Signaling of normal root growth involves glycosylated SOS5 binding FEI1/2, possibly inducing dimer formation and activation of the kinase domain as well as allowing for the binding of FEI1/2 to ACC synthase. Such binding will inhibit the production of ACC, a potential signaling molecule and ethylene precursor, which directly or indirectly, inhibits cellulose biosynthesis independent of ethylene. In contrast, when SOS5 glycosylation is inhibited or SOS5 is mutated or FEI1/2 is mutated, ACC synthase can no longer bind to FEI; thus unbound ACC synthase produces ACC, which inhibits cellulose synthesis as well as leads to the production of ethylene. 56

CHAPTER 3: CONCLUSIONS AND FUTURE WORK

Despite the fact that plants contain substantial amounts of AGPs, there is a lack of knowledge on the enzymology of AGP glycan biosynthesis. AGP biosynthesis involves

O-galactosylation of Hyp residues followed by a stepwise elongation of the complex sugar chains. This thesis research focused on the identification of AGP-specific Hyp-

GALTs involved in the initial glycosylation of AGPs and the functional characterization of Hyp-GALT genetic mutants. The overall goal was to examine the enzymatic synthesis of the carbohydrate moieties decorating AGPs and evaluate the contribution of AGP glycosylation to biological functions. Also, an attempt was made to elucidate the role of

AGPs in cellular signaling. Overall, my intent was to unravel the structure, function, and biosynthesis of AGPs. A diversified approach utilizing biochemistry, and molecular genetics were employed to determine the function of the carbohydrate moieties of AGPs in plant growth, development, and reproduction.

The single galt mutants did not have dramatic phenotypes under normal growth conditions. Conditional mutant phenotypes, however, were observed, including salt- hypersensitive reduced root growth and root tip swelling and less-inhibited root growth in response to β-Yariv reagent (Figures 2.6, 2.7, and 2.9).

This mutant work clearly indicates that AGP glycans are essential for optimal plant growth and development. Perhaps the roles of the various Hyp-GALTs will become clearer as more than one redundant gene is knocked out in a single plant to reveal more drastic phenotypes during normal growth and development. It will be also interesting to analyze the structure of AGPs in the mutants which will in turn help to relate the role of 57 glycosylation to AGP function. And finally it will be important to unravel the mode of action of AGPs in regulating these pleitropic functions.

I have also provided genetic evidence for a likely non-additive linear signaling pathway involving interactions among FEI1, FEI2, SOS5, GALT2, and GALT5. My work proved that in roots, disruption of FEI1, FEI2, SOS5 or both GALT2 and GALT5 results in virtually identical conditional phenotypes, which includes swollen root tips and delayed root bending. It is important to mention that further biochemical evidence is required to confirm such interactions on the protein level, especially whether SOS5 is glycosylated by GALT2 and GALT5 and then goes on to interact with FEI1/FEI2.

REFERENCES

Baron-Epel O., Gharyal P.K., Schindler M. (1988) Pectins as mediators of wall porosity

in soybean cells. Planta 175, 389-395.

Basu D, Liang Y, Liu X, Himmeldirk K, Faik A, Kieliszewski M, Held M, Showalter

AM (2013) Functional identification of a hydroxyproline-O-galactosyltransferase

specific for arabinogalactan protein biosynthesis in Arabidopsis. J. Biol. Chem. 288,

10132–10143.

Basu D, Wang W, Ma S, DeBrosse T, Poirier E, Emch K, Soukup E, Tian L, Showalter

AM. (2015) Two hydroxyproline galactosyltransferases, GALT5 and GALT2,

function in arabinogalactan-protein glycosylation, growth and development in

Arabidopsis. PLoS ONE 10, e0125624.

Carpita N.C., Gibeaut D.M. (1993) Structural models of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of the

walls during growth. Plant J. 3, 1-30.

Carpita N. (1996) Structure and biogenesis of the cell walls of grasses. Annu Rev Plant

Mol Biol 47, 445–476.

Carpita N.C., McCann M. (2000) The Cell Wall In Biochemistry & Molecular Biology of

Plants, 1st ed., B. B. Buchanan, W. Gruissem and R. L. Jones, eds (Rockville, MD:

American Society of Plant Physiologists) pp. 52-108.

Delmer D.P. (1999) Cellulose biosyntehsis: Exciting times for a difficult field of study.

Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 245-276. 59

Dilokpimol A, Geshi N (2014) Arabidopsis thaliana glucuronosyltransferase in family

GT14. Plant Signal Behav. 9, e28891.

Ellis C, Karafyllidis I, Wasternack C, Turner JG. (2002) The Arabidopsis mutant cev 1

links cell wall signalling to jasmonate and ethylene responses. Plant Cell 14, 1557–

1566.

