Sex Without Crossing Over in the Yeast Saccharomycodes Ludwigii

bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1

ARTICLE

Sex without crossing over in the yeast Saccharomycodes ludwigii

Ioannis A. Papaioannou1, Fabien Dutreux2, France A. Peltier1, Hiromi Maekawa1#, Nicolas Delhomme3, Amit Bardhan1, Anne Friedrich2, Joseph Schacherer2,4 and Michael Knop1,5*

1 Center for Molecular Biology of Heidelberg University (ZMBH), Heidelberg, Germany 2 Université de Strasbourg, CNRS, GMGM UMR 7156, Strasbourg, France 3 Umeå Plant Science Centre, Department of Forest Genetics and Plant Physiology, Swedish University of Agricultural Sciences, Umeå, Sweden 4 Institut Universitaire de France (IUF), Paris, France 5 German Cancer Research Center (DKFZ), DKFZ-ZMBH Alliance, Heidelberg, Germany # Current affiliation: Faculty of Agriculture, Kyushu University, Fukuoka, Japan

* To whom correspondence should be addressed: [email protected]

Abstract

Meiotic recombination is a ubiquitous function of sexual reproduction throughout eukaryotes. Here we report that recombination is extremely suppressed during meiosis in the yeast species Saccharomycodes ludwigii. DNA double-strand break formation, processing and repair are required for normal meiosis but do not lead to crossing over. Although the species has retained an intact meiotic gene repertoire, genetic and population analyses suggest the exceptionally rare occurrence of meiotic crossovers. We propose that Sd. ludwigii has followed a unique evolutionary trajectory that possibly derives fitness benefits from the combination of frequent fertilization within the meiotic tetrad with the absence of meiotic recombination.

Main

Sex constitutes the prevailing reproductive mode throughout the eukaryotic tree of life1. At its core lies a periodic ploidy cycling, accomplished through meiosis, during which haploid gametes are produced, and mating, which ensures the restoration of the original ploidy level. Meiosis is thought to have arisen early in the eukaryotic evolution and is a ubiquitous attribute of sexual life cycles2. During the first meiotic division (meiosis I), parental chromosomes are recombined and separated, while in the second sister chromatids segregate (meiosis II). Random reassortment and recombination of homologous chromosomes in meiosis I lead to novel genetic constellations in the offspring. These are used as substrates for natural selection, for promotion of advantageous and purging of deleterious genetic combinations3,4. However, the significant complexity and biological costs of sex render its widespread occurrence paradoxical, and the questions of its evolutionary origin, persistence and functions have been outstanding enigmas in biology5–7. Saccharomyces cerevisiae (baker’s yeast) is a premier model organism for the study of cellular, molecular and evolutionary biology, and it has been used to gain major insights into the molecular aspects of meiosis8,9. Following pairing of homologous chromosomes, meiotic recombination is initiated in prophase I with the formation of DNA double-strand breaks (DSBs) by the topoisomerase-like protein Spo1110. Several pathways mediate the subsequent repair of these DSBs and pathway choice is regulated by a multitude of meiosis- specific factors that act in concert with the DNA repair machinery. One possibility involves the use of the homologous chromosome as repair template, which can ultimately lead to the generation of chimeric DNA molecules. This process may involve either reciprocal exchange of the chromosomal regions that flank the DSB site (crossover, CO) or gene conversion without reciprocal exchange (non-crossover, NCO)8,9. Crossing over leads to the establishment of chiasmata (Fig. 1d), which ensure the physical interconnection of bivalents that is important for the faithful segregation of homologous chromosomes in meiosis I11. In many, but not all, organisms this is facilitated by the synaptonemal complex, which mediates stable synapsis9. The extent of genetic exchange in meiosis and thus the generation of genomic diversity are strongly influenced by the frequency and distribution of COs along chromosomes. Homeostatic regulation controls these parameters in many organisms12,13, with different outcomes in different species. These range from one obligatory CO per chromosome in Caenorhabditis elegans14 to 10 or more in Schizosaccharomyces pombe15. Among yeasts, the frequency of meiotic COs per chromosome ranges from an average of 2.5 COs in Lachancea kluyveri to its highest level in Sc. pombe15–19. Furthermore, generation of diversity is influenced by the mating behavior (breeding), which can involve gametes of variable genetic relatedness. Mating occurs between unrelated gametes in outbreeding, which ensures high genetic diversity in the offspring. On the other hand, inbreeding (self- fertilization) refers to mating between genetically related gametes that originate from the

same individual or clonal line. Inbreeding is generally considered to lead to lower heterozygosity, which can compromise the adaptive potential of populations20. Mating of gametes from the same meiotic event represents a particular type of inbreeding referred to as intratetrad mating or automixis21. This appears to be the most frequent breeding strategy in S. cerevisiae22–24. If automixis brings together chromosomes that had been separated during meiosis I (non-sister components), it is described as “central fusion” or “first division restitution”. This has important genetic consequences, since it maintains parental heterozygosity around the centromeres, reducing the risk of deleterious alleles being exposed due to homozygotization25–27. The degree to which parental heterozygosity is restituted upon intratetrad mating correlates inversely with the frequency of COs during meiosis. In the extreme case of absent crossing over parental genomes would be fully reconstituted and their heterozygosity maintained. Evolutionary models suggested that high frequency of deleterious mutations could promote automixis in the absence of meiotic recombination28. Chromosome segregation in meiosis I without any recombination (achiasmate meiosis) has been observed in one of the two sexes6,29 or in individual chromosomes30,31 of a few organisms. Furthermore, unusually low overall recombination rates have been reported in some species32,33. However, these data should be interpreted with caution since sampling bias, insufficient marker coverage and incomplete genome assemblies may have hindered the identification of COs in many of these cases. In addition, most of these studies could not exclude the possibility of crossing over near chromosome ends, which has been observed in a number of species across kingdoms32. The budding yeast species Saccharomycodes ludwigii (Fig. 1a-b) preferentially undergoes intratetrad mating (Fig. 1c), ensured by strong inter-spore bridges that efficiently keep spores together in pairs of opposite mating types during germination and subsequent mating34,35. This organism was used in the early days of yeast genetics for the pioneering description of heterothallism by Øjvind Winge at the Carlsberg laboratory35,36. During his studies, Winge also observed in this species an unusual segregation pattern of two cell morphology markers35. The subsequent interpretation by Lindegren was that the two genes were not linked and that “each is so close to the spindle attachment that segregation invariably occurs at the Meiosis I without crossing over”37. While it could have been a coincidence that both markers were linked to centromeres, later work by the Oshima lab surprisingly revealed that the same behavior was displayed by any combination of more than 20 genetic markers tested. These findings led to the conclusion that this “may be due to the absence of crossing over in Sd. ludwigii”38,39. Here we continued this work by exploring the extent and types of meiotic interactions between homologous chromosomes in Sd. ludwigii. For this, we performed whole-genome sequencing and high-contiguity de novo assembly of wild-type strains, which enabled a high- resolution DNA variant segregation analysis of meiosis. We combined bioinformatic analyses of the meiotic gene repertoire with a functional study of key meiotic components in order to

derive a better understanding of the meiotic mechanisms in this species. We also searched for signs of recombination on an evolutionary scale between divergent strains of Sd. ludwigii in comparison to other species with different levels of meiotic recombination. In order to unravel the relative contributions of mutational pressure and recombination to genome evolution, we determined the genome-wide mutation rate and bias using a mutation accumulation experiment. Our results provide insights into the unique sexual lifestyle of the yeast species Sd. ludwigii, and they propose this organism as a particularly suitable model system for the study of the evolution of recombination rates and their impact on genome evolution.

Fig. 1: The budding yeast Saccharomycodes ludwigii. a, Classification of Sd. ludwigii in the yeast phylogeny. WGD: whole-genome duplication; CUG-Ser1/2 and CUG-Ala: clades deviating from the universal genetic code. b, Transmission electron microscopy images of representative Sd. ludwigii vegetative cells (reference strain NBRC 1722). c, Life cycle of Sd. ludwigii. Brightfield images of strains NBRC 1722 and its diploid progenitor NBRC 1721 are shown. d, Chiasmata in meiotic prophase I contribute to spindle stabilization and faithful segregation of homologous chromosomes. Meiosis in Sd. ludwigii, however, has been suggested to be achiasmate38,39.

Results

The Sd. ludwigii genome To investigate meiotic recombination in Sd. ludwigii, we first used long-read PacBio sequencing to generate a high-contiguity de novo genome assembly of our reference haploid strain NBRC 1722 (Supplementary Table 1). The 12.5-Mb assembly consists of 7 chromosomal scaffolds, in concordance with PFGE karyotyping39,40 (Fig. 2a) and previous genetic mapping38,39. Gene synteny and DNA motif analyses (Extended Data Fig. 1a) enabled the identification of putative point centromeres on all chromosomes. The extremities of all scaffolds share subtelomere-related repetitive sequences and genes, while telomeric DNA repeats were also detected in 9 cases (Extended Data Fig. 1b). A single mating-type locus (MATalpha) was identified in the centromeric vicinity of chrE (Fig. 2a), in congruence with the known heterothallic nature of the species35,36. The Sd. ludwigii genome shares many features with Saccharomycetaceae members that diverged before the whole-genome duplication event (Fig. 1a), including genome size, number of chromosomes, point centromeres, overall gene synteny, number of genes (5,031 ORFs) and frequency of introns (3.3%). Remarkably, Sd. ludwigii chromosomes exhibit GC levels that are unusually low for a yeast species (30.9% on average; Fig. 2a), as shown by a comparison to 100 yeast and other fungal genomes (Extended Data Fig. 2a; Supplementary Table 2). The comparative analysis further revealed exceptionally high coverage in Sd. ludwigii by AT-rich low-complexity regions and simple sequence repeats (microsatellites), as well as enrichment in transposable elements (Extended Data Fig. 2b-e). Meiotic crossing over could be hindered in chromosomal regions of Sd. ludwigii that do not align during meiotic prophase I due to major sequence variation or structural differences of the homologous chromosomes. To investigate whether high genomic dissimilarity could be responsible for the scarcity of COs observed in previous analyses38,39 that used our reference strain as one of the parents, we also sequenced and assembled de novo the genome of the second parent used in those experiments (NBRC 1723; Supplementary Table 1). The two parental genomes are highly collinear (Fig. 2b) and similar at the DNA sequence level (99.6% identity on average), apart from the terminal region of chrA and the longest part of chrF, which exhibit lower degrees of sequence identity (95.3% on average). These findings exclude the possibility that the absence of COs could be due to major differences between homologous chromosomes. Another possibility for the explanation of the extreme rarity of previously detected COs could be a non-random chromosomal distribution of the UV-generated genetic markers used in those analyses38,39. By combining the results of our gene prediction and annotation of the reference assembly with the phenotypic gene annotations of S. cerevisiae (www.yeastgenome.org), we identified the chromosomal positions of 16 out of the 24 used markers (Fig. 2c). This analysis revealed that all chromosomes were covered by markers, most of which were quite distant from the corresponding centromeres. Therefore, the

previously used experimental setup38,39 appears sufficient for capturing the majority of COs in the largest part of the genome.

Fig. 2: Genome structure of Sd. ludwigii and mapping of previously used genetic markers. a, The nuclear genome of the haploid reference strain NBRC 1722 is organized in 7 chromosomes, resolved as chromosomal bands on a PFGE gel (left) and depicted as bars (right). The only gap in the assembly (in chrB) corresponds to the internal part of the rDNA region, which is flanked by assembled rDNA repeats. b, Genomic comparison of the Sd. ludwigii parental strains used in the previous genetic analyses. c, The 7 previously defined Sd. ludwigii linkage groups39 were matched to the 7 chromosomes of the reference genome assembly, and 16 of the previously used markers were unambiguously mapped on the assembly (yellow circles). The MAT locus is shown as a blue circle (in chrE). One of the rare COs that were previously detected using tetrad analysis was tracked down to a reciprocal exchange event between the marker “ade3” (corresponding to the ADE4 gene) and the centromere of chrF, depicted here as an example.

The Sd. ludwigii meiotic gene machinery To gain insight into the genetic causes of the unusual meiotic behavior of Sd. ludwigii, we manually refined the gene prediction and we curated the annotation of Sd. ludwigii genes based on the available S. cerevisiae dataset (www.yeastgenome.org). Gene prediction yielded a total of 5,347 genes, of which 5,031 are protein-coding ORFs. Among these genes, we identified homologs of 272 out of the 284 genes of S. cerevisiae with annotated functions in meiosis (Gene Ontology terms; www.yeastgenome.org), using protein sequence similarity and gene synteny as criteria (Fig. 3a; Supplementary Table 3). All genes that are required for wild-type levels of meiotic recombination in S. cerevisiae have homologs in Sd. ludwigii, with the only exception of MER141 (Fig. 3a). This gene codes for a meiosis-specific splicing activator for introns in the genes AMA1, HFM1, REC107 and SPO22, which function in chromosome pairing, meiotic recombination and cell cycle regulation. Deletion of MER1 in S. cerevisiae abrogates the expression of these 4 target genes and causes major defects in meiotic recombination and progression41,42. However, the Mer1 regulon of Sd. ludwigii appears largely rescued, as no introns were detected in 3 of its target genes (AMA1, HFM1 and REC107), while SPO22 has only a minor role in S. cerevisiae meiosis43. By investigating the phylogenetic distribution of MER1 we confirmed its ancestral origin as syntenic homologs were identified in the distant families Phaffomycetaceae, Ascoideaceae and Saccharomycopsidaceae (Fig. 1a; 3a). Therefore, its absence from Sd. ludwigii and the closely related Hanseniaspora species must be due to a secondary loss early in the evolution of their family (i.e. Saccharomycodaceae; Fig. 3a). Apart from MER1, no homologs were detected in Sd. ludwigii for 11 additional genes with meiotic functions, namely NEJ1, DNL4, LIF1, GMC1, CNN1, NKP1, NKP2, WIP1, SPO12/BNS1 (paralogs in S. cerevisiae), WTM1 and ESC8/IOC3 (paralogs in S. cerevisiae) (Fig. 3b). In contrast to MER1, inactivation of any of these genes in S. cerevisiae does not abrogate meiotic crossing over. With the exception of DNL4, these genes are also absent from members of the Pichiaceae that are known to form COs in meiosis, such as Komagataella phaffii and Ogataea polymorpha19,44. A phylogenetic analysis suggested that 7 of these genes (i.e. LIF1, NKP1, NKP2, CNN1, WIP1, GMC1 and WTM1) are present only in Saccharomycetaceae members, and thus have probably emerged after the separation of the Sd. ludwigii lineage. Among the remaining 4 genes, DNL4 and NEJ1 (involved in nonhomologous end joining, NHEJ45) are also missing from Lachancea kluyveri, which is capable of meiotic crossing over17, while SPO1246 and ESC847 have only minor and indirect roles in S. cerevisiae meiosis. Overall, our results demonstrate very limited meiotic gene loss and the retention in Sd. ludwigii of the essential gene machinery for meiotic recombination. Eight of the putative Sd. ludwigii meiotic proteins have little or no similarity to their S. cerevisiae homologs, and the identification of their genes was mostly based on synteny. These are MEI4, NDJ1, PSY3, SPO16, REC104, POL4, IML3 and HED1 (Supplementary Table 3). Using similarity searches with either the S. cerevisiae or Sd. ludwigii protein sequences as queries, most of these genes could not be detected in the closely related

Hanseniaspora species, which is consistent with extensive loss of genes involved in DNA repair, cell cycle regulation and meiosis from those species48.

Fig. 3: Sd. ludwigii possesses a nearly full meiotic gene complement. a, Meiotic genes of Sd. ludwigii and other yeast representatives. Genes were classified into functional groups (top) based on the associated GO terms of their S. cerevisiae homologs (www.yeastgenome.org), and the total gene count for each of them is plotted for each species (right). Apart from the presumably asexual species C. glabrata49, Hanseniaspora jakobsenii, for which sexual sporulation has not been reported to date50, and the mitosporic yeasts Candida mycetangii, C. orba, C. stellimalicola, C. ponderosae, C. montana and C. vartiovaarae, all other 71 species included in this analysis are sexual. The names of species with documented meiotic recombination appear in bold17,19,44,51,52. b, Meiosis/meiotic recombination- related genes that are absent from the reference Sd. ludwigii strain are summarized here. Presence or absence of homologs is also indicated for all other species, for comparison. The function of each gene is indicated by a colored circle beneath its name (color code as in a).

Meiotic recombination components are required for Sd. ludwigii meiosis The presence of a nearly intact meiotic gene machinery suggests that these genes are functional in Sd. ludwigii. This is further supported by our finding that deletion of SPO11, which in other organisms initiates meiotic recombination by generating DNA DSBs, led to significantly reduced sporulation and spore viability (Fig. 4a), similarly to spo11 hypomorphs of S. cerevisiae53,54. These results indicate an important function of this protein in meiosis. Since S. cerevisiae Δspo11 mutants also exhibit defects in chromosome synapsis10, we also deleted SAE2, an endonuclease that operates downstream of Spo11 in DSB processing and cleavage of DNA-Spo11 intermediates55. This led to a similar sporulation defect to that of the Δspo11 strain (Extended Data Fig. 3), suggesting a role for the endonuclease function of Spo11 in Sd. ludwigii meiosis. In order to confirm directly the occurrence of Spo11- dependent DSBs, we investigated the meiotic localization of Rad51, a recombinase that is involved in DSB repair8. Using an anti-Rad51 antibody, we detected discrete foci in spreads of meiotic Sd. ludwigii chromosomes. No such foci were observed in Δrad51 or Δspo11 mutants, indicating the specificity of detection and the dependence of DSBs on Spo11 (Fig. 4b). We detected 5-12 foci per nucleus, which would be consistent with the formation of 1-2 Spo11-dependent DSBs per meiotic chromosome. Our results overall suggest that Spo11 is required for normal meiosis in Sd. ludwigii, through the generation of meiotic DNA DSBs. We also performed Rad51 immunostaining in meiotic spreads of Sd. ludwigii cells deleted for DMC1, a ubiquitous meiosis-specific recombinase involved in DSB repair as well as in homolog interactions. In this case, we observed elongated, filamentous foci (Fig. 4c), which is consistent with the anticipated function of Dmc1 as an inhibitor of the Rad51 strand exchange activity56. Another conserved single-stranded (ss) DNA-binding protein that is involved in DNA replication, repair and recombination, is Rfa1. We detected expanded Rfa1 foci in Δdmc1 meiotic spreads, whereas no foci were detected in wild-type spreads (Fig. 4d). This is congruent with the normally transient nature of ssDNA-binding activity of Rfa1, which is replaced by Dmc1, and the accumulation of ssDNA at DSBs in Δdmc1 cells, similarly to S. cerevisiae57. Overall, formation of meiotic DSBs and their recombinational repair, mediated by key meiotic components, are required for normal meiosis in Sd. ludwigii, consistently with what is known from S. cerevisiae.

Fig. 4: Core meiotic recombination components are required for normal meiosis in Sd. ludwigii. a, Meiotic time-course analysis of a homozygous Δspo11 Sd. ludwigii mutant in comparison to its wild type (left). After induction of meiosis, samples were withdrawn at the indicated time points and their cellular DNA content was stained with Hoechst 33258 to determine the fractions of binucleate (meiosis I) and tetranucleate (meiosis II) cells. Error bars: SD (3 replicates for each strain). Spore viability was examined using tetrad dissection and viable colony counting (right). A total of 50 tetrads of each strain were analyzed. b-d, Meiotic nuclear spreads of sporulating cells with the indicated genotypes (homozygous diploids). Cellular DNA was stained with Hoechst 33258. Immunostaining was performed using anti-Rad51 or anti-Rfa1 antibodies. Bars: 1 µm.

High-resolution analysis of meiotic segregation in Sd. ludwigii Our findings suggest that meiotic recombination might still be occurring in Sd. ludwigii, albeit with patterns that perhaps prevented detection by segregation analyses using only few markers. To address this, we performed a high-resolution genome-wide SNP segregation analysis of Sd. ludwigii meiosis (Fig. 5a; Extended Data Fig. 4a). We used as parents the reference strain and a spore that we isolated from a tetrad of a geographically distant strain (spore 122; Supplementary Table 1). Crosses between these two haploid strains frequently formed tetrads with 4 viable spores. Long-read sequencing and de novo assembly of the second parent’s genome did not reveal significant karyotypic differences that could prevent pairing of homologous chromosomes in this cross (Fig. 5b). Variant calling between the two strains resulted in a total of 199,392 high-quality SNPs, with an average density of 34 SNPs per kb of genomic sequence on chrC, chrF, chrG and parts of chrA and chrB, whereas the remaining parts of the genome exhibited lower heterozygosity levels, of approx. 3 SNPs per kb on average (Extended Data Fig. 4b). Sequencing of all spores from 5 full tetrads from this cross followed by analysis of the SNP segregation patterns revealed complete absence of meiotic COs (Fig. 5c). The same was observed when we extended our analysis to 2 tetrads from a cross between 2 spores of the second parents’ lineage (spores 100 and 102; Supplementary Table 1; Extended Data Fig. 4a). These results confirm the previous genetic evidence that suggested extreme rarity of meiotic crossing over in Sd. ludwigii38,39. Among the 7 tetrads, we detected 2 independent single-marker NCOs (gene conversion tracts with 3:1 segregation patterns; Fig. 5d), which were validated by PCR amplification and sequencing. Their maximum tract lengths were 5.8 and 0.6 kb, respectively (calculated based on the distance between their closest flanking SNPs with 2:2 segregation patterns). This suggests that at least some of the meiotic DSBs are processed by interactions that use the homologous chromosome as repair template without, however, leading to CO formation. Finally, our analysis revealed a 21.1 kb-long loss-of-heterozygosity (LOH) tract (Fig. 5e), which could have resulted from a mitotic gene conversion event during diploid growth preceding sporulation. This LOH event occurred in close proximity to a 2.5 kb-long region of distinctly lower SNP density than that of the flanking chromosomal regions (Fig. 5e), indicating that another ancient event had occurred in the same region. Telomeric regions of chromosomes are highly repetitive (Extended Data Fig. 1b) and this could compromise the sensitivity of our method for the detection of COs in these regions16,17,19,32. To investigate the possibility of crossing over in telomeric or telomere- proximal regions, we used meiotic chromosome spreads to compare the localization of GFP- tagged Rap1, a cytological marker of telomeres58, and that of Rad51 foci as an indicator of meiotic DSBs8. Our experiments consistently demonstrated absence of co-localization of the 2 proteins (Fig. 5f). Therefore, initiation of recombination is not biased towards telomeres or adjacent regions in Sd. ludwigii, and the extreme suppression of crossing over appears to affect the entire genome.

Fig. 5: A high-resolution segregation analysis revealed the absence of crossing over in Sd. ludwigii meiosis. a, Experimental setup (further details in Extended Data Fig. 4a). b, Genomic comparison of the haploid parental strains. c, Results of the genome-wide SNP segregation analysis for a representative tetrad. Each dimorphic position of the genome was assigned to one of the parental haplotypes (red for the reference strain, blue for spore 122). d, Two verified single-marker NCOs were detected by the SNP segregation analysis. e, A single LOH event was detected in tetrad

985-988, in close proximity to another shorter region with unusually low SNP density. f, Immunostaining of meiotic nuclear spreads of a Sd. ludwigii strain expressing Rap1-GFP using anti- Rad51 and anti-GFP antibodies. Bar: 1 μm.

