Characterization of the Locust Retinoid X Receptors

CHARACTERIZATION OF THE LOCUST RETINOID X RECEPTORS

Shaun M. Nowickyj

A thesis submitted to the Department of Biology in conformity with the requirements for the degree of Master of Science

Queen’s University Kingston, Ontario, Canada (December, 2007)

Abstract

The retinoid X receptor (RXR) participates in a multitude of nuclear receptor signaling pathways and is induced by its highly soughtafter cognate ligand, 9cis retinoic acid (9 cis RA). In flies and moths, molting is mediated by the ecdysone receptor that consists of a heterodimer comprising the ecdysone receptor monomer (EcR) and the invertebrate

RXR homolog ultraspiracle (USP); the latter, however, is believed to have diverged from its RXR origin. From the more evolutionarilyprimitive insect Locusta migratoria (Lm), long and short RXR transcripts (LmRXRL and LmRXRS, respectively) were detected during embryogenesis. This thesis reports the immunochemical detection of RXR cross reactive material throughout Locusta embryogenesis, suggesting that the protein may have another role besides ecdysone signaling. Thus, the RXR isoforms were cloned for recombinant expression and purification in order to demonstrate retinoid specificity.

Both isoforms bound 9cis RA and alltrans RA with high affinity. Binding was further corroborated by the identification of endogenous retinoids during embryogenesis.

Embryos were first subjected to modified “Bligh and Dyer” as well as solid phase extractions to circumvent oil precipitation that rendered whole homogenates unsuitable for retinoid assay and detection. The RAinducible Cyp26A1promoter reporter cell line identified the presence of endogenous RAs (5.4 nM) from insect embryo extracts.

Finally, high pressure liquid chromatography followed by mass spectroscopy

(HPLC/MS) confirmed the identity of alltrans RA and the more abundant 9cis RA (1.3 nM). These findings suggest a functional role for 9cis RA in the invertebrate embryo and favour signaling through the combination of 9cis RA and RXR in evolutionarily early RAdriven animal development. iii

Co-Authorship

The following researchers contributed to the success of the work described in this thesis and are gratefully acknowledged with coauthorship.

Chapter 2

Don Cameron and Dr. M. Petkovich (supervisor) provided the Cyp26A1promoter reporter cell line, performed luminometer analysis and provided technical advice.

Dr. James V. Chithalen and Dr. G. Jones (supervisor) helped develop the Locusta RA extraction protocol, performed HPLC/MS analysis and provided considerable advice.

Dr. Michael G. Tyshenko assisted in generating antiLmRXR and antihRXR antibodies and provided technical advice.

Dr. Gerard R. Wyatt provided advice and assistance for the radioligand binding assays and in handling Locusta .

Acknowledgements

I would like to express my sincerest thanks to my supervisor Dr. Virginia Walker for her support, guidance and friendship. Her teachings, advice and conversations of science and life have helped me immensely and will be remembered.

I would also like thank my committee members, Dr. Hawryshyn and Dr.

Mulligan, for time taken to provide advice, critical comments and assistance in completing this thesis.

Dr. Jones, Dr. Chithalen, Dr. Petkovich and Don Cameron are thanked for many helpful retinoid conversations. I truly enjoyed my research experience in their respective labs and learned a great deal from everyone in Botterell Hall. Dr. Wyatt is thanked for his advice, teachings and numerous fruitful conversations. I am grateful for the help of

Dr. Tyshenko and for teaching me to balance work and fitness. Thank you to Dr. Ko for answering all last minute questions big and small.

This experience will be forever memorable because of the support and friendship of past and present Bug Group members: Joslynn Affleck, Alan Brown, Raimond

Gordienko, Emily Huva, Mike Kuiper, Niraj Kumar, Katerina Neumann, Wensheng Qin,

Mike Tyshenko, Sandra Wilson, Suzy Wu, and Shutang Zhou.

The Department of Biology’s staff is thanked for their excellent technical and administrative assistance.

The Cornwall Community Hospital and Cornwall Public Library are kindly thanked for their encouragement and support.

To Lynn, Stephan and Charles for making me smile everyday. v

To Zachary McGlynn, Darryl Knight, Chris Boulton, Rich Lyon and Morris Lin.

Your friendship means the world to me thanks for taking care of me all these years.

To Alissa Lunney whose constant support and encouragement guided me through this thesis I can not thank you enough.

Thank you to my family who has supported me from the start. For my mom, dad and grandparents to whom this thesis means the most. vi

Table of Contents

Abstract ...... ii

CoAuthorship...... iii

Acknowledgements ...... iv

Table of Contents ...... vi

List of Abbreviations...... ix

List of Tables...... xi

List of Figures ...... xii

CHAPTER 1: Introduction and Literature Review

The Migratory Locust...... 1

Early Evidence of Insect Hormones...... 2

Insect Endocrine Structures and Molting...... 5

JH Structure and Synthesis...... 6

Modes of JH Action ...... 8

The Nuclear Receptors...... 9

Nuclear Receptor Domains ...... 10

The Nuclear Mechanisms of Molting ...... 12

Vitamin A...... 13

The Retinoids ...... 14

9cis Retinoic Acid ...... 15

Research Objectives ...... 16 vii

Literature Cited ...... 18

CHAPTER 2: Locust retinoid X receptors: 9-cis -retinoic acid in embryos from a primitive insect

Abstract ...... 28

Introduction ...... 30

Results...... 31

Ligand Binding Assays ...... 32

Retinoids in Locust Embryos ...... 33

Discussion ...... 35

Locust RXR Characterization ...... 35

Ligand Binding and Retinoid Identification ...... 36

Materials and Methods...... 40

Animals ...... 40

Plasmids ...... 40

Protein Expression and Purification...... 42

Antibody Preparation ...... 43

Western Blotting ...... 43

LigandBinding Assays...... 44

Luciferase Assays...... 45

Embryo Retinoid Extraction...... 45

High Pressure Liquid Chromatography (HPLC) and Mass Spectroscopy (MS) ...... 46

Acknowledgements ...... 47 viii

Literature Cited ...... 48

CHAPTER 3: General Discussion

General Discussion...... 66

Exogenous Effects of RA...... 66

RA Synthesis...... 67

RXR Loss of Function...... 69

Invertebrate RA Signaling...... 70

Conclusions and Future Considerations...... 71

Literature Cited ...... 74

List of Abbreviations

3 [ H]9cis RA...... tritiated 9cis retinoic acid 9cis RA...... 9cis retinoic acid 20OHEc...... 20hydroxyecdysone alltrans RA ...... alltrans Retinoic acid oC...... degrees Celsius cDNA ...... complementary deoxyribonucleic acid CHAPS...... 3[(3cholamidopropyl)demethylammonio]1propanesulfonate Ci...... Curie DHA...... cis 4,7,10,13,16,19Docosahexaenoic acid Dm...... Drosophila melanogaster DMSO ...... dimethylsulfoxide DNA...... deoxyribonucleic acid DPPD ...... 1,2dianilinoethane (N,N′diphenylethylenediamine) DTT...... dithiothreitol EcR...... ecdysone receptor monomer EDTA...... ethylenediaminetetraacetic acid EtOH ...... ethanol x g...... gravitational field HAP...... hydroxylapatite His ...... histidine HPLC ...... high pressure liquid chromatography HPLC/MS...... high pressure liquid chromatographymass spectroscopy IgG ...... Immunoglobulin G IPTG...... isopropyl1thioβDgalactopyranoside JH (III)...... juvenile hormone (III) KCl...... potassium chloride kDa...... kilodalton LBD...... ligand binding domain Lm ...... Locusta migratoria x

LmRXRL ...... Locusta migratoria retinoid X receptorlong isoform LmRXRS ...... Locusta migratoria retinoid X receptorshort isoform MeOH...... methanol MEM ...... minimum essential medium NaCl ...... sodium chloride

NaN 3...... sodium azide NaOH ...... sodium hydroxide PAGE ...... polyacrylamide gel electrophoresis PBS...... phosphatebuffered saline PCR...... polymerase chain reaction PMSF ...... phenyl methyl sulfonyl fluoride POD...... peroxidase (horseradish) RA ...... retinoic acid SDS ...... sodium dodecyl sulfate TBST...... tris buffered saline tween20 Tris ...... tris(hydroxymethyl) aminomethane USP ...... ultraspiracle

List of Tables

Table 1.1 Chemical structures ...... 27

Table 2.1 IC 50 values of purified Locusta RXR subtypes (LmRXRL and –Short)

and human RXRα using inert ligands...... 62

Table 2.2 Retinoid signaling in the bilaterians...... 64

Table 3.1 Summary of retinoid synthesis and signaling pathways in bilaterians...... 79

xii

List of Figures

Fig. 1.1 Locusta migratoria life cycle ...... 25

Fig. 2.1 Recombinant protein purification and western blot analysis...... 54

Fig. 2.2 Competitive binding studies ...... 56

Fig. 2.3 Cyp26A1promoter reporter cell line assays...... 58

Fig. 2.4 HPLC/MS analysis of Locusta extracts...... 60

CHAPTER 1: Introduction and Literature Review

The Migratory Locust

The African migratory locust, Locusta migratoria migratorioides (Reiche and

Fairmaire), is a member of the phylum Arthropoda, class Insecta, order Orthoptera, family Acrididae, and is one of 20,000 grasshopper species described to date. Its range extends through the Atlantic Islands, Africa, Asia and parts of Australia. The locust is hemimetabolous with a lifecycle comprised of three stages: egg, nymph and imago (Fig.

1.1). Developmental time depends on a variety of factors including temperature, humidity, soil conditions, and food availability (Roffey and Magor, 2003).

Females drill holes into the ground with their telescopic ovipositor, lay their eggs and seal the opening hole with a protective froth plug. Under ideal conditions, females lay up to 5 egg pods in their lifetime with each pod containing 60 eggs. Females may withhold fully matured eggs for 3 days in search of optimal soil conditions (moisture, salinity, and composition) for oviposition (Roffey and Magor, 2003). Generally, egg development occurs over two weeks and during this time the egg absorbs moisture and doubles in weight (HunterJones, 1964). Nymphs, or hoppers, develop over 1 month before becoming adults. Growth is achieved through the process of molting; 5 or 6 molts may be observed where each instar is distinguished by wing bud development. The final molt is known as a fledging; a young adult locust with fully developed wings, and sexual maturity is reached approximately 14 days afterward (Fig. 1.1). Adults can live for approximately 2 months and 56 locust generations can occur within a year. 2

Locusts are polymorphic since they have the ability to switch from a solitary to a gregarious phase. Phase change is noted during rainfall seasons, vegetative changes, and overcrowding caused by convergent winds or patchy distributions of oviposition sites

(Despland et al ., 2000; Simpson et al ., 1999). Phase changes are accompanied by a change in morphology, colour and behaviour, an increase in reproductive potential, and swarming (Applebaum and Heifetz, 1999). Swarm densities (quantified as: total numbers x 10 6; area in km 2), are classified as small (1000; >10), medium (10,000; >100) and large

(100,000; >100) (Roffey, 1965). Swarms are highly mobile achieving a net displacement of 1000 km and destructive since locusts can consume up to their own weight (~2.5 g) in vegetation per day (Waloff, 1966).

Organophosphate pesticides are readily applied by aerial and ground spraying and are the primary mode of locust population control (Lomer et al ., 2001). These pesticides are nonspecific, potentially posing a human and environmental threat. The development of biosafe pesticides such as Green Muscle TM (a locustspecific, eggparasitoid mycopesticide based on the fungus Metarhizium anisoliae var. acridum ) which promises death before sexual maturation (Lomer et al ., 2001) is now a priority. A complete understanding of the molecular mechanisms underlying locust reproduction, growth, and development may elucidate additional methods of controlling these populations.

Early Evidence of Insect Hormones

Agriculturalists have known that castrating chickens results in docile capons that fail to exhibit mating behaviour as observed in normal rooster development. In 1849,

Berthold implanted avian testes into castrated capons and observed a ‘masculinizing 3 effect’ followed by normal rooster development. Though the testes were neurologically nonfunctional, it was proposed that a ‘substance’ was released from the testes into circulation causing the ‘masculinizing effect’. Bernard proposed the term ‘internal secretion’ to describe this endocrine function of the testes and later the word ‘hormone’

(of Greek origins, meaning ‘to excite’) was proposed by Hardy (reviewed in

Wigglesworth, 1985). However, similar castration and reimplantation experiments of insect sex glands in the silkworm, Bombyx mori , and the cricket, Gryllus domesticus , failed to produce an endocrine response (Kellogg, 1904). The application of vertebrate hormones to these insects also produced inconsistent results leading to the misconclusion that insects did not secrete hormones.

This belief was challenged a decade later in Kopeč’s series of ligation and ligature experiments on the gypsy moth, Lymantria dispar (reviewed in Klowden, 2003). During the moth’s last larval stage, prior to a critical period of growth, a ligature was tied at the moth’s center. The anterior end of the moth was observed to pupate while the posterior end remained unchanged. Kopeč reasoned that the insect head was necessary for metamorphosis. Further experiments demonstrated a complete arrest in metamorphosis when the brain was excised whereas severance of the nerve cord behind the head had no effect on pupation. Kopeč concluded that metamorphosis required the secretion of hormone from the brain during the insect’s developmental ‘critical period’. These results were unfortunately met with skepticism since it was commonly believed that insects were devoid of hormones and that the brain could not be a source of hormonal secretions. This belief was not accepted until Scharrer demonstrated that neurosecretory cells are nerve 4 cells with evidence of secretion in both the vertebrate and insect brain (Scharrer and

Scharrer, 1944).

The concept of a secreted insect hormone controlling metamorphosis was successfully brought forth a decade later in a series of classical endocrine experiments by

Wigglesworth. Using the bloodsucking bug, Rhodnius prolixus , Wigglesworth demonstrated that neurosecretory cells implanted in previously decapitated larva induced a molt (Wigglesworth, 1940). This was the first demonstration of a hormonal function for the neurosecretory cells and provided evidence for Kopeč’s argument that the insect brain can be a source of hormonal secretion. Using silkworm pupae, Bombyx mori ,

Fukuda (reviewed in Klowden, 2003) identified the molting hormone’s source and location as the prothoracic gland. The hormone itself was later identified as ecdysone and was first purified from a half ton of B. mori pupae.

Like Kopeč, Wigglesworth also discovered a ‘critical period’ where Rhodnius larvae molt after a blood meal. Wigglesworth decapitated fourth instar larvae during their ‘critical period’ and noted that some molted to fifth instars, some failed to molt, and some displayed partial adult characteristics. It was believed that an inhibitory factor caused partial metamorphosis and Wigglesworth identified its source as the corpora allata (CA) located in the head of the insect (reviewed in Wigglesworth, 1985).

Wigglesworth further disproved this factor’s supposed role as a molting hormone antagonist. He showed that adult Rhodnius treated with molting hormone produced a new adult cuticle. When treated with the molting hormone and an excess of the inhibitory factor there was partial recovery of the larval cuticle (Wigglesworth, 1940).

This demonstration of reversal metamorphosis proved that the CA was not a molting 5 hormone antagonist; rather, it exerted an influence by seeming to retain the expression of larval characteristics. The inhibitory factor was therefore given the name juvenile hormone (JH).

Insect Endocrine Structures and Molting

The locust brain has four main hormonal structures: the neurosecretory cells, the corpora cardiaca (CC), the CA, and the prothoracic glands. The neurosecretory cells exist in medial and lateral clusters along the insect brain. They release brain hormone and transmit the stimuli through fine axons to stimulate the CA and the CC. The CA synthesizes and secretes JH and the CC stores and secretes prothoracicotropic hormone

(PTTH). PTTH stimulates the prothoracic glands to release their store of ecdysteroids.