Ellis M, Egelund J, Schultz CJ, Bacic A. (2010) Arabinogalactan-proteins: Key

regulators at the cell surface? Plant Physiol. 153, 403-419.

Fry S.C. (1988) The Growing Plant Cell Wall: Chemical and Metabolic Analysis, 1st ed.

(Longman Scientific & Technical) pp. 333.

Gao M, Showalter AM. (1999) Yariv reagent treatment induces programmed cell death in

arabidopsis cell cultures and implicates arabinogalactan protein involvement. Plant J.

19, 321–331.

Geshi N, Pauly M, Ulvskov P. (2002) Solubilization of galactosyltransferase that

synthesizes 1, 4-β-galactan side chains in pectic rhamnogalacturonan I. Plant Physiol.

114, 540–548.

Geshi N, Johansen JN, Dilokpimol A, Rolland A, Belcram K, Verger S, Kotake T,

Tsumuraya Y, Kaneko S, Tryfona T, Dupree P, Scheller HV, Höfte H, Mouille G

(2013) A galactosyltransferase acting on arabinogalactan protein glycans is essential

for embryo development in Arabidopsis. Plant J. 76, 128–137.

Gille S, Sharma V, Baidoo EEK, Keasling JD, Scheller HV, Pauly M (2013)

Arabinosylation of a Yariv-precipitable cell wall polymer impacts plant growth as 60

exemplified by the Arabidopsis glycosyltransferase mutant ray1. Molecular Plant 6,

1369-1372.

Harpaz-Saad S, McFarlane HE, Xu S, Divi UK, Forward B, Western TL, Kieber JJ

(2011) Cellulose synthesis via the FEI2 RLK/SOS5 pathway and CELLULOSE

SYNTHASE 5 is required for the structure of seed coat mucilage in Arabidopsis.

Plant J. 68, 941-953.

Herth W. (1983) Arrays of plasma membrane “rosettes” in cellulose microfibril

formation of Spirogyra. Planta 159, 347-356.

Knoch E, Dilokpimol A, Tryfona T, Poulsen CP, Xiong G, Harholt J, Petersen BL,

Ulvskov P, Hadi MZ, Kotake T, Tsumuraya Y, Pauly M, Dupree P, Geshi N (2013) A

β–glucuronosyltransferase from Arabidopsis thaliana involved in biosynthesis of type

II arabinogalactan has a role in cell elongation during seedling growth. Plant J. 76,

1016–1029.

Knoch E, Dilokpimol A, Geshi N (2014) Arabinogalactan proteins: focus on

carbohydrate active enzymes. Front. Plant Sci. 11, 198.

Lamport DT, Kieliszewski MJ, Showalter AM (2006) Salt stress upregulates periplasmic

arabinogalactan proteins: using salt stress to analyse AGP function. New Phytol. 169,

479-492.

Liang Y, Faik A, Kieliszewski M, Tan L, Xu WL, Showalter AM. (2010) Identification

and characterization of in vitro galactosyltransferase activities involved in

arabinogalactan-protein glycosylation in tobacco and Arabidopsis. Plant Physiol. 154,

632–642. 61

MacMillan CP, Mansfield SD, Stachurski ZH, Evans R, Southerton SG (2010) Fasciclin-

like arabinogalactan proteins: specialization for stem biomechanics and cell wall

architecture in Arabidopsis and Eucalyptus. Plant J. 62, 689–703.

Mollet JC, Kim S, Jauh GY, Lord EM (2002) Arabinogalactan proteins pollen tube

growth, and the reversible effects of Yariv phenylglycoside. Protoplasma 219, 89–98.

Nguema-Ona E, Vicré-Gibouin M, Cannesan MA, Driouich A. (2013) Arabinogalactan

proteins in root–microbe interactions. Trends Plant Sci. 18, 440–449.

Ogawa-Ohnishi M, Matsubayashi Y. (2015) Identification of three potent hydroxyproline

O-galactosyltransferases in Arabidopsis. Plant J. 81, 736–746.

Pereira LG, Coimbra S, Oliveira H, Monteiro L, Sottomayor M (2006) Expression of

arabinogalactan protein genes in pollen tubes of Arabidopsis thaliana. Planta 223,

374–380.

Qu Y, Egelund J, Gilson PR,, Houghton F, Gleeson P A, Schultz CJ, Bacic A. (2008)

Identification of a novel group of putative Arabidopsis thaliana β-(1,3)-galactosyl

transferases. Plant Mol. Biol. 68, 43–59.

Schmittgen TD, Livak KJ. (2008) Analyzing real-time PCR data by the comparative CT

method. Nat Protoc 3, 1101–1108.