Search for signs of historical crossing over in Sd. ludwigii The unusual suppression of homolog interactions in Sd. ludwigii meiosis motivated us to search for signs of recombination by comparing divergent strains of international origin. For this, we sequenced 10 available haploid and diploid strains (Supplementary Table 4), two of which were found to be aneuploids (2n+1 trisomies) by a read coverage analysis (Extended Data Fig. 5a). Variant calling and comparison to our reference strain revealed variable sequence divergence (~18,000-308,000 SNPs) and heterozygosity levels in diploids (~1,300-60,000 heterozygous SNPs) (Supplementary Table 4). Apart from the very divergent haploid strain PC99_R_1, sequence variation showed non-uniform patterns of distribution across the genome, being mostly restricted to particular chromosomes (spore 122) or, in most strains, to chromosomal segments (Extended Data Fig. 5b). Phylogenetic analysis of all strains based on their genome-wide SNP content revealed the presence of a major cluster of 7 strains, and 4 more divergent ones (Fig. 6a). When we compared the dendrograms of individual chromosomes, we observed chromosome- dependent topologies and distances for particular strains (Fig. 6a-b; Extended Data Fig. 5c). Our analyses revealed that chromosomes of strains with unusually unstable topologies differ significantly in SNP density from their genomic average (Extended Data Fig. 5e). One possible explanation for these contrasting chromosome-specific signals could be that absence or rarity of meiotic recombination over an extended period of time has deprived chromosomes of the corresponding homogenizing effect, allowing them to accumulate SNPs independently from their homologs to a certain extent. We gained further support for this hypothesis by performing the same analysis in the yeast Lachancea kluyveri, a Saccharomycetaceae member with a similar genome size and chromosome number to Sd. ludwigii, but with demonstrated capability of meiotic recombination17. The analysis revealed very stable topologies in L. kluyveri, with all chromosomes yielding the same topology as the whole genome (Extended Data Fig. 5d, 5f; Fig. 6b). Next, we performed a genome-wide linkage disequilibrium (LD) analysis in Sd. ludwigii, in comparison to L. kluyveri and S. cerevisiae, which are characterized by low and high meiotic recombination activity, respectively16,17. Generation of LD decay curves, for which the LD estimate r2 for each pair of SNPs is plotted versus their physical distance, revealed striking differences between the species (Fig. 6c). The overall levels of LD were unusually high in Sd. ludwigii, intermediate in L. kluyveri, and lowest in S. cerevisiae. Furthermore, LD decayed extremely fast in Sd. ludwigii, where it reached its plateau within the first ~50 bp, in contrast to the more gradual decay of the 2 other species, which is typical of recombining organisms59,60. Four of the Sd. ludwigii chromosomes exhibited even higher LD levels and faster decay than the genomic average (Extended Data Fig. 6a). To address the limitation of

the small sample size in these analyses (due to the limited availability of wild-type Sd. ludwigii strains), we always compared groups of the same size (11 strains for all species), and we also compared multiple groups of randomly selected strains of L. kluyveri and S. cerevisiae. Curves of LD decay were quite stable and the observed differences between species were independent of the particular group considered (Extended Data Fig. 6b). These results are consistent with the hypothesis of absent or very rare meiotic recombination in Sd. ludwigii over evolutionary time, which would decrease the overall LD levels and decelerate its decay.

Fig. 6: Crossing over has been absent or unusually rare in Sd. ludwigii over evolutionary time. a, Dendrograms of Sd. ludwigii strains, constructed by neighbor-joining analysis of all SNPs genome- wide (“whole genome”) or SNPs of individual chromosomes. The dendrograms of the remaining chromosomes are shown in Extended Data Fig. 5c. b, Scores of tree difference (5 topological, unrooted metrics) between all combinations of whole-genome SNPs and SNPs of individual chromosomes, for Sd. ludwigii and L. kluyveri. The analyzed L. kluyveri strains and their corresponding dendrograms are provided in Extended Data Fig. 5d. The results shown here are based on normalized distances to the average values of 1,000 randomly generated tree pairs (uniform average method). MAS: unrooted maximum agreement subtree distance; MS: matching split distance; RF: Robinson-Foulds distance; PD: path difference distance; Q: Quartet distance. c, Decay of LD as a function of physical distance between SNP marker pairs, for Sd. ludwigii in comparison to representative L. kluyveri and S. cerevisiae groups of strains. The moving averages of the LD estimate r2 values are plotted for all SNP marker pairs (genome-wide) of different physical distances. All data (no line smoothing) for the first 2 kb of distance are plotted in the insets.

Mutation rate and genomic evolution in Sd. ludwigii A hypothetically elevated mutation rate could be a compensatory solution for the generation of genetic diversity in Sd. ludwigii in the absence of meiotic recombination, or even serve as a driver of achiasmate meiosis28. Furthermore, we reasoned that a significant AT bias of spontaneous mutations could explain the particularly low GC content of the Sd. ludwigii genome (Extended Data Fig. 2a). We investigated these hypotheses directly by a mutation accumulation analysis in 3 founder Sd. ludwigii strains: our haploid reference strain, a corresponding homozygous diploid strain, and the hybrid diploid strain used in our SNP segregation experiment (Table 1; Supplementary Table 1). We adopted a single-cell population bottlenecking regime of growth on agar plates to evolve 60 independent mutation accumulation lines for ~2,000 generations each. Such an experimental setup ensures fixation of the majority of spontaneous mutations and minimizes elimination of non-lethal deleterious mutations due to selection61. Sequencing and genome-wide analysis revealed a total of 186 line-exclusive single nucleotide mutations (SNMs) (Supplementary Table 5). This -11 -10 corresponds to an overall base-substitutional mutation rate (μbs) of 5.70 × 10 - 1.20 × 10 mutations per base per generation, for the 3 strain genealogies (Table 1). These rates, which are in line with the rate of another recently analyzed Sd. ludwigii diploid strain62 (7.3 × 10-11), fall within the range of unicellular eukaryotes, and they are even slightly lower than those of other yeast species62,63. Therefore, mutation rate in Sd. ludwigii is not unusually elevated. Similarly, the overall transition-to-transversion (Ts:Tv) ratio (1.21 in Sd. ludwigii) is comparable to the values reported for S. cerevisiae and expected for organisms with no cytosine methylation63. The Sd. ludwigii genome has a remarkably low GC content. We determined that, similarly to the majority of eukaryotes, Sd. ludwigii has a strong AT bias of spontaneous mutations, with SNMs that convert GC to AT occurring on average 3.6 times more frequently than SNMs in the opposite direction (Table 1). Based on this, the theoretical equilibrium GC content of the Sd. ludwigii genome should be 23.3%, if it were determined by spontaneous mutations alone. In these calculations we excluded repeat regions (~7% of the genome), since they are difficult to analyze and are associated with a high indel formation frequency64. The observed genomic GC content of the analyzed genomic fraction was 29.6%, which cannot be explained by the effect of spontaneous mutations only. Therefore, balancing forces in the opposite direction, such as selection on GC or GC-biased gene conversion63, are probably also present in Sd. ludwigii.

Table 1: Mutation accumulation analysis. The base-substitutional mutation rate (μbs), its Poisson 95% confidence interval (CI), the AT bias (weighted by genomic nucleotide composition), and the transition:transversion ratio (Ts:Tv) of spontaneous single-nucleotide mutations are provided for each strain genealogy.

mutation- # # observed μbs Poisson 95% AT driven Ts:Tv Strain generations mutations GC (/site/generation) CI bias equilibrium ratio (average) (# lines) content GC content haploid 9.62 × 10-11 - 2,037 85 (30) 1.20 × 10-10 2.92 0.255 0.296 1.18 (NBRC 1722) 1.49 × 10-10 isogenic 4.20 × 10-11 - diploid 1,920 48 (19) 5.70 × 10-11 5.85 0.146 0.296 1.53 7.55 × 10-11 (YLFP17-4) hybrid diploid 7.16 × 10-11 - 2,016 53 (11) 9.55 × 10-11 2.63 0.276 0.296 0.96 (YLFP188-1) 1.25 × 10-10

Mitotic LOH in Sd. ludwigii The striking rarity of homolog interactions in Sd. ludwigii meiosis prompted us to investigate the levels of mitotic homologous recombination, to understand whether the observed strong suppression is specific to meiosis. Further analysis of the 11 mutation accumulation lines of the hybrid diploid strain (Table 1) revealed a total of 22 LOH events (Supplementary Table 6), half of which occurred on chrA. Chromosome A is the largest chromosome (representing ~25% of the Sd. ludwigii genome). Whether this relative enrichment of events on this chromosome explains its lower SNP density compared to other chromosomes (Extended Data Fig. 4b) is unclear. Similarly non-uniform distributions of LOH events have been observed in S. cerevisiae65,66. Among the detected events, we identified one long terminal event (in chrC; ~183 kb), which could be attributed to either a mitotic crossover or a break- induced replication (BIR) event67. The remaining events were shorter interstitial LOH regions with a maximum length of 12.5 kb (Supplementary Table 6). These may be associated with mitotic crossing over or gene conversion65,66,68. The total genomic rate of LOH events was 9.9 × 10-4 events per generation, which is moderately lower than the 3-10 times higher frequencies reported for S. cerevisiae65,66. Therefore, the core machinery for repair of spontaneous DSBs during the vegetative life phase of Sd. ludwigii is present and functional. The extreme suppression of recombination is, therefore, limited to meiosis.

Discussion

Intermixing of genomes for the generation of variability is the unifying theme of sexual reproduction. Although sexual life cycles appear very diverse in nature6, genomic reshuffling through meiotic reassortment and recombination of homologous chromosomes is regarded as a common denominator of sexual cycles2,7. The level of heterozygosity present in individuals and, therefore, the extent of genetic diversity in populations are largely dependent on mating strategies. This is clearly illustrated in the case of yeasts that can alternate between outcrossing and inbreeding reproductive regimes23. Frequent intratetrad mating, in particular, preserves high levels of heterozygosity in parts of the genome (Fig. 7a), ensures efficient purging of deleterious mutations, and provides fitness advantages25,27,28,69. Suppression of recombination in organisms that often engage in intratetrad mating could be beneficial for their evolution by extending the preservation of heterozygosity to larger parts of their genomes26 (Fig. 7b). Here, we describe the yeast Saccharomycodes ludwigii as an example of an organism with extremely suppressed meiotic recombination in a sexual cycle that is predominated by intratetrad mating. Our study shows that this species suppresses meiotic crossing over throughout its genome, and this behavior has persisted over evolutionary time. Our findings corroborate the hypothesis of Yamazaki and coworkers, who found that tetratype tetrads, putatively indicative of crossing over, are extremely rare in Sd. ludwigii crosses (i.e. 22 tetratypes out of a total of 2,234 analyzed tetrads)38,39. Meiotic recombination is initiated during the prophase of meiosis I of sexual eukaryotes with the programmed introduction of DNA DSBs by the conserved transesterase Spo118,10,52. It is thought that meiotic cells induce those dangerous lesions that put their genomic integrity at risk to induce the formation of COs that promote accurate segregation of homologous chromosomes by the establishment of chiasmata and exchange genetic information between them8,9,11. Given the high toxicity of DNA DSBs, organisms have evolved multiple pathways for their repair70. Meiotic cells preferentially rely on homologous recombination, which is the only pathway that can repair a subset of these DSBs to form COs, whereas the remainder are repaired as NCOs or using the sister chromatid as template for repair70,71. The pathway choice decision is controlled by multiple factors, including those that determine DSB positioning and the formation and processing of recombination intermediates72, and it can be subject to evolutionary selection. Our experiments revealed that Spo11-mediated introduction of DSBs is required for normal meiosis in Sd. ludwigii. Given that immunostaining of Rad51 for visualizing DSBs may underestimate their number by half or more73, we conclude that the observed 5-12 Rad51 foci could correspond to at least 1-2 DSBs per chromosome in Sd. ludwigii meiosis. The demonstrated involvement of Dmc1 in DSB processing suggests that at least a fraction of these DSBs are processed through homolog-templated repair pathways8,9,11, but with a strong bias towards NCOs as suggested by the absence of COs. This is supported by the detection of 2 NCOs in our meiotic SNP segregation analysis, which per se provides evidence for the presence of interhomolog

interactions in this species. Since such events typically involve short gene conversion tracts (usually 1-2 kb in S. cerevisiae16,74), more short-tract NCOs might have occurred in our analyzed tetrads but evaded detection due to the lower SNP density in some genomic regions, masking of low-complexity fractions of the genome (~7%) in our analysis, or restoration of the original genotype by the mismatch repair system. On the other hand, our study conclusively demonstrated absence of crossing over throughout the genome, which confirms its previous detection by tetratype analyses at extremely low levels38,39. These data suggest that meiotic interactions between homologs are needed for meiosis I in Sd. ludwigii, but DSB repair is biased towards NCOs, without reciprocal exchange of the flanking regions. Finally, considerable involvement of NHEJ in the repair of meiotic DSBs is unlikely, given that Sd. ludwigii misses 4 components of the major NHEJ pathway (i.e. Nej1, Dnl4, Lif1 and Pol4)75, which is anyway suppressed during meiosis of other organisms76,77. In the absence of crossing over in Sd. ludwigii meiosis I, compensatory mechanisms must be present to prevent nondisjunction of homologous chromosomes due to the lack of chiasmata9. In other organisms with sex- or chromosome-specific suppression of crossing over, components of the synaptonemal complex (SC) or specific cohesins facilitate segregation of meiotic chromosomes78,79. The unique meiotic behavior of Sd. ludwigii renders the functional dissection of its meiotic mechanisms an interesting goal of future research. In this context, the investigation of ZMM proteins that provide links between the SC and repair of meiotic DSBs80,81, as well as the characterization of components that regulate homolog bias and pathway choice9,72,82, could provide useful insights. Preliminary analyses in our lab revealed the presence of a SC and considerable roles of its core components in meiosis. In order to understand the particular regulation of meiotic recombination in Sd. ludwigii, an interesting subject might be the fast evolving meiotic proteins, i.e. the ones that have retained little homology to the corresponding S. cerevisiae genes: Rec104 participates in a complex with Spo11 during the initiation of recombination83; Mei4 also interacts with DSB formation proteins84,85; and Ndj1 and Spo16 are involved in the regulation of CO formation and distribution86,87. In the cases of Mei4, Rec104 and Pol4, the characteristic protein domains were not identifiable in the Sd. ludwigii putative homologs and the Sd. ludwigii Pol4 (component of NHEJ75) appears truncated (41.2% of the S. cerevisiae Pol4 length) and is predicted to be intrinsically disordered, suggesting loss of function and pseudogenization. However, further functional investigations depend on the development of Sd. ludwigii strains with higher sporulation rates and better synchronization of meiosis I than the currently available ones. Our findings support the hypothesis that achiasmate meiosis might have evolved in the Sd. ludwigii lineage on the basis of mutual selection between suppression of meiotic recombination and frequent intratetrad mating. The fixation of such a sexual lifestyle suggests that suppression of crossing over must have provided advantages to the organism, which must also have developed sufficient mechanisms or behaviors to compensate for the

absence of crossing over. Low recombination rates could have arisen through the accidental loss of an important meiotic gene, e.g. MER142, which might have spread to fixation possibly due to genetic hitchhiking by suppressing recombination along its entire chromosome. The need to overcome the negative consequences of the loss of crossing over could have driven the selection of secondary mutations that rescued the ability of the species to complete meiosis without the detrimental effects of frequent chromosome nondisjunction. One possible strategy that is often observed in Sd. ludwigii strains88 is the completion of meiosis with only one division, which leads to two-spore asci with diploid spores exhibiting excellent viability, according to our observations. Secondary loss of SPO12, which is absent from Sd. ludwigii, might have helped to achieve this and prevent a meiotic arrest in cell cycle progression, since natural S. cerevisiae strains lacking SPO12 and SPO13 exhibit the same behavior89. Alternatively, the risk of inviable spores due to chromosomal mis-segregation might be alleviated by mating in the tetrad with non-sister meiotic components, which would restore a full diploid chromosome complement (Fig. 7b) even in the case of aneuploid individual spores, which are still likely capable of mating28,90. The absence of recombination would not permit the exchange of mating types between non-sister chromatids in meiosis I and, therefore, the requirement for opposite mating types would lead to full reconstitution of the parental diploid genomic content upon mating. If intratetrad mating is prevented, e.g. by experimental dissection of tetrads, frequent spore aneuploidy as well as accumulation of haploid lethal mutations would be expected. This organism appears to be avoiding these risks by particularly enforcing intratetrad mating in its life cycle through the development of robust interspore bridges that keep non-sister spores tightly linked together in its asci91. These structures efficiently promote intratetrad mating35,37,92, and our investigations have revealed that their mechanical integrity depends on chitin synthase III, since deletion of CHS3 renders them much more fragile, similarly to L. kluyveri17. In this scenario, the duet of suppressed recombination and frequent intratetrad mating could have persisted because of the efficient preservation of heterozygosity and the fitness advantages that it could offer, according to previous research26–28. The establishment of a lifestyle that successfully copes with the lack of meiotic recombination does not exclude the possibility of rare outbreeding91 that would occasionally permit intermixing of chromosomes, as was observed in our study (Fig. 6a; Extended Data Fig. 6c). In addition, the species seems to not have completely abolished its ability to rarely recombine its genome38,39, which is reflected in the preservation of the corresponding gene arsenal, and the partial rescuing of its Mer1 regulon, possibly to compensate for the loss of MER1. However, those processes would require the maintenance of chromosomal structural stability, without which the accumulation of gross rearrangements in homologs would further hinder synapsis in meiosis I and preclude recombination. The loss of the classical NHEJ pathway from the Sd. ludwigii lineage (Fig. 3) could contribute to the preservation of genomic collinearity between different lineages of this species over longer evolutionary periods.

Recombination, genomic GC content and mutation rate are thought to be linked, although the causality of their relationships is still not fully understood63,93. We performed a mutation accumulation analysis to investigate the reason for the particularly low genomic GC level in Sd. ludwigii, which is reflected in numerous low-complexity regions and AT-rich microsatellites across its genome. Our study revealed that the base-substitution mutation rate is within the normal range of yeasts and other unicellular eukaryotes63. On the other hand, the strong detected AT bias of spontaneous mutations –similarly to many other organisms63,94– in conjunction with the presumably low relevance of GC-biased gene conversion61,63 due to the rarity of recombination, provides an explanation for the particularly low GC level of its genome. Nevertheless, balancing forces in the opposite direction must also act, given that the expected equilibrium genomic GC level would be 6.3% lower than the actual one if it were determined solely by the mutational load. Such forces could include selection on GC95, especially in the coding fraction of the genome due to codon usage constraints, and temporary or conditional changes of the mutation rate and/or bias96. Loss of heterozygosity has been suggested to offer rapid evolutionary solutions for the increase of phenotypic diversity and the adaptation to changing environments, by exposing recessive beneficial alleles which are masked in the heterozygous diploid state, or by alleviating negative epistasis of alleles in the heterozygous state66,97,98. Such adaptive flexibility could be very important in the case of Sd. ludwigii, which is predicted to generally preserve heterozygosity throughout its genome due to intratetrad mating without recombination. Our results indicate that LOH events, often resulting from mitotic COs or NCOs, occur in Sd. ludwigii at frequencies comparable to the ones observed in S. cerevisiae65,66, which are significantly higher than the base-substitution mutation rate. The suppression of recombination in Sd. ludwigii is, therefore, limited to meiosis, and LOH could be important for its adaptive potential. Long-standing theories about sex suggest advantages of recombination for adaptation to changing environments by combining beneficial alleles and disengaging them from deleterious mutations. Our findings open up the possibility that the extreme suppression of crossing over in meiosis has been coupled with a high intratetrad mating rate in Sd. ludwigii to ensure adaptive genome evolution in a trajectory that does not rely on meiotic recombination. Therefore, we envision that Sd. ludwigii provides a new paradigm and an excellent natural forum, in which to study experimentally the relationship of genome evolution and the evolution of recombination rate by manipulating factors that could influence the frequency of recombination, such as the rate of outbreeding.

Fig. 7: The evolutionary coupling of high rates of non-sister intratetrad mating with extremely suppressed meiotic recombination in Sd. ludwigii maximizes preservation of heterozygosity. a, Non-sister intratetrad mating with crossing over in meiosis I. The mating-type locus is linked to the centromere of its chromosome (which is often observed in species that engage in intratetrad mating, e.g. S. cerevisiae and Sd. ludwigii). b, Non-sister intratetrad mating with achiasmate meiosis I, which normally happens in Sd. ludwigii.

Data availability All sequencing datasets generated in this work have been deposited at the Sequence Read Archive (NCBI GenBank), included in the BioProjects with accession numbers PRJNA28063, PRJNA578491 and PRJNA639224. All genome assemblies have been deposited at GenBank as Whole Genome Shotgun projects, under the accession numbers JACTOA000000000 (version JACTOA010000000) for Sd. ludwigii strain NBRC 1722 (annotated genome assembly of our reference strain), JACTNW000000000 (version JACTNW010000000) for Sd. ludwigii strain NBRC 1723, and JACTNV000000000 (version JACTNV010000000) for Sd. ludwigii spore 122.

Acknowledgements We would like to acknowledge T. Yamazaki (University of Yamanashi, Japan) for his valuable feedback and useful advice on handling Sd. ludwigii. We are also grateful to A. Shinohara (Osaka University, Japan) for the anti-Rad51 antibody, E. Mancera (National Polytechnic Institute of Mexico) and L. Steinmetz (EMBL, Heidelberg, Germany) for the anti- Rfa1 antibody, J. Trček (University of Maribor, Slovenia) for the Sd. ludwigii isolate BJK_5C, and A. Giacomini (University of Padua, Italy) for the Sd. ludwigii isolate PC99/R. Funding/further support: This work was supported by a postdoctoral fellowship grant from the Cluster of Excellence CellNetworks (University of Heidelberg) to I.A.P. We also acknowledge support by the state of Baden-Württemberg through bwHPC for high- performance computing and SDS@hd for data storage (grant INST 35/1314-1 FUGG). Additional help was provided by the Flow Cytometry and the Deep Sequencing Core Facilities of the University of Heidelberg (both supported by CellNetworks).

Author contributions Conceptualization: M.K.; Methodology: M.K., I.A.P., J.S. and A.F.; Investigation: I.A.P., F.A.P. and H.M.; Formal analysis: I.A.P., F.D., A.F. and N.D.; Supervision: M.K. and I.A.P.; Visualization: I.A.P., F.D. and A.F.; Writing – Original Draft: I.A.P.; Writing – Review & Editing: I.A.P., M.K., J.S. and A.F.; Funding acquisition: M.K. and I.A.P.

Competing interests The authors declare no competing interests.