An ecdysteroid pulse, in the absence of JH, initiates the 7step process of molting.

First the old endocuticle is separated form the epidermal cells and an inactive molting gel is deposited in the newly created space (1 apolysis). Epidermis cells secrete the lipoprotein, cuticulin, for protection against the molting gel (2 epicuticle formation).

The molting fluid is activated and chemically digests the old endocuticle. These amino acids are recycled under the cuticulin layer to form the new procuticle (3 procuticle deposition). The old cuticle splits and is shed (4 – ecdysis). The insect intakes air and contracts its muscles to stretch the new procuticle (5 – procuticle expansion). Cross linking resulting in hardening and darkening of sclerites in the new exocuticle (6 sclerotization). Finally, chitin and other proteins are deposited (7 – endocuticle deposition).

JH Structure and Synthesis

The JHs are a family of structurally unique compounds derived from farnesoic acid. Synthesized and stored in the CA, JH is secreted into the haemolymph. As demonstrated in Lepidoptera, JH is sensitive to degradation by JH esterases and JH epoxide hydrolase (Hammock, 1985). In Locusta , juvenile hormone binding protein

(JHBP) synthesized in the fat body binds JH with nanomolar affinity (Braun et al ., 1996).

JHBPs protect the hormone from esterase degradation and facilitates the transport of JH across the cell membrane of the target cell. The effects of the hormone are both metamorphic and reproductive since JH promotes the maintenance of larval characteristics and stimulates vitellogenin synthesis (Riddiford, 1996; Wyatt, 1997).

The multistep biosynthesis of JH follows the mevalonate pathway, which is ubiquitous in nearly all metazoans. The mevalonate pathway involves the reductive polymerization of acetylCoA to various isoprenoid compounds. Plants, however, make use of the methylerythritol pathway to synthesize phytoalexins and cytokinins (reviewed in Stermer et al ., 1994). In mammals, cholesterol and other hormonal messengers are major final products of the mevalonate pathway. Insects and arthropods make use of the initial steps of this pathway: from the acetylCoA to farnesyl diphosphate, JH biosynthesis is identical to mammalian cholesterol biosynthesis. Insects lack squalene synthase and the subsequent enzymes needed to yield cholesterol (Clark and Bloch,

1959). In Orthoptera, subsequent steps esterify then epoxidate farnesoic acid to yield the

JH end product. This differs in Lepidoptera, where epoxidation occurs before esterification of JH (Bhaskaran et al ., 1986).

JH is a sesquiterpenoid (consisting of three isoprene units) with a methyl ester group and an epoxide group at opposite ends. Three classical members of the JH family are known, differing in carbon chain length and epoxidation. The first JH to be characterized was the monomethyl isoform JH I (C=18) from the moth Hyalophora cecropia (Röller et al ., 1967). Subsequently, diethyl JH II (C=17) and triethyl JH III isoforms were identified, the former from the silk moth (Meyer et al ., 1968). Variants of these three JH structures include: 4methyl JH I (C=18) and a JH III bisepoxide (JHB3;

C=16; Fig. 1.2) with a 6, 7 epoxide group. Although JH III is the most common hormone found throughout the Insecta , it is not uncommon for insects to synthesize a combination of different JHs. For example, JH O and 4methyl JH I are found in the Lepidopteran embryos of the tobacco hornworm, Manduca sexta (Bergot et al ., 1980). The armyworm moth, Pseudaletia unipuncta , was shown to have JH acids I, II, and III (Cusson et al .,

1991). Throughout embryonic development of the cockroach, Diploptera punctata, JH

III and the JH precursor, methyl farnesoate, are present (Stay et al ., 2002). The higher ordered dipterans exclusively synthesize JHB3 (Richard et al ., 1989).

In L. migratoria , haemolymph extracts from nymphs and female adults show that

JH III is the principle JH, although minor JH III 1011diols are known to exist in the female CA (Bergot et al ., 1981; Gadot et al ., 1987). Crustaceans, however, make use of the JH precursor methyl farnesoate to regulate growth, morphotypic differentiation, mating behaviour and vitellogenesis (Laufer et al ., 1987). Methyl farnesoate is similar to

JH III except that it lacks the C1011 epoxide group. Although JH III is not found in crustaceans, it has been isolated from some plants suggesting a means of protection against insect herbivory (Toong et al ., 1988). Recently, a biosynthetic pathway for JH III 8 was elucidated from the ricefield flatsedge, Cyperus iria (Bede et al ., 2001). JH III also bears structural similarity to the active vitamin A compound, alltrans retinoic acid (Fig.

1.2).

A variety of JH agonists and antagonists have been synthesized in the search for insect control and pesticide development. Methoprene (Fig. 1.2) is a synthetic insect growth regulator that mimics the function of JH and in Locusta it has been demonstrated to restore transcription of vitellogenin genes after the CA activity was chemically abolished by precocene (Dhadialla et al ., 1987).

Modes of JH Action

JH appears to exert its effect by membrane receptor as well as by nuclear receptors. A membrane receptor model is affiliated with copulationinduced RNA and protein synthesis in the male accessory glands of the fruit fly Drosophila melanogaster .

JH applied to the glands in vitro mimics the copulationinduced response of protein synthesis. In the absence of calcium, and in mutants deficient in protein kinase C, the copulationinduced response was not observed (Yamamoto et al ., 1988). These observations provided initial support for a membrane receptor model of JH action.

Further support for the membrane receptor model has been observed during vitellogenesis in Rhodnius and Locusta . The onset of vitellogenesis creates large spaces

(patency) between ovarian follicular epithelium cells thereby permitting vitellogenins access to the oocyte surface (reviewed in Wyatt, 1997). JH binds a follicle cell membrane receptor and stimulates patency by decreasing cell volume up to 50%

(Ilenchuck and Davey, 1985; AbuHakima and Davey, 1977). JHinduced cell patency 9 was correlated with the phosphorylation of a 100 kDa polypeptide and the activation of a

JHsensitive Na +/K +ATPase (Sevala and Davey, 1993). Similar to the results of

Yamamoto et al . (1988), this JHinduced cascade was found to be mediated by protein kinase C and favours the membrane receptor model of JH action (Sevala and Davey,

1993).

In the fat body of the female Locusta , the JHinduced vitellogenin genes VgA and

VgB are coordinately expressed with the reproductivelyrelated gene, jhp21 (Locke et al .,

1987; Zhang et al ., 1993). Of interest are three almost symmetrical 15nucleotide motifs found in the upstream region of jhp21 that enhance its transcription and bear a close resemblance to the ecdysone response element IR1 (Zhang and Wyatt, 1996). These putative JHREs indicate that JH signaling may occur through a transcription factor; therefore, jhp21 is a candidate for signaling by the elusive locust JH nuclear receptor.

Furthermore, this evidence supports a “crosstalk” model where JH signaling is regulated by both cell surface and nuclear receptors (Zhou et al ., 2002). Additional theoretical support for the nuclear receptor model comes from the JH structurallysimilar molecule, alltrans RA, which is a ligand for the retinoic acid nuclear receptor (RAR).

The Nuclear Receptors

The nuclear hormone receptors are a superfamily of ligandactivated transcription factors that control gene expression involved in metazoan growth, metabolism and reproduction. The superfamily is organized as two families: the steroid receptor family and the nonsteroid receptor family. The former includes the androgen, glucocorticoid, 10 mineralocorticoid, and progesterone receptors and the latter includes the retinoid, thyroid, vitamin D and ecdysone receptors.

Further organization into six classes is based on the nuclear receptors mode of dimerization and their DNA hormone response elements (DNAHREs). Class I receptors are the steroid receptors that form homodimers and bind to inverted DNAHRE repeats.

Class II receptors form heterodimers with RXRs and generally bind to direct DNAHRE repeats. Class III receptors form homodimers and generally bind to direct DNAHRE repeats. Finally, classes IVVI bind palindrome and hemisite DNAHRE repeats as monomers, homodimers or heterodimers (review see Mangelsdorf et al ., 1995). Nuclear receptor subtypes are also produced by differential RNA splicing or promoter usage as in the α, β, or γ isoforms of the human RXR (reviewed in Chambon, 1996). With over

300 described nuclear receptor sequences, homology classification with respect to evolutionary conservation of receptor domains has been suggested (Nuclear Receptors

Nomenclature Committee, 1999).

Nuclear Receptor Domains

The nuclear receptor proteins share 56 common structural domains (A through F) with each domain showing varying degrees of homology (originally defined by Krust et al ., 1986). From the amino terminal there is a transactivation domain (A/B), a DNA binding domain (DBD or C), a hinge region (D), and at the carboxyterminus exists a ligandbinding domain (LBD or E) and a terminal region (F) (reviewed in Chambon,

1996). 11

The aminoterminal A/B region exhibits the greatest variability of all the domains with respect to its size, sequence composition, and evolutionary conservation. Subtypes transcribed from a single gene generally differ due to this region. The A/B region includes a transcriptional activation function (AF1). AF1 is ligand independent, cell type and promoter specific, and is a target for phosphorylation, which results in enhanced transcriptional activity of the target genes.

The DBD shows the greatest sequence conservation among nuclear receptors of the same family. For example, the RXR DBD of Locusta shares 96% similarity to

Drosophila USP, Xenopus laevis RXRα and Homo sapien RXRα (Hayward et al ., 1999).

It is characterized by two zincfinger structures and a COOHterminal extension (CTE) that directs binding to specific DNAHREs. Each zinc finger structure is stabilized by four conserved cysteines that coordinate to a zinc divalent cation. At the bottom of the aminoterminal zinc finger is the proximalbox (Pbox) containing 5 amino acids that recognize and determine target DNA specificity of the major groove. At the bottom of the second zinc finger is the distalbox (Dbox) containing amino acids that contribute to a dimerization interface that is active in the presence of a DNAHRE. The CTE contains the TBox and ABox that each form helices. The former functions in dimerization and the latter makes contact with the DNA backbone and minor groove.

The hinge region, located between the DBD and LBD, is thought to relieve steric hindrance and allow adaptability. As shown in the androgen and glucocorticoid receptors, this domain may contain a nuclear localization signal shuttling these receptors from the cytoplasm to the nucleus after ligand binding (GuiochonMantel et al ., 1994). 12

The LBD is a less conserved than the DBD. For example, the RXR LBD from

Locusta shares less than 71% similarity with other insects (Hayward et al ., 1999). This may be attributed to its multifunctional roles: it specifies ligand selectivity, acts as the primary dimerization interface and ultimately alters liganddependent transcriptional response. Also present within the LBD is a second activation function (AF2) allowing for coactivator recognition. The LBD is comprised of 12 αhelices and one βturn arranged as three antiparallel layers. Within the LBD is a ligand binding pocket comprised of hydrophobic residues and polar residues at the end to anchor and orient the ligand. Binding of the ligand is followed by receptor conformation change that is thought to stabilize the docked ligand and activate the receptor.

Located at the Cterminal of the nuclear receptor is the F region. This region is highly variable in sequence and length and its function is not well known. Studies of the estrogen receptor suggest its role in the recruitment of a LBD coactivator (Peters and

Khan, 1999).

The Nuclear Mechanisms of Molting

The nuclear receptors governing insect molting are well characterized in D. melanogaster . Molting is initiated by the active molting hormone 20hydroxyecdysone

(20OHEc) and is mediated by the invertebrate ecdysone receptor. This receptor is a heterodimer comprised of the Drosophila ecdysone receptor monomer (EcR) and the

Drosophila Ultraspiracle (USP) protein, homologue of the retinoid X receptor (RXR).

The EcR gene, formerly the Drosophila Hormone Receptor 23 (DHR23), encodes the

EcR protein monomer (Koelle et al ., 1991; 1992). Differential RNAsplicing yields three 13

Drosophila EcR isoforms (EcRA, EcRB1 and EcRB2) while the Drosophila usp gene encodes a single USP protein monomer. Both Drosophila EcR and usp have been cloned and sequenced (Talbot et al ., 1993; Oro et al ., 1990).

Although USP is unpartnered while EcR binds 20OHEc, both subunits and the ligand are required for 20OHEc gene regulation. Reporter assays demonstrate three fold induction in the presence of 20OHEc when EcR and usp are cotransfected into a

Drosophila cell line (Yao et al ., 1992; 1993). In contrast, ecdysone responsiveness is absent when EcR , or usp , are transfected alone or when EcR is cotransfected with vertebrate RXRα .

Individually, EcR and USP monomers do not bind to ecdysone HREs indicating the importance of heterodimerization with EcR forming a heterodimer with either vertebrate RXRα or USP (Thomas et al ., 1993). Likewise, Drosophila USP can heterodimerize with a variety of vertebrate nuclear receptors (RARα, TRβ, VDR and

PPAR) much like its vertebrate RXR homologue (Yao et al ., 1992). In the absence of ecdysone, EcR and USP weakly form a heterodimer whereas the EcRRXRα heterodimer does not form. Therefore the presence of 20OHEc stabilizes the ecdysone heterodimer and enhances its affinity for ecdysone DNA HREs (Yao et al ., 1993).

Vitamin A

In the late 1800s purified dietary experiments using mice models linked nutrition to proper animal growth and development. Hopkins (1912) described feeding experiments where rat growth was impaired when fed a synthetic diet of pure proteins, carbohydrates, fats and salts and restored when supplemented with milk. It was 14 determined that ‘accessory factors’ present in food was essential for proper health, especially in rickets and scurvy experiments. Casimir Funk (1912) believed these factors were chemical amines and dubbed the term “vital amines”, or simply “vitamines”

(reviewed in Rosenfeld, 1997). McCollum and Davis (1913) identified the sought after accessory factor from butter as “fatsoluble A”, later designated as “vitamine A”.

Vitamin A derived from animals exists as the alcohol, retinol, and belongs to the class of chemical compounds called the retinoids.

The Retinoids

The retinoids are generally distinguished by their three structural domains: a β ionone ring, a polyene chain and a polar end group. After dietary intake, retinol may be oxidized to higher states either as an aldehyde (retinal) or an acid (retinoic acid), or simply be reduced to an ester (retinyl ester). Numerous isomers of retinol, retinal and retinoic acid exist as a result of cis and trans configurations of the polyene chain.

The retinoids present in the body are dietarily derived from animal and plant origin. Animal products such as milk and eggs are a source of retinyl esters and other preformed retinoids whereas plant products such as carrots and spinach are a source of provitamin A carotenoids such as βcarotene. Although central cleavage of the carotenes is a direct route to retinal production, evidence exists for excentric cleavage producing various βapo carotenals, retinal and RA (Wang et al ., 1991). Retinal binds to the cellular retinolbinding protein type II (CRBP II) and is reduced to retinol by the intestinal microsomal enzyme, retinal reductase (Kakkad and Ong, 1988). While bound to CRBP II, retinol undergoes intestinal esterification by the enzyme lecithin:retinol 15 acyltransferase and is packaged in nascent chylomicrons (MacDonald and Ong, 1988).

The chylomicrons are secreted into the lymphatic system and eventually taken up by the liver. Retinyl esters stored in the liver represent the majority of retinoids in the body and are readily distributed to peripheral tissues where they are converted to active biological forms.