Schultz JC, Kim LJ, Currie G, Bacic A. (2000) The classical arabinogalactan protein

gene family of Arabidopsis. Plant Cell 12, 1751-1768.

Seifert GJ, Roberts K. (2007) The biology of arabinogalactan proteins. Annu. Rev. Plant

Biol. 58, 137–161. 62

Seifert GJ, Xue H, Acet T. (2014) The Arabidopsis thaliana FASCICLIN LIKE

ARABINOGALACTAN PROTEIN4 gene acts synergistically with abscisic acid

signaling to control root growth. Ann Bot; 114, 1125-33.

Shi H, Kim Y, Guo Y, Stevenson B, Zhu J-K (2003) The Arabidopsis SOS5 locus

encodes a putative cell surface adhesion protein and is required for normal cell

expansion. Plant Cell 15, 19–32.

Showalter AM (1993) Structure and function of plant cell wall proteins. Plant Cell 5, 9-

23.

Showalter AM (2001) Arabinogalactan-proteins: structure, expression, and function.

Cellular and Molecular Life Sciences 58, 1399-1417.

Showalter AM, Keppler B, Lichtenberg J, Gu D, Welch LR. (2010) A bioinformatics

approach to the identification, classification, and analysis of hydroxyproline-rich

glycoproteins. Plant Physiol. 153, 485–513.

Somerville C. (2006) Cellulose synthesis in higher plants. Annu. Rev. Cell Dev. Biol. 22,

53-78.

Strasser R, Bondili JS, Vavra U, Schoberer J, Svoboda B, Glossl J, Leonard R,

Stadlmann J, Altmann F, Steinkellner H, Mach L. (2007) A unique 1,3-

galactosyltransferase is indispensable for the biosynthesis of N-glycans containing

Lewis a structures in Arabidopsis thaliana. Plant Cell 19, 2278–2292.

Tan L, Showalter AM, Egelund J, Hernandez-Sanchez A, Doblin MS, Bacic A. (2012)

Arabinogalactan-proteins and the research challenges for these enigmatic plant cell

surface proteoglycans. Front Plant Sci. 3, 1-10. 63

Tan L, Eberhard S, Pattathil S, Warder C, Glushka J, Yuan C, Hao Z, Zhu X, Avci U,

Miller JS, Baldwin D, Pham C, Orlando R, Darvill A, Hahn MG, Kieliszewski MJ,

Mohnen D. (2013) An Arabidopsis cell wall proteoglycan consists of pectin and

arabinoxylan covalently linked to an arabinogalactan protein. Plant Cell 25, 270–287. van Hengel AJ, Roberts K (2002) Fucosylated arabinogalactan-proteins are required for

full root cell elongation in Arabidopsis. Plant J. 32, 105-113.

Willats GTW, Knox JP. (1996) A role for arabinogalactan-proteins in plant cell

expansion: evidence from studies on the interaction of β-glucosyl Yariv reagent with

seedlings of Arabidopsis thaliana. Plant J. 9, 919–925.

Willats WGT, McCartney L, Knox JP (2001) In-situ analysis of pectic polysaccharides in

seed mucilage and at the root surface of Arabidopsis thaliana. Planta 213, 37-44.

Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ (2007) An 'electronic

fluorescent pictograph' browser for exploring and analyzing large-scale biological

data sets. PLoS ONE 2, e718.

Wu Y, Williams M, Bernard S, Driouich A, Showalter AM, Faik A. (2010) Functional

identification of two nonredundant Arabidopsis (1,2) fucosyltransferases specific to

arabinogalactan proteins. J. Biol. Chem. 285, 13638–13645.

Xu SL, Rahman A, Baskin TI, Kieber JJ (2008) Two leucine-rich repeat receptor kinases

mediate signaling, linking cell wall biosynthesis and ACC synthase in Arabidopsis.

Plant Cell 20, 3065–3079. 64

Xue H, Seifert GJ. (2015) FASCICLIN LIKE ARABINOGALACTAN PROTEIN 4 and

RESPIRATORY BURST OXIDASE HOMOLOG D and F independently modulate

abscisic acid signaling, Plant Signal. Behav. 10, e989064.

Yokoyama R., Nishitani K. (2004) Genomic basis for cell-wall diversity in plants. A

comparative approach to gene families in rice and Arabidopsis. Plant Cell Physiol.

45, 1111-1121.

Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W. (2004)

GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant

Physiol. 136, 2621–2632.

Zhu J-K, Liu J, Xiong L (1998) Genetic analysis of salt tolerance in Arabidopsis evidence

for a critical role of potassium nutrition. Plant Cell 10, 1181–1191. ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! !

Thesis and Dissertation Services ! !