References 1. Otto, S. P. The Evolutionary Enigma of Sex. Am. Nat. 174, S1–S14 (2009). 2. Lenormand, T., Engelstädter, J., Johnston, S. E., Wijnker, E. & Haag, C. R. Evolutionary mysteries in meiosis. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 371, (2016). 3. Fisher, R. A. The genetical theory of natural selection. xiv, 272 (Clarendon Press, 1930). doi:10.5962/bhl.title.27468. 4. Muller, H. J. Some Genetic Aspects of Sex. Am. Nat. 66, 118–138 (1932). 5. Maynard Smith, J. The Evolution of Sex. (Cambridge University Press, 1978). 6. Bell, G. The Masterpiece of Nature: The Evolution and Genetics of Sexuality. (University of California Press, 1982). 7. Hartfield, M. & Keightley, P. D. Current hypotheses for the evolution of sex and recombination. Integr. Zool. 7, 192–209 (2012). 8. Hunter, N. Meiotic Recombination: The Essence of Heredity. Cold Spring Harb. Perspect. Biol. a016618 (2015) doi:10.1101/cshperspect.a016618. 9. Zickler, D. & Kleckner, N. Recombination, Pairing, and Synapsis of Homologs during Meiosis. Cold Spring Harb. Perspect. Biol. 7, a016626 (2015). 10. Keeney, S., Giroux, C. N. & Kleckner, N. Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family. Cell 88, 375– 384 (1997). 11. Gray, S. & Cohen, P. E. Control of Meiotic Crossovers: From Double-Strand Break Formation to Designation. Annu. Rev. Genet. 50, 175–210 (2016). 12. Phadnis, N., Hyppa, R. W. & Smith, G. R. New and old ways to control meiotic recombination. Trends Genet. TIG 27, 411–421 (2011). 13. Wang, S., Zickler, D., Kleckner, N. & Zhang, L. Meiotic crossover patterns: Obligatory crossover, interference and homeostasis in a single process. Cell Cycle 14, 305–314 (2015). 14. Barnes, T. M., Kohara, Y., Coulson, A. & Hekimi, S. Meiotic recombination, noncoding DNA and genomic organization in Caenorhabditis elegans. Genetics 141, 159–179 (1995). 15. Cromie, G. & Smith, G. R. Meiotic Recombination in Schizosaccharomyces pombe: A Paradigm for Genetic and Molecular Analysis. Genome Dyn. Stab. 3, 195 (2008). 16. Mancera, E., Bourgon, R., Brozzi, A., Huber, W. & Steinmetz, L. M. High-resolution mapping of meiotic crossovers and non-crossovers in yeast. Nature 454, 479–485 (2008). 17. Brion, C. et al. Variation of the meiotic recombination landscape and properties over a broad evolutionary distance in yeasts. PLOS Genet. 13, e1006917 (2017). 18. Liu, H., Maclean, C. J. & Zhang, J. Evolution of the Yeast Recombination Landscape. Mol. Biol. Evol. 36, 412–422 (2019). 19. Braun-Galleani, S. et al. Genomic diversity and meiotic recombination among isolates of the biotech yeast Komagataella phaffii (Pichia pastoris). Microb. Cell Factories 18, 211 (2019). 20. Neaves, L. E. et al. The fitness consequences of inbreeding in natural populations and their implications for species conservation – a systematic map. Environ. Evid. 4, 5 (2015). 21. Mogie, M. Automixis: its distribution and status. Biol. J. Linn. Soc. 28, 321–329 (1986). 22. Taxis, C. et al. Spore number control and breeding in Saccharomyces cerevisiae: a key role for a self-organizing system. J. Cell Biol. 171, 627–640 (2005). 23. Knop, M. Evolution of the hemiascomycete yeasts: on life styles and the importance of inbreeding. BioEssays 28, 696–708 (2006). 24. Fischer, G., Liti, G. & Llorente, B. The budding yeast life cycle: More complex than anticipated? Yeast 38, 5–11 (2021).

25. Zakharov, I. A. Increase in Homozygosity as a Result of Intratetrad and Intraoctad Fertilization in Fungi. Genet. Mosc. 4, 98–105 (1968). 26. Zakharov, I. A. Intratetrad mating and its genetic and evolutionary consequences. Russ. J. Genet. 41, 402–411 (2005). 27. Hood, M. E. & Antonovics, J. Mating Within the Meiotic Tetrad and the Maintenance of Genomic Heterozygosity. Genetics 166, 1751–1759 (2004). 28. Keller, P. J. & Knop, M. Evolution of Mutational Robustness in the Yeast Genome: A Link to Essential Genes and Meiotic Recombination Hotspots. PLoS Genet. 5, e1000533 (2009). 29. Noda, S. Achiasmate meiosis in the Fritillaria japonica group. Heredity 34, 373–380 (1975). 30. Riddle, N. C. & Elgin, S. C. R. The dot chromosome of Drosophila: Insights into chromatin states and their change over evolutionary time. Chromosome Res. 14, 405–416 (2006). 31. de la Fuente, R. et al. Meiotic Pairing and Segregation of Achiasmate Sex Chromosomes in Eutherian Mammals: The Role of SYCP3 Protein. PLoS Genet. 3, (2007). 32. Haag, C. R., Theodosiou, L., Zahab, R. & Lenormand, T. Low recombination rates in sexual species and sex–asex transitions. Philos. Trans. R. Soc. B Biol. Sci. 372, 20160461 (2017). 33. Stapley, J., Feulner, P. G. D., Johnston, S. E., Santure, A. W. & Smadja, C. M. Variation in recombination frequency and distribution across eukaryotes: patterns and processes. Philos. Trans. R. Soc. B Biol. Sci. 372, 20160455 (2017). 34. Simmons, R. B. & Ahearn, D. G. Ascospore Ornamentation in Saccharomycodes Ludwigii. Mycologia 77, 660–662 (1985). 35. Winge, O. & Laustsen, O. Saccharomycodes ludwigii Hansen, a balanced heterozygote. Comptes-Rendus Lab. Carlsberg Ser Physiol 22, 357–379 (1939). 36. Barnett, J. A. A history of research on yeasts 10: foundations of yeast genetics. Yeast Chichester Engl. 24, 799–845 (2007). 37. Lindegren, C. C. Yeast genetics: Life cycles, cytology, hybridization, vitamin synthesis, and adaptive enzymes. Bacteriol. Rev. 9, 111 (1945). 38. Yamazaki, T., Ohara, Y. & Oshima, Y. Rare occurrence of the tetratype tetrads in Saccharomycodes ludwigii. J. Bacteriol. 125, 461–466 (1976). 39. Yamazaki, T. & Oshima, Y. Saccharomycodes ludwigii has seven chromosomes. Yeast 12, 237–240 (1996). 40. Tavares, M. J., Güldener, U., Mendes-Ferreira, A. & Mira, N. P. Genome sequencing, annotation and exploration of the SO2-tolerant non-conventional yeast Saccharomycodes ludwigii. BMC Genomics 22, (2021). 41. Engebrecht, J., Voelkel-Meiman, K. & Roeder, G. S. Meiosis-specific RNA splicing in yeast. Cell 66, 1257–1268 (1991). 42. Engebrecht, J. & Roeder, G. S. Yeast Mer1 Mutants Display Reduced Levels of Meiotic Recombination. Genetics 121, 237–247 (1989). 43. Tsubouchi, T., Zhao, H. & Roeder, G. S. The meiosis-specific zip4 protein regulates crossover distribution by promoting synaptonemal complex formation together with zip2. Dev. Cell 10, 809–819 (2006). 44. Gleeson, M. A. & Sudbery, P. E. Genetic analysis in the methylotrophic yeast Hansenula polymorpha. Yeast 4, 293–303 (1988). 45. Deshpande, R. A. & Wilson, T. E. Modes of interaction among yeast Nej1, Lif1 and Dnl4 proteins and comparison to human XLF, XRCC4 and Lig4. DNA Repair 6, 1507–1516 (2007).

46. Stegmeier, F., Visintin, R. & Amon, A. Separase, polo kinase, the kinetochore protein Slk19, and Spo12 function in a network that controls Cdc14 localization during early anaphase. Cell 108, 207–220 (2002). 47. Cuperus, G. & Shore, D. Restoration of silencing in Saccharomyces cerevisiae by tethering of a novel Sir2-interacting protein, Esc8. Genetics 162, 633–645 (2002). 48. Steenwyk, J. L. et al. Extensive loss of cell-cycle and DNA repair genes in an ancient lineage of bipolar budding yeasts. PLoS Biol. 17, e3000255 (2019). 49. Gabaldón, T. & Fairhead, C. Genomes shed light on the secret life of Candida glabrata: not so asexual, not so commensal. Curr. Genet. 65, 93–98 (2019). 50. Ouoba, L. I. I. et al. Hanseniaspora jakobsenii sp. nov., a yeast isolated from Bandji, a traditional palm wine of Borassus akeassii. Int. J. Syst. Evol. Microbiol. 65, 3576–3579 (2015). 51. Zonneveld, B. J. M. & Steensma, H. Y. Mating, Sporulation and Tetrad Analysis in Kluyveromyces lactis. in Non-Conventional Yeasts in Genetics, Biochemistry and Biotechnology: Practical Protocols (eds. Wolf, K., Breunig, K. & Barth, G.) 151–154 (Springer, 2003). doi:10.1007/978-3-642-55758-3_23. 52. Lam, I. & Keeney, S. Mechanism and regulation of meiotic recombination initiation. Cold Spring Harb. Perspect. Biol. 7, a016634 (2014). 53. Klapholz, S., Waddell, C. S. & Esposito, R. E. The Role of the Spo11 Gene in Meiotic Recombination in Yeast. Genetics 110, 187–216 (1985). 54. Rockmill, B. et al. High Throughput Sequencing Reveals Alterations in the Recombination Signatures with Diminishing Spo11 Activity. PLOS Genet. 9, e1003932 (2013). 55. Lengsfeld, B. M., Rattray, A. J., Bhaskara, V., Ghirlando, R. & Paull, T. T. Sae2 is an endonuclease that processes hairpin DNA cooperatively with the Mre11/Rad50/Xrs2 complex. Mol. Cell 28, 638–651 (2007). 56. Lao, J. P. et al. Meiotic crossover control by concerted action of Rad51-Dmc1 in homolog template bias and robust homeostatic regulation. PLoS Genet. 9, e1003978 (2013). 57. Johnson, R. et al. Excess single-stranded DNA inhibits meiotic double-strand break repair. PLoS Genet. 3, e223 (2007). 58. Klein, F. et al. Localization of RAP1 and topoisomerase II in nuclei and meiotic chromosomes of yeast. J. Cell Biol. 117, 935–948 (1992). 59. Schacherer, J., Shapiro, J. A., Ruderfer, D. M. & Kruglyak, L. Comprehensive polymorphism survey elucidates population structure of Saccharomyces cerevisiae. Nature 458, 342–345 (2009). 60. Friedrich, A., Jung, P., Reisser, C., Fischer, G. & Schacherer, J. Population Genomics Reveals Chromosome-Scale Heterogeneous Evolution in a Protoploid Yeast. Mol. Biol. Evol. 32, 184–192 (2015). 61. Lynch, M. et al. A genome-wide view of the spectrum of spontaneous mutations in yeast. Proc. Natl. Acad. Sci. 105, 9272–9277 (2008). 62. Nguyen, D. T. et al. Variable Spontaneous Mutation and Loss of Heterozygosity among Heterozygous Genomes in Yeast. Mol. Biol. Evol. 37, 3118–3130 (2020). 63. Katju, V. & Bergthorsson, U. Old Trade, New Tricks: Insights into the Spontaneous Mutation Process from the Partnering of Classical Mutation Accumulation Experiments with High-Throughput Genomic Approaches. Genome Biol. Evol. 11, 136–165 (2019). 64. Sharp, N. P., Sandell, L., James, C. G. & Otto, S. P. The genome-wide rate and spectrum of spontaneous mutations differ between haploid and diploid yeast. Proc. Natl. Acad. Sci. 115, E5046–E5055 (2018). 65. Tattini, L. et al. Accurate Tracking of the Mutational Landscape of Diploid Hybrid Genomes. Mol. Biol. Evol. 36, 2861–2877 (2019).

66. James, T. Y. et al. Adaptation by Loss of Heterozygosity in Saccharomyces cerevisiae Clones Under Divergent Selection. Genetics 213, 665–683 (2019). 67. Zhang, K., Zheng, D.-Q., Sui, Y., Qi, L. & Petes, T. D. Genome-wide analysis of genomic alterations induced by oxidative DNA damage in yeast. Nucleic Acids Res. 47, 3521–3535 (2019). 68. St Charles, J. & Petes, T. D. High-resolution mapping of spontaneous mitotic recombination hotspots on the 1.1 Mb arm of yeast chromosome IV. PLoS Genet. 9, e1003434 (2013). 69. Johnson, L. J., Antonovics, J. & Hood, M. E. The Evolution of Intratetrad Mating Rates. Evolution 59, 2525–2532 (2005). 70. Mehta, A. & Haber, J. E. Sources of DNA double-strand breaks and models of recombinational DNA repair. Cold Spring Harb. Perspect. Biol. 6, a016428 (2014). 71. Goldfarb, T. & Lichten, M. Frequent and Efficient Use of the Sister Chromatid for DNA Double-Strand Break Repair during Budding Yeast Meiosis. PLoS Biol. 8, (2010). 72. Youds, J. L. & Boulton, S. J. The choice in meiosis - defining the factors that influence crossover or non-crossover formation. J. Cell Sci. 124, 501–513 (2011). 73. Bishop, D. K. RecA homologs Dmc1 and Rad51 interact to form multiple nuclear complexes prior to meiotic chromosome synapsis. Cell 79, 1081–1092 (1994). 74. Chen, J.-M., Cooper, D. N., Chuzhanova, N., Férec, C. & Patrinos, G. P. Gene conversion: mechanisms, evolution and human disease. Nat. Rev. Genet. 8, 762–775 (2007). 75. Tseng, H.-M. & Tomkinson, A. E. Processing and Joining of DNA Ends Coordinated by Interactions among Dnl4/Lif1, Pol4, and FEN-1 *. J. Biol. Chem. 279, 47580–47588 (2004). 76. Joyce, E. F., Paul, A., Chen, K. E., Tanneti, N. & McKim, K. S. Multiple Barriers to Nonhomologous DNA End Joining During Meiosis in Drosophila. Genetics 191, 739– 746 (2012). 77. Yun, H. & Kim, K. Ku complex suppresses recombination in the absence of MRX activity during budding yeast meiosis. BMB Rep. 52, 607–612 (2019). 78. Kurdzo, E. L., Obeso, D., Chuong, H. & Dawson, D. S. Meiotic Centromere Coupling and Pairing Function by Two Separate Mechanisms in Saccharomyces cerevisiae. Genetics 205, 657–671 (2017). 79. McKee, B. D., Yan, R. & Tsai, J.-H. Meiosis in male Drosophila. Spermatogenesis 2, 167–184 (2012). 80. Page, S. L. & Hawley, R. S. The genetics and molecular biology of the synaptonemal complex. Annu. Rev. Cell Dev. Biol. 20, 525–558 (2004). 81. Agarwal, S. & Roeder, G. S. Zip3 Provides a Link between Recombination Enzymes and Synaptonemal Complex Proteins. Cell 102, 245–255 (2000). 82. Niu, H. et al. Partner Choice during Meiosis Is Regulated by Hop1-promoted Dimerization of Mek1. Mol. Biol. Cell 16, 5804–5818 (2005). 83. Jiao, K., Salem, L. & Malone, R. Support for a Meiotic Recombination Initiation Complex: Interactions among Rec102p, Rec104p, and Spo11p. Mol. Cell. Biol. 23, 5928– 5938 (2003). 84. Menees, T. M. & Roeder, G. S. MEI4, a yeast gene required for meiotic recombination. Genetics 123, 675–682 (1989). 85. Maleki, S., Neale, M. J., Arora, C., Henderson, K. A. & Keeney, S. Interactions between Mei4, Rec114, and other proteins required for meiotic DNA double-strand break formation in Saccharomyces cerevisiae. Chromosoma 116, 471–486 (2007). 86. Chua, P. R. & Roeder, G. S. Tam1, a telomere-associated meiotic protein, functions in chromosome synapsis and crossover interference. Genes Dev. 11, 1786–1800 (1997).

87. Shinohara, M., Oh, S. D., Hunter, N. & Shinohara, A. Crossover assurance and crossover interference are distinctly regulated by the ZMM proteins during yeast meiosis. Nat. Genet. 40, 299–309 (2008). 88. Kurtzman, C. & Fell, J. W. The Yeasts - A Taxonomic Study (4th Edition). (Elsevier Science, 1998). 89. Klapholz, S. & Esposito, R. E. Isolation of SPO12–1 and SPO13–1 from a Natural Variant of Yeast That Undergoes a Single Meiotic Division. Genetics 96, 567–588 (1980). 90. Deutschbauer, A. M., Williams, R. M., Chu, A. M. & Davis, R. W. Parallel phenotypic analysis of sporulation and postgermination growth in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. 99, 15530–15535 (2002). 91. Kreger-van Rij, N. J. A new feature of the ascospores of Saccharomycodes ludwigii Hansen. Can. J. Microbiol. 15, 823–825 (1969). 92. Winge, Ö. The segregation in the ascus ofSaccharomycodes Ludwigii. Antonie Van Leeuwenhoek 12, 129–132 (1947). 93. Marsolier-Kergoat, M.-C. & Yeramian, E. GC Content and Recombination: Reassessing the Causal Effects for the Saccharomyces cerevisiae Genome. Genetics 183, 31–38 (2009). 94. Lynch, M. Evolution of the mutation rate. Trends Genet. TIG 26, 345–352 (2010). 95. Hildebrand, F., Meyer, A. & Eyre-Walker, A. Evidence of selection upon genomic GC- content in bacteria. PLoS Genet. 6, e1001107 (2010). 96. Liu, H. & Zhang, J. Yeast Spontaneous Mutation Rate and Spectrum Vary with Environment. Curr. Biol. 29, 1584-1591.e3 (2019). 97. Lancaster, S. M., Payen, C., Heil, C. S. & Dunham, M. J. Fitness benefits of loss of heterozygosity in Saccharomyces hybrids. Genome Res. 29, 1685–1692 (2019). 98. Peter, J. et al. Genome evolution across 1,011 Saccharomyces cerevisiae isolates. Nature 556, 339–344 (2018).

Methods

Yeast and bacterial strains – strain construction All yeast strains used in this study are listed in Supplementary Table 1. Growth media were as previously described for S. cerevisiae99. All yeast strains were incubated at 30 °C (with shaking of liquid cultures at 230 rpm) for vegetative growth or at 23 °C for sporulation. Gene deletion and tagging were performed using the PCR targeting method100. To increase transformation efficiency in Sd. ludwigii, 180-300 bp-long homology flanks were used, by using S. cerevisiae strain ESM356-1 for in vivo recombinational cloning of the DNA constructs or the NEBuilder HiFi DNA Assembly Cloning kit (New England Biolabs) for their in vitro assembly. High-fidelity DNA polymerases were always used for amplification of PCR cassettes for strain construction, whereas Taq DNA polymerases were routinely used for validation of engineered strains using colony PCR. All plasmids used in this study are provided in Supplementary Table 7. They were maintained and propagated in E. coli strain DH5α and carried the ampicillin resistance cassette for selection in lysogeny broth (LB) supplemented with ampicillin (100 μg ml-1). All DNA oligonucleotides used for plasmid/strain construction are listed in Supplementary Table 8. Preparation and transformation of E. coli competent cells were performed using standard procedures101.

Transformation of Sd. ludwigii A lithium acetate (LiAc)-based method was optimized and used to transform Sd. ludwigii. For preparation of competent cells, a 50-ml YPD culture was inoculated from a saturated starter culture at an initial OD600 of 0.1 and was incubated at 30 °C (shaking at 230 rpm) until OD600 was in the range 0.8-1.0. Cells were harvested by centrifugation (500 × g for 5 min) and washed once in 25 ml of sterile distilled water and once in 12 ml of LiSorb buffer (100 mM LiAc, 1 M sorbitol, 10 mM Tris-HCl pH 8.0, 1 mM EDTA-NaOH pH 8.0) at room temperature. Cells were resuspended in 360 μl of LiSorb buffer, followed by the addition of 40 μl of denatured carrier DNA solution (salmon sperm ssDNA, 10 mg ml-1; Invitrogen). Aliquots of 50 μl of these competent cells were used immediately for transformation (for maximum efficiency) or stored for future use at -80 °C (no snap freezing). For each transformation, an aliquot of competent cells was thawed at room temperature and up to 20 μg of DNA (in max. 5 μl of water) were added. After mixing, 300 μl of buffer SdlLiPEG (50 mM LiAc, 45% w/v PEG-3350, 10 mM Tris-HCl pH 8.0, 1 mM EDTA-NaOH pH 8.0) were added, and the suspension was mixed well before being incubated at room temperature for 2 h. Following this incubation, the sample was subjected to heat shock at 38 °C for 40 min; alternatively, DMSO was added to a final concentration of 15% and heat shock was performed at 38 °C for 15 min. Subsequently, the cells were washed twice in YPD medium (4,000 rpm for 2 min), before resuspension in 2 ml of this medium and incubation at 30 °C for at least 6 h (with shaking at 230 rpm). Finally, cells were pelleted again, resuspended in 100 μl of YPD medium, plated on selective medium and incubated at 30 °C for 3-4 days. Three to six independent transformants were streaked to single colonies on fresh selective medium and the genomic alterations were validated by colony PCR.

Mating and sporulation of Sd. ludwigii Mating of Sd. ludwigii strains was performed by mixing equal numbers of haploid cells of opposite mating types on YPD plates and incubating them at 30 °C for 16 h. The cell mixture was subsequently transferred directly to sporulation medium or was streaked to single colonies on double selective YPD plates that support growth of diploid cells only (in case of strains containing different markers). When wild-type strains without suitable markers were mated, diploid colonies were identified by visual inspection, based on their brittle and matte morphology. For sporulation in liquid cultures, diploid cells were pre-grown in YPD medium to early stationary phase and then transferred to liquid sporulation medium (1% potassium acetate, 1% glucose, 0.25% yeast extract) at an initial density of OD600=0.6. The culture was

incubated at 23 °C (with shaking at 230 rpm) for 3 days. For sporulation on plates, freshly grown cells from YPD plates were transferred to sporulation plates (2% w/v potassium acetate, 0.1% glucose, 2% agar) and incubated at 23 °C for up to 5 days.

Construction of isogenic Sd. ludwigii strains of opposite mating types Strain Sd. ludwigii NBRC 1722 (MATalpha) was used as the background strain for strain construction. To generate an isogenic MATa strain, a two-step replacement of the MATalpha locus was performed. Briefly, the URA3 gene of strain NBRC 1722 was replaced with the kanMX4 cassette. Then, the MATalpha locus was replaced with URA3, followed by replacement of the URA3 marker with a cloned copy of the MATa locus (from strain NBRC 1723), using selection on 5-FOA. This resulted in strain Sdl-339. All strains and their genotypes are listed in Supplementary Table 1.