The metabolic pathway describing retinoic acid synthesis from retinol is a two step oxidative process. The oxidation of retinol to retinal is the ratelimiting step in retinoic acid synthesis. In humans it is catalyzed by a zincdepended alcohol dehydrogenase (ADH) in the presence of NAD (Kedishvili et al ., 1995). This step is reversible and is catalyzed by ADH and a shortchain dehydrogenase/reductase (Chai et al ., 1995a, 1995b). The oxidation of retinal to retinoic acid is an irreversible step catalyzed by the liver aldehyde dehydrogenase (ALDH) (Futterman, 1962).

9-cis -Retinoic Acid

Retinoic acids can move through the cell membrane and signal developmental changes or can be modified, which affects the signaling specificity. Chief amongst these are the monocis retinoids isomers. Of these, 9cis RA (Fig. 1.2) activates RAR and

RXR nuclear receptors, but curiously, little is known regarding its enzymatic biosynthesis. This is in contrast to the retinoic acids associated with the visual cycle where the enzymes involved in isomerization between 11cis RA and alltrans RA are known. Three pathways have been proposed for 9cis RA biosynthesis but these are supported only by in vitro evidence: (1) Using bovine liver membrane preparations, direct isomerization of alltrans RA to 9cis RA, 13cis RA and 9,13Dicis RA relies on 16 the presence of sulfhydryl groups rather than an enzymatic reaction (Urbach and Rando,

1994). (2) Dietary sources of 9cis βcarotene were suggested as 9cis RA precursors but paradoxically rats maintained on a carotenoidfree diet remained healthy, and therefore must have an alternative pathway (Hebuterne et al ., 1995). (3) A ratderived

ALDH was shown to convert exogenous 9cis retinal to 9cis RA suggesting that biosynthesis may begin with 9cis retinol (Labrecque et al ., 1993). Furthermore, the identification of the 11cis retinol dehydrogenase (11cis RoDH) was shown to specifically oxidize 9cis , 11cis and 13cis retinols (and not trans retinols) to respective retinoic acids (Driessen et al ., 1998). Again, however, mice without this activity (11cis RoDH /) developed normally indicating that 11cis RoDH was not essential for 9cis RA biosynthesis (Driessen et al ., 2000).

Research Objectives

In Orthopteran and Dipteran insect orders, molting is initiated by 20OHEc and mediated by ecdysone receptor, the heterodimer of EcR and USP. In the more evolutionarilyprimitive insect L. migratoria , the USP homologue bears greater sequence similarity to the LBD of the human RXR (Hayward et al ., 1999). Furthermore, in silico modeling indicated that LmRXR favours the tertiary structure of the human RXR

(Hayward et al ., 2003). Locusta developmental studies demonstrate the constitutive presence of LmRXR transcripts, even in the absence of LmEcR transcripts, suggesting a distinct additional function for RXR during embryogenesis (Hayward et al ., 2003).

The objective of this thesis, therefore, was to determine if L. migratoria is capable of retinoid signaling through its nuclear receptors LmRXRL and LmRXRS. More 17 specifically, it is hypothesized that the LmRXR isoforms could be detected during embryogenesis and shown to bind a putative ligand, 9cis RA, with high affinity as has been demonstrated in vertebrate RXR models. Furthermore, RA signaling during embryogenesis would likely be only of physiological relevance should the presence of an endogenous retinoid be detected during this period of development. If the objectives are met, L. migratoria would likely represent a class of invertebrates that are developmentally dependent on RA signaling. In perspective, RA’s morphogenic role would not be a chordateexclusive innovation, rather the vertebrate mechanisms of RA developmental signaling would merely reflect an evolutionary acquisition from the invertebrates.

Literature Cited

AbuHakima, R., Davey, K.G. 1977. The action of juvenile hormone on the follicle cells of Rhodnius prolixus : The importance of volume changes. J. Exp. Biol. 69: 3344.

Applebaum, S.W., Heifetz, Y. 1999. Densitydependent physiological phase in insects. Annu. Rev. Entomol. 44: 317341.

Bede, J.C., Teal, P.E.A., Goodman, W.G., Tobe, S.S. 2001. Biosynthetic pathway of insect juvenile hormone III in cell suspension cultures of the sedge Cyperus iria . Plant Physiol. 127: 584593.

Bergot, B.J., Jamieson, G.C., Ratcliff, M.A., Schooley, D.A. 1980. JH zero: New naturally occurring insect juvenile hormone from developing embryos of the tobacco hornworm. Science 17: 336338.

Bergot, B.J., Schooley, D.A., de Kort, C.A.D. 1981. Identification of JH III as the principal juvenile hormone in Locusta migratoria . Experientia 37: 909910.

Bhaskaran, G., Sparagana, S.P., Barrera, P., Dahm, K.H. 1986. Change in corpus allatum function during metamorphosis of the tobacco hornworm Manduca sexta : Regulation at the terminal step in juvenile hormone biosynthesis. Arch. Insect Biochem. Physiol. 3: 321–338.

Braun, R.P., Wyatt, G.R. 1996. Sequence of the hexameric juvenile hormonebinding protein from the hemolymph of Locusta migratoria . J. Biol. Chem. 271: 3175631762.

Chai, X., Boerman, M.H.E.M., Zhai, Y., Napoli, J.L. 1995a. Cloning of a cDNA for liver microsomal retinol dehydrogenase. J. Biol. Chem. 270: 39003904.

Chai, X., Zhai, Y., Popescu, G., Napoli, J.L. 1995b. Cloning of a cDNA for a second retinol dehydrogenase type II. J. Biol. Chem. 270: 2840828412.

Chambon, P.A. 1996. Decade of molecular biology of retinoic acid receptors. FASEB J. 10: 940–954.

Clark, A.J., Bloch, K. 1959. The absence of sterol synthesis in insects. J. Biol. Chem. 234: 2578–2582.

Cusson, M., Yagi, K.J., Ding, Q., Duve, H., Thorpe, A., McNeil, J.N., Tobe, S.S. 1991. Biosynthesis and release of juvenile hormone and its precursors in insects and crustaceans: The search for a unifying Arthropod endocrinology. Insect Biochem. 21: 1– 6.

Department of Agriculture, Fisheries and Forestry: Australian Plague Locust Commission (2007) Migratory Locust [OnLine Brochure] AU; Available: http://www.daff.gov.au/aplc.

Despland, E., Collett, M., Simpson, S.J. 2000. Smallscale processes in desert locust swarm formation: how vegetation patterns influence gregarization. Oikos 88: 652662.

Dhadialla, T.S., Cook, K.E., Wyatt, G.R. 1987. Vitellogenin mRNA in locust fat body: Coordinate induction of two genes by a juvenile hormone analog. Dev. Biol. 123: 108 114.

Driessen, C.A.G.G., Winkens, H. J., Kuhlmann, E. D., Janssen, A.P.M., van Vugt, A. H. M., Deutman, A.F., Janssen, J.J.M. 1998. The visual cycle retinol dehydrogenase: possible involvement in the 9cis retinoic acid pathway. FEBS Lett. 428: 135–140.

Driessen, C.A.G.G., Winkens, H.J., Hoffmann, K., Kuhlmann, L.D., Janssen, B.P., Van Vugt, A.H., Van Hooser, J.P., Wieringa, B.E., Deutman, A.F., Palczewski, K., Ruether, K., Janssen, J.J. 2000. Disruption of the 11cis retinol dehydrogenase gene leads to accumulation of cis retinols and cis retinyl esters. Mol. Cell. Biol. 20: 42754287.

Futterman, S. 1962. Enzymatic oxidation of vitamin A aldehyde to vitamin A acid. J. Biol. Chem. 237: 677680.

Gadot, M., Goldman, A., Cojocaru, M., Applebaum, S.W. 1987. The intrinsic synthesis of juvenile hormoneIII diol by locust corpora allata in vitro . Mol. Cell. Endocrinol. 49: 99–107.

GuiochonMantel, A., Delabre, K., Lescop, P., MilgromE. 1994. Nuclear localization signals also mediate the outward movement of proteins from the nucleus. Proc. Natl. Acad. Sci. U.S.A. 91: 7179–7183.

Hammock, B. D. (1985) in Comprehensive Insect Physiology, Biochemistry, and Pharmacology (Kerkut. G. A.. and Gilbert. L. I., eds) DD. 431472. Pereamon Press, Oxford.

Hayward, D.C., Bastiani, M.J., Trueman, J.W., Truman, J.W., Riddiford, L.M., Ball, E.E. 1999. The sequence of Locusta RXR, homologous to Drosophila Ultraspiracle, and its evolutionary implications. Dev. Genes Evol. 209: 564571.

Hayward, D.C., Dhadialla, T.S., Zhou, S., Kuiper, M.J., Ball, E.E., Wyatt, G.R., Walker, V.K. 2003. Ligand specificity and developmental expression of RXR and ecdysone receptor in the migratory locust. J. Insect Physiol. 49: 11351144.

Hebuterne, X., Wang, X.D., Johnson, E.J., Krinsky, N.I., Russell, R.M. 1995. Intestinal absorption and metabolism of 9cis betacarotene in vivo : biosynthesis of 9cis retinoic acid. J. Lipid Res. 36: 12641273. 20

Hopkins, F.G. 1912. Feeding experiments illustrating the importance of accessory factors in normal dietaries. J. Physiol. 44: 425460.

HunterJones, P. 1964. Egg development in the Desert Locust ( Schistocerca gregaria Forsk.) in relation to the availability of water. Proc. R. Ent. Soc., Lond. A. 39: 2533.

Illenchuk, T.T., Davey, K.G. 1985. The binding of juvenile hormone to the membranes of follicle cells in the insect Rhodnius prolixus . Can. J. Biochem. Cell Biol. 63: 102106.

Kakkad, B.P., Ong, D.E. 1988. Reduction of retinaldehyde bound to cellular retinol binding protein (type II) by microsomes from rat small intestine. J. Biol. Chem. 263: 1291612919.

Kedishvili, N.Y., Bosron, W.F., Stone, C.L., Hurley, T.D., Peggs, C.F., Thomasson, H.R., Popov, K.M., Carr, L.G., Edenberg, H.J., Li, T.K. 1995. Expression and kinetic characterization of recombinant human stomach alcohol dehydrogenase. Activesite amino acid sequence explains substrate specificity compared with liver isozymes. J. Biol. Chem. 270: 36253630.

Kellogg, V.L. 1904. Influence of the primary reproduction organs on the secondary sexual characters. J. Exp. Zool. 1: 601605.

Klowden M.J. 2003. Contributions of insect research toward our understanding of neurosecretion. Arch. Insect Biochem Physiol 53: 101–114.

Koelle, M.R., Talbot, W.S., Segraves, W.A., Bender, M.T., Cherbas, P., Hogness, D.S. 1991. The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily. Cell 67: 59–77.

Koelle, M.R., Segraves, W.A., Hogness, D.S. 1992. DHR3: a Drosophila steroid receptor homolog. Proc. Natl. Acad. Sci. U.S.A. 89: 61676171.

Krust, A., Green, S., Argos, P., Kumar, V., Walter, P., Bornert, J.M., Chambon, P. 1986. The chicken oestrogen receptor sequence: homology with verbA and the human oestrogen and glucocorticoid receptors. EMBO J. 5: 891–897.

Labrecque, J., Bhat, P.V., Lacroix, A. 1993. Purification and partial characterization of a rat kidney aldehyde dehydrogenase that oxidizes retinal to retinoic acid. Biochem. Cell Biol. 71: 8589.

Laufer, H., Borst, D., Baker, F.C., Carrasco, C., Sinkus, M., Reuter, C.C., Tsai, L.W., Schooley, D.A. 1987. Identification of a juvenile hormonelike compound in a crustacean. Science 235: 202–205.

Locke, J., White, B.N., Wyatt, G.R. 1987. Cloning and 5' end nucleotide sequences of two juvenile hormoneinducible vitellogenin genes of the African migratory locust. DNA 6:331342.

Lomer, C.J., Bateman, R.P., Johnson, D.L., Langewald, J., Thomas, M. 2001. Biological control of locusts and grasshoppers. Ann. Rev. Entomol. 46: 667702.

MacDonald, P.N., Ong, D.E. 1988. A lecithin:retinol acyltransferase activity in human and rat liver. Biochem. Biophys. Res. Commun. 156: 157163.

Mangelsdorf, D.J., Thummel, C., Beato, M., Herrlich, P., Schiitz, G., Umesono, K., Blumberg, B., Kastner, P., Mark, M., Chambon, P., Evans, R.M. 1995. The nuclear receptor superfamily: The second decade. Cell 83: 835839.

McCollum, E.V., Davis, M. 1913. The Necessity of certain lipins in the diet during growth. J. Biol. Chem. 15: 167175.

Meyer, A.S., Schneiderman, H.A., Hanzmann, E., Ko, J.H. 1968. The two juvenile hormones from the Cecropia silk moth. Proc. Natl. Acad. Sci. U.S.A. 60: 853–860.

Nuclear Receptors Nomenclature Committee. 1999. A unified nomenclature system for the nuclear receptor superfamily [letter]. Cell 97: 161–163.

Oro, A.E., McKeown, M., Evans, R.M. 1990. Relationship between the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor. Nature 347: 298– 301.

Peters, G.A., Khan, S.A. 1999. Estrogen receptor domains E and F: role in dimerization and interaction with coactivator RIP140. Mol. Endocrinol. 13: 286–296.

Richard, D.S., Applebaum, S.W., Sliter, T.J., Baker, F.C., Schooley, D.A., Reuter, C.C., Henrich, V.C., Gilbert, L.I. 1989. Juvenile hormone bisepoxide biosynthesis in vitro by the ring gland of Drosophila melanogaster : a putative juvenile hormone in the higher Diptera. Proc. Natl. Acad. Sci. U.S.A. 86: 14211425.

Riddiford, L.M. 1996. Juvenile hormone: the status of its "status quo" action. Arch. Insect Biochem. Physiol. 32: 271286.

Roffey, J. 1965. Locust surveys. In Final Report of the Operational Research Team of the United Nations Special Fund Desert Locust Project. FAO Progress Report 1: 150205, 283285.

Roffey, J. Magor, J.I. 2003. Desert locust population dynamics parameters. Desert locust technical series. Rome: Food and Agriculture organization (FAO) of the United Nations, 135 pp.

Röller, H., Dahm, K.H., Sweely, C.C., Trost, B.M. 1967. The structure of the juvenile hormones. Angew. Chem. Internal. 6: 179180.

Rosenfeld, L. 1997. Vitamine—vitamin. The early years of discovery. Clin. Chem. 43: 680685.

Scharrer, B., Scharrer, E. 1944. Neurosecretion. IV. Comparison between the intercerebraliscardiacumallatum system of the insects and the hypothalamo hypophyseal system of the vertebrates. Biol. Bull. 87: 242–251.

Sevala, V.L., Davey, K.G. 1993. Juvenile hormone dependent phosphorylation of a 100 kDa polypeptide is mediated by protein kinase C in the follicle cells of Rhodnius prolixus . Invert. Reprod. Dev. 23: 189193.

Simpson, S.J., McCaffery, A.R., Hägele, B.F. 1999. A behavioural analysis of phase change in the desert locust. Biol. Rev. 74: 461480.

Stay, B., Zhang, J.R., Tobe, S.S. 2002. Methyl farnesoate and juvenile hormone production in embryos of Diploptera punctata in relation to innervation of corpora allata and their sensitivity to allatostatin. Peptides 23:19811990.

Stermer, B.A., Bianchini, G.M., Korth, K.L. 1994. Regulation of HMGCoA reductase activity in plants. J. Lipid Res. 35: 11331140.

Talbot, W.S., Swyryd, E.A., Hogness, D.S. 1993. Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell 73: 13231337.