Sd. ludwigii tetrad dissection For tetrad dissection, a loopful of sporulated cells were transferred to 100 μl of sterile water and 1 μl of a zymolyase 100T solution (10 mg ml-1; Amsbio) was added. The suspension was gently mixed, incubated at room temperature for 10 min, and afterwards stored on ice. Droplets (15 μl) of this suspension were spread in the middle of YPD plates, which were used for tetrad dissection with a dissection microscope (Singer Instruments). Compared to S. cerevisiae, tetrads of Sd. ludwigii exhibit strong interspore bridges that link pairs of spores (dyads). In order to dissect tetrads, these bridges have to be broken mechanically. This can be tedious, and meticulous manipulation is necessary to prevent spore damage. To facilitate breakage of interspore bridges, the method developed by Yamazaki38,39 was adopted. This involved placing a hydrated sterile cellophane sheet on the surface of the agar as a solid yet flexible support surface for dissection. Individual tetrads were carefully transferred onto it and spores were manipulated by lateral pushing rather than applying any pressure directly on them, since this could damage them. In addition, we used self-made glass needles with a little dent at one side in order to facilitate separation of dyads. Only with this setup, precise positioning of the dyads and exact application of forces to the bridges did we manage to dissect tetrads without damaging the spores. For analysis of mutants, we always dissected an equal number of control tetrads from wild-type cells.

Pulsed-field gel electrophoresis (PFGE) Spheroplasts were prepared from Sd. ludwigii cells, embedded in agarose plugs, lysed and processed for electrophoresis of intact chromosomes as previously described39, using the CHEF-DR II Pulsed Field Electrophoresis System (Bio-Rad).

Transmission electron microscopy (TEM) The glutaraldehyde-KMnO4 fixation method, followed by embedding in Agar 100, was used for electron microscopy of vegetative Sd. ludwigii cells as previously described102.

Immunostaining of meiotic spreads Spreads of Sd. ludwigii meiotic nuclei were prepared from sporulating cells in meiotic time courses using the procedure previously described for S. cerevisiae103 with some modifications. For spheroplast formation, 10 ml of a liquid sporulation culture were centrifuged at 700 × g for 5 min and the cell pellet was resuspended in 1 ml resuspension buffer (2% potassium acetate, 0.8 M sorbitol). Following the addition of 20 μl of a 0.5 M DTT solution and 25 μl of a zymolyase 100T (10 mg ml-1) solution, the sample was placed on a rotating wheel at 37 °C for digestion of cells; the process was monitored microscopically every 5 min. Cell shape changes during digestion; at first, cells become small and round, then their size increases by 2 to 3-fold and, finally, the cell wall disappears but the cell content is still held together by the plasma membrane. When at least 70% of the cells were at this stage, digestion was arrested by transferring the cells to a 15-ml tube containing 10 ml of ice-cold stop solution (0.1 M MES, 1 M sorbitol, 1 mM EDTA, 0.5 mM MgCl2, pH 6.4). The suspension was then centrifuged at 900 × g for 7 min (at 4 °C), the supernatant was

discarded and the cell pellet was gently resuspended in 30 μl of ice-cold stop solution without sorbitol (absence of sorbitol causes hypotonic burst of the cells). This was followed by the addition of 60 μl of fixative (4% formaldehyde, 1.5% sucrose, pH 7.3) and 30 μl of the suspension were pipetted onto a microscope slide previously coated with 0.1% w/v poly-L- lysine. The suspension was spread by tilting the slide, which was followed by the addition of 80 μl of 1% Lipsol and mixing by tilting the slide again. Another 80 μl of fixative were added and the slide was tilted again for mixing. The slide was then dried overnight under a fume hood, and it was subsequently stored in a Coplin jar at -20 °C or processed directly for immunostaining. Before immunostaining the slide was washed by immersion in PBS buffer for 10 min, which was followed by the addition of 100 μl of blocking buffer (0.5% BSA, 0.2% gelatin) and incubation for 10 min. The slide was covered with a coverslip during the incubation; to remove it before the next step of the procedure, the slide was immersed in PBS and gently shaken. For immunostaining, 40 μl of a primary antibody solution in blocking buffer were added, the slide was covered with a coverslip again and was incubated for 2 h in a humid chamber. The coverslip was then removed in PBS buffer and the slide was washed by immersion in PBS buffer for 5 min. Following that, 40 μl of a secondary antibody solution in blocking buffer were added on the slide, a coverslip was placed and the sample was incubated in a humid chamber for 1 h. The primary antibodies used were: rabbit anti-ScRfa1 (gift from E. Mancera), sheep anti-GFP (generated in our lab) at 1:500 dilution each, and rabbit anti-ScRad51 (gift from A. Shinohara) at dilution 1:1,000. The latter antibody104 was used for detection of discrete Rad51 foci, while the anti-GFP antibody was used for localization studies of GFP-tagged Rap1 in spreads of meiotic nuclei. The secondary antibodies used were: Alexa Fluor 488-conjugated donkey anti-rabbit IgG (Dianova), Cy2- conjugated donkey anti-sheep IgG (Dianova) and Cy3-conjugated donkey anti-rabbit IgG (Dianova), at 1:500 dilution each. For DNA staining, the coverslip was removed in PBS buffer and the slide was washed by immersion in fresh PBS buffer for 10 min (twice). The sample was then mounted with 20 μl of a Hoechst 33258 solution (0.5 μg ml-1) in 60% glycerol, a coverslip was added and sealed with nail polish. Single-plane epifluorescence images were acquired using an upright fluorescence microscope and a 100x Plan- Apochromat oil immersion objective. Image processing and merging of channels was performed using ImageJ105.

Mutation accumulation experiment Three Sd. ludwigii strains were used for the mutation accumulation study: the haploid reference strain NBRC 1722, the nearly isogenic diploid strain YLFP17-4 (homozygous diploid with the reference strain’s background) and the hybrid diploid strain YLFP188-1 (heterozygous diploid) (Supplementary Table 1). Clonal stocks of these parental strains were streaked on YPD plates, and randomly selected single colonies of each one served as founders of independent mutation accumulation lines (MALs). Spontaneous mutations were accumulated in 30, 19 and 11 MALs of the haploid, the homozygous and the heterozygous diploid strain, respectively, while they were growing under favorable conditions (YPD medium, at 30 °C). Each MAL was passed through a single-cell population bottleneck every 48 h by picking a random single colony and streaking it to single colonies on fresh YPD plates again. The plates were pre-marked with a target, and the single colony closest to the target was picked for each cycle, to ensure random colony selection. The experiment was performed for a total of 96-97 cycles, which corresponds to 2,037 generations for the haploid, 1,920 generations for the homozygous diploid, and 2,016 generations for the heterozygous diploid strain (each cycle corresponds to 20 generations for the homozygous diploid strain or 21 for the two other strains, as determined by resuspending 10 independent colonies of each one in water and counting cells using a Neubauer-improved hemocytometer, at the beginning of the experiment).

Ploidy determination using flow cytometry The cellular DNA content was analyzed by propidium iodide staining following ethanol fixation and flow cytometry on a FACSCanto II (BD Biosciences) instrument, according to standard protocols106.

Total DNA extraction from Sd. ludwigii for next-generation sequencing We optimized and used in this study two alternative methods that yielded total DNA of sufficient quality and quantity from Sd. ludwigii, as follows: DNA isolation with commercial kits: Liquid Sd. ludwigii cultures in YPD medium (early stationary phase) were processed for DNA extraction using the Genomic-tip 20/G (mini prep, starting with approx. 108 cells) or 100/G (midi prep, 109 cells) kit (QIAGEN), according to the manufacturer’s recommendations. An additional washing step with buffer QC was performed before the final elution step. Elution buffer QF was pre-warmed to 50 °C for maximum yield. To recover DNA following isopropanol precipitation, spooling with a pipette tip was preferably used, or alternatively DNA was pelleted by centrifugation at 4,500 × g for 40 min (at 4 °C). A washing step was performed using 500 μl of ice-cold 70% ethanol. Following centrifugation (13,000 rpm for 10 min at 4 °C), ethanol was completely removed, the sample was air-dried at room temperature for 10 min, and DNA was then resuspended in 100 μl (mini prep) or 200 μl (midi prep) TE buffer (pH 8.0). To further improve the quality of the isolated DNA, 100 μl of each DNA sample were further processed using the DNeasy PowerClean Pro Cleanup kit (QIAGEN), according to the manufacturer’s instructions. Total DNA was finally eluted in 50 μl of elution buffer (10 mM Tris-HCl, pH 8.0) and stored at -20 or -80 °C. Alternative DNA isolation method: Cells were harvested from a liquid culture in YPD medium (OD600 = 1), washed in 1 ml of resuspension buffer (0.9 M sorbitol, 0.1 M EDTA pH 7.5), pelleted again by centrifugation and finally resuspended in 0.4 ml of resuspension buffer amended with 1.4 mM β-mercaptoethanol. Subsequently, 20 μl of a zymolyase 100T solution (10 mg ml-1) were added, and the suspension was incubated at 37 °C for 30 min. Digested cells were layered over a sorbitol cushion (1.8 M) in a 50-ml tube, which was then centrifuged at 2,000 rpm for 15 min (at 4 °C). Sorbitol was discarded and the pellet was resuspended in 0.4 ml TE buffer (pH 8.0) after the addition of 90 μl of a solution containing 0.5 M EDTA, 2 M Tris and 10% SDS (pH 8.0). The sample was incubated at 65 °C for 30 min before the addition of 80 μl of a 5 M potassium acetate solution and incubation at 4 °C for at least 1 h (usually overnight). The sample was then centrifuged at 13,000 rpm for 15 min and the supernatant was mixed with 1 ml of ethanol. The precipitate was recovered by brief centrifugation (5 s) at maximum speed, and the pellet was then rinsed with 70% ethanol, air-dried and gently resuspended in 0.5 mL TE buffer (pH 8.0). The sample was centrifuged again (13,000 rpm for 15 min) to remove any insoluble material, and 5 μl of an RNase A solution (5 mg ml-1) were added to the supernatant, which was followed by incubation at 37 °C for 30 min. Two consecutive phenol-chloroform-isoamyl alcohol (25:24:1) extraction steps followed (the 5Prime Phase Lock Gel system was used for maximum recovery), and 0.6-0.8 volumes of isopropanol were added for DNA precipitation by centrifugation (13,000 rpm for 10 min, at 4 °C). Total DNA was washed with 70% ethanol, dried and resuspended in 50 μl molecular grade water. For removal of polysaccharides, the DNA sample was mixed with 0.1 volume of a hexaamminecobalt(III) chloride solution (100 mM) and centrifuged at 13,000 rpm for 5 min. The pellet was washed with 200 μl of water and dissolved in 50-100 μl of exchange buffer (100 mM EDTA pH 8.0, 2 M guanidinium thiocyanate) at 37 °C for 1 h. Once the pellet was completely dissolved, total DNA was precipitated, washed, dried and finally resuspended in 50 μl TE buffer (pH 8.0). Agarose gel electrophoresis, UV spectrophotometry and fluorometry (Qubit 4.0, using the Qubit dsDNA HS Assay Kit; Invitrogen) were used for the assessment of the quality and quantity of the isolated DNA. During optimization of the extraction protocols, DNA quality was characterized using the Fragment Analyzer (with the Genomic DNA 50 kb kit; Agilent).

Next-generation sequencing (NGS) Short-read (Illumina) and long-read (Pacific Biosciences, Oxford Nanopore Technologies) sequencing methods were used in this study for addressing different questions. Library preparation workflows and sequencing procedures are summarized below. Illumina sequencing: For sequencing on an in-house Illumina NextSeq instrument, libraries were prepared using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs), using the appropriate protocols for DNA samples of 50 ng (lower input, without size selection) or 250 ng (higher input, with size selection), according to the manufacturer’s recommendations. Enzymatic fragmentation of DNA was controlled to generate fragment size distributions in the range of 300-500 bp. For PCR enrichment of adaptor-ligated DNA, 6 or 7 amplification cycles were used for samples with higher and lower starting amounts of DNA, respectively. Multiple DNA samples were barcoded with unique dual indices using the NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs) (New England Biolabs) and pooled at equimolar concentrations. The NEBNext Library Quant Kit for Illumina (New England Biolabs) was used for the qPCR-based quantification of the pooled library, which was then loaded on a high-output flow cell (NextSeq 500/550 High Output Kit v2.1, 300 cycles; Illumina) for sequencing on an Illumina NextSeq 550 sequencer, in paired-end mode (2x150 bp). Alternatively, Illumina sequencing was performed on MiSeq and HiSeq 2000 instruments, at the EMBL Genomics Core Facility (Heidelberg, Germany), in paired-end mode (2x150 and 2x100 bp for MiSeq and HiSeq systems, respectively). Sequencing libraries were prepared by the Deep Sequencing Core Facility (University of Heidelberg, Germany). Briefly, mechanical shearing using a Covaris ultrasonicator was used for DNA fragmentation to a size range of 300-500 bp. The NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs) was used for library preparation, and 8 PCR cycles were performed for amplification of adaptor-ligated DNA. The quality and quantity of libraries were assessed by using a Qubit fluorometer (Invitrogen) and a Bioanalyzer instrument (Agilent). Pacific Biosciences SMRT (single-molecule real-time) sequencing (PacBio): For the generation of the de novo genome assembly of our reference Sd. ludwigii strain we used PacBio sequencing, which was performed at GATC Biotech AG (now Eurofins Genomics). Library preparation briefly involved DNA fragmentation, size selection (using a BluePippin instrument; Biozym Scientific), DNA end repair and adaptor ligation, annealing of the primer and the polymerase. The PacBio library was then sequenced on 2 SMRT cells in a PacBio RS II instrument (run mode: 240 min. movie) using the P6-C4 chemistry. This yielded a total of 2.52 Gb of pass-filter sequence data, which corresponds to an average genomic sequencing depth of approx. 200x. Oxford Nanopore Technologies sequencing (ONT): Generation of genome assemblies of other Sd. ludwigii strains was based on ONT sequencing on a MinION sequencer. The Ligation Sequencing Kit (for 1D experiments; SQK-LSK109) was used for library construction, starting from 1 μg of total DNA of each sample, and different samples were barcoded using the Native Barcoding Expansion 1-12 (PCR-free) kit (both kits were purchased from Oxford Nanopore Technologies) and pooled for multiplexed sequencing (according to the manufacturer’s instructions). No fragmentation of the input DNA was performed. The sequencing libraries were loaded on R9.4.1 flow cells and sequenced on a MinION device. Each strain was sequenced until the desired amount of sequencing data was gathered, corresponding to average genomic sequencing depths of approx. 30-40x.

Bioinformatics Genome assemblies: The de novo genome assembly of the reference Sd. ludwigii strain NBRC 1722 was based on high-coverage PacBio sequencing data. A total of 193,117 reads (totalling 2,518,671,875 bp and corresponding to an average genomic sequencing depth of approx. 200x) with mean length 13,041 bp and mean q-score 0.827 passed the filter (SMRT Portal, Pacific Biosciences). The PacBio HGAP.3 pipeline (Hierarchical Genome Assembly Process) within SMRT Analysis v2.3.0 (Pacific Biosciences) was used for the assembly (mapping single-pass reads to seed reads, generating and quality trimming pre-assembled

consensus sequences, assembling long high-quality reads using the Celera Assembler107 and consensus polishing using Quiver108). One of the resulting scaffolds (with length 22,745 bp and GC content 11.7% was determined using BLAST+ v2.8.0109 to be part of the mitochondrial genome and was removed from the nuclear assembly. Subsequently, we used an Illumina MiSeq 2x150-bp paired-end read dataset generated from the same DNA sample for further polishing of the assembly using Pilon110 (version 1.22), to generate the final assembly version (with an N50 value of 1,848,403 bp). The genome is organized in 7 chromosomes, with a total size of 12,500,424 bp and an overall GC content of 30.9%. Chromosome B is interrupted by the single rDNA locus, which is estimated to be at least 100 kb-long (based on the PFGE profile of the strain) and is represented by the only gap in the assembly. Only one small (26,468 bp-long) subtelomeric scaffold (“scaffold1”) could not be unambiguously linked to any of the chromosomal scaffolds, but it is presumed to be part of the right extremity of chrG (based on repetitive subtelomeric content analysis, gene synteny and co-segregation in meiosis). For whole-genome comparisons of the reference genome with those of Sd. ludwigii strains 122 and NBRC 1723, we used ONT sequencing and generated de novo assemblies of their genome sequences. For this, we used 93,607 filter-passing reads (totalling 407,656,509 bp and corresponding to an average genomic sequencing depth of approx. 33x) with an N50 read length of 6.89 kb and a mean q-score of 13.242 for strain 122, and 102,478 filter-passing reads (totalling 526,253,091 bp and corresponding to a genomic depth of approx. 42x) with an N50 read length of 7.76 kb and a mean q-score of 13.586 for strain NBRC 1723. We used the GPU-accelerated base-caller Guppy (v2.3.5; Oxford Nanopore Technologies) with the high-accuracy model (“flip-flop” algorithm) for base-calling. Demultiplexing of barcoded reads and trimming of ONT adaptors were performed using Porechop (v0.2.4; https://github.com/rrwick/Porechop). Genome assembly were then constructed using SMARTdenovo (https://github.com/ruanjue/smartdenovo), which generates assemblies from all-vs-all raw read alignments, with parameters “-c 1 -k 14 -J 500 -e zmo”. Scaffolds of the strain 122 assembly were polished using an Illumina MiSeq 2x150- bp paired-end sequencing dataset of the same strain and Pilon110 (v1.23). Subsequently, the assemblies were scaffolded further using ONT long read information with SSPACE- LongRead111 (v1-1) and, in the case of strain 122, gaps were closed using GapFiller112 (v1- 10) and the previously mentioned paired-end Illumina MiSeq reads. The NBRC 1723 assembly was corrected by mapping the raw ONT reads using minimap2113 (2.17) and then using Racon114 (v1.3.3). The final assemblies were generated after a second round of scaffolding using SSPACE-LongRead (v1-1), followed by polishing using Pilon (v1.23) for strain 122 or Nanopolish115 (v0.11.0) for strain NBRC 1723. The assemblies consist of 18 scaffolds (12,368,365 bp, N50 = 1,655,802 bp) for strain 122 and 10 scaffolds (12,251,049 bp; N50 = 1,643,865 bp) for strain NBRC 1723. Whole-genome comparison (alignment): For genomic comparisons between Sd. ludwigii strains we used the software MUMmer116 (v4.0.0). Alignments of genomic sequences were performed using the program nucmer (with the --maxmatch option). The output files were passed on to the script mummerplot for visualization. Comparisons between genomes were plotted as chord diagrams using the R package circlize117 (v0.4.6). The dnadiff (v1.3) wrapper of the genome alignment system MUMmer116 was used for the calculation of average nucleotide identity between whole genomes. Structural variations were called using Sniffles118 (v1.0.10) from the sorted output of the BWA-MEM aligner119 (v0.7.17). Gene prediction and annotation: For the generation of a comprehensive Sd. ludwigii gene annotation dataset, we used the reference genome sequence and combined the results from different tools and pipelines, followed by extensive manual curation. Firstly, we used the Yeast Genome Annotation Pipeline (YGAP120), which is based on homology and gene synteny information from previously analyzed yeast species, available in the Yeast Gene Order Browser (YGOB) database121. Secondly, AUGUSTUS122 (v3.2.1) was trained on the latest (as of September 2018) available protein datasets of several annotated yeast species (Saccharomyces cerevisiae, Naumovozyma dairenensis, Tetrapisispora blattae, Vanderwaltozyma polyspora, Kluyveromyces lactis, Eremothecium gossypii, Hanseniaspora

uvarum) and all resulting training datasets were independently used for ab initio gene prediction in Sd. ludwigii. Thirdly, the MAKER pipeline123 (v2.30), with predictors Augustus122 (v2.5.5), Genemark-ES124 (v2.3) and SNAP125, was used for gene prediction using the protein datasets of all yeast species available in the YGOB database121 as evidence. Custom scripts were then used for comparing the aforementioned prediction datasets and integrating all non-overlapping predicted gene models into a union dataset. The most probable gene model was retained for each gene, based on manual curation (using the genome browser IGV126; v2.6.2) and BLAST+109 (v2.8.0) comparisons. Finally, all genomic regions without predicted genes were extracted from the genomic sequence (using BEDtools127; v2.27.0), and custom scripts were used for retrieving all open reading frames in these regions that were predicted to code for proteins with a minimum size of 30 aa. These were analysed using BLAST+109 (v2.8.0) and were retained in the final gene prediction dataset only if they were homologous to known proteins of other yeast species or similar to conserved hypothetical proteins. Furthermore, we used tRNAscan-SE128 (v2.0) for the identification of tRNA genes, BLAST+109 (v2.8.0) and RNAmmer129 (v1.2) for the annotation of rRNA genes, and the program cmscan (v1.1) of Rfam130 (v12.1) for prediction of other RNA genes. For the assessment of gene prediction completeness, BUSCO131 (v3) was used, against the “Saccharomycetales” and “Fungi” databases of conserved single-copy orthologs. Functional annotation and Gene Ontology (GO) assignment of the final gene dataset was performed using the software suite Blast2GO PRO132 (v5), integrating evidence from BLAST+109 (v2.8.0), InterProScan133 (v5) and eggNOG134 (v4.5) searches, and manual curation for resolving conflicting results. The consensus features of point centromeres of Saccharomycetaceae representatives, that were compared to the Sd. ludwigii predictions, were retrieved from Gordon et al.135. Analysis of meiotic gene content: All S. cerevisiae genes that are known to be involved in meiosis and recombination were retrieved from the Saccharomyces Genome Database (SGD136, https://www.yeastgenome.org) by searching for genes with relevant GO terms. These searches retrieved a total of 284 genes, which were then used as queries for the identification of homologs in the Sd. ludwigii gene annotation dataset using BLAST+109 (v2.8.0) analyses. For all genes that remained undetected after similarity searches, we performed detailed gene synteny comparisons with annotated Saccharomycetaceae species that are included in the Yeast Gene Order Browser (YGOB121) database (v7; http://ygob.ucd.ie). The meiotic gene complement of Sd. ludwigii was compared to that of the 20 Saccharomycetaceae species that are included in the YGOB (v7) database, as well as to that of 9 Pichiaceae species that are included in the Methylotroph Gene Order Browser137 (http://mgob.ucd.ie). In order to gain a better understanding of how the missing meiotic genes from Sd. ludwigii evolved along the yeast phylogeny, we also studied the distribution of their homologs in the families Saccharomycodaceae and Phaffomycetaceae. For this, we used the S. cerevisiae protein sequences as queries in tBLASTn109 searches (with the Expect threshold set at 50) against all available genome assemblies from these two families in the NCBI Genome database on the 18th August 2019 (i.e. 28 genome assemblies from 18 Hanseniaspora/Kloeckera species or unclassified strains from the Saccharomycodaceae, and 42 assemblies from 33 species/strains of the Phaffomycetaceae, excluding the Komagataella species that have been classified in the Pichiaceae clade138). Representative positive hits were further examined using reciprocal BLASTp searches against the annotated S. cerevisiae proteome (SGD136). In those cases of putative homologs with marginally detectable similarity (often limited to short protein regions), synteny with S. cerevisiae S288C (YGOB database; v7) was also investigated and used as additional evidence for inferring homology. To confirm the absence of detectable homologs of MER1 from the Hanseniaspora species (family Saccharomycodaceae), we used the synteny information from S. cerevisiae to identify the expected positions in the genomes of 10 representative species (i.e. H. vineae, H. osmophila, H. occidentalis, H. lachancei, H. pseudoguilliermondii, H. guilliermondii, H. opuntiae, H. thailandica, H. jakobsenii and H. singularis) and we analysed all predicted ORFs in these regions for weak similarity to the S. cerevisiae Mer1 sequence. The online search engine of the Pfam database139 (v32.0; https://pfam.xfam.org)

was used for the identification of protein domains. Prediction of intrinsically unstructured regions in proteins was performed with the online tool IUPred2A140 (https://iupred2a.elte.hu). Read mapping and variant calling: Reads were mapped to the Sd. ludwigii reference genome (strain NBRC 1722), which was previously masked with RepeatMasker (v4.0.7, default parameters; http://www.repeatmasker.org), using bwa mem141 (v0.7.17). Resulting bam files were sorted and indexed using SAMtools142 (v1.9). Duplicate reads were marked and sample names were assigned using Picard (v2.18.14; https://broadinstitute.github.io/picard/). The GATK pipeline143 (v3.7.0) was used to realign remaining reads. Variants were then called using GATK UnifiedGenotyper. Calling was performed simultaneously for all spores from the same tetrad or all lines from the same background. Identification of recombination events: For the single-nucleotide polymorphism (SNP) segregation analysis of the hybrid cross, SNPs called from the respective reads mapping were first filtered (bcftools view; v1.9, https://github.com/samtools/bcftools) in order to define a set of high-confidence discriminant markers. Only positions with a single alternate allele, supported by at least 10 reads across both parents and with >90% of the reads covering either the reference or alternate allele, were selected. For each tetrad of the cross, SNPs located at the aforementioned marker positions were extracted, and the parental origin was assigned based on SNP correspondence between parents and spores at those positions. The result was formatted as a Seg file and used as input of the CrossOver pipeline (ReCombine suite)144, using default parameters and modified chromosome sizes/coordinates to match the reference genome of Sd. ludwigii. The reported events were individually validated by visual inspection using the Integrative Genomics Viewer (IGV). The same method was applied for the SNP segregation analysis of the South African cross, except that the minimum amount of reads supporting a marker position was lowered to 3 for each parent, as the coverage was reduced for one of the parents. Mutation accumulation analysis: Filters were applied to the SNPs called from the mutation accumulation lines to identify SNPs that were present only in a single line, as we expected these events to be line-exclusive. First, only positions covered by more than 10 reads in each sample with a single alternate allele were kept. Then, filters based on the numbers of lines per background and the type of conversion event expected to occur in a given background (homozygous to homozygous, homozygous to heterozygous, heterozygous to homozygous) were applied. Heterozygous SNPs were only retained if their allele balance was between 0.4 and 0.6. In the case of heterozygous-to-homozygous substitution, likely LOH events were filtered out to prevent false-positive SNP calls. The base-substitutional mutation rate (μbs) of each strain genealogy was calculated as the ratio of the total number of line-exclusive novel mutations divided by the size of the analyzed fraction of the genome (after masking), the total number of generations and the number of respective lines. The 95% Poisson confidence intervals of mutation rates were computed as in Long et al.145, and the mutation bias (corrected for the genomic GC content) as well as the theoretical equilibrium GC level (under mutation pressure alone) were calculated as in Krasovec et al.146. Population analyses: A total of 558,629 biallelic segregating sites were used to construct the neighbor-joining trees using the R147 packages ape and SNPrelate. The .gvcf matrices (of the whole genome or individual chromosomes) were converted into .gds files. Individual dissimilarities were estimated using the snpgdsDiss function, and the bionj algorithm was run on the distance matrices. Tree comparison was performed using the Visual TreeCmp package148 (web application; v2.0.76), using 7 unrooted metrics (topological or weighted). For normalization of distances, the results of the topological metrics were compared to the average values of 1,000 randomly generated tree pairs (uniform average method). The software PopLDdecay149 (v3.41) was used for the calculation of the LD decay data, which were then smoothed (moving average method) and plotted using R147. Other genomic analyses: We used RepeatMasker (v4.0.7; http://www.repeatmasker.org) with combined Dfam150 (v2.0) and Repbase151 (Genetic Information Research Institute - GIRI) databases, NCBI RMBLAST109 (v.2.6.0+) as the search engine and Tandem Repeats

Finder152 (v4.0.9), for identification of genomic repeats, low-complexity regions and transposable elements. Other genomic data analyses were performed using R147 and the Bioconductor framework153.

References 99. Sherman, F. Getting started with yeast. in Methods in Enzymology (eds. Guthrie, C. & Fink, G. R.) vol. 350 3–41 (Academic Press, 2002). 100. Janke, C. et al. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 21, 947– 962 (2004). 101. Green, M. R., Sambrook, J. & Sambrook, J. Molecular cloning: a laboratory manual. (Cold Spring Harbor Laboratory Press, 2014). 102. Neiman, A. M. Prospore Membrane Formation Defines a Developmentally Regulated Branch of the Secretory Pathway in Yeast. J. Cell Biol. 140, 29–37 (1998). 103. Loidl, J., Klein, F. & Scherthan, H. Homologous pairing is reduced but not abolished in asynaptic mutants of yeast. J. Cell Biol. 125, 1191–1200 (1994). 104. Shinohara, A., Ogawa, H. & Ogawa, T. Rad51 protein involved in repair and recombination in S. cerevisiae is a RecA-like protein. Cell 69, 457–470 (1992). 105. Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675 (2012). 106. Raghavan, V. et al. Incompatibilities in Mismatch Repair Genes MLH1-PMS1 Contribute to a Wide Range of Mutation Rates in Human Isolates of Baker’s Yeast. Genetics 210, 1253–1266 (2018). 107. Myers, E. W. et al. A whole-genome assembly of Drosophila. Science 287, 2196– 2204 (2000). 108. Chin, C.-S. et al. Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nat. Methods 10, 563–569 (2013). 109. Camacho, C. et al. BLAST+: architecture and applications. BMC Bioinformatics 10, 421 (2009). 110. Walker, B. J. et al. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PloS One 9, e112963 (2014). 111. Boetzer, M. & Pirovano, W. SSPACE-LongRead: scaffolding bacterial draft genomes using long read sequence information. BMC Bioinformatics 15, 211 (2014). 112. Boetzer, M. & Pirovano, W. Toward almost closed genomes with GapFiller. Genome Biol. 13, R56 (2012). 113. Li, H. Minimap2: pairwise alignment for nucleotide sequences. Bioinforma. Oxf. Engl. 34, 3094–3100 (2018). 114. Vaser, R., Sović, I., Nagarajan, N. & Šikić, M. Fast and accurate de novo genome assembly from long uncorrected reads. Genome Res. 27, 737–746 (2017). 115. Loman, N. J., Quick, J. & Simpson, J. T. A complete bacterial genome assembled de novo using only nanopore sequencing data. Nat. Methods 12, 733–735 (2015). 116. Marçais, G. et al. MUMmer4: A fast and versatile genome alignment system. PLoS Comput. Biol. 14, e1005944 (2018). 117. Gu, Z., Gu, L., Eils, R., Schlesner, M. & Brors, B. circlize Implements and enhances circular visualization in R. Bioinforma. Oxf. Engl. 30, 2811–2812 (2014). 118. Sedlazeck, F. J. et al. Accurate detection of complex structural variations using single-molecule sequencing. Nat. Methods 15, 461–468 (2018).

119. Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA- MEM. ArXiv13033997 Q-Bio (2013). 120. Proux-Wéra, E., Armisén, D., Byrne, K. P. & Wolfe, K. H. A pipeline for automated annotation of yeast genome sequences by a conserved-synteny approach. BMC Bioinformatics 13, 237 (2012). 121. Byrne, K. P. & Wolfe, K. H. The Yeast Gene Order Browser: combining curated homology and syntenic context reveals gene fate in polyploid species. Genome Res. 15, 1456–1461 (2005). 122. Stanke, M. & Morgenstern, B. AUGUSTUS: a web server for gene prediction in eukaryotes that allows user-defined constraints. Nucleic Acids Res. 33, W465–W467 (2005). 123. Cantarel, B. L. et al. MAKER: An easy-to-use annotation pipeline designed for emerging model organism genomes. Genome Res. 18, 188–196 (2008). 124. Lomsadze, A., Ter-Hovhannisyan, V., Chernoff, Y. & Borodovsky, M. Gene identification in novel eukaryotic genomes by self-training algorithm. Nucleic Acids Res. (2005) doi:10.1093/NAR/GKI937. 125. Korf, I. Gene finding in novel genomes. BMC Bioinformatics 5, 59 (2004). 126. Thorvaldsdóttir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief. Bioinform. 14, 178–192 (2013). 127. Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010). 128. Lowe, T. M. & Chan, P. P. tRNAscan-SE On-line: integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 44, W54-57 (2016). 129. Lagesen, K. et al. RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res. (2007) doi:10.1093/nar/gkm160. 130. Kalvari, I. et al. Rfam 13.0: shifting to a genome-centric resource for non-coding RNA families. Nucleic Acids Res. 46, D335–D342 (2018). 131. Waterhouse, R. M. et al. BUSCO Applications from Quality Assessments to Gene Prediction and Phylogenomics. Mol. Biol. Evol. 35, 543–548 (2018). 132. Götz, S. et al. High-throughput functional annotation and data mining with the Blast2GO suite. Nucleic Acids Res. 36, 3420–3435 (2008). 133. Jones, P. et al. InterProScan 5: genome-scale protein function classification. Bioinforma. Oxf. Engl. 30, 1236–1240 (2014). 134. Huerta-Cepas, J. et al. eggNOG 4.5: a hierarchical orthology framework with improved functional annotations for eukaryotic, prokaryotic and viral sequences. Nucleic Acids Res. 44, D286-293 (2016). 135. Gordon, J. L., Byrne, K. P. & Wolfe, K. H. Mechanisms of chromosome number evolution in yeast. PLoS Genet. 7, e1002190 (2011). 136. Cherry, J. M. et al. Saccharomyces Genome Database: the genomics resource of budding yeast. Nucleic Acids Res. 40, D700-705 (2012). 137. Douglass, A. P., Byrne, K. P. & Wolfe, K. H. The Methylotroph Gene Order Browser (MGOB) reveals conserved synteny and ancestral centromere locations in the yeast family Pichiaceae. FEMS Yeast Res. 19, (2019). 138. Shen, X.-X. et al. Tempo and Mode of Genome Evolution in the Budding Yeast Subphylum. Cell 175, 1533-1545.e20 (2018). 139. El-Gebali, S. et al. The Pfam protein families database in 2019. Nucleic Acids Res. 47, D427–D432 (2019). 140. Mészáros, B., Erdos, G. & Dosztányi, Z. IUPred2A: context-dependent prediction of protein disorder as a function of redox state and protein binding. Nucleic Acids Res. 46, W329–W337 (2018).

141. Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754–1760 (2009). 142. Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinforma. Oxf. Engl. 25, 2078–2079 (2009). 143. McKenna, A. et al. The Genome Analysis Toolkit: A MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 20, 1297–1303 (2010). 144. Anderson, C. M. et al. ReCombine: a suite of programs for detection and analysis of meiotic recombination in whole-genome datasets. PloS One 6, e25509 (2011). 145. Long, H., Behringer, M. G., Williams, E., Te, R. & Lynch, M. Similar Mutation Rates but Highly Diverse Mutation Spectra in Ascomycete and Basidiomycete Yeasts. Genome Biol. Evol. 8, 3815–3821 (2016). 146. Krasovec, M., Sanchez-Brosseau, S. & Piganeau, G. First Estimation of the Spontaneous Mutation Rate in Diatoms. Genome Biol. Evol. 11, 1829–1837 (2019). 147. R Core Team (2020). — European Environment Agency. https://www.eea.europa.eu/data-and-maps/indicators/oxygen-consuming-substances-in- rivers/r-development-core-team-2006. 148. Goluch, T., Bogdanowicz, D. & Giaro, K. Visual TreeCmp: Comprehensive Comparison of Phylogenetic Trees on the Web. Methods Ecol. Evol. 11, 494–499 (2020). 149. Zhang, C., Ss, D., Jy, X., Wm, H. & Tl, Y. PopLDdecay: a fast and effective tool for linkage disequilibrium decay analysis based on variant call format files. Bioinformatics (Oxford, England) vol. 35 https://pubmed.ncbi.nlm.nih.gov/30321304/ (2019). 150. Hubley, R. et al. The Dfam database of repetitive DNA families. Nucleic Acids Res (2016) doi:10.1093/nar/gkv1272. 151. Bao, W., Kojima, K. K. & Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mob. DNA 6, 11 (2015). 152. Benson, G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 27, 573–580 (1999). 153. Huber, W. et al. Orchestrating high-throughput genomic analysis with Bioconductor. Nat. Methods 12, 115–121 (2015).

Extended Data – Figures

Sex without crossing over in the yeast Saccharomycodes ludwigii

Ioannis A. Papaioannou1, Fabien Dutreux2, France A. Peltier1, Hiromi Maekawa1#, Nicolas Delhomme3, Amit Bardhan1, Anne Friedrich2, Joseph Schacherer2,4 and Michael Knop1,5*

* To whom correspondence should be addressed: [email protected]

Extended Data Fig. 1: Features of Sd. ludwigii point centromeres and repetitive (sub)telomeres. a, Sequences of the centromere DNA elements (CDEs) I and III, and length and AT content of CDE II of each predicted centromere. The direction of each centromere with reference to the genomic scaffold (+/-) is provided next to its bar (left). The consensus DNA motif sequences of CDEs I and III and the ranges of length and AT content of CDEs II are shown (bottom), in comparison bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 3

to the respective Saccharomycetaceae data. b, The terminal regions of all chromosomal scaffolds are shown. A horizontal line beneath each bar indicates coverage by subtelomere-specific DNA repeats that are shared between different subtelomeres. These coverage bars are color-coded on the basis of the highest sequence similarity to other subtelomeres, according to the color key (bottom right). Detected telomere-specific DNA motif sequences at the ends of chromosomal scaffolds are indicated by square brackets. Gene content/locations for each subtelomere are shown as boxes within the bars, colored according to the respective code (bottom left). Gene homologs typical of S. cerevisiae subtelomeres, such as FLO and ARG gene family members, are present in all Sd. ludwigii subtelomeres, while retrotransposons are also present in most of them.

Extended Data Fig. 2: A comparative genomic analysis with 100 yeast and other fungal genomes revealed that the Sd. ludwigii genome is exceptionally AT-rich and enriched in low- complexity, repetitive, and transposable elements. a, Overall genomic GC content. b, Genomic coverage by low-complexity regions (dot width) and the proportion of those regions that are AT-rich (>70%; y axis) versus the overall genomic GC content (x axis). c, Genomic coverage by simple sequence repeats (SSRs or microsatellites; dot width) and the total AT content of SSRs (y axis) versus the mean genomic GC content (x axis). d and e, Genomic coverage by retroelements (d) and DNA transposons (e). All genomes included in the comparisons here are listed in Supplementary Table 2. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 4

Extended Data Fig. 3: Sd. ludwigii Sae2 is necessary for normal sporulation, similarly to Spo11. Meiotic time-course analysis of a homozygous Δsae2 deletion strain in comparison to the wild type. Following induction of cells to enter meiosis, samples were withdrawn at the indicated time points and their cellular DNA content was stained with Hoechst 33258 to determine binucleate (meiosis I) and tetranucleate (meiosis II) cells. Error bars: SD (3 replicates).

Extended Data Fig. 4: Meiotic SNP segregation analysis in Sd. ludwigii. a, A detailed scheme of the experimental setup, including the identifiers of all strains used: the wild-type isolates are referred to with their original strain collection IDs, whereas the Knop lab Sd. ludwigii strain collection IDs are provided for all other strains that were generated in this study (Supplementary Table 1). Spore viability of strain CBS 5929 was very low (probably due to high load of deleterious mutations); it was thus impossible to obtain full viable tetrads from this strain for the SNP segregation analysis. We used backcrossing to isolate two spores (spores 100 and 102) that gave rise to diploids with high spore viability. b, Heterozygosity levels (expressed as the number of filtered high-quality SNPs per kb of genomic sequence) between the parental strains of each cross are plotted here along the chromosomes of the reference genome sequence.

Extended Data Fig. 5: Genomic comparisons of Sd. ludwigii strains. a, Examples of euploid (NCYC 849) and aneuploid (chrD and chrG trisomies in NCYC 3345 and DSM 70550, respectively) isolates of Sd. ludwigii, determined by read coverage analysis. The gap near the middle of chrB corresponds to the rDNA region. b, Genome-wide distribution of SNPs of all Sd. ludwigii strains in comparison to the reference strain. For each diploid strain, the total number of SNPs (“all”) is shown in the upper bar and the heterozygous positions (“het”) in the bottom one. c, Dendrograms of Sd. ludwigii strains, constructed by hierarchical cluster analysis of SNPs of individual chromosomes. The dendrograms of the remaining chromosomes, as well as that of the whole genome, are shown in Fig. 6a. d, Similarly constructed dendrograms of L. kluyveri strains. e, Differences in SNP density of individual chromosomes of Sd. ludwigii in comparison to the whole genome, for all strains (color code as in c). f, Tree difference scores (seven unrooted metrics, no normalization) between all combinations of whole-genome SNPs and SNPs of individual chromosomes, for Sd. ludwigii and L. kluyveri. The analyzed strains are shown in panels (c) and (d), respectively. WRF: weighted Robinson-Foulds distance. WG-BHV: weighted geodesic (BHV) unrooted distance. RF: Robinson- Foulds distance. MS: matching split distance. MAS: unrooted maximum agreement subtree distance. PD: path difference distance. MT: matching triplet distance. Q: quartet distance.

Extended Data Fig. 6: Curves of linkage disequilibrium (LD) decay as a function of physical distance between SNP marker pairs. a, LD decay curves of the whole genome in comparison to individual chromosomes of Sd. ludwigii. b, LD decay curves of 5 L. kluyveri and 20 S. cerevisiae groups of strains (of the same sample size, n=11). bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supplementary Table 1: List of yeast strains generated and used in this study.

Strain Parental Mating partners Source/ Genotype Ploidy ID1 Name background (for diploids) Reference

Parental strains (used for genome sequencing, crosses and/or strain construction)

Saccharomycodes ludwigii

2 Sc-9750 NBRC 1721 wild-type isolate (origin: Japan) diploid Ohara et al., 1964 Sc-9752/9753 NBRC 17223 MATα, meiotic descendant of wild-type isolate NBRC 1721 haploid Yamazaki et al., 1976 Sc-9754 NBRC 17234 MATa, meiotic descendant of wild-type isolate NBRC 1721 haploid Yamazaki et al., 1976 Sdl-75 CBS 59295 wild-type isolate (origin: South Africa) diploid

Strains used for functional analyses of meiotic genes

Sdl-206 YLFP10-1 Sc-9753 MATα Δura3::hphNT1 haploid this study Sdl-307 YLFP15-1 Sdl-206 Δmatα::URA3-kanMX4 Δura3::hphNT1 haploid this study Sdl-334 YLFP16-5 Sdl-307 MATa Δura3::hphNT1 haploid this study Sdl-339 YLFP18-1 Sdl-334 MATa (isogenic to NBRC 1722) haploid this study Sdl-336 YLFP17-1 MATa/MATα URA3/Δura3::hphNT1 diploid Sc-9753 x Sdl-334 this study Sdl-502 YLFP17-4 MATa/MATα diploid Sc-9753 x Sdl-339 this study Sdl-452 YLFP37-1 Sdl-339 MATa Δspo11::kanMX4 haploid this study Sdl-361 YLFP23-1 Sc-9753 MATα Δspo11::hphNT1 haploid this study Sdl-539 YLFP58-1 MATa/MATα Δspo11::kanMX4/Δspo11::hphNT1 diploid Sdl-452 x Sdl-361 this study Sdl-878 YLFP157-1 Sc-9753 MATα Δrad51::kanMX4 haploid this study Sdl-882 YLFP158-1 Sdl-339 MATa Δrad51::kanMX4 haploid this study Sdl-886 YLFP159-1 MATa/MATα Δrad51::kanMX4/Δrad51::kanMX4 diploid Sdl-878 x Sdl-882 this study Sdl-926 YLFP174-1 Sc-9753 MATα Δdmc1::kanMX4 haploid this study Sdl-930 YLFP175-1 Sdl-339 MATa Δdmc1::kanMX4 haploid this study Sdl-958 YLFP182-1 MATa/MATα Δdmc1::kanMX4/Δdmc1::kanMX4 diploid Sdl-926 x Sdl-930 this study Sdl-728 YLFP99-1 Sc-9753 MATα RAP1-GFP-kanMX6 haploid this study Sdl-736 YLFP101-1 Sdl-339 MATa RAP1-GFP-kanMX6 haploid this study Sdl-764 YLFP108-1 MATa/MATα RAP1-GFP-kanMX6/RAP1-GFP-kanMX6 diploid Sdl-728 x Sdl-736 this study

Strains used for meiotic segregation analyses

Sdl-100 YLNH55 MATα, meiotic descendant of wild-type isolate Sdl-75 haploid this study Sdl-102 YLΝΗ57 MATa, meiotic descendant of wild-type isolate Sdl-75 haploid this study Sdl-122 YLNH75 MATa, meiotic descendant of cross Sdl-100 x Sdl-102 haploid this study Sdl-982 YLFP188-1 MATa/MATα diploid Sdl-9752 x Sdl-122 this study

Tetrad Sdl-113 - Sdl-116

Sdl-113 YLNH66 first meiotic descendant of cross Sdl-100 x Sdl-102 haploid this study Sdl-114 YLNH67 dyad meiotic descendant of cross Sdl-100 x Sdl-102 haploid this study Sdl-115 YLNH68 second meiotic descendant of cross Sdl-100 x Sdl-102 haploid this study Sdl-116 YLNH69 dyad meiotic descendant of cross Sdl-100 x Sdl-102 haploid this study

Tetrad Sdl-117 - Sdl-120 S dl-117 YLNH70 first m eiotic descendant of cross Sdl-100 x Sdl-102 haploid this study Sdl-118 YLNH71 dyad meiotic descendant of cross Sdl-100 x Sdl-102 haploid this study Sdl-119 YLNH72 second meiotic descendant of cross Sdl-100 x Sdl-102 haploid this study Sdl-120 YLNH73 dyad meiotic descendant of cross Sdl-100 x Sdl-102 haploid this study

Tetrad Sdl-280 - Sdl-283 Sdl -280 YLNH198 first m eiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-281 YLNH199 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-282 YLNH200 second meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-283 YLNH201 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study

Tetrad Sdl-284 - Sdl-287 Sdl -284 YLNH202 first m eiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-285 YLNH203 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-286 YLNH204 second meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-287 YLNH205 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study

Tetrad Sdl-985 - Sdl-988

Sdl-985 YLFP189-1 first meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-986 YLFP189-2 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Sdl-987 YLFP189-3 second meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-988 YLFP189-4 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study

Tetrad Sdl-989 - Sdl-992

Sdl-989 YLFP190-1 first meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-990 YLFP190-2 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-991 YLFP190-3 second meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-992 YLFP190-4 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study

Tetrad Sdl-1233 - Sdl-1239

Sdl-1233 YLIP2-1 first meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-1235 YLIP3-1 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-1237 YLIP4-1 second meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study Sdl-1239 YLIP5-1 dyad meiotic descendant of cross Sc-9752 x Sdl-122 haploid this study

Additional strains used for population comparisons/analyses

Sdl-58 CBS 1168 wild-type isolate haploid Sdl-1211 BJK_5C wild-type isolate (origin: Slovenia) diploid Štornik et al., 2016 Sc-9673 NCYC 732 wild-type isolate (origin: Italy) diploid Sc-9676 NCYC 734 wild-type isolate (origin: UK) diploid Sc-9679 NCYC 849 wild-type isolate (origin: UK) diploid Sc-9682 NCYC 3345 wild-type isolate aneuploid (2n+1) Sc-9790 DSM 70550 wild-type isolate (origin: France) aneuploid (2n+1) Sdl-1267 PC99_R_1 meiotic descendant of wild-type isolate PC99/R (origin: Italy) haploid Bovo et al., 2014

1 Database ID numbers of yeast strains correspond to their permanent identifiers in the Knop lab yeast strain collections. 2 Wild-type diploid isolate from grape must in Japan; isolated in 1964; alternative strain identifiers: IFO 1721, DSM 3447, O-81. 3 Single-spore meiotic descendant of wild-type diploid isolate NBRC 1721; alternative strain identifiers: ATCC 26617, DSM 3448, IFO 1722, IIA11S1. 4 Single-spore meiotic descendant of wild-type diploid isolate NBRC 1721; alternative strain identifiers: ATCC 26618, DSM 3449, IFO 1723, IIA11S2. 5 Wild-type diploid isolate from garden soil in Pretoria (South Africa); isolated in 1953. References: Ohara et al. (1964) in Bull. Res. Inst. Ferment. 11:1-12; Yamazaki et al. (1976) in J. Bacteriol. 125:461-466; Štornik et al., 2016 in Food Technol. Biotechnol. 54:113-119; Bovo et al. (2014) in Food Microbiol. 41:33-41. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supplementary Table 2: List of genome assemblies of yeasts and filamentous fungi analyzed in this study.