Thomas, H.E., Stunnenberg, H.G., Stewart, A.F. 1993. Heterodimerization of the Drosophila ecdysone receptor with retinoid X receptor and ultraspiracle. Nature 362: 471–475.

Toong, Y.C., Schooley, D.A., Baker, F.C. 1988. Isolation of insect juvenile hormone III from a plant. Nature 333: 170–171.

Urbach, J., Rando, R.R. 1994. Isomerization of alltrans retinoic acid to 9cis retinoic acid. Biochem. J. 299: 459–465.

Waloff, Z. 1966. The upsurges and recessions of the Desert Locust plague: an historical survey. AntiLocust Mem. 8: 111

Wang, X.D., Tang, G.W., Fox, J. G., Krinsky, N. I., Russell, R.M. 1991. Enzymatic conversion of βcarotene to βapo carotenals and retinoids by humans, monkey, ferret, and rat tissues. Arch. Biochem. Biophys. 285: 816.

Wigglesworth, V.B. 1940. The determination of characters at metamorphosis in Rhodnius prolixus (Hemiptera). J. Exp. Biol. 17: 201222.

Wigglesworth, V.B. 1985. Historical Perspectives. In: Kerkut GA and Gilbert LI, Eds. Comprehensive Insect Physiology Biochemistry and Pharmacology vol 7 Endocrinology I. pp. 124. Pergamon Press Inc. Toronto.

Wyatt, G.R. 1997. Juvenile hormone in insect reproduction a paradox? Eur. J. Entomol. 94: 323333.

Yamamoto, K., Chadarevian, A., Pellegrini, M. 1988. Juvenile hormone action mediated in male accessory glands of Drosophila by calcium and kinase C. Science 239: 916919.

Yao, T.P., Segraves, W.A., Oro, A.E., McKeown, M., Evans, R.M. 1992. Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell 71: 63–72.

Yao, T.P., Forman, B.M., Jiang, Z., Cherbas, L., Chen, J.D., McKeown, M., Cherbas, P., Evans, R.M. 1993. Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 366: 476–497.

Zhang, J., McCracken, A., Wyatt, G.R. 1993. Properties and sequence of a female specific, juvenile hormoneinduced protein from locust hemolymph. J. Biol. Chem. 268: 32823288.

Zhang, J., Wyatt, G.R. 1996. Cloning and upstream sequence of a juvenile hormone– regulated gene from the migratory locust. Gene 175:193–197.

Zhou, S., Zhang, J., Fam, M.D., Wyatt G.R., Walker V.K. 2002. Sequences of elongation factors1α and 1γ and stimulation by juvenile hormone in Locusta migratoria . Insect Biochem. Mol. Biol. 32:156776. 24

Fig. 1.1. The life cycle of the African migratory locust, Locusta migratoria , consists of three main stages: egg, nymph and adult (modified from the Department of Agriculture,

Fisheries and Forestry: Australian Plague Locust Commission, 2007). 25 26

Table 1.1. Chemical structures of polyunsaturated fatty acid, juvenoids, juvenoid analogues and retinoids. 27

Name Chemical Structure Docosahexaenoic acid O

H3C OH

CH3 CH3 Juvenile hormone I CH3 O

CH3 H3C O O

CH3 Juvenile hormone II CH3 CH3 O

CH3 H3C O O

Juvenile hormone III CH3 CH3 CH3 O CH3 H3C O O

Juvenile hormone III CH3 CH3 CH3 O CH3 bis epoxide H3C O O O

CH3 Methoprene O CH3 CH3 O CH3

H3C O CH3 CH3

CH3 Methoprene acid O CH3 CH3 O

H3C OH CH3

CH CH Retinol H3C CH3 3 3 OH

CH3

CH CH O Retinal H3C CH3 3 3 H

CH3

CH CH O alltrans Retinoic acid H3C CH3 3 3 OH

CH3

CH 9cis Retinoic acid H3C CH3 3

CH3

H3C

O OH 28

CHAPTER 2: Locust retinoid X receptors: 9-cis -retinoic acid in embryos from a primitive insect

Shaun M. Nowickyj*, James V. Chithalen†, Don Cameron†, Michael G. Tyshenko*,

Martin Petkovich†‡, Gerard R. Wyatt*, Glenville Jones†§, and Virginia K. Walker*¶

Departments of Biology*, Biochemistry†, Pathology‡ and Medicine§, Queen’s

University, Kingston, ON, K7L 3N6, Canada

Abstract

The retinoid X receptor (RXR) participates in a multitude of nuclear signaling pathways and is activated by its often elusive cognate ligand, 9cis retinoic acid (9cis RA). In flies and moths, molting is mediated by the ecdysone receptor that is a heterodimer comprising the ecdysone receptor monomer (EcR) and the invertebrate RXR homolog, ultraspiracle (USP); the latter is believed to have diverged from its RXR origin. In the evolutionarily more primitive insect, Locusta migratoria (Lm), long and short RXR isoforms appear to be more similar to human RXRs than to the receptors from these betterstudied insects. In addition, RXR was immunologically detected in early locust embryos when EcR transcripts are absent. Since this suggests another role for the receptors apart from ecdysone signaling, recombinantly produced locust RXRs were purified and shown to competitively bind 9cis RA and alltrans RA with high affinity

8 (IC 50 = 6 13 x 10 M), similar to human RXR. To determine if specific binding had functional significance, the presence of endogenous retinoids at this stage was assessed. 29

Embryos were extracted using modified Bligh and Dyer and solid phase protocols to avoid the oily precipitate that initially made this material unsuitable for retinoid assay.

These extracts contained retinoids (5.4 nM) as assessed by a RAinducible Cyp26A1 promoter luciferase reporter cell line. Furthermore, HPLC/MS confirmed the presence of retinoids and identified for the first time in any organism, 9cis RA, in addition to all trans RA. We estimate that embryos contain 9cis RA at a concentration of 1.6 nM.

These findings strongly argue for a functional role for retinoids in primitive insects and favour a model where signaling through the binding of 9cis RA to its RXR receptor is established relatively early in evolution and in embryonic development.

Introduction

Insect development and metamorphosis are directed by two principal lipophilic hormones: 20hydroxyecdysone (20OHEc), the active molting hormone, and juvenile hormone (JH), whose titre determines the nature of the molt (1, 2). As demonstrated in the fruitfly, Drosophila melanogaster (Dm), 20OHEc binds to the ecdysone receptor

(EcR), which in turn is bound to its obligate heterodimerization partner ultraspiracle

(USP), a homologue of the vertebrate retinoid X receptor (RXR) (36). As members of the nuclear receptor superfamily, EcR and USP/RXR share a common modular structure

(7) comprised of a Nterminal variable domain (A/B), a DNA binding domain (C), hinge

(D), and Cterminal ligandbinding domain (LBD; or domain E/F).

The vertebrate RXRs are known heterodimeric partners of several members of the nuclear receptor superfamily, including the retinoid, thyroid and vitamin D receptors (8).

As demonstrated in vivo , these RXRs can also form homodimers and conceivably mediate an independent retinoid signaling pathway (9, 10). Indeed, the vertebrate RXRs are known ligandactivated transcription factors that bind 9cisRA, a stereoisomer of the vitamin A derivative, alltrans RA (11, 12). In contrast, the retinoic acid receptors

(RARs), reported only in vertebrates, bind both alltrans RA and 9cis RA with high affinity (13, 6). In contrast to the vertebrate RXRs, crystal structures reveal that DmUSP and the USP from the moth Heliothis virescens , probably adopt an inactive conformation

(14, 15) and are unlikely to have an activating ligand. Nevertheless, Jones et al . (16) have suggested that USP could be a JH receptor since it binds methyl farnesoate, an unepoxidated derivative of JH III (K d = 44 nM) and JH to a lesser extent (K d = 6.7 M). 31

A high affinity JH receptor, Met (K d = 5.3 nM) has been recently identified in D. melanogaster (17).

Remarkably, the LBD of the protein corresponding to USP from the primitive insect, Locusta migratoria (Lm), shows greater identity to the vertebrate RXR than to

USPs of more advanced insects (18). In silico modeling of the LmRXR ligand binding pocket also emphasizes amino acid and tertiary structural similarity to the human RXRγ

(hRXRγ) (19). In L. migratoria and the German cockroach, Blattella germanica , RXR transcripts have been detected during early embryonic development, even before the appearance of EcR transcripts (19, 20). Thus at least in these two insects it is possible that this EcR binding partner could have a second function. To explore this possibility, two RXR cDNAs were isolated from Locusta . Long and Short isoforms (LmRXRL and

LmRXRS, respectively) differ by the presence/absence of 22 amino acids in their LBDs.

Results

Recombinant LmRXRS was expressed using the T5 promoter in pQE32 after transfer to E. coli M15[pREP4] cells. Under similar conditions, LmRXRL expression was disappointing (results not shown). Therefore the hinge and ligand binding domains of LmRXRL were subcloned into pET15b and expressed in BL21(DE3) cells using the

T7 lac promoter. The humanderived sequence, hRXRα(DE), was similarly recombinantly expressed. These expressed proteins are subsequently referred to as LmRXRL and hRXRα. Typically, the purification protocol (a total of 10 purifications were done for the long and short isoforms) yielded approximately 0.8 mg/mL LmRXRS and 1.7 mg/mL

LmRXRL protein (Fig. 2.1A and B; lanes 7 and 8). Expression and purification of 32 hRXRα normally yielded 1.0 mg/mL. These preparations were used for assays and antibody production.

Polyclonal antibodies made against purified hRXRα and LmRXRL were used for immunological detection by western blotting (Fig. 2.1C). The high similarity between the expressed human and locust RXR LBDs is demonstrated by the observation that the antihRXRα antibody crossreacted with purified LmRXRL (Fig. 2.1C; lane 1) and anti

LmRXRL antibody crossreacted with the purified hRXRα (Fig. 2.1D; lane 2). Western blots further demonstrated the presence of crossreacting material to the antiLmRXRL in whole embryo extracts (Fig. 2.1E).

Ligand Binding Assays

When recombinant LmRXRS, LmRXRL and hRXRα were incubated with [ 3H]

9cis RA, there was evidence of binding (Fig. 2.2). Competition with unlabeled 9cis RA showed that for all three protein preparations, binding was specific and was very similar.

8 The IC 50 for 9cis RA by hRXRα was 7.4 x 10 M, in agreement with a previous

8 published value (5.6 nM) (21). LmRXRS showed twice the affinity (IC 50 = 6.1 x 10

M) for 9cis RA than did LmRXRL (Table 2.1). When the unlabeled stereoisomer, all trans RA was used to displace [ 3H]9cis RA, LmRXRS again showed twice the affinity

8 (IC 50 = 7.51 x 10 M) for the retinoid compared to LmRXRL, but both retinoids had similar overall competition curves (Fig. 2.2A and B; Table 2.1).

Competition binding assays with other potential ligands showed lower affinity for the proteins. The affinities of the polyunsaturated fatty acid, docosahexaenoic acid

(DHA), and the juvenile hormone analogue, methoprene acid, were 2 and 3 orders of 33 magnitude lower, respectively, than 9cis RA for LmRXRS (Fig. 2.2C and D; Table

2.1). The two nonretinoids were also not as effective competitors for 9cis RA binding to LmRXRL. Overall, the IC 50 for DHA was similar for both RXR isoforms but the IC 50 of methoprene acid for LmRXRS was 30% that of LmRXRL.

Retinoids in Locust Embryos

The analysis of early locust embryos was difficult due to the presence of yolk and a tough chorion or egg shell. A procedure was developed in several initial trials by

‘spiking’ extracts with 500 ng 9cis RA and radiolabeled [ 3H]9cis RA. Many extraction methods using ethyl acetate and hexane as well as numerous solid phase extractions were also tried. Finally a modified Bligh and Dyer (22) procedure combined with tandem solid phase extraction was selected since it resulted in 42.6 ± 9.9 % (N = 3) recovery of the added [ 3H]9cis RA label (not shown). Embryos were extracted twice to optimize retinoid recovery and avoid the problem of precipitation of a brown viscous oil from the embryos during evaporation.

Retinoid reporter cells were used to detect the presence of endogenous retinoids in

Locusta embryo homogenates and extract preparations (23). These cells proved sensitive to very low concentrations (10 10 M) of alltrans RA and alltrans RA/9cis RA suspensions, resulting in luciferase reporter activity that was 2.5fold and 2.2fold greater than control DMSO treatments (Fig. 2.3). Dilutions of locust embryo homogenates (1:10 dilution) did not induce a significant reporter response. However, preparations of embryo extracts (see Methods) resulted in significantly greater reporter activity (2.5fold) than

DMSO control treatments (P<0.05). Concentration determination using standard curves 34 generated by a range of 9cis RA and alltrans RA diluted in 100% DMSO, indicated the presence of retinoids in embryonic tissue at a concentration of 1.6 ng/g (N = 4) or ~ 5.4 nM.

Since in vitro experiments indicated the presence of retinoids in Locusta embryos,

HPLCMS was employed to identify the specific RAs in embryo extracts. Monitoring the eluant from HPLC at 350 nm did not resolve a significant retinoid peak relative to control protein samples (Fig. 2.3; Top). However, MRM 299 255 chromatographs of the Locusta extract preparations showed a dominant peak with retention times of 32.8 min and a consistent secondary peak at 33.4 min. The peaks correspond to the exact retention times of 9cis RA and alltrans RA, respectively (Fig. 2.3; Bottom). These experiments were repeated several times with isomer standards. The locust extract (3 g) preparation yielded 1.17 ± 0.27 ng (N = 3) of total retinoid. Diluted locust extracts (1.5 g and 1.5 g BSA) yielded similar peaks and retention times (32.8 and 33.3 min, respectively) but approximately half the mass (0.64 ± 0.17 ng; N = 3; not shown).

Retinoid peaks were not seen when no embryo extracts or 3 g BSA were chromatographed. Furthermore, blank runs of samples involving a single isomer did not result in the isomerization of one isomer into the other suggesting that 9cis RA is not a methodological artifact. Thus both 9cis RA and alltrans RA were present in embryos.

Integration of the area under the curves suggested that the majority (54.6 %) of the retinoid was 9cis RA. Using this method and based on total retinoid mass and embryo volume, a calculated 1.3 nM retinoid was detected. Analysis of radiolabelled 9cis RA in extracted samples indicated a recovery of 43% of 9cis RA; accordingly, there would be

~3 nM of identified total retinoid, including 1.6 nM of 9cis RA in Locusta embryos. 35

Discussion

Locust RXR Characterization

Recently, we described the cloning and initial characterization of two locust RXR isoforms (19) and noted that the LBDs showed greater identity to the vertebrate RXR

LBDs than to the USP receptors from moths and flies. Furthermore, RXR transcripts appeared to be present throughout embryogenesis, despite the absence of message for

EcR until midembryogenesis (19). This appeared curious since EcR is RXR’s supposed obligate heterodimerization partner in insects. Similarly, in the cockroach, RXRL transcripts are detected at the beginning of embryogenesis, prior to the initial ecdysteroid pulse and RXRS message appears later in midembryogenesis (20). Together, these observations suggested that RXR in locusts and possibly other primitive insects and arthropods might have an additional role during early development, similar to the function of vertebrate RXR, and in contrast to the orthologous USP of more advanced insect species.