Kingdom Subkingdom Phylum Class Order Family # Species Strain Assembly Accession Scaffolds Contigs N50 L50 Assembly level Database 1 Candida glabrata CBS 138 GCA_000002545.2 ASM254v2 14 17 1100349 5 chromosome NCBI Genome 2 Kazachstania africana CBS 2517 GCA_000304475.1 Ka_CBS2517 12 34 925516 5 chromosome NCBI Genome 3 Kazachstania naganishii CBS 8797 GCA_000348985.1 ASM34898v1 13 95 227487 12 chromosome NCBI Genome 4 Naumovozyma castellii CBS 4309 GCA_000237345.1 ASM23734v1 10 17 1245273 3 chromosome NCBI Genome 5 Naumovozyma dairenensis CBS 421 GCA_000227115.2 ASM22711v2 11 279 109578 37 chromosome NCBI Genome post-WGD 6 Saccharomyces arboricola H-6 (CBS 10644) GCA_000292725.1 SacArb1.0 35 219 117287 35 chromosome NCBI Genome 7 Saccharomyces cerevisiae S288C S288C_reference_R64_2_1 (SGD) R64_2_1 (SGD) 17 17 924431 6 complete genome SGD 8 Saccharomyces eubayanus FM1318 GCA_001298625.1 SEUB3.0 24 133 197643 17 chromosome NCBI Genome 9 Saccharomyces paradoxus CBS 432 GCA_002079055.1 ASM207905v1 17 18 835812 6 chromosome NCBI Genome 10 Tetrapisispora blattae CBS 6284 GCA_000315915.1 ASM31591v1 10 82 286437 18 chromosome NCBI Genome 11 Tetrapisispora phaffii CBS 4417 GCA_000236905.1 ASM23690v1 17 105 249073 18 chromosome NCBI Genome 12 Torulaspora delbrueckii CBS 1146 GCA_000243375.1 ASM24337v1 8 34 539679 6 chromosome NCBI Genome ZT clade 13 Zygosaccharomyces bailii CLIB 213 GCA_000442885.1 ZYBA0 27 287 84072 38 scaffold NCBI Genome 14 Zygosaccharomyces rouxii CBS 732 GCA_000026365.1 ASM2636v1 7 9 1496342 3 chromosome NCBI Genome Saccharomycetaceae 15 Eremothecium coryli CBS 5749 GCA_000710315.1 Eremothecium coryli 19 63 324660 9 scaffold NCBI Genome 16 Eremothecium cymbalariae DBVPG 7215 GCA_000235365.1 ASM23536v1 8 9 1193613 4 chromosome NCBI Genome 17 Eremothecium gossypii ATCC 10895 GCA_000091025.4 ASM9102v4 8 8 1519140 3 complete genome NCBI Genome 18 Kluyveromyces dobzhanskii CBS 2104 GCA_000820885.1 KLDO_01 86 86 493016 7 contig NCBI Genome 19 Kluyveromyces lactis NRRL Y-1140 GCA_000002515.1 ASM251v1 7 7 1753957 3 complete genome NCBI Genome 20 Kluyveromyces marxianus NBRC 1777 GCA_001417835.1 KM1777_03 9 9 1422013 4 complete genome NCBI Genome 21 Lachancea dasiensis CBS 10888 GCA_900074725.1 LADA0 8 31 988707 5 chromosome NCBI Genome KLE clade 22 Lachancea fantastica (sp. PJ-2012a) CBS 6924 GCA_900074735.1 LAFA0 7 25 730885 6 chromosome NCBI Genome 23 Lachancea fermentati CBS 6772 GCA_900074765.1 LAFE0 8 36 821294 6 chromosome NCBI Genome 24 Lachancea kluyveri NRRL Y-12651 GCA_000149225.1 ASM14922v1 32 35 1252455 5 chromosome NCBI Genome 25 Lachancea lanzarotensis CBS 12615 GCA_000938715.1 LALA0 24 34 700478 6 scaffold NCBI Genome 26 Lachancea meyersii CBS 8951 GCA_900074715.1 LAME0 8 27 716495 6 chromosome NCBI Genome 27 Lachancea mirantina CBS 11717 GCA_900074745.1 LAMI0 8 20 1114975 4 chromosome NCBI Genome

Saccharomycetaceae and related families 28 Lachancea nothofagi CBS 11611 GCA_900074755.1 LANO0 8 37 994480 4 chromosome NCBI Genome 29 Lachancea thermotolerans CBS 6340 GCA_000142805.1 ASM14280v1 8 10 1513537 4 chromosome NCBI Genome 30 Hanseniaspora opuntiae AWRI 3578 GCA_001749795.1 ASM174979v1 17 66 240102 11 scaffold NCBI Genome Saccharomycodaceae 31 Hanseniaspora osmophila AWRI 3579 GCA_001747045.1 ASM174704v1 17 899 18891 178 scaffold NCBI Genome 32 Hanseniaspora uvarum AWRI 3580 GCA_001747055.1 ASM174705v1 18 44 453480 6 scaffold NCBI Genome 33 Cyberlindnera fabianii JCM 3601 GCA_001599195.1 JCM_3601_assembly_v001 12 53 450523 7 scaffold NCBI Genome Phaffomycetaceae 34 Cyberlindnera jadinii NRRL Y-1542 GCA_001661405.1 Cybja1 76 392 111555 34 scaffold NCBI Genome 35 Wickerhamomyces anomalus NRRL Y-366-8 GCA_001661255.1 Wican1 46 222 185283 23 scaffold NCBI Genome Saccharomycopsidaceae 36 Saccharomycopsis fibuligera KPH12 GCA_001936155.1 KPH12 7 7 3000806 3 complete genome NCBI Genome 37 Saccharomycopsis malanga JCM 7620 GCA_001599215.1 JCM_7620_assembly_v001 44 229 190130 23 scaffold NCBI Genome Ascoideaceae 38 Ascoidea asiatica JCM 7603 GCA_001600695.1 JCM_7603_assembly_v001 71 264 236462 24 scaffold NCBI Genome 39 Ascoidea rubescens DSM 1968 GCA_001661345.1 Ascru1 63 326 171347 33 scaffold NCBI Genome 40 Babjeviella inositovora NRRL Y-12698 GCA_001661335.1 Babin1 49 211 198400 25 scaffold NCBI Genome 41 Candida albicans SC5314 GCA_000182965.3 ASM18296v3 8 88 334280 12 chromosome NCBI Genome 42 Candida carpophila JCM 9396 GCA_001599235.1 JCM_9396_assembly_v001 10 26 765813 5 scaffold NCBI Genome 43 Candida dubliniensis CD36 GCA_000026945.1 ASM2694v1 8 8 2267510 3 complete genome NCBI Genome 44 Candida orthopsilosis Co 90-125 GCA_000315875.1 ASM31587v1 8 242 120081 36 chromosome NCBI Genome Saccharomycetes Saccharomycetales 45 Candida parapsilosis CDC317 GCA_000182765.2 ASM18276v2 9 9 2091826 3 scaffold NCBI Genome 46 Candida tanzawaensis NRRL Y-17324 GCA_001661415.1 Canta1 16 249 183924 21 scaffold NCBI Genome 47 Candida tenuis ATCC 10573 GCA_000223465.1 Candida tenuis v1.0 25 74 382504 12 scaffold NCBI Genome 48 Candida tropicalis MYA-3404 GCA_000006335.3 ASM633v2 24 128 221103 21 scaffold NCBI Genome Ascomycota Debaryomycetaceae 49 Debaryomyces hansenii CBS 767 GCA_000006445.2 ASM644v2 8 15 993818 5 chromosome NCBI Genome Dikarya Fungi 50 Lodderomyces elongisporus NRRL YB-4239 GCA_000149685.1 ASM14968v1 28 145 261145 20 scaffold NCBI Genome 51 Meyerozyma caribbica MG20W GCA_000755205.1 ASM75520v1 9 9 1673638 3 contig NCBI Genome 52 Meyerozyma guilliermondii ATCC 6260 GCA_000149425.1 ASM14942v1 9 71 313225 12 scaffold NCBI Genome 53 Millerozyma acaciae JCM 10732 GCA_001600675.1 JCM_10732_assembly_v001 10 29 778428 6 scaffold NCBI Genome 54 Priceomyces haplophilus JCM 1635 GCA_001599895.1 JCM_1635_assembly_v001 9 29 598910 8 scaffold NCBI Genome CTG clade 55 Scheffersomyces lignosus JCM 9837 GCA_001599395.1 JCM_9837_assembly_v001 19 73 619226 8 scaffold NCBI Genome 56 Scheffersomyces stipitis CBS 6054 GCA_000209165.1 ASM20916v1 8 9 1803401 4 chromosome NCBI Genome 57 Spathaspora arborariae UFMG-19.1A GCA_000497715.1 SpaArb1.0 41 381 63812 59 scaffold NCBI Genome 58 Spathaspora passalidarum NRRL Y-27907 GCA_000223485.1 Spathaspora passalidarum v2.0 8 26 1645821 4 scaffold NCBI Genome 59 Candida intermedia CBS 141442 GCA_900106115.1 CBS 141442 assembly 8 10 1965937 4 chromosome NCBI Genome Metschnikowiaceae 60 Clavispora lusitaniae ATCC 42720 GCA_000003835.1 ASM383v1 9 88 266609 15 scaffold NCBI Genome 61 Metschnikowia bicuspidata NRRL YB-4993 GCA_001664035.1 Metbi1 48 582 62344 72 scaffold NCBI Genome 62 Metschnikowia fructicola 277 GCA_000317355.2 ASM31735v2 93 93 957836 9 contig NCBI Genome 63 Hyphopichia burtonii NRRL Y-1933 GCA_001661395.1 Hypbu1 27 243 114103 34 scaffold NCBI Genome related species incertae sedis 64 Hyphopichia homilentoma JCM 1507 GCA_001599095.1 JCM_1507_assembly_v001 8 32 708264 6 scaffold NCBI Genome 65 Wickerhamia fluorescens JCM 1821 GCA_001599155.1 JCM_1821_assembly_v001 20 109 312802 15 scaffold NCBI Genome 66 Brettanomyces anomalus CBS 7654 GCA_001754015.1 ASM175401v1 28 261 123727 27 scaffold NCBI Genome 67 Brettanomyces bruxellensis CBS 2499 GCA_000340765.1 Dekkera bruxellensis CBS 2499 v2.0 63 887 30855 105 scaffold NCBI Genome 68 Brettanomyces naardenensis CBS 7540 GCA_001753995.1 ASM175399v1 76 104 355666 10 scaffold NCBI Genome 69 Candida arabinofermentans NRRL YB-2248 GCA_001661425.1 Canar1 62 701 101778 39 scaffold NCBI Genome 70 Candida boidinii JCM 9604 GCA_001599335.1 JCM_9604_assembly_v001 32 144 512251 12 scaffold NCBI Genome Pichiaceae 71 Candida succiphila JCM 9445 GCA_001599255.1 JCM_9445_assembly_v001 22 64 546973 8 scaffold NCBI Genome 72 Komagataella phaffii CBS 7435 GCA_000223565.1 PicPas_Mar2011 5 17 1320048 3 chromosome NCBI Genome 73 Ogataea methanolica JCM 10240 GCA_001600755.1 JCM_10240_assembly_v001 32 168 223418 23 scaffold NCBI Genome 74 Ogataea parapolymorpha DL-1 GCA_000187245.3 Hansenula_2 7 10 1273462 4 chromosome NCBI Genome 75 Ogataea polymorpha NCYC 495 leu1.1 GCA_001664045.1 Hanpo2 7 7 1302532 4 contig NCBI Genome Methylotrophs 76 Pichia membranifaciens NRRL Y-2026 GCA_001661235.1 Picme2 10 144 472039 9 scaffold NCBI Genome 77 Nakazawaea peltata JCM 9829 GCA_001599355.1 JCM_9829_assembly_v001 11 34 648860 5 scaffold NCBI Genome 78 Ambrosiozyma kashinagacola JCM 15019 GCA_001599075.1 JCM_15019_assembly_v001 23 59 418399 8 scaffold NCBI Genome incertae sedis 79 Candida sorboxylosa JCM 1536 GCA_001599115.1 JCM_1536_assembly_v001 37 277 118414 24 scaffold NCBI Genome 80 Kuraishia capsulata CBS 1993 GCA_000576695.1 AUH_PRJEB4427_v1 7 73 370915 10 scaffold NCBI Genome 81 Sporopachydermia quercuum JCM 9486 GCA_001599295.1 JCM_9486_assembly_v001 15 37 852576 6 scaffold NCBI Genome Dipodascaceae 82 Yarrowia deformans JCM 1694 GCA_001600075.1 JCM_1694_assembly_v001 44 174 264734 24 scaffold NCBI Genome 83 Yarrowia keelungensis JCM 14894 GCA_001600195.1 JCM_14894_assembly_v001 41 180 288559 24 scaffold NCBI Genome 84 Yarrowia lipolytica CLIB 89 (W29) GCA_001761485.1 ASM176148v1 7 7 3629463 3 complete genome NCBI Genome Trichomonascaceae 85 Sugiyamaella lignohabitans CBS 10342 GCA_001640025.2 ASM164002v2 4 4 4956242 2 complete genome NCBI Genome 86 Wickerhamiella domercqiae JCM 9478 GCA_001599275.1 JCM_9478_assembly_v001 4 50 440821 8 scaffold NCBI Genome Trigonopsidaceae 87 Tortispora caseinolytica NRRL Y-17796 GCA_001661475.1 Canca1 6 64 572105 6 scaffold NCBI Genome

Basal lineages 88 Candida apicola NRRL Y-50540 GCA_001005415.1 ASM100541v1 40 135 182354 17 scaffold NCBI Genome incertae sedis 89 Nadsonia fulvescens DSM 6958 GCA_001661315.1 Nadfu1 20 200 200547 21 scaffold NCBI Genome 90 Starmerella bombicola JCM 9596 GCA_001599315.1 JCM_9596_assembly_v001 16 63 662740 6 scaffold NCBI Genome Leotiomycetes Helotiales Sclerotiniaceae 91 Botrytis cinerea B05.10 GCA_000832945.1 ASM83294v1 18 18 2617329 7 complete genome NCBI Genome Sordariomycetes Glomerellales Plectosphaerellaceae 92 Verticillium dahliae JR2 GCA_000400815.2 VDAG_JR2v.4.0 8 8 4168633 4 complete genome NCBI Genome Sordariales Sordariaceae 93 Neurospora crassa OR74A GCA_000182925.2 NC12 21 412 656009 21 chromosome NCBI Genome Dothideomycetes Pleosporales Pleosporaceae 94 Bipolaris maydis C5 GCA_000338975.1 CocheC5_3 68 88 1168586 12 scaffold NCBI Genome Eurotiomycetes Eurotiales Aspergillaceae 95 Aspergillus nidulans FGSC A4 GCA_000011425.1 ASM1142v1 8 82 679860 13 chromosome NCBI Genome Onygenales incertae sedis 96 Coccidioides immitis RS GCA_000149335.2 ASM14933v2 7 11 4311478 3 scaffold NCBI Genome Schizosaccharomycetes Schizosaccharomycetales Schizosaccharomycetaceae 97 Schizosaccharomyces pombe 972h- GCA_000002945.2 ASM294v2 4 8 2923134 2 chromosome NCBI Genome Basidiomycota Tremellomycetes Tremellales Cryptococcaceae 98 Cryptococcus neoformans JEC21 GCA_000091045.1 ASM9104v1 14 37 1076541 7 chromosome NCBI Genome Ustilaginomycetes Ustilaginales Ustilaginaceae 99 Ustilago maydis 521 GCA_000328475.2 Umaydis521_2.0 27 254 129796 47 chromosome NCBI Genome Mucoromycota Mucorales Rhizopodaceae 100 Rhizopus delemar RA 99-880 GCA_000149305.1 RO3 83 391 303,659 46 scaffold NCBI Genome bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supplementary Table 3: Genes involved in meiosis/meiotic recombination and their presence/absence in Sd. ludwigii and other yeasts.

post-WGD species

Saccharomyces cerevisiae genes involved in meiosis / meiotic recombination Saccharomycodes ludwigii predicted

Systematic name Standard name (aliases) | paralogs ludwigii Saccharomycodes Lachancea waltii Lachancea thermotolerans Lachancea kluyveri Eremothecium cymbalariae Eremothecium gossypii Kluyveromyces lactis Torulaspora delbrueckii Zygosaccharomyces rouxii Vanderwaltozyma polyspora Tetrapisispora phaffii Tetrapisispora blattae Naumovozyma dairenensis Naumovozyma castellii Kazachstania naganishii Kazachstania africana Candida glabrata Saccharomyces bayanus Saccharomyces kudriavzevii Saccharomyces mikatae Saccharomyces cerevisiae homolog Meiotic recombination and related processes - double-strand break (DSB) formation and repair

Mechanisms

YDL074C BRE1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2402 YNR051C BRE5 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1720 YMR001C CDC5 (MSD2 , PKX2 ) 1 1 1 1 1 1 1 1 1 2 2 1 1 1 2 2 1 1 1 1 1 Slud3353 YLR394W CST9 (ZIP3 ) 1 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2415 YER179W DMC1 (ISC2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3934 YHR164C DNA2 (WEB2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3099 YDR446W ECM11 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3211 YOR033C | YDR263C EXO1 (DHS1 ) | DIN7 (DIN3 ) 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 2 2 2 2 Slud3014 YDR110W FOB1 (HRM1 ) 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 1 1 1 1 1 1 Slud3944 YLR445W GMC2 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2339 YGL251C HFM1 (MER3 ) 1 1 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0435 YGL033W HOP2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3835 YBR136W MEC1 (RAD31 , ESR1 , SAD3 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0702 YER044C-A MEI4 15 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0093 YPL121C MEI5 (LPH6 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4159 YNL210W MER1 0 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 0 1 1 1 1 - YMR167W MLH1 (PMS2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0795 YLR035C MLH2 1 0 0 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 Slud0579 YPL164C MLH3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4111 YBR098W MMS4 (SLX2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0400 YGL183C MND1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3742 YIR025W MND2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 Slud3464 YIR002C MPH1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4562 YMR224C MRE11 (RAD58 , XRS4 , NGS1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1978 YML128C MSC1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 Slud3684 YLR219W MSC3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4336 YOR354C MSC6 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1336 YHR039C MSC7 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 Slud2841 YFL003C MSH4 1 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1732 YDL154W MSH5 1 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1404 YDR386W MUS81 (SLX3 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1232 YOL104C NDJ1 (TAM1 ) 15 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0702 YDL105W NSE4 (QRI2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0794 YOL115W | YNL299W PAP2 (TRF4 ) | TRF5 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud4446 YBR186W PCH2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4234 YDL102W POL3 (CDC2 , HPR6 , TEX1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0767 YLR376C PSY3 15 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud5095 YPL022W RAD1 (RAD12 , LPB9 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4308 YGL058W RAD6 (UBC2 , PSO8 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3390 YML095C RAD10 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3689 YOR368W RAD17 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3219 YER173W RAD24 (RS1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3925 YNL250W RAD50 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2677 YER095W RAD51 (MUT5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2123 YML032C RAD52 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3198 YGL163C RAD54 (XRS1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3267 YDR076W RAD55 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3886 YDR004W RAD57 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0658 YDL059C RAD59 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 1 1 1 1 1 1 Slud4914 YBR073W RDH54 (TID1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1662 YLR329W REC102 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0231 YHR157W REC104 15 1 1 1 0 0 1 1 1 1 1 0 0 0 1 1 1 1 1 1 1 Slud0173 YJR021C REC107 (MER2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2929 YMR133W REC114 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0747 YPR007C REC8 (SPO69 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3262 YAR007C RFA1 (RPA70 , BUF2 , FUN3 , RPA1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3825 YNL312W RFA2 (RPA32 , RPA2 , BUF1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4424 YJL173C RFA3 (RPA14 , RPA3 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2650 YHL024W RIM4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3708 YPL024W RMI1 (NCE4 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4306 YGL250W RMR1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0436 YGL175C SAE2 (COM1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3748 YHR079C-A SAE3 1 1 1 1 0 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 Slud0413 YAL027W SAW1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1916 YHL006C SHU1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2532 YDR078C SHU2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3889 YGL213C SKI8 (REC103 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0482 YBR228W SLX1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3405 YLR135W SLX4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4009 YJL074C SMC3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1559 YOL034W SMC5 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1891 YLR383W SMC6 (RHC18 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2429 YGL127C SOH1 (MED31 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3396 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

YHL022C SPO11 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0631 YJL092W SRS2 (HPR5 , RADH , RADH1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1628 YNL088W TOP2 (TOR3 , TRF3 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1001 YLR234W TOP3 (EDR1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4360 YDR369C XRS2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1207 YER041W YEN1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 Slud0470 YDR285W ZIP1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2848 YGL249W ZIP2 1 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0437 Regulation

YBL097W BRN1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2171 YPL178W CBC2 (CBP20 , MUD13 , SAE1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3448 YDL017W CDC7 (LSD6 , SAS1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0551 YPL200W | YGL075C CSM4 | MPS2 (MMC1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 Slud3503 YDR110W FOB1 (HRM1 ) 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 1 1 1 1 1 1 Slud3944 YDR318W MCM21 (CTF5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2860 YBR098W MMS4 (SLX2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0400 YHR086W NAM8 (MRE2 , MUD15 ) 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 Slud3149 YOL104C NDJ1 (TAM1 ) 15 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0702 YNL330C RPD3 (REC3 , SDI2 , SDS6 , MOF6 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4400 YHR119W SET1 (YTX1 , KMT2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0958 YJL168C SET2 (EZL1 , KMT3 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2644 YMR190C SGS1 1 1 1 1 1 1 1 1 1 2 2 1 2 2 2 2 2 1 1 1 1 Slud3569 YDL042C | YOL068C SIR2 (MAR1 ) | HST1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud4467 YLR135W SLX4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4009 YFR031C SMC2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0612 YHR153C SPO16 15 0 0 1 0 0 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 Slud0172 YPL138C SPP1 (CPS40 , SAF41 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4147 YJL092W SRS2 (HPR5 , RADH , RADH1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1628 YBR175W SWD3 (CPS30 , SAF35 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4209 YLR182W SWI6 (PSL8 , SDS11 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2726 YBL088C TEL1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2160 YDR325W YCG1 (TIE1 , YCS5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3023 YLR272C YCS4 (LOC7 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3316 YDR285W ZIP1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2848 Checkpoint

YPL194W DDC1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3495 YDR440W DOT1 (KMT4 , PCH1 ) 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 Slud1313 YML074C | YLR449W FPR3 (NPI46 ) | FPR4 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 2 2 2 2 2 Slud2332 YIL072W HOP1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2047 YLR288C MEC3 (PSO9 , PIP3 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3303 YOR351C MEK1 (MRE4 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1340 YBR186W PCH2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4234 YDR075W PPH3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3885 YNL201C PSY2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1053 YLR263W RED1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3329 YDL042C | YOL068C SIR2 (MAR1 ) | HST1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud4467 Non-homologous end joining (NHEJ)

YOR005C DNL4 (LIG4 ) 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 - YKL213C DOA1 (UFD3 , ZZZ4 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4056 YNL133C FYV6 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0943 YLR247C IRC20 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1454 YGL090W LIF1 0 1 1 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 - YNL307C | YOL128C MCK1 (CMS1 , YPK1 ) | YGK3 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 2 2 2 2 Slud4432 YMR224C MRE11 (RAD58 , XRS4 , NGS1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1978 YLR265C NEJ1 (LIF2 ) 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 - YNL102W POL1 (CDC17 , CRT5 , HPR3 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0982 YNL262W POL2 (DUN2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2693 YCR014C POL4 (POLX ) 15 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1499 YMR137C PSO2 (SNM1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0751 YKL113C RAD27 (ERC11 , RTH1 , FEN1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2518 YNL250W RAD50 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2677 YGR056W | YLR357W RSC1 | RSC2 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud3252 YHR056C | YDR303C RSC30 | RSC3 2 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud3345 | Slud2818 YFR037C RSC8 (SWH3 ) 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 2 1 1 1 1 Slud1990 YOL004W SIN3 (CPE1 , GAM2 , RPD1 , SDI1 , SDS16 , UME4 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 Slud3355 YJL092W SRS2 (HPR5 , RADH , RADH1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1628 YMR039C SUB1 (TSP1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2505 YNL246W VPS75 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2672 YDR369C XRS2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1207 YMR284W YKU70 (HDF1 , NES24 , KU70 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 Slud3643 YMR106C YKU80 (HDF2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2596 Meiotic cell cycle - nuclear division

DNA replication and integrity checkpoint

YGR225W AMA1 (SPO70 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2969 YDL017W CDC7 (LSD6 , SAS1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0551 YJR057W CDC8 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1952 YOR074C CDC21 (CRT9 , TMP1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1134 YPR120C | YGR109C CLB5 | CLB6 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud0494 YDR052C DBF4 (LSD7 , DNA52 ) 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 1 1 1 1 1 Slud1671 YDR359C EAF1 (VID21 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0372 YPL055C LGE1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4278 YBR057C MUM2 (SPOT8 ) 1 1 1 1 1 1 1 1 1 2 2 2 2 2 1 1 1 1 1 1 1 Slud1644 YNL102W POL1 (CDC17 , CRT5 , HPR3 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0982 YDL102W POL3 (CDC2 , HPR6 , TEX1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0767 YKL045W PRI2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2467 YHL024W RIM4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3708 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

YAL009W SPO7 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1890 Sister chromatid cohesion

YDR254W CHL4 (CTF17 , MCM17 ) 1 1 1 1 1 1 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 Slud4292 YPR135W CTF4 (CHL15 , POB1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4595 YFR027W ECO1 (CTF7 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1470 YBR107C IML3 (MCM19 ) 15 1 1 1 0 0 0 1 1 1 1 1 0 0 1 1 1 1 1 1 1 Slud0081 YIL026C IRR1 (SCC3 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0598 YER106W MAM1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2143 YDL003W MCD1 (PDS3 , RHC21 , SCC1 ) 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0672 YJL019W MPS3 (NEP98 , YJL018W ) 1 1 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 1 1 1 1 Slud2950 YOL104C NDJ1 (TAM1 ) 15 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0702 YDR014W RAD61 (WPL1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1592 YPR007C REC8 (SPO69 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3262 YOR014W RTS1 (SCS1 ) 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 Slud1889 YDR180W SCC2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4388 YER147C SCC4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3882 YOR073W SGO1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1135 YFL008W SMC1 (CHL10 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1736 YJL074C SMC3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1559 YHR014W SPO13 1 1 1 1 1 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 1 Slud0183 Synapsis - synaptonemal complex

YGR225W AMA1 (SPO70 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2969 YBR160W CDC28 (CDK1 , HSL5 , SRM5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4280 YMR001C CDC5 (MSD2 , PKX2 ) 1 1 1 1 1 1 1 1 1 2 2 1 1 1 2 2 1 1 1 1 1 Slud3353 YPL200W | YGL075C CSM4 | MPS2 (MMC1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 Slud3503 YLR394W CST9 (ZIP3 ) 1 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2415 YKL054C DEF1 (VID31 ) 1 1 1 1 0 1 1 1 1 1 1 1 2 2 1 2 1 1 1 1 1 Slud2487 YER179W DMC1 (ISC2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3934 YDR446W ECM11 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3211 YDR506C GMC1 0 1 1 0 1 0 1 1 1 1 1 0 0 0 1 1 1 1 1 1 1 - YLR445W GMC2 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2339 YDR014W-A HED1 15 1 1 1 0 0 0 1 1 1 1 0 1 1 1 1 1 1 1 1 1 Slud0064 YGL251C HFM1 (MER3 ) 1 1 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0435 YIL072W HOP1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2047 YGL033W HOP2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3835 YMR167W MLH1 (PMS2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0795 YPL164C MLH3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4111 YJL019W MPS3 (NEP98 , YJL018W ) 1 1 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 1 1 1 1 Slud2950 YOL104C NDJ1 (TAM1 ) 15 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0702 YMR076C PDS5 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4611 YPR007C REC8 (SPO69 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3262 YLR263W RED1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3329 YFR031C SMC2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0612 YJL074C SMC3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1559 YLR086W SMC4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3941 YHR153C SPO16 15 0 0 1 0 0 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 Slud0172 YIL073C SPO22 (ZIP4 ) 1 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2064 YNL088W TOP2 (TOR3 , TRF3 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1001 YDL064W UBC9 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2421 YDR325W YCG1 (TIE1 , YCS5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3023 YLR272C YCS4 (LOC7 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3316 YDR285W ZIP1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2848 YGL249W ZIP2 1 0 0 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0437 Mismatch repair

YMR167W MLH1 (PMS2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0795 YPL164C MLH3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4111 YOL090W MSH2 (PMS5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4489 YCR092C MSH3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1711 YDR097C MSH6 (PMS3 , PMS6 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3921 YNL082W PMS1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0912 YBR088C POL30 (PCNA ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4693 YPL022W RAD1 (RAD12 , LPB9 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4308 YML095C RAD10 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3689 Telomere clustering

YPL200W | YGL075C CSM4 | MPS2 (MMC1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 Slud3503 YJL019W MPS3 (NEP98 , YJL018W ) 1 1 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 1 1 1 1 Slud2950 YOL104C NDJ1 (TAM1 ) 15 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0702 YJL080C SCP160 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 1 1 1 1 1 1 Slud1562 Chromosome segregation

YGL071W | YPL202C AFT1 (RCS1 ) | AFT2 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 Slud3505 YGR225W AMA1 (SPO70 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2969 YPL204W HRR25 (KTI14 ) 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 1 1 1 1 1 Slud3509 YGL190C CDC55 (TMR4 ) 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 Slud3734 YFR046C CNN1 0 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 - YCR086W CSM1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud5099 YIL132C CSM2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0898 YMR048W CSM3 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2513 YPL200W | YGL075C CSM4 | MPS2 (MMC1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 Slud3503 YPL018W CTF19 (MCM18 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1744 YDR110W FOB1 (HRM1 ) 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 1 1 1 1 1 1 Slud3944 YPL209C IPL1 (PAC15 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3515 YDR439W LRS4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1310 YGR188C | YJL013C BUB1 | MAD3 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 Slud2952 YGL086W MAD1 1 1 1 1 0 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 Slud3478 YJL030W MAD2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3074 YER106W MAM1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2143 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

YDR383C NKP1 0 1 1 1 0 0 1 1 1 1 1 1 0 0 1 1 1 1 1 1 1 - YLR315W NKP2 0 1 1 1 0 0 1 1 1 1 1 0 0 0 1 1 1 1 1 1 1 - YOR373W NUD1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 Slud3224 YMR190C SGS1 1 1 1 1 1 1 1 1 1 2 2 1 2 2 2 2 2 1 1 1 1 Slud3569 YFR031C SMC2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0612 YLR086W SMC4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3941 YML085C | YML124C TUB1 | TUB3 1 1 1 1 1 1 1 1 1 2 2 1 1 2 1 2 1 2 2 2 2 Slud3671 YFL037W TUB2 (ARM10 , SHE8 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1781 YDR374W-A WIP1 0 1 1 1 0 1 1 1 1 0 1 0 1 1 0 0 1 1 1 1 1 - YDR325W YCG1 (TIE1 , YCS5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3023 YLR272C YCS4 (LOC7 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3316 Sister chromatid segregation

YPR135W CTF4 (CHL15 , POB1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4595 YIR010W DSN1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0622 YGR098C ESP1 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0504 YBR107C IML3 (MCM19 ) 15 1 1 1 0 0 0 1 1 1 1 1 0 0 1 1 1 1 1 1 1 Slud0081 YPL209C IPL1 (PAC15 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3515 YPL017C | YFL018C IRC15 | LPD1 (HPD1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 Slud1739 YLR320W MMS22 (SLM2 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3792 YBR073W RDH54 (TID1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1662 YOR073W SGO1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1135 YGL127C SOH1 (MED31 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3396 Regulation

YKL112W ABF1 (SBF-B , SBF1 , BAF1 , OBF1 , REB2 , GFI ) 1 1 1 1 0 1 1 1 1 1 1 1 2 2 2 2 2 1 1 1 1 Slud2550 YIL033C BCY1 (SRA1 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1992 YMR001C CDC5 (MSD2 , PKX2 ) 1 1 1 1 1 1 1 1 1 2 2 1 1 1 2 2 1 1 1 1 1 Slud3353 YDL017W CDC7 (LSD6 , SAS1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0551 YGL116W CDC20 (PAC5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3415 YLR310C | YLL016W | YLL017W CDC25 (CDC25' , CTN1 ) | SDC25 | - 1 1 1 1 0 1 1 1 1 2 2 2 2 2 2 1 2 2 2 2 2 Slud3765 YBR160W CDC28 (CDK1 , HSL5 , SRM5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4280 YGR108W | YPR119W CLB1 (SCB1 ) | CLB2 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 Slud0493 YAL040C CLN3 (DAF1 , FUN10 , WHI1 ) 2 1 1 1 0 1 1 1 1 2 1 2 2 2 1 2 1 1 1 1 1 Slud1335 | Slud2710 YDR155C CPR1 (CYP1 , CPH1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4015 YPL200W | YGL075C CSM4 | MPS2 (MMC1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 Slud3503 + YBR112C CYC8 (CRT8 , SSN6 , [OCT1 ], [OCT ]) 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 2 Slud1666 | Slud1828 YDR052C DBF4 (LSD7 , DNA52 ) 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 1 1 1 1 1 Slud1671 YKL054C DEF1 (VID31 ) 1 1 1 1 0 1 1 1 1 1 1 1 2 2 1 2 1 1 1 1 1 Slud2487 YER020W GPA2 (SSP101) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2231 YFL031W HAC1 (ERN4 , IRE15 ) 1 1 1 1 1 1 1 1 1 2 1 2 1 1 1 1 1 1 1 1 1 Slud1802 YGL194C HOS2 (RTL1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3731 YIL112W HOS4 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0873 YJL146W IDS2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0725 YJR094C IME1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 Slud2202 YJL106W IME2 (SME1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1609 YGL192W IME4 (SPO8 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3732 YOR304W ISW2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3230 YGL133W | YPL216W ITC1 | - 1 1 1 1 1 1 1 1 1 2 2 2 2 1 2 2 2 2 1 1 1 Slud3526 YGL197W | YER132C MDS3 | PMD1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud3727 YMR037C | YKL062W MSN2 | MSN4 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud2501 YMR224C MRE11 (RAD58 , XRS4 , NGS1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1978 YOL104C NDJ1 (TAM1 ) 15 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0702 YHR124W NDT80 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0944 YNL231C PDR16 (SFH3 ) 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 Slud1082 YDR113C PDS1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3947 YOR208W PTP2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 Slud4164 YER075C PTP3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 0 1 Slud2043 YNL098C | YOR101W RAS2 (CTN5 , CYR3 , TSL7 , GLC5 ) | RAS1 1 1 1 1 1 1 1 1 1 2 2 2 2 1 2 2 1 1 1 1 2 Slud0985 YLR248W | YGL158W RCK2 (CLK1 , CMK3 ) | RCK1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 Slud1455 YLR071C RGR1 (MED14 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3277 YCR028C-A RIM1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2661 YGL045W RIM8 (ART9 , PAL3 , YGL046W ) 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3846 YMR063W RIM9 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1119 YMR139W | YDL079C RIM11 (GSK3 , MDS1 ) | MRK1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 2 2 2 2 Slud0754 YMR154C RIM13 (CPL1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0780 YFL033C RIM15 (TAK1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1774 YOR275C RIM20 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4075 YGR044C RME1 (CSP1 ) 1 1 1 1 0 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3260 YBL093C ROX3 (MED19 , SSN7 , SSX2 , NUT3 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2167 YNL330C RPD3 (REC3 , SDI2 , SDS6 , MOF6 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4400 YFL034C-A | YLR061W RPL22B (eL22 , YL31 , l1c , L22B , rp4 , L22e ) | RPL22A (L22A ) 1 1 1 1 1 1 1 1 1 1 1 2 2 2 1 1 1 2 2 2 2 Slud1777 YKR029C | YJL105W SET3 | SET4 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud1610 YBR103W SIF2 (EMB1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4733 YOL004W SIN3 (CPE1 , GAM2 , RPD1 , SDI1 , SDS16 , UME4 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 Slud3355 YNL236W SIN4 (MED16 , RYE1 , BEL2 , GAL22 , SDI3 , SSF5 , SSN4 , TSF3 , SSX3 ) 1 1 1 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1085 YDR510W SMT3 1 0 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2733 YDR477W SNF1 (CAT1 , CCR1 , GLC2 , HAF3 , PAS14 ) 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 1 1 1 Slud3165 YDL194W | YDL138W SNF3 | RGT2 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 Slud1425 YMR016C | YKL043W SOK2 | PHD1 1 1 1 1 1 1 1 1 1 2 2 0 2 2 2 2 2 2 2 2 2 Slud2466 YHR152W | YGR230W SPO12 (SDB21 ) | BNS1 1 1 1 1 1 1 1 1 2 2 1 2 2 1 2 2 2 2 2 2 - YDR443C SSN2 (RYE3 , MED13 , NUT8 , SCA1 , SRB9 , UME2 , SSX5 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1316 YNL025C SSN8 (RYE2 , CycC , GIG3 , NUT9 , SRB11 , UME3 , CNC1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0854 YMR039C SUB1 (TSP1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2505 YDR310C SUM1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 1 1 1 1 1 1 Slud2808 + YPL016W SWI1 ([SWI ], [SWI (+)], ADR6 , GAM3 , LPA1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4309 YJL187C SWE1 (WEE1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2663 YPL157W TGS1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4119 YJL164C | YKL166C TPK1 (SRA3 , PKA1 ) | TPK3 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 1 2 2 2 2 Slud0567 YPL203W TPK2 (PKA3 , PKA2 , YKR1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3508 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

YCR084C TUP1 (AAR1 , AER2 , AMM1 , CRT4 , CYC9 , FLK1 , ROX4 , SFL2 , UMR7 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 2 1 2 2 2 Slud1704 YPL139C | YOR229W UME1 (WTM3 ) | WTM2 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 Slud4146 YDR207C UME6 (CAR80 , NIM2 , RIM16 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4358 YOR230W WTM1 0 1 1 1 1 1 1 1 1 1 - Others

YJL115W ASF1 (CIA1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4497 YFR021W ATG18 (SVP1 , NMR1 , CVT18 , AUT10 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 1 1 1 Slud1442 YJR053W BFA1 (IBD1 ) 1 1 1 1 1 1 1 1 1 2 2 0 2 1 1 1 1 1 1 1 1 Slud1943 YMR055C BUB2 (PAC7 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4833 YGL174W BUD13 (CWC26 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3747 YLR103C CDC45 (SLD4 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3969 YJL005W CYR1 (FIL1 , CDC35 , HSR1 , SRA4 , TSM0185 ) 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 Slud2922 YAL013W DEP1 (FUN54 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1898 YNL001W | YCL001W-B DOM34 | - 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 2 2 2 2 1 2 Slud1394 YPR175W DPB2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2265 YDL101C DUN1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud5068 YOL017W | YFR013W ESC8 | IOC3 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 - YGR252W GCN5 (ADA4 , SWI9 , KAT2 , AAS104 ) 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 1 1 1 Slud3052 YER133W GLC7 (CID1 , DIS2 , PP1 , DIS2S1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3725 YCR065W HCM1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 2 2 1 1 Slud3615 YDR138W HPR1 (TRF1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3982 YIR005W IST3 (SNU17 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4552 YOL086W-A MHF1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 1 1 1 1 1 Slud0285 YDL160C-A MHF2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0411 YCL061C MRC1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2773 YEL062W NPR2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4900 YHL023C NPR3 (RMD11 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3707 YBR233W PBP2 (HEK1 ) 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 Slud3412 YNL267W PIK1 (PIK41 , PIK120 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud2704 YLR016C PML1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 0 0 1 1 1 Slud0177 YGL167C PMR1 (SSC1 , BSD1 , LDB1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 Slud1794 YDR217C RAD9 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4349 YNL072W RNH201 (RNH35 , Rnh2A ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0902 YER070W | YIL066C RNR1 (CRT7 , RIR1 , SDS12 ) | RNR3 (DIN1 , RIR3 ) 1 1 1 1 1 1 1 1 1 2 2 2 2 1 2 2 2 2 2 2 2 Slud2036 YGL066W SGF73 (SCA7 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud3511 YLR442C | YML065W SIR3 (CMT1 , MAR2 , STE8 ) | ORC1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 Slud2354 YDR240C SNU56 (MUD10 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud4316 YKR031C SPO14 (PLD1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud1606 YMR179W SPT21 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 Slud3544 YDR108W TRS85 (GSG1 , MUM1 ) 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Slud0393

1 present (one homolog) 2 present (at least two paralogs) 15 presence of syntenic ORF with no or very weak similarity to the S. cerevisiae homolog absent bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supplementary Table 4: Population analysis - read mapping statistics.