Recombinant LmRXRL and human RXR were expressed and used to generate antibodies. Immunochemical assays showed that the sequence similarity of the locust and human proteins was also reflected in epitope determinants since there was strong antigenantibody crossreactivity with antisera derived from either insect or vertebrate proteins. These antibodies were used to detect crossreacting material in locust embryos during early embryogenesis (Fig. 2.1E and not shown), and indicated that RXR transcripts seen early in embryonic development (19) were translated and therefore of likely functional significance. In vertebrates, activated RXR (as opposed to 36 heterodimerized RXR), is important for neurological promotion in embryos (24, 25). Of the various forms of vertebrate RXRs, RXRα is thought to be of the greatest functional significance during mouse embryogenesis (26).

Ligand Binding and Retinoid Identification

In order to evaluate if Locusta RXR has a role similar to that of the vertebrate receptor during development, it was crucial to determine if it could bind ligand. Purified, recombinantlyexpressed locust RXRs competitively bound 9cis RA (IC 50 = 6.1 13 x

10 8 M) similar to the high affinity shown by human RXRα, in our assays and as previously published (Fig. 2.2A and not shown) (21). It is noteworthy that although

RXRs from vertebrates have been reported to bind 9cis RA (27, but see also 28, 29), the fly and moth USP proteins do not. The insect protein may function solely as a dimerization partner for EcR (6, 30). Unlike LmRXRL, a potential capping loop between helices 1 and 3 of LBD appears to be missing in LmRXRS, and this initially suggested that the small locust isoform might not bind ligand. However, both isoforms showed high affinity for 9cis RA. Among invertebrates, only the RXRs from the jellyfish, Tripedalia cystophora , and the sea snail, Biomphalaria glabrata , have been previously shown to bind this ligand (31, 32). Thus the binding of LmRXR to a ligand,

9cis RA, is the first report in terrestrial invertebrates.

In chordates, the active vitamin A metabolite, alltran sRA binds the chordate exclusive retinoic acid receptors (RARs). The D. melanogaster genome does not contain an RAR gene (33) and no RAR has been identified in any invertebrate. Indeed, phylogenetic analysis compellingly argues that RARs evolved from duplication events 37 that took place at the origins of vertebrates (34). Nevertheless, both LmRXRL and –S bind alltrans RA with high affinity, indicating a role for the receptors in transducing the signal of both retinoid isomers and suggesting that alltrans RA as well as 9cis RA could act as morphogens in these primitive insects.

Another potential ligand, the polyunsaturated fatty acid, DHA has been detected in the mouse brain and activates mammalian RXRα with micromolar affinity (35, 36).

Similarly, DHA bound competitively to both LmRXRS and –L isoforms at a low affinity compared to the retinoids. As well, the JH analogue, methoprene acid, binds to the locust

RXRs with approximately the same low affinity as it does to hRXRα (Fig. 2.2) (37).

Thus, it appears that locust RXRs are retinoidspecific receptors.

To determine if RAs were present in locust embryos at a time when RXR transcripts were detected, retinoid sensitive reporter cells (23) were employed. When whole locust embryo homogenates were incubated with these cells no significant reporter activity was detected. As well, the addition of homogenates to known concentrations of retinoids lowered the apparent reporter activity (results not shown), suggesting that locust homogenates interfered with the cell line assay. Therefore, efforts were made to extract retinoids from the early embryos.

Although procedures for the extraction of retinoid isomers have been previously described for many vertebrate embryo types and tissues including mouse (38), Xenopus

(39) and chicken (40), Locusta embryo extracts presented additional challenges. The main difficulty was the presence of a viscous brown oil, presumably derived from the yolk, which readily precipitated as reported previously for eggs of another locust,

Schistocerca gregaria (41). Notably, these authors reported the presence of the thick oil 38 prevented analysis by HPLC. We were able to circumvent this problem by performing a second, solid phase extraction followed by tandem mass spectroscopy. Even with a limited amount of insect tissue for extraction, the addition of the preparation to the mouse cells bearing two synergistic endogenous retinoic acid response elements (RAREs) (23) was positive; the Cyp26A1promoter induced luciferase activity indicated the presence of retinoids. Since this particular cell line is responsive to both 9cis RA and alltrans RA

(Fig. 2.3), these experiments indicated that locust embryos have levels of retinoids (1.6 ng/g) similar to those reported in mouse serum (0.71.08 ng/ml) (42). However, this first unambiguous determination of 9cis RA in any embryonic sample could only be accomplished using highly sensitive LCMS/MS in the MRM mode.

Previously, alltrans RA, as well as its precursor, alltrans retinol, has been identified in several vertebrate tissues and embryos ( e.g. 38, 4346). There have also been several reports that there are insignificant levels of 9cis RA in these same species

(47, 48). Indeed, some have suggested that 9cis RA is not the endogenous ligand for

RXR (27, 28). However, Luria and Furlow (25) argued that 9cis RA was a ‘logical candidate’ for the RXR ligand but that DHA could also be the important morphogen in

Xenopus . Here we show that DHA does not bind with such high affinity as 9cis RA to locust RXR, and that 9cis RA is present, and represents approximately 55% of the retinoids in the locust embryo. We do not know if there is compartmentalization of the

RAs, and at this stage approximately half the length of the egg is still filled with yolk.

Nevertheless, the presence of retinoids at locust midembryogenesis coincides with a period of rapid growth just prior to dorsal closure and the production of 20OHEc and

JH by developing prothoracic glands and corpora allata , respectively (49, 50). 39

Although the role of 9cis RA in vertebrates remains unclear, the significance of this isomer as an important signaling molecule in invertebrates is better established. 9 cis RA has been detected in adults of the cephalochordate, amphioxus, Branchiostoma floridae (51), as well as the limb blastemas of an arthropod, the crab, Uca pugilator (52).

Furthermore, 9cis RA acts as a potent morphogen in the gastropod, Thais clavigera , where exogenous 9cis RA induced male genital tracts in females (53). In insects, exogenous alltrans RA inhibits metamorphosis and arrests embryogenesis (54).

Therefore, our identification of 9cis RA in Locusta embryos, the first in an invertebrate, argues strongly that RXR and this natural ligand are also active morphogens in primitive insect embryogenesis. Thus, locusts may be a good system to investigate the mode of synthesis of this retinoid, which is still not clear (Table 2.2) (55). We further speculate that similar to the function of alltrans RA in vertebrate anteriorposterior patterning mechanisms, 9cis RA may also have a role in early mesoderm patterning in invertebrates along with a primitive signaling pathway. Therefore, locust RXR may not merely serve as a silent partner with EcR as does the USP of flies and moths, but it has a major role in early embryonic development. Indeed, this role is likely ancestral and conserved (55, 56) in invertebrates, but may have been partially usurped by the loss of retinoid binding by the USPs of the more advanced insects and the evolution of RARs in vertebrates (Table 2.2).

Materials and Methods

Animals

African migratory locusts, Locusta migratoria migratorioides , were reared under gregarious colony conditions, which are standard for our experiments (57).

Reproductively mature female locusts oviposited into plastic cups lightly packed with wet sand. Cups were replaced daily and embryos kept at 31ºC where 1 st instar larvae emerged on day 14. Embryos were recovered from egg pods in the sand cups at day 5 and stored at 80 oC.

Plasmids

The full length isoform LmRXRL (GenBank accession number AY348873) was subcloned to generate the LBD (domain DE) for recombinant expression and functional studies. LmRXRL (corresponding to residues Met185 to Ser1337) was PCRamplified with the forward primer 5’CGCCATATG ACAAGCAGCCTGCATACAGAC3’ and the reverse primer 5’ CGCTCAGC TTATGAATCAGAAGGTGATTCAAGCA3’

(underlining indicates restriction sites Nde 1 and Bpu1102 1 , respectively) in 1X PCR buffer (10 mM TrisHCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl 2, 0.001% (w/v) gelatin) under the following conditions: 94 oC for 5 min, then 94 oC for 1 min, 65 oC for 45 sec,

72 oC for 45 sec for 31 cycles with a final extension at 72 oC for 8 min, then 4 oC.

The amplified fragment was electrophoresed on a 1% (w/v) agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Mississauga, ON, Canada) according to the manufacturer’s protocol and then ligated to 10 ng linearized pCR2.1

TOPO plasmid (Invitrogen Canada Inc., Burlington, Ontario, Canada). Ligation 41 proceeded by incubating insert and vector for 5 min at 22°C. A portion of the ligation reaction (2 l) was gently mixed with TOP10 F′ One Shot competent E. coli cells

(Invitrogen) and incubated on ice for 30 min. The cells were heatshocked for 30 sec at

42°C, briefly placed on ice and 250 l S.O.C. (Invitrogen) medium was added at 22 oC.

After shaking for 1 h at 37°C, the cells were spread on LB plates containing kanamycin

(50 g/mL) and treated with isopropyl1thioβDgalactopyranoside (IPTG) and Xgal for bluewhite colour selection, according to established protocols. Transformed, white colonies were recovered, replated on kanamycin LB plates and plasmid DNA was isolated using the QIAprep Miniprep Kit as described.

Digestion with the restriction enzymes Nde1 and Bpu1102 1 and subsequent gel purification allowed the sequence corresponding to the DE domain to be ligated into pET15b, and used to transform BL21(DE3) competent cells as previously described except that colonies were grown on LB media supplemented with ampicillin (100

g/mL). The resulting LmRXRL(DE) construct was sequenced twice in both directions to ensure veracity.

LmRXRS (GenBank: AF136372) has been previously described (19). Both constructs were designed to produce recombinant locust proteins bearing 6 His residues on the aminoterminal end. The human RXR, hRXRα(DE) (GenBank: NM002957) also with His residues has been previously used for crystallographic studies (a generous gift from Dr. P. Chambon, IGBMC, Université Louis Pasteur) (58). 42

Protein Expression and Purification

E. coli cells (BL21(DE3)) (Novagen, Mississaga, ON, Canada) for LmRXR

L(DE) and hRXRα(DE), as well as M15[pREP4] (Qiagen) for LmRXRL and LmRXR

o S) were grown (OD 600 of 0.8 at 37 C) and induced with IPTG to a final concentration of 1 mM and further incubated at 24ºC for 16 h. LmRXRL was also transformed into

M15[pREP4] cells. The cells were harvested by centrifugation (7,500 x g , 4ºC, for 20 min) and stored (80 oC). They were subsequently resuspended in lysis buffer (20 mM

Tris, 500 mM NaCl, pH 7.8, containing Mini, EDTAfree protease inhibitor cocktail tablets; Roche, Mannheim, Germany) and mechanically disrupted with a Branson sonicator for 25 sec with 1 min intermittent cooling on ice. Insoluble cellular debris was removed by centrifugation (15,000 x g, 4ºC, for 40 min). The clarified extract was incubated with Talon Metal Affinity Resin (BD Biosciences, Mountain View, CA, USA) and incubated at 4ºC for 1.5 h with gentle shaking to facilitate binding of Histagged proteins. After incubation, the resin was loaded into a column and washed once with wash buffer (20 mM Tris, 500 mM NaCl, pH 7.8), twice with wash buffer containing 20 mM imidazole and eluted twice with wash buffer containing 250 mM imidazole.

Purification was monitored by separating all fractions on a 12% SDSPAGE and staining with Coomassie Brilliant Blue R250. Protein concentration was determined using colorimetric detection and quantification (BCA Protein Assay Kit, Pierce, Rockford, IL,

USA). 43

Antibody Preparation

Recombinantly purified LmRXRL(DE) and hRXRαDE proteins were electrophoresed on separate 12% SDSPAGE gels. Bands corresponding to the recombinantlyexpressed proteins were excised and electroeluted for 4 h (100 mA

Model 422 ElectroEluter; BioRad, Mississauga, ON, Canada) in protein elution buffer

(25 mM Tris, 192 mM glycine, 0.1% (w/v) SDS). New Zealand White rabbits (2 kg) were separately immunized by subcutaneous injections with 100 g of recovered protein emulsified with Ribi adjuvant (Animal Care Services, Queen’s University). Booster injections were administered at 3 intervals and blood was collected by cardiac puncture.

Serum was obtained by allowing the blood to clot and subsequently centrifuged twice at

o o 3000 x g, for 10 min, at 4 C. Antisera were stored at 80 C with 0.02% (w/v) NaN 3.

Western Blotting

LmRXRL(DE) and hRXRαDE were purified as described and after electrophoresis (1 g) on 12% SDSPAGE gels were transferred to Polyvinylidene difluoride membranes (PVDF) (Millipore, Bedford, Mass., USA) overnight at 15 V and 4 oC. Membranes were prewashed in TBS (0.05 M Tris, 0.15 M NaCl, pH 7.5) and blocked for 1 h with 1% (w/v) nonfat skim milk powder in TBST (0.05 M Tris, 0.15 M

NaCl, pH 7.5, 0.1% (v/v) Tween20). Subsequently, gels were either incubated with the rabbit antiLmRXRL(DE) or the antihRXRαDE at 1:500 in TBST. After washing, the primary antibody was detected with a secondary goat antirabbit IgG conjugated to horseradish peroxidase (1:30,000 dilution; BioRad, Mississauga, Ontario, Canada) using the BM Chemiluminescence Blotting Substrate (POD) kit (Roche, Mannheim, Germany) 44 and subsequently visualized by exposure to Biomax MS film (Eastman Kodak Company,

Rochester, NY, USA).

Ligand-Binding Assay

Displacement binding experiments were performed according to Allegretto (59).

Briefly, LmRXRL(DE) and LmRXRS purified as described, were incubated in borosilicate glass tubes containing binding buffer (0.15 M KCl, 10 mM TrisHCl, pH 7.4,

8% (v/v) glycerol, and 0.5% (w/v) CHAPS detergent) with ~7.5 nM 3H9cis RA (1.44

TBq/mmol or 39.0 Ci/mmol; Amersham, Little Chalfont, UK) to a final volume of 300

L. Competitor ligands were dissolved in 100% (v/v) ethanol and added in increasing concentrations and incubated for 4 h at 4 oC. Competitors included 9cis RA (4.6 x 10 11

M to 5.0 x 10 5 M), alltrans RA (4.2 x 10 11 M to 4.2 x 10 5 M), methoprene acid (3.1 x

10 9 M to 3.1 x 10 4 M) and cis 4,7,10,13,16,19docosahexaenoic acid (DHA; 1.3 x 10 9 M to 1.3 x 10 3 M). Hydroxylapatite (HAP; BioRad Laboratories Inc., Mississauga, ON,

Canada) was used to separate bound from free ligand (60). 300 L of HAP slurry (0.1 mg/mL) was added to the binding reactions and incubated for 45 min on ice (with mixing every 5 min). The samples were then diluted with 0.9 mL of binding buffer and centrifuged at 857 x g for 5 min at 4 oC. The HAP pellet was washed three more times and transferred to a scintillation vial with 0.5 mL binding buffer and 4.5 mL of liquid scintillant (Amersham Canada Ltd., Oakville, ON, Canada). Each sample was counted

(Beckman LS6500 Liquid Scintillation counter) and the data were calculated using

GraphPad Prism 3.0 software.

Luciferase Assays

A P19 mouse embryomal carcinoma cell line was transfected with pGL3Basic

(Promega, Madison, WI, U.S.A.) containing a 2.6 Kb Cyp26A1 promoter sequence fused to a firefly luciferase reporter gene (35). The cells were seeded in 24well plates at a

o density of 30,000 cells/well and incubated for 24 h at 37 C in 5% CO 2. The cells were then washed with 1 mL 1 x PBS and treated with 0.5 mL MEM (pH 7.3, supplemented with 0.37% NaHCO 3, 10% FCS, 0.5% penicillinstreptomycin, 0.1% gentamicin, and

0.1% fungizone; Invitrogen Life Technologies, Carlsbad, CA, USA). The MEM was supplemented with DMSO; alltrans RA; a mixture of alltrans RA and 9cis RA; day5

Locusta embryo homogenates or extracts in amounts listed in Results. The cells were incubated for an additional 24 h, washed as before and lysed with 200 L of passive 1 x lysis buffer (Promega Corp., Nepean, Canada) for 20 min. Lysates were scraped from the bottom of the wells and 20 L samples were treated with luciferase reagents (Promega) and enzyme levels were determined immediately in a Berthold Luminometer. Data were analyzed using Student’s ttest.

Embryo Retinoid Extraction

All dissections, extractions and downstream analyses were performed under dim amber lighting and glassware was used in sample preparation and handling. Day 5 locust embryos were ground in homogenization buffer (PBS containing 100 M DPPD) for 2 min using a Rotor Stator homogenizer (KikaWerk, Germany). Embryo samples included

3 g embryos, 1.5 g embryos with 1.5 g BSA (bovine serum albumin), and 3 g BSA, all in triplicate; all samples were extracted according to a modified Bligh and Dyer (22) 46 protocol. Homogenates were adjusted to pH 9.5 to partition the deprotonated retinoic acid to the aqueous phase, and nonpolar lipids to the organic phase. The homogenates were extracted with 2 x 5 mL 100% (v/v) MeOH, 2 x 5 mL dichloromethane and 5 mL saturated KCl and centrifuged at 1,000 x g, 4 ºC, for 15 min. The aqueous phase was removed with a Pasteur pipette and subsequently dried in a sample evaporator (37ºC) under a gentle stream of N 2 to reduce the content of organic solvent. Samples were resuspended in 1 mL 5% (v/v) MeOH, vortexed and subjected to a second solid phase extraction. For this, Waters Oasis HLB cartridges (6 mL) were washed with 6 mL 100%

MeOH and then 6 mL ddH 2O. Fractions were collected by vacuum filtration, washed once with 6 mL 5% (v/v) MeOH and eluted with 6 mL 100% (v/v) MeOH. Eluants were dried in a sample evaporator (37ºC) under a gentle stream of N 2, resuspended in 1 mL

100% (v/v) EtOH, dried again, and resuspended in 30 L 60% (v/v) acetonitrile. Sample standards (500 ng of alltrans RA and 500 ng 9cis RA) were dried under N 2 and resuspended in 30 L 60% (v/v) acetonitrile. Standards and samples were centrifuged for

15 min at 1,500 x g, 4ºC and transferred to glass vials with a polyspring insert for HPLC analysis. Concentrations were calculated using the formula weight of alltrans RA and

9cis RA (300.44 g/mol) and the embryonic volume of Locusta (0.01 mL).

High Pressure Liquid Chromatography (HPLC) and Mass Spectroscopy (MS)

HPLC/MS analysis of extracted locust embryos was performed as described by

Chithalen et al . (61). Briefly, reversephase HPLC separation of extracted samples was performed on a Waters 2695 separation module (Waters, Mississauga, Ontario, Canada) with a 996 photodiode array (monitoring at 350 nm) and a ZorbaxSB C 18 column 47

(Agilent, Santa Clara, CA, U.S.A.; 3.5 m, 150 x 2.1 mm) using a gradient solvent system of ddH 2Oacetonitrileglacial acetic acid (74.99:25:0.01 (v/v/v) to 0.99:99:0.1

(v/v/v) at a flow rate of 200 L/min for 35 min with final conditions held for 5 min).

Samples were further analyzed by the most sensitive LCMS/MS multiple reaction monitoring (MRM) system available to us. A Micromass Quattro Ultima (Waters,

Milford, MA, U.S.A.) mass spectrometer (equipped with a ZSpray electrospray interface in the negative mode set with a capillary voltage of 3.70 kV and a cone voltage of 55 V) was used. The source and desolvation temperatures were maintained at 80 ºC and 350 ºC respectively and the cone and desolvation gases were kept at 50 L/h and 562 L/h, respectively. Argon, used as the collision gas, was maintained in the chamber at

1.6 x 10 3 mBar with a collision energy of 14 V. MRM was used to observe the transition of m/z 299255. The areas under the curves were calculated for chromatogram and averaged. Standards (including radiolabeled 9cis RA, as well as alltrans RA) were analyzed both before and after each of the analyses to ensure there was no drift in retention times and no isomerization of the retinoids.

Acknowledgements

The majority of this work was supported by a NSERC (Canada) grant to V.K.W. We thank Drs. S. Zhou, D. Hayward and E. Ball for their encouragement. We also acknowledge operating and equipment maintenance grants MT9475 and SMFSA

260938 from CIHR to GJ. 48

Literature Cited

1. Riddiford LM, Cherbas P, Truman JW (2000) Ecdysone receptors and their biological actions. Vitam Horm 60:173.

2. Wyatt GR (1997) Juvenile hormone in insect reproduction a paradox? Eur J Entomol 94:323333.

3. Koelle MR, et al . (1991) The drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid receptor superfamily. Cell 67:5977.

4. Yao TP, Segraves WA, Oro AE, McKeown M, Evans RM (1992) Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell 71:6372.

5. Yao TP, et al . (1993) Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 366:476–479.

6. Oro AE, McKeown M, Evans RM (1990) Relationship between the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor. Nature 347:298–301.

7. Segraves WA (1994) Steroid receptors and other transcription factors in ecdysone response. Recent Prog Horm Res 49:167195.

8. Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM (1992) Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signaling. Nature 355:446–449.

9. Mangelsdorf DJ, et al . (1991) A direct repeat in the cellular retinolbinding protein type II gene confers differential regulation by RXR and RAR. Cell 66:555561.

10. Mader S, et al. (1993) The patterns of binding of RAR, RXR and TR homo and heterodimers to direct repeats are dictated by the binding specificities of the DNA binding domains. EMBO J 12:5029–5041.

11. Levin AA, et al . (1992) 9cis retinoic acid stereoisomer binds and activates the nuclear receptor RXRα. Nature 355:359361.

12. Heyman RA, et al . (1992) 9cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell 68:397406.

13. Chambon P (1996) A decade of molecular biology of retinoic acid receptors. FASEB J 10:940954.

14. Clayton GM, PeakChew SY, Evans RM, Schwabe JWR (2001) The structure of the ultraspiracle ligandbinding domain reveals a nuclear receptor locked in an inactive conformation. Proc Natl Acad Sci USA 98:15491554.

15. Billas IML, Moulinier L, Rochel N, Moras D (2001) Crystal structure of the ligand binding domain of the ultraspiracle protein USP, the ortholog of retinoid X receptors in insects. J Biol Chem 276:74657474.

16. Jones G, Jones D, Teal P, Sapa A, Wozniak M (2006) The retinoidX receptor ortholog, Ultraspiracle, binds with nanomolar affinity to an endogenous morphogenetic ligand. FEBS J 273:114.

17. Miura K, Oda M, Mikita S, Chinzei Y (2005) Characterization of the Drosophila Methoprene –tolerant gene product: Juvenile hormone binding and liganddependent gene regulation. FEBS J 272:11691178.

18. Hayward DC, et al . (1999) The sequence of Locusta RXR, homologous to Drosophila Ultraspiracle, and its evolutionary implications. Dev Genes Evol 209:564 571.

19. Hayward DC, et al . (2003) Ligand specificity and developmental expression of RXR and ecdysone receptor in the migratory locust. J Insect Physiol 49:11351144.

20. Maestro O, Cruz J, Pascual N, Martín D, Bellés X (2005) Differential expression of two RXR/ultraspiracle isoforms during the life cycle of the hemimetabolous insect Blattella germanica (Dictyoptera, Blattellidae). Mol Cell Endocrinol 238:2737.

21. Cheng L, et al . (1994) Characterization of the ligand binding domain of human retinoid X receptor α expressed in Escherichia coli . J Biol Chem 269:1866218667.

22. Bligh EG, Dyer WJ (1959) A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37:911917.

23. MacLean G, Li H, Metzger D, Chambon P, Petkovich M (2007) Apoptotic extinction of germ cells in testes of Cyp26b1 knockout mice. Endocrinology 148:45604567.

24. Solomin L, et al . (1998) Retinoid X receptor signaling in the developing spinal cord. Nature 395:398402.

25. Luria A., Furlow JD (2004) Spatiotemporal retinoidX receptor activation detected in live vertebrate embryos. Proc Natl Acad Sci USA 101:89878992.

26. Krezel W, et al . (1996) RXRγ null mice are apparently normal and compound RXRα +/ /RXRβ / /RXRγ / mutant mice are viable. Proc Natl Acad Sci USA 93:9010 9014.

27. Allenby G, et al . (1993) Retinoic acid receptors and retinoid X receptors: Interactions with endogenous retinoic acids. Proc Natl Acad Sci USA 90:3034.

28. Calléja C, et al . (2006) Genetic and pharmacological evidence that a retinoic acid cannot be the RXRactivating ligand in mouse epidermis keratinocytes. Genes Dev 20:15251538.

29. Wolf G (2006) Is 9cisretinoic acid the endogenous ligand for the retinoic acidX receptor? Nutr Rev 64:532538.

30. Tzertzinis G, Malecki A, Kafatos FC (1994) BmCF1, a Bombyx mori RXRtype receptor related to the Drosophila ultraspiracle . J Mol Biol 238:479486.

31. Kostrouch Z, et al . (1998) Retinoic acid X receptor in the diploblast, Tripedalia cystophora . Proc Natl Acad Sci USA 95:1344213447.

32. Bouton D, et al . (2005) A conserved retinoid X receptor (RXR) from the mollusk Biomphalaria glabrata transactivates transcription in the presence of retinoids. J Mol Endocrinol 34:567582.

33. Adams MD, et al . (2000) The genome sequence of Drosophila melanogaster . Science 287:2185–2195.

34. Escriva H, et al . (1997) Ligand binding was acquired during evolution of nuclear receptors. Proc Natl Acad Sci USA 94:6803–6808.

35. de Urquiza AM, et al . (2000) Docosahexaenoic acid, a ligand for the retinoid X receptor in mouse brain. Science 290:21402144.

36. Lengqvist J, et al . (2004) Polyunsaturated fatty acids including docosahexaenoic and arachidonic acid bind to the retinoid X receptor alpha ligandbinding domain. Mol Cell Proteomics 3:692703.

37. Harmon MA, Boehm MF, Heyman RA, Mangelsdorf DJ (1995) Activation of mammalian retinoid X receptors by the insect growth regulator methoprene. Proc Natl Acad Sci USA 92:6157–6160.

38. Horton C, Maden M (1995) Endogenous distribution of retinoids during normal development and teratogenesis in the mouse embryo. Dev Dyn 202:312323.

39. Pijnappel WWM, et al . (1993) The retinoid ligand 4oxoretinoic acid is a highly active modulator of positional specification. Nature 366:340–344.

40. Thaller C, Eichele G (1990) Isolation of 3,4didehydroretinoic acid, a novel morphogenetic signal in the chick wing bud. Nature 345:815–819.

41. Dinan LN, Rees HH (1981) The identification and titres of conjugated and free ecdysteroids in developing ovaries and newlylaid eggs of Schistocerca gregaria . J Insect Physiol 27:5158.

42. Schmidt CK, Brouwer A, Nau H. (2003) Chromatographic analysis of endogenous retinoids in tissues and serum. Anal Biochem 315:3648.

43. Scadding SR, Maden M (1994) Retinoic acid gradients during limb regeneration. Dev Biol 162:608617.

44. Costaridis P, Horton C, Zeitlinger J, Holder N, Maden M (1996) Endogenous retinoids in the zebrafish embryo and adult. Dev Dyn 205:4151.

45. Satre MA, Kochhar DM (1989) Elevations in the endogenous levels of the putative morphogen retinoic acid in the embryonic mouse limb buds associated with limb dysmorphogenesis. Dev Biol 133:529536.

46. Schweigert FJ, Siegling C, Tzimas G, Seeger J, Nau H (2002) Distribution of endogenous retinoids, retinoid binding proteins (RBP, CRABPI) and nuclear retinoid X receptor β (RXR β) in the porcine embryo. Reprod Nutr Dev 42:285294.

47. Blumberg B, et al . (1996) Novel retinoic acid receptor ligands in Xenopus embryos. Proc Natl Acad Sci USA 93:48734878.

48. Ulven SM, Gundersen TE, Sakhi AK, Glover JC, Blomhoff R (2001) Quantitative axial profiles of retinoic acid in the embryonic mouse spinal cord: 9cis retinoic acid only detected after alltrans retinoic acid levels are superelevated experimentally. Dev Dyn 222:341353.

49. Hartmann R, Jendrsczok C, Peter MG (1987) The occurrence of a juvenile hormone binding protein and in vitro synthesis of juvenile hormone by the serosa of Locusta migratoria embryos. Dev Genes Evol 196:347355.

50. Tawfik AI, Vedrová A, Sehnal F (1999) Ecdysteroids during ovarian development and embryogenesis in solitary and gregarious Schistocerca gregaria . Arch Insect Biochem Physiol 41:134–143.

51. Dalfó D, Albalat R, Molotkov A, Duester G, GonzàlezDuarte R (2002) Retinoic acid synthesis in the prevertebrate amphioxus involves retinol oxidation. Dev Genes Evol 212:388–393.

52. Hopkins PM (2001) Limb regeneration in the fiddler crab, Uca pugilator : Hormonal and growth factor control. Am Zool 41:389–398.

53. Nishikawa J, et al . (2004) Involvement of the retinoid X receptor in the development of imposex caused by organotins in gastropods. Environ Sci Technol 38:62716276. 52

54. Němec V, Kodrík D, Matolín S, Laufer H (1993) Juvenile hormonelike effects of retinoic acid in insect metamorphosis, embryogenesis and reproduction. J Insect Physiol 39:10831093.

55. SimõesCosta MS, Azambuja AP, XavierNeto J (2006) The search for nonchordate retinoic acid signaling: lessons from chordates. J Exp Zoolog B Mol Dev Evol 306B:119.

56. Marletaz F, Holland LZ, Laudet V, Schubert M. (2006) Retinoic acid signaling and the evolution of chordates. Int J Biol Sci 2:38–47.

57. Chinzei Y, White EN, Wyatt GR (1982) Vitellogenin mRNA in locust fat body: Identification, isolation and quantitative changes induced by juvenile hormone. Can J Biochem 60:243251.

58. Egea PF, Moras D (2001) Purification and crystallization of the human RXRα ligand binding domain9cis RA complex. Acta Cryst D57:434437.

59. Allegretto EA (1998) in Retinoid Protocols , ed Redfern CPF (Humana Press, Totowa) pp 219–232.

60. Wecksler WR, Norman AW (1979) An hydroxylapatite batch assay for quantitation of 1α, 25dihydroxyvitamin D 3receptor complexes. Anal Biochem 92:314323.

61. Chithalen JV, Luu L, Petkovich M, Jones G (2002) HPLCMS/MS analysis of the products generated from alltrans retinoic acid using recombinant human CYP26A. J Lipid Res 43:11331142.

62. Wald G (1968) The molecular basis of visual excitation. Nature 219:800807.

63. Lammer EJ, et al . (1985) Retinoic acid embryopathy. N Engl J Med 313:837–841.

64. Napoli JL, Pramanik BC, Williams JB, Dawson MI, Hobbs PD (1985) Quantification of retinoic acid by gasliquid chromatographymass spectrometry: total versus all trans retinoic acid in human plasma. J Lipid Res 26:38792.

65. Arnhold T, Tzimas G, Wittfoht W, Plonait S, Nau H (1996) Identification of 9cis retinoic acid, 9,13dicis retinoic acid, and 14hydroxy4,14retro retinol in human plasma after liver consumption. Life Sci 59:PL169PL177.

66. von Lintig J, Dreher A, Kiefer C, Wernet MF, Vogt K (2001) Analysis of the blind Drosophila mutant ninaB identifies the gene encoding the key enzyme for vitamin A formation in vivo . Proc Natl Acad Sci USA 98:11305.

67. Sun D, Chen DM, Harrelson A, Stark WS (1993) Increased expression of chloramphenicol acetyltransferase by carotenoid and retinoid replacement in Drosophila opsin promotor fusion stocks. Exp Eye Res 57:177187.

68. Bennett RR, White RH (1991) 11cis retinal restores visual function in vitamin A deficient Manduca . Vis Neurosci 6:473479.

Fig. 2.1. Recombinant protein purification and western blot analysis. Representative gels (2 of 10) total showing bacterial expression and metal affinity purification of polyHistagged fusion proteins, LmRXRS (A) and LmRXRL (B), under native conditions. Samples from the purification protocol (see Methods) were electrophoresed and stained. Lanes are represented as: (1) prestained protein molecular weight marker

(MBI Fermentas, #SM0441); (2) sonicated E. coli lysate; (3) flowthrough lysate unbound to resin; (4) 0 mM imidazole wash; (5) and (6) 20 mM imidazole washes; (7) and (8) 250 mM imidazole elutions. Major bands (7) and (8) represent the purified proteins LmRXRS (~43 kDa) and LmRXRL (~28 kDa; DE domain). Representative western blots of antihumanRXRα (C) and antiLmRXRL (D) against purified LmRXR

L (lane 1) and humanRXRα (lane 2) proteins. Western blot using antiLmRXRL against day 5 and 6 (lanes 1 and 2, respectively) developing locust embryos (E). 55

Fig. 2.2. Competitive binding studies. Competitive binding of 9cis RA (A), alltrans

RA (B), DHA (C) and methoprene acid (D) with [ 3H]9cis RA to the purified receptors

LmRXRShort (▲), LmRXRL(DE) (●) and hRXRα(DE) (■). Competition binding studies were done 37 times on a total of 27 independently prepared recombinant protein purifications. 57

100 A 100 B 75 75 50

50 25 -RA Bound (%) -RA Bound -RA Bound (%) -RA Bound cis cis 25 9- 9- 0

-25 0 -11 -10 -9 -8 -7 -6 -5 -4 -3 -2 -11 -10 -9 -8 -7 -6 -5 -4 -3 -2 log [9- cis -RA] (M) log [alltrans -RA] (M)

100 C D 100

75 75

50 50 -RA Bound (%) -RA Bound (%) -RA Bound cis cis 25 25 9- 9-

0 0 -11 -10 -9 -8 -7 -6 -5 -4 -3 -2 -11 -10 -9 -8 -7 -6 -5 -4 -3 -2 log [DHA] (M) log [Methoprene Acid] (M) 58

Fig. 2.3. Response of retinoid reporter cell lines to locust embryo extracts. Mouse P19 cells were incubated with locust embryo homogenates or extracts. Retinoids were suspended in 100% DMSO and this solvent was used as a control, along with alltrans

RA, as well as equimolar amounts of alltrans and 9cis RA. Embryos were either used as whole homogenates or subjected to retinoid extraction as described. Luciferase activity was determined in a luminometer and vertical error bars represent standard deviations (N

= 4). Stars indicate significant differences from the controls. 59

Fig. 2.4. HPLCMS analysis of locust embryo extracts. A typical chromatograph of control protein samples (BSA; broken line) and day 5 Locusta embryo extract preparations (solid line). Top: Elution profile of the HPLC, monitored at 350 nm, with the scale shown. An expanded view (x8) of the fractions of interest indicates that the retinoids were outside the detection range. Bottom: A typical chromatogram for the negative ion LCMS/MS in the MRM mode using the 299255 transition showing the retention time positions of alltrans RA and 9cis RA as previously determined by reference experiments (results not shown) as well as a nonspecific peak at ~21 min. 61

Table 2.1. Mean IC 50 values (N = 37) of purified Locusta RXR isoforms (LmRXRL and –S) and human RXRα using retinoid or related molecules to competitively displace

[3H]9cis RA. Data are means from multiple experiments as shown in Fig. 2.2. 63

Competitor LmRXRL1 LmRXRS1 hRXRα 1

9cis RA 2 1.31 x 10 7 M 6.13 x 10 8 M 7.42 x 10 8 M alltrans RA 3 1.05 x 10 7 M 7.50 x 10 8 M ND

Methoprene acid 4 8.74 x 10 6 M 2.66 x 10 5 M ND

DHA 5 4.05 x 10 6 M 2.91 x 10 6 M ND

1 Determined at ~5 mM

2Tested at concentrations ranging from 4.6 x 10 11 M to 5.0 x 10 5 M

3Tested at concentrations ranging from 4.2 x 10 11 M to 4.2 x 10 5 M

4Tested at concentrations ranging from 3.1 x 10 9 M to 3.1 x 10 4 M

5Tested at concentrations ranging from 1.3 x 10 9 M to 1.3 x 10 3 M

ND: not determined 64

Table 2.2. A summary of retinoid synthesis and signaling pathways in mammals and insects. Flies ( D. melanogaster ), moths and locust ( L. migratoria) represent the insects and human and mouse represent the mammals (portion of the table modified from reference 55). 65 66

CHAPTER 3: General Discussion

In the early 1900s, selective nutrientdeprivation experiments identified vitamin A

(retinol) as a dietaryderived, lipophilic molecule exerting a notable influence on vertebrate vision (Semba, 1999). Oxidation of retinol gives rise to the naturally occurring retinoids and the active metabolite RA (reviewed in Duester, 1996). The subsequent identification and cloning of the human retinoid receptors, RAR (Giguere et al ., 1987;

Petkovich et al ., 1987) and RXR (Mangelsodorf, 1990), solidified RA’s role as a potent ligand which modifies gene transcription thereby influencing embryogenesis, organogenesis, cell differentiation and apoptosis (reviewed in Mark et al ., 2006; Clagett

Dame et al ., 2002). In light of chordate’s embryonic and developmental dependence on

RA, its synthesis and signaling pathways are arguably of early origin and thus derived from invertebrates (Canestro et al ., 2000). In this thesis, evidence for evolutionarily early RA signaling is petitioned by the identification of endogenous 9cis RA and all trans RA isomers in embryonic tissues of the insect L. migratoria and the presence of the insect nuclear receptors, LmRXRL and LmRXRS (Chapter 2). Presumably, these can transduce the RA signals. Taken together, these results argue that insects represent early patrons of retinoids and retinoid signaling pathways in the evolution of RAdriven animal development and homeostasis.

Exogenous Effects of RA

The vitamin A metabolites, alltrans RA and 9cis RA, are potent morphogens where exogenous treatments can result in dosedependent changes in vertebrate tissue 67 morphology and teratogenesis (reviewed in ClagettDame and DeLuca, 2002). The invertebrates are also subject to RA potency. In the nematode Brugia malayi , RA is readily taken up in a dosedependent manner where it is sequestered in the somatic and developing embryonic tissues (Wolff and Scott, 1995). Profound morphological changes are observed in the rock shell, T. clavigera , where 9cis RA induces the development of imposex, male genital tracts in females (Nishikawa et al ., 2004), and in the pond snail,

Lymnaea stagnalis , where alltrans RA increased the number and length of cell neurite outgrowth (Dmetrichuk et al ., 2006). Insect morphology is also affected by exogenous

RA treatments as demonstrated by its juvenilizing effects in newly ecdysed larvae of the fire bug ( Pyrrhocoris apterus ) and cotton stainer ( Dysdercus cingulatus ) and pupae of the yellow mealworm beetle ( Tenebrio molitor ; Němec et al ., 1993). Furthermore, RA was capable of restoring vitellogenin synthesis and arresting embryo development (Němec et al ., 1993). Preliminary experiments using Locusta embryos demonstrate that topological application of 9cis RA halts embryogenesis (not shown). RA’s potency in insect development and reproduction is paralleled to the chemical nature and structure of JH as they are both terpenoid derivatives.

RA Synthesis

Vertebrate synthesis of alltrans RA begins with the rate limiting oxidation step of retinol to retinaldehyde by an alcohol dehydrogenase (ADH) and the subsequent irreversible oxidation of retinaldehyde to alltrans RA by a retinaldehyde dehydrogenase

(RALDH; reviewed in Duester, 1996). This pathway also permits the storage of retinoids by reversibly converting retinol to liver retinyl ester, an advantageous adaptation 68 described in mammalian models (reviewed in Blomhoff and Blomhoff, 2005). However, the enzymes driving RA synthesis are believed to have been present before the divergence of the vertebrates. Of the seven classes of ADH enzymes described in the vertebrates, ADHIII is the sole class represented in the arthropod Drosophila (Dalfó et al ., 2002). To date, four RALDH enzymes are described in the mammalians. However, the eubacterial enzyme Diox1, was recently found to produce retinaldehyde from the asymmetric cleavage of an apocarotenoid (Ruch et al ., 2005). While Diox1 is implicated in photoreception in the cyanobacterium Synechocystis sp (Ruch et al ., 2005), ADH is believed to protect invertebrates from xenobiotic compounds. Therefore vertebrate orthologues would have acquired retinolmetabolizing specificity.

RA can also be derived from the provitamin A molecule, βcarotene. β, β carotene15,15′oxygenase (BCO) cleaves the βcarotene molecule at the central 15,15′ carbon double bond yielding two molecules of alltrans retinaldehyde (von Lintig and

Vogt, 2000) that can be further oxidized to alltrans RA. After BCOI was identified in

Drosophila it was then identified in the invertebrate sea squirt (Takimoto et al ., 2007), and subsequently in the mouse (Paik et al ., 2001) and human (Yan et al ., 2001). In vertebrates, a second BCO is identified (BCOII), which is capable of asymmetric cleavage of the βcarotene molecule. Its production of various βapo carotenoic acids, in the presence of rabbit liver mitochondrial fractions, produce βapo 15carotenoic acid, better known as alltrans RA (Wang et al ., 1996), thus demonstrating that an alternative route to RA synthesis was acquired by the vertebrates. In general, retinaldehyde formation by βcarotene cleavage is regarded as an evolutionarily earlier alltrans RA synthetic pathway rooted in the invertebrates compared to the previously described 69 retinol oxidative pathway favoured in the vertebrates. As 9cis RA eludes detection in mammalian models its mode of synthesis and physiological role is uncertain and remains under scrutiny (Horton and Maden, 1995).

RXR Loss of Function

Vertebrate studies demonstrate that RXR lies at the crossroads of multiple nuclear receptor signaling pathways. It is an obligate heterodimeric partner for several members of the nuclear receptor superfamily when binding their cognate HREs and as a homodimer it can be activated by 9cis RA signaling (reviewed in Chambon, 1996).

Therefore, mutations and RNA silencing of RXR/USP can have detrimental effects on animal development. Mouse RXRαnull fetuses display multiple ocular and ventricular myocardium defects; the latter is the main cause of fetal death demonstrating the importance of RXRα during embryogenesis (Kastner et al ., 1994; RuizLozano et al .,

1998). Similarly, the invertebrate homologue USP is necessary at different stages of

Drosophila development and for different developmental functions including: oogenesis, cuticle production during embryogenesis and the development of eyeantennal discs (Oro et al ., 1992). In the more evolutionarilyprimitive cockroach, B. germanica , the role of

RXR in sixth instar nymphs was investigated by RNAi knockdown. The majority of nymphs either failed to ecdyse or did not complete ecdysis and cuticular, tracheal and gut structures were observed to have duplicated (Martin et al ., 2006). Like their vertebrate counterparts, the insects require USP/RXR at multiple stages during their lifecycle as many embryonic and morphogenic structures are dependent on the presence of this protein. 70

Invertebrate RA Signaling

In the vertebrates, alltrans RA signaling is transduced through heterodimeric combinations of three RAR and RXR subtypes. Phylogenetic analysis indicates that

RXR is of earlier origin while RAR is chordateexclusive believed to arise from gene duplication events at the origin of vertebrates (Escriva et al ., 1997; Fujiwara and

Kawamura, 2003). The presence of RXR is widely distributed throughout invertebrates since it has been identified in a crab (Chung et al ., 1998), a marine sponge (Wiens et al .,

2003), jellyfish (Kostrouch et al ., 1998) and cockroach (Maestro et al ., 2005). As mentioned, LmRXRL and LmRXRS bearing greater sequence similarity to the human

RXRα LBD than the DmUSP LBD (Hayward et al ., 1999; 2003). Like the human

RXRα, both isoforms competitively bind 9cis RA with high affinity (Chapter 2) compared to previously suggested ligands including polyunsaturated fatty acids and JH analogues (Cheng et al ., 1994; de Urquiza et al ., 2000; Lengqvist et al ., 2004; Harmon et al ., 1995). The genome of the more evolutionarily advanced Drosophila does not contain an RAR gene and DmUSP does not bind 9cis RA, suggesting USP diverged structurally and functionally from its RXR origin (Adams et al ., 2000; Oro et al ., 1990).

Although RXR is ubiquitous throughout the chordates, as previously mentioned, the physiological role of its ligand, 9cis RA, is questioned as it remains undetected in vertebrate tissues (Horton and Maden, 1995). In mice, embryonic detection of 9cis RA was demonstrated only when pregnant dams were fed teratogenic levels of alltrans RA

(Ulven et al ., 2000). Interestingly, 9cis RA is detected in the adult cephalochordate amphioxus (Dalfó et al ., 2002) and in the limb blastemas of the invertebrate crab 71

(Hopkins, 2001), but not in murine limb buds or whole mouse embryos (Horton and

Maden, 1995). It is therefore enticing to suggest that 9cis RA’s niche is in the non chordates. The data in this thesis supports my hypothesis since 9cis RA and alltrans

RA isomers are detecteded at physiological concentrations in day 5 developing Locusta embryos (Fig. 4). Culturing Drosophila on vitamin Adeficient diets indicates that

Drosophila development does not require vitamin A except for its visual chromophore,

11cis retinal (Sun et al ., 1993) and questions the requirement for RA isomers during development and embryogenesis of these more advanced insects. The distribution of

RXR throughout the invertebrates and the indication of 9cis RA in the prechordates suggests that early retinoid signaling is rooted in the combination of this receptor and ligand. By identifying the endogenous 9cis RA ligand during Locusta embryogenesis and characterizing the RXR isoform specificity for this ligand, this thesis supports this theory and strives to fill in the gap regarding RA signaling in the invertebrates (Table

3.1).

Conclusions and Future Considerations

Evidence that RA signaling is of prechordate origin is becoming more compelling: exogenous alltrans RA and 9cis RA can be readily sequestered and act as potent morphogens, RAspecific synthesizing enzymes are of early invertebrate/eubacterial origin, and RXR/USP lossoffunction is detrimental to invertebrate development. Futhermore, our identification of the endogenous 9cis RA and alltrans RA stereoisomers during Locusta embryogenesis and demonstration of highaffinity retinoid signaling through its LmRXRs attempt to finalize this list of RA 72 signaling criteria (Table 3.1). In doing so, the data obtained in this study is consistent with the theory that 9cis RA signaling by RXR is of prechordate origin and that ultimately the insects are capable of RA signaling.

Having established the presence of 9cis RA in the primitive insect model, L. migratoria , its synthesis pathway may be conclusively elucidated. Due to Locusta’s voracity for plant material, the more ancient carotenoid derived synthesis of RA may be favoured. Furthermore, insectspecific carotenoid cleaving and RALDH enzymes could be identified from Locusta since Drosophila ’s use of carotenoids and retinoids appears to be visuallyexclusive. Locusta may therefore serve as an insect model for vitamin A deprivation diet experiments and developmental studies. Finally, the results in this thesis describe RALmRXR signaling in vitro ; future mutagenesis studies in vivo will help elucidate the relationship, developmental and functional roles of the long and short RXR isoforms in the egg, nymph and adult.

During vertebrate embryogenesis, alltrans RA signaling orchestrates a variety of patterning mechanisms including left and right coordination of somites, from developed paraxial mesoderm, that give rise to bones, muscles, and dermis. A decrease in RA signaling during somitogenesis results in left and right asymmetric somite formation observed in mouse and chicken embryos (Vermot et al ., 2005; Vermot and Pourquié,

2005). It is ironic then that embryogenic mechanisms of RA coordinated patterning and mesoderm morphogenesis which have been traditionally described in the vertebrate models, may in fact have been evolutionarily derived from the invertebrates. More specifically, the foundations for RAdriven development in Locusta embryogenesis have 73 been established which may be more representative of the insects as a class, unlike its apparent loss in the advanced and more specialized insect Drosophila .

Literature Cited

Adams, M.D., Celniker, S.E., Holt, R.A., Evans, C.A., Gocayne, J.D., Amanatides, P.G., Scherer, S.E., Li, P.W., Hoskins, R.A., Galle, R.F., George, R.A., Lewis, S.E., Richards, S., Ashburner, M., Henderson, S.N., Sutton, G.G., Wortman, J.R., Yandell, M.D., Zhang, Q., Chen, L.X., Brandon, R.C., Rogers, Y.H., Blazei, R.G., Champe, M., Pfeiffer, B.D., Wan, K.H., Doyle, C., Baxter, E.G., Helt, G., Nelson, C.R., Gabor, G.L., Abril, J.F., Agbayani, A., An, H.J., AndrewsPfannkoch, C., Baldwin, D., Ballew, R.M., Basu, A., Baxendale, J., Bayraktaroglu, L., Beasley, E.M., Beeson, K.Y., Benos, P.V., Berman, B.P., Bhandari, D., Bolshakov, S., Borkova, D., Botchan, M.R., Bouck, J., Brokstein, P., Brottier, P., Burtis, K.C., Busam, D.A., Butler, H., Cadieu, E., Center, A., Chandra, I., Cherry, J.M., Cawley, S., Dahlke, C., Davenport, L.B., Davis, P., de Pablos, B., Delcher, A., Deng, Z., Mays, A.D., Dew, I., Dietz, S.M., Dodson, K., Doup, L.E., Downes, M., DuganRocha, S., Dunkov, B.C., Dunn, P., Durbin, K.J., Evangelista, C.C., Ferraz, C., Ferriera, S., Fleischmann, W., Fosler, C., Gabrielian, A.E., Garg, N.S., Gelbart, W.M., Glasser, K., Glodek, A., Gong, F., Gorrell, J.H., Gu, Z., Guan, P., Harris, M., Harris, N.L., Harvey, D., Heiman, T.J., Hernandez, J.R., Houck, J., Hostin, D., Houston, K.A., Howland, T.J., Wei, M.H., Ibegwam, C., Jalali, M., Kalush, F., Karpen, G.H., Ke, Z., Kennison, J.A., Ketchum, K.A., Kimmel, B.E., Kodira, C.D., Kraft, C., Kravitz, S., Kulp, D., Lai, Z., Lasko, P., Lei, Y., Levitsky, A.A., Li, J., Liang, Y., Lin, X., Mattei, B., McIntosh, T.C., McLeod, M.P., McPherson, D., Merkulov, G., Milshina, N.V., Mobarry, C., Morris, J., Moshrefi, A., Mount, S.M., Moy, M., Murphy, B., Muzny, D.M., Nelson, D.L., Nelson, D.R., Nelson, K.A., Nixon, K., Nusskern, D.R., Pacleb, J.M., Palazzolo, M., Pittman, G.S., Pan, S., Pollard, J., Puri, V., Reese, M.G., Reinert, K., Remington, K., Saunders, R.D., Scheeler, F., Shen, H., Shue, B.C., SidenKiamos, I., Simpson, M., Skupski, M.P., Smith, T., Spier, E., Spradling, A.C., Stapleton, M., Strong, R., Sun, E., Svirskas, R., Tector, C., Turner, R., Venter, E., Wang, A.H., Wang, X., Wang, Z.Y., Wassarman, D.A., Weinstock, G.M., Weissenbach, J., Williams, S.M., Woodage, T., Workley, K.C., Wu, D., Yang, S., Yao, Q.A., Ye, J., Yeh, R.F., Zayeri, J.S., Zhan, M., Zhang, G., Zhao, Q., Zheng, L., Zheng, X.H., Zhong, F.N., Zhong, W., Zhou, X., Zhu, S., Zhu, X., Smith, H.O., Gibbs, R.A., Myers, E.W., Rubin, G.M., Venter, J.C. 2000. The genome sequence of Drosophila melanogaster . Science 287: 2185–2195.

Blomhoff, R., Blomhoff, H.K. 2005. Overview of retinoid metabolism and function. J. Neurobiol. 66: 606630.

Canestro, C., Hjelmqvist, L., Albalat, R., GarciaFernandez, J., GonzalezDuarte, R., Jornvall, H. 2000. Amphioxus alcohol dehydrogenase is a class 3 form of single type and of structural conservation but with unique developmental expression. Eur. J. Biochem. 267: 6511–6518.

Chambon, P. 1996. A decade of molecular biology of retinoic acid receptors. FASEB J. 10: 940954.

Cheng, L., Norris, A.W., Tate, B.F., Rosenberger, M., Grippo, J.F., Li, E. 1994. Characterization of the ligand binding domain of human retinoid X receptor α expressed in Escherichia coli . J. Biol. Chem. 269: 1866218667.

Chung, A.C., Durica, D.S., Clifton, S.W., Roe, B.A., Hopkins, P.M. 1998. Cloning of crustacean ecdysteroid receptor and retinoidX receptor gene homologs and elevation of retinoidX receptor mRNA by retinoic acid. Mol. Cell Endocrinol. 139: 209–227.

ClagettDame, M., DeLuca, H. F. 2002. The role of vitamin A in mammalian reproduction and embryonic development. Annu. Rev. Nutr. 22: 347381.

Dalfó, D., Albalat, R., Molotkov, A., Duester, G., GonzàlezDuarte, R. 2002. Retinoic acid synthesis in the prevertebrate amphioxus involves retinol oxidation. Dev. Genes Evol. 212: 388–393.

Dmetrichuk, J.M., Carlone, R.L., Spencer, G.E. 2006. Retinoic acid induces neurite outgrowth and growth cone turning in invertebrate neurons. Dev. Biol. 294: 39–49.

De Urquiza, A.M., Liu, S., Sjoberg, M., Zetterstrom, R.H., Griffiths, W., Sjovall, J., Perlmann, T. 2000. Docosahexaenoic acid, a ligand for the retinoid X receptor in mouse brain. Science 290: 21402144.

Duester, G. 1996. Involvement of alcohol dehydrogenase, shortchain dehydrogenase/reductase, aldehyde dehydrogenase, and cytochrome P450 in the control of retinoid signaling by activation of retinoic acid synthesis. Biochemistry 35: 12221– 12227.

Escriva, H., Safi, R., Hanni, C., Langlois, M.C., SaumitouLaprade, P., Stehelin, D., Capron, A., Pierce, R., Laudet, V. 1997. Ligand binding was acquired during evolution of nuclear receptors. Proc. Natl. Acad. Sci. U.S.A. 94: 6803–6808.

Fujiwara, S., Kawamura, K. 2003. Acquisition of retinoic acid signaling pathway and innovation of the chordate body plan. Zool. Sci. 20: 809–818.

Giguere, V., Ong, E.S., Segui, P., Evans, R.M. 1987. Identification of a receptor for the morphogen retinoic acid. Nature 330: 624–629.

Harmon, M.A., Boehm, M.F., Heyman, R.A., Mangelsdorf, D.J. 1995. Activation of mammalian retinoid X receptors by the insect growth regulator methoprene. Proc. Natl. Acad. Sci. U.S.A. 92: 6157–6160.

Hopkins, P.M. 2001. Limb regeneration in the fiddler crab, Uca pugilator : hormonal and growth factor control. Am. Zool. 41: 389–398.

Horton, C. and Maden, M. 1995. Endogenous distribution of retinoids during normal development and teratogenesis in the mouse embryo. Dev. Dyn. 202: 312323.

Kastner, P., Grondona, J.M., Mark, M., Gansmuller, A., LeMeur, M., Decimo, D., Vonesch, J.L., Dollé, P., Chambon, P. 1994. Genetic analysis of RXR alpha developmental function: convergence of RXR and RAR ignaling pathways in heart and eye morphogenesis. Cell 78: 987–1003.

Kostrouch, Z., Kostrouchova, M., Love, W., Jannini, E., Piatigorsky, J., Rall, J.E. 1998. Retinoic acid X receptor in the diploblast, Tripedalia cystophora . Proc. Natl. Acad. Sci. U.S.A. 95: 1344213447.

Lengqvist, J., de Urquiza, A.M., Bergman, A.C., Willson, T.M., Sjövall, J., Perlmann, T., Griffiths, W.J. 2004. Polyunsaturated fatty acids including docosahexaenoic and arachidonic acid bind to the retinoid X receptor alpha ligandbinding domain. Mol. Cell. Proteomics. 3: 692703.

Maestro, O., Cruz, J., Pascual, N., Martín, D., Bellés, X. 2005. Differential expression of two RXR/ultraspiracle isoforms during the life cycle of the hemimetabolous insect Blattella germanica (Dictyoptera, Blattellidae). Mol. Cell Endocrinol. 238: 2737.

Mangelsdorf, D.J., Ong, E.S., Dyck, J.A., Evans, R.M. 1990. Nuclear receptor that identifies a novel retinoic acid response pathway. Nature 345: 224–229.

Mark, M., Ghyselinck, N. B., Chambon, P. 2006. Function of retinoid nuclear receptors: Lessons from genetic and pharmacological dissections of the retinoic acid signaling pathways during mouse embryogenesis. Annu. Rev. Pharmacol. Toxicol. 46: 451480.

Martín, D., Maestro, O., Cruz, J., ManéPadrós, D., Bellés, X. 2006. RNAi studies reveal a conserved role for RXR in molting in the cockroach Blattella germanica . J. Insect Physiol. 2006 52: 410426.

Němec, V., Kodrík, D., Matolín, S., Laufer, H. 1993. Juvenile hormonelike effects of retinoic acid in insect metamorphosis, embryogenesis and reproduction. J. Insect Physiol. 39: 10831093.

Nishikawa, J., Mamiya, S., Kanayama, T., Nishikawa, T., Shiraishi, F., Horiguchi, T. 2004. Involvement of the retinoid X receptor in the development of imposex caused by organotins in gastropods. Environ. Sci. Technol. 38: 6271 6276. 77

Oro, A.E., McKeown, M., Evans, R.M. 1990. Relationship between the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor. Nature. 347: 298– 301.

Oro, A.E., McKeown, M., Evans, R.M. 1992. The Drosophila retinoid X receptor homolog ultraspiracle functions in both female reproduction and eye morphogenesis. Development 115: 449462.

Paik, J., During, A., Harrison, E.H., Mendelsohn, C.L., Lai, K., Blaner, W.S. 2001. Expression and characterization of a murine enzyme able to cleave betacarotene. The formation of retinoids. J. Biol. Chem. 276: 32160–32168.

Petkovich, M., Brand, N.J., Krust, A., Chambon, P. 1987. A human retinoic acid receptor which belongs to the family of nuclear receptors. Nature 330: 444–450.

Ruch, S., Beyer, P., Ernst, H., AlBabili, S. 2005. Retinal biosynthesis in Eubacteria: in vitro characterization of a novel carotenoid oxygenase from Synechocystis sp. PCC 6803. Mol. Microbiol. 55:1015–1024.

RuizLozano, P., Smith, S.M., Perkins, G., Kubalak, S.W., Boss, G.R., Sucov, H.M., Evans, R.M., Chien, K.R. 1998. Energy deprivation and a deficiency in downstream metabolic target genes during the onset of embryonic heart failure in RXRalpha−/− embryos. Development 125: 533–544.

Semba, R. D. 1999. Vitamin A as “AntiInfective” Therapy, 1920–1940. J. Nutr. 129: 783791.

SimõesCosta, M.S., Azambuja, A.P., XavierNeto, J. 2006. The search for nonchordate retinoic acid signaling: lessons from chordates. J. Exp. Zool. (Mol. Dev. Evol.) 306B: 1 19.

Sun, D., Chen, D.M., Harrelson, A., Stark, W. S. 1993. Enhancement of expression of chloramphenicol acetyltransferase (CAT) by carotenoid and retinoid replacement in opsin promoter – CAT reporter fusion Drosophila . Exp. Eye Res. 57: 177187.

Takimoto, N., Kusakabe, T., Horie, T., Miyamoto, Y., Tsuda, M. 2007. Origin of the vertebrate visual cycle. Photochem. Photobiol. 83: 242–247.

Ulven, S.M., Gundersen, T.E., Weedon, M.S., Landaas, V.O., Sakhi, A.K., Fromm, S.H., Geronimo, B.A., Moskaug, J.O., Blomhoff, R. 2000. Identification of endogenous retinoids, enzymes, binding proteins, and receptors during early postimplantation development in mouse: important role of retinal dehydrogenase type 2 in synthesis of all trans retinoic acid. Dev. Biol. 220:379391.

Vermot, J., Gallego Llamas, J., Fraulob, V., Niederreither, K., Chambon, P., Dolle, P. 2005. Retinoic acid controls the bilateral symmetry of somite formation in the mouse embryo. Science 308: 563–566.

Vermot, J., Pourquié, O. 2005. Retinoic acid coordinates somitogenesis and left–right patterning in vertebrate embryos. Nature 435: 215–220.

Von Lintig J, Vogt K. 2000. Filling the gap in vitamin A research. Molecular identification of an enzyme cleaving betacarotene to retinal. J. Biol. Chem. 275:11915– 11920.

Wang, X.D., Russell, R.M., Liu, C., Stickel, F., Smith, D.E., Krinsky, N.I. 1996. Beta oxidation in rabbit liver in vitro and in the perfused ferret liver contributes to retinoic acid biosynthesis from betaapocarotenoic acids. J. Biol. Chem. 271: 26490–26498.

Wiens, M., Batel, R., Korzhev, M., Müller, W.E.G. 2003. Retinoid X receptor and retinoic acid response in the marine sponge Suberites domuncula . J. Exp. Biol. 206: 32613271.

Wolff, K.M., Scott, A.L. 1995. Brugia malayi : Retinoic acid uptake and localization. Exp. Parasitol. 80: 282290.

Yan, W., Jang, G.F., Haeseleer, F., Esumi, N., Chang, J., Kerrigan, M., Campochiaro, M., Campochiaro, P., Palczewski, K., Zack, D.J. 2001. Cloning and characterization of a human beta,betacarotene15,15′dioxygenase that is highly expressed in the retinal pigment epithelium. Genomics 72:193–202. 79

Table 3.1. Summary of retinoid synthesis and signaling pathways in bilaterians. Locusta represents the evolutionarily more primitive insects while Drosophila represents the advanced insect orders of Diptera and Orthoptera. Adapted from SimõesCosta et al .,

2005 and with data from this thesis.