Mapping on masked reference genome Ploidy estimation Mapping on reference genome Mapping on masked reference genome (flow cytometry) (subtelomeres removed)

Strain Ploidy # SNPs # homozygous SNPs # heterozygous SNPs # SNPs # homozygous SNPs # heterozygous SNPs # SNPs # homozygous SNPs # heterozygous SNPs CBS 1168 haploid 41,533 35,052 6,481 32,832 26,991 5,841 27,466 25,455 2,011 PC99_R_1 haploid 443,046 435,913 7,133 318,604 312,832 5,772 311,830 308,351 3,479 122 haploid 204,068 197,741 6,327 149,054 142,238 6,816 144,655 140,038 4,617 UTAD17 haploid1 31,189 24,704 6,485 25,026 19,182 5,844 21,628 18,360 3,268 NCYC 732 diploid 31,867 27,474 4,393 24,924 21,155 3,769 21,360 20,065 1,295 NCYC 734 diploid 42,188 35,306 6,882 33,419 27,449 5,970 27,588 25,948 1,640 NCYC 3345 aneuploid (2n+1)2 37,319 20,655 16,664 29,335 15,791 13,544 26,252 15,151 11,101 BJK-5C diploid 46,611 25,013 21,598 37,367 19,283 18,084 33,375 18,268 15,107 NCYC 849 diploid 40,172 17,423 22,749 31,809 13,309 18,500 28,065 12,879 15,186 DSM 70550 aneuploid (2n+1)3 115,551 28,924 86,627 86,940 22,559 64,381 80,351 20,553 59,798

1 The isolate was not available in our study, but it is presumed to be haploid (GenBank assembly accession: GCA_900491785.1). 2 Based on read coverage, the isolate was determined to have an additional (third) copy of chromosome D. 3 Based on read coverage, the isolate was determined to have an additional (third) copy of chromosome G. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supplementary Table 5: Novel mutations that arose during the mutation accumulation experiment. strain ploidy chr pos line AC AB GQ REF ALT GT note NBRC 1722 haploid chrA 400307 Sdl-C3 1 . 99 T G 1 NBRC 1722 haploid chrA 666817 Sdl-D6 1 . 99 T C 1 NBRC 1722 haploid chrA 674943 Sdl-A3 1 . 99 C T 1 NBRC 1722 haploid chrA 683073 Sdl-B2 1 . 99 G C 1 NBRC 1722 haploid chrA 781918 Sdl-A4 1 . 99 G A 1 NBRC 1722 haploid chrA 920700 Sdl-C5 1 . 99 T G 1 NBRC 1722 haploid chrA 1082934 Sdl-C2 1 . 99 C T 1 NBRC 1722 haploid chrA 1114570 Sdl-B5 1 . 99 C T 1 NBRC 1722 haploid chrA 1388818 Sdl-E3 1 . 99 C A 1 NBRC 1722 haploid chrA 1391835 Sdl-B5 1 . 99 T C 1 NBRC 1722 haploid chrA 1503698 Sdl-A4 1 . 99 T G 1 NBRC 1722 haploid chrA 1676440 Sdl-A4 1 . 99 C A 1 NBRC 1722 haploid chrA 1738809 Sdl-A3 1 . 99 A G 1 NBRC 1722 haploid chrA 1798149 Sdl-D4 1 . 99 G A 1 NBRC 1722 haploid chrA 1912929 Sdl-C2 1 . 99 A G 1 NBRC 1722 haploid chrA 2096503 Sdl-C1 1 . 99 C A 1 NBRC 1722 haploid chrA 2246284 Sdl-A6 1 . 99 C A 1 NBRC 1722 haploid chrA 2254515 Sdl-D6 1 . 99 A C 1 NBRC 1722 haploid chrA 2283408 Sdl-E3 1 . 99 A G 1 NBRC 1722 haploid chrA 2776172 Sdl-E1 1 . 99 C A 1 NBRC 1722 haploid chrA 2787652 Sdl-D4 1 . 99 G T 1 NBRC 1722 haploid chrA 3063321 Sdl-E3 1 . 99 T G 1 NBRC 1722 haploid chrB 10675 Sdl-B6 1 . 99 A C 1 NBRC 1722 haploid chrB 260595 Sdl-E5 1 . 99 C A 1 NBRC 1722 haploid chrB 376935 Sdl-E1 1 . 99 A T 1 NBRC 1722 haploid chrB 541689 Sdl-E5 1 . 99 G T 1 NBRC 1722 haploid chrB 627968 Sdl-B2 30 . 15 C T 0 NBRC 1722 haploid chrB 954927 Sdl-A3 1 . 99 C G 1 NBRC 1722 haploid chrB 1067204 Sdl-D4 1 . 99 T C 1 NBRC 1722 haploid chrB 1482284 Sdl-A6 1 . 99 C T 1 NBRC 1722 haploid chrB 2169189 Sdl-D4 1 . 99 A C 1 NBRC 1722 haploid chrC 401275 Sdl-D1 1 . 99 G A 1 NBRC 1722 haploid chrC 588395 Sdl-B2 1 . 99 C T 1 NBRC 1722 haploid chrC 735592 Sdl-C4 1 . 99 G A 1 NBRC 1722 haploid chrC 802357 Sdl-A4 1 . 99 G T 1 NBRC 1722 haploid chrC 971450 Sdl-A6 1 . 99 T A 1 NBRC 1722 haploid chrC 1131055 Sdl-A6 1 . 99 A T 1 NBRC 1722 haploid chrC 1199715 Sdl-A1 1 . 99 A G 1 NBRC 1722 haploid chrC 1345913 Sdl-C2 1 . 99 A G 1 NBRC 1722 haploid chrC 1522911 Sdl-B5 1 . 99 C G 1 NBRC 1722 haploid chrC 1604135 Sdl-A3 1 . 99 C T 1 NBRC 1722 haploid chrC 1694824 Sdl-E2 1 . 99 G A 1 NBRC 1722 haploid chrC 1706719 Sdl-C1 30 . 47 G A 0 NBRC 1722 haploid chrD 6751 Sdl-B1 1 . 99 A T 1 NBRC 1722 haploid chrD 145289 Sdl-D5 1 . 99 G T 1 NBRC 1722 haploid chrD 260253 Sdl-C4 1 . 99 G T 1 NBRC 1722 haploid chrD 369054 Sdl-B3 1 . 99 T C 1 NBRC 1722 haploid chrD 419232 Sdl-A4 1 . 99 T A 1 NBRC 1722 haploid chrD 483354 Sdl-C6 1 . 99 T A 1 NBRC 1722 haploid chrD 665188 Sdl-E1 1 . 99 A T 1 NBRC 1722 haploid chrD 743085 Sdl-C6 1 . 99 A G 1 NBRC 1722 haploid chrD 903666 Sdl-D3 1 . 99 A G 1 NBRC 1722 haploid chrD 1332088 Sdl-A6 1 . 99 C T 1 NBRC 1722 haploid chrD 1608204 Sdl-C1 1 . 99 A G 1 NBRC 1722 haploid chrD 1674136 Sdl-A6 1 . 99 G T 1 NBRC 1722 haploid chrD 1674160 Sdl-A6 1 . 99 A G 1 NBRC 1722 haploid chrD 1674161 Sdl-A6 1 . 99 T C 1 NBRC 1722 haploid chrD 1674166 Sdl-A6 1 . 99 T C 1 NBRC 1722 haploid chrD 1674168 Sdl-A6 1 . 99 A G 1 NBRC 1722 haploid chrE 17379 Sdl-A6 1 . 99 C G 1 NBRC 1722 haploid chrE 123437 Sdl-D5 1 . 99 C T 1 NBRC 1722 haploid chrE 174769 Sdl-E2 1 . 99 G A 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

NBRC 1722 haploid chrE 613893 Sdl-C1 1 . 99 A G 1 NBRC 1722 haploid chrE 719472 Sdl-E2 1 . 99 A T 1 NBRC 1722 haploid chrE 914233 Sdl-C1 1 . 99 C A 1 NBRC 1722 haploid chrE 1013120 Sdl-A6 1 . 99 C T 1 NBRC 1722 haploid chrE 1076816 Sdl-C5 1 . 99 G A 1 NBRC 1722 haploid chrE 1318818 Sdl-A3 1 . 99 T C 1 NBRC 1722 haploid chrE 1415009 Sdl-C4 30 . 75 T G 0 NBRC 1722 haploid chrF 180378 Sdl-D4 1 . 99 C A 1 NBRC 1722 haploid chrF 266998 Sdl-B2 1 . 99 A G 1 NBRC 1722 haploid chrF 510147 Sdl-D1 1 . 99 A T 1 NBRC 1722 haploid chrF 685831 Sdl-B5 1 . 99 T C 1 NBRC 1722 haploid chrF 704245 Sdl-C2 1 . 99 T C 1 NBRC 1722 haploid chrF 816501 Sdl-E3 1 . 99 C T 1 NBRC 1722 haploid chrF 825035 Sdl-C2 30 . 73 G A 0 NBRC 1722 haploid chrF 1294027 Sdl-C5 1 . 99 G A 1 NBRC 1722 haploid chrF 1294062 Sdl-C5 1 . 99 A G 1 NBRC 1722 haploid chrF 1301219 Sdl-A3 30 . 2 A T 0 NBRC 1722 haploid chrF 1307867 Sdl-B3 30 . 99 G A 0 NBRC 1722 haploid chrF 1307871 Sdl-B3 30 . 99 C A 0 NBRC 1722 haploid chrG 3489 Sdl-B6 30 . 18 T C 0 NBRC 1722 haploid chrG 233665 Sdl-C1 1 . 99 G A 1 NBRC 1722 haploid chrG 492229 Sdl-B1 1 . 99 G C 1 NBRC 1722 haploid chrG 618893 Sdl-E4 1 . 99 A T 1 YLFP17-4 diploid (isogenic) chrA 134295 J5 1 0.56 99 C T 0/1 YLFP17-4 diploid (isogenic) chrA 485187 F1 1 0.47 99 G T 0/1 YLFP17-4 diploid (isogenic) chrA 873994 F5 1 0.41 99 G A 0/1 YLFP17-4 diploid (isogenic) chrA 890571 G3 1 0.5 99 T G 0/1 YLFP17-4 diploid (isogenic) chrA 1300923 F5 1 0.45 99 C T 0/1 YLFP17-4 diploid (isogenic) chrA 1463165 H3 1 0.48 99 A G 0/1 YLFP17-4 diploid (isogenic) chrA 1640205 F1 1 0.43 99 T C 0/1 YLFP17-4 diploid (isogenic) chrA 1753949 G6 1 0.47 99 C A 0/1 YLFP17-4 diploid (isogenic) chrA 2043594 F4 1 0.58 99 C T 0/1 YLFP17-4 diploid (isogenic) chrA 2708859 F4 1 0.48 99 C A 0/1 YLFP17-4 diploid (isogenic) chrA 2711278 F4 1 0.43 99 C A 0/1 YLFP17-4 diploid (isogenic) chrA 2888473 I4 1 0.54 99 T A 0/1 YLFP17-4 diploid (isogenic) chrB 113493 G6 1 0.52 99 T C 0/1 YLFP17-4 diploid (isogenic) chrB 261445 J6 1 0.46 99 C A 0/1 YLFP17-4 diploid (isogenic) chrB 785254 F6 1 0.42 99 T C 0/1 YLFP17-4 diploid (isogenic) chrB 1061405 F1 1 0.47 99 C A 0/1 YLFP17-4 diploid (isogenic) chrB 1542769 I5 1 0.57 99 G T 0/1 YLFP17-4 diploid (isogenic) chrB 1610644 J4 1 0.44 99 A G 0/1 YLFP17-4 diploid (isogenic) chrB 2198465 I4 1 0.55 99 A G 0/1 YLFP17-4 diploid (isogenic) chrC 87097 F3 1 0.53 99 A G 0/1 YLFP17-4 diploid (isogenic) chrC 460750 J3 1 0.59 99 G T 0/1 YLFP17-4 diploid (isogenic) chrC 501290 J5 1 0.54 99 T C 0/1 YLFP17-4 diploid (isogenic) chrC 671979 I4 1 0.47 99 A G 0/1 YLFP17-4 diploid (isogenic) chrC 883032 F4 1 0.55 99 G T 0/1 YLFP17-4 diploid (isogenic) chrC 952114 J2 1 0.52 99 C T 0/1 YLFP17-4 diploid (isogenic) chrC 993017 J2 1 0.43 99 A G 0/1 YLFP17-4 diploid (isogenic) chrC 1078748 I2 1 0.53 99 G T 0/1 YLFP17-4 diploid (isogenic) chrC 1274107 I6 1 0.59 99 G T 0/1 YLFP17-4 diploid (isogenic) chrC 1545770 I6 1 0.43 99 G A 0/1 YLFP17-4 diploid (isogenic) chrC 1631738 J1 1 0.58 99 C G 0/1 YLFP17-4 diploid (isogenic) chrC 1795088 I2 1 0.56 99 C T 0/1 YLFP17-4 diploid (isogenic) chrC 1812850 G3 1 0.49 99 T C 0/1 YLFP17-4 diploid (isogenic) chrD 275057 I2 1 0.43 99 G A 0/1 YLFP17-4 diploid (isogenic) chrD 583701 G5 1 0.54 99 C A 0/1 YLFP17-4 diploid (isogenic) chrD 879177 G5 1 0.58 99 C T 0/1 YLFP17-4 diploid (isogenic) chrD 1022697 G6 1 0.55 99 A G 0/1 YLFP17-4 diploid (isogenic) chrD 1069206 H3 1 0.57 99 C A 0/1 YLFP17-4 diploid (isogenic) chrD 1136164 J4 1 0.55 99 G T 0/1 YLFP17-4 diploid (isogenic) chrD 1299741 I5 1 0.57 99 G A 0/1 YLFP17-4 diploid (isogenic) chrE 1334698 I2 1 0.43 99 C T 0/1 YLFP17-4 diploid (isogenic) chrF 144834 F5 1 0.51 99 C A 0/1 YLFP17-4 diploid (isogenic) chrF 223367 J3 1 0.53 99 G A 0/1 YLFP17-4 diploid (isogenic) chrF 364390 F6 1 0.57 99 G A 0/1 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

YLFP17-4 diploid (isogenic) chrF 974087 J1 1 0.41 99 G A 0/1 YLFP17-4 diploid (isogenic) chrG 230046 F5 1 0.5 99 C T 0/1 YLFP17-4 diploid (isogenic) chrG 230055 F5 1 0.5 99 T A 0/1 YLFP17-4 diploid (isogenic) chrG 425497 F1 1 0.55 99 G A 0/1 YLFP17-4 diploid (isogenic) chrG 634414 J5 1 0.46 99 C T 0/1 YLFP188-1 diploid (hybrid) chrA 575511 K3 1 0.55 99 C T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 595019 L3 1 0.44 99 C G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 798264 K1 1 0.51 99 T A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 811318 L4 1 0.5 99 G A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 939612 K2 1 0.52 99 C T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 1035295 K6 1 0.47 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 1245954 L4 1 0.5 99 T G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 1353499 L1 1 0.53 99 G T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 1850563 L6 1 0.56 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 2059925 K6 1 0.51 99 C A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 2622539 L3 1 0.46 99 C A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 2695038 K1 1 0.42 99 C A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrA 3058692 L3 1 0.48 99 G A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 117858 L2 1 0.51 99 C G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 159385 K3 1 0.48 99 T C 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 345488 L1 1 0.51 99 G A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 345632 K4 1 0.49 99 T C 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 540836 L1 1 0.41 99 T C 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 748410 K4 1 0.48 99 A T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 748411 K4 1 0.52 99 T G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 762074 K5 1 0.5 99 G C 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 1272305 L2 23 0.49 8 C G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 2101324 K4 1 0.41 99 T A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrB 2128527 K2 1 0.52 99 C A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 209877 K2 1 0.47 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 285477 L4 1 0.47 99 C G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 649869 K5 1 0.44 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 655945 K5 1 0.44 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 758503 K3 1 0.47 99 T G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 758505 K3 1 0.51 99 T G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 930063 K4 1 0.46 99 G T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 1243241 L6 1 0.5 99 G A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 1310575 K6 1 0.48 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 1495479 L6 1 0.45 99 A C 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrC 1553527 K3 1 0.48 99 G A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrD 538374 K5 1 0.51 99 T A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrD 637341 L6 1 0.48 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrD 793607 L1 1 0.47 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrD 1662826 L3 1 0.59 9 C T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrD 1669254 L3 1 0.57 99 C T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrE 183754 L6 1 0.45 99 C T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrE 362933 L6 1 0.54 99 T A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrE 388157 L1 1 0.48 99 A T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrE 397152 L1 1 0.43 99 G T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrE 671942 L3 1 0.52 99 C T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrE 854034 L2 1 0.45 99 T C 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrF 369673 K3 1 0.57 99 A G 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrF 369675 K3 1 0.59 99 G A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrF 981864 K1 1 0.54 99 T A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrG 296907 L4 1 0.54 99 C A 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrG 400567 L1 1 0.51 99 C T 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrG 466575 L3 1 0.58 99 A C 0/1 homozygous-to-homozygous substitution YLFP188-1 diploid (hybrid) chrG 505967 K1 1 0.49 99 A T 0/1 homozygous-to-homozygous substitution bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supplementary Table 6: List of LOH tracts detected in the mutation accumulation analysis.

Mutation accumulation line Loss-of-heterozygosity (LOH) tract (hybrid diploid ancestry) chromosome beginning end minimum size (bp) number of SNP markers K1 chrA 411449 413791 2343 6 L1 chrA 513059 522453 9395 20 L3 chrA 578207 578207 1 1 K1 chrA 948826 948826 1 1 K6 chrA 1222049 1223493 1445 5 K5 chrA 1505212 1506895 1684 9 K3 chrA 1661620 1661620 1 1 K5 chrA 1708548 1708548 1 1 L2 chrA 2188868 2189916 1049 11 L4 chrA 3017907 3017907 1 1 K1 chrA 3066698 3066698 1 1 L6 chrB 514822 514849 28 2 K1 chrC 1258 182642 181385 4190 L4 chrC 281216 281366 151 6 L2 chrC 336505 336505 1 1 L2 chrD 344988 357464 12477 23 L3 chrD 1666276 1675901 9626 7 L3 chrE 830403 830403 1 1 K3 chrE 944151 944151 1 1 L3 chrE 956070 956070 1 1 L6 chrG 21383 21691 309 2 K3 chrG 281226 281272 47 4 bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supplementary Table 7: List of plasmids generated and used in this study.

Plasmid Backbone Features Purpose Source/Reference ID1 Name

Vectors used for plasmid construction

R Ec-312 pRS415 pRS415 CEN vector, LEU2, amp backbone for plasmid construction Sikorski & Hieter, 1989 Ec-432 pFA6a-kanMX4 kanMX4 amplification of the kanMX4 cassette Wach et al., 1994 Ec-1579 pFA6a-hphNT1 (pKS133-6) hphNT1 amplification of the hphNT1 cassette Janke et al., 2004 Ec-3108 pYM12-1 pFA6a eGFP-kanMX6 amplification of the eGFP-kanMX6 cassette Knop et al., 1999

Plasmids for construction of the Sd. ludwigii isogenic diploid strain (YLFP18-12)

Ec-4664 pFP6-1 Ec-312 URA3 cloning of Sd. ludwigii URA3 this study Ec-4528 pFP2-1 Ec-312 Δura3::kanMX43 deletion of Sd. ludwigii URA3 this study Ec-4526 pFP1-1 Ec-312 Δura3::hphNT14 deletion of Sd. ludwigii URA3 this study Ec-4648 pFP4-1 Ec-312 MATα cloning of Sd. ludwigii MATα this study Ec-4727 pMaM64 Ec-312 Δmatα::Δura3::kanMX4 deletion of Sd. ludwigii MATα this study Ec-4682 pMaM55 Ec-312 MATa cloning of Sd. ludwigii MATa this study

Plasmids for functional analyses of meiotic genes

Ec-4672 pFP10-1 Ec-312 SPO11 cloning of Sd. ludwigii SPO11 this study Ec-4695 pFP15-1 Ec-312 Δspo11::kanMX43 deletion of Sd. ludwigii SPO11 this study Ec-5101 pFP41-1 Ec-312 RAD51 cloning of Sd. ludwigii RAD51 this study Ec-5105 pFP42-1 Ec-312 Δrad51::kanMX43 deletion of Sd. ludwigii RAD51 this study Ec-5219 pFP44-1 Ec-312 DMC1 cloning of Sd. ludwigii DMC1 this study Ec-5225 pFP46-1 Ec-312 Δdmc1::kanMX43 deletion of Sd. ludwigii DMC1 this study Ec-4709 pFP17-1 Ec-312 SAE2 cloning of Sd. ludwigii SAE2 this study Ec-4725 pFP21-1 Ec-312 Δsae2::kanMX43 deletion of Sd. ludwigii SAE2 this study Ec-4963 pFP35-1 Ec-312 RAP1 cloning of Sd. ludwigii RAP1 this study Ec-5017 pFP39-1 Ec-312 RAP1-eGFP-kanMX65 tagging of Sd. ludwigii RAP1 with eGFP this study

1 Database ID numbers of plasmids correspond to their permanent identifiers in the Knop lab collection of Escherichia coli host strain DH5α clones. 2 See Supplementary Table 1. 3 The kanMX4 cassette was amplified from plasmid Ec-432. 4 The hphNT1 cassette was amplified from plasmid Ec-1579. 5 The eGFP-kanMX6 cassette was amplified from plasmid Ec-3108. References: Sikorski & Hieter (1989) in Genetics 122:19-27; Wach et al. (1994) in Yeast 10:1793-1808; Janke et al. (2004) in Yeast 21:947-962; Knop et al. (1999) in Yeast 15:963-972. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supplementary Table 8: List of DNA oligonucleotides used in this study.

Oligo name Sequence (5’ to 3’) Template1 Purpose

Construction of the Sd. ludwigii isogenic diploid strain (YLFP18-12)

Sdl.URA3-C TAACCCTTCTGGTTGTGAAGTC Sd. ludwigii genomic DNA cloning of URA3 Sdl.URA3-D ATAAGTAATCAAATTTTGGGGGTC

S1-Sdl.URA3 GAACGAGAAACTCGATAAAACAATACAAATAAAGCAAATCCCAATTTCTATAATGCGTACGCTGCAGGTCGAC S2-Sdl.URA3 ATCAATACAAATTCATATGAAAATGTTCTGAATCTTTGATTCAAAAAGAAACTTAATCGATGAATTCGAGCTCG plasmids Ec-432/Ec-1579 deletion of URA3

Sdl.MAT-A5 CAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCATGTTGCAGCATCCACCGTTC Sdl.MAT-B5 CGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGAGTACAGACAAGTACCGGTCC Sd. ludwigii genomic DNA cloning of MATα

MATalpha-A4 GGCGAATTGGAGGTCAATAAAG exchange of MAT MATalpha-B6 CGCTACTGAAAGGAACAGACG Sd. ludwigii genomic DNA idiomorphs

Functional analyses of meiotic genes

SPO11_LongFor CAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCTGTATATTGGGTGATGTTTGGGC Sd. ludwigii genomic DNA cloning of SPO11 SPO11_LongRev CGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGAACTGTACTTATACTTCCAACTC

SPO11-S1 GTAAAGTAAAATAAATAAACAAATAAAAAATAATAAAAAAAAATTAATTATGCGTACGCTGCAGGTCGAC plasmid Ec-432 deletion of SPO11 SPO11-S2 TTCATTGGCTTCAAATCTACTAATATGTCAGTTTAATTAAACCCTTCATTCACTAATCGATGAATTCGAGCTCG

RAD51-F1 CAGTGAATCTGGTGGCAATAC Sd. ludwigii genomic DNA cloning of RAD51 RAD51-R2 GTGTAAGAACCCTCACCATTATC

S1-RAD51 GAAAAAAGAAAGAAAAAGAAAATAAAAGAGATTTTTCTAAGATATATCAAACTATGCGTACGCTGCAGGTCGAC plasmid Ec-432 deletion of RAD51 S2-RAD51 ATTGTCGCTGGGTATTATATTACAATTATTTTATACGATACAATATATTCTTATTAATCGATGAATTCGAGCTCG

DMC1-F2 CAGTACCAGTTGGATACCACC Sd. ludwigii genomic DNA cloning of DMC1 DMC1-R2 TGATTTCATTCCCGTGGGCAG

S1-DMC1 GAAATGTCAGAAACAACCACAACAGGTATAATTACAATTGATGAACTACAAAATTCGTACGCTGCAGGTCGAC plasmid Ec-432 deletion of DMC1 S2-DMC1 ATATATAATGGTAAATAAAAATAAGCTTCACGGATTTGGAATAACATAATAAATCAATCGATGAATTCGAGCTCG

SAE2_LongFor CAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCTGGATACGGATTGGGTTAATGG Sd. ludwigii genomic DNA cloning of SAE2 SAE2_LongRev CGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGCGTGATTTGGTACGGAAGG bioRxiv preprint doi: https://doi.org/10.1101/2021.04.22.440946; this version posted April 23, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

S1-SAE2 GATCTAAAGCTTTTGCAACTTTTAGGAGTTTTTACACTAACCTAGAGAATACAAATGCGTACGCTGCAGGTCGAC plasmid Ec-432 deletion of SAE2 S2-SAE2 ATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAATCGATGAATTCGAGCTCG

RAP1_LongFor CAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCAAGGTGTGTTAAGGGCGGAG Sd. ludwigii genomic DNA cloning of RAP1 RAP1_LongRev CGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGTGGATTGGGAGGATCTAATGGTTC

RAP1-S1 CATAACGCTTAAAAACAAAAAAAATATATATAAATACCAGAGAGCAAGGAGATGCGTACGCTGCAGGTCGAC RAP1-S2 ATATGAGAGAGAAAGGAAGAAAATAAAAAGTGTTCAACTAAAAAACTTGGAACTAATCGATGAATTCGAGCTCG plasmid Ec-3108 tagging of RAP1

Validation of NCOs

For_1599931 TCATTATTTCCGCCAGGTGC Sd. ludwigii genomic DNA validation of NCO Rev_1599931 GTGTTTCAGCGTTTGTCGTTG (tetrad 280-283) (in chrA)

For_113786 TAATGACATGAGCGTGAGAAGG Sd. ludwigii genomic DNA validation of NCO Rev_113786 CGGCCAATAACAAAGCATGGG (tetrad 989-992) (in chrD)

1 Plasmid (see Supplementary Table 7) or genomic DNA of yeast strain (see Supplementary Table 1). 2 See Supplementary Table 